DOI
stringlengths 13
40
| instance_id
stringlengths 9
26
| News Finding
stringlengths 13
1.2k
| Paper Finding
stringlengths 2
1.32k
| News Context
stringlengths 13
1.61k
| Paper Context
stringlengths 27
1.71k
| scores
stringlengths 3
25
| field
stringclasses 4
values | split
stringclasses 1
value | final_score
float64 1
5
| source
stringclasses 2
values | News URL
stringlengths 17
210
|
|---|---|---|---|---|---|---|---|---|---|---|---|
10.1126/science.1222939 | Medicine_easy_255 | Still, the experts said esketamine has some important negative side effects and limitations. | 3) (39) . | They also said they believed esketamine's benefits outweighed its risks. Still, the experts said esketamine has some important negative side effects and limitations. And upon careful review, they felt Johnson & Johnson's new drug met the criteria to become one of those treatments, Farchione added. | An excess of GSK3-deconsolidation could contribute to the reduction in spine synapses in response to stress and depression (Fig. 3) (39) . Levels of GSK3 activity in the nucleus accumbens are also associated with social defeat stress, and blockade of GSK3 in this brain region or in response to systemic administration of a GSK3 inhibitor produces antidepressant effects in behavioral models of depression (39, 40) . | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38698437603&p=1pl&v=1&x=wF8FpTPjqDBWQD9Nqv4Ddg |
10.1038/s41598-018-29793-w | Medicine_easy_256 | The discovery surprised even the longtime cold researchers who made it. | Furthermore, oral probiotic consumption did not have an effect on nasal or fecal microbiota composition. | The compositions also were found to correlate with viral load -- the amount of cold virus inside the body. The discovery surprised even the longtime cold researchers who made it. "The first surprise was that you can kind of identify these different buckets that people kind of fit into, and then the fact that the buckets seem to have some impact on how you respond to the virus and how sick you get was also interesting," said Ronald B. Turner, MD, of the University of Virginia School of Medicine. | We further found that rhinovirus infection did not have a major impact on the nasal microbiota. Furthermore, oral probiotic consumption did not have an effect on nasal or fecal microbiota composition. The results of this study raise the possibility that the modulation of the nasal microbiota, perhaps by intranasal administration of probiotics, might provide an approach to intervention in rhinovirus-associated illness or other viral infections. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37225510845&p=1pl&v=1&x=cC_QQTJtCDR1qED9-8SGHg |
10.3402/ejpt.v5.22250 | Medicine_easy_257 | In addition, alters who hold anger or pain are much more likely to hurt themselves than anyone else.a
Joubert encourages newly diagnosed people to seek support from trauma- and DID-informed helpers. | The small number of participants meant that observed power was very low in many of the analyses. | For some people, especially people who have not yet been diagnosed or started therapy, this is true,a Joubert says. In addition, alters who hold anger or pain are much more likely to hurt themselves than anyone else.a
Joubert encourages newly diagnosed people to seek support from trauma- and DID-informed helpers. "We are inspired to do the work we do by the people in the DID community and our own experiences. | However, a sample size of 11 does limit the number of inferential statistical tests that can meaningfully be performed. The small number of participants meant that observed power was very low in many of the analyses. In the future, dividing the concepts of interest into several smaller, more focused studies should alleviate some of these problems. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38920678242&p=1pl&v=1&x=_UY1KqSAMnWKI6YGx_CLrw |
10.1038/s41467-018-05229-x | Medicine_easy_259 | The short-lived Wannier-Stark localization correlates with drastic changes to the electronic structure of the crystal and results, for example, in extremely high optical nonlinearity. | Under our biasing conditions, we can clearly see this effect also for the bulk semiconductor GaAs under study (see Supplementary Fig. | "If the electric field inside the crystal is strong enough, the electronic states can be localized to a few atoms. The short-lived Wannier-Stark localization correlates with drastic changes to the electronic structure of the crystal and results, for example, in extremely high optical nonlinearity. The first-ever experimental realization of Wannier-Stark localization in a gallium arsenide crystal was made possible through highly intense Terahertz radiation with field intensities of more than ten million volts per centimetre. | We also want to address the negligible role of high-harmonics generation for the interpretation of our data. Under our biasing conditions, we can clearly see this effect also for the bulk semiconductor GaAs under study (see Supplementary Fig. Nevertheless, we want to underline that this emission originates from the mid-infrared bias alone and it does not necessitate the presence of even a weak interband probe pulse. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34669971079&p=1pl&v=1&x=vdqBVutlRrBG6NrsU9ADLw |
10.1073/pnas.1411728112 | Medicine_easy_260 | In a sense, the traditional second law only holds on average. | Since our second laws concern general state transformations, they can be applied to the case of deterministic work extraction or to the case of extracting a fluctuating amount of work, but here we apply our second laws to the former case. | "Even while individual parts of a system may become more ordered, the overall entropy of the total system (a measure of disorder) increases." In a sense, the traditional second law only holds on average. Surprisingly, the researchers found that not only does the second law hold at such small scales, but there are actually many other second laws at work. | Given the monotonicity of F α (ρ, ρ β ) we may easily compute the maximum amount of deterministic work which can be extracted when going from a system in state ρ to one in state ρ . Since our second laws concern general state transformations, they can be applied to the case of deterministic work extraction or to the case of extracting a fluctuating amount of work, but here we apply our second laws to the former case. From them, we know that a transition is possible if and only if | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2015/02/150209161417.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news%2Ftop_technology+%28ScienceDaily%3A+Top+Technology+News%29 |
10.1038/s41591-018-0091-x | Medicine_easy_261 | Therefore if a tumour becomes more aggressive, and spreads around the body, we would advise always taking a second biopsy. | Our analyses support the hypothesis that genes associated with clonal enhancers have higher bulk RNA levels ( Supplementary Fig. | He continued: "However our results suggest tumours switch different genes on and off as they progress, and can fundamentally change their 'appearance'. Therefore if a tumour becomes more aggressive, and spreads around the body, we would advise always taking a second biopsy. The cancer might have changed significantly in this time, and would respond to different treatments. | As the average expression is a function of the number of cells engaged in active transcription and the number of RNA molecule within each cell 33 , assuming a stochastic single-cell contribution, bulk mRNA levels should positively correlate with the number of transcribing cells. Our analyses support the hypothesis that genes associated with clonal enhancers have higher bulk RNA levels ( Supplementary Fig. 7a ). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34627030168&p=1pl&v=1&x=hF9k2ZTU-XUiToM72b9JHA |
10.1073/pnas.1411728112 | Medicine_easy_262 | That means some rooms in the quantum house may spontaneously become much tidier, while others only become messier but only imperceptibly." | However, this is only so when we do not allow ancillary systems that are then returned in the same state. | For instance, a small system can spontaneously become more ordered when it interacts with another system which barely seems to change. That means some rooms in the quantum house may spontaneously become much tidier, while others only become messier but only imperceptibly." The results of the study give an improved understanding of how heat and energy is transformed on very small scales. | As we mentioned, in this toy thermodynamics, the law that governs state-to-state transitions is majorization. However, this is only so when we do not allow ancillary systems that are then returned in the same state. It is interesting to analyse how the laws change if we allow catalytic transitions between states. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2015/02/150209161417.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news%2Ftop_technology+%28ScienceDaily%3A+Top+Technology+News%29 |
10.1016/j.neuron.2014.04.039 | Medicine_easy_264 | Pinning down those details could pave the path to new drugs to stave off the defects in learning ability and memory that characterize Alzheimer's. | (C) LTP of the fEPSP resulting from a strong inducing stimulus (Y, tetanus; three 1 s duration 100 Hz trains of stimuli delivered 15 s apart) is not significantly reduced by Ab1-42 (B, n = 7; 129% ± 6%) compared to vehicle (C; n = 7; 146% ± 13%; p = 0.375, n.s. | Pinning down those details could pave the path to new drugs to stave off the defects in learning ability and memory that characterize Alzheimer's. advertisement
A surprise finding by Madison's group suggests that in small, physiologically normal concentrations, A-beta tamps down a signal-boosting process that under certain conditions increases the odds that pyramidal nerve cells will transmit information they've received to other nerve cells down the line. When incoming signals to the pyramidal tract build to high intensity, pyramidal cells adapt by becoming more inclined to fire than they normally are. | (B) LTP of the fEPSP, following a weak inducing stimulus ([, five bursts of four stimuli at 100 Hz, 400 ms interburst interval) is reduced by Ab1-42 (B, n = 7; 105% ± 5%) compared to vehicle (C; n = 7; 115% ± 4%) (p < 0.01 at 35-40 min posttetanus). (C) LTP of the fEPSP resulting from a strong inducing stimulus (Y, tetanus; three 1 s duration 100 Hz trains of stimuli delivered 15 s apart) is not significantly reduced by Ab1-42 (B, n = 7; 129% ± 6%) compared to vehicle (C; n = 7; 146% ± 13%; p = 0.375, n.s. not significant). | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2014/06/140618131955.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28Latest+Science+News+--+ScienceDaily%29 |
10.1016/j.immuni.2019.05.007 | Medicine_easy_266 | Note: material may have been edited for length and content. | The VP1 protein among these strains shows only $50% amino acid identity . | Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination. Note: material may have been edited for length and content. For further information, please contact the cited source. | The 10 serum antibodies could be categorized into three classes. The VP1 protein among these strains shows only $50% amino acid identity . The second class consisted of antibodies B403, C601, and C602, which had strong blockade activity towards the vaccine strain and the earlier pandemic GII.4 1997 strain but not to GII.4 strains that emerged post vaccination. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39496179252&p=1pl&v=1&x=1Ybn3Q7h2gozRyncgH43aA |
10.1016/j.cell.2015.07.058 | Medicine_easy_269 | "Our work implies that we may be able to engineer viruses that selectively kill cancer cells." | The MDC1 scaffolding protein binds gH2AX and recruits additional MRN, ATM, DDR kinases, and effectors into nuclear foci readily visualized by light microscopy . | O'Shea says this may explain why people with conditions resulting in high levels of cellular DNA damage (e.g., cancer, chemotherapy, inflammation and aging) are more susceptible to viral infections. "Our work implies that we may be able to engineer viruses that selectively kill cancer cells." In cancer cells, MRN is already so preoccupied with responding to DNA breaks in cancer cells that an engineered virus could sneak in undetected. | In Brief gH2AX foci discriminate ''self'' and ''nonself'' genomes and determine whether a localized anti-viral or global ATM response is appropriate, providing an elegant mechanism to neutralize viral genomes without jeopardizing cellular viability. The MDC1 scaffolding protein binds gH2AX and recruits additional MRN, ATM, DDR kinases, and effectors into nuclear foci readily visualized by light microscopy . gH2AX DDR foci play an important role in nucleating ATM and effector kinases to induce the global phosphorylation of DDR substrates, including KAP1, RPA32, 53BP1, and p53, that elicit cell-cycle arrest, repair, senescence, or apoptosis . | [1] | Medicine | train | 1 | news | http://www.healthcanal.com/cancers/66433-the-dna-damage-response-goes-viral-a-way-in-for-new-cancer-treatments.html |
10.2337/db11-1488 | Medicine_easy_270 | Sure enough, having higher levels of IGFBP-2 was associated with a variety of factors, such as a lower BMI, smaller waist circumference, smaller fatty liver index, and a lower risk of type 2 diabetes. | First, unlike both Sandhu et al. | Their findings suggested that the gene for IGFBP-2 in the liver was edited early in life, setting the mice up for type 2 diabetes later. Sure enough, having higher levels of IGFBP-2 was associated with a variety of factors, such as a lower BMI, smaller waist circumference, smaller fatty liver index, and a lower risk of type 2 diabetes. But for the subjects with type 2 diabetes the same chemical padlock found in the diabetic mice was also more likely to appear, again suggesting that for many people, diabetes could be influenced, if not caused, by epigenetic changes early in life. | Despite several areas of concordance between our study and prior epidemiologic and laboratory data, there are limitations to the current investigation that must be considered in its interpretation. First, unlike both Sandhu et al. (15, , we did not observe a relation of diabetes with total IGF-I, only a relation of diabetes with free IGF-I. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37654789048&p=1pl&v=1&x=Fe02NGVhEEhdNaHtErvtQg |
10.1001/jamasurg.2018.0672 | Medicine_easy_273 | Also, patients with inadequate functional health literacy had a lower health-related quality of life in terms of physical function, bodily pain, vitality, social functioning, mental health and physical aspects. | There were no statistical differences between the 3 groups in age, sex, type of anesthesia and surgery, or ASA classification ( Table 1) . | The poor recovery score among participants with inadequate literacy was 37.2 and 22.9 for problematic.The group with sufficient literacy had a score of 17.7. Also, patients with inadequate functional health literacy had a lower health-related quality of life in terms of physical function, bodily pain, vitality, social functioning, mental health and physical aspects. The researchers note that they did not have data on education or socioeconomic status, nor were they aware of how many can speak and read Swedish, which would also pose a challenge to understanding healthcare information, and will require further research. | Most (n = 427 [60.6%]) of the 704 patients undergoing day surgery reported sufficient FHL, 223 (31.7%) reported problematic FHL, and 54 (7.7%) reported inadequate FHL. There were no statistical differences between the 3 groups in age, sex, type of anesthesia and surgery, or ASA classification ( Table 1) . The global score of SwQoR indicated poor recovery in both inadequate (37. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=33897057585&p=1pl&v=1&x=gsIoyrhoCs5f3L7Wv3ex4w |
10.1038/s41598-018-29793-w | Medicine_easy_274 | Researchers found that the bacteria found inside study participantsa nasal microbiome types were linked to how much cold virus was found inside the body, and how cold symptoms manifested person to person. | The scores were lower in Cor/All cluster compared to Staph (P = 0.007) and Ps/Mix clusters (P = 0.013) (Fig. | These nasal microbiome types are linked to how bad your cold symptoms get, and how well you fight the virus off in the first place. Researchers found that the bacteria found inside study participantsa nasal microbiome types were linked to how much cold virus was found inside the body, and how cold symptoms manifested person to person. Itas further noted in the press release that genes might play a role in both the composition of your nasal microbiome, and how bad your cold symptoms get. | With total Cold Symptom scores (runny nose, plugged nose, sneezing, sore throat, scratchy throat, cough, hoarseness, head congestion, and feeling tired) a significant D0 cluster effect was found (P = 0.011). The scores were lower in Cor/All cluster compared to Staph (P = 0.007) and Ps/Mix clusters (P = 0.013) (Fig. When individual symptoms were analyzed, the D0 cluster effect was found not significant (P > 0.1) in all analysis models. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37227743738&p=1pl&v=1&x=2zyW9bON3VHP6zbXr8qTXQ |
10.1001/jamaoncol.2018.3701 | Medicine_easy_275 | "These data further demonstrate the importance of adjunctive biomarkers regarding PSA assessment, especially regarding the decision to either avoid or to proceed to prostate biopsy," said principal investigator Neal Shore , M.D., Medical Director at the Carolina Urologic Research Center , Atlantic Urology Clinics in Myrtle Beach, South Carolina. | Furthermore, our study and the microcosting methodology revealed additional insights that warrant further discussion. | NEWS RELEASE REGULATED INFORMATION
Real-world study shows that SelectMDx helps urologists more confidently determine
the need for an initial prostate biopsy
IRVINE, CA, and HERSTAL, BELGIUM - 07.00 CEST, 7 November 2018 - MDxHealth SA (Euronext: MDXH.BR) or the "Company" today announces that the journal Urology Practice has published a study demonstrating the clinical utility of SelectMDx, the Company's non-invasive 'liquid biopsy' test to identify patients at increased risk of aggressive prostate cancer, in guiding initial prostate biopsy decision-making. "These data further demonstrate the importance of adjunctive biomarkers regarding PSA assessment, especially regarding the decision to either avoid or to proceed to prostate biopsy," said principal investigator Neal Shore , M.D., Medical Director at the Carolina Urologic Research Center , Atlantic Urology Clinics in Myrtle Beach, South Carolina. "The SelectMDx biomarker offers physicians and patients an easily obtained urine-based test, which combines cost effectiveness with clinical utility, improving urologists' ability to diagnose and treat prostate cancer." | Overall, our findings were consistent with this prior study. Furthermore, our study and the microcosting methodology revealed additional insights that warrant further discussion. First, with the continued controversy regarding prostate cancer screening, the present study provides insight on an important but understudied piece of this debate-cost. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37616037423&p=1pl&v=1&x=gXp7O7pmGkPY1w04wbVK7A |
10.1088/1741-2552/aabc9b | Medicine_easy_276 | "Instead, our device receives feedback from the motor cortex, far from the stimulation source, providing a more reliable signal." | The classifier algorithm performed as expected, appropriately detecting changes in gamma band power and triggering reduction in DBS amplitude when the gamma threshold was exceeded. | The short time periods over which movement was assessed did not permit comparison of the two deep brain stimulation paradigms relative to incidence of dyskinesia, but it is hoped that the variable stimulation will also translate into a reduction in adverse effects when tested over longer time periods. "Instead, our device receives feedback from the motor cortex, far from the stimulation source, providing a more reliable signal." An adaptive system like the one being tested here could offer an effective alternative and may also limit adverse effects of traditional deep brain stimulation, but considerable testing remains to be done. | While the total energy delivered by adaptive stimulation was substantially less than that of open-loop stimulation, blinded clinical ratings confirmed similar efficacy for both approaches. The classifier algorithm performed as expected, appropriately detecting changes in gamma band power and triggering reduction in DBS amplitude when the gamma threshold was exceeded. Although this approach has shown promise 1,2 , the STN LFP is a low amplitude signal that is strongly affected by stimulation artifact when stimulation is delivered on adjacent contacts. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34178086266&p=1pl&v=1&x=nNMoIIdQdsrnpbYA5pi8RQ |
10.1093/eurpub/cky178 | Medicine_easy_277 | spoke mainly of an increasingly strapped and fragmented National Health Service, the country's public health system. | After controlling for regional fixed effects, to address time-consistent variations in surveillance and health infrastructure, the corresponding figure increased to 0.53 percentage points (95% CI: 0.37-0.69 percentage points). | They also mentioned the fact that there is no system in place to remind people to get their shots, among other barriers to access. spoke mainly of an increasingly strapped and fragmented National Health Service, the country's public health system. They also mentioned the fact that there is no system in place to remind people to get their shots, among other barriers to access. | Our unadjusted model estimates that each 1% increase in real public health expenditure was associated with a significant increase in MMR coverage of 0.29 percentage points (95% CI: 0.19-0.40 percentage points). After controlling for regional fixed effects, to address time-consistent variations in surveillance and health infrastructure, the corresponding figure increased to 0.53 percentage points (95% CI: 0.37-0.69 percentage points). Similarly, when correcting for regional time trends, every 1% increase in real public health expenditure per-capita (corresponding to an average of E17 percapita) was associated with an increase of 0.50 percentage points in MMR coverage (95% CI: 0.36-0.65 percentage points). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37159214862&p=1pl&v=1&x=CcPjjUifeL13VJ3H086Sjg |
10.1073/pnas.1411728112 | Medicine_easy_278 | Surprisingly, the researchers found that not only does the second law hold at such small scales, but there are actually many other second laws at work. | Now, let us note that | In a sense, the traditional second law only holds on average. Surprisingly, the researchers found that not only does the second law hold at such small scales, but there are actually many other second laws at work. In other words, just like larger systems, small systems also tend to become more disordered. | we know that for n sufficiently large Now, let us note that (G38), and the fact that the dimension of the catalyst is N = n2 n−1 . | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2015/02/150209161417.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news%2Ftop_technology+%28ScienceDaily%3A+Top+Technology+News%29 |
10.1016/j.jpain.2017.11.005 | Medicine_easy_279 | How (in the hell) could it do that? | was determined to have a sham acupuncture arm with a high likelihood of bias from unblinding. | Long story short, the jury's still out. How (in the hell) could it do that? It found no significant uptick in successful births among those who underwent acupuncture versus those who didn't. | 13, 26, 41, 49, 59, 103 In one trial, two types of sham acupuncture were used, although only one type (non-needle sham acupuncture) was found to have an intermediate likelihood of bias from unblinding. was determined to have a sham acupuncture arm with a high likelihood of bias from unblinding. None of the 10 new trials included in this analysis had dropout rates of higher than 25%. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38497695155&p=1pl&v=1&x=s_16A13LceP0QMt7V7o-QA |
10.1111/gcb.13276 | Medicine_easy_280 | "We want this index to be used to predict how corals might react to future bleaching events. | The effect of extrinsic factors P ext was found by correlation between BRI j and taxon-sBRI j (Eqn 17). | "Using very large data sets, we have teased out valuable information that will help researchers identify global trends and learn about individual corals," says coauthor Vadim Backman, professor of biomedical engineering. "We want this index to be used to predict how corals might react to future bleaching events. The index will be available online, so that data on corals can be added as they become available, making the tool even more robust. | The threshold at which uncertainty of a report increases total uncertainty can be determined; reports with average-dB jk more than twice the average of all reports for a taxon increase total uncertainty and are candidates for exclusion (if minimizing the uncertainty is the goal, Eqns 30-33, Text S1.6). The effect of extrinsic factors P ext was found by correlation between BRI j and taxon-sBRI j (Eqn 17). Because we cannot eliminate effects of intrinsic factors on taxon-sBRI j (e.g., a site may contain mostly bleaching-susceptible coral taxa), P ext is the upper bound of the true variance due to extrinsic factors, and it is expected to increase in accuracy for sites with diverse bleaching responses (i.e., in the limit of a high number of taxa per site n, Eqns 17-19). | [1] | Medicine | train | 1 | news | http://www.futurity.org/coral-reefs-climate-change-1138362/ |
10.1073/pnas.1613193114 | Medicine_easy_281 | Under the stabilization scenario, demand on an average day would climb 3 percent, and on a peak day, 7 percent. | As such, even absent population and income changes, climate change will demand significant changes to the electric grid. | Under both scenarios, if the nation were to experience temperatures like the ones predicted 100 years from now with today's infrastructure, the grid would be overtaxed. Under the stabilization scenario, demand on an average day would climb 3 percent, and on a peak day, 7 percent. Absorbing this would require an investment of $70 billion. | Overall, if the US had faced, over the past decade, the warmer climate that scientists predict for the future, our results show that much greater generation or storage capacity would have been needed. As such, even absent population and income changes, climate change will demand significant changes to the electric grid. ERCOT covers Texas only and can be thought of as more representative of warmer regions. | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/electricity-costs-a-new-way-theyll-surge-in-a-warming-world/ |
10.1126/sciadv.aau1291 | Medicine_easy_283 | This way of delivering drugs also has the advantage of not increasing the local pressure where the drug exits the device because the drug molecules are not in a solvent - they exit the device "dry". | Figure 3 overviews the frequency of pathological events for the control experiments with 4AP injection but no GABA delivery (n = 8), the case of GABA delivery after 4AP injection (n = 3), and the case of GABA delivery before 4AP injection (n = 4) (see table S1 for the complete data set). | We show that the implant can treat problems in the brain, such as epileptic seizures, by delivering brain chemicals - known as neurotransmitters - directly to the cells in the brain that cause the problem. This way of delivering drugs also has the advantage of not increasing the local pressure where the drug exits the device because the drug molecules are not in a solvent - they exit the device "dry". This stopped the seizures. | Neither interictal spikes nor seizures were observed when the GABA delivery was initiated before the 4AP injection. Figure 3 overviews the frequency of pathological events for the control experiments with 4AP injection but no GABA delivery (n = 8), the case of GABA delivery after 4AP injection (n = 3), and the case of GABA delivery before 4AP injection (n = 4) (see table S1 for the complete data set). The decrease in pathological activity was found to be significant (P < 0.05) in the case of delivering GABA before 4AP relative to the control experiments. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34961518391&p=1pl&v=1&x=gYock5HcirAl4GI18svsfA |
10.1038/s41467-018-04627-5 | Medicine_easy_285 | Subjects in the control group showed no changes in diffusion rates or structure between MRI measurements. | Similarly, in the ILF, we saw a significant main effect of Table 3 , the group-by-time interaction approached significance for the quadratic term for FA in the left AF and ILF, but not for MD in the AF or ILF, or for either parameter in the CC. | That plasticity points to changes brought about by the environment, indicating that these regions are not inherently inflexible structures. Subjects in the control group showed no changes in diffusion rates or structure between MRI measurements. But for subjects who took part in the tutoring program, reading skills improved by an average of one full grade level. | In the left AF, we found a significant main effect of group (F(1,125) = 7.047, p = 0.009) but not of time (F(1,125) = 1.033, p = 0.31) and a significant groupby-time interaction (F(1,125) = 4.97, p = 0.028), consistent with a decrease in MD over time that was specific to the intervention subjects. Similarly, in the ILF, we saw a significant main effect of Table 3 , the group-by-time interaction approached significance for the quadratic term for FA in the left AF and ILF, but not for MD in the AF or ILF, or for either parameter in the CC. Sessions were systematically spaced over time, and this timing was consistent across subjects; hence "session" was highly correlated with "days" (r(127) = 0.97, p < 0.001). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34316135354&p=1pl&v=1&x=D1Z-S3HDnAF3EPGxC7uLSg |
10.1126/science.1256773 | Medicine_easy_286 | "To really prove that we reconstituted the cytokinesis signal, we needed to add the bilayer membrane and then see if it could recruit the proteins that would be on the cortex of the cell," Field said about the specialized layer beneath the cell membrane. | Microtubules grew outward radially within each aster. | "We believe our work is a step forward, not only for understanding the assembly of the cleavage furrow but also, more generally, for understanding the biophysics of cytokinesis signaling." "To really prove that we reconstituted the cytokinesis signal, we needed to add the bilayer membrane and then see if it could recruit the proteins that would be on the cortex of the cell," Field said about the specialized layer beneath the cell membrane. The scientists saw this signal in part because Field chose to include actin in their system, a cellular component that is often discarded because it makes it so difficult to do experiments with the egg extract. | The morphology of the midplane in zygotes, as defined by microtubule morphology and CPC/centralspindlin localization, was strikingly similar to that of the AAIZ in extracts (Fig. Microtubules grew outward radially within each aster. At the AAIZ, EB1 comets from both directions entered antiparallel bundles, where they usually disappeared (Fig. | [1] | Medicine | train | 1 | news | http://www.science20.com/news_articles/cytokinesis_lite_cellular_division_now_with_no_cells-148202 |
10.1001/jama.2013.277165 | Medicine_easy_287 | The study is being released early online to coincide with its presentation at the European Society of Cardiology Congress 2013
"Major progress has been made in the management of non-ST-segment elevation [a certain pattern on an electrocardiogram] acute coronary syndromes (NSTE-ACS) because of the availability of potent combinations of oral antiplatelet agents, injectable anticoagulants, and increasing use of an invasive strategy. | A lower dose of otamixaban did not achieve better results. | The study is being released early online to coincide with its presentation at the European Society of Cardiology Congress 2013
"Major progress has been made in the management of non-ST-segment elevation [a certain pattern on an electrocardiogram] acute coronary syndromes (NSTE-ACS) because of the availability of potent combinations of oral antiplatelet agents, injectable anticoagulants, and increasing use of an invasive strategy. The primary outcome of death or new myocardial infarction through day 7 occurred in 5.5 percent of the patients treated with otamixaban vs. 5.7 percent of the patients treated with UFH plus eptifibatide. Otamixaban did not significantly reduce the risk of any of the components of the primary outcomes, either death or heart attack, or of any of the secondary efficacy outcomes, including procedural thrombotic complications. | These results were consistent across patient subgroups. A lower dose of otamixaban did not achieve better results. 12 In a post hoc analysis, a 44% to 48% RR reduction in death or myocardial infarction was seen in the midrange doses compared with UFH plus eptifibatide, similar to those tested in the TAO trial. | [1] | Medicine | train | 1 | news | http://www.newswise.com/articles/anticoagulant-does-not-reduce-rate-of-ischemic-events-among-certain-patients-undergoing-pci |
10.1111/cdev.12250 | Medicine_easy_288 | Of course, the vanity of focusing on social hierarchies never fares too well in the end. | This fact, plus the lack of consistent links between pubertal timing and delinquent and romantic behavior in the existing literature, suggests that prior differences in pubertal timing are unlikely to account for the findings observed. | Allen says he believes that part of the problem may be that as popular youth grow older, they have to do increasingly extreme things in order to grab the attention of their peers and keep it. Of course, the vanity of focusing on social hierarchies never fares too well in the end. "The quiet, not-so-cool kids do well in the long term," Allen says. | Although no measures of pubertal status were available in this study, by the ages of 13-15, the period during which pseudomature behavior was observed, the vast majority of teens are well into puberty. This fact, plus the lack of consistent links between pubertal timing and delinquent and romantic behavior in the existing literature, suggests that prior differences in pubertal timing are unlikely to account for the findings observed. Third, "popularity" is now recognized as potentially referring to both preference-based measures (i.e., who do teens prefer as associates) and statusbased measures (i.e., who do teens perceive as being "popular"). | [1] | Medicine | train | 1 | news | http://www.scienceworldreport.com/articles/15380/20140612/treatment-of-sleep-apnea-helps-improve-heart-health.htm |
10.1210/en.2015-2036 | Medicine_easy_289 | The use of sunscreen can also affect vitamin D synthesis. | Interestingly, basal levels of ID1 protein expression were significantly increased in the VDR KD cell line relative to control cells ( Figure 3D ) and the VDR Rescue cell line had lower levels of ID1 ( Figure 3E ; reprobed Western blot from Figure 1D ). | Those who don't get enough sun exposure, or people with darker skin, are more likely than fair-skinned individuals who spend time outdoors each day to be deficient. The use of sunscreen can also affect vitamin D synthesis. Mice fed a diet deficient in vitamin D developed palpable tumors an average of seven days sooner than their peers, and after six weeks of growth those tumors were significantly larger in size than those in animals with adequate vitamin D levels. | This suppression of Id1 by calcitriol treatment was substantially abrogated in the VDR KD cells ( Figure 3D ). Interestingly, basal levels of ID1 protein expression were significantly increased in the VDR KD cell line relative to control cells ( Figure 3D ) and the VDR Rescue cell line had lower levels of ID1 ( Figure 3E ; reprobed Western blot from Figure 1D ). These results suggest that VDR might directly regulate Id1 in BCa cells and that basal endogenous levels of VDR suppress Id1 expression. | [1] | Medicine | train | 1 | news | http://www.science20.com/news_articles/vitamin_d_deficiency_contributes_to_spread_of_breast_cancer_in_mice_stanford_study_finds-167109 |
10.1016/j.jpeds.2017.10.028 | Medicine_easy_291 | But if you can connect with a kid when they're doing something right, they're more likely to do that again in the future." | Results In all, 19% of participants (n = 134) reported physical dating violence perpetration and 68% reported experiencing corporal punishment as children (n = 498). | It's not just a Texas thing; it's proven not to work. But if you can connect with a kid when they're doing something right, they're more likely to do that again in the future." As a father himself, he knows this is difficult to adhere to, but he believes this can happen even in the most difficult situation. | Results In all, 19% of participants (n = 134) reported physical dating violence perpetration and 68% reported experiencing corporal punishment as children (n = 498). Analysis showed a significant positive association between corporal punishment and physical perpetration of dating violence (OR 1.30, 95% CI 1.07-1.59). Even after controlling for sex, ethnicity, age, parental education, and child physical abuse, childhood corporal punishment was associated significantly with physical dating violence perpetration (aOR 1.29, 95% CI 1.02-1.62). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=32755946603&p=1pl&v=1&x=0KWopEIxShdttKNVIWuAxg |
10.1007/s00213-014-3810-0 | Medicine_easy_292 | / no comments
These Bacteria Could Be The Leading Cause Of Your Anxiety -- And Other Issues
Your gut feeling could be causing your anxiety. | a Attentional vigilance did not differ between groups during masked trials of the attentional dot-probe task. | / no comments
These Bacteria Could Be The Leading Cause Of Your Anxiety -- And Other Issues
Your gut feeling could be causing your anxiety. There is a connection between anxiety and an upset gut. In the study, when the bacteria's healthy functions were restored, mood and behavior leveled out, reducing or eliminating anxious feelings. | *p<0.05 Fig. a Attentional vigilance did not differ between groups during masked trials of the attentional dot-probe task. b Participants showed decreased attentional vigilance to negative versus positive words in the unmasked condition of the dot-probe task after B-GOS but not FOS intake compared to placebo involuntary deployment of attention ), whereas at longer stimulus durations, it may further involve a difficulty to disengage from salient emotional stimuli . | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/can-bacteria-cause-anxiety/ |
10.1038/ncomms14514 | Medicine_easy_293 | It turns out with these clusters, every single cluster is exactly the same structure. | The LSPR peak energy of the clusters saturates to a value of 1.06 eV on prolonged oxidation, only marginally higher than the saturation peak energy of 0.99 eV for the 6 nm Cu 2 Se NCs and the value of 1 eV from Manna and coworkers . | This crystal structure is a result of internal strain in the clusters. It turns out with these clusters, every single cluster is exactly the same structure. Somehow, at this size, the electronic structure of the material is so stable that every single cluster has the same arrangement of atoms." | In this regard the clusters show behaviour similar to that of the larger 6 nm NCs, even though the oxidation kinetics appear to be slower for the 2 nm clusters (Fig. The LSPR peak energy of the clusters saturates to a value of 1.06 eV on prolonged oxidation, only marginally higher than the saturation peak energy of 0.99 eV for the 6 nm Cu 2 Se NCs and the value of 1 eV from Manna and coworkers . The difference is only 7% and could be due to increased carrier confinement in the clusters, known to cause a blue-shift or due to differences in the local medium refractive index presented by the ligand shell. | [1] | Medicine | train | 1 | news | http://feedproxy.google.com/~r/TechnologyOrg/~3/uNVFlIGRBVk/ |
10.1038/s41467-018-04408-0 | Medicine_easy_294 | Recognition of the link between testosterone and BAFF is completely new. | Since BAFF production in secondary lymphoid organs relies heavily on the FRC stromal compartment 47 , these events provide a mechanism for the increased splenic production of BAFF in testosterone/AR deficiency. | If you eliminate testosterone, you get more BAFF and thereby more B cells in the spleen because they survive to a greater extent. Recognition of the link between testosterone and BAFF is completely new. Ultimately, the researchers hope that their findings lead to more effective medications for lupus and other autoimmune diseases that impact so many women. | Thus, the decreased splenic noradrenaline levels in testosterone/AR deficiency increases the number of FRCs. Since BAFF production in secondary lymphoid organs relies heavily on the FRC stromal compartment 47 , these events provide a mechanism for the increased splenic production of BAFF in testosterone/AR deficiency. The increase in B cell number in the lymph nodes was less pronounced than in the spleen, and not associated with increased FRC number, suggesting that this is a systemic effect of BAFF. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34230456675&p=1pl&v=1&x=lt6z2jq1xfFKoXvXclXMKg |
10.1038/s41467-018-05229-x | Medicine_easy_295 | The system remains stable as long as the rubber band is as strong as the repulsion is. | When an electric field of the order of E WSL is applied, localization of wave functions occurs only in one lattice direction, while the electronic bonding structure perpendicular to the field remains intact. | Using the ultrafast laser systems at the University of Konstanz, Wannier-Stark localization has now been demonstrated for the first time. The system remains stable as long as the rubber band is as strong as the repulsion is. If this is the case, the beads neither move closer to each other, nor do they move away from each other -- the distance between them remains about the same. | 2b , c. The step-like character and field-independent position of the central feature in Wannier-Stark electro-absorption is explained microscopically in Fig. When an electric field of the order of E WSL is applied, localization of wave functions occurs only in one lattice direction, while the electronic bonding structure perpendicular to the field remains intact. A step-function-like absorption spectrum characteristic for twodimensional electron systems arises with an onset of absorption at a higher energy E gap 2D , which may be related to the atomic transition energies in the compound (Fig. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34669971079&p=1pl&v=1&x=vdqBVutlRrBG6NrsU9ADLw |
10.1002/cncr.30912 | Medicine_easy_296 | Next Steps
The researchers have found that early consideration of palliative care in a treatment plan for patients with solid tumors improves patients' understanding of the prognosis. | First, we performed the study at a single, tertiary care site in a patient sample with limited socioeconomic diversity, which may limit the generalizability of findings to other, more diverse populations or to patients in other geographic areas. | The researchers attribute this to higher levels of distress seen in people with AML due to the urgency of their treatment decisions. Next Steps
The researchers have found that early consideration of palliative care in a treatment plan for patients with solid tumors improves patients' understanding of the prognosis. They hope to implement a similar study in patients with leukemia. | Several limitations of this study warrant discussion. First, we performed the study at a single, tertiary care site in a patient sample with limited socioeconomic diversity, which may limit the generalizability of findings to other, more diverse populations or to patients in other geographic areas. Second, it is possible that differences in illness severity and other factors could confound the relation between symptom burden and health care utilization. | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/people-with-leukemia-and-their-oncologists-have-vastly-different-perceptions-of-prognosis/ |
10.1016/j.cell.2013.08.004 | Medicine_easy_297 | If you think about, it makes sense to have a buffering mechanism in place to provide some stability to the clock. | Of particular interest were two kinases that caused period lengthening. | When they blocked the activity of SIK1, the mice adjusted faster to changes in light cycle. If you think about, it makes sense to have a buffering mechanism in place to provide some stability to the clock. The clock needs to be sure that it is getting a reliable signal, and if the signal occurs at the same time over several days it probably has biological relevance. | Silencing of several of the genes caused significant changes in period length, which would indicate a role in regulating phase delays of the clock . Of particular interest were two kinases that caused period lengthening. It is closely related to CsnkE, which is mutated in the Tau mutant hamster, which also shows period lengthening . | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2013/08/130829124013.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28ScienceDaily%3A+Latest+Science+News%29 |
10.1016/j.jpain.2017.11.005 | Medicine_easy_298 | "I think its mechanisms depend on the disease it's trying to treat," he says. | An additional 13 trials were identified, with data received for a total of 20,827 patients from 39 trials. | Napadow's take: It's not a panacea that will cure all ills, but there are some areas where acupuncture is promising and, given its safety profile, should be recommended. "I think its mechanisms depend on the disease it's trying to treat," he says. "This is the area where we have the most data," Napadow says. | -Acupuncture has a clinically relevant effect on chronic pain that persists over time -The effect of acupuncture cannot be explained only by placebo effects -Factors in addition to the specific effects of needling are important contributors -Referral for acupuncture treatment is a reasonable option for chronic pain patients An additional 13 trials were identified, with data received for a total of 20,827 patients from 39 trials. Acupuncture was superior to both sham and no acupuncture control for each pain condition (all p<0.001) with differences between groups close to 0.5 standard deviations (SD) for comparison with no acupuncture control and close to 0.2 SDs in comparison with sham. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38497695155&p=1pl&v=1&x=s_16A13LceP0QMt7V7o-QA |
10.1016/j.cell.2015.07.058 | Medicine_easy_299 | This provides an elegant mechanism to neutralize viral replication without jeopardizing cellular viability. | ATM activation triggers ATM autophosphorylation at Ser1981 . | MRN starts a domino effect, activating histones on surrounding chromosomes, which summons a cascade of additional proteins, resulting in a cell-wide, all-hands-on-deck alarm to help mend the DNA. This provides an elegant mechanism to neutralize viral replication without jeopardizing cellular viability. Image: Courtesy of the Salk Institute for Biological Studies
"What's interesting is that even a single break transmits a global signal through the cell, halting cell division and growth," says O'Shea. | HU and KU-55933 also prevent the phosphorylation of DNA-PKcs ( Figure 3B ), indicating that DNA-PK is activated downstream of ATM in response to virus DNA replication. ATM activation triggers ATM autophosphorylation at Ser1981 . Etoposide induces cellular DNA breaks and the phosphorylation of ATM at discrete DDR foci ( Figure 3C ). | [1] | Medicine | train | 1 | news | http://www.healthcanal.com/cancers/66433-the-dna-damage-response-goes-viral-a-way-in-for-new-cancer-treatments.html |
10.1534/genetics.116.197285 | Medicine_easy_300 | They show nature still has the edge over scientists hoping to solve human problems with GM organisms. | Driver alleles, by contrast, carry a substantial cost that is codominant, s d0 = 0.1 = s dd /2. | "We expect that resistance alleles will pop up either before the drive can spread, or after the drive spreads, and eventually replace the drive," he said. They show nature still has the edge over scientists hoping to solve human problems with GM organisms. "Basically, looking at the numbers and assuming a simple gene drive system, it's a foregone conclusion that resistance will evolve," Unckless said. | This will allow us to dissect the particular role each individual parameter plays in the general behavior of the model, and the evolution of resistance specifically. Driver alleles, by contrast, carry a substantial cost that is codominant, s d0 = 0.1 = s dd /2. In those analyses where both the driver and the resistance allele carry a cost, we assume that these costs are codominant to each other, | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/research-shows-nature-can-beat-back-scientific-tinkering-with-genes-of-entire-species/ |
10.1073/pnas.1403984111 | Medicine_easy_301 | The sheer number of animals being killed shows us that, up until the UAVs take to the air, most poachers have been able to operate with impunity. | Illegal killing was most pervasive in the populations of Central Africa (Figs. | This is critical since poachers will try to change their behavior once they learn that they are at an extremely high risk of apprehension. The sheer number of animals being killed shows us that, up until the UAVs take to the air, most poachers have been able to operate with impunity. The most important finding is that in every area where we have put our solutions package to work and the UAVs are flying, poaching stops with 5 to 7 days. | The three regions of Africa (Central, East, and Southern) demonstrated different trends that were captured by both approaches. Illegal killing was most pervasive in the populations of Central Africa (Figs. 2 and 3) , where results supported probable annual declines each year since at least 2007 ( Fig. | [1] | Medicine | train | 1 | news | http://www.theecologist.org/News/news_analysis/2731159/satellites_mathematics_and_drones_take_down_africas_poachers.html |
10.1016/j.neuron.2018.12.026 | Medicine_easy_304 | "But actually, our results suggest that loss of inhibition might represent a useful compensation that the brain is doing, or might be unrelated to disease symptoms. | Mutant and WT PYR cells did not differ in baseline recording or stimulation parameters or in EPSC or IPSC kinetics including latency and EPSC-IPSC delay (Table S2 ; Figure S1 ). | Instead, this altered balance seems to be a compensatory mechanism that stabilizes brain activity in response to the disorder. "But actually, our results suggest that loss of inhibition might represent a useful compensation that the brain is doing, or might be unrelated to disease symptoms. And if you go in there and increase inhibition, you might make things worse or you might not affect things at all." | Overall, in Fmr1 À/y , Cntnap2 À/À , 16p11.2 del/+ and Tsc2 +/À mice, the area under the mean inputoutput curve for EPSCs was 0.57, 0.36, 0.86, and 0.92 of WT, respectively; for IPSCs it was 0.55, 0.18, 0.63, and 0.74 of WT; and for E-I ratio was 2.24, 1.79, 1.29, and 1.37 of WT. Mutant and WT PYR cells did not differ in baseline recording or stimulation parameters or in EPSC or IPSC kinetics including latency and EPSC-IPSC delay (Table S2 ; Figure S1 ). Thus, these 4 genetically distinct ASD mutants exhibited a common impairment in feedforward IPSCs, variably coupled to a loss of feedforward EPSCs, yielding a common increase in E-I conductance ratio. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38318437455&p=1pl&v=1&x=tFlh-_qIVNCNf8CEol-uvQ |
10.1373/clinchem.2012.187617 | Medicine_easy_305 | While a flight to Mars will expose astronauts to more radiation and longer durations of space flight, the researchers said this study is one indication that the flight itself isn't likely to permanently harm human bodies. | contribute to increased gut permeability, this change in the gut microbiome may result in a leaky gut and yield increased concentrations of endotoxins such as LPS in the circulation. | Overall, NASA views this study as good news so far for their plans of crewed missions to Mars. While a flight to Mars will expose astronauts to more radiation and longer durations of space flight, the researchers said this study is one indication that the flight itself isn't likely to permanently harm human bodies. What the researchers did
Conducting a fecal study in space is harder than you think. | In addition to improved insulin activity and glucose tolerance, because lower levels of Bifidobacterium spp. contribute to increased gut permeability, this change in the gut microbiome may result in a leaky gut and yield increased concentrations of endotoxins such as LPS in the circulation. The immune system recognizes LPS as a microbial pattern triggering TLR signaling and causing inflammation. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38972928248&p=1pl&v=1&x=ysfCh3UQ1PqOUUs0UQwPzg |
10.1038/s41598-018-25573-8 | Medicine_easy_306 | The team had similar results when they used ovarian tumour samples taken directly from patients, showing that their chicken egg model provides a convenient system for replicating human cancer. | We further demonstrated that doxorubicin is preferentially delivered to the tumor when the nanoparticle formulation was used, as shown by the preferential appearance of red fluorescence of doxorubicin in the tumor. | The team had similar results when they used ovarian tumour samples taken directly from patients, showing that their chicken egg model provides a convenient system for replicating human cancer. This conclusion is supported by their detailed characterization of the tumour, demonstrating that it possesses all major cancer features. "We were surprised when the tumour was formed in three days," says Tamanoi. " | Nanoparticle formulation enables higher amount of doxorubicin to be used. We further demonstrated that doxorubicin is preferentially delivered to the tumor when the nanoparticle formulation was used, as shown by the preferential appearance of red fluorescence of doxorubicin in the tumor. This is in contrast with the distribution of red fluorescence when free doxorubicin was injected. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34220579892&p=1pl&v=1&x=hyv7yBfI9spqaAdmPr3ViA |
10.3402/ejpt.v5.22250 | Medicine_easy_308 | People seem to forget this sometimes.a
Despite the profound challenges that both trauma and DID have given Joubert, she also says that her systemas adaptation to trauma has been nothing short of lifesaving. | The IM may be useful in treatment settings to assess progress or change over time. | If a therapist makes you uncomfortable or raises red flags for you, you don't have to see them. People seem to forget this sometimes.a
Despite the profound challenges that both trauma and DID have given Joubert, she also says that her systemas adaptation to trauma has been nothing short of lifesaving. aDID saved our life. | Directions for future research are also discussed, including expanding the IM from this pilot. The IM may be useful in treatment settings to assess progress or change over time. They also propose that fragmentation of information storage may occur only when that information is personally relevant, or when attempting to transfer information between different types of identities that serve different roles. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38920678242&p=1pl&v=1&x=_UY1KqSAMnWKI6YGx_CLrw |
10.1038/s41598-018-30656-7 | Medicine_easy_309 | Thatas because this skill likely co-evolved with planning abilities, complex cognition, and the ability to use language. | These differences suggest that sharing the burden of information gathering and decision-making across multiple individuals has benefits that are not always immediately obvious: colonies rely on adaptive satisficing without suffering major increases in the probability of errors, while individuals face the full conflict between accuracy of choice and time to decision. | In other words, they may play out the potential steps in their brain before settling on a viable solution they can perform. Thatas because this skill likely co-evolved with planning abilities, complex cognition, and the ability to use language. While this latest study doesnat imply that the cognitive powers of a crow rival those of humans or apes, it hints that they too have evolved to perform complex tasks with coordination and ease. | Individuals are also vulnerable to decoy effects in choices among options that vary in multiple attributes 33 , while whole colonies are more resilient towards decoys, consistently adhering to economic principles of rational choice 40 . These differences suggest that sharing the burden of information gathering and decision-making across multiple individuals has benefits that are not always immediately obvious: colonies rely on adaptive satisficing without suffering major increases in the probability of errors, while individuals face the full conflict between accuracy of choice and time to decision. Given the obligatory eusocial condition of our subject species, the functional significance of decisions by isolated workers deserves some caveats. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37498408749&p=1pl&v=1&x=JzrzVk7uH3JlDWFg7C-bNg |
10.1073/pnas.1414221111 | Medicine_easy_310 | Whole genome sequencing of the Plasmodium falciparum, the deadliest of the malaria parasites, revealed that (+)-SJ733 disrupted activity of the ATP4 protein in the parasites. | The three rodent malaria species (P. berghei, Plasmodium vinckei, and Plasmodium chabaudi) were all significantly less sensitive to (+)-SJ733 than was P. falciparum both ex vivo (SI Appendix, Fig. | "These results indicate that SJ733 and other compounds that act in a similar fashion are highly attractive additions to the global malaria eradication campaign, which would mean so much for the world's children, who are central to the mission of St. Whole genome sequencing of the Plasmodium falciparum, the deadliest of the malaria parasites, revealed that (+)-SJ733 disrupted activity of the ATP4 protein in the parasites. Researchers showed that inhibiting ATP4 triggered a series of changes in malaria-infected red blood cells that marked them for destruction by the immune system. | Unconstrained docking of the structure of (+)-SJ733 to this homology model revealed one predicted binding site, which is enveloped by the cluster of residues bearing resistance-conferring mutations (Fig. The three rodent malaria species (P. berghei, Plasmodium vinckei, and Plasmodium chabaudi) were all significantly less sensitive to (+)-SJ733 than was P. falciparum both ex vivo (SI Appendix, Fig. S2E ), which is predicted to encode a loop within the (+)-SJ733 binding site (purple ribbon, Fig. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2014/12/141205175027.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news%2Ftop_science+%28ScienceDaily%3A+Top+Science+News%29 |
10.1002/ejhf.69 | Medicine_easy_311 | "People seem to mix the concepts of prevention and treatment together," he said. | Integrating incident HF into cardiovascular disease risk prediction and prevention strategies should be considered. | But don't think you are treating heart failure per se until the results of the dedicated heart failure trials come out." "People seem to mix the concepts of prevention and treatment together," he said. "We have now very good evidence across all trials with SGLT-2 inhibitors for prevention of heart failure. | 48 In conclusion, the present study underscores the importance of vascular disease in relation to risk of HF but also reaffirms the existence of an important yet largely ignored clinical entity of HF without preceding vascular disease. Integrating incident HF into cardiovascular disease risk prediction and prevention strategies should be considered. Targeted HF prevention strategies may be beneficial at the population level and need further study. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38228224591&p=1pl&v=1&x=VEvBLGqbB4NvvfbrYC9-sA |
10.1126/science.aap7778 | Medicine_easy_312 | In a fourth cave, the scientists also found another pile of evidence pointing to Neanderthals: painted shells, some with a single hole drilled through them, perhaps to accommodate a string. | The implication is, therefore, that the artists were Neandertals. | And clearly, some of the paintings required hearty determination. In a fourth cave, the scientists also found another pile of evidence pointing to Neanderthals: painted shells, some with a single hole drilled through them, perhaps to accommodate a string. "I think we should accept them as part of us. | In this age range, Iberia was exclusively populated by Neandertals, as indicated by numerous diagnostic osteological remains, including articulated skeletons (28, 29) . The implication is, therefore, that the artists were Neandertals. This is a 1 cm 5 cm restricted and nonfigurative set of subjects and could represent the extension of Neandertal body art to the external world. | [1] | Medicine | train | 1 | news | http://feedproxy.google.com/~r/GPBNewsFeed/~3/RRsCDiK7bt8/cave-art-may-have-been-handiwork-neanderthals |
10.1080/10635150701775111 | Medicine_easy_314 | "Perhaps such fluctuations are not given the attention this paper suggests they ought to give." | They argue that two populations separated by a region outside the climatic niche envelope of the two populations makes current gene flow unlikely and thus supports both populations being considered separate species. | Ilya Maclean, lecturer in natural environment at the University of Exeter, thinks this study can help people understand which species are most at risk. "Perhaps such fluctuations are not given the attention this paper suggests they ought to give." "The passenger pigeon's tale is an interesting one as it points to the catastrophic things that happen when multiple stressors combine." | Beyond the obvious merits of species discovery (especially for conservation management), this ultimately will also result in phylogenetic and biogeographic analyses that benefit from greater taxonomic sampling, and that are spatially more informative. They argue that two populations separated by a region outside the climatic niche envelope of the two populations makes current gene flow unlikely and thus supports both populations being considered separate species. In cases of divergent ecological niches and a pair of valid 910 SYSTEMATIC BIOLOGY VOL. | [1] | Medicine | train | 1 | news | http://arstechnica.com/science/2014/06/humans-not-entirely-at-fault-for-passenger-pigeon-extinction/ |
10.1038/s41591-018-0091-x | Medicine_easy_315 | advertisement
The results, published in the journal Nature Medicine, revealed cancer cells are much more reliant on Yin Yang1 than normal cells, and that it may drive breast cancer growth. | Interestingly, LTED cells have an expanded repertoire of ERα binding compared to MCF7, fuelled by endogenous ligands 10 . | Crucially, the findings also reveal how tumours can change their 'appearance' to evade cancer treatments, using a system called epigenetics. advertisement
The results, published in the journal Nature Medicine, revealed cancer cells are much more reliant on Yin Yang1 than normal cells, and that it may drive breast cancer growth. The findings also revealed tumours change which genes they switch on as they become aggressive -- which may affect how they respond to treatment. | YY1positive cells appear to dominate both primary and metastatic lesions in luminal patients, suggesting that this might remain important even after ET ( Fig. Interestingly, LTED cells have an expanded repertoire of ERα binding compared to MCF7, fuelled by endogenous ligands 10 . Nonetheless, YY1 and ERα overlap remains restricted to a minority of sites ( Supplementary Fig. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34627030168&p=1pl&v=1&x=hF9k2ZTU-XUiToM72b9JHA |
10.1073/pnas.1403984111 | Medicine_easy_316 | John Calvelli, also with the group, said that such occasions help spur legislation to cut down on trade in the material. | Intriguingly, our analysis suggests the rate of killing slowed after the peak in 2011 both locally in Samburu and globally, although it still remained unsustainable. | But various experts at the event said that wasn't the case. John Calvelli, also with the group, said that such occasions help spur legislation to cut down on trade in the material. The event helps show that these dead animal parts have no value, he added. | Although the reliability of any single site estimate by the modeling approach is uncertain, efforts to refine the model to improve accuracy will undoubtedly enhance its utility. Intriguingly, our analysis suggests the rate of killing slowed after the peak in 2011 both locally in Samburu and globally, although it still remained unsustainable. It is critical to identify the drivers of this change in the rate of illegal killing. | [1] | Medicine | train | 1 | news | http://www.newsweek.com/us-government-crushed-1-ton-ivory-times-square-345137 |
10.1016/j.cmet.2015.02.003 | Medicine_easy_317 | The natural infection-fighting function of salt accumulation may be largely unnecessary, given the widespread use of antibiotics. | We found that Na + accumulated at the site of bacterial skin infections in humans and in mice. | "This mostly happens totally independent of the diet." The natural infection-fighting function of salt accumulation may be largely unnecessary, given the widespread use of antibiotics. The results may also help explain why elderly patients show high concentrations of salt, as salt stores may grow as the aging body deals with more and more instances of inflammation, in response to the maladies of old age like heart disease and cancer. | High-salt diet promotes skin Na + accumulation, which boosts macrophage activation and helps resolve bacterial infection. We found that Na + accumulated at the site of bacterial skin infections in humans and in mice. Activation of macrophages in the presence of high NaCl concentrations modified epigenetic markers and enhanced p38 mitogen-activated protein kinase (p38/MAPK)-dependent nuclear factor of activated T cells 5 (NFAT5) activation. | [1] | Medicine | train | 1 | news | http://www.upi.com/Science_News/2015/03/03/Scientists-say-salt-may-guard-against-infection/4511425414509/ |
10.1073/pnas.1214971109 | Medicine_easy_318 | To explore this new area, the researcher must expand from the micro- to the nanometric level. | At intermediate densities more compact porous structures are observed, whereas a homogeneous glass emerges when the solute occupies more than 50% of the volume . | "We could apply these methods to a wealth of materials other than gels, foams or inks," says Giuseppe Foffi. To explore this new area, the researcher must expand from the micro- to the nanometric level. He also wants to explore "trigels" and other "polygels." | At low densities, irreversible aggregation leads to fractal gels. At intermediate densities more compact porous structures are observed, whereas a homogeneous glass emerges when the solute occupies more than 50% of the volume . After the quench, the system is thermodynamically unstable and strong density fluctuations set in, favoring the separation of the fluid into two coexisting phases. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2012/11/121105161212.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28ScienceDaily%3A+Latest+Science+News%29 |
10.1038/srep01456 | Medicine_easy_319 | Figuring out the resistance time line, Adelman added, could provide insights about how fast evolution is working in bedbugs and could have implications for the future of bedbug control. | One or both kdr mutations are present in 18 populations tested (Fig. | An intriguing question raised by the new findings, researchers say, is just when did bedbugs evolve their resistance? Figuring out the resistance time line, Adelman added, could provide insights about how fast evolution is working in bedbugs and could have implications for the future of bedbug control. A New Prescription
Changlu Wang, an entomologist at Rutgers University in New Jersey, said the new findings are already providing valuable clues about how to better handle bedbugs. | An Abc transporter associated mechanism was also detected in all the populations except LEX-5. One or both kdr mutations are present in 18 populations tested (Fig. Out of the marker genes studied, ClCE21331 showed the maximum increase (.50 fold) of gene expression in most field populations (76.2%). | [1] | Medicine | train | 1 | news | http://news.nationalgeographic.com/news/2013/13/130314-bedbug-insecticide-resistance-pest-science/ |
10.1038/nn.3635 | Medicine_easy_320 | "This method gives you a visualization of 'when' and 'where' at the same time. | At the subordinate level, we found that visual representations distinguished bodies by species with an onset at 75 ms (64-113 ms) and a peak at 170 ms (104-252 ms), and the MDS showed a clear species-specific clustering of bodies ( Fig. | "This method gives you a visualization of 'when' and 'where' at the same time. However, it works too slowly to keep up with the brain's millisecond-by-millisecond dynamics. It's just pure automatic machinery that starts every time you open your eyes, and it's incredibly fast," Cichy says. | 2c ) showed a division between faces and bodies, dominated by nonhuman bodies versus the other conditions. At the subordinate level, we found that visual representations distinguished bodies by species with an onset at 75 ms (64-113 ms) and a peak at 170 ms (104-252 ms), and the MDS showed a clear species-specific clustering of bodies ( Fig. We also observed a significant difference in decoding accuracy for human versus nonhuman faces starting at 70 ms (54-74 ms), followed by two prominent peaks at 127 ms (122-133 ms) and 190 ms (175-207 ms, calculated on the time window starting at the trough between the two peaks at 156 ms and 1,200 ms) ( Fig. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2014/01/140127141758.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28Latest+Science+News+--+ScienceDaily%29 |
10.1038/s41467-018-04627-5 | Medicine_easy_321 | For example, the measurements might be picking up on increases in the number or size of certain types of cells that help nourish and maintain the white matter, or on added insulation for existing neural connections, Huber said. | In other words, skilled readers benefited slightly from repeated practice with the timed reading tests, while poor readers did not show any improvements with practice and only showed an improvement in performance as a result of the intervention program. | Just what kind of tissue was created among reading program participants is likely to be the subject of future study, the authors said. For example, the measurements might be picking up on increases in the number or size of certain types of cells that help nourish and maintain the white matter, or on added insulation for existing neural connections, Huber said. But the structure of this experiment underscores the importance of the findings, he added: Children participated in a tightly controlled, short-term educational intervention, with measurable, identifiable growth in brain tissue from start to finish. | Indeed, in a reading-skill-matched subset of the control subjects (n = 9), we detected no change in reading scores over time and significant group-by-time interactions for all of the reading-related measures. In other words, skilled readers benefited slightly from repeated practice with the timed reading tests, while poor readers did not show any improvements with practice and only showed an improvement in performance as a result of the intervention program. In the left AF, we found a significant main effect of group (F(1,125) = 7.047, p = 0.009) but not of time (F(1,125) = 1.033, p = 0.31) and a significant groupby-time interaction (F(1,125) = 4.97, p = 0.028), consistent with a decrease in MD over time that was specific to the intervention subjects. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34316135354&p=1pl&v=1&x=D1Z-S3HDnAF3EPGxC7uLSg |
10.1016/j.mito.2018.08.001 | Medicine_easy_323 | "New treatments might only be given for a short period of time to promote healing, not unlike applying a cast to promote the healing of a broken leg. | This initiates the oxidative shielding response needed for damage control and containment . | Naviaux suggests science may be on the cusp of writing a second book of medicine, one that focuses on the prevention of chronic illness and new treatments for chronic disease that can help some people recover completely, where old approaches produced only small improvements with symptoms that persisted for life. "New treatments might only be given for a short period of time to promote healing, not unlike applying a cast to promote the healing of a broken leg. When the cast is removed, the limb is weak, but over time, muscles recover and bone that was once broken may actually be stronger." | Within minutes, the normal anti-inflammatory M2 form of mitochondria that is specialized to meet the metabolic needs of the differentiated cell, is polarized toward pro-inflammatory, M1 mitochondria (Fig. This initiates the oxidative shielding response needed for damage control and containment . With M1 polarization, energy-coupled mitochondrial oxygen consumption drops, and cellular energy production switches to glycolysis and lactate production. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37052707703&p=1pl&v=1&x=sh4bblHfq4G8CThdM37YaA |
10.1111/j.1471-0528.2008.01772.x | Medicine_easy_324 | [18]
How to prevent ovarian cancer
"The most important thing to prevent ovarian cancer is an awareness of your body and family history," Dr. Wethington says. | Examination of the variable of abdominal distension and bloating revealed that 38 of the women diagnosed with cancer experienced distension (sensitivity of 86.4%, 95% CI 72.6-94.8%) compared with 38 (47.5%) of those without cancer (specificity of 52.5%, 95% CI 41.0-63.8%). | And if a woman has both ovaries removed and has not undergone menopause, the surgery will cause her to experience premature menopause. [18]
How to prevent ovarian cancer
"The most important thing to prevent ovarian cancer is an awareness of your body and family history," Dr. Wethington says. Even if you stop taking them, you still have some benefit from the years you did take them, Dr. Wethington adds. | Intramenstrual bleeding was more prevalent among the noncancer group. Examination of the variable of abdominal distension and bloating revealed that 38 of the women diagnosed with cancer experienced distension (sensitivity of 86.4%, 95% CI 72.6-94.8%) compared with 38 (47.5%) of those without cancer (specificity of 52.5%, 95% CI 41.0-63.8%). In contrast, only two women with cancer experienced abdominal bloating (without distension) (sensitivity of 4.5%, 95% CI 0.6-15.5%) compared with 22 (27.5%) women without cancer (specificity of 72.5%, 95% CI 61.4-81.9%). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39307773432&p=1pl&v=1&x=bXk43UkJ_BFT3HKaYb2PQA |
10.1038/s41598-017-18618-x | Medicine_easy_325 | Acetic acid influences BRL-3A cell lipid metabolism via AMPK signaling pathway. | The minimum dilution of ACV required for growth inhibition varied for each microbial species. | This study gives good advice about how to stay vigilant over false claims. And that is how I was exposed to the potential of false claims. Acetic acid influences BRL-3A cell lipid metabolism via AMPK signaling pathway. | The minimum dilution of ACV required for growth inhibition varied for each microbial species. For C. albicans, a 1/2 ACV had the strongest effect, S. aureus, a 1/25 dilution ACV was required, whereas for E-coli cultures, a 1/50 ACV dilution was required (p < 0.05). Monocyte co-culture with microbes alongside ACV resulted in dose dependent downregulation of inflammatory cytokines (TNFα, IL-6). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39098464353&p=1pl&v=1&x=1oF0R8OHMp2RCFFanDJNtw |
10.1016/j.mito.2018.08.001 | Medicine_easy_326 | When the abnormal ATP signaling was silenced, the treated boys in the trial displayed dramatically improved communication and social behaviors. | This switch in bioenergetics is protective to cells when capillaries have been disrupted and the availability of oxygen for aerobic metabolism is compromised. | A concussion sustained before an earlier concussion has completely resolved typically results in more severe symptoms and prolonged recovery, even if the second impact is less than the first. When the abnormal ATP signaling was silenced, the treated boys in the trial displayed dramatically improved communication and social behaviors. But the benefits were transient, fading and disappearing as the drug exited their systems. | With M1 polarization, energy-coupled mitochondrial oxygen consumption drops, and cellular energy production switches to glycolysis and lactate production. This switch in bioenergetics is protective to cells when capillaries have been disrupted and the availability of oxygen for aerobic metabolism is compromised. This treatment causes cells to enter CDR1, decreasing mitochondrial oxidative phosphorylation and increasing glycolysis. | [1] | Medicine | train | 1 | news | http://feedproxy.google.com/~r/TechnologyOrg/~3/ypj94azpXWE/ |
10.14814/phy2.13617 | Medicine_easy_327 | "The effects of light at night exposure can definitely go beyond sleep," Akacem said. | For one child, we replaced actigraphic measures with sleep diary data due to noncompliance with wearing the actigraph. | For preschoolers, this may not only lead to trouble falling asleep one night, but to chronic problems feeling sleepy at bedtime. "The effects of light at night exposure can definitely go beyond sleep," Akacem said. The study sample size was small and it used only one intensity of light, 1,000 lux, which is far greater than the intensity of a typical handheld electronic device, she notes. | Of these, 11 children were enrolled and 10 completed the study. For one child, we replaced actigraphic measures with sleep diary data due to noncompliance with wearing the actigraph. The intra and interassay coefficients of variation were 4.1% and 6.6%, respectively. | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/preschoolers-exposed-to-nighttime-light-lack-melatonin/ |
10.1038/ncomms5060 | Medicine_easy_328 | (Image: Forschungszentrum Julich) (click on image to enlarge)
In our cells, which contain biopolymer filaments, active flow due to molecular motor proteins can be observed. | The other protein bands between 50-150 kDa were degradation products of TbIAD5-1. | This finding may explain how other biological as well as man-made filaments flow, which could aid, among other things, the search for renewable alternatives to replace oil-based polymers. (Image: Forschungszentrum Julich) (click on image to enlarge)
In our cells, which contain biopolymer filaments, active flow due to molecular motor proteins can be observed. The viscosity of solutions of semiflexible polymers decreases dramatically at high shear rates a measure of the velocity gradient or the speed differences within a fluid. | 3B) , and LC-MS/MS showed that this band represented Tb927.7.920, which encodes a putative inner-arm dynein with a predicted molecular mass of 465 kDa and is one of the two IAD5-family dyneins that share an overall sequence identify of 33.2% . The other protein bands between 50-150 kDa were degradation products of TbIAD5-1. Immunoprecipitation of TbCentrin3::PTP was capable of pulling down TbIAD5-1::3HA from the cell lysate prepared by sonication (Fig. | [1] | Medicine | train | 1 | news | http://www.nanowerk.com/nanotechnology-news/newsid=37681.php |
10.1073/pnas.1511220112 | Medicine_easy_329 | They found that modern human shoulders most similarly resemble the orangutans' lateral orientation and the African apes' blade shape. | Later postnatal growth has a relatively limited and similar effect on blade shape across lineages whereas spine angle does not change with age . | Primitive in some ways, derived in other ways, and different from all of them," Young explained in the release. They found that modern human shoulders most similarly resemble the orangutans' lateral orientation and the African apes' blade shape. While the A. afarensis shoulder was most similar to the African ape and the A. sediba shoulder was closer to humans', this positioning confirms that Australopithecus species were able to use sophisticated tools. | Both models posit a series of changes to both the position of the spine and the shape of the blade in multiple lineages. Later postnatal growth has a relatively limited and similar effect on blade shape across lineages whereas spine angle does not change with age . These facts suggest that genetic regulation of the early positioning of muscles, spine, and acromion are critical to establishing species differences rather than later growth or functional remodeling. | [1] | Medicine | train | 1 | news | http://www.natureworldnews.com/articles/16572/20150909/ape-human-evolution-more-clues-revealed-shoulders.htm |
10.1080/10635150701775111 | Medicine_easy_330 | It is nature's fault, too
Zink and his colleagues thought natural fluctuation may have played a role in the bird's extinction. | However, the inclusion of many more species is needed to explore the full biogeographic history of this group, especially concerning continental speciation within Madagascar itself. | Their excrement was toxic to plants, and when a flock roosted on trees, they could break all the branches through the sheer numbers perching." It is nature's fault, too
Zink and his colleagues thought natural fluctuation may have played a role in the bird's extinction. They knew that such fluctuations could dramatically reduce population size, and perhaps human exploitation through hunting and trade may have tipped the balance at the wrong time for this species, which could never recover. | Our preliminary analysis based on 12S mtDNA (not shown) finds the Zanzibar specimen falling in a clade with P. ravenala and the other Comoros specimens forming a polytomy with P. dubia from Northwest Madagascar. However, the inclusion of many more species is needed to explore the full biogeographic history of this group, especially concerning continental speciation within Madagascar itself. Nevertheless, based on the findings of this study, we anticipate that this new application of ecological niche modeling will greatly facilitate species delimitation, and thus also aid the recognition of both additional species diversity and more recent speciation events. | [1] | Medicine | train | 1 | news | http://arstechnica.com/science/2014/06/humans-not-entirely-at-fault-for-passenger-pigeon-extinction/ |
10.1534/genetics.116.197285 | Medicine_easy_331 | But organisms use both NHEJ and homology-directed repair. | 2 ), consistent with general results for the probability of adaptation from SGV after an environmental shift [17] . | It's like the perfect template for repairing your 2007 Honda Civic. But organisms use both NHEJ and homology-directed repair. For a CRISPR/Cas9 gene drive to be most effective, it must be "tuned" toward homology-directed repair. | Generally, as long as resistance alleles do not carry large costs themselves and provide any fitness advantage over the driver, evolution of resistance from the SGV is practically assured whenever θ > 0.1, whereas it remains unlikely for θ << 0.1 (Fig. 2 ), consistent with general results for the probability of adaptation from SGV after an environmental shift [17] . The likelihood that resistance evolves from de novo mutation also depends strongly on θ, with resistance becoming likely once θ > 1. | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/research-shows-nature-can-beat-back-scientific-tinkering-with-genes-of-entire-species/ |
10.1073/pnas.1403984111 | Medicine_easy_332 | In this way, he showed that almost all the ivory that's been seized in the last decade has come from just two poaching hotspots--one that includes Gabon and the Congo, and another centered in Tanzania. | More broadly, results from application to continental data indicated illegal killing levels were unsustainable for the species between 2010 and 2012, peaking to ∼8% in 2011 which extrapolates to ∼40,000 elephants illegally killed and a probable species reduction of ∼3% that year. | In this way, he showed that almost all the ivory that's been seized in the last decade has come from just two poaching hotspots--one that includes Gabon and the Congo, and another centered in Tanzania. So, rather than targeting poachers, he says, it's far more efficient to go after their customers. It's likely that these same cartels are funding poachers in the first place. | At the intensively monitored site, illegal killing increased markedly after 2008 and was correlated strongly with the local black market ivory price and increased seizures of ivory destined for China. More broadly, results from application to continental data indicated illegal killing levels were unsustainable for the species between 2010 and 2012, peaking to ∼8% in 2011 which extrapolates to ∼40,000 elephants illegally killed and a probable species reduction of ∼3% that year. Preliminary data from 2013 indicate overharvesting continued. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37151262070&p=1pl&v=1&x=2kcAbHXpIqOOjL4ptCVntA |
10.1001/jamaoncol.2018.3701 | Medicine_easy_333 | SelectMDx-positive men, who are more likely to benefit from treatment, were five times more likely to receive a biopsy than SelectMDx-negative men. | 24 That study found annual expenditures for patients aged 66 to 99 years related to screening to be $447 million in 2009 US dollars, but this did not include costs of treatment and subsequent follow-up, which we found to represent the majority of spending related to prostate cancer detection. | SelectMDx was shown to have a significant impact on initial prostate biopsy decision-making. SelectMDx-positive men, who are more likely to benefit from treatment, were five times more likely to receive a biopsy than SelectMDx-negative men. In the subset of patients biopsied within three months of receiving test results, high-grade cancers were discovered only in the SelectMDx-positive men, with none of the SelectMDx-negative patients biopsied within three months of testing being diagnosed with a clinically-significant disease. | In contrast, the microcosting approach of the present study did not require a comparison sample of noncancer patients and additionally enabled detailed calculations of costs attributable to different categories of care. 24 That study found annual expenditures for patients aged 66 to 99 years related to screening to be $447 million in 2009 US dollars, but this did not include costs of treatment and subsequent follow-up, which we found to represent the majority of spending related to prostate cancer detection. Overall, our findings were consistent with this prior study. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37616037423&p=1pl&v=1&x=gXp7O7pmGkPY1w04wbVK7A |
10.1038/s41467-018-07557-4 | Medicine_easy_334 | The research is the first to explicitly show the amount of fundamental infrastructure across the Northern Hemisphere that is at risk of structural failure from permafrost thaw caused by climate change. | 1 ), the regional differences appear less pronounced ( Fig. | "And here, in Alaska, we are dealing already and will be dealing even more in the near future with this reality." The research is the first to explicitly show the amount of fundamental infrastructure across the Northern Hemisphere that is at risk of structural failure from permafrost thaw caused by climate change. "The results show that most fundamental Arctic infrastructure will be at risk, even if the Paris Agreement target is achieved," the authors write. | However, acknowledging a broader spectrum of factors known to contribute to the hazard level ( Supplementary Fig. 1 ), the regional differences appear less pronounced ( Fig. For example, our results highlight critical areas such as the Pechora region, the northwestern parts of the Ural Mountains, northwest and central Siberia, the Yakutsk basin (except for the city of Yakutsk in low to moderate hazard area), as well as the central and western parts of Alaska to which high priority for local scale infrastructure hazard assessments should be performed in future decades 1 . | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37952353365&p=1pl&v=1&x=z8k6aIsKNtvV0TWFOzO7Gg |
10.1016/j.cub.2013.09.038 | Medicine_easy_335 | It gave us unique insights into the potentially key role disassembling cilia have in deciding the tails' length. | Similar to previous results with wild-type cells , we consistently observed that in adf1-6 cells, the remaining flagellum resorbed during the initial phase of regrowth of the shed flagellum ( Figure 2E ). | They were unlike anything anyone had ever seen before. It gave us unique insights into the potentially key role disassembling cilia have in deciding the tails' length. Further investigation will help us understand how ciliary malfunction causes a progression of diseases." | This phenomenon is most apparent in a ''long-zero'' experiment: when one flagellum is amputated and the other is full length, the long flagellum resorbs as the zero-length flagellum regenerates, and once they are equal in length, they continue to regenerate together until both flagella are full length again . Similar to previous results with wild-type cells , we consistently observed that in adf1-6 cells, the remaining flagellum resorbed during the initial phase of regrowth of the shed flagellum ( Figure 2E ). We did not observe any abnormal behavior such as overshoot (data not shown). | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2013/10/131031124920.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28ScienceDaily%3A+Latest+Science+News%29 |
10.1126/science.aap7778 | Medicine_easy_337 | This analyses the natural decay of uranium in minerals that build up over cave paintings, providing surprisingly specific results. | For subsamples in all locations, the expected depth-age consistency was confirmed. | The issue was technology. This analyses the natural decay of uranium in minerals that build up over cave paintings, providing surprisingly specific results. Rather than providing answers within a millenium-sized ballpark, for example, uranium-thorium dating can pin materials to specific centuries. | In Maltravieso ( fig. For subsamples in all locations, the expected depth-age consistency was confirmed. The oldest date provides a minimum age of 66.7 ka (MAL 13) (Table 1 ) for the hand stencil. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=33376300846&p=1pl&v=1&x=Ak0UjVbeV1ss5tQU-rQsig |
10.1016/j.neuron.2017.06.028 | Medicine_easy_338 | These novel findings show that Brevican is dynamically regulated by experiences coming from the environment and is fundamentally required for spatial working memory and short-term memories. | Specifically, these properties seem to depend on BCAN expression in PV+ interneurons, as the PV+ cell-specific knockdown revealed a particularly strong and broad phenotype when compared to the full Bcan knockout that might be explained by the different timing of the experimental manipulations. | The researchers also found that this protein shapes the intrinsic properties of PV+ interneurons and sculpts their connections to other neurons. These novel findings show that Brevican is dynamically regulated by experiences coming from the environment and is fundamentally required for spatial working memory and short-term memories. When we identified some of the mechanisms underlying this regulation, I was amazed by how a single protein can act as an activity sensor, orchestrate such a complex molecular program and simultaneously influence several key cellular processes', said Dr Emilia Favuzzi, first author of the study from the Centre for Developmental Neurobiology (CDN) at King's College London. | Indeed, the changes in spike shape and Kv3.1b clustering appear more directly related with the absence of BCAN. Specifically, these properties seem to depend on BCAN expression in PV+ interneurons, as the PV+ cell-specific knockdown revealed a particularly strong and broad phenotype when compared to the full Bcan knockout that might be explained by the different timing of the experimental manipulations. Likewise, the first PNNs are observed around P7 and their maturation continues until P28 . | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/how-neurons-sense-our-everyday-life/ |
10.1016/j.neuron.2017.06.028 | Medicine_easy_339 | As such, unravelling key molecular players in this form of plasticity may pave the way for new treatments. | GluA1 mutants also exhibit impaired short-term spatial memory . | The findings are published in the journal Neuron and have the potential to reveal new therapeutic strategies for neurological and psychiatric disorders. As such, unravelling key molecular players in this form of plasticity may pave the way for new treatments. The researchers also found that this protein shapes the intrinsic properties of PV+ interneurons and sculpts their connections to other neurons. | We assessed spatial working memory on the T-maze and found a moderate impairment in Bcan mutant mice ( Figures 8A and 8B ) that resembles the phenotype of mice lacking GluA1 in PV+ cells . GluA1 mutants also exhibit impaired short-term spatial memory . As expected, control mice showed a strong preference for the novel arm ( Figures 8E-8H ). | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/how-neurons-sense-our-everyday-life/ |
10.1016/j.cell.2018.04.038 | Medicine_easy_340 | Knowing that may lead to the development of new drugs that target specific parts of the enzyme." | In total, 20,400 movies of the DNA-bound telomerase sample and 12,344 movies of the DNA-free telomerase sample were acquired for the structures presented in this paper. | "At each step, we zoom in closer and see more and more details, and can now begin to deduce not just what the enzyme looks like, but also how it functions. Knowing that may lead to the development of new drugs that target specific parts of the enzyme." In addition to reporting the highest level of detail ever seen of the structure of telomerase's catalytic core, shown in the animation below, the researchers report for the first time they have captured telomerase in the process of making DNA. | Because the human TERT-TER catalytic core and IFD-TRAP-TEN-TPP1-POT1 interactions are expected to be similar to corresponding interactions in Tetrahymena , this first complete model of a telomerase with bound DNA and sstDNA-handling proteins also provides unprecedented insight into human telomerase mechanism, mutations that affect function, and recruitment to telomeres and a framework for design of telomerase targeting therapeutics. In total, 20,400 movies of the DNA-bound telomerase sample and 12,344 movies of the DNA-free telomerase sample were acquired for the structures presented in this paper. Notably, as discussed below, most of the particles were considered as ''bad'' particles during 2D and 3D classifications and therefore discarded. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34239565585&p=1pl&v=1&x=dKdwlCB2iE4axi2krXvE_w |
10.1016/j.ijheh.2018.01.004 | Medicine_easy_341 | O Actively engage with local communities, healthcare users, frontline health workers and vulnerable groups to ensure that progress towards better health systems is socially inclusive and responsive to the needs of everyone, leaving no one behind. | authority operating the facility) differed by country. | Drawing on examples of WaterAid's work in healthcare facilities from Cambodia to Nicaragua, Myanmar to Malawi Transforming Health Systems makes a series of recommendations to health ministries in order to address the crisis faced by healthcare facilities globally, including:
O Embed the need for water, sanitation and hygiene in healthcare facilities as a core priority for investment across all relevant health efforts, including maternal and newborn health, tackling antimicrobial resistance, health emergency preparedness, infection prevention and control, sexual and reproductive health and rights, quality of care and plans for achieving Universal Health Coverage. O Actively engage with local communities, healthcare users, frontline health workers and vulnerable groups to ensure that progress towards better health systems is socially inclusive and responsive to the needs of everyone, leaving no one behind. O Put in place national minimum standards for water, sanitation and hygiene in all government and private healthcare settings, and ensure these are adhered to, with improvement plans and the necessary investment put in place where needed. | The relationship was significant in the multivariable models of Haiti, Malawi, Senegal, and Tanzania. authority operating the facility) differed by country. In univariable regression in Bangladesh, Haiti, Malawi, and Nepal, NGO-managed HCFs had significantly higher odds of having a basic water service as compared to governmentmanaged facilities (no NGO facility categorization was used in the Senegal and Tanzania datasets). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34104392589&p=1pl&v=1&x=fUbOLvAgGSdkdG9TgkDIzg |
10.1098/rsos.171474 | Medicine_easy_342 | Mass shooters killed 31 people last weekend in El Paso and Dayton, Ohio, and three people in Gilroy, California, last month, including two children. | Instead, we argue that mere exposure to, and enactment of, putatively violent virtual acts in gaming contexts in aggregate is unlikely, on its own, to bear positively on perceivable differences in adolescents' aggression in real-world settings. | Mass shooters killed 31 people last weekend in El Paso and Dayton, Ohio, and three people in Gilroy, California, last month, including two children. The week was the deadliest for mass shootings and fatalities this year, whichever way one chooses to count them. Based on what their analyses revealed, here are five common misconceptions about the perpetrators of mass shootings:
Myth: Mass shooters have a specific profile that can be easily spotted ahead of time. | These topics provide promising avenues for inquiry and have direct implications for literature focused on antisocial behaviours such as bullying, trolling and griefing . Instead, we argue that mere exposure to, and enactment of, putatively violent virtual acts in gaming contexts in aggregate is unlikely, on its own, to bear positively on perceivable differences in adolescents' aggression in real-world settings. Further, this is not to say that we could rule out a correlation between every operationalization of gaming and every measure of adolescents' violent behaviour. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39882736616&p=1pl&v=1&x=QLA1HMQhScCizGL1drmq5A |
10.1001/jamapsychiatry.2015.0500 | Medicine_easy_343 | "Guidelines and clinical wisdom suggest that you really should be using a high degree of caution and only using them when other treatments have failed, as a last resort." | 41 In our study, among adolescents treated with antipsychotics who had diagnosed psychiatric disorders, the most common diagnoses were ADHD (34.9%), followed by depression (24.4%) and bipolar disorder (20.5%). | "Guidelines and clinical wisdom suggest that you really should be using a high degree of caution and only using them when other treatments have failed, as a last resort." Teens were most likely to be prescribed antipsychotics, with 1.19 percent getting the drugs in 2010, compared to 0.11 percent in younger children. Boys were more likely to be given the medications. | Stimulant prescriptions and ADHD diagnoses peaked among older children, while antidepressant prescriptions and depression diagnoses increased during adolescence. 41 In our study, among adolescents treated with antipsychotics who had diagnosed psychiatric disorders, the most common diagnoses were ADHD (34.9%), followed by depression (24.4%) and bipolar disorder (20.5%). In the community, the prevalence of adolescents with severe impairment is 8.7% for depression, 4.3% for ADHD, and 2.6% for bipolar disorder. | [1] | Medicine | train | 1 | news | http://www.npr.org/sections/health-shots/2015/07/01/418935734/antipsychotics-too-often-prescribed-for-aggression-in-children |
10.1136/bmjopen-2014-006648 | Medicine_easy_344 | But the social care costs of dementia outweighed the social care costs of the other three conditions combined. | A total of 15 773 charities were identified through the Charity Commission as potentially funding medical research. | The costs of healthcare were highest for cancer (PS4.4 billion) and lowest for dementia at PS1.4 billion and for stroke at PS1.8 billion. But the social care costs of dementia outweighed the social care costs of the other three conditions combined. And the combined costs of health and social care for dementia came to PS11.6 billion in 2012, the researchers calculated. | Of these charities, 51 (42%) were included in the analysis. A total of 15 773 charities were identified through the Charity Commission as potentially funding medical research. Owing to the very high number of charities identified, we only included the first 214 representing 75% of the total combined income. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2015/04/150413213252.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news+%28ScienceDaily%3A+Top+News%29 |
10.1016/j.neuron.2018.12.026 | Medicine_easy_347 | "Changes in the excitation-inhibition ratio might be successfully compensating to maintain a relatively normal firing rate, but a side effect of that compensation may be that they degrade the precision of the coding information," he suggests. | There were no significant differences between any ASD mutant and its WT. | But decreased inhibition may have unwanted secondary effects that impair other aspects of neural information processing, such as the tuning each neuron has to specific stimuli. "Changes in the excitation-inhibition ratio might be successfully compensating to maintain a relatively normal firing rate, but a side effect of that compensation may be that they degrade the precision of the coding information," he suggests. "So even though there are not more spikes, the spiking could encode information less precisely." | In all mutants, this lies within 0.5 mV of the PSP stability contour. There were no significant differences between any ASD mutant and its WT. This common reduction in whisker-evoked spiking of L2/3 FS neurons suggests that feedforward inhibition is reduced in vivo. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38318437455&p=1pl&v=1&x=tFlh-_qIVNCNf8CEol-uvQ |
10.1186/s13059-018-1434-0 | Medicine_easy_348 | Interdisciplinarity and collaboration are the key success factors
This work, which has been published in Genome Biology, shows how interdisciplinary research pushes the boundaries of knowledge and contributes to finding new insights for improving health. | Interestingly, AP-1 is essential for MHC complex I downregulation and immune escape upon HIV infection . | "Our work could be interpreted as a proof of concept; it may shed light upon mechanisms underlying immune evasion and may provide insights for improving cancer therapies in the future by revealing cancer vulnerabilities." Interdisciplinarity and collaboration are the key success factors
This work, which has been published in Genome Biology, shows how interdisciplinary research pushes the boundaries of knowledge and contributes to finding new insights for improving health. This is a new example on how interdisciplinarity may lead to new insights in cancer genomics and provides new tools for cancer research. | AP1B1 (d N / d S = 0.41, Q = 0.039) and AP2S1 (d N /d S = 0.04, Q = 0.01) are members of the clathrin-associated adaptor protein complex 1 (AP-1) and 2 (AP-2), respectively, which are involved in antigen loading onto the MHC class II complex . Interestingly, AP-1 is essential for MHC complex I downregulation and immune escape upon HIV infection . In summary, the presented evidence supports a major role of negative selection in cancer evolution, which has been neglected in most studies, and ultimately challenges the current paradigm of an exclusive role of positive selection in cancer. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34527375501&p=1pl&v=1&x=1CtmjzSbC1y6cGD8LDIXPA |
10.1186/s13229-018-0246-0 | Medicine_easy_349 | In Shenzhen and Jiamusi cities, only data for children in mainstream education was available; in Shenzhen City, 42 out of every 10,000 children in mainstream education had autism, and in Jiamusi City this figure was 19 per 10,000. | It is important for national policy to report data from these first three cities, and our on-going data collection in the seven other cities will serve to further inform national policy and future research directions. | In Jilin City, from a total population of 7,258, the team identified 77 cases of autism, equating to a prevalence of 108 per 10,000, very similar to that found in the West. In Shenzhen and Jiamusi cities, only data for children in mainstream education was available; in Shenzhen City, 42 out of every 10,000 children in mainstream education had autism, and in Jiamusi City this figure was 19 per 10,000. In all three cities, the researchers identified new cases of autism in mainstream schools, confirming that there is under-diagnosis of autism in China. | First, according to the recruitment criteria, the sample for the cities was representative for the local region but is not yet nationally representative of China; hence, the hope for the China SCORE project is to map autism prevalence in 10 cities in total. It is important for national policy to report data from these first three cities, and our on-going data collection in the seven other cities will serve to further inform national policy and future research directions. The participation rate of the communities in this study is much higher than most of the prevalence studies of autism internationally. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=38803711012&p=1pl&v=1&x=__aEa1i_DgRqCsuf6-1kqA |
10.1038/s41467-018-04906-1 | Medicine_easy_350 | According to the research paper, the sensor developed by the team "can be integrated with all transparent forms of tactile pressure sensors and skin temperature sensors, to enable the detection of a finger pressing on the display," and at a resolution that satisfies FBI security standards. | These invisible percolative networks exhibit excellent optoelectronic properties (R s of~1.03 Ω/sq T of 91.04% in the visible light region) and outstanding reliability against mechanical bending. | Getty Images
Forget fingerprint scanners tucked away on the back of your phone or beneath a home button -- your next smartphone is probably going to have a fingerprint sensor under the screen that measures your temperature, just to make sure you're a real human. According to the research paper, the sensor developed by the team "can be integrated with all transparent forms of tactile pressure sensors and skin temperature sensors, to enable the detection of a finger pressing on the display," and at a resolution that satisfies FBI security standards. Don't expect the new sensor to detect a fever through your finger just yet -- the temperature sensor is designed to detect human skin temperature to make sure you're not using a fake hand or artificial fingerprint to spoof security. | As a result, the capacitance change between fingerprint ridges and valleys is very low. These invisible percolative networks exhibit excellent optoelectronic properties (R s of~1.03 Ω/sq T of 91.04% in the visible light region) and outstanding reliability against mechanical bending. In addition, the fingerprint sensor using the AgNF-AgNW hybrid electrode has high resolution (318 capacitors per inch (CPI)) with good transparency (89.05%). | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34461950539&p=1pl&v=1&x=XLGqlDf_Oo7GWj0vCJKGfw |
10.1038/s41467-018-05229-x | Medicine_easy_351 | The short-lived Wannier-Stark localization correlates with drastic changes to the electronic structure of the crystal and results, for example, in extremely high optical nonlinearity. | The situation changes drastically when considering bulk solids, where D is in the order of the lattice constant a ≈5 Å and Δ ≈1 eV, resulting in E WSL ≈20 MV/ cm, which is far above the typical breakdown field of dielectrics under stationary bias. | "If the electric field inside the crystal is strong enough, the electronic states can be localized to a few atoms. The short-lived Wannier-Stark localization correlates with drastic changes to the electronic structure of the crystal and results, for example, in extremely high optical nonlinearity. The first-ever experimental realization of Wannier-Stark localization in a gallium arsenide crystal was made possible through highly intense Terahertz radiation with field intensities of more than ten million volts per centimetre. | Such an electric field is easily sustained by typical semiconductor devices. The situation changes drastically when considering bulk solids, where D is in the order of the lattice constant a ≈5 Å and Δ ≈1 eV, resulting in E WSL ≈20 MV/ cm, which is far above the typical breakdown field of dielectrics under stationary bias. In contrast to superlattices where localization concerns only the envelope wave functions of electrons in the modulated compound structure, such Wannier-Stark quantization in a bulk material would result in strong distortions of the electronic system on the level of a single unit cell, equivalent e.g., to a significant change of interatomic chemical bonds. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34669971079&p=1pl&v=1&x=vdqBVutlRrBG6NrsU9ADLw |
10.1038/s41598-018-30656-7 | Medicine_easy_352 | But the team thinks that the crowsa natural propensity to use tools and their ability to determine which objects can be used as tools certainly help. | In theory, the presence of multiple nest sites could enhance competition between scouts and lead to longer decision times, but this does not occur in our data. | When the scientists made the task more difficult by supplying three or four combinable parts, Mango was the only one that figured it out. But the team thinks that the crowsa natural propensity to use tools and their ability to determine which objects can be used as tools certainly help. In other words, they may play out the potential steps in their brain before settling on a viable solution they can perform. | For example, inhibitory interactions, in which a scout committed to one site diminishes the effectiveness of recruiters to competing sites, could produce the time cost at the heart of choice overload and predicted by the ToW model. In theory, the presence of multiple nest sites could enhance competition between scouts and lead to longer decision times, but this does not occur in our data. The decision latency evidence presented here does not support a role for such inhibitory interactions, but it would be premature to conclude that these ants do not use these pheromones or some other inhibitory signal. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37498408749&p=1pl&v=1&x=JzrzVk7uH3JlDWFg7C-bNg |
10.1016/j.immuni.2019.05.007 | Medicine_easy_353 | A research discovery at UNC-Chapel Hill could help tackle stomach flu. | Pre-existing and emergent antibodies displayed similar somatic hypermutation profiles ( Figure 1E ). | We may be closer than ever to ending those miserable days of vomiting, diarrhea and harsh fever after eating contaminated food or shaking the wrong person's hand. A research discovery at UNC-Chapel Hill could help tackle stomach flu. Local news has never been more important To support vital, local reporting like the coronavirus coverage, please sign up for a digital subscription to charlotteobserver.com #readlocal
Norovirus causes more than 200,000 deaths, mostly young children and elderly, around the world each year, according to the Centers for Disease Control and Prevention. | The low level of emergent antibodies in donor C, who had the highest pre-vaccination titer, is consistent with the strong inverse correlation between day 0 serum titer and the number of emergent antibody clonotypes in the serological memory after immunization with the seasonal influenza vaccine (Lee et al., 2016) . Pre-existing and emergent antibodies displayed similar somatic hypermutation profiles ( Figure 1E ). Although emergent Table S1 . | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39573303215&p=1pl&v=1&x=LZ9cWPbe63hLu_eeKZOP_g |
10.1098/rsos.171474 | Medicine_easy_355 | In its study, the FBI found that most shooters didn't research target locations. | Results did not support this prediction, nor did they support the idea that the relationship between these factors follows a nonlinear parabolic function. | The FBI researched 34 active shootings between 2000 and 2013 and found that in 77% of the cases, the subject spent a week or longer planning the attack. In its study, the FBI found that most shooters didn't research target locations. Often, the shooters were already familiar with their intended target, such as their school or office. | The discussion presents an interpretation of this pattern of effects in terms of both the ongoing scientific and policy debates around violent video games, and emerging standards for robust evidence-based policy concerning young people's technology use. Results did not support this prediction, nor did they support the idea that the relationship between these factors follows a nonlinear parabolic function. There was no evidence for a critical tipping point relating violent game engagement to aggressive behaviour. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39882736616&p=1pl&v=1&x=QLA1HMQhScCizGL1drmq5A |
10.1038/s41598-018-20760-z | Medicine_easy_356 | "The most difficult part of this research was how to control the growth and direction of SDS ribbons with precision," says Hong. | S5 for details) . | Therefore, the molecules adsorbed with small angles to the AFM tip scan direction act as the nuclei and grow to become the SDS ribbon. "The most difficult part of this research was how to control the growth and direction of SDS ribbons with precision," says Hong. "Once the SDS ribbons were grown, their orientations did not change under the AFM scanning conditions. | In general, the AFM tip scanning induces a finite frictional dragging force between the tip and the surface molecules because of microscopic shear flow or because of direct contact between the tip and the molecules . S5 for details) . The destabilization energy shows a quadratic dependence on both of the translational shifts, which means that the SDS molecules are stable against a small translational shift both along and perpendicular to the zigzag direction. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=33624582612&p=1pl&v=1&x=OROGVuUGDgkWIep8DYDL5w |
10.1073/pnas.1601081113 | Medicine_easy_357 | "Perhaps these giant animals were already teetering on the edge of extinction, and humans were just the straw that broke the camel's back," Yoder said. | These fragments thus might be described as "museums" of genetic diversity within an otherwise desolated grassland savanna. | This intermittent forest corridor made it possible for tree-dwelling mouse lemurs and other forest animals to intermingle and move from one side of the island to the other until about 55,000 years ago, when a hot dry period caused their forest habitat to retreat once again. The research could help shed light on why extinct animals like the 350-pound giant lemurs and the 10-foot-tall elephant birds all died out within a thousand years of human arrival. "Perhaps these giant animals were already teetering on the edge of extinction, and humans were just the straw that broke the camel's back," Yoder said. | Taking this hypothesis to its logical extreme, patterns of genetic diversity within and among these relictual habitats thus might share a signature of genetic diversification driven by long-term isolation but punctuated by periods of gene flow. These fragments thus might be described as "museums" of genetic diversity within an otherwise desolated grassland savanna. There were 1,583 SNPs without any missing data across the four taxa (M. lehilahytsara, M. rufus, M. myoxinus, and M. mittermeieri). | [1] | Medicine | train | 1 | news | http://feedproxy.google.com/~r/TechnologyOrg/~3/41GB1vb0sOU/ |
10.1098/rsos.171474 | Medicine_easy_360 | In one incident in November, a youngster reportedly killed his friend with a shotgun in Erbil province while recreating a PUBG scene. | Preregistered sensitivity and exploratory analyses demonstrated this finding was consistent across three different operationalizations of violent game content and two ways of measuring key adolescent behaviours relating to aggressive and prosocial behaviours. | The draft is currently awaiting revision by parliament's speaker. In one incident in November, a youngster reportedly killed his friend with a shotgun in Erbil province while recreating a PUBG scene. However, youths see it as a way to stay safe from the violence outside. | Results from these confirmatory analyses provided evidence that adolescents' recent violent video game play is not a statistically or practically significant correlate of their aggressive behaviour as judged by carers. Preregistered sensitivity and exploratory analyses demonstrated this finding was consistent across three different operationalizations of violent game content and two ways of measuring key adolescent behaviours relating to aggressive and prosocial behaviours. In other words, we found adolescents were not more or less likely to engage in aggressive or prosocial behaviours as a function of the amount of time they devoted to playing violent games. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39008420426&p=1pl&v=1&x=Y9M61MqnjfzY0SC9noiwvw |
10.1016/j.cub.2013.09.038 | Medicine_easy_361 | They were unlike anything anyone had ever seen before. | Using this antibody in western blots, CNK2 protein was not detectable in whole-cell extracts of wild-type cells (data not shown), but a band of 72 kDa, the predicted size of CNK2, was detectable in flagellar extracts. | "We knew that we had something important when we saw that cells bearing mutations in both CNK2 and LF4 had the most extraordinarily long cilia. They were unlike anything anyone had ever seen before. It gave us unique insights into the potentially key role disassembling cilia have in deciding the tails' length. | Sequencing of this PCR product revealed that the 5 0 end of the insertion also lies within the first CNK2 intron in the 5 0 UTR ( Figure 1A ). Using this antibody in western blots, CNK2 protein was not detectable in whole-cell extracts of wild-type cells (data not shown), but a band of 72 kDa, the predicted size of CNK2, was detectable in flagellar extracts. This band was not present in cnk2-1 flagellar extracts, and we concluded that the antibody is specifically recognizing CNK2 and that cnk2-1 is null for protein expression ( Figure 1B ). | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2013/10/131031124920.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28ScienceDaily%3A+Latest+Science+News%29 |
10.1073/pnas.1411728112 | Medicine_easy_362 | It's possible we will find all the coins landing tails. | However, let us note, that we might borrow a noisy version of |0 0| namely (1 − )|0 0| + |1 1|. | However, this is not true when tossing the coin just a few times. It's possible we will find all the coins landing tails. "We can use tools from quantum information theory to understand the case when we don't have a large number of particles." | and by Theorem 18 we can transform the state ρ S ⊗ |0 0| into arbitrary good version of ρ S ⊗ |0 0|. However, let us note, that we might borrow a noisy version of |0 0| namely (1 − )|0 0| + |1 1|. It costs a finite amount of work to create it from the thermal state. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2015/02/150209161417.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Ftop_news%2Ftop_technology+%28ScienceDaily%3A+Top+Technology+News%29 |
10.1038/s41598-018-29793-w | Medicine_easy_363 | These results suggest that nasal microbiota influences the host response to rhinovirus infection. | Anyhow, few differences between the clusters were detected. | In general, subjects having Staphyloccocus, and Corynebacterium/Alloiococcus types had lower inflammatory responses and Pseudomonadaceae/Mixed type had lower viral load than other types. These results suggest that nasal microbiota influences the host response to rhinovirus infection. Importantly, changes in the response were reflected in cold symptoms and showed that subjects with Corynebacterium/Alloiococcus nasal microbiota type had lower symptom scores than Staphylococcus or Pseudomonadaceae/Mixed types. | Overall the D0 cluster effect on total symptom scores did not reach statistical significance (P = 0.06). Anyhow, few differences between the clusters were detected. WURSS-21 score, including functional and symptom scores, was lower in Cor/All cluster compared to Staph (P = 0.031) and Ps/Mix clusters (P = 0.026) (Fig. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37212363335&p=1pl&v=1&x=sLcdfRtU-o1Jl6n2DiKDzQ |
10.1038/ncomms5060 | Medicine_easy_364 | They found that filaments have an irregular configuration and are intricately entwined with each other while at rest, but that they form hairpin-like structures and detach themselves completely from one another when in flow. | However, these RNAi-induced cells appeared to lose motility in the culture medium as observed under a light microscope. | The viscosity of solutions of semiflexible polymers decreases dramatically at high shear rates a measure of the velocity gradient or the speed differences within a fluid. They found that filaments have an irregular configuration and are intricately entwined with each other while at rest, but that they form hairpin-like structures and detach themselves completely from one another when in flow. The filaments can then freely slide over each other, which causes the dramatic shear-thinning of semiflexible polymer solutions. | Depletion of TbCentrin3 only slightly slowed down cell growth (Fig. However, these RNAi-induced cells appeared to lose motility in the culture medium as observed under a light microscope. Loss of cell motility occurred at as early as day 1 of RNAi induction, and at day 3 of RNAi all cells lost motility. | [1] | Medicine | train | 1 | news | http://www.bio-medicine.org/biology-news-1/Of-bio-hairpins-and-polymer-spaghetti-38373-1/ |
10.1152/ajpregu.00204.2013 | Medicine_easy_365 | Although toxic at high levels, low levels of CO are produced naturally by the body and have positive effects. | Further, exposure to 250 ppm CO led to maternal mouse CO levels of 12.65% COHb, similar to maternal %COHb levels in women who smoke roughly a pack of cigarettes per day during pregnancy; measured in our laboratory as high as 9.85% COHb (unpublished data) and by others as 14% COHb . | The study also suggests a therapy that could offer similar protection against PE with none of smoking's well-known risks. Although toxic at high levels, low levels of CO are produced naturally by the body and have positive effects. This study, the first to look at the effects of CO on the placenta in mice, found that exposing the animals to inhalable CO increased blood flow and vascular growth in the developing placenta, created more, bigger, and stronger connections to the mother's uterus, a process that provides more oxygen and nutrients to the fetus. | Therefore, it is possible that elevated CO levels in women who smoke during pregnancy may contribute to the reduced risk of developing PE. Further, exposure to 250 ppm CO led to maternal mouse CO levels of 12.65% COHb, similar to maternal %COHb levels in women who smoke roughly a pack of cigarettes per day during pregnancy; measured in our laboratory as high as 9.85% COHb (unpublished data) and by others as 14% COHb . We demonstrated that maternal chronic exposure to 250 ppm CO throughout pregnancy increases placental Fig. | [1] | Medicine | train | 1 | news | http://www.sciencedaily.com/releases/2013/09/130919154253.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily+%28ScienceDaily%3A+Latest+Science+News%29 |
10.1038/s41467-018-04355-w | Medicine_easy_367 | In the new study, Pecot and his collaborators found that lung squamous carcinoma could be reclassified into just two different categories based on whether they showed a high presence of inflammatory monocytes. | Intense membranous CD14 staining was predominately found on tumor-infiltrating leukocytes, and rarely on cancer cells ( Supplementary Fig. | "The way that these immune cells promote lung cancer metastases was very unexpected. In the new study, Pecot and his collaborators found that lung squamous carcinoma could be reclassified into just two different categories based on whether they showed a high presence of inflammatory monocytes. "It's important to understand that while there is so much focus on activating parts of the immune system to attack cancer, there is also a 'Jekyll and Hyde' process going on in most tumors," Pecot said. | We found an impressive dynamic range of expression for CD14 and these chemokines by subtype, with the Basal and Secretory subtypes consistently having the highest levels (Fig. Intense membranous CD14 staining was predominately found on tumor-infiltrating leukocytes, and rarely on cancer cells ( Supplementary Fig. Consistent with RNA-seq data, CD14 protein expression correlated with subtype, and the Secretory subtype displayed the highest levels, followed by Basal ( Supplementary Fig. | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/by-forming-clots-in-tumors-immune-cell-aids-lung-cancers-spread/ |
10.1016/j.neuron.2017.06.028 | Medicine_easy_368 | The researchers also found that this protein shapes the intrinsic properties of PV+ interneurons and sculpts their connections to other neurons. | The two-color radial distribution analysis of Brevican with respect to Bassoon ( Figure S1R ) or Homer1 ( Figure S1S ) was done correspondingly, except that in the latter case the mean x,y position of Homer1 localizations was used to establish x,y = 0,0. | As such, unravelling key molecular players in this form of plasticity may pave the way for new treatments. The researchers also found that this protein shapes the intrinsic properties of PV+ interneurons and sculpts their connections to other neurons. These novel findings show that Brevican is dynamically regulated by experiences coming from the environment and is fundamentally required for spatial working memory and short-term memories. | The z stability was better than ± 10 nm over several hours. The two-color radial distribution analysis of Brevican with respect to Bassoon ( Figure S1R ) or Homer1 ( Figure S1S ) was done correspondingly, except that in the latter case the mean x,y position of Homer1 localizations was used to establish x,y = 0,0. The ssDNA primers to generate the shBCAN (5 0 -CTAGGCAAG CAGAACCGCTTCAATGCCTGACCCACATTGAAGCGGTTCTGTTGCTTTTTG-3 0 and 3 0 -AATTCAAAAAGCAAGCAGAACCGCTTCA ATGTGGGTC AGGCATTGAAGCGGTTCTGCTTGC-5 0 ) were obtained using the Block-it RNAi web tool (Thermo Scientific). | [1] | Medicine | train | 1 | news | http://healthmedicinet.com/news/how-neurons-sense-our-everyday-life/ |
10.1038/s41598-018-26198-7 | Medicine_easy_369 | The authors point out that diminished cytotoxic immunity is a mechanism that underpins the state of T-cell exhaustion in cancer, and is linked with lower levels of effector cytokines and the presence of inhibitor receptors on T cells, which permits tolerance to the cancer cells. | Another important consideration is that, in this study, stretching was performed for 10 minutes once a day at ~25% strain, and we do not know whether a lower "dose" of stretching could be equally effective. | Stretching was in addition more specifically found to increase the number of INF-g+ CD4+ T cells within the inflammatory lesion, within just days. The authors point out that diminished cytotoxic immunity is a mechanism that underpins the state of T-cell exhaustion in cancer, and is linked with lower levels of effector cytokines and the presence of inhibitor receptors on T cells, which permits tolerance to the cancer cells. "Because INF-g is one of the key effector cytokines in cytotoxic immune responses, these results support a role for stretching in promoting TH-1 cytotoxic immunity," they note. | Because stretching tissues in one dimension likely results in some amount of perpendicular compression, this question is relevant to our model and will need to be examined. Another important consideration is that, in this study, stretching was performed for 10 minutes once a day at ~25% strain, and we do not know whether a lower "dose" of stretching could be equally effective. Determining the minimum effective amplitude, duration and frequency of stretching in animals will be important before translational studies in humans can be undertaken. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34125675804&p=1pl&v=1&x=EIuTbzUDbEKkr7kvXb-kdg |
10.1038/s41589-018-0155-8 | Medicine_easy_372 | The rise wasn't as great as that seen in the ABHD12-knockout mice, and even four weeks of treatment with the inhibitor appeared to cause only slight hearing defects -- nothing like the profound defects experienced by PHARC patients. | 5 ). | The team found that in adult mice, reducing ABHD12 activity with the inhibitor led to a rise in lyso-PS in immune cells called macrophages, as well as in brain tissue. The rise wasn't as great as that seen in the ABHD12-knockout mice, and even four weeks of treatment with the inhibitor appeared to cause only slight hearing defects -- nothing like the profound defects experienced by PHARC patients. However, in further experiments conducted by the laboratory of study co-senior author John Teijaro, an assistant professor in the Department of Immunology and Microbiology at Scripps Research, it was clear that the reduction in ABHD12 activity had a big effect on the mouse immune system. | 1e and Supplementary Fig. 5 ). In contrast, we prepared an authentic sample of the semithiocarbazide (termed DO127 ) and found that it showed no activity against ABHD12 ( Supplementary Fig. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37814264274&p=1pl&v=1&x=fV_-TrzPs9X1ZtNnkmq4RQ |
10.1038/s41467-019-09863-x | Medicine_easy_374 | In both cases, the primary driver behind the additional costs is the emitted permafrost carbon. | They fall outside the range covered by the SSPW and RCPW pairs described above. | In both cases, the primary driver behind the additional costs is the emitted permafrost carbon. The interdisciplinary research team hope their assessments will provide a better understanding of the socio-economic risks from climate change under different scenarios and help guide policy-makers towards prudent decisions on emissions reduction targets. "These two components are set to peak for global temperatures within the range covered by the Paris Agreement, but if the climate warms further, the summer and spring sea ice and land snow covers will retreat further north and the albedo feedback will actually weaken. | The 1.5°C and 2°C scenarios, defined as having a 50% chance of keeping the GMST rise in 2100 below the 1.5°C and 2°C targets based on PAGE-ICE simulations, require extra abatement relative to RCP2.6. They fall outside the range covered by the SSPW and RCPW pairs described above. We, therefore, introduced an additional abatement rate relative to RCP2.6, the same for all the major GHGs represented in PAGE-ICE, and employed Risk Optimiser to find that it is equal to 0.24% per year for the 2°C target and 4.05% per year for the 2°C target scenario. | [1] | Medicine | train | 1 | news | https://www.sciencedaily.com/releases/2019/04/190423114027.htm |
10.1038/s41467-019-09863-x | Medicine_easy_375 | Even with supercomputers, the number crunching took weeks because the vast geography and complex climate interactions of the Arctic throw up multiple variables. | Nevertheless, under all scenarios, the predominantly warmer future climate associated with the nonlinear PCF and SAF relative to their legacy values translates into marginal increases in the total discounted economic effect of climate change. | It shows how destabilised natural systems will worsen the problem caused by man-made emissions, making it more difficult and expensive to solve. Even with supercomputers, the number crunching took weeks because the vast geography and complex climate interactions of the Arctic throw up multiple variables. So far the impact is small. | For high emissions scenarios, the strength of the PCF saturates, and the weakening SAF gradually cancels the warming effect of the PCF; for BaU, this takes place from the second half of the 22nd century onwards. Nevertheless, under all scenarios, the predominantly warmer future climate associated with the nonlinear PCF and SAF relative to their legacy values translates into marginal increases in the total discounted economic effect of climate change. These increases, which are significant for all scenarios except for BaU, occur through additional temperaturedriven impacts on economy, ecosystems and human health, additional impacts from sea level rise, as well as highly uncertain extra impacts from social discontinuities and climate tipping elements other than the PCF and SAF. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39105856338&p=1pl&v=1&x=Ev5nvBW8jFG5yhRKbQsfjQ |
10.1098/rsos.171474 | Medicine_easy_376 | It will still be available this weekend on ESPN's digital channels, including its app. | It is possible that the retrospective month-long 'snap shot' this study uses missed a critical dynamic which develops over repeated engagement with video games. | The decision comes in the wake of the two shootings that prompted politicians, including President Donald Trump, to say video games that glorify violence could be contributing to the country's shooting epidemic. It will still be available this weekend on ESPN's digital channels, including its app. "Blaming video games is a 'look over there' move instead of a 'look at ourselves' reflection. | This could provide a context to understand gaming effects set against a rich data milieu, including information on objective gaming behaviours, social, familial, school, individual and genetic level factors. It is possible that the retrospective month-long 'snap shot' this study uses missed a critical dynamic which develops over repeated engagement with video games. To this end, field or natural experiments using multi-wave random-intercepts cross-lagged panel modelling should follow the present work to provide an expanded test of the effects of violent gaming on human behaviour. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=39907846044&p=1pl&v=1&x=qR_l8J7Kj5CPAEm_xm1uww |
10.1111/cdev.12370 | Medicine_easy_378 | Regulating emotions
Young people who reflected on their experiences from a self-distanced perspective became less upset than those who reflected from a self-immersed perspective, according to the study in Child Development. | (1 = right now, 7 = a long time ago). | Regulating emotions
Young people who reflected on their experiences from a self-distanced perspective became less upset than those who reflected from a self-immersed perspective, according to the study in Child Development. In part, this was because adolescents who saw their experience from a distance thought about it differently. These teens were more likely to reconsider the events in meaningful and insightful ways and less likely to simply replay the upsetting events in their minds. | (1 = very real, 7 = very imagined). (1 = right now, 7 = a long time ago). We averaged ratings on these four questions to compute a spontaneous distancing composite score (a = .60, M = 3.58, SD = 1.24. | [1] | Medicine | train | 1 | news | http://www.futurity.org/teens-emotions-distance-903192/ |
10.1038/s41467-018-05242-0 | Medicine_easy_379 | The study is published in Nature Communications and the researchers believe their discovery could lead to new drugs against infection and inflammation, for example in wound healing. | This LPS concentration corresponds to saturation in the LPS adsorption isotherm under these conditions. | The study is published in Nature Communications and the researchers believe their discovery could lead to new drugs against infection and inflammation, for example in wound healing. This will become a new way of preventing both infection and inflammation without using antibiotics." | In brief, by monitoring the change in the state of polarisation of light reflected at a surface in the absence and presence of an adsorbed layer, the mean refractive index (n) and layer thickness (d) of the adsorbed layer can be obtained. This LPS concentration corresponds to saturation in the LPS adsorption isotherm under these conditions. ARTICLE of data collection and generated a large number of tr-NOE cross-peaks. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=34802890066&p=1pl&v=1&x=3d-jvbsKa-ZTabLWHurVnw |
10.1016/j.mito.2018.08.001 | Medicine_easy_380 | Naviaux's team is preparing for a larger, longer trial in 2019. | Exercise increases physiologic reserve capacity and resilience to periodic exposure to stress or acute illness. | But the benefits were transient, fading and disappearing as the drug exited their systems. Naviaux's team is preparing for a larger, longer trial in 2019. "It's abnormalities in metabokine signaling that cause the normal stages of the cell danger response to persist abnormally, creating blocks in the healing cycle," said Navaiux, who noted CDR theory also explains why some people heal more quickly than others and why a chronic disease seemingly treated successfully can relapse. | In many important metabolic ways, exercise "reminds" the body how to heal and promotes disease-free health throughout life. Exercise increases physiologic reserve capacity and resilience to periodic exposure to stress or acute illness. Exercise combats this loss. | [1] | Medicine | train | 1 | news | http://ct.moreover.com/?a=37052707703&p=1pl&v=1&x=sh4bblHfq4G8CThdM37YaA |