Datasets:

ronitHF

/

pubmed-10k-8.1.1

like 0

haemophilus spp . generally colonize the upper respiratory tract and can cause infections such as bronchitis , sinusitis , epiglottitis , pneumonia and meningitis . h. influenzae has been reported as a rare cause of genitourinary tract infection such as urinary tract infection , , , , , pyelonephritis , , prostatitis , epididymitis , salpingitis and endometritis . we report here an immunocompetent japanese man with bacteremic pyelonephritis caused by nontypable h. influenzae associated with a left ureteral calculus . a 44-year - old japanese man with a history of left ureteral renal calculus presented to our hospital with a one - day history of left flank pain , fever and malaise without any respiratory symptoms . he had left flank pain caused by a left ureteral calculus over the past two decades . otherwise , his past history and family history were unremarkable . on physical examination , his blood pressure was 153/91 mm hg , pulse rate 112 beats / min , respiratory rate 20 breaths / min , oxygen saturation on ambient air 98% and body temperature 38.9 c . laboratory tests showed an elevated white blood cell ( wbc ) count 12.2 10/l and creatinine level of 1.25 mg / dl . microscopic examination of the urine sediment showed an elevated wbc and red blood cell ( rbc ) count of 50 and 99 per high power field , respectively . two sets of blood cultures were obtained using bactec plus aerobic / f and anaerobic / f culture bottles ( becton , dickinson and company , sparks , md ) . urine culture was performed using sheep blood agar and drygalski improved medium ( eiken chemical co , ltd , tokyo , japan ) . abdominal ultrasound and computerized tomography ( ct ) scan of the abdomen and pelvis without contrast showed a left ureteral calculus ( 17 10 19 mm ) , left hydronephrosis and a normal - sized prostate gland . after admission , treatment with intravenous ceftriaxone 2 g every 24 h was initiated and the ureteral stent was inserted into his left ureter . after 32 h of incubation , gram - negative bacilli were isolated from an aerobic blood bottle . both blood and urine cultures using sheep blood agar and drygalski improved medium showed no growth . chocolate ii agar ( nissui pharmaceutical co , ltd , tokyo , japan ) for blood and urine based on candle jar method at 37 c were used for culture . the bacteria required both x factor ( hemin ) and v factor ( nicotinamide adenine dinucleotide ) for its growth . , the united states ) automated identification and susceptibility testing showed 99.99% probability of -lactamase - negative h. influenzae biotype 3 . it was also identified as nontypable h. influenzae by influenza bacillus immune serum kit ( denka seiken , co. , ltd , niigata , japan ) . this organism was susceptible to ampicillin ( mic = 0.25 g / ml ) , amoxicillin clavulanic acid ( mic 1 g / ml ) , ampicillin sulbactam ( mic 0.5 g / ml ) , ceftriaxone ( mic 0.12 g / ml ) , meropenem ( mic 0.12 g / ml ) , clarithromycin ( mic = 4 g / ml ) , levofloxacin ( mic 0.12 g / ml ) and rifampicin ( mic 0.5 g / ml ) and resistant to sulfamethoxazole - trimethoprime ( mic = 4 g / ml ) . nasopharyngeal culture that was obtained after the initiation of antimicrobials was negative for haemophilus spp . follow up blood and urine cultures were negative . on hospital day 4 , he became afebrile . he was discharged home on hospital day 9 and treated with oral amoxicillin 1000 mg three times a day for 5 more days . fifteen days after discharge , he underwent extracorporeal shock wave lithotrity for the left ureteral calculus . the non - typable strains generally are not invasive and only the type b strain is preventable by vaccine . h. influenzae has been reported as a rare cause of genitourinary tract infection and fewer case reports of genitourinary tract infections along with bacteremia due to h. influenzae . the reported prevalence of h. influenzae in urine samples was 0.04% in women and 0.22% in men . true prevalence of this organism in the genitourinary tract , may be underestimated , since culture media for this organism are not routinely used for urine specimens . when chocolate agar was used for routine urine cultures showed that biotype 4 predominated in genitourinary isolates , while biotype 1 in respiratory isolates . wallace et al . also reported that nontypable h. influenzae of biotype 4 may have been most common for genitourinary tract infection of women . the results of these studies suggest that h. influenzae biotype 4 might have some mechanism related to the affinity to the genitourinary systems and/or direct invasion to the epithelium . the patients were stratified by gender due to differences in clinical features . in women , 90% ( 18/20 cases ) of the patients were associated with pregnancy and , notably , 75% ( 15/20 ) had bacteremia , . non - bacteremic urinary tract infection was only a case reported by morgan et al . . in men , 25.6% ( 10 out of 39 cases ) of past reported patients had anatomical or functional abnormality of genitourinary tract such as renal calculus , benign prostate hypertrophy , ureteral occlusion or post - operation . there were only 3 cases of bacteremia among the infections in males ( 7.6% ) . therefore the true proportion of the patients with underlying diseases was possibly underestimated . regarding the serotypes of h. influenzae , a total of 66.7% ( 26 out of 39 ) was type b and 28.2% ( 11 out of 39 ) was nontypable ( 2 cases was unknown ) . in 29 out of 39 patients , biologic type of h. influenzae thirteen were type 2 , 9 were type 3 , type 1 or 4 for 3 patients respectively and type 8 was only from one patient . our patient had left renal calculus and serologic / biologic type was nontypable / type 3 . regardless gender and serologic type , h. influenzae were mostly biotype 14 ( 39 out of 42 ) . it is possible that this ability might facilitate colonization or infection in the genitourinary tract . indeed , urease production in the urine will produce an alkaline ph which can predispose to stone formation . we report an immunocompetent patient with a ureteral calculus associated with bacteremic urinary tract infection caused by nontypable h. influenzae ( biotype 3 ) . h. influenzae is difficult to grow on urine culture and its isolation may be underestimated . collaboration between clinicians and microbiology laboratory personnel is essential for correct identification of the organism and appropriate therapy for genitourinary tract infections due to this organism .

haemophilus species are known to colonize the upper respiratory tract and can cause infections . however haemophilus influenzae has been rarely described as a cause of genitourinary tract infection . we report a 44-year - old nonimmunocompromised japanese man with bacteremic pyelonephritis caused by a nontypable h. influenzae associated with a left ureteral calculus . the organism was isolated from both blood and urine cultures . treatment consisted of 14 days of intravenous ceftriaxone and oral amoxicillin one after than other and insertion of a left ureteral stent . after discharge , he underwent extracorporeal shock wave lithotrity for the left ureteral calculus . he had no recrudescence of the symptoms . h. influenzae should be considered as a genitourinary pathogen among patients with certain risk factors such as anatomical or functional abnormality of genitourinary tract . collaboration between clinicians and microbiology laboratory personnel is essential for correct identification of the organism and appropriate therapy for genitourinary tract infections due to this organism .

Introduction Case report Discussion Conclusion Conflict of interests Ethical approval

the long - term survival of patients with hematological malignancies has improved dramatically over the past decades . nowadays , about 40% of patients with acute leukemia or high - grade non - hodgkin lymphoma survive for more than 5 years and about 30% of these patients can be cured . unfortunately , owing to their underlying disease or treatment or both , these patients are at high risk of severe complications , often requiring transfer to the icu . historically , intensivists have been reluctant to admit these patients to the icu because of the almost uniformly fatal prognosis reported in the literature in patients with evolving organ dysfunction requiring mechanical ventilation , vasopressors , or renal replacement therapy alone or in combination . over the past decade , several centers around the world that specialize in the management of these patients have clearly shown that these grim prognostic estimates no longer hold and that the reluctance to admit these patients to the icu , simply because of their underlying malignancy , is no longer justified . an important remaining question , however , is how these patients perform in the long term with regard to survival and quality of life . in a study in the previous issue of critical care , bernal and colleagues focused on the determinants of survival beyond 1 year in a multicenter setting . as could be expected from what we observed at the bedside , functional status ( eastern cooperative oncology group performance status of more than 2 ) , relapsing hematological malignancy , and absence of compliance with the scheduled therapy for the underlying disease after icu discharge were associated with a worse survival . however , what was less expected is that the survival reached nearly 0% after 1.5 years if only one of these factors was present . of note , only 62 patients were included in this study , and depending on whether we focus on a half - empty or half - full glass , the other half of the patients achieved a 5-year post - icu survival of 40% to 50% . in the largest study ever published , including more than 1,000 patients with hematological malignancies admitted over a 16-month period in 17 specialized centers in france and belgium , hospital survival was 60.7% ; up to 80% of these patients had no change in treatment intensity , and 80% were in complete or partial remission 6 months after icu discharge . moreover , recent studies have shown that icu admission does not influence long - term outcome in patients with acute myeloid leukemia who survive the first 30 days after icu discharge : they had similar survival and complete remission rates up to 3 years and 6 years , respectively , after discharge in comparison with acute myeloid leukemia patients for whom icu admission was not necessary . therefore , what the study by bernal and colleagues shows above all is that being technically skilled in advanced life - support therapies is not enough to improve long - term outcome ; as intensivists , we also have to acknowledge better when to use these therapies and when we have to withdraw them during icu stay . more than ever , long - term estimations with regard to survival and quality of life should be taken into account upon referral to the icu . only close collaboration and in - depth communication between hematologists and intensivists upon referral and during icu stay can bridge the two extremes of the overoptimistic oncologists who often overestimate the long - term survival of their patients in daily practice and the overpessimistic intensivists who are reluctant to admit them . such an open and constructive atmosphere , in which physicians assume a leading role , disseminate a clear vision , and let other team members , the patients , and relatives actively and safely participate in the decision - making processes , will not only improve the average long - term outcome of published series focusing on any severe underlying comorbidity but also reduce the burden for individual patients and their relatives at the bedside . health - care workers will also benefit , since real or perceived disproportional care in the icu leads to acute or , much worse , more subtle chronic conflicts within the team , resulting in poor quality of care . the latter is particularly deleterious since it will affect the patient s short- and long - term outcome in general , regardless of whether the admission is justified or not . a good admission policy is necessary in order to safeguard the quality of icu care provided to patients with good long - term expectations on the one hand and to reduce the burden for patients and relatives with poor long - term expectations on the other . this can be achieved only by creating working environments enhancing close collaboration and communication between intensivists and hematologists and where the patient and relatives are closely involved in the decision - making process upon icu referral and during icu stay . it is important to note that this holds not only for patients with hematological malignancies such as in the study by bernal and colleagues but also for patients with any other severe underlying comorbidity that are increasingly referred to the icu . a good admission policy is necessary in order to safeguard the quality of icu care provided to patients with good long - term expectations on the one hand and to reduce the burden for patients and relatives with poor long - term expectations on the other . this can be achieved only by creating working environments enhancing close collaboration and communication between intensivists and hematologists and where the patient and relatives are closely involved in the decision - making process upon icu referral and during icu stay . it is important to note that this holds not only for patients with hematological malignancies such as in the study by bernal and colleagues but also for patients with any other severe underlying comorbidity that are increasingly referred to the icu .

the spectacular improvement in long - term prognosis of patients with hematological malignancies since the 1980s , coupled with the subsequent improvement over the past decade in short- and mid - term survival in cases of critical illness , resulted in an increasing referral of such patients to the icu . a remaining question , however , is how these patients perform in the long term with regard to survival and quality of life . here we discuss the present multicenter study on survival beyond 1 year in critically ill patients with hematological malignancies . we conclude with suggestions on how we can further improve the long - term outcome of these patients .

None Conclusions Competing interests Acknowledgments

chronic hepatitis c ( chc ) is a major health care burden and a leading cause of end - stage liver disease and hepatocellular carcinoma ( hcc ) worldwide . although non - uniform distributions of chc in certain areas complicate the establishment of global and regional epidemiology , the global prevalence of chc has been estimated as 2.35% , affecting approximately 160 million people ( 1 ) . in taiwan , seroprevalences of hepatitis c virus ( hcv ) antibody positivity were estimated as 4.4% to 8.6% ( 2 , 3 ) . upwards of 53% of chc patients are infected with hcv genotype 1 ( g1 ) ( 4 ) . either in most resource - limited areas worldwide or in most of the asian countries , pegylated interferon ( pegifn ) plus ribavirin ( rbv ) combination therapy remains the first - line standard of care ( soc ) for chc . the national health insurance program of taiwan reimburses the cost of soc for chc . however , severe rbv - induced hemolytic anemia severely complicates chc patients during soc by causing suboptimal tolerance , poor compliance and early withdrawal from therapy ( 5 ) . the risks of anemia have been shown to be higher in asian than non - asian patients ( 6 ) . extensive accumulation of rbv in erythrocytes causes membrane oxidative damage , premature hemolysis and subsequent anemia ( 7 ) . the haptoglobin phenotype , pretreatment platelet level ( 8) , impaired renal function ( 9 ) , high dose / body weight ratio , old age and female sex ( 10 ) have been previously demonstrated to be associated with anemia . recent genome - wide association studies have advanced to a strong association between rbv - induced anemia and single - nucleotide polymorphisms ( snps ) in the inosine triphosphate pyrophosphatase ( itpa ) gene on chromosome 20 in chc patients on soc ( 11 ) . identifying patients at high risk of anemia is crucial for improving patient compliance and soc outcomes for chc patients ( 12 ) . novel treatment strategies or algorithms based on a combination of relevant pharmacogenetics and host factors may facilitate patient counseling prior to anemia events ( 13 ) . however , limited studies included predictive modeling of severe anemia ( hemoglobin , hb < 10 g / dl ) based on an index incorporating the strong predictor , itpa snp status ( 14 , 15 ) . therefore , we estimated the effect of itpa snp status on severe anemia and treatment responses to construct a clinically practical predictive index for severe anemia during chc combination therapy . the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki and was approved by the institutional review board of china medical university hospital . informed consent was obtained from each patient included in the study . from september 2005 to september 2013 , consecutive east asian patients with chc g1 were screened and enrolled in a prospective cohort to analyze antiviral treatment responses . we defined chc g1 as positive result for serum anti - hcv antibody ( abbott laboratories , abbott park , il , usa ) for more than six months with detectable serum hcv g1 rna ( cobas amplicor hcv monitor 2.0 ; roche diagnostics , branchburg , nj , usa ) . patients with a history of any of the following conditions were excluded from the cohort ; age < 20 years or > 75 years , treatment discontinued in less than four months after starting soc with no severe anemia event , hepatitis b virus coinfection , human immunodeficiency virus coinfection , hcc , alcoholic liver disease , primary biliary cirrhosis , primary sclerosing cholangitis , wilson s disease , autoimmune hepatitis , hemochromatosis , previous ifn - based therapy , baseline hb < 13 g / dl in men , hb < 12 g / dl in women , nucleoside- or nucleotide - analog therapies other than rbv , decompensated cirrhosis and end - stage renal disease . eligible patients were randomly assigned to the development and validation cohorts at a ratio of 4:1 . patients received pegifn -2a ( pegasys , hoffmann - la roche , basel , switzerland ) at a dosage of 180 g / week or pegifn -2b ( peg - intron , schering - plough , kenilworth , nj , usa ) at a dosage of 1.5 g / kg / week subcutaneously . oral rbv was prescribed for all patients at a daily dose of 1000 mg ( body weight < 75 kg ) or 1200 mg ( body weight 75 kg ) for 24 weeks or 48 weeks based on the baseline hcv rna ( < versus 6 log10 copies / ml ) and virological response at week 4 ( 16 , 17 ) . baseline and mean doses of rbv ( mg / kg / day ) on treatment were calculated for each patient . erythropoietin ( epo ) was considered if hb fell below 10 g / dl during the treatment . blood biochemistry ( beckman coulter , ca , usa ) and complete blood count analyses ( sysmex hst - series , kanogawa , japan ) were performed in the central laboratory at the medical center . hcv rna load was quantified at baseline and monitored at weeks 4 , 12 , 24 and 48 . sustained virological response ( svr ) was defined as undetectable hcv rna at or before the end of treatment and at 24 weeks after the end of treatment . monthly distributions of patients with severe anemia ( hemoglobin < 10 g / dl ) on treatment were compared between c / c versus a / a or c / a genotypes . participant genomic dna was extracted from peripheral blood mononuclear cells using a qiagen dna blood mini kit ( qiagen , valencia , ca , usa ) . genotyping for one functional missense itpa variant in exon 2 at rs1127354 on chromosome 20 ( 18 , 19 ) was performed using 20 l of faststart universal probe master mix ( roche diagnostics , branchburg , nj , usa ) containing 500 nmol rs1127354 forward primer ( 5-tcttggaacaggtcgttcagattcta-3 ) , 500 nmol rs1127354 reverse primer ( 5-aggaagacagagaaatccaaccatc-3 ) , 250 nmol c allele probe ( fam - agtttccatgcactttggtgg - bbq ) and 250 nmol a allele probe ( yak - agtttacatgcactttggtggc - bbq ) . the reaction mixture was denatured at 95c for 10 minutes before thermal cycling at 95c for 15 seconds and 60c for 1 minute for 40 cycles . genotypes were analyzed using steponetm software version 2.0 ( life technologies , carlsbad , ca , usa ) . therefore , patients were not genotyped for itpa snp rs7270101 ( 18 ) . the cohort was also genotyped for interleukin 28b ( il28b ) polymorphisms at rs8099917 and rs12979860 , as previously described ( 20 ) . both kolmogorov - smirnov and shapiro - wilk tests showed that ( p < 0.05 ) none of the continuous variables in this study had a normal distribution . therefore , continuous variables were expressed as median ( interquartile range , iqr ) and estimated using mann - whitney u test . categorical variables were estimated using the chi - square test or fisher s exact test . univariate logistic regression identified the variables ( p < 0.25 ) associated with severe anemia for subsequent multiple regressions . by expressing the likelihood of severe anemia as a probability ranging from 0 to 1 , an index for identifying severe anemia was constructed by incorporating significant independent associated factors and the beta coefficients acquired through the final multiple logistic regression for severe anemia ( 14 ) . the diagnostic performance of the predictive index was evaluated by the area under the receiver operating - characteristic curves ( aucs ) . the odds ratios ( ors ) of significant associations were determined based on a 95% confidence interval ( ci ) . the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki and was approved by the institutional review board of china medical university hospital . from september 2005 to september 2013 , consecutive east asian patients with chc g1 were screened and enrolled in a prospective cohort to analyze antiviral treatment responses . we defined chc g1 as positive result for serum anti - hcv antibody ( abbott laboratories , abbott park , il , usa ) for more than six months with detectable serum hcv g1 rna ( cobas amplicor hcv monitor 2.0 ; roche diagnostics , branchburg , nj , usa ) . patients with a history of any of the following conditions were excluded from the cohort ; age < 20 years or > 75 years , treatment discontinued in less than four months after starting soc with no severe anemia event , hepatitis b virus coinfection , human immunodeficiency virus coinfection , hcc , alcoholic liver disease , primary biliary cirrhosis , primary sclerosing cholangitis , wilson s disease , autoimmune hepatitis , hemochromatosis , previous ifn - based therapy , baseline hb < 13 g / dl in men , hb < 12 g / dl in women , nucleoside- or nucleotide - analog therapies other than rbv , decompensated cirrhosis and end - stage renal disease . eligible patients were randomly assigned to the development and validation cohorts at a ratio of 4:1 . patients received pegifn -2a ( pegasys , hoffmann - la roche , basel , switzerland ) at a dosage of 180 g / week or pegifn -2b ( peg - intron , schering - plough , kenilworth , nj , usa ) at a dosage of 1.5 g / kg / week subcutaneously . oral rbv was prescribed for all patients at a daily dose of 1000 mg ( body weight < 75 kg ) or 1200 mg ( body weight 75 kg ) for 24 weeks or 48 weeks based on the baseline hcv rna ( < versus 6 log10 copies / ml ) and virological response at week 4 ( 16 , 17 ) . baseline and mean doses of rbv ( mg / kg / day ) on treatment were calculated for each patient . erythropoietin ( epo ) was considered if hb fell below 10 g / dl during the treatment . blood biochemistry ( beckman coulter , ca , usa ) and complete blood count analyses ( sysmex hst - series , kanogawa , japan ) were performed in the central laboratory at the medical center . hcv rna load was quantified at baseline and monitored at weeks 4 , 12 , 24 and 48 . sustained virological response ( svr ) was defined as undetectable hcv rna at or before the end of treatment and at 24 weeks after the end of treatment . monthly distributions of patients with severe anemia ( hemoglobin < 10 g / dl ) on treatment were compared between c / c versus a / a or c / a genotypes . participant genomic dna was extracted from peripheral blood mononuclear cells using a qiagen dna blood mini kit ( qiagen , valencia , ca , usa ) . genotyping for one functional missense itpa variant in exon 2 at rs1127354 on chromosome 20 ( 18 , 19 ) was performed using 20 l of faststart universal probe master mix ( roche diagnostics , branchburg , nj , usa ) containing 500 nmol rs1127354 forward primer ( 5-tcttggaacaggtcgttcagattcta-3 ) , 500 nmol rs1127354 reverse primer ( 5-aggaagacagagaaatccaaccatc-3 ) , 250 nmol c allele probe ( fam - agtttccatgcactttggtgg - bbq ) and 250 nmol a allele probe ( yak - agtttacatgcactttggtggc - bbq ) . the reaction mixture was denatured at 95c for 10 minutes before thermal cycling at 95c for 15 seconds and 60c for 1 minute for 40 cycles . genotypes were analyzed using steponetm software version 2.0 ( life technologies , carlsbad , ca , usa ) . the cohort was also genotyped for interleukin 28b ( il28b ) polymorphisms at rs8099917 and rs12979860 , as previously described ( 20 ) . both kolmogorov - smirnov and shapiro - wilk tests showed that ( p < 0.05 ) none of the continuous variables in this study had a normal distribution . therefore , continuous variables were expressed as median ( interquartile range , iqr ) and estimated using mann - whitney u test . categorical variables were estimated using the chi - square test or fisher s exact test . univariate logistic regression identified the variables ( p < 0.25 ) associated with severe anemia for subsequent multiple regressions . by expressing the likelihood of severe anemia as a probability ranging from 0 to 1 , an index for identifying severe anemia was constructed by incorporating significant independent associated factors and the beta coefficients acquired through the final multiple logistic regression for severe anemia ( 14 ) . the diagnostic performance of the predictive index was evaluated by the area under the receiver operating - characteristic curves ( aucs ) . the odds ratios ( ors ) of significant associations were determined based on a 95% confidence interval ( ci ) . excluded patients included those with baseline hepatitis b virus coinfection ( n = 9 ) , hcc ( n = 5 ) , a history of ifn - based therapy ( n = 11 ) , men with baseline hb < 13 g / dl or women < 12 g / dl ( n = 8) and end - stage renal disease ( n = 2 ) . therefore , the chc g1 cohort consisted of 418 eligible participants who intended to receive combination therapy . nine patients were also excluded , because the treatment was discontinued within four months from the treatment baseline for reasons other than severe anemia . the cohort was randomized into a development cohort ( n = 324 ) and a validation cohort ( n = 81 ) . among them , 367 ( 90.6% ) of 405 patients had liver histology data . a total of 148 ( 36.5% ) patients received combination therapy for 24 weeks and 257 ( 63.5% ) patients for 48 weeks . patients per protocol ( n = 357 ) entered the analysis for svr ( 41 patients discontinued before the intended eot and seven patients were lost to follow - up for svr visit ) . the median patient age was 53.0 ( 13.0 ) years and 49.6% of patients were men . the c / c genotype was present in 66.4% of patients and 33.6% had the a / a or the c / a allelic variants ( a / a or c / a as a combo variable ) at rs1127354 . the development cohort ( n = 324 ) and validation cohort ( n = 81 ) did not differ significantly in a univariate analysis . monthly distributions of severe anemia events are demonstrated in figure 1 . among patients who received 24-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month on treatment than those with a / a or c / a genotype ( 37.1% versus 0.0% , p = 0.0135 ) . likewise , among patients who received 48-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month on treatment than those with a / a or c / a genotype ( 22.9% versus 2.9% , p = 0.0079 ) . in total , 166 patients ( 166/324 , 51.2% ) in the development cohort developed severe anemia on treatment . multiple logistic regressions identified age ( 50 y : or = 9.7 , 95% ci = 5.0 - 18.6 ) , itpa rs1127354 ( c / c : or = 3.3 , 95% ci = 1.8 - 5.8 ) and baseline hemoglobin ( < 14.0 g / dl : or 6.4 , 95% ci = 3.3 - 12.1 ; 14.0 - 14.9 : or = 2.4 , 95% ci = 1.2 - 4.6 ) as predictors of severe anemia on treatment ( tables 1 and 2 ) . there was no significant dose effect between itpa snp status ( c / a versus a / a , p = 0.5387 ) and severe anemia . therefore , the predictive index derived from the development cohort incorporating age ( y ) , itpa snp status and baseline hb ( g / dl ) was expressed as 1/(1 + exp ( - x ) ) , where x = - 3.2835 + 2.2709 a + 1.1822 i + 1.8848 h1 + 0.8684 h2 ( a = 1 if age 50 ; a = 0 if age < 50 ; i = 1 if itpa snp = c / c ; i = 0 if itpa snp = a / a or c / a ; h1 = 1 if hb < 14.0 ; h1 = 0 if hb 14.0 ; h2 = 1 if hb = 14.0 - 14.9 ; h2 = 0 if hb < 14.0 or 15.0 ) . to dichotomize the anemia status ( with versus without severe anemia ) in the development , the cutoff value of 0.5 was optimal when maximizing the values of the predictive index yielded a diagnostic accuracy ( auc ) of 0.830 ( 95% ci = 0.783 - 0.871 ) in the development ( n = 324 ) and 0.902 ( 0.826 - 0.925 ) in the validation ( n = 81 ) cohorts to dichotomize the anemia status , respectively ( figure 2 ) . in total , 135 ( 135/357 per protocol , 37.8% ) patients achieved rvr . seventy - three of them ( 73/135 , 54.1% ) had a median baseline hcv rna of 5.29 ( 0.76 ) log10 copies / ml and received 24-week treatment . the remaining 62 patients ( 62/135 , 45.9% ) received 48-week treatment . liver pathology was acquired in 69 of 73 ( 94.5% ) patients with rvr and 24-week treatment . among them , metavir fibrosis stages 0 - 2 were noted in 54 ( 54/69 , 78.3% ) , and 3 - 4 in 15 ( 15/69 , 21.7% ) . in total , 255 ( 255/357 per protocol , 71.4% ) patients achieved svr . the rvr ( or = 8.2 ; 95% ci = 3.519.1 ; p < .0001 ) , t / t il28b genotype at rs8099917 ( or = 3.0 ; 95% ci = 1.2 - 7.4 ; p = 0.0156 ) , the metavir fibrosis stages 0 - 2 ( or = 1.9 ; 95% ci = 1.0 - 3.5 ; p = 0.0450 ) , baseline hcv rna ( or = 0.4 ; 95% ci = 0.2 - 0.7 ; p = 0.0008 ) and 48-week treatment duration ( or = 1.1 ; 95% ci = 1.0 - 1.1 ; p = 0.0003 ) were independently associated with svr . anemia events and epo treatment were not independently associated with svr . in patients with either itpa c / c or a / a or c / a genotypes , the mean rbv dose exposures were not significantly different between patients with svr versus non - svr . the il28b snp ( rs12979860 ) was not included in the final multiple regression because of collinearity with the other il28b snp ( rs8099917 ) ( table 3 ) . in addition , through univariate analyses , the itpa snp status was significantly associated with rbv dose reduction in the development cohort ( n = 324 ) ( mann - whitney u test , p = 0.0035 ) . patients ( n = 103/324 , 31.8% ) with a / a or c / a genotype received 100% ( 8% ) intended rbv doses . in contrast , patients ( n = 221/324 , 68.2% ) with c / c genotype received 97% ( 1.4% ) intended rbv doses . however , itpa snp status was not significantly associated with epo use ( chi - square test , p = 0.1617 ) . forty - five of 103 patients ( 45/103 , 43.7% ) with a / a or c / a genotype received epo treatment . in contrast , 115 of 221 patients ( 115/221 , 52.0% ) with c / c genotype received epo treatment . a ) among patients who received 24-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month than those with a / a or c / a genotype ( p = 0.0135 ) . b ) ; also , among patients who received 48-week treatment ( p = 0.0079 ) . data are presented for hemoglobin < 10 g / dl and development cohort ( n = 324 ) . excluded patients included those with baseline hepatitis b virus coinfection ( n = 9 ) , hcc ( n = 5 ) , a history of ifn - based therapy ( n = 11 ) , men with baseline hb < 13 g / dl or women < 12 g / dl ( n = 8) and end - stage renal disease ( n = 2 ) . therefore , the chc g1 cohort consisted of 418 eligible participants who intended to receive combination therapy . nine patients were also excluded , because the treatment was discontinued within four months from the treatment baseline for reasons other than severe anemia . the cohort was randomized into a development cohort ( n = 324 ) and a validation cohort ( n = 81 ) . among them , 367 ( 90.6% ) of 405 patients had liver histology data . a total of 148 ( 36.5% ) patients received combination therapy for 24 weeks and 257 ( 63.5% ) patients for 48 weeks . patients per protocol ( n = 357 ) entered the analysis for svr ( 41 patients discontinued before the intended eot and seven patients were lost to follow - up for svr visit ) . the median patient age was 53.0 ( 13.0 ) years and 49.6% of patients were men . the c / c genotype was present in 66.4% of patients and 33.6% had the a / a or the c / a allelic variants ( a / a or c / a as a combo variable ) at rs1127354 . the development cohort ( n = 324 ) and validation cohort ( n = 81 ) did not differ significantly in a univariate analysis . monthly distributions of severe anemia events are demonstrated in figure 1 . among patients who received 24-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month on treatment than those with a / a or c / a genotype ( 37.1% versus 0.0% , p = 0.0135 ) . likewise , among patients who received 48-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month on treatment than those with a / a or c / a genotype ( 22.9% versus 2.9% , p = 0.0079 ) . in total , 166 patients ( 166/324 , 51.2% ) in the development cohort developed severe anemia on treatment . multiple logistic regressions identified age ( 50 y : or = 9.7 , 95% ci = 5.0 - 18.6 ) , itpa rs1127354 ( c / c : or = 3.3 , 95% ci = 1.8 - 5.8 ) and baseline hemoglobin ( < 14.0 g / dl : or 6.4 , 95% ci = 3.3 - 12.1 ; 14.0 - 14.9 : or = 2.4 , 95% ci = 1.2 - 4.6 ) as predictors of severe anemia on treatment ( tables 1 and 2 ) . there was no significant dose effect between itpa snp status ( c / a versus a / a , p = 0.5387 ) and severe anemia . therefore , the predictive index derived from the development cohort incorporating age ( y ) , itpa snp status and baseline hb ( g / dl ) was expressed as 1/(1 + exp ( - x ) ) , where x = - 3.2835 + 2.2709 a + 1.1822 i + 1.8848 h1 + 0.8684 h2 ( a = 1 if age 50 ; a = 0 if age < 50 ; i = 1 if itpa snp = c / c ; i = 0 if itpa snp = a / a or c / a ; h1 = 1 if hb < 14.0 ; h1 = 0 if hb 14.0 ; h2 = 1 if hb = 14.0 - 14.9 ; h2 = 0 if hb < 14.0 or 15.0 ) . to dichotomize the anemia status ( with versus without severe anemia ) in the development , the cutoff value of 0.5 was optimal when maximizing the values of the predictive index yielded a diagnostic accuracy ( auc ) of 0.830 ( 95% ci = 0.783 - 0.871 ) in the development ( n = 324 ) and 0.902 ( 0.826 - 0.925 ) in the validation ( n = 81 ) cohorts to dichotomize the anemia status , respectively ( figure 2 ) . seventy - three of them ( 73/135 , 54.1% ) had a median baseline hcv rna of 5.29 ( 0.76 ) log10 copies / ml and received 24-week treatment . liver pathology was acquired in 69 of 73 ( 94.5% ) patients with rvr and 24-week treatment . among them , metavir fibrosis stages 0 - 2 were noted in 54 ( 54/69 , 78.3% ) , and 3 - 4 in 15 ( 15/69 , 21.7% ) . in total , 255 ( 255/357 per protocol , 71.4% ) patients achieved svr . the rvr ( or = 8.2 ; 95% ci = 3.519.1 ; p < .0001 ) , t / t il28b genotype at rs8099917 ( or = 3.0 ; 95% ci = 1.2 - 7.4 ; p = 0.0156 ) , the metavir fibrosis stages 0 - 2 ( or = 1.9 ; 95% ci = 1.0 - 3.5 ; p = 0.0450 ) , baseline hcv rna ( or = 0.4 ; 95% ci = 0.2 - 0.7 ; p = 0.0008 ) and 48-week treatment duration ( or = 1.1 ; 95% ci = 1.0 - 1.1 ; p = 0.0003 ) were independently associated with svr . anemia events and epo treatment were not independently associated with svr . in patients with either itpa c / c or a / a or c / a genotypes , the mean rbv dose exposures were not significantly different between patients with svr versus non - svr . the il28b snp ( rs12979860 ) was not included in the final multiple regression because of collinearity with the other il28b snp ( rs8099917 ) ( table 3 ) . in addition , through univariate analyses , the itpa snp status was significantly associated with rbv dose reduction in the development cohort ( n = 324 ) ( mann - whitney u test , p = 0.0035 ) . patients ( n = 103/324 , 31.8% ) with a / a or c / a genotype received 100% ( 8% ) intended rbv doses . in contrast , patients ( n = 221/324 , 68.2% ) with c / c genotype received 97% ( 1.4% ) intended rbv doses . however , itpa snp status was not significantly associated with epo use ( chi - square test , p = 0.1617 ) . forty - five of 103 patients ( 45/103 , 43.7% ) with a / a or c / a genotype received epo treatment . in contrast , 115 of 221 patients ( 115/221 , 52.0% ) with c / c genotype received epo treatment . a ) among patients who received 24-week treatment and developed severe anemia , a significantly higher percentage of patients with c / c genotype did so during the first month than those with b ) ; also , among patients who received 48-week treatment ( p = 0.0079 ) . data are presented for hemoglobin < 10 g / dl and development cohort ( n = 324 ) . this incidence was higher than that reported ( 39.3% ) in a previous study of 466 east asian patients diagnosed with chc ( 5 ) . the higher anemia frequency in our study can be attributed to the higher rbv dosage in patients infected with hcv g1 . consistent with hb kinetics reported in previous studies ( 5 , 12 , 19 , 22 - 25 ) , the anemia events in our study accumulated during the first few months of treatment and remained relatively stable thereafter ( figure 1 ) . the accumulated itp was substituted for gtp during the biosynthesis of atp and protected against rbv - induced hemolytic anemia . . methods of gene expression analysis such as mrna transcripts or western blotting were not used in our study . however , the results of snp genotyping of itpa that we performed correlated closely with phenotypes or predicted itpa activities of these allelic variants ( 26 - 28 ) . although rbv pharmacokinetics in serum or in erythrocytes or predicted itpa activities were not applicable in our current study ( 29 ) , this index may serve as a clinically practical one based on dichotomized parameters available in clinical settings . future studies can develop algorithms or scoring systems based on age , sex , body weight , renal function , hb and itpa snp status for modifying rbv dosage to achieve an optimal steady - state concentration range or for administering epo prior to the development of anemia , rather than reducing the rbv dose following an anemia event ( 30 , 31 ) . recent studies indicated that itpa allelic variants a / a or c / a at rs1127354 are less likely associated with rbv dose reduction ( 19 , 22 , 23 , 32 ) . future studies can also use a time - to - event analysis to identify significant predictors for rbv dose reduction . the effects of older age and female sex on severe anemia ( < 11 g / dl ) during the first four weeks of treatment were also reported in a study of 61 hcv g1-infected japanese patients , in which 49 patients exhibited rbv - sensitive itpa c / c genotype at rs1127354 and 12 patients exhibited rbv - resistant a / a or c / a variants ( 19 ) . therefore , older female patients require stringent monitoring of anemia during combination therapy . however , sex was not included in the predictive index through multiple logistic regressions in the current study because of collinearity with baseline hb . therefore , it was not applicable to adopt creatinine level in multiple regression modeling for predictive index of severe anemia . in the study by tsubota et al . , estimated glomerular filtration rate was found to be one of the significant associated factors to construct a predictive model for rbv - induced anemia ( 14 ) . our future studies would recruit participants in larger sample sizes receiving more uniform treatment durations to allow time - dependent analysis of anemia events for constructing a predictive index through cox regression analysis . based on our results , we suggest that subjects with a predictive index greater than 0.5 might receive epo treatment early after the start of pegifn and rbv combination therapy to facilitate quality of life , prevent rbv dose reduction and avoid compromised treatment responses . however , anticipated benefits associated with early implementation of epo treatment need to be confirmed by further studies . both rvr and t / t il28b genotype at rs8099917 remained significant predictors for svr in our chc g1 cohort ( 33 ) . also consistent with recent studies ( 18 , 19 , 22 - 24 , 34 ) , itpa snp status was a non - significant predictor of svr in our study . however , the reported itpa - svr correlations varied ( 35 ) . in a recent report by rembeck et al . ( 27 ) , itpa allelic variants encoding reduced itpa activity was demonstrated to correlate with svr and non - relapse , unrelated to rbv adherence or protection against anemia , although the molecular mechanisms require further elucidation . although previous reports yielded conflicting results regarding the significance of anemia - svr correlation ( 5 , 12 , 36 , 37 ) , most recent studies on itpa snps have not estimated anemia - svr correlation ( 18 , 19 , 22 - 25 , 32 , 38 ) . in our study , svr was not associated with severe anemia or hb decline ( 4 g / dl ) on treatment ( table 3 ) . recent anemia - svr correlations have also been reported based on the divergent results of non - genetic ( 5 , 23 , 36 ) and molecular studies ( 11 , 14 ) . molecular studies indicated that anemia might not only be a surrogate for rbv exposure , because anemia - svr association was attenuated when adjusting for rbv levels ( 39 ) , but also represent the first molecular evidence connecting anemia - svr association to novel genes and pathways through statistical analyses on gene expressions and mrna signatures ( 11 ) . in conclusion , itpa snp status is a significant predictor of rbv - induced hemolytic anemia in patients diagnosed with chc g1 and receiving pegifn and rbv combination therapy . the itpa snp - based index is an accurate and practical predictive solution for severe anemia in clinical practice . information on itpa snp status of patients may assist in maximizing the tolerability of soc for patients with chc .

background : single - nucleotide polymorphisms ( snp ) in the inosine triphosphate pyrophosphatase ( itpa ) gene correlate with ribavirin ( rbv)-induced anemia in patients with chronic hepatitis c ( chc ) receiving combination therapy . managing anemia is an early priority in the treatment process.objectives:the aim was to develop a predictive index based on itpa snp status to identify chc patients at risk of anemia.patients and methods : a total of 418 eligible east asian patients diagnosed with chc genotype 1 ( g1 ) received combination therapy in this study . participant dna was genotyped for a functional itpa snp ( c / c , a / a or c / a ) on chromosome 20 at rs1127354 . a predictive index was constructed by incorporating independent factors identified for severe anemia events ( hemoglobin < 10 g / dl ) . areas under the receiver - operating characteristic curves ( aucs ) represented the diagnostic accuracies of the predictive index in randomly assigned development and validation cohorts.results:multiple logistic regressions identified age ( 50 y : or = 9.7 , 95% ci = 5.0 - 18.6 ) , itpa rs1127354 ( c / c : or = 3.3 , 95% ci = 1.8 - 5.8 ) and baseline hemoglobin ( < 14.0 g / dl : or 6.4 , 95% ci = 3.3 - 12.1 ; 14.0 - 14.9 : or = 2.4 , 95% ci = 1.2 - 4.6 ) as predictors of severe anemia throughout the treatment . for severe anemia , the predictive index incorporating age , itpa snp status and baseline hemoglobin yielded diagnostic accuracies ( aucs ) of 0.830 ( 95% ci = 0.783 - 0.871 ) in the development ( n = 324 ) and 0.902 ( 0.826 - 0.925 ) in the validation ( n = 81 ) cohorts.conclusions:in patients with chc g1 and receiving combination therapy , itpa snp - based index was an accurate and practical solution for prediction of severe anemia .

1. Background 2. Objectives 3. Patients and Methods 3.1. Ethics 3.2. Patients 3.3. Combination Therapy 3.4. Treatment Monitoring 3.5. Clinical Endpoints 3.6. ITPA SNP Genotyping 3.7. Statistical Analysis 4. Results 4.1. Patient Characteristics 4.2. Predictive Index 4.3. Treatment Responses 5. Discussion

endometrial carcinoma is the most common cancer of the female genital tract in the western world . endometrial carcinomas are generally thought to have a favorable prognosis due to early detection , and the majority of tumors are detected in early stages . however , in fact this is not fully true , and there are important subgroups within this diagnosis with poor prognosis and outcome of treatment . therefore , the first step to improve the situation has been to find predictive and prognostic factors , then to define clinically relevant risk groups , and finally to design clinical trials and treatment options for these risk groups . unfortunately , no consensus exists on which predictive or prognostic factors that should be used and how to combine them in the definition of suitable - risk groups . as a result of this , the randomized phase iii trials presented during the last decades are difficult to compare since these definitions have varied , more or less , in most of them . another problem has been the small size and low power of most studies in the literature dealing with prognostic and predictive factors . despite more or less sophisticated statistical methods with multivariate technique , the results are not reliable enough for definitive conclusions from such small series analyzing multiple variables . a few exceptions do exist but then with data from large registry studies , but then with other problems of selection and bias built in . six prospective randomized studies have been presented since 1980 to elucidate the value of external beam pelvic radiotherapy after surgery in early - stage endometrial carcinoma ( aalders , portec-1 , gog#99 , astec / en.5 , portec-2 , and sorbe ) [ 17 ] . the treated populations varied in all these studies from no risk groups defined ( aalders ) to a mixture of low - risk ( portec-1 , gog#99 ) [ 2 , 3 ] , medium - risk ( portec-1 , gog#99 , astec / en.5 , and portec-2 ) [ 25 ] , or high - risk cases ( astec / en.5 ) . type of primary surgery and staging also varied from no staging at all ( aalders , portec-1 , astec / en.5 , and portec-2 ) [ 1 , 2 , 4 , 5 ] to staging with lymph node sampling or complete lymphadenectomy ( gog#99 , astec / en.5 ) [ 3 , 4 ] . subgroup analyses performed within the frame of these studies have suffered from low power , and no level one data are presented for well - defined medium - risk or high - risk groups . three prospective randomized trials of low - risk , medium - risk , and high - risk cancers have been performed in sweden and some other european countries . vaginal brachytherapy , external beam pelvic radiation , and adjuvant chemotherapy were addressed in these studies . study a large , comprehensive , and consecutive series of more than 4,500 endometrial carcinomas in figo stages i iv were analyzed with regard to predictive and prognostic factors and definition of the risk groups used in the above mentioned three prospective randomized studies . special emphasis will be made on the prognostic value of dna ploidy and the importance of this factor in the risk group definitions . one swedish cancer center ( rebro ) for gynecological oncology recruited patients with all stages ( figo i iv ) of endometrial carcinomas in an observation study . the period of recruitment was from january 1975 to december 2009 . in all , 4,543 patients were included . postoperative external pelvic irradiation and/or vaginal brachytherapy were administered to the majority of the patients . the definition of high - risk carcinomas was as follows : ( 1 ) figo stage i , ( 2 ) nonendometrioid histological type , ( 3 ) presence of two of the following risk factors : figo grade 3 ( poorly differentiated ) , deep ( 50% ) myometrial infiltration , dna aneuploidy ( fcm ) , ( 4 ) nuclear grade 3 , ( 5 ) pathologically negative lymph nodes , and ( 6 ) negative abdominal cytology . points 5 - 6 were optional in this study , and data are not available for all cases . the definition of medium - risk carcinomas was as follows : ( 1 ) figo stage i , ( 2 ) endometrioid histological type , ( 3 ) presence of one of the following risk factors : figo grade 3 ( poorly differentiated ) , deep ( 50% ) myometrial infiltration , dna aneuploidy ( fcm ) , ( 4 ) nuclear grade 1 - 2 , ( 5 ) pathologically negative lymph nodes , and ( 6 ) negative abdominal cytology . points 5 - 6 were optional in this study , and data are not available for all cases . lymph vascular space invasion ( lvsi ) was not regularly included in the pathology reports at the participating centers and was not included in the definition of the medium - risk group . the definition of low - risk carcinomas was as follows : ( 1 ) figo stage i , ( 2 ) endometrioid histological type , ( 3 ) presence of none of the following risk factors : figo grade 3 ( poorly differentiated ) , deep ( 50% ) myometrial infiltration , dna aneuploidy ( fcm ) , or ( 4 ) nuclear grade 3 . the primary surgery was total abdominal hysterectomy , bilateral salpingo - oophorectomy , appendectomy , node sampling of enlarged lymph nodes , and peritoneal washing with cytology . lymphadenectomy ( pelvic paraaortic ) was not performed as a routine at the centers referring patients to the regional clinic . the surgery was performed at five departments of gynecology and obstetrics , but all patients were then referred to a gynecologic oncology department for postoperative evaluation and treatment . the median follow - up period at the time of analysis was 115 months ( range 1362 months ) for patients alive . during all visits , symptoms and signs related to the therapy were recorded , but in this study treatment - related side effects are not presented . for the brachytherapy treatments , plastic vaginal cylinders with a diameter of 20 mm , 25 mm , or 30 mm were used as standard . the diameter of the cylinder was individually chosen to ensure good contact between the surface of the applicator and the vaginal mucosa . the length of the vagina was measured from the vault to the level of introitus . the dose per fraction was specified at a depth of 5 mm from the surface of the vaginal cylinder with the hdr technique . library dose plans that covered different vaginal lengths in steps of 10 mm and the different diameters of the cylinders were used . the dose calculations were made on the nucletron planning system ( nps v. 10 ) and the plato brachytherapy planning system ( bps v. 14 ) at centers using this equipment . thus , the total doses delivered were 15.018.0 gy . recalculated to 2-gy - equivalent doses ( eqd2 ) , the total doses were 15.619.5 gy at a depth of 5 mm ( / = 10.0 ) . external beam therapy was given to patients with high - risk tumors and to many with medium - risk tumors . the target volume was the previous site of the uterus and adnexa , the parametria , the proximal two - thirds of the vagina , and the lymphatic drainage regions along the iliac vessels up to the promontory . the superior field border was set at the l5-s1 disk . the total dose to be delivered to this volume was 46 gy ( median dose 46.0 gy , range 650 gy ) and daily fractions of 1.82.0 gy ( table 3 ) . all data were collected in a computerized database at the regional oncology center , rebro , sweden . in the statistical analyses , survival curves were generated using the kaplan - meier technique , and differences were tested with the log - rank test . the pearson chi - square test was used for comparison of proportions and the independent t - test for comparing means of two groups . multivariate analysis of prognostic factors was performed using the cox proportional hazards model and logistic regression analysis . best subset analysis was performed with multivariate technique to find the most important prognostic factors and to find the most powerful combination of these factors . all p values were based on two - sided tests , with p < 0.05 considered statistically significant . the statistica software package ( statsoft , inc . , tulsa , ok , usa , version 10 , 2010 ) was used for the statistical analyses . the overall recurrence rate of the complete series was 519 out of 4,543 cases or 11.4% . the regional pelvic ( excluding vaginal recurrence ) recurrence rate was 2.3% ( 103 cases ) , and the locoregional ( vaginal or pelvic , or both ) recurrence rate was 4.2% ( 190 cases ) . distant recurrences ( outside the pelvic area ) were noted in 329 cases ( 7.2% ) , and the 5-year actuarial relapse rate was 6.6% . the median time to relapse in in the complete series , 370 out of 519 recurrences ( 71% ) occurred within 3 years and 445 recurrences ( 86% ) within 5 years . the median age of all patients was 67.0 years ( 2399 years ) , for those with recurrences was 68.4 years , and those without recurrences was 66.4 years . eight of these factors ( age , figo stage , histology , figo grade , nuclear grade , dna ploidy , myometrial infiltration , and p53 expression ) were analyzed in this study with regard to the risk of tumor recurrence , both total rate and locoregional and distant recurrences . in a multivariate logistic regression analysis , three of these factors ( figo grade , depth of myometrial infiltration , and dna ploidy ) were independent and statistically significant with regard to overall recurrence rate and distant recurrences ( table 5 ) . the fourth most important predictive factor was the nuclear grade ( best subset analysis ) . for locoregional recurrences no significant results were noted for these risk factors . in a model building analysis with best subset technique , the figo grade , depth of myometrial infiltration , and dna ploidy gave the best predictive information with regard to the risk of tumor recurrences . addition of further factors ( age , histology , nuclear grade ) only marginally increased the predictive value of the model . depth of myometrial infiltration was the second most important , and dna ploidy ( aneuploidy ) the third factor . in this series 23.7% of the tumors with evaluable dna status ( n = 1,613 ) were nondiploid ( aneuploid ) . at the last followup ( march 2010 ) , the number of patients alive was 2,764 ( 61% ) , dead of disease 819 ( 18% ) , and dead of intercurrent disease 960 ( 21% ) . the five - year actuarial overall survival rate was 73% and the cancer - specific survival rate was 83% . the salvage rate was 44% ( 38/87 ) after isolated vaginal recurrences , 20% ( 21/103 ) after pelvic recurrences , and 6% ( 19/329 ) after distant recurrences . eight prognostic factors were analyzed with cox proportional multivariate regression analyses and with overall and cancer - specific survival rate as the dependent variable . tumor stage ( stages iii - iv versus i - ii ) was the single most important factor with a risk ratio of 4.2 ( 95% ci 3.55.0 ) for advanced tumor stage . tumor grade ( grade 3 versus 1 - 2 ) was the second most important prognostic factor with risk ratio 2.5 ( 95% ci 2.13.0 ) . depth of myometrial infiltration had the lowest risk ratio 1.3 ( 95% ci 1.11.6 ) among the seven significant risk factors . the nuclear grade of the tumor was significant and independent of the figo grade in multivariate analysis . dna ploidy ( aneuploid versus diploid ) was also an important and significant prognostic factor with a risk ratio of 1.6 ( 95% ci 1.32.0 ) with regard to cancer - specific survival rate . the risk group definitions presented under material and methods were used in the complete series and for all stages together and for stage i alone . in the complete series , 54% of the cases fulfilled low - risk criteria , 23% medium - risk criteria , and 22% high - risk criteria . in stage i , the corresponding figures were 57% , 25% , and 17% , respectively . the discriminating power ( chi - square = 471.8 ; p < 0.000001 ) with regard to cancer - specific survival rate was very high both for the complete series and for stage i tumors alone . the 5-year survival rate in the high - risk group was only 50% in the complete series , and this group was very distinctly separated from the low - risk and medium - risk groups ( figure 1 ) . on the other hand , the difference in survival between the last two groups was only 10% at 5 years . if instead only two risk groups are used , which are proposed for preoperative risk group definitions , a 30% difference was noted in cancer - specific survival at 5 years , which was also highly statistically significant ( z = 22.948 ; p < 0.000001 ) . in figo stage i , the difference between the two groups was 20% ( 75% versus 95% ) ( z = 12.980 ; p < 0.000001 ) ( figure 2 ) . in the preoperative definitions , only three prognostic factors were used : histology ( nonendometrioid versus endometrioid ) , figo grade ( grade 3 versus 1 - 2 ) , and dna ploidy ( nondiploid versus diploid ) . it was not necessary to use myometrial infiltration , which is not a reliable prognostic factor assessed preoperatively . the optimal treatment of endometrial carcinoma patients have been vividly discussed and also studied in a number of randomized trials during the last decades [ 19 ] . before that , no consensus existed with regard to type of therapy , but the situation has changed , and our evidence - based knowledge in this field has improved substantially . however , still different conclusions are drawn from the available study data , and the optimal treatment of the various risk groups is continuously debated in various countries and in different centers . various definitions of the risk groups have confused the results , and conclusions drawn from the studies [ 25 , 79 ] . the portec-1 study included both low - risk ( grade 2 , superficial infiltration ) and medium - risk cases , and the astec / en.5 study included both medium - risk and high - risk cases . most authors agree that low - risk cases can be left with surgery alone [ 7 , 10 , 11 ] . still , vaginal brachytherapy is effective and will reduce the rate of vaginal recurrences in all risk groups , but from different levels . from a cost - effectiveness perspective , it seems reasonable to exclude the low - risk tumors from this type of adjuvant therapy . treatment of isolated vaginal relapse after surgery alone is effective in 89% ( complete remission ) with 65% survival rate . in the present study , the salvage rate was only 44% after vaginal recurrences . for medium - risk cases , a number of studies have focused on this risk group , but still with various definitions of this risk group ( medium - risk , low - medium risk , and high - medium risk ) [ 19 ] . a mixture of both low - risk and medium - risk cases has been studied as well as a mixture of medium - risk and high - risk cases . improved locoregional tumor control has been shown but so far no influence on survival [ 18 ] . from our country a randomized study has presented data for a pure medium - risk group that did include neither low - risk cases nor high - risk cases . the low - risk and high - risk groups have been studied separately in two other randomized protocols , and the results have been presented elsewhere [ 7 , 8 ] . the aim of the present study was to evaluate the prognostic value of the various clinical and histopathological factors commonly discussed in endometrial cancer and how to combine them into risk group definitions . proposals of pre- and postoperative risk groups are presented and tested in a large series of endometrial carcinomas comprising more than 4,500 patients . the only large study published before analyzing prognostic factors in endometrial cancer was the registry seer study , where 41,120 cases were included . figo stage , type of histology , figo grade , lymph node status , age at diagnosis , and race were found to be prognostic factors in that study . the 5-year actuarial locoregional recurrence rate was 3.6% , and the distant recurrence rate was 6.6% in our series . eight of twelve commonly used prognostic and predictive factors were analyzed in this study . with regard to recurrences figo grade , dna ploidy , and depth of myometrial infiltration were independent and significant predictive factors in a multivariate logistic regression analysis . a best subset analysis also confirmed that these three factors were the most important ones , and addition of further factors only marginally improved the predictive value of the model . the single most important factor was the figo grade , but it is important to point out that the dna ploidy , not so commonly used in the international literature , was one of the three most important predictive factors together with myometrial invasion to predict the risk of tumor recurrences , and especially distant recurrences . a number of studies from sweden [ 1417 ] have pointed out the prognostic importance of dna ploidy before , but this information does not seem to have been generally accepted and spread worldwide [ 25 ] . the 5-year actuarial overall survival rate in this series of patients was 73% , and the cancer - specific survival rate was 83% . the study covers a long time period , but in fact the overall survival did not change during the last three decades . changes in the treatment technique during these years seem to have had no impact on survival . cox proportional multivariate regression analysis was used to find out the most important prognostic factors with regard to the cancer - specific survival probability . eight factors were included in the model , and seven were found to be independent and significant . of the included factors only p53 expression was nonsignificant in these analyses . advanced versus early tumor stage was the single most important factor with a risk ratio of 4.2 , and figo grade was the second most important with a risk ratio of 2.5 . interesting findings were that the nuclear grade [ 14 , 15 ] was significant and independent of the figo grade , and the dna ploidy with a risk ratio of 1.6 was more important than myometrial invasion with a risk ratio of 1.3 . in fact , myometrial invasion had the lowest risk ratio of all seven analyzed and significant prognostic factors . tumor size and lymphovascular space invasion ( lvsi ) were not included in the present analyses , since these variables were not regularly reported by the departments of pathology during the extensive study period . tumor size with a cutoff level of 2 cm has been reported to be an important predictive factor in preoperative risk classification to define a low - risk group where lymph node dissection is not required . in another study tumor size lvsi has been pointed out as an important predictive factor associated with lymph node metastases and distant tumor spread [ 2022 ] . three risk groups were analyzed with the definitions used in our country during the last 20 years and also in three published randomized multicenter studies [ 79 ] . interesting to note is that 22% of all tumors belonged to a high - risk group with these definitions and 54% belonged to a low - risk group . the prognoses of the three groups are highly significantly different , and especially the high - risk group showed a poor prognosis with only 50% cancer - specific survival rate . these definitions and risk groups seemed to work out well to discriminate between patients , where surgery alone is enough ( low - risk cases ) , where vaginal brachytherapy should be added ( medium - risk cases ) , and where external beam radiotherapy and chemotherapy probably are the treatment options [ 79 ] . for preoperative risk group classification it is more convenient to use two risk groups . the aim of this classification is to sort out those patients requiring lymph node dissection from those who do not . myometrial invasion is an important predictive and prognostic factor but difficult to assess preoperatively in a reliable way . our multivariate analyses of this large series of patients have shown that myometrial invasion can be replaced by other prognostic factors without losing to much of prognostic information . the results from our analysis showed that histology ( nonendometrioid versus endometrioid ) , figo grade ( grade 3 versus grade 1 - 2 ) , and dna ploidy ( nondiploid versus diploid ) could be used to define two preoperative risk groups . these two risk groups discriminated well ( p < 0.000001 ) between low - risk and high - risk cases with a 30% difference in 5-year cancer - specific survival rate . using this definition , the preoperative high - risk group includes 27% of all new cases of endometrial cancer . in an italian study , preoperative risk classification was made using histology , tumor grade , myometrial invasion , cervical spread , and abdominal spread and correctly identified the postoperative risk classification in 96% with high sensitivity and specificity . the importance of dna ploidy as a predictive and prognostic factor in endometrial carcinoma [ 1417 , 24 ] and part of risk group classifications [ 79 ] is one of the most important results of this study . it is important to analyze large samples of endometrial carcinomas to sort out the most important and significant predictive and prognostic factors that should be used in future risk group classifications . it is also important for coming randomized studies that there will be an international consensus regarding the definition criteria to be used for the various risk groups . risk group definitions are important in the design of randomized studies in endometrial carcinomas . up to now some confusion exists in these definitions in published randomized studies making firm conclusions and comparisons difficult . three risk groups seem reasonable to use in the postoperative setting , but probably only two in the preoperative classification . our study has shown that dna ploidy is an important predictive and prognostic factor and if used in combination with the figo grade and type of histopathology can replace myometrial invasion in definition of preoperative high - risk cases needing more extensive surgery .

background . the aim was to evaluate predictive and prognostic factors in a large consecutive series of endometrial carcinomas and to discuss pre- and postoperative risk groups based on these factors . material and methods . in a consecutive series of 4,543 endometrial carcinomas predictive and prognostic factors were analyzed with regard to recurrence rate and survival . the patients were treated with primary surgery and adjuvant radiotherapy . two preoperative and three postoperative risk groups were defined . dna ploidy was included in the definitions . eight predictive or prognostic factors were used in multivariate analyses . results . the overall recurrence rate of the complete series was 11.4% . median time to relapse was 19.7 months . in a multivariate logistic regression analysis , figo grade , myometrial infiltration , and dna ploidy were independent and statistically predictive factors with regard to recurrence rate . the 5-year overall survival rate was 73% . tumor stage was the single most important factor with figo grade on the second place . dna ploidy was also a significant prognostic factor . in the preoperative risk group definitions three factors were used : histology , figo grade , and dna ploidy . conclusions . dna ploidy was an important and significant predictive and prognostic factor and should be used both in preoperative and postoperative risk group definitions .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

fistula - in - ano is an abnormal hollow tract lined by unhealthy granulation tissue connecting a primary opening in the anal canal to a secondary opening in the perianal skin . the fistula tract may be single or multiple and may extend from the same primary opening . it is nearly always caused by a previous anorectal abscess , following either poor surgical or spontaneous drainage in the perianal skin . men are involved in 70% of cases and the majority of cases present initially in the 3 to the 6 decade , which incidentally coincide with the mean age occurrence of fournier 's gangrene . fournier 's gangrene , which was first described by jean alfred fournier in 1883 , is an infective necrotizing fasciitis of the perineal , genital or perianal regions as a result of subcutaneous vascular thrombosis and resulting in gangrene of the overlying scrotal skin . fistula - in - ano and fournier 's gangrene still continue to pose management challenges to surgeons . however , there has been no report on management of this concomitant occurrence of these diseases . this is a retrospective study of all fistulas - in - ano complicated by fournier 's gangrene managed in university of maiduguri teaching hospital and federal medical center yola and gombe within a period of 5 years ( january 2007 to december 2011 ) highlighting the causal relationship . the case files of all patients with the diagnosis of fistula - in - ano complicated by fournier 's gangrene during the study period were retrieved from the central medical records department of these hospitals . information retrieved includes the demographic data , mode of presentation , type of infecting organisms , co - morbidity illnesses , nature and outcome of treatment . data analysis was carried out using the statistical package for the social sciences version 16 ( spss 16 ) to determine the level of significance and correlations with the variables . a total of 10 male patients who developed fistula - in - ano and then complicated by fournier 's gangrene with a mean age of 50.5 ( 50 - 59 ) years were managed within the period of 5 years [ table 1 ] . nearly , 50% of patients were peasant farmers , 30% businessmen and 20% were civil servant . all patients presented with initial perianal pain , external opening and discharge and then followed by scrotal swelling and high grade fever [ table 2 ] . nearly , 70% of these patients presented with fournier 's gangrene within 1 - 4 weeks of development of fistula - in - ano , which were preceded by perianal abscess and the rest within 8 weeks [ table 3 ] . fistula - in - ano was submuscular ( intersphincteric ) , 30% subcutaneous with straight anterior external opening and 10% were complex or recurrent running curved course from internal posterior to anterior external opening [ figure 1 ] . age distribution of 10 patients with fistula - in - ano and fournier 's gangrene major clinical features of 10 patients with fistula - in - ano and fournier 's gangrene duration of symptoms prior to presentation of 10 patients with fistula - in - ano and fournier 's gangrene types of fistula - in - ano with fournier 's gangrene at presentation of the 10 patients nearly , 40% of these patients had initial nick for drainage of their perianal abscess and 20% incision and drainage ( i and d ) , but 40% came with spontaneously ruptured perianal abscess , which developed fistula - in - ano and then fournier 's gangrene with no initial treatment [ table 4 ] . types of treatment prior to presentation of 10 patients with fistula - in - ano and fournier 's gangrene all patients were given adequate intravenous fluid and parenteral antibiotics before definitive treatment . 20% of patients had fistulotomy and seton ( rubber band ) application for adequate drainage . in 50% of patients mucosal advancement flap was done to close the internal opening of the fistula , but 30% had fistulotomy and sitz bath [ table 5 ] . types of procedure and surgery for 10 patients with fistula - in - ano and fournier 's gangrene there is a significant relationship between initial treatments , type of fistula - in - ano , durations of the clinical features type of definitive surgical procedure carried out and the outcome [ table 6 ] . the paired t samples tests of association of durations and the clinical features with other variables if the cryptoglandular abscess is either poorly drained or spontaneously ruptures through the perianal skin , then becomes fistula in 50% of patients . severe polymicrobial synergistic infection from the gut flora can cause an extensive subfascial tissue necrosis involving the scrotum , fournier 's gangrene [ figure 2 ] , which is an unusual complication of fistula - in - ano . other common causes of anal fistula include chronic ulcerative colitis , crohn 's disease , tuberculosis , carcinoma of the rectum or anal canal , benign rectal strictures , foreign bodies or diverticulitis . cryptoglandular fistula with fournier 's gangrene fournier 's gangrene , which was thought to be idiopathic by jean alfred fournier ( 1883 ) is now known to have definite etiology and is characterized by obliterative endarteritis causing cutaneous and subcutaneous vascular thrombosis and tissue necrosis , then invaded by polymicrobial enterobacteria . in our region , staphylococcus and proteus species are the commonest mixed growth infection and quinolones ( ciprofloxacin and ofloxacin ) are the most potent antibiotics in treating these infection . urogenital foci such as urethral stricture , indwelling urethral catheter , prostatic message and biopsy are the most common primary adjacent focus of fournier 's gangrene and in africa immunosuppressive illnesses such as diabetes mellitus , human immunodeficiency virus infection , filarial infestations and low socio - economic status contributed to the high prevalence of the disease . in these patients , 50% are in the low socio - economic category , however , 80% of them were otherwise healthy without immunosuppressive illnesses . usually , fournier 's gangrene is presented in the acute form , but recently it runs an indolent course , which some studies attributed it to immunosuppressive comorbidities ; however in our series , it 's probably due to suboptimal antibiotic therapy and delay in referral . these patients presented with high grade fever associated with rigors and sweating , some of them delirious . nearly , 60% of the patients either had a perianal nick [ figure 3 ] or inadequate i and d [ figure 4 ] and 40% had a prior history of spontaneous rupture and discharge from a perianal abscess with worse clinical symptoms . nick of perianal abscess and fournier 's gangrene inadequate perineal abscess drainage and fournier 's gangrene the parks classification system divided fistula - in - ano resulting from cryptoglandular infections as intersphincteric , transsphincteric , suprasphincteric and extrasphincteric , however , the current procedural terminology codes classification include subcutaneous fistula resulting from unhealed anal fissure or anorectal procedures such as hemorrhoidectomy , submuscular fistula ( intersphincteric , low transsphincteric ) and complex fistular , recurrent ( high transsphincteric , suprasphincteric and extrasphinteric , multiple tracts , recurrent ) . majority of fistula - in - ano can be diagnosed based on clinical history and physical examination , however , in cases associated with multiple or complex problems such as a horse shoe abscesses or recurrent complex fistula - in - ano , rectal cancer or crohn 's disease , diagnostic imaging such as transrectal ultrasound , computed tomography scan or magnetic resonance imaging would be required . the parenteral antimicrobials ciprofloxacin and metronidazole were given based on the sensitivity pattern of the microbial pathogens in our region . some of the patients had extensive debridement from the perianal region up to the scrotum and groins leaving the testes bare [ figure 5 ] . hypertonic saline soaking ( sitz bath ) and wound dressing were continued mornings and evenings until the wounds were cleaned and granulated in 2 - 4 months [ figures 6 and 7 ] . if patient presented early with cryptoglandular infection and perianal abscess , the abscess is immediately drained by either radial perianal incision or adequate cruciate incision with unroofing the abscess cavity . these procedures allow adequate abscess drainage and are performed close to anal verge in order to allow fast healing . it is rare for fistula to heal spontaneously even with antibiotic therapy . in order to heal , the internal opening ( crypt ) should be obliterated and therefore operative procedure is necessary . if the internal opening identified , the tract should be probed to clarify and a seton suture of silk passed through to serve as a drain until definitive treatment can be done . nearly , 40% of these patients had a nick of the abscess cavity as primary treatment , which was inadequate i and d and 40% had spontaneous rupture of the abscess cavity . these made perineal spread of the infection rapid and thus prolonged period of patient 's management and increased risk of mortality . although 20% of the patients had adequate i and d , but yet developed a complication of fournier 's gangrene , probably would have benefited from closure of the internal opening as part of primary treatment . extensive perineal and scrotal debridement with bare testes cleaned granulated scrotal and perineal wound ready for grafting healing anal fistula and scrotal wound with continuing sitz bath the operative goals for subcutaneous and submuscular fistulae are to open the tract and remove tract lining either by curettage or electrocautery . the complex or recurrent fistulae may be treated by either non - cutting setons , fibrin glue , ablation , rectal mucosal advancement flap , anal fistula plugs or combination of these in order to avoid sphincter muscle division and its attendant fecal incontinence complication . fistulotomy is a preferred procedure for subcutaneous and submuscular fistulae whether complicated or not and has 3 - 5% risk of flatus and stool leakage and with more muscle cutting fecal incontinence may develop . majority of the patients had their scrotal wounds healed spontaneously with continuing sitz bath [ figure 7 ] , but those with more extensive perineal wound had mesh skin grafting [ figure 8 ] . patients were followed - up over a year with no history of fecal incontinence or fistula recurrence . cryptoglandular infection is an important cause of perianal abscess and fistula - in - ano when poorly managed can lead to fournier 's gangrene , which is a urological emergency . early adequate parenteral antibiotic therapy , primary surgical treatment including closure of internal opening ( crypt ) can prevent serious complications like fournier 's gangrene .

background : fistula - in - ano when complicated by fournier 's gangrene is an unusual finding and always carries high morbidity . this study details our experience in managing 10 cases.methods of study : case files of all patients managed in university of maiduguri teaching hospital and federal medical center of yola and gombe from january , 2007 to december , 2011 were retrieved from medical record departments and other hospital records . these were analyzed for demographic , clinical and pathological variables , the type of treatment and follow-up.results:a total of 10 men with a mean age of 50.5 years ( 35 - 60 ) were managed in the period of study . nearly , 50% of the patients were farmers , 30% businessmen and 20% were civil servant . 7 ( 70% ) of these patients presented with fournier 's gangrene within 4 weeks of development of fistula - in - ano and the rest within 8 weeks . 4 ( 40% ) of these patients had inadequate drainage of their perianal abscess and 2 ( 20% ) had incision and drainage . another 4 ( 40% ) had spontaneously rupture of the perianal abscess . 6 ( 60% ) of the fistula - in - ano was submuscular , 30% subcutaneous and 10% were complex or recurrent . nearly , 20% of patients had fistulotomy and seton application for adequate drainage . mucosal advancement flap was performed in 5 ( 50% ) and fistulotomy in 3 ( 30% ) patients . another 30% had fistulotomy and continuing sitz bath.conclusion:cryptoglandular infection is an important cause of perianal abscesses and fistula - in - ano and if poorly managed results in fournier 's gangrene . early broad spectrum parenteral antibiotic therapy and primary surgical treatment can prevent fournier 's gangrene .

I M R D C

congenital coarctation of the aorta is a narrowing of the descending aorta which typically is located at the ligamentum arteriosum just distal to the left subclavian artery . this condition may be undiagnosed until adult life , when the clinical presentation most often is high blood pressure ( bp ) in both or more seldom in only one of the upper extremities . other typical clinical manifestations may include headache , fatigue on exertion , and bilateral lower limb claudication . coarctation of the aorta occurs in 5 - 8% of cases of congenital heart defects . this condition may occur along with ventricular septal defect and other related heart defects , or may occur isolated . in rare cases , severe trauma and injury may lead to coarctation of the aorta . in extremely rare cases , severe atherosclerosis or inflammatory diseases of the aorta may cause narrowing of the artery leading to aortic coarctation . a 57-year - old patient was referred to our outpatient clinic by his primary care physician because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy . twenty - two years earlier , the patient had been referred for cardiological examination due to a cardiac systolic murmur . at that time , his bp was 98/50 mmhg , and simultaneous and equal radial and femoral pulses were described . no medical or cardiovascular history or cardiovascular risk factors were present , and the patient had no signs of genetic disorders . at the present consultation , the patient confirmed the absence of any cardiovascular symptoms . transthoracic echocardiography showed a non - dilated , hypertrophic left ventricle [ figure 1a and b ] with end - diastolic interventricular septal thickness of 21 mm , end - diastolic lv posterior wall thickness of 12 mm , and an estimated lv mass of 449 g ( lv mass index 214 g / m ) . the lv ejection fraction was 50% . except for a mild aortic regurgitation ( in a normally shaped tricuspid aortic valve ) and a dilatation of the ascending aorta of 40 mm a continuous wave doppler examination from the suprasternal notch showed a peak systolic pressure gradient in the thoracic descending aorta of 80 mmhg without diastolic run - off [ figure 1c and d ] , indicating a severe obstruction at the classical site of a coarctation . multislice computed tomographic ( ct ) angiography confirmed the finding of severe coarctation of the aorta . the ct scan demonstrated that both subclavian arteries originated distal to the severe coarctation , explaining the normal bp in both arms [ figure 2 ] . moreover , a ct scan of the cerebrum revealed the vessels in the circle of willis giving rise to numerous collaterals in the brain circulation . 57-year - old male was referred to our outpatient clinic because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy that was later diagnosed as due to congenital coarctation of the aorta . transthoracic echocardiography ( a ) apical four - chamber view and ( b ) m - mode show left ventricle hypertrophy ( arrows ) ; ( c and d ) suprasternal views show the narrowing in the thoracic descending aorta ( arrow ) and the continuous wave doppler curve without diastolic run - off ( arrow ) . 57-year - old male was referred to our outpatient clinic because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy that was later diagnosed as due to congenital coarctation of the aorta . we report an uncommon case of congenital coarctation in a 57-year - old man without the clinical signs of coarctation . because of the uncommon location of the aortic narrowing with both the right and left subclavian arteries originating distal to the area of coarctation , the bp was equally low in both upper extremities . the present case shows that a normal brachial bp does not rule out severe coarctation and should be considered in apparently normotensive patients presenting with a systolic murmur or target organ damage , in this case severe lv hypertrophy . uncorrected coarctation of the aorta in adults predisposes to congestive heart failure , aortic dissection and rupture , stroke , cerebral hemorrhage , and infective endocarditis . therefore , an early diagnosis is important , and the present case emphasizes the use of suprasternal view as a part of a standard diagnostic echocardiography . treatment options include surgical repair or balloon angioplasty with or without stent implantation . taking the atypical location , extent , and complexity of the lesion into account ,

the present case shows that a normal brachial blood pressure ( bp ) does not exclude severe coarctation and should be considered in normotensive patients presenting with a systolic murmur and/or unexplained severe left ventricular hypertrophy . congenital coarctation of the aorta is a narrowing of the descending aorta , usually located distal to the origin of the subclavian artery , causing hypertension in the upper part of the body . this condition may be undiagnosed until adult life where the clinical presentation most often is high bp in the upper extremities . a 57-year - old patient with severe aortic coarctation and left ventricular hypertrophy presented with normal brachial bp . however , standard suprasternal view by echocardiography indicated coarctation . multislice computed tomographic ( ct ) angiography revealed an uncommon location of the aortic narrowing with the right and left subclavian arteries originating below the area of coarctation , explaining the equally low bp in both upper extremities .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

multistep skin carcinogenesis assays were performed with mice with keratinocyte - specific deletion of the cnb1 gene ( cnb1xk5-crepr1)3 in parallel with cre - negative controls ( cnb1 ) . detailed conditions for these assays as well as chromatin immunoprecipitation , immunoblotting , immunofluorescence , senescence -galactosidase staining , biotinylated dna pull down assays , and sorting can be found in the method section and supplementary figure legends .

calcineurin inhibitors such as cyclosporin a ( csa ) are the mainstay of immunosuppressive treatment for organ transplant recipients . squamous cell carcinoma ( scc ) of the skin is a major complication of treatment with these drugs , with a 65100 fold higher risk than in the normal population1 . by contrast , the incidence of basal cell carcinoma ( bcc ) , the other major keratinocyte - derived tumour of the skin , of melanoma and of internal malignancies increases to a significantly lesser extent 1 . here we report that genetic and pharmacological suppression of calcineurin / nfat function promotes tumour formation in mouse skin and in xenografts , in immune compromised mice , of h - rasv12 expressing primary human keratinocytes or keratinocyte - derived scc cells . calcineurin / nfat inhibition counteracts p53-dependent cancer cell senescence thereby increasing tumourigenic potential . atf3 , a member of the enlarged ap-1 family , is selectively induced by calcineurin / nfat inhibition , both under experimental conditions and in clinically occurring tumours , and increased atf3 expression accounts for suppression of p53-dependent senescence and enhanced tumourigenic potential . thus , intact calcineurin / nfat signalling is critically required for p53 and senescence - associated mechanisms that protect against skin squamous cancer development .

Methods summary Supplementary Material

micrornas ( mirnas ) are single stranded non - coding rna molecules of 22 nucleotides ( nt ) that regulate gene expression via post - transcriptional and/or translational repression ( ambros , 2004 ) . primary mirna ( pri - mirnas ) are transcribed in the nucleus by rna polymerase ii or iii , where 70 nt stem - loop mirna precursors ( pre - mirnas ) are subsequently excised by the microprocessor complex containing the rnase iii enzyme drosha , and exported to the cytoplasm via exportin-5 ( kim et al . , 2009 ) . dicer , another rnase iii enzyme , further processes pre - mirnas to produce mature mirnas , the final product being a 22 base - pair duplex with 2 nt - long 3 overhangs ( he and hannon , 2004 ) . then , one strand of the mature mirna is loaded onto argonaute ( ago , also known as eif2c ) , a core protein of the rna - induced silencing complex ( risc ) . mirna forms base pairs with a target mrna as a guide for ago binding and to direct the specificity of the risc effector , decreasing target mrna levels and/or its translation ( fabian et al . , 2010 ) , where mrna destabilization is the dominant mechanism ( eichhorn et al . , 2014 ; guo et al . , mirnas are abundant in the mammalian genome ( more than 2000 human mirnas are currently reported in mirbase ) ( kozomara and griffiths - jones , 2014 ) and their regulatory role is essential , affecting various biological phenomena ( kim , 2005 ; sim et al . , 2014 ) . supporting evidence derives from the fact that a lethal phenotype during early development was observed in dicer1-null ( bernstein et al . , 2003 ) or ago2-null ( liu et al . , 2004 ) mice , and various biological defects were also reported after losses of individual mirnas ( park et al . , 2010 ) . in addition , alterations of mirna regulation are related to many diseases such as neurological disorders ( hebert and de strooper , 2009 ) , various types of cancer ( croce , 2009 ) , and cardiovascular diseases ( olson , 2014 ) . importantly , all of these defects were ultimately caused by a dysregulation in target gene expression . however , the limitation here is our ability to delineate a general principle for identification of specific rna targets upon which mirnas act . the problem stems from the observation that most of mirna target sites have partial complementarity ( ambros , 2004 ) . in contrast to plants , a near - perfect base pairing of mirna to its target is rare in animals , making it a challenge to predict the target sites ( bartel , 2009 ) . however , initial prediction attempts provided evidence that local short stretches ( 6 nt ) of consecutive base - pairing significantly contribute to target recognition ( john et al . , 2004 ; krek et al . , 2005 ; lewis et al . conceptually termed as the nucleus , the short consecutive matches could initiate a mirna - target duplex , followed by the propagation of partial annealing that may further stabilize mirna - target hybridization ( filipowicz , 2005 ; rajewsky , 2006 ) . intriguingly , nuclei were further found to be typically located in the 5 end region of mirnas called the seed , enabling the prediction of mirna target sites ( lewis et al . , functional mirna - target interactions are known to majorly require as few as 6-nt matches within the seed region ( position 2 - 8 , fig . there are possible 6-mers ( positions 16 , 27 , and 38 ) , 7-mers ( positions 28 and 17 ) , and 8-mer ( position 18 ) matches in the seed . otherwise , offset 6-mer seed because of its position and a marginal effect on repression ( friedman et al . , 2009 ) . such canonical seed sites were initially known by early biological studies ( lee et al . , 1993 ; poy et al . , 2004 ; wightman et al . , 1993 ) , which were further validated by microarray experiments that detected enrichment of seed matches in mirna - dependent transcripts showing repression ( grimson , 2007 ; lim , 2005 ) , and also by bioinformatics analyses , which found widespread conservation of seed sites in 3 untranslated regions ( 3 utrs ) in multi - genome sequences ( lewis et al . , 2005 ; xie et al . , 2005 ) . seed - pairing rules have been informative in prediction and analysis of canonical seed sites , often in combination with evolutionary conservation ( friedman et al . , 2009 ; lewis et al . , 2005 ) , secondary structure ( long et al . , however , since a 6 nt match presents on average every 4,000 nt , likely to be occurred often by chance , such strategies still suffer from both false - positive ( 4066% ) and false - negative predictions ( 5070% ) ( mourelatos , 2008 ) even in the usage of microarray or proteomic approaches ( baek et al . , seed - pairing rules can not identify non - canonical target sites , which have been reported as functional ( brodersen and voinnet , 2009 ) . since seed - pairing rules are widely adopted , there has been an unintentional bias to study only the canonical seed matches , overlooking the non - canonical targets . nevertheless , several biological studies have functionally validated that perfectly matched mirna seeds are neither necessary nor sufficient for all functional mirna - target interactions ( brodersen and voinnet , 2009 ) . for example , supplementary components in near - perfect sites compensate for imperfect seed matches and are functional for target cleavage ( mir-196 for hoxb8 , fig . 1b ) as well as the wobble ( g : u pairing ) in seed sites of lin-41 with 3 compensatory pairings ( vella et al . , lsy-6 can also tolerate wobble paring in the seed to downregulate its target , cog-1 ( didiano and hobert , 2006 ) . in mammals , nanog , oct4 and sox2 genes , well - known regulators generating induced pluripotent stem ( ips ) cells , have been shown to contain functional wobble ( mir-296 for nanog , fig . 1b ) and bulge pairing sites for cognate mirna seeds ( mir-134 , mir-296 , and mir-470 ) , harboring a few cases in their coding sequences ( cds ) ( tay et al . , in contrast to a fruit fly genetic study where 3 compensatory sites were shown to be as functional as the 5 dominant canonical seed sites ( brennecke et al . , 2005 ) , such non - canonical mirna target sites were revealed to be rare in mammals ( less than 5% ) ( friedman et al . , 2009 ) and their effects were modest ( grimson , 2007 ; wee et al . , 2012 ) . when seed - pairing rules were applied , putative mirna targets from microarrays that showed mirna - dependent repression were often demonstrated to have high false - negatives , implicating prevalent usage of non - canonical target sites . in lieu of this , microarray analysis of mir-24-transfected k562 cells found that several mir-24 targets are repressed through non - canonical sites , named seedless 1b ) ( lal et al . , 2009 ) . in addition , centered sites , comprising 1112 consecutive base - pairing to the center of mirna , were also identified by the analysis of microarray data where neither perfect seed nor 3 compensatory pairing was observed ( fig . however , the limitation of such studies is that , lacking information on precise binding sites , they are unable to distinguish between direct and indirect mirna targets . uncertainty in direct mirna target sites necessitates the development of experimental methods capable of recovering mirnas physically associated with their targets ( easow et al . , 2007 ) . initially , biochemical isolation of mirna - mrna complexes via ago protein - specific immunoprecipitation was attempted in order to purify mrnas bound by ago - mirna ( easow et al . , 2007 ; hammell , 2008 ; hendrickson et al . , 2008 ; karginov , 2007 ) . however , the integrity of the approach was questioned because of the possible high background caused by nonspecific rna - protein interactions , especially mediated by in vitro rearrangements in the ago - rna complex ( mili and steitz , 2004 ; riley et al . , 2012b ) . however , the cross - linking and immunoprecipitation ( clip ) method that uses ultraviolet ( uv ) irradiation to crosslink rna - protein complexes in direct contact within approximately single angstrom distances in living cells , can secure specific rna - protein interactions by allowing stringent purification ( ule , 2003 ) . combined with high - throughput sequencing ( hits - clip ) ( licatalosi , 2008 ) , it was successfully applied to ago ( ago hits - clip ) to produce transcriptome - wide information of mirna binding sites ( chi et al . , 2009 ) . the novelty lies not only in providing direct mirna target sites , but also in accomplishing high target specificity ( 93% ) , low false - positives ( 1327% ) , and low false - negatives ( 1525% ) ( chi et al . , furthermore , by analyzing crosslinking - induced mutation sites ( cims ) , footprints of ago - mirna binding regions ( 4562 nt ) became available at single nucleotide resolution ( zhang and darnell , 2011 ) . a modification of this method , par - clip ( photoactivatable - ribonucleoside - enhanced crosslinking and immuno - precipitation ) , used a nucleoside analog that improved the efficiency of uv crosslinking and subsequent mutations ( hafner et al . , 2010 ) , and iclip ( individual - nucleotide resolution uv crosslinking and immunoprecipitation ) analyzed truncated cdnas at the position of the protein - rna crosslink sites ( konig et al . , 2010 ) . ago hits - clip was the first to offer a general means of mapping precise mirna target sites and has been widely applied to cultured cells ( haecker et al . , 2012 ; hafner et al . , 2010 ; kim et al . , 2015 ; kishore et al . , 2011 ; leung et al . ; loeb et al . , 2012 ; riley et al . , 2012a ; xue et al . , 2013 ) , tissues ( boudreau et al . , 2014 ; chi et al . , 2009 ; kameswaran et al . , 2014 ) , and even to a whole organism ( c. elegans ) ( grosswendt et al . , 2014 ; zisoulis et al . , 2010 ) it also provides an opportunity to analyze general properties of mirna - target interactions in an unbiased and transcriptome - wide manner . intriguingly , ago hits - clip analysis revealed that not all identified direct ago - target interactions follow canonical seed - pairing rules ( chi et al . indeed , seed matches for 90% of ago - bound mirnas only explain 73% of ago - mrna interactions in the mouse brain , and the rest of 27% are orphans with no predicted seed matches , strongly suggesting that non - canonical mirna target sites might be prevalent in vivo . non - canonical mirna - target sites called nucleation bulges were identified by analyzing ago hits - clip orphan clusters ( chi et al . , 2012 ) . initially , g - bulge sites for mir-124 were found to be abundant in the mouse brain , where the target sites matched to the seed ( positions 27 ) contained a bulged - out g nucleotide corresponding to position between 5 and 6 of the mirna ( mir-124 for mink1 , fig . upon further analysis , a general rule governing such non - canonical interactions , called the pivot pairing rule , was proposed ( fig . this rule dictates that the nucleotide composition in the bulge position should be determined by the base - pairing competency to a nucleotide in position 6 of the mirna , named pivot to confer the thermodynamic stability on the consecutive 5 base pairs of nucleation ( termed nucleation bulge ; figs . otherwise , the base - pair - mediated interaction of only the 4 nt resulting from the non - competent nucleotide in the pivot ( non - nucleation bulge ) is unstable and not functional . well accommodates a canonical interaction mode through nucleation pairing in position 26 , which is followed by the propagation to position 68 of the mirna ( fig . application of the pivot pairing rule successfully decoded the non - canonical nucleation bulge sites , comprising 15% of all ago - mirna - mrna interactions in the mouse brain ( chi et al . , nucleation bulge sites were also observed in ago hits - clip analyses performed in the human brain ( boudreau et al . , 2014 ) and several cell lines ( hafner et al . , 2010 ) . in addition , their sequences are evolutionally conserved ( chi et al . , 2012 ) . the pivot pairing rule improved both quality and quantity of mirna target sites in their identification ( stefani and slack , 2012 ) since it can serve as a general rule that can be incorporated in any computational analysis ( kim et al . , 2013 ) . in addition to nucleation bulges , seed - like motifs that contain mismatches in seed pairing were found by examining differential ago hits - clip binding sites in mir-155 deficient t cells ( mir-155 for gimap3 , fig . 1c ) , indicating that 20% of ago - mir-155 binding sites contain seed - like motifs ( loeb et al . , 2012 ) . recent variants of ago hits - clip , which can directly sequence the binding sites together with mirnas by inducing ligation between mirnas and their target rna sites , also confirmed the widespread occurrence of non - canonical seed - like motifs including some nucleation bulges initially , clash ( cross - linking , ligation , and sequencing of hybrids ) identified that 60% of seed interactions are seed - like motifs in hek293 t cells ( helwak et al . , soon after , modified par - clip and analyses of mirna - target chimeras in ago hits - clip showed that 30% of mirna - target chimeras were also seed - like motifs more recently , clear - clip ( covalent ligation of endogenous argonaute - bound rnas ) also reported the same observation ( moore et al . , 2015 ) . although most of the non - canonical interactions were identified by ago hits - clip , it would be difficult to explain their occurrence through globally applicable rules . however , non - canonical nucleation bulges could be governed by a general rule of pivot pairing , leading to further insights into mirna - target recognition within other similar transcriptome - wide non - canonical interactions . 2 ) ( chi et al . , 2012 ) . combining the concepts of a nucleus ( filipowicz , 2005 ; rajewsky , 2006 ; tomari and zamore , 2005 ) and findings from structural studies for recognition mechanisms of ago silencing complexes - nucleation , propagation and cleavage of target rnas ( schirle et al . , 2014 ; wang et al . , 2009 ) , transitional nucleation is defined as a transient mirna - target duplex with a 5-base - paired nucleation ( position 26 ) ( fig . if the transitional nucleation becomes sufficiently stable to form , this state may be further transformed into a bulge formation where the originally matched pivot nucleotide in position 6 becomes bulged - out and subsequently extended to hybridization towards the 3 end of the mirna ( further than position 6 , fig . this model is also well supported by several structural studies of ago ( elkayam et al . , 2012 ; nakanishi et al . , 2012 ; schirle and macrae , 2012 ) where nucleotides poised for transitional nucleation ( position 26 ) are particularly prearranged becoming a - form helical structures , which are susceptible for base pairing . intriguingly , such a - form - like helical geometry is disrupted after a pivot ( between position 6 and 7 ) formed by a kink resulting from the insertion of the amino acid isoleucine ( i365 ) from the human ago2 protein ( elkayam et al . thus , in theory , any target site pairing to the seed region ( either a seed match or a nucleation bulge ) requires a shift of this nuclear helix to overcome the kink . in support of this model , single - molecule analysis showed such stepwise processes whereby ago2 initially scans for target sites using a small region ( position 24 ) ( chandradoss et al . , 2015 ) and subsequently mediates a rapid and stable binding to the seed region of a mirna ( jo et al . , 2015 ; salomon et al . , 2015 ) , serving as a proofreading procedure for target recognition ( yao et al . , 2015 ) . mirna is reshaped by loading onto ago , being divided into several functional domains - the anchor , seed , central , 3 supplementary , and tail regions ( fig . 3 ) ( salomon et al . , 2015 ; schirle et al . , 2014 ; wee et al . , 2012 ) . importantly , the seed region has two prearranged continuous base stacking configurations ( positions 26 and 79 ) caused by kinks at nucleotides 67 and 910 ( fig . 3a ) ( elkayam et al . , 2012 ; schirle and macrae , 2012 ; schirle et al . , 2014 ) . therefore , transitional nucleation starts pairing through helix 26 and subsequently propagates to helices 79 , overcoming the kink at 67 for cases of 5 dominant interactions ( fig . 3b ) , such as the seed ( bartel , 2009 ) or nucleation bulge sites ( chi et al . , the opposite may also happen for central dominant interactions ( shin et al . , 2010 ) - the interaction could be initiated by paring through helix 79 along with the central region ( positions 1012 ) and further expand up to the 3 supplementary region ( positions 1316 ) ( fig . 3c ) . in this case , crossing the barrier of the kink at position 910 may be required . for seed - like motifs , where seed sites contain mismatches , deletions , or wobble pairings ( grosswendt et al . , 2012 ; moore et al . , 2015 ) , transitional nucleation may require 3 compensatory interactions ( fig . 3d ) , which could be a general determinant of additional specificity for ago binding as shown by clear - clip ( moore et al . , 2015 ) . biological systems initially generate marginally effective non - canonical regulations when existing biological mechanisms require alternative strategies to compensate for what major canonical pathways have been unable to accomplish . followed by this notion , majority of non - canonical mirna - target sites were shown to mediate gene repression at a modest level ( chi et al . , 2012 ; , 2009 ; loeb et al . , 2012 ; moore et al . , 2015 ) only except for centered sites ( shin et al . , 2010 ) , which can trigger slicing activity of ago but only exist as few in whole transcriptome . however , such modest repression , shown by which the most of non - canonical target sites including nucleation bulges for mirnas , was often observed as insignificant in large - scale gene expression analyses ( agarwal et al . , 2015 ) . these were possibly because the marginal repression was confounded by the issue of cellular heterogeneity , variability derived from secondary effects of target repression , and differences in sensitivity and threshold used in the analyses , or non - canonical sites identified by ago clip based methods could be the true interaction but may not be always functional as the consequence of transient bindings for searching targets ( chandradoss et al . , 2015 ) or as requiring combinatorial occurrences of target sites ( krek et al . in fact , evaluation of target repression at individual single cell level ( moore et al . , 2015 ) and gene expression analyses in combination with clip data ( chi et al . , 2012 ; , 2013 ; loeb et al . , 2012 ; moore et al . , 2015 ) did observe significant repression mediated by non - canonical sites albeit the effect is still marginal . since clip data only indicate the direct bindings , they should be analyzed together with gene expression data to access the functionality . future studies should be performed carefully to clear out such issues whenever they analyze marginal effects from non - canonical interactions . the modest effects from the widespread non - canonical sites are likely to be caused by reduced numbers of targets bound by ago - mirna ( chi et al . , 2012 ; grosswendt et al . , 2014 ; , 2012 ; moore et al . , 2015 ) probably due to low binding affinity . in support of this , any mismatches or wobbles in the seed region decrease target binding but enhance the turnover of the risc complex ( wee et al . , 2012 ) , suggesting that non - canonical binding can induce intermediate affinity without affecting the concentration of the ago complex . additionally , this may be a mechanism that provides an unbound ago - mirna complex to adjacent target sites , as shown by the single - molecule analysis where the lateral diffusion from weakly bound ago promoted cooperation between neighboring target sites ( chandradoss et al . , 2015 ) . as a result , combination of canonical and non - canonical sites may provide a variety of spectra in the regulation of gene expression , enabling a fine - tuning of repression activity . moreover , relative to canonical seed sites , non - canonical sites have modest sequence conservation across species ( chi et al . , 2012 ; , 2012 ; moore et al . , 2015 ) , suggesting that they may be evolutionary intermediates under selective pressure for a shift towards high affinity seed sites . in addition , gene ontology analysis of ago hits - clip showed that the majority of non - canonical targets have similar functions to the canonical ones , although they are slightly different in detail ( chi et al . , 2012 ; loeb et al . , 2012 ; this indicates that non - canonical targets may have a different biological function that needs to be acquired to improve or compensate for the canonical targets . although several non - canonical mirna - target sites were reported as functional , they did not receive much intention since they could not be definitely defined ( brodersen and voinnet , 2009 ) . however , ago hits - clip method , which can generate a precise transcriptome - wide map of mirna target sites ( chi et al . , 2009 ) , unexpectedly revealed that large portion of mirna - target interactions are non - canonical ( chi et al . , 2012 ) . advances in ago hits - clip analyses further identified non - canonical nucleation bulges , 2012 ; moore et al . , 2015 ) , expanding our knowledge in the understanding of mirna targets and their functions . moreover , the transitional nucleation model , yielded by the analytic process of explaining the pattern of nucleation bulges , offers a general molecular model that can be used to understand the mechanism of mirna target recognition through seed regions ( chi et al . , 2012 ) . extending this knowledge to applications of rna silencing , modified sirnas that contain abasic substitution in the pivot ( position 6 ) were recently developed to completely eliminate mirna - like off - target repression ( lee et al . , 2015 ; seok et al . , . biological significance of the non - canonical interactions could be interpreted as evolutional intermediates with slightly distinct functions .

micrornas ( mirnas ) are small non - coding rnas ( 22 nucleotides ) regulating gene expression at the post - transcriptional level . by directing the rna - induced silencing complex ( risc ) to bind specific target mrnas , mirna can repress target genes and affect various biological phenotypes . functional mirna target recognition is known to majorly attribute specificity to consecutive pairing with seed region ( position 28 ) of mirna . recent advances in a transcriptome - wide method of mapping mirna binding sites ( ago hits - clip ) elucidated that a large portion of mirna - target interactions in vivo are mediated not only through the canonical seed sites but also via non - canonical sites ( 1580% ) , setting the stage to expand and determine their properties . here we focus on recent findings from transcriptome - wide non - canonical mirna - target interactions , specifically regarding nucleation bulges and seed - like motifs . we also discuss insights from ago hits - clip data alongside structural and biochemical studies , which highlight putative mechanisms of mirna target recognition , and the biological significance of these non - canonical sites mediating marginal repression .

INTRODUCTION CANONICAL TARGET SITES: SEED PAIRING RULES EVIDENCE OF NON-CANONICAL TARGET SITES TRANSCRIPTOME-WIDE MIRNA BINDING SITES WIDESPREAD NON-CANONICAL INTERACTIONS: NUCLEATION BULGES AND SEED-LIKE MOTIFS TRANSITIONAL NUCLEATION MODEL INSIGHT FOR MARGINAL REPRESSION AND SIGNIFICANCE OF NON-CANONICAL INTERACTIONS CONCLUSION

prostate cancer , one of the most commonly diagnosed male malignancies in western countries , is now the leading cause of cancer - related death in men . over the years , genetic epidemiological evidence has accumulated in favor of a considerable hereditary component in prostate cancer susceptibility . genetic linkage analysis in 360 hereditary prostate cancer pedigrees revealed the presence of a hereditary prostate cancer susceptibility gene(s ) at xq27 - 28 ( hpcx ) . in agreement with this finding , further data were obtained by analyzing linkage disequilibrium of molecular markers of x chromosome in a finnish x haplotype . xq27 is a region containing a number of genes important in cancer and embryonic development , including the sperm protein associated with the nucleus in the x chromosome ( spanx ) gene family that consists of the two subfamilies spanx - n and spanx - a / d ( human genome build 37.1 ) . spanx - a / d genes map within segmental duplications , which are regions involved in genomic rearrangements resulting in an abnormally high level of structural polymorphisms . accordingly , the spanx - b and the spanx - c genes were shown to be present in a variable number of copies ( ranging from one to > 11 ) in the normal population ; however , no association was found between spanx copy number and the occurrence of hereditary prostate cancer by the genetic locus described by xu , thus leaving uncertain the possible identification of the aforementioned locus with spanx gene cluster . spanx proteins are normally expressed in germ cells ; however , their expression has also been detected in a number of tumors , including melanoma , myeloma , glyoblastoma , breast carcinoma , prostate cancer , and testicular germ cell tumors . the present study was undertaken to evaluate the expression of spanx proteins in normal prostate tissues and in prostate cancer by immunohistochemistry . the analysis was carried out on 15 normal ( at autopsy ) donors and 12 men with prostate cancer following radical prostatectomy . patients ( 71.71.8 years ) and normal controls ( 74.51.3 years ) had a similar mean age ( table 1 ) . patients ' histological diagnosis , gleason scores and pre - surgery serum psa levels are shown in table 1 . table 1characteristics of healthy prostate tissue donors and of patients who underwent radical prostatectomy for prostate carcinoma.normal prostate ( autopsy)prostate carcinoma ( radical prostatectomy)idage ( years)positive cell nuclei ( % ) positive cell cytoplasm ( % ) idage ( years)psa ( ng / ml)ptngleason scoregpositive cell nuclei ( % ) positive cell cytoplasm ( % ) 0.163001727.8pt304 + 3g280700.277002639.2pt304 + 4g3000.3725503798.7pt3na4 + 4g3000.4716004707.6pt303 + 3g275650.5680057211.6pt3na4 + 3g280600.680006796.8pt2bna3 + 3g2000.7795507728.2pt303 + 2g175600.877008779.6pt2b03 + 4g2000.97650097410.1pt3na4 + 4g2000.10800010739.9pt304 + 3g2000.117160011578.7pt304 + 3g285750.12740012729.5pt2b02 + 2g1000.1379000.1472000.1578450id , identification ; psa , prostate specific antigen ; pt , tumor stage ; n , lymphonodes ; na , lymphonodes not excissed ; g , grading . i d , identification ; psa , prostate specific antigen ; pt , tumor stage ; n , lymphonodes ; na , lymphonodes not excissed ; g , grading . the protocol was approved by the internal institutional review board and an informed written consent was obtained from each patient with prostate cancer or , if deceased , by his relatives . four m formalin - fixed and paraffin - embedded prostate sections were processed following the standard protocol previously described . we did not observe any time - related effect on immunostaining with the antibody used for this study nor with any other antibody used for diagnosis . a polyclonal serum against the common spanx epitope tptgdsdpqp , developed in mouse , was used , as reported in a previous study . as negative control , anti - spanx serum was pre - incubated with the immunizing peptide ( 100 ng ) for 1 h. tissues were visually scored at 20x magnification for spanx positivity ; the fraction of spanx - positive cells was evaluated independently in a blinded fashion by two of us in microscopic fields where non prostatic cells ( infiltrating leukocytes , fibroblasts , etc . ) were as few as possible . since no significant difference was observed between the two observers , a mean value was used . comparisons between the percentages of spanx - positive cells were carried out by the student 's t test ( spss 9.0 software package for windows ) . the analysis was carried out on 15 normal ( at autopsy ) donors and 12 men with prostate cancer following radical prostatectomy . patients ( 71.71.8 years ) and normal controls ( 74.51.3 years ) had a similar mean age ( table 1 ) . patients ' histological diagnosis , gleason scores and pre - surgery serum psa levels are shown in table 1 . table 1characteristics of healthy prostate tissue donors and of patients who underwent radical prostatectomy for prostate carcinoma.normal prostate ( autopsy)prostate carcinoma ( radical prostatectomy)idage ( years)positive cell nuclei ( % ) positive cell cytoplasm ( % ) idage ( years)psa ( ng / ml)ptngleason scoregpositive cell nuclei ( % ) positive cell cytoplasm ( % ) 0.163001727.8pt304 + 3g280700.277002639.2pt304 + 4g3000.3725503798.7pt3na4 + 4g3000.4716004707.6pt303 + 3g275650.5680057211.6pt3na4 + 3g280600.680006796.8pt2bna3 + 3g2000.7795507728.2pt303 + 2g175600.877008779.6pt2b03 + 4g2000.97650097410.1pt3na4 + 4g2000.10800010739.9pt304 + 3g2000.117160011578.7pt304 + 3g285750.12740012729.5pt2b02 + 2g1000.1379000.1472000.1578450id , identification ; psa , prostate specific antigen ; pt , tumor stage ; n , lymphonodes ; na , lymphonodes not excissed ; g , grading . i d , identification ; psa , prostate specific antigen ; pt , tumor stage ; n , lymphonodes ; na , lymphonodes not excissed ; g , grading . the protocol was approved by the internal institutional review board and an informed written consent was obtained from each patient with prostate cancer or , if deceased , by his relatives . four m formalin - fixed and paraffin - embedded prostate sections were processed following the standard protocol previously described . we did not observe any time - related effect on immunostaining with the antibody used for this study nor with any other antibody used for diagnosis . a polyclonal serum against the common spanx epitope tptgdsdpqp , developed in mouse , was used , as reported in a previous study . as negative control , anti - spanx serum was pre - incubated with the immunizing peptide ( 100 ng ) for 1 h. tissues were visually scored at 20x magnification for spanx positivity ; the fraction of spanx - positive cells was evaluated independently in a blinded fashion by two of us in microscopic fields where non prostatic cells ( infiltrating leukocytes , fibroblasts , etc . ) were as few as possible . since no significant difference was observed between the two observers , a mean value was used . comparisons between the percentages of spanx - positive cells were carried out by the student 's t test ( spss 9.0 software package for windows ) . normal tissues showed only a spanx - positive nuclear signal in 6 samples out of the 15 examined ( 40% ) , with a mean of 21.77.2% cells with spanx - positive nuclei ( figure 1 a , c ; table 1 ) . the expression of spanx was also evaluated in 12 samples of prostate carcinoma with a mean gleason score of 3.50.2 and 3.20.2 and a grading ranging from g1 to g3 . five samples exhibited a spanx - positive nuclear signal ( 41.7% ) with a mean of 32.911.8% positive nuclei ( figure 1 b , d ; table 1 ) . moreover , cytoplasmic staining for spanx was observed in the 27.59.9% of the cells ( range : 6075 ) . none of the controls , analyzed in parallel , exhibited cytoplasmic staining ( p<0.001 vs. prostate carcinoma samples ) . no cytoplasmic staining was observed in the absence of nuclear staining in prostate cancer tissue ( table 1 ) . ( a ) normal prostatic tissue ; ( b ) prostate carcinoma ( a , b hematoxylin counterstain ; bar = 800 m ) ; ( c ) normal prostatic tissue ( hematoxylin counterstain ; bar = 200 m ) ; ( d ) prostate carcinoma ( hematoxylin counterstain ; bar = 80 m ) . ( a ) normal prostatic tissue ; ( b ) prostate carcinoma ( a , b hematoxylin counterstain ; bar = 800 m ) ; ( c ) normal prostatic tissue ( hematoxylin counterstain ; bar = 200 m ) ; ( d ) prostate carcinoma ( hematoxylin counterstain ; bar = 80 m ) . this is the first demonstration that spanx genes are expressed in a normal somatic tissue , apart the already known expression in germ cells . the percentage of cells showing a spanx - positive nuclear staining was comparable both in normal and in pathologic tissues ; prostate cancer cells showed also a cytoplasmic staining . this peculiar feature of spanx staining , if confirmed by larger cohort studies , may be of clinical usefulness for the immunohistochemical differential diagnosis of prostate carcinoma . cytoplasmic spanx labeling is a common finding in malignant cancer cells , such as embryonal carcinomas and melanomas . in addition , evidences of cytoplasmic labeling in melanomas has been shown by westbrook et al . on the basis of extensive observations of histological samples , we believe that the cytoplasmic signal represents a leakage of spanx proteins from the nucleus . a definitive answer will require the study of tumor cells lines expressing spanx . it is conceivable that similar events , which have the potential of altering the regulation of gene expression , may also be present in malignant cells . the similar fraction of spanx positive cells in normal and cancer tissues suggests that the expression of spanx genes in prostate carcinomas correlates with their expression in normal cells from which the tumor originates : a finding similar to what previously described in seminomas , where nonetheless the nuclear positivity involves approximately 100% of the cells . since our antibody was generated by immunizing mice with a synthetic peptide , which sequence is shared by almost all known spanx proteins , we can not differentiate spanx - b form spanx - a - like subfamilies . although this is a limiting aspect , we believe that , given the high homology among spanx gene family members , it would be difficult to assess the specificity of any antibody for a spanx subfamily or for a single member , especially for immunohistochemical purposes . in conclusion , the present findings showed that spanx expression is physiological in 40% of normal individuals , at least in the sicilian sample examined in this study . the similar incidence of spanx - positive cells in normal and neoplastic tissues , although suggestive , is not sufficient to establish a causative relationship between spanx expression and prostate cancer tissues , and deserves more detailed studies in additional patients .

the sperm protein associated with the nucleus in the x chromosome ( spanx ) gene family encodes for proteins that are not only expressed in germ cells , but also in a number of tumors . in addition , spanx genes map in an interval of the x chromosome ( namely , xq27 ) , which has been found to be associated with familial prostate cancer by linkage analysis . the aim of this study was therefore to evaluate spanx protein expression in normal prostate tissues and in prostate carcinoma . for this purpose , formalin - fixed and paraffin - embedded sections obtained from 15 normal ( at autopsy ) donors and 12 men with prostate cancer were analyzed by immunohistochemistry . about 40% of both normal and tumor prostate samples resulted spanx positive . signals were exclusively within the nucleus in normal prostate cells , whereas both nuclear and cytoplasmic positivity was observed in tumor cells . in conclusion , these findings showed that spanx genes are expressed in both normal and tumor prostate gland , but the latter showed a peculiar cytoplasmic staining positivity . this suggests a possible association between spanx over expression and prostate cancer development . additional studies are needed to corroborate this hypothesis .

Introduction Materials and Methods Patients Immunohistochemical staining Statistical analysis Results Discussion

gli2 mice , in which the bovine k5 promoter drives the constitutive expression of mouse gli26 , develop bcc and bfh6,7 , which are both linked to deregulated hh signaling in humans7,8 . gli2 mice show a reproducible pattern of lesions on the ear that successively involves hyper - keratosis ( flaking ) , thickening and hyperpigmentation ( supplemental fig . mice were scored as positive for the onset of lesions upon the first sign of macroscopic hyperkeratosis in ear tissue . histologically , the lesions present between p80 and p120 resemble bfh as described 7,8 . by p180 , larger , nodular , bcc - like tumors frequently occur deeper in the dermis ( supplemental fig . induction of k17 , a gli target gene9 , is the main alteration in keratin expression prior to onset of lesions in gli2 epidermis ( supplemental fig . gli2 and k17 mice6,10 were interbred so as to assess the impact of k17 loss on genesis of bfh - like tumors . appearance and progression of hamartoma - like lesions were captured from p30 to p125 . at p80 , epithelial lesions are clearly less pronounced in gli2/k17 than in gli2 ear tissue ( fig . in male gli2 and gli2/k17 mice the average onset of lesions is 652 days ( n=32 ) and 912 days ( n=31 ; p < 0.01 ) , respectively . in females , onset is at 805 days ( gli2 ; n=22 ) vs. 1012 days ( gli2/k17 ; n=21 ; p < 0.01)(fig . loss of k17 does not impact gli2 subcellular localization or hedgehog signaling ( supplemental fig . therefore , the absence of k17 causes a delay in the inception of bfh - like skin tumors in gli2 mice . histological anomalies common to hh pathway - activated mouse skin7 were scored in gli2 and gli2/k17 ear tissue ( supplementary fig . 3b ) , are prominent in gli2 ear but markedly reduced in gli2/k17 ear ( supplementary fig . 3c ) . overall tissue thickness and penetration of epithelial downgrowths are also reduced in gli2/k17 ear tissue ( supplementary fig . k17 , k5 , and k14 are uniformly distributed in the lesional epithelium ( supplemental fig . co - assembly of k5 and k17 in gli2 lesional epithelium is conveyed by their co - localization and co - immunoprecipitation ( supplemental fig . the wound - inducible k6 , k6 and k16 , absent in intact epidermis , are induced in the upper layers of thickened gli2 epidermis , preferentially , but are markedly reduced in gli2/k17 skin ( supplemental fig . reduced proliferation , rather than increased cell death , is a key contributor to delayed tumor onset in gli2/k17 skin . relative to gli2 , indeed , the frequency of mitotically - active cells is depressed by > 3-fold in gli2/k17 ear epithelium ( fig . g ) . in contrast , tunel - positive , apoptotic cells are restricted to the upper epidermis of lesional skin and show similar density in both genotypes ( fig . inflammation has emerged as a driver of angiogenesis and tumor growth12 and coincides with k17 induction and loss of barrier function in several skin diseases13,14 . immunoreactivity for markers of innate immune cells ( cd11b ) , t cells ( thy-1 ) , and phagocytes ( inos ) are enhanced in gli2 compared to gli2/k17 ear skin of p80 male mice ( fig . 2a ) , reflecting decreased angiogenesis . myeloperoxidase ( mpo ) enzymatic activity , inherent to neutrophils15 , is increased 17.4 0.5 fold in p80 male gli2 ear tissue but only 5.8 0.1 fold in gli2/k17 males ( data normalized to p80 female gli2 ear ; fig . female gli2/k17 mice also show a reduced level of mpo activity at p80 , being at 0.75 fold of that seen in gli2 controls ( fig . . skin barrier integrity , assessed via a whole - mount dye penetration assay16 , is intact as expected in p70 wildtype ear skin ( fig . in contrast , a sizable portion of the ear is dye - permeable in p70 gli2 mice ( fig . 2c ) ; again , this readout is markedly decreased in gli2/k17 mice ( fig . 2d ) , mpo activity is 5.91.9 fold greater in male gli2 mice relative to females , substantiating the gender bias in this model . mpo activity is lower in p40 male gli2/k17 mice ( 0.55 0.20 relative to female gli2 mice ; fig . 2d ) , mitotic activity is higher in gli2 vs. gli2/k17 epidermis at p40 ( 0.52 0.01 vs. 0.14 0.02 brdu labeled cells / mm of epidermis ) ( fig . barrier integrity is mildy compromised in p40 gli2 ear skin , is again better preserved in gli2/k17 mice ( supplemental fig . thus , the marked reductions in inflammation and hyperplasia that define gli2/k17 ear skin occur as early as p40 , ahead of progression to overt tumorigenesis in the gli2 model . expression of inflammatory cytokines and chemokines was examined via qrt - pcr in ear tissue at p40 and p80 . the findings are stratified according to specific classes of t - helper cytokines : th1 ( cellular immunity ; generally pro - inflammatory ) , th2 ( humoral immunity ; anti - inflammatory ) , and th17 ( anti - microbial immunity at epithelial barriers)17,18 . th1 and absence of k17 in gli2 skin correlates with a marked reduction in th1- and th17-related markers and induction of th2-related markers ( table 1 ) , many of which are prominently expressed by skin keratinocytes themselves . expression of il-1 , a keratinocyte mitogen20 , is ~10 fold higher in gli2 compared to gli2/k17 skin ( table 1 ) . spp1 ( osteopontin ) , which acts to bias immune responses toward th121 , is reduced by ~15 fold and il-6 , associated with the acute phase response and upregulated in human bcc22 , is lowered ~17 fold in gli2/k17 skin ( table1 ) . the matrix metalloproteases mmp3 , mmp9 and mmp13 , whose expression is enhanced in bcc23 , are downregulated in gli2/k17 ear tissue . classical th2 type cytokines primarily secreted by t - cells , e.g. , il-4 and il-10 , are modestly altered whereas ccl24 and ccr4 , expressed by skin keratinocytes24 , are respectively ~9 and ~3 fold higher in gli2/k17 ear tissue ( table 1 ) . il1 and cxcl5 expression is enhanced in the presence of k17 , while the th2 markers il20 and il4 are enhanced in its absence ( table 1 ) . thus , the immunomodulatory influence of k17 is first manifested at an early stage in this model . topical application of the phorbol ester , 12-o - tetradecanoylphorbol-13-acetate ( tpa)25 , to ear skin induces acute inflammation and epidermal proliferation ( fig . 3a , b ) , providing a tumor - free , dermatitis - like setting in which to assess the impact of k17 loss . the latter curtails hyperplasia - driven epidermal thickening ( wt ear tissue : 34.12.3 m in tpa- vs. 10.40.3 m in vehicle - treated ; k17 ear tissue : 18.7 0.8 m in tpa- vs. 10.60.8 m in vehicle - treated ; fig . markers related to compromised skin barrier function ( s100a826 , thymic stromal lymphoprotein ( tslp)14 , -defensin 27 ) show elevated mrna levels in tpa - treated wildtype skin ( fig . a partial shift toward a th2-dominated cytokine profile is seen in tpa - treated k17 skin , though the magnitude of the changes is less than in gli2 skin . the th1 chemokines cxcl5 , ccl3 and il-1 are reduced 2.4- , 3.0- and 1.7-fold , respectively , and the th2 cytokine il-20 is 7.1 fold higher in tpa - treated k17 skin relative to control ( table 2 ) . skin keratinocytes from gli2 and gli2/k17 newborn mice were seeded for primary culture ( 48h ) , and treated with tpa ( 12h ) to assess whether key changes in cytokine / chemokine expression are keratinocyte - autonomous . under basal conditions , gli2 and tpa induces a two - fold enhancement in gli2 keratinocyte proliferation by 12h , whereas gli2/k17 cells are unchanged ( supplemental fig . levels of cxcl11 , cxcl5 , cxcl9 and cxcl10 mrnas , among others , are significantly lower in tpa - treated gli2/k17 keratinocytes ( fig . these chemokines promote keratinocyte proliferation in skin tumors , and show a tight spatial correlation with k17 expression28,29 . re - expression of k17 into tpa - treated gli2/k17 keratinocytes markedly elevates the levels of cxcl5 , cxcl9 , and cxcl11 mrnas , relative to mock - transfected cells ( fig . k17 impacts the tpa - induced expression of select chemokines relevant to bcc pathogenesis in both adult epidermis in situ and isolated newborn keratinocytes in culture , suggesting that the mechanism(s ) involved are in part cell - autonomous . several nf - kb target genes show a modest but consistent reduction in their expression in gli2/k17 relative to gli2 keratinocytes in tpa - treated cultures ( supplemental figure 5a ) . this is consistent with the prominent role of nf-b in skin inflammatory conditions 30 and , in particular , with its impact on cxcl5 , cxcl9 , and cxcl11 expression3133 . similar analyses of p80 whole ear skin tissue revealed no difference between the genotypes , likely reflecting the large complexity of these lesions in situ and the occurrence of secondary or compensatory changes ( supplemental figure 5 , b , k17 has been shown to promote anagen growth during hair follicle cycling34 and stimulates protein synthesis during tissue repair35 . the phenotype reported here can not be correlated to obvious alterations in these roles , again as inferred from analyses of skin tissue sections ( data not shown ) or extracts ( supplemental fig . 5 , b k17 is ectopically expressed in numerous settings associated with robust inflammation including cutaneous wounds , various carcinomas , psoriasis , and virus - induced warts10 . high levels of k17 expression correlate with a poor prognosis in breast36 and pancreatic37 cancers whether this phenomenon is related to altered inflammatory signatures represents an issue of interest . there exists a correlation between th1 hyperactivity and k17 expression in psoriatic plaques19 ; plaque resolution coincides with a shift to a th2 response and loss of k17 expression . we posit that the presence of k17 in epidermis ( and related epithelia ) promotes hyperplasia in bcc - like tumors ( this study ) and likely in additional tumors and inflammatory disease settings in part through its ability to promote a specific type of inflammatory response . normal contexts in which prominent k17 expression is not correlated to local inflammation ( e.g. , hair follicles ) may benefit from an immune - privileged status38 or reflect its regulation via post - translational modifications or interaction with other proteins34,35 . a role for k17 as an immunomodulator , whether direct or indirect , provides a novel way of conceiving how snps affecting k5 influence the risk of developing bcc 2 , and makes these keratins potentially attractive target for novel therapies aimed at curtailing conditions driven by or linked to chronic inflammation . methods and any associated references are available in the online version of the paper at http://www.nature.com / naturegenetics/.

basaloid skin tumors , including basal cell carcinoma ( bcc ) and basaloid follicular hamartoma ( bfh ) , are associated with aberrant hedgehog ( hh ) signaling1 and , in the case of bcc , an expanding set of genetic variants including keratin 5 ( k5)2 , an intermediate filament - forming protein . we show that genetic ablation of keratin 17 ( k17 ) protein , which is induced in basaloid skin tumors3,4 and co - polymerizes with k5 in vivo5 , delays bfh tumor initiation and growth in mice with constitutive hh signaling in epidermis6,7 . the delay is preceded by reduced inflammation and a polarization of inflammatory cytokines from a th1/th17- to a th2-dominated profile . absence of k17 also attenuates hyperplasia and inflammation in a model of acute dermatitis . re - expression of k17 in gli2tg k17/ keratinocytes induces select th1 chemokines with established roles in bcc . our findings establish a novel immunomodulatory role for k17 in hh - driven basaloid skin tumors that could impact additional tumor settings , psoriasis , and wound repair .

Main Text METHODS Supplementary Material

most vertebrates are unable to grow and reach their normal adult form without the thyroid hormone [ 1 , 2 ] . however , various subsequent studies revealed that thyroid hormone plays a key role in rat testis development [ 47 ] . mammalian testis is a target of thyroid hormone action and altered thyroid function which is known to affect testicular functions [ 8 , 9 ] . thyroid hormone is well known as a physiological modulator of oxidative stress [ 10 , 11 ] . previous studies on the role of thyroid hormone in testis are mainly focused on histological and physiological aspects resulting into reproductive failure [ 6 , 8 , 1214 ] . altered thyroid function during early stages of development and maturation may adversely affect testicular growth and physiology [ 79 ] ; particularly the sertoli cells , which play a major role in spermatogenesis and are the main cell type in the testis which expresses t3 receptors . it is well established that the formation of normal numbers of sertoli cells is a key factor in determining testis size , germ cell numbers per testis , and sperm production rate in adulthood in a range of mammals , including humans . in our earlier reports , it was demonstrated that experimentally hypothyroidism modulates several oxidative stress and antioxidant defence parameters in mitochondria and postmitochondrial fractions in adult rat testis [ 18 , 19 ] . we also reported about the effects of transient and persistent hypothyroidism on testicular antioxidant defence system in mature rats to know the role of hypothyroidism - induced oxidative stress in testicular development and maturation . however , information about the role of deprivation of thyroid hormone in early developmental growth and function of testis in relation to antioxidant status in immature rats is inadequate . in rat , spermatogenesis reaches the pachytene stage at 20 days of age . at 25 days of age , round spermatids appear , and at the age of 50 days , mature spermatozoa are released into seminiferous tubular lumen [ 20 , 21 ] . fetal type leydig cells disappear soon after birth ( during first 2 weeks after birth ) and are replaced by adult type leydig cells [ 22 , 23 ] . sertoli cell proliferation reaches its maximum level just before birth and ceases by the age of 3 weeks . hence , four weeks or around 30 days of age , testis is undergoing critical stages of development and thyroid hormone is playing a key role during this stage . in our earlier studies , it was reported that transient hypothyroidism ( from day 1 of neonatal age till day 30 ) modulated testicular antioxidant defence status as well as functions in adult stage . moreover , it was also shown that germ cells in these rats were under oxidative stress and had poor antioxidant defence system . so , it is interesting to know about the testicular antioxidant defence status and oxidative stress parameters along with testicular physiology at the 30 days of age , that is , before puberty . the objective of the present study is to investigate the modulation of antioxidant defence status in neonatal persistent hypothyroid rats before their sexual maturation . in addition , we have tried to identify the specific cell populations in testes vulnerable to degeneration during neonatal hypothyroidism in immature rats . male pups obtained from breeding were made hypothyroid from day 1 of neonatal age till day 30 of postnatal age . hypothyroidism was induced in neonates by feeding the lactating mother with 0.05% 6-n - propyl-2-thiouracil ( ptu ) through the drinking water [ 7 , 18 , 25 ] . from the day of parturition till weaning ( 25 day postpartum ) , the pups received ptu through mother 's milk ( or ) drinking water and then directly from drinking water containing 0.05% ptu for the remaining period of experimentation . adult male wistar rats ( rattus norvegicus ) were divided into two groups containing 15 animals each . group - ii rats were treated with ptu from day 1 postpartum to day 30 postpartum . animal care , maintenance , and experiments were conducted under the supervision of the institutional animal ethics committee ( iaec ) regulated by the committee for the purpose of control and supervision of experiments on animals ( cpcsea ) , government of india . on the 31st day postpartum , body weight of animals in group - i and ii was recorded ; the animals were sacrificed by decapitation , trunk blood was collected and allowed to clot and then centrifuged to obtain sera . the serum levels of total t3 , t4 , tsh , and testosterone were measured by using elisa kits ( monobind , inc . , costa mesa , ca , usa , and equipar diagnostici , italy ) . testes and accessory sex organs , that is , seminal vesicle , ventral prostate and epididymis were removed , cleaned in cold 0.15 mol / l nacl ( normal saline ) , pat dried , and weighed . testes from three animals were pooled to one sample and five such samples were taken for the study . the whole procedure of tissue processing was done as described earlier by sahoo et al . a 20% ( w / v ) homogenate of testis was prepared in 50 mm phosphate buffer , ph 7.4 , containing 0.25 m sucrose . the crude homogenate ( ch ) was centrifuged at 600 g for 10 min to precipitate nuclei and other cellular debris . the resulted supernatant was again centrifuged at 10,000 g for 20 min to separate mitochondria . the mitochondrial pellet was washed thrice in 50 mm phosphate buffer , ph 7.4 ( 10,000 g for 5 min each ) , and finally suspended in the same buffer to obtain mitochondrial fraction ( mf ) . for lipid peroxidation ( lpx ) , lpx was measured in ch and mf by monitoring the formation of thiobarbituric acid - reactive substances ( tbarss ) following ohkawa et al . the assay was performed in presence of 0.02% ( w / v ) butylated hydroxytoluene to suppress artefactual peroxidation during heating . malondialdehyde ( mda ) was used as the standard and tbars were expressed in terms of mda equivalents as nmol tbars formed / mg protein . protein carbonyl ( pc ) content was estimated in testicular ch , mf , and pmf following levine et al . for measuring protein - sh content , pmf and mf samples were first precipitated in ice - cold 5% trichloroacetic acid ( tca ) containing 0.01 m hcl and centrifuged at 1000 g for 15 min . protein precipitates dissolved in 8 m guanidine hydrochloride were then used to measure thiol content and presented as mol / mg protein [ 29 , 30 ] . total glutathione content was measured in the supernatant of tca - precipitated testicular pmf and mf samples by enzymatic recycling procedure and gssg was measured after masking gsh with 2-vinylpyridine [ 31 , 32 ] . total gsh equivalents , gsh and gssg contents were expressed as nmol / g tissue . hydrogen peroxide ( h2o2 ) content was determined in testicular pmf and mf following horseradish peroxidase - dependent oxidation of phenol red . for measuring the activity of catalase ( cat ) , pmf treated with ethanol ( 0.17 m ) and triton x-100 ( 1% ) was directly used . the enzyme activity was measured following decomposition of h2o2 at 240 nm as described earlier and expressed as nkat / mg protein . superoxide dismutase ( sod ) activity in pmf ( for cu / zn - sod ) and mf ( for mn - sod ) of testis was determined following modified nitrite method . one unit of enzyme activity was defined as the amount of enzyme capable of inhibiting 50% of nitrite formation under assay conditions . glutathione peroxidase ( gpx ) activity was assayed in pmf and mf by measuring oxidation rate of nadph in presence of hydroperoxide , gsh , and glutathione reductase ( gr ) [ 19 , 36 ] . total and selenium - dependent gpx activities were estimated by using cumene and tert - butyl hydroperoxides , respectively . the difference between total glutathione peroxidase and selenium - dependent glutathione peroxidase ( se - d - gpx ) activities represents the selenium - independent glutathione peroxidase ( se - i - gpx ) activity [ 19 , 37 ] . glutathione reductase ( gr ) activity in testicular pmf and mf was assayed by measuring oxidation rate of nadph in presence of gssg . in testicular pmf and mf , glutathione - s - transferase ( gst ) activity was measured following change in absorbance of the conjugated product of gsh and 1-chloro , 2 , 4-dinitrobenzene ( cdnb ) at 340 nm . gpx , gr , and gst enzyme activities were expressed as nkat / mg protein . glucose-6-phosphate dehydrogenase ( g6pd ) activity was assayed in pmf by measuring nadph formation from glucose-6-phosphate along with nadp and expressed as nkat / mg protein . following sacrifice , testis tissues were immediately fixed for histological studies in freshly prepared sublimate formal , dehydrated in graded ethanol series , cleared in xylene , and embedded in paraffin wax . all data represent means standard deviation and were subjected to unpaired student 's t - test to find out the level of significance between control and experimental rats . the weight gain in group - ii rats on 31st day of age was almost 50% less than group - i control rats ( table 1 ) . the weight of testis , seminal vesicle , and ventral prostate ( g/100 g body wt ) decreased significantly in ptu - treated rats of group - ii ( table 2 ) . the serum t3 , t4 , and testosterone level decreased significantly whereas the level of tsh increased by several folds in group - ii rats in comparison to control rats in group - i ( table 3 ) . marked decrease in seminiferous tubule diameter was observed in neonatal persistent hypothyroid 30-day - old rats ( group - ii ) as compared to the corresponding controls ( table 4 ) . there was a significant decrease in spermatogonia ( 24% ) and spermatocytes ( 79% ) accompanied by complete absence of round spermatids in group - ii testis ( table 4 ) . however , a significant increase in the sertoli cell number in group - ii rat testis was marked ( table 4 ) . the level of endogenous lipid peroxidation showed a decrease by 13.6% and 64% in crude and mitochondrial fractions , respectively , in response to 30 days persistent ptu treatment ( group - ii ) in comparison to control ( group - i ) rats ( figure 1 ) . a significant elevation in protein carbonyl content was recorded in the crude homogenate ( by 35.6% ) , mitochondrial ( 78% ) , and postmitochondrial fraction ( 22% ) of testis of group ii hypothyroid rats when compared to the controls ( group i , figure 2 ) . hydrogen peroxide content remained unaltered in pmf and decreased ( by 15% ) in mf of group - ii ptu - treated rats ( figure 3 ) . the protein - sh content decreased significantly by 14% and 24% , respectively , in mitochondrial and postmitochondrial fractions of testis of group - ii rats ( figure 4 ) . in mitochondrial fraction of testis of group - ii , rats , total gsh equivalent , oxidized , and reduced glutathione contents and gsh to gssg ratio declined , respectively , by 50% , 16.7% , 67% , and 61% ( table 5 ) . on the other hand , the group - ii testicular postmitochondrial total gsh equivalent and reduced glutathione contents did not alter with 23.5% decrease in gssg activity and 27% elevation in gsh to gssg ratio ( table 5 ) . the mn - sod activity was elevated by 20% in mf whereas cu / zn - sod activity was increased by 30% in pmf of testis of group - ii rats ( figure 5 ) . in the postmitochondrial fraction of testis , the cat activity was increased by 83% in response to ptu treatment in group - ii rats in comparison to control rats ( group - i ) ( figure 6 ) . in group - ii rat however , in postmitochondrial fraction , total gpx and se - i - gpx declined , respectively , by 6.7% and 22.35% with 9.5% elevation in se - d - gpx activity ( figure 7 ) . the gr activity increased significantly by 56% and 55% , respectively , in mitochondrial and postmitochondrial fractions of testis of group - ii rats in response to ptu treatment for 30 days ( figure 8) . the gst activity decreased by 59% in mitochondrial fraction and elevated by 42% in postmitochondrial fraction of testis in response to ptu treatment in group - ii rats when compared to control rats ( group - i , figure 9 ) . an increase in enzyme activity in post mitochondrial fraction of testis was recorded in group - ii rats by 73% ( figure 10 ) . thyroid hormones are reported to play a critical role in growth , differentiation , maturation , and metabolism in vertebrates . essential role of thyroid hormone in male sexual maturation , and reproduction was reported earlier [ 4 , 6 , 42 ] . both hyperthyroidism and hypothyroidism states alter testicular antioxidant defence parameters in adult rats [ 7 , 18 , 19 , 25 , 4345 ] . however , the effects of persistent hypothyroidism on neonatal rats before their puberty need to be studied . the present study reports the effect of neonatal persistent hypothyroidism induced by ptu treatment on the testicular antioxidant system and spermatogenic function in rats before puberty . the efficacy of the treatment was confirmed by a dip in t3 and t4 levels and a consequent increase in tsh level in serum of neonatal persistent hypothyroid rats . ptu is well known to decrease the conversion of peripheral t4 to t3 and thereby reduces serum t3 concentration . a significant reduction in the body weight was observed in ptu - treated rats when compared to control rats as reported earlier in case of neonatal hypothyroidism . the lower h2o2 contents in hypothyroid rats might be due to lower superoxide production in hypothyroid state due to hypometabolic rate . the hypothyroid rat testis resulted in a reduction in lipid peroxidation , which might be as a result of metabolic depression due to hypothyroid condition which serves as a protective factor to prevent lipid peroxidation [ 18 , 47 , 48 ] . in another study , ( 2005 ) also observed a low lipid peroxide content in testicular and renal tissues of hypothyroid rats . on the contrary , oxidative stress is marked as the increase in protein carbonyl contents in crude and mitochondrial fraction of hypothyroid rat testis in the present study . ( 2008 ) , who observed an increased level of carbonylation of protein in crude homogenate of testes of hypothyroid rats . superoxide dismutase ( sod ; ec 1.15.1.1 ) constitutes the first line of coordinated enzymatic defense against ros by dismutating o2 into o2 and h2o2 . catalase ( cat ; ec 1.11.1.6 ) and glutathione peroxidase ( gpx ; ec 1.11.1.9 ) are most crucial for detoxifying h2o2 , thereby preventing the generation of hydroxyl radical by the fenton reaction . selenium - dependent glutathione peroxidases ( se - d gpxs ) are the major selenoprotein - containing gene family in mammals . among the different types of selenium - dependent hydroperoxide - reducing isozymes , phospholipid hydroperoxide glutathione peroxidase ( ph - gpx / gpx-4 ; ec 1.11.1.12 ) and classic cellular glutathione peroxidase ( cgpx / gpx-1 ; ec 1.11.1.9 ) other gpx activities in mammalian systems are selenium independent . the se - independent gpx ( se - i gpx ) , component of gst alfa class ( accession : ipr003080 gst_alpha ) , is responsible for gpx activity in testis . a significant elevation in total sod and cat activities in response to neonatal persistent hypothyroidism and a simultaneous decrease in total gpx , se - d gpx ( gpx-1 and gpx-4 ) , and se - i gpx in the pmf of testis in experimental group suggested that sod and cat have predominant role to fight oxidative stress than gpx in hypothyroid rats . the majority of the cytosolic gpx in rat testis existed as selenium- and nonselenium - dependent gpx which is present in the leydig cells . gpx is primarily responsible for h2o2 removal in testicular mitochondria that does not contain catalase . gpx plays a crucial role in scavenging peroxyl radicals and thereby maintains functional integrity of the cell membrane , spermatogenesis , sperm morphology , and motility . in testis , ph - gpx or gpx-4 which is partially cytosolic and partially bound we observed that mitochondrial se - dependent gpx ( including gpx1 and gpx-4 ) activity was unaltered in hypothyroid rats as reported earlier by chattopadhyay et al . in fact , the role of cgpx / gpx1 in protecting testes from oxidative injury is questionable as cgpx knockout mice were found to be fertile . it has also been suggested that the metabolic pathway of testosterone biosynthesis requires protection against peroxidation and will be affected by a decrease in the gpx activity . the lower serum testosterone level in hypothyroid rats in the present study also corroborates the fact . mammalian testis contains relatively high levels of gsh , which is reported to play an important role in the proliferation and differentiation of spermatogenic cells by protecting them from noxious effects of ros . the level of gsh is different in testicular cell types , having maximum level in sertoli and germ cells . thyroid hormone is known to play a role in triggering the biosynthesis of gsh , therefore under hypothyroid states , it is possible that there may be a fall in gsh levels contributing to susceptibility of the testes to oxidative stress . the ratio of reduced glutathione ( gsh ) to oxidized glutathione ( gssg ) in tissues is also considered as one of the important marker of oxidative stress . the decrease in its ratio and also a decrease in gsh contents in testicular mf of hypothyroid rats suggest severely hindered gsh metabolism . such type of decreased gsh contents in testis - mitochondria of hypothyroid rats was also reported earlier . moreover , declined gsh contents in germ cells were reported earlier in case of transient hypothyroid rats . the decreased protein - sh contents in both mitochondrial and postmitochondrial fractions might be due to the response against disturbed testicular redox pool in hypothyroidism . similar effects on testicular protein - sh during hypothyroidism were reported by chattopadhyay et al . glutathione - s - transferase ( gst ; ec 2.5.1.18 ) metabolizes xenobiotics by conjugating with gsh . in fact , gst - catalysed conjugation of gsh with exogenous compounds and endogenous metabolites such as 4-hydroxynonenal is regarded as major cellular defense mechanism against toxicity . the decreased activity of this enzyme in mf of testes in neonatal persistent hypothyroid rats reflects the inability of the testis to counteract oxidative stress by this pathway . glutathione reductase ( gr ; ec 1.6.4.2 ) is the enzyme responsible for maintenance of gsh by reducing gssg back to gsh . stimulated gr activity in neonatal hypothyroid rats indicated that mitochondrial metabolism attempted reduction of gssg to gsh in order to maintain redox status . such type of gr elevation was also reported in hypothyroid rat testis by sahoo et al . increase in activity of glucose-6-phosphate dehydrogenase ( g6pd ) due to neonatal hypothyroidism might be due to higher demand for nadph as gr requires this reducing equivalence to generate reduced gsh from gssg . the testis seems to be the most vulnerable during neonatal persistent hypothyroidism as evident from the significantly decreased germ cell count . they reported absence of round spermatids in 30 days hypothyroid testis and the inability of the spermatogenic cells to complete meiosis . ( 1991 ) also reported an impaired spermatogenesis and increased degeneration of germ cells in testis in response to prolonged hypothyroidism in rats . increased sertoli cell number in hypothyroid rats in the present investigation might be due to extended sertoli cell proliferation as in an earlier report , van haaster et al . ( 1992 ) and holsberger and cooke ( 2005 ) demonstrated that neonatal hypothyroidism may increase adult sertoli cell populations by extending sertoli cell proliferation . as hypothyroidism causes significant decrease in lh and fsh with a fall in serum testosterone [ 69 , 70 ] , this might lead to a disruption of the spermatogenic and steroidogenic processes . moreover , it has been reported that neonatal hypothyroidism adversely affects leydig cell proliferation , differentiation , along with impaired steroidogenesis [ 71 , 72 ] . hampered of testicular function may have their origins in fetal or early life as a result of abnormal development or proliferation of sertoli cells . a compromised antioxidant defence system marked by increased protein carbonylation , disturbed redox status during neonatal hypothyroidism , might have contributed to poor growth and development of testis by affecting spermatogenesis and steroidogenesis in rats before puberty as indicated by reduced germ cell number , complete absence of round spermatids , decreased seminiferous tubule diameter , and decreased testosterone level . such type of altered testicular physiology by hypothyroidism is reflected in adulthood with hampered fertility as evidenced by reduced total viable germ cells and sperm counts .

altered thyroid function during early stages of development is known to affect adversely testicular growth , physiology , and antioxidant defence status at adulthood . the objective of the present study is to investigate the modulation of antioxidant defence status in neonatal persistent hypothyroid rats before their sexual maturation and also to identify the specific testicular cell populations vulnerable to degeneration during neonatal hypothyroidism in immature rats . hypothyroidism was induced in neonates by feeding the lactating mother with 0.05% 6-n - propyl-2-thiouracil ( ptu ) through the drinking water . from the day of parturition till weaning ( 25 day postpartum ) , the pups received ptu through mother 's milk ( or ) drinking water and then directly from drinking water containing ptu for the remaining period of experimentation . on the 31st day postpartum , the animals were sacrificed for the study . an altered antioxidant defence system marked by elevated sod , cat , and gr activities , with decreased gpx and gst activities were observed along with increased protein carbonylation , disturbed redox status in hypothyroid immature rat testis . this compromised testicular antioxidant status might have contributed to poor growth and development by affecting the spermatogenesis and steroidogenesis in rats before puberty as indicated by reduced germ cell number , complete absence of round spermatids , decreased seminiferous tubule diameter , and decreased testosterone level .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

ewing 's sarcoma family of tumors are a group of small round - cell neoplasms , which include ewing 's sarcoma ( ews ) , primitive neuroectodermal tumor ( pnet ) , askins tumor , pnet of the bone , and extraosseous ewing 's sarcoma ( ess ) . ewing 's sarcoma / peripheral primitive neuroectodermal tumor , presumed to be neuroectodermal in origin , most often occurs in the bone and soft tissues of children and young adults . the intracranial extraosseous ewing 's sarcoma ( cns - ess ) is extremely rare and often misdiagnosed as central nervous system pnet ( c - pnet ) or as other primary intracranial neoplasms . an 11-year - old female presented with a history of headache for one year , which increased in intensity over the last one month . she had repeated episodes of vomiting for one month and a left temporal scalp swelling , which was gradually increasing in size . on examination there was bilateral papilledema , but no other focal neurological deficits were detected . the left temporal scalp swelling was mildly tender , firm , immobile , and non - pulsatile with ill - defined margins . the computed tomography scan ( ct scan ) of the brain showed a rounded , well - defined , heterogeneously hyperdense , enhancing lesion in the left temporoparietal region , with a mass effect and destruction of the left temporal bone , extending into the scalp , suggesting the possibility of a meningioma . no evidence of calcification was noted within the lesion [ figure 1 ] . magnetic resonance imaging ( mri ) of the brain showed a left temporal lesion , hypointense on t1 , heterointense on t2 , with heterogeneous enhancement [ figure 2 ] . a significant mass effect was detected with a midline shift to the right , of 15 mm . preoperative ct scan of the brain showed a rounded , well - defined , heterogeneously hyperdense , enhancing lesion in the left temporoparietal region , with a mass effect and destruction of the left temporal bone extending into the scalp , suggesting the possibility of meningioma . no evidence of calcification was noted within the lesion preoperative mri of the brain showed a left temporal lesion , hypointense on t1 , heterointense on t2 , with heterogenous enhancement the patient underwent left temporoparietal craniotomy and decompression of the lesion . the operative findings suggested that the lesion was extradural , with erosion of bone in some areas and involvement of the overlying temporalis muscle . the histopathological examination showed round - to - oval cells arranged in lobules , separated by a thin vascular channel , having vesicular nuclei , with indistinct nucleoli . it was negative for cd20 , cd3 , myosin , and glial fibrillary acidic protein . the overall features were compatible with a primitive neuroectodermal tumor ( pnet ) , with a possibility of ewing 's sarcoma in the temporal region . the tumor was positive for t ( 11 ; 22 ) ( q24 ; q12 ) translocation detected by fluorescent in situ hybridization ( fish ) in the tumor biopsy sample . the findings of further metastatic workups , including ct scans of the thorax and abdomen and a bone scan with technetium tc-99 m , were negative . ews / pnet 's are characterized by immunoreactivity to the surface antigen cd99 / mic2 , which is expressed in up to 97% of the cases a postoperative ct scan of the brain revealed a large extradural and subdural hematoma in the left frontotemporal region , with a postoperative craniotomy defect and scalp edema . the child went on to receive 12 weeks of chemotherapy with vincristine , doxorubicin , and cyclophosphamide , alternated with ifosfamide and etoposide . the treatment was completed with the same combination of chemotherapeutic drugs for another 24 weeks . james ewing ( 18661943 ) first described the tumor , establishing that the disease was different from lymphoma and other types of cancer known at that time . in 1921 , he described a lethal primary bone lesion that affects children and young adults and most frequently originates in the long bones ( 47% ) , pelvis ( 19% ) or ribs ( 12% ) . the skull is rarely involved , probably in less than 4% of the cases , with the frontal and parietal bones being the most commonly affected . extraosseous ewing 's sarcoma ( ees ) has been recognized as a distinct disease entity that afflicts young adults in the second and third decades of life , with equal sex predilection . the ees commonly involves the paravertebral regions of the spine and in rare instances , these lesions arise in the intracranial compartment , where they have been commonly misdiagnosed as c - pnet , because of the similarity in their histological appearance . very few cases of the central nervous system extraosseous ewing 's sarcoma ( cns - ees ) have been reported in pathology literature.[611 ] jay et al . was probably the first to describe a patient with an isolated posterior fossa mass that histologically resembled a medulloblastoma , but demonstrated the t(11;22 ) ( q24;q12 ) translocation , which confirmed cns - ees . as far as our knowledge goes , this is the seventh case we are reporting . the differential diagnosis of an intracranial round cell tumor is primitive neuroectodermal tumor ( neuroblastoma ) , lymphoma , rhabdomyosarcoma , and ewing 's sarcoma . the histological examination reveals that these tumors are composed of small , undifferentiated neuroectodermal cells and frequently demonstrate immunohistochemical and/or electron microscopic features of glial or neuronal differentiation . recent advances in the molecular classification has allowed a clear pathological distinction between c - pnet and cns - ees . cns - ees is known to demonstrate in 97% of the patients , a strong membrane expression of the mic-2 gene product , designated cd99 , which is specifically recognized by the monoclonal antibodies o13 and hba71.[1316 ] in addition , the chromosomal translocation t(11 , 22)(q24;q12 ) , detected by fish , is found in more than 90% of ees . this nonrandom translocation is not found in the central primitive neuroectodermal tumors ( c - pnet ) such as the medulloblastoma and supratentorial pnet . although , cns - ees is histologically similar to c - pnets such as the medulloblastoma , it differs significantly in clinical behavior , treatment , and prognosis . the treatment options available for patients with cns - ees are similar to those of ees elsewhere in the body and include multimodality treatment comprising of surgery , chemotherapy , and radiation . patients with c - pnet also require surgery ; however , the chemotherapeutic and radiation therapy protocols differ from those used for cns - ees . multiagent chemotherapy regimens including cyclophosphamide , ifosfamide , doxorubicin , dactinomycin , and etoposide have been shown to be effective in localized ewing 's sarcoma , in various trials . the primary treatment for localized ess consists of neoadjuvant chemotherapy , with a combination of vincristine , doxorubicin , and cyclophosphamide , alternating with ifosfamide and etoposide , given for 12 to 24 weeks , followed by definitive local treatment of surgery or radiation , or surgery and postoperative radiation directed at the primary site . the treatment is completed with administering chemotherapy with a similar combination for a total of 36 to 49 weeks . because of the small number of patients , the prognosis of cns - ees is not clearly known , although it has been suggested that patients with ees that arises from structures within or around the cns may have a more favorable outcome than patients with c - pnet .

ewing 's sarcoma / peripheral primitive neuroectodermal tumors occur most often in bone and soft tissues of children and young adults . the intracranial manifestation of the disease is rare , and when present , this is often misdiagnosed with other varieties of primary brain tumors . we report such a case of extraosseous ewing 's sarcoma , which was initially suspected to be a case of meningioma in an 11-year - old girl .

INTRODUCTION CASE REPORT DISCUSSION

nitric oxide ( no ) is known to have several important vasculo - protective effects ( el - mas et al 1997 ; grdal et al 2005 ) . reduced production of no may lead to atherosclerosis ( lscher and vanhoutte 1990 ; harrison 1997 ; shimokawa 1999 ) . the synthesis of no from the amino acid , l - arginine , is catalysed by no synthase ( nos ) . no then plays a critical role in the relaxation of vascular smooth muscle cells ( vsmcs ) . it is well known that no is involved in reducing vsmc proliferation , adhesion of platelets and leukocytes ( moncada and higgs 1993 ; draijer et al 1995 ; myers and tanner 1998 ; brocq et al 2008 ) . no is likely , therefore , to be an important contributory factor in the pathogenesis of some forms of stroke . there are 3 distinct isoforms of nos identified in humans : endothelial ( enos ) , neuronal nos ( nnos ) and inducible nos ( inos ) . it synthesizes very low levels no under basal conditions ( lscher and vanhoutte 1990 ; harrison 1997 ; shimokawa 1999 ) . because enos plays a central role in the maintenance of vascular homeostasis , including regulation of the cerebral circulation , a number of studies have been conducted to investigate the genetic association between the enos gene and the incidence of ischemic stroke . howard and colleagues ( 2005 ) detected 3 single nucleotide polymorphisms ( snps ) in the promoter region , 1 in exon 7 ( g894 t ) and 1 insertion / deletion polymorphism within intron 4 among 110 cases with ischemic stroke and 206 controls . they found strong associations of both the 922 g - a and 786 t - c snps with ischemic stroke . hou and colleagues ( 2001 ) were the first to report the genetic association between the enos gene and ischemic stroke in a chinese population and a recent work has confirmed the intial finding ( berger et al 2007 ) although the enos association failed to be replicated in a japanese population ( yahashi et al 1998 ) . this study might have been hampered by poor replication , a common problem with genetic analysis . linkage disequilibrium ( ld ) structure and sample power may be one of major reasons for poor replication of an initial finding . therefore , the present study was designed to apply a large sample size to investigate genetic association between the enos gene and ischemic stroke . the present study recruited 560 unrelated patients with ischemic stroke and 153 unrelated controls in order to undertake a genetic analysis for association between the nos3 gene and ischemic stroke . patients with ischemic stroke were admitted to the first hospital of jilin university , changchun , china in the period between 2005 and 2006 . they were diagnosed as having ischemic stroke independently by at least two well - trained neurologists based on strict neurological examination , computed tomography , or magnetic resonance imaging , which meet the international classification of diseases ( nchs 2007 ) . detailed information regarding their medical history , medication and clinical presentation was taken through either their close relatives or themselves . of these 560 patients ( 398 males and 162 females ) , 426 were suffering from simple lacunar infarction , 246 from large - vessel infarction and 112 from both . the study was granted prior approval by the ethics committee of jilin university , changchun , china . to perform genetic analysis , we selected snp rs3918181 ( rsa i site ) as a genetic marker at the nos3 locus . it is an a to g base change present in intron 14 of the gene . polymerase chain reaction ( pcr)-based restriction fragment length polymorphism ( rflp ) analysis was performed to genotype rs3918181 . genomic dna used for pcr amplification was extracted from the whole blood sample using a dna extraction kit ( promega , beijing , china ) . pcr amplification was performed in a 25-l reaction volume containing 10 mm tris - hcl ( ph 8.3 ) , 50 mm kcl , 1.5 mm mgcl2 , 0.001% ( w / v ) gelatin , 200 m of each dntp , 0.4 m of each primer , 1.0 unit of taq dna polymerase ( promega , beijing , china ) , and 3050 ng of genomic dna . the conditions used for pcr amplification included an initial denaturation at 94 c for 5 min , followed by 3540 cycles of 94 c for 45s , 5560 c for 1 min and 72 c for 1 min , and a final elongation at 72 c for 10 min . a 15-l aliquot of the pcr products was completely digested with 68 units of restriction enzymes . the hardy - weinberg equilibrium for the genotypic distributions of rs3918181 was tested using the chi - square ( ) goodness - of - fit test . applied to test sample power for individual alleles was tested using the spss samplepower 2.0 software package ( spss inc . , allelic association was tested by the cocaphase module of the unphased program ( dudbridge 2003 ) and genotypic association was tested by the spss program for windows 15.0 ( spss inc . ) . the goodness - of - fit test showed that the genotypic distributions of rs3918181 were not deviated from hardy - weinberg equilibrium in both the patient group ( = 0.166 , p = 0.684 ) and the control group ( = 0.421 , p = 0.517 ) . these 560 case and 153 control samples gave a power of 60% for detection of small effect size and 100% for detection of medium effect size . analysis with the cocaphase program showed that rs3918181 was associated with ischemic stroke in males ( = 4.04 , p = 0.044 , or = 1.43 , 95%ci 1.012.02 ) and frequency of allele a of rs3918181 was significantly higher in male patients than male control subjects ( table 2 ) . however , female patients did not show such an association ( table 2 ) . as shown in table 3 , the test revealed genotypic association between rs3918181 and ischemic stroke in males ( x = 4.26 , df = 1 , p = 0.039 , or = 1.61 , 95% ci 1.022.53 ) but not the genotypic association was not observed in female subjects . the gene coding for enos is mapped to the long arm of chromosome 7 ( 7q36 ) and spans 21 kb of dna , although it contains 26 exons . it should be sufficient to capture a linkage disequilibrium ( ld ) signal by genotyping a highly polymorphic dna marker present in the middle of the gene . snp rs3918181 is located in intron 14 of the gene and has heterozygosity of 0.43 . this finding gives further evidence in support of the enos association with ischemic stroke in the chinese population , although female patients did not show such an association in our samples ( tables 2 and 3 ) . the sample power test indicates that the study is not sufficiently powered at present for detection of small effect - size gene . however , we will continue to collect controls matched for age , sex and ethnicity in order to confirm the results and 80% of power will be needed for combined samples in our future study .

we recruited 560 unrelated patients with ischemic stroke and 153 unrelated controls to undertake a genetic analysis for association between the nos3 gene and ischemic stroke . all the subjects were chinese of han descent . because the nos3 gene spans about 21 kb of dna and contains 26 exons , we selected a single nucleotide polymorphism ( snp ) rs3918181 , an a to g base change located in intron 14 of the gene , as a dna marker . pcr - based restriction fragment length polymorphism analysis was applied to genotype rs3918181 ( rsai site ) . the chi - square ( 2 ) goodness - of - fit test showed that the genotypic distributions of the marker were not deviated from hardy - weinberg equilibrium in both the patient group ( 2 = 0.166 , p = 0.684 ) and the control group ( 2 = 0.421 , p = 0.517 ) . the cocaphase analysis showed allelic association of rs3918181 with ischemic stroke in males ( 2 = 4.04 , p = 0.044 , or = 1.43 , 95% ci 1.012.02 ) and frequency of allele a was significantly higher in male patients than male control subjects . the 2 test revealed genotypic association between rs3918181 and ischemic stroke in males ( 2 = 4.26 , df = 1 , p = 0.039 , or = 1.61 , 95% ci 1.022.53 ) but not in females . the present work suggests that rs3918181 is associated with ischemic stroke in male patients . this finding gives further evidence in support of the enos association with ischemic stroke in the chinese population .

Introduction Materials and methods Results Discussion

it is located at the interface of these two vastly different environments , and thus is charged with making the final decision about what , from an uncontrolled and often hostile chemical surround , should be incorporated into the highly controlled biochemical environment within . taste is the beginning of a long chemosensory tube that extends from palate to intestines , with receptors along that length that are sensitive to the products liberated by digestion . those on the palate are not unique to taste ; the same receptors often occur elsewhere in the body . what is unique is that those serving taste gather their information before the irrevocable decision to swallow has been made , and so can influence that decision . hence , whereas the distribution of information from other chemical sensors may be limited to the gastrointestinal ( gi ) tract , or may be conveyed through the vagus only to the hindbrain , that from taste receptors is projected through the brainstem to the thalamus and multiple cortical sites as well as to ventral forebrain areas . this vast distribution through the central nervous system permits the control of somatic and autonomic reflexes , a cognitive evaluation , and hedonic appreciation . an apt metaphor for taste is a janus head , mounted on an ancient city gate , one face turned outward to assess the traffic beyond the walls , warning of approaching toxins and alerting gatekeepers to the availability of nutrients ; the other turned inward to monitor the city 's changing needs and to adjust its decisions of what passes through the city walls to satisfy them ( scott , 1987 ) . this view of the role of gustation as a visceral ( internal ) as well as somatic ( external ) sense defines its learning capacity . taste is exquisitely well suited to learn from visceral consequences ( satiety , nausea ) ; it is less inclined to learn from those that are somatic ( tones , lights , and shocks ) . as garcia noted in describing the development of a taste aversion following a meal , no other aspect of the event was implicated in having caused nausea : not his dinner companions , the table settings , or the background music , only the visceral component represented by the taste of the meal ( garcia et al . , 1985 ) . the realm of conditioning can be broadly divided into those events that one can do something about , and those that one can not . the former typically demands operant conditioning to manipulate the environment to one 's satisfaction , using somatic senses to gather information and striated muscles for action ; the latter more commonly demands classical conditioning to prepare for the inevitable , often using smooth muscles . gustatory learning serves as a special case of classical conditioning , with taste representing the conditioned stimulus ( cs ) , and the visceral sequelae of ingestion , the unconditioned stimulus ( us ) . it has been proposed that the visceral response alters the reward value of the taste , and that this new value then guides the animal 's behavior to either seek or avoid that taste ( rolls , 2005 ) . such learning can occur in an appetitive or aversive direction , with the establishment of either conditioned taste aversions ( ctas ) or preferences ( ctps ) . it is of greater urgency to the animal to avoid a chemical that has sickened it than to develop a preference for one among many that have proven to provide nutrition . the cta is readily established with a single pairing of the gustatory cs and the visceral us , even with a cs - us interval for several hours . it is not impaired by placing the animal under deep anesthesia or rendering it comatose before the us is delivered . indeed , the predisposition of an animal to develop a cta is so striking that the investigators first suspected it to be an artifact , a suspicion laid to rest only by an exhaustive series of studies and arguments ( revusky , 1977 ) . as easily as it is created , a cta is notoriously difficult to extinguish ( nolan et al . , 1997 ) . the cta also has a robust impact on behavior , often suppressing subsequent acceptance of the cs to less than 10% of preconditioned levels , even in animals motivated to consume by moderate deprivation . with such a dramatic impact on behavior , the cta has a half - century history as a rich topic of research . thousands of studies were conducted during the 1960s and 1970s on behavioral variables such as the distinctiveness and novelty of the taste , the nature and severity of the nausea , the amount of time between them and how that time was spent . with these clearly defined , the cta could be employed by researchers as a tool for altering taste acceptability , creating a profound reduction in acceptance of the cs , from which generalization gradients of both quality and intensity could be determined to reveal the relative similarities among taste qualities . in parallel , behavioral neuroscientists began to investigate the mechanisms by which this extraordinary learning process occurred , using rats in nearly all studies . they performed lesions of taste pathways and relays to determine which areas of the nervous system were required in order to develop and retain a cta . there followed electrophysiological investigations of the impact of a cta on taste processing , immunohistochemical studies of gene expression elicited by a cta , and microdialysis experiments on the neurochemical consequences of the experience . a ctp can be established rather quickly by pairing a novel taste with recovery from a dietary deficiency , most notably the provision of thiamine to animals on a thiamine - deficient diet ( rodgers , 1967 ; capretta , 1977 ) . more commonly , however , the impact of a ctp on behavior is revealed only gradually over days of continuous pairing of taste with nutrition , though that impact can reach levels equal to those of a cta in the opposite direction , i.e. , approaching 100% preference ( sclafani and nissenbaum , 1988 ) . the electrophysiological and neurochemical concomitants of a ctp are also more subtle than those of a cta . yet , the ctp may have played a larger role in defining human culture than the cta , for while the latter is powerful , it is idiosyncratic to the individual . the ctp , by contrast , is often shared by members of a culture where certain foods are available . it is typical of a culture 's cuisine that there are a few piquant tastes ( the cs ) accompanied by carbohydrate loads ( the us ) . the gustatory cs comes to be favored by association with the nutritional us , and the cuisine , with all its cultural trappings and traditions , tends to bind its consumers together as part of their cultural identity . in the paragraphs that follow , i will review some of the work on the mechanisms of ctas and ctps that have come from our laboratory and those of our colleagues . the ingredients of the cta taste and visceral distress are represented widely across the cns . investigators have performed lesions of areas that receive such inputs in an effort to define which are crucial to the creation and to subsequent retention of a cta . results implicate the area postrema in acquisition ( rabin et al . , 1983a ) , but not retention ( rabin et al . , 1983b ) they reveal that loss of the parabrachial nuclei ( pbn ) causes the most profound disruption on both creating a cta ( with lesions of the lateral division ) ( spector et al . , 1992 ; yamamoto et al . , 1994 ) and maintaining a previous aversion ( medial division ) ( sakai et al . , 1994 ) . they implicate the ventromedial globus pallidus in both acquisition and retention ( hernadi et al . , 1997 ) . electrolytic lesions of the basolateral amygdala disrupt the creation and retention of a cta ( yamamoto et al . , 1995 ) , but nmda lesions , which spare fibers of passage , do not ( chambers , 1990 ) ; thus the amygdala remains a likely participant in cta formation , but the axons that pass through it may be of greater import , since leaving them intact sustains the learning . lesions of prefrontal cortex have yielded conflicting results , and its role in ctas remains uncertain . those in insular cortex ( ic ) , however , reliably degrade cta acquisition ( braun et al . , 1982 ; bermudez - rattoni and mcgaugh , 1991 ) and have an even larger impact on retention . thus , the cast of participants in creating and retaining a cta as demonstrated by these fixed , permanent lesions range from the deepest recesses of the brain stem through ventral forebrain to the neocortex . greater insight may be gleaned from lesions that are reversible , or that combine the loss of more than one area . ivanova and bures ( 1990a , b ) temporarily disabled regions of the brainstem with microinjections of tetrodotoxin ( ttx ) . they reported that ttx injected in the pbn up to one day in advance or four days following training blocked the consolidation of a cta without affecting the rejection threshold for quinine . thus , taste processing per se remained intact , but the associative functions required for learning the aversion were disrupted by inactivation of the pbn . the crucial role of pbn in mediating associative taste learning was reinforced by clark and bernstein ( 2009 ) . these investigators performed asymmetrical , unilateral lesions of the pbn and ic , and thereby disrupted cta acquisition . however , when both lesions were made in the same hemisphere , leaving the contralateral hemisphere intact , learning proceeded normally . the effect of a cta is to reverse the behavioral reaction to a previously preferred taste to one of the revulsion . the rejection response is organized in caudal brainstem ( norgren and grill , 1982 ) and released in stereotypical fashion upon encountering an inherently aversive stimulus or one to which a cta has been formed . the nucleus of the solitary tract ( nst ) , the first central relay for taste , is likely to be involved in cta formation . here gustatory and visceral afferents converge ( norgren , 1981 ) yet do not directly overlap , communicating instead via the adjacent reticular formation , offering a close association between signals from the two necessary components of a cta . chang and scott ( 1984 ) took single neuron recordings from the nst of rats that were ( 1 ) unconditioned ( tasted the saccharin cs with no subsequent nausea ) , ( 2 ) pseudoconditioned ( experienced the nausea us with no preceding taste ) , or ( 3 ) conditioned ( the taste of the saccharin cs was paired with licl - induced nausea us ) . the recordings revealed that sweet - oriented nst neurons gave exaggerated responses to the saccharin cs in conditioned rats , and that the increase was due to a sharp spike of activity that peaked at about 900 msec following stimulus delivery ( figure 1 ) . moreover , the neural response profile to saccharin in conditioned rats was more similar to those of aversive stimuli . we concluded that the sensory code for the saccharin cs ( and , to a lesser extent , for other sweet stimuli ) was altered at the first central taste relay by conditioning , and that such a modification could explain not only the behavioral reaction , but also the immunohistochemical , and neurochemical consequences of a cta described below . such a modification of the taste signal might also reveal why the cephalic phase insulin release from the pancreas , a parasympathetic reflex elicited by sweet taste , is blocked after a cta has been created to that taste ( louis - sylvestre and lemagnen , 1980 ) . the altered neural message would lose the capacity to innervate the vagal efferents responsible for stimulating pancreatic cells . post - stimulus time histograms of the mean responses among sweet - sensitive neurons in the nucleus of the solitary tract to the conditioned stimulus : 0.0025 m sodium saccharin . activity is shown for control ( dotted line ) , pseudoconditioned ( dashed line ) , and conditioned ( solid line ) rats . the enhanced activity during the first three seconds of the evoked response in conditioned animals may represent the increased salience of the sodium saccharin taste and its aversive quality . in a subsequent experiment , we created , and then fully extinguished a cta to saccharin ( nolan et al . , 1997 ) , then recorded responses to saccharin and other stimuli in these recovered rats and in unconditioned controls ( mccaughey et al . , 1997 ) . the mean responses to all stimuli were no different in the two groups of rats , nor was there any significant difference between the neural response profiles to any taste . however , the neural activity was not completely restored to the preconditioning state . there remained a clear vestige of the conditioning experience in an attenuated burst given to the cs by the sweet - sensitive subgroup of neurons . the burst was no longer associated with conditioned behavior which was fully extinguished though it may have served as a permanent marker for a once - salient cs that can abet subsequent reacquisition of the aversion . curiously , lesions in gustatory nst do not interfere with either the acquisition or retention of a cta ( grigson et al . , 1997 ; shimura et al . , 1997a ) . even if the electrophysiological effects recounted above were only advisory to a more commanding cta nucleus or circuit , the blockade of taste information at this obligatory synapse would appear to prevent any subsequent learning . the lack of an impact may reflect the inadequacy of lesions to fully compromise a functioning relay , particularly when they must spare adjacent areas that control vital reflexes , including respiration . in the parabrachial nucleus , the creation of a cta to nacl resulted in an elevated response to that stimulus in sodium - specific taste cells , in agreement with the responses to the saccharin cs in the nst described above ( shimura et al . , 1997b ) . the same was found in the ic ( yamamoto et al . , 1989 ) and amygdala , where an exaggerated response to the cs is often expressed as inhibition ( yasoshima et al . , 1995 ) . finally , in the hypothalamus of nave rats , the taste of saccharin activates areas associated with feeding and inhibits those for satiety ; after the saccharin is paired with nausea , these roles are reversed ( aleksanyan et al . , 1976 ) . thus , the impact of a cta is demonstrable in the electrophysiological activity of neurons across the widely dispersed regions that process taste activity , and that impact is appropriate to guide the aversive reaction to the cs that follows conditioning . the formation of long - term memories requires the expression of immediate early genes and the synthesis of their associated proteins ( mcgaugh , 2000 ) . the gene c - fos has been shown to be expressed and the associated fos protein synthesized in a variety of species as a basis for modifying the neural activity associated with learning ( sanyal et al . , 2002 ) . c - fos expression , then , can serve as a useful index of conditioning . 1994 ) demonstrated that sucrose elicited c - fos expression in the nst after it had been paired with an intraperitoneal injection of licl . this was not simply a response to the aversive taste that sucrose had become , for quinine did not induce the same expression in unconditioned rats ( houpt et al . , 1996 ) . however , this index of learning in nst was blocked when the amygdala was impaired , demonstrating the importance of centrifugal fibers in mediating the conditioning process ( schafe and bernstein , 1996 ) . his colleagues have shown that c - fos is induced in cells in the medial division of pbn by hedonically positive tastes associated with ingestion , and in neurons in more lateral divisions by aversive tastes . saccharin activates medial cells in nave rats , but after the saccharin has been paired with a licl injection , its taste induced c - fos expression in the lateral division ( yamamoto et al . , 1994 ) . moreover , when c - fos expression was blocked in pbn , cta learning was impaired , just as it is when the pbn is lesioned ( yasoshima et al . , 2006 ) . thus , a functioning pbn , capable of modifying its responses to a taste stimulus as a consequence of experience , is crucial to learning to avoid toxins . in forebrain , bernstein and koh ( 2007 ) addressed the issue of which areas reacted to novel tastes differently from those that were familiar , since only the former serve as effective conditioned stimuli . they used c - fos expression to identify the central nucleus of the amygdala ( cna ) and ic as two such sites . the next question was which of these also responded to the us , the second of the necessary elements of a cta . only the cna expressed c - fos to a licl us , implicating this nucleus as a crucial nexus for making the association . yet while ic , which had responded to gustatory novelty , did not show increased c - fos expression to the us alone , its neurons did respond to pairing of the cs and us , reinforcing its role in the associative process , perhaps through communication with the pbn and amygdala ( ferreira et al . , 2006 ) . gene expression , of course , is a precursor of protein production , and it is assumed that the protein is the basis for forming the associative memory . accordingly , when protein synthesis was inhibited by administration of anisomycin into the ic , a cta was not formed ( rosenblum et al . , 1993 ) . more specifically , the administration of oligodeoxynucleotide ( odn ) antisense to c - fos in the amygdala blocked cta acquisition ( lamprecht and dudai , 1996 ) . again , the two critical forebrain regions ic and amygdala are implicated , and the capacity of their neurons to synthesize proteins in general , and fos in particular , is essential to associative learning . finally , bernstein and her colleagues ( barot et al . , 2008 ; used a direct visualization approach to identify neurons that responded both to the cs and us , reasoning that this afforded them prima facie data from which to support the association . they found such cells only in the basolateral nucleus of the amygdala , and only under normal training conditions , i.e. , cs followed by us . the bulk of evidence from gene expression studies , then , focuses on three structures as being central to the acquisition and retention of ctas : the pbn , the amygdala ( both central and basolateral nuclei ) , and the ic . it is unsurprising , then , that when the cs to which a cta has been developed is subsequently presented , reminiscent of that experience , plasma corticosteroid levels rise ( smotherman et al . , 1976 ) . yet , the cta does not depend on this adrenal index of stress , for adrenalectomized rats acquired ctas as readily as controls ( ader et al . , 1978 ) . a more specific measure of the impact of a cta is seen in the levels of neurochemicals associated with reward or aversion , particularly in the limbic system . reward is associated with increased dopamine ( hoebel , 1984 ) and reduced acetylcholine ( rada et al . , 1991 ) in the nucleus accumbens , and lowered serotonin levels in the paraventricular hypothalamus ( stanley et al . , 1989 ) . this relationship has been demonstrated both through microdialysis , where dopamine levels in the accumbens rose following a sweet taste , and conversely through reverse microdialysis in which dopamine administered to the accumbens increased sucrose consumption ( hajnal and norgren , 2001 ) . the taste of saccharin evoked dopamine release in the rat 's accumbens , in accord with its reinforcing value . however , if the saccharin had been paired with nausea to create a cta , the same stimulus caused a reduction in dopamine , and instead a release of acetylcholine in accumbens ( mark et al . , 1991 ) , and serotonin in the hypothalamus ( west et al . , 1991 ) , denying the neurochemical basis for reward . when subjects develop a cta , there is little doubt that they are subsequently repulsed by the taste . not only do they avoid it , they also show the well - defined mimetic reflexes of aversiveness : gaping , head - shaking , and chin - rubbing . all that follows the blockade of parasympathetic reflexes , the alteration of the afferent signal and its projection to brain areas associated with avoidance , the reversal of neurochemical release from rewarding to aversive is in accord with this powerful experience . the behavior changes only over days of training , though the cs does finally reach asymptotically high levels of acceptance , and is quite resistant to extinction . mimetic responses of rats , however , do not change as the cs wins acceptance , raising the question of whether the hedonic quality of the cs has increased ( sclafani , 1991 ) . ( 1997 ) recorded electrophysiological responses from the nst of rats that had been conditioned to prefer either of two formerly aversive chemicals . in each case , the gustatory code was modified to reflect a less aversive quality , though the effect was less pronounced than that seen in the opposite direction upon creation of a cta ( chang and scott , 1984 ) . secondly , the taste for which a preference was acquired now elicited a heightened dopamine release in the nucleus accumbens , a clear neurochemical marker of reward ( mark et al . , 1994 ) . the animal knows two facts : what the chemical was ( taste ) , and what it did ( gi ) . this information permits it to tailor its chemical selection to full individual advantage over a lifetime . the learning process draws on responses that extend from the viscera through caudal brainstem , to ventral forebrain and cortex , implying an ancient system , much like the control of feeding itself . it is only a marginally conscious process , for ctas can be learned while comatose , and most people can not recall the occasion upon which they developed a food aversion ( bernstein , 1985 ) . conditioned aversions and preferences provide the operative link between the chemical and biochemical environments . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

taste is the final arbiter of which chemicals from the environment will be admitted to the body . the action of swallowing a substance leads to a physiological consequence of which the taste system should be informed . accordingly , taste neurons in the central nervous system are closely allied with those that receive input from the viscera so as to monitor the impact of a recently ingested substance . there is behavioral , anatomical , electrophysiological , gene expression , and neurochemical evidence that the consequences of ingestion influence subsequent food selection through development of either a conditioned taste aversion ( cta ) ( if illness ensues ) or a conditioned taste preference ( ctp ) ( if nutrition ) . this ongoing communication between taste and the viscera permits the animal to tailor its taste system to its individual needs over a lifetime .

Introduction Conditioned taste aversion: Lesion studies Conditioned taste aversion: Electrophysiology Conditioned taste aversion: Gene expression Conditioned taste aversion: Neurochemistry Conditioned taste preference Conclusion Conflict of interest statement

a 36-year - old man visited the emergency department of inje university haeundae paik hospital with severe pain in both lower limbs for 1 day . a physical examination revealed pale , pulseless , and cold lower limbs . one year ago , he had been diagnosed with kimura disease ( kd ) after excision of a right upper limb mass ( fig . the initial laboratory findings were as follows : leukocyte count of 45.510/l with 74% eosinophils , elevated serum fibrinogen degradation product ( fdp ) level ( 18.7 g / ml ) , elevated d - dimer level ( 5.1 g / ml ) , and extremely elevated serum immunoglobulin ( ig ) e ( > 2,500 iu / dl ) . a computed tomography ( ct ) angiogram showed total occlusion of both popliteal arteries ( pas ) ( fig . under the presumptive diagnosis of acute limb ischemia ( ali ) , the patient underwent an emergency thrombectomy of both femoral arteries using a fogarty catheter ( edwards laboratories , santa ana , ca , usa ) . after the operation , the pain and color changes resolved , but the right foot drop remained . to prevent thromboembolic events , immunochemical tests for autoimmune diseases , including lupus anticoagulant , anticardiolipin igg and igm antibodies , anti - beta2-glycoprotein igg and igm , and anti - phospholipid antibodies , were negative . protein s activity was low , but the levels of the total and free protein s antigen were normal , suggesting a type - ii protein s deficiency . an echocardiogram was performed ; it revealed no evidence of a cardiac thrombus or decreased systolic function of the left ventricle ( ejection fraction=47% ) . under the presumptive diagnosis of kd - related ali , the patient was administered steroid therapy . a follow - up ct angiogram on postoperative day ( pod ) brachial index ( abi ) was 0.87 on the right side and 0.62 on the left . coronary angiography ( cag ) on pod 5 showed triple - vessel disease with chronic total occlusion of the left anterior descending artery ( lad ) , left circumflex artery ( lcx ) , proximal obtuse marginal artery , and posterior descending artery ( fig . stent insertion for the coronary artery was delayed because we needed to observe the kd activity and plan the second operation for the left pa . we performed the second operation on pod 17 because of the low abi of the left lower limb . a thrombus and a hypertrophic , injured intimal layer were observed after the longitudinal arteriotomy ( fig . after the removal of the thrombus and the injured intimal layer , a patch angioplasty using bovine pericardium ( vascu - guard biovascular inc . , st . 2e ) : ( 1 ) thrombosis occluding the vessel lumen and intimal thickening with fibroblastic proliferation ( the intima showed reactive changes with fibroblastic proliferation ) were observed . ( 2 ) the thrombotic material contained a prominent number of eosinophils , and mixed inflammatory cell infiltration composed of eosinophils and lymphocytes was observed in the vessel wall . two months after the first discharge , the patient returned to the emergency department with right lower extremity pain and a color change that had developed the day before . a ct angiogram showed total occlusion from the right superficial femoral artery to the distal pa ( fig . we performed an emergency thrombectomy , partial endarterectomy , and patch angioplasty on the right side . the operative findings on the right side were the same as the findings on the left side . a coronary stent was inserted into the lad , and the lcx was balloon dilated ( fig . the patient was then treated with aspirin , clopidogrel , and cilostazol for preventing in - stent thrombosis and prednisolone for kd . kd is characterized by marked eosinophilia , an elevated ige level , and recurrent subcutaneous nodules around the head and neck . however , the increased serum ige level and eosinophilia suggest an allergic disease [ 14 ] . despite an unclear mechanism , hypereosinophilia can lead to a hypercoagulable condition and vasculitis according to some published reports [ 57 ] . a possible mechanism is that the cytokines secreted by eosinophils , including eosinophil cationic protein , eosinophil peroxidase , and major basic protein , activate platelet aggregation . some researchers have demonstrated that human eosinophils contain various amounts of the tissue factor ( tf ) and have concluded that relatively high tf expression in patients with hypereosinophilia may contribute to an increased thrombotic risk . in this case however , kd has been treated with local mass excision , steroids for systemic inflammation , revascularization , and anticoagulation for organ ischemia . some researchers have reported that radiotherapy was a successful treatment for kd . in our patient , furthermore , we performed a partial endarterectomy and patch angioplasty for revascularization . additionally , the patient was administered prednisolone to control the activity of kd . his serum leukocyte and eosinophil counts and fdp and serum ige levels normalized . many revascularization methods are available for ali , including thrombectomy , stent insertion , patch angioplasty , and extra - anatomic bypass with a synthetic or saphenous vein graft . patch angioplasty is more effective for removing a thrombus and widening the lumen than a stent and is easier than a bypass . cag to evaluate other forms of vasculitis revealed coronary artery obstructive disease ( caod ) , and we inserted a coronary stent instead of performing a bypass . because of the patient s young age , coronary artery bypass grafting was the treatment of choice for caod . the mechanism of caod in our patient was different from that of caod in other cases . however , antiplatelet therapy was needed , and the patient required long - term follow - up . in conclusion , kd is a systemic disease that affects many organs and presents with thromboembolism and vasculitis . in a patient with kd , physicians should evaluate the vascular system , including the coronary arteries .

kimura disease ( kd ) is an immune - mediated chronic inflammatory disease of unknown etiology . kd has many complications associated with hypereosinophilia , including various forms of allergic reactions and eosinophilic lung disease . additionally , hypereosinophilia is associated with hypercoagulability , which may lead to thromboembolic events . a 36-year - old man with kd presented with acute limb ischemia and coronary artery occlusion . he underwent thrombectomy , partial endarterectomy of both popliteal arteries , and coronary artery stent insertion . kd is a systemic disease that affects many organs and presents with thromboembolism and vasculitis . in a patient with kd , physicians should evaluate the vascular system , including the coronary arteries .

Case report Discussion

businesses offering goods and services to consumers often request feedback from former customers to assess strengths and weaknesses and to leverage positive feedback and testimonials as marketing materials . as these testimonials become more digitized and more public on sites like yelp , facebook , and google+ , businesses have a high stake in ensuring that their consumers are satisfied with the quality of service or goods they provide [ 2 , 3 ] . in the healthcare space , the hospital consumer assessment of healthcare providers and systems ( hcahps ) initiative provides a survey tool to measure patients ' perspectives and satisfaction within hospital systems . the hcahps survey aims to produce standardized data on patients ' perspectives on hospital care to allow for meaningful comparisons between hospitals based on consumer importance and publicly represent these findings to encourage transparency and incentivize hospital systems to improve their quality of care . the hcahps initiative has identified 21 rating items that have been determined to affect patient perspectives on hospital care and has generated a 32-question survey that assesses quality of care from nurses and doctors , hospital environment , and experiences in the hospital . while this survey instrument is widely used in the hospital setting , an equivalent tool does not exist to evaluate satisfaction and perspectives in other areas of medicine and health , including addiction rehabilitation programs . unique in its function , residential addiction treatment centers simultaneously operate as healthcare providers and hospitality managers , delivering medical and psychological support while offering accommodations , meals , and amenities in lieu of a clients ' typical home environment . in this exploratory study , we aim to determine which criteria are most significant to influencing overall alumni satisfaction with an inpatient drug or alcohol rehabilitation facility . because the residential and intensive outpatient addiction rehabilitation industry functions at the crux of social science , medicine , and hospitality services , we hypothesize that alumni perceptions of facility amenities and perceived quality of individual therapies and group counseling will have significant influence on alumni satisfaction . we also hypothesize that the presence of subsequent relapse after discharge from a facility as a proxy measurement for success will negatively influence alumni satisfaction . a survey was created using surveymonkey 's online survey design platform to assess alumni feedback and satisfaction of a recent stay in an inpatient drug or alcohol rehabilitation facility . the survey contains 45 questions with an equal mix of single choice and open - ended questions . the survey also includes three matrix questions for evaluation of facility features , individual therapy , and group counseling . respondents were asked to evaluate their facilities by the following criteria : the facility 's amenities and individual and group counseling services . they were also asked to respond to demographic and personal questions regarding age of entry into treatment , method of payment , and motivation to enter treatment . the evaluated aspects are as follows : amenities accommodations , meals and nutrition , exercise options , leisure / extracurricular , holistic offerings ( e.g. , yoga and meditation ) , staff support , connectivity ( internet / phone use ) , visitor policy , and cleanliness;individual counseling counselor availability , counselor training / experience , counselor respect for patient 's treatment preferences , flexibility to switch counselors , inclusion of holistic approaches , and inclusion of alternative / creative treatment approaches;group counseling quality of lead counselor , frequency of meetings , consistency of meetings , member empowerment / safety , and conflict resolution . amenities accommodations , meals and nutrition , exercise options , leisure / extracurricular , holistic offerings ( e.g. , yoga and meditation ) , staff support , connectivity ( internet / phone use ) , visitor policy , and cleanliness ; individual counseling counselor availability , counselor training / experience , counselor respect for patient 's treatment preferences , flexibility to switch counselors , inclusion of holistic approaches , and inclusion of alternative / creative treatment approaches ; group counseling quality of lead counselor , frequency of meetings , consistency of meetings , member empowerment / safety , and conflict resolution . the survey targets alumni of inpatient drug or alcohol rehabilitation facilities whose most recent enrollment occurred within the past ten years . respondents were targeted through surveymonkey audience , which is a service that provides survey takers with targeted , representative sample populations . additionally , respondents were asked a qualifying question , to ensure they met targeting requirements . inclusion criteria for analyses include a minimum survey completion of 75% over the variables forming the aggregate scores ( i.e. , category components ) and 100% over the remaining relevant variables . survey data collected from august 25 , 2014 , to february 22 , 2015 , were included in these analyses . of the 864 survey responses received , 485 responses did not fit the sample parameters for completeness and were removed from the database , resulting in a sample of 379 surveys . recoding was required to convert the survey platform 's default coding into a consistent format compatible with stata 's requirements . full details regarding cleaning and coding ( .log ) are available at the reader 's request . data were analyzed using a variety of logistic regression models , due to the outcome variables being dichotomous . for the purpose of these analyses , the dataset was declared as survey data , using stata 's svyset command . all of the following analyses utilized the appropriate svy command prefix , unless otherwise noted . the likelihood of a respondent responding positively ( i.e. , answering yes ) to the binary questions would you recommend the facility to a friend or family member ? was assessed by examining the impact of the respondent 's perception of the facility 's offerings . to better evaluate this potential impact , variable was formed by finding the mean of the respective category component scores for each respondent . all data were deidentified , and respondents provided consent for use of survey data in public reporting and research directly on the survey . two metrics were considered indicators of satisfaction with the facility attended : if treatment was worth the cost , and if the respondent would recommend this facility to a friend or family member who is seeking addiction treatment . these two metrics were considered indicators of satisfaction as recommendations and personal cost - benefit ratios are standard proxies for satisfaction in marketing practices , as well as in health service assessments [ 4 , 814 ] . 66.05% ( n = 249 ) of respondents entered inpatient addiction treatment between 40 and 59 years of age . treatment was sought by individuals most frequently at their own behest ( 62.33% n = 235 ) and was most commonly paid for through private ( 33.86% n = 128 ) or government - provided ( 18.25% n = 69 ) insurance . the most frequently occurring profile is an individual that entered treatment as a personal choice between the ages of 40 and 59 years . the second most frequently occurring profile is an individual that entered treatment as a personal choice , between the ages of 26 and 39 years ; this profile fits 13.87% ( n = 52 ) of respondents . likert - scale scores were calculated for each individual metric regarding amenities , individual counseling , and group counseling ( table 2 ) . amenities received an overall composite likert - scale score of 3.99 ( sd = 0.97 ) . respondents scored four out of nine amenities factors highly ( likert - scale score > 4.00 ) . with regard to individual counseling offerings , which received an overall score of 3.84 ( sd = 1.14 ) , respondents highly rated counselor training and experience ( 4.36 sd = 1.10 ) , as well as their respect for the individual 's treatment preferences ( 4.25 sd = 1.18 ) . respondents were less pleased with counselors ' willingness to incorporate holistic approaches ( 3.18 sd = 1.62 ) . group counseling offerings were given an overall score of 4.37 ( sd = 1.00 ) . each of the five factors of group counseling was given a score greater than 4.00 , with the frequency of group meetings receiving the highest likert - scale score . four models were constructed using logistic regression to evaluate factors impacting an individual 's notion of treatment being worth the cost . the first model regresses the three summed aggregate offering scores regarding amenities ( variable name = afacilityscore ) , individual counseling ( acounsscore ) , and group counseling ( agrpcounsscore ) on the variable for was treatment worth the cost ? these variables are did the facility deliver the promised amount of counseling ? ( promcouns ) ; did psychiatric care meet expectations ? ( psyexpect ) ; and did marketing materials accurately portray the facility 's offerings ? ( market ) . the fourth model adjusts model 1c , taking into account whether or not the respondent had relapsed . the results of each model are as follows:(i)model 1a the aggregate mean group score is statistically significant , with a p value of 0.022 . the group counseling score produced the highest degree of substantive significance ; each point increase of the group counseling score corresponds with an increase in the odds of the respondent regarding their treatment as worth the cost by 126%.(ii)model 1b all three variables are statistically significant . whether or not the facility provided the promised amount of counseling has the highest degree of substantive significance . moving from no to yes on this variable corresponds to approximately a 37-fold increase in the odds of the respondent regarding his treatment as worth the cost.(iii)model 1c combining the previous two models yields interesting results . notably , when adjusting for offerings scores , the marketing materials accuracy becomes statistically insignificant . additionally , psychiatric care is no longer significant to the 0.001 level ; it also loses degrees of substantive significance . when taken together , this suggests that these variables are not the strongest predictive components . promised amount of counseling and aggregate mean group counseling score remain statistically significant and increase in substantive significance.(iv)model 1d model suggests that relapse is not a predictive component of whether or not the respondent considers their treatment as worth the cost , as relapse is not statistically significant . furthermore , adjusting for relapse increases the substantive significance of aggregate mean group counseling score and psychiatric expectations score . reproducing this model without the svy - estimation and conducting a likelihood ratio test with 1c yield a statistically insignificant result , suggesting that the model is not an improvement over 1c . model 1a the aggregate mean group score is statistically significant , with a p value of 0.022 . the group counseling score produced the highest degree of substantive significance ; each point increase of the group counseling score corresponds with an increase in the odds of the respondent regarding their treatment as worth the cost by 126% . model 1b all three variables are statistically significant . whether or not the facility provided the promised amount of counseling has the highest degree of substantive significance . moving from no to yes on this variable corresponds to approximately a 37-fold increase in the odds of the respondent regarding his treatment as worth the cost . notably , when adjusting for offerings scores , the marketing materials accuracy becomes statistically insignificant . additionally , psychiatric care is no longer significant to the 0.001 level ; it also loses degrees of substantive significance . when taken together , this suggests that these variables are not the strongest predictive components . promised amount of counseling and aggregate mean group counseling score remain statistically significant and increase in substantive significance . model 1d model suggests that relapse is not a predictive component of whether or not the respondent considers their treatment as worth the cost , as relapse is not statistically significant . furthermore , adjusting for relapse increases the substantive significance of aggregate mean group counseling score and psychiatric expectations score . reproducing this model without the svy - estimation and conducting a likelihood ratio test with 1c yield a statistically insignificant result , suggesting that the model is not an improvement over 1c . four models were constructed using logistic regression to determine potentially influential factors on alumni 's willingness to recommend the facility where they received treatment , represented by the variable recff . the first model regresses the aforementioned three aggregate mean offering scores ( afacilityscore , acounsscore , and agrpcounsscore ) on recff . the second model regresses the three aforementioned expectation variables ( promcouns , psyexpect , and market ) on recff . the results of each model are as follows : model 2a each point increase of the group counseling score corresponds with an increase in the odds of the respondent recommending the facility by 256% . the other two variables are not statistically significant.model 2b all three included variables are significant to , at least , the 0.001 level . of these variables , the most influential is the variable representing the promised amount of counseling ; a respondent answering yes to this question corresponds to an increase in the odds that they would recommend the facility approximately 661%.model 2c by increasing model specification , a clearer picture of recff 's predictors becomes apparent . for the group offering score and promised amount of counseling , the relative consistency in odds ratios and statistical significance across the two models suggests that these variables are influential factors in a facility receiving a positive alumni recommendation . this model also suggests that the respondent 's perceptions of the facility 's amenity offerings and individual counseling are not predictor variables , as these variables produced a statistically insignificant output over both models . finally , when controlling for the offerings scores , the psychiatric expectation and accuracy of marketing materials variables are not statistically significant , suggesting that they may not be strong predictor variables , despite being statistically significant predictors in model 2b.model 2drelapse is not a significant predictor . adjusting for relapse has minimal substantive effects on the significant predictor variables . as with 1d , reproducing this model without the svy - estimation and conducting a likelihood ratio test with 2c yield a statistically insignificant result , suggesting the model is not an improvement over 2c . model 2a each point increase of the group counseling score corresponds with an increase in the odds of the respondent recommending the facility by 256% . model 2b all three included variables are significant to , at least , the 0.001 level . of these variables , the most influential is the variable representing the promised amount of counseling ; a respondent answering yes to this question corresponds to an increase in the odds that they would recommend the facility approximately 661% . model 2c by increasing model specification , a clearer picture of recff 's predictors becomes apparent . for the group offering score and promised amount of counseling , the relative consistency in odds ratios and statistical significance across the two models suggests that these variables are influential factors in a facility receiving a positive alumni recommendation . this model also suggests that the respondent 's perceptions of the facility 's amenity offerings and individual counseling are not predictor variables , as these variables produced a statistically insignificant output over both models . finally , when controlling for the offerings scores , the psychiatric expectation and accuracy of marketing materials variables are not statistically significant , suggesting that they may not be strong predictor variables , despite being statistically significant predictors in model 2b . adjusting for relapse has minimal substantive effects on the significant predictor variables . as with 1d , reproducing this model without the svy - estimation and conducting a likelihood ratio test with 2c yield a statistically insignificant result , suggesting the model is not an improvement over 2c . the respondents ' evaluations of their respective facility 's offerings shed insight into the population 's perception of inpatient treatment . the study results indicate trends in facility offerings and respondents ' perceptions . in the aggregate , this finding is consistent with reviews across other industries , where the literature has shown that the general reviews tend to have a negative skew distribution . alumni reception towards facilities ' amenities and individual counseling is generally positive , albeit to a less enthusiastic degree compared to group counseling . facilities ' individual counseling offerings were the least enthusiastically received , particularly in regard to the facilities ' inclusion of holistic , alternative , and creative approaches . this dissatisfaction with holistic offerings is also present in the amenities category , indicating that such an attitude is pervasive and present in the respondents ' overall perception of the facility . models 1a d aim to determine the most substantial predictors of satisfaction with the financial value provided by treatment . these models suggest that high - quality group counseling , as well as meeting or exceeding expectations for the amount of counseling received , is the most substantial and substantively significant predictors of satisfaction relating to cost worthiness . additional statistically significant predictors of satisfaction for this metric are psychiatric care meeting expectations and , to a lesser extent , individual counseling offerings . models 2a d suggest key factors in alumni 's willingness to recommend a facility to their friends or family members . specifically , the results suggest that the respondent 's perceptions of their group counseling experiences , whether or not the facility delivered its promised amount of counseling and , to a slightly lesser extent , whether psychiatric care meets expectations , are instrumental in alumni 's decision to recommend their facility . the selected outcome variables and their responses are proxy measures of consumer satisfaction with treatment facilities ' services . evaluating the models related to these two variables simultaneously highlights strong and consistent potential predictors of consumer satisfaction with treatment facilities ' services . for both outcomes , and across each relevant model , the aggregate group counseling score and whether the facility kept its promises regarding individual counseling are statistically significant predictors of a respondent 's ( i.e. , consumer 's ) satisfaction with his or her treatment . this consistency across outcomes and models suggests the presence of predictive power for these two aspects of treatment services . to a lesser extent , this consistency is also observed for variables representing individual counseling and whether the facility delivered the expected psychiatric care . these results are strengthened by the failure to confirm the second hypothesis ; adjusted for the other selected variables , whether the respondent had relapsed or not was not a statistically significant predictor of alumni satisfaction . furthermore , its inclusion with these other potential predictor variables may not serve as necessary or beneficial specification . facilities should not approach their clients ' satisfaction with fatalistic uncertainty that the client 's postdischarge actions will solely create a negative retrospective perception of treatment ; rather , facilities should recognize that their actions can directly and primarily impact satisfaction , regardless of long - term client outcomes . it is well documented in the literature that higher patient satisfaction scores correlate well with medical treatment adherence [ 16 , 17 ] . for those struggling with addiction , facilities should aim to provide the most satisfactory service to promote treatment adherence . while individual counseling and amenity offerings certainly should not be ignored , high - quality group counseling should be supported and promoted to enhance clients ' treatment experience . improving satisfaction with group counseling offerings has the highest likelihood of improving overall consumer satisfaction , which in turn is likely to support greater adherence to a recovery plan a goal that should guide facilities ' operations . through incorporating empirical research into operational policy the importance placed on group counseling offerings should not solely be viewed through the lens of predicting consumer satisfaction , as broader implications for the treatment space exist . in addition to the aggregate group counseling score being the most consistent substantively and statistically significant predictor , each of its components , collectively , had the highest mean perception scores of the three aggregate categories . viewed together , these findings suggest that consumers are most enthusiastic and receptive to group counseling offerings . investigations into the role of social support on treatment adherence within the addiction space , and across several other health and wellness industries , have demonstrated moderate to significant improvements in adherence [ 1821 ] . just as satisfaction can improve adherence , adherence and subsequently resulting treatment successcan positively influence retrospective perceived satisfaction , thus beginning a cyclical pattern for satisfaction and treatment adherence [ 22 , 23 ] . for treatment providers , the construction of social support during treatment may build the foundation for successful and satisfactory long - term recovery . future research should aim to determine how group therapies improve satisfaction scores and treatment adherence to encourage clients ' recovery . this study includes the limitation that only two metrics were chosen as proxies for satisfaction . while cost worthiness and recommendations are significant proxies for satisfaction , other proxies may also exist . subsequent investigations may include the use of other metrics indicating satisfaction to test our findings . respondent recruitment utilized a self - selection method , which could contribute to selection bias within the study 's sample population . specifically , as the survey was hosted online , respondent demographics will reflect general internet user demographics , which may not be reflective of the general population . precise demographics for both the general population of rehabilitation alumni are unavailable , limiting the ability to determine sample representativeness . additionally , as reviews tend to skew positive , the potential predictor factors discussed below may not be generalizable for unenthusiastic alumni . through producing multiple models in regard to two outcome variables , our results highlight potentially key predictors of alumni 's satisfaction with their treatment experience . across both outcome variables , alumni 's perceptions of the facility 's group offerings and the facility keeping its promises regarding individual counseling are statistically and substantively significant . the alumni 's perceptions of the facility 's marketing materials ' accuracy and whether the facility delivered the expected psychiatric care are also statistically and substantively significant , but inconsistently so . satisfaction with treatment may be correlated with increased treatment adherence and subsequent long - term success in recovery . the addiction treatment space would benefit greatly from further research into the impact of these predictors , through refining of the aggregate component measurements , as well as evaluating the impact of components themselves , to gain a more clear understanding of predictors of consumer satisfaction and thus a better understanding of the treatment space .

objective . the primary objective of this investigation is to determine which individual and aggregate factors of residential addiction treatment centers are most significant influencers of alumni satisfaction . design . survey targeted alumni of residential addiction treatment facilities . alumni were queried through a survey , which utilized likert - scale matrices and binary response options : 379 respondents met the completion threshold . alumni rated amenities and individual and group counseling factors ; additionally , respondents provided feedback on two satisfaction proxies : cost worthiness and future recommendations . descriptive and relational analyses were conducted , with the latter utilizing logistic regression models . results . individual factors ' scores of group counseling , and overall aggregate group counseling score , are most enthusiastically positive . group counseling is also the most significant influencer of satisfaction . other significant influencers of satisfaction are met expectations for individual counseling and psychiatric care offerings . conclusions . while individual counseling and facility amenities should not be ignored , group counseling may be the most significant influencer of alumni satisfaction . long - term outcomes are not single - faceted ; however , treatment providers should be encouraged to invest in high - quality group counseling offerings in order to best satisfy , and thereby empower , clients .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

the majority of japanese patients with type 2 diabetes mellitus are not obese , as reported by kosaka and ogata more than 50 years ago . eastern asian subjects might share common characteristics of the disease , comparable to those reported in korean people . it is , therefore , debatable whether we can apply epidemiological evidence obtained from studies of caucasian subjects with type 2 diabetes and obesity to eastern asian people , especially in the fields of diabetic complications , which are influenced not only by hyperglycemia but also by obesity . for example , type 2 diabetes is a relative risk factor for cardiovascular disease in asians , as in western societies , but the absolute risk differs greatly between these populations [ 47 ] . recently , the legacy effect of intensive glycemic control early after the diagnosis of diabetes was advocated based on the ukpds follow - up study . however , there is no report about the legacy effect of past obesity over a lifetime on diabetic complications . although there have been inconsistent results as to whether obesity is a risk for diabetic nephropathy [ 912 ] , it was reported that current obesity and maximum past body mass index ( bmi ) were significant risk factors for diabetic nephropathy in the japanese . although caucasian subjects with type 2 diabetes usually maintain their body weight status during their disease course , the majority of patients of eastern asian ethnicity begin to lose body weight from around the time of diagnosis of diabetes [ 3 , 13 ] . this was easily overlooked , even if the effect of obesity in the past persisted for a long time , because they were already nonobese at the start of clinical follow - up . to clarify the influence of past obesity on diabetic complications is an important clinical concern in patients of eastern asian ethnicity . we therefore analyzed the difference in the prevalence of diabetic nephropathy in japanese type 2 diabetics according to their history of body weight status to clarify the effect of past obesity on diabetic nephropathy . we examined subjects with type 2 diabetes whose estimated glomerular filtration rate ( egfr ) was 30 ml / min/1.73 m or more and who were admitted to saiseikai central hospital from january 1999 to december 2004 ( n = 1834 ) or keio university hospital from april 1998 to september 2010 ( n = 1093 ) for the management of metabolic control . the study protocol was reviewed and approved by the ethics committee of both hospitals . those subjects in whom the etiology of renal disease was strongly suspected to be other than diabetic nephropathy were excluded . according to the history of body weight status and the japanese criteria for obesity , we defined current obesity as bmi on hospitalization of 25 or more , previous obesity as bmi on hospitalization of less than 25 and self - reported maximum bmi in the past of 25 or more , and continuously lean as maximum bmi of less than 25 . hba1c level on admission was determined by high - performance liquid chromatography ( hplc : arkray inc . , kyoto , japan ) according to the recommended method by the japan diabetes society ( jds ) at that time and converted to the national glycohemoglobin standardization program ( ngsp ) value . egfr ( ml / min/1.73 m ) was calculated as 194 cr age ( with further multiplication by 0.739 for female subjects ) using the equation provided by the japanese society of nephrology . subjects with albumin excretion rate ( aer ) of 20 g / min or more in 24-hour urine were considered to have diabetic nephropathy . hypertension was defined as systolic blood pressure > 140 mmhg , diastolic blood pressure > 90 mmhg , or the prescription of antihypertensive medication . < 1.04 mmol / l , or the prescription of lipid - lowering medication . continuous variables are expressed as mean sd . differences in baseline characteristics among the obesity categories were analyzed by anova and chi - squared test . chi - squared test was also performed to evaluate differences in prevalence , with bonferroni 's correction for post hoc multiple comparisons . as a result , logistic regression analysis with forced entry method was performed to detect significant independent predictors of diabetic nephropathy . we adopted as covariates factors such as sex , age , disease duration , hypertension , dyslipidemia , hba1c , and obesity status ( current obesity , past obesity , and continuously lean ) in this study . we analyzed a total of 2927 persons ( males 2038 , females 889 , age 59.3 10.6 years , bmi 24.0 4.0 , duration of diabetes 10.4 28.0 years , hba1c 9.3 2.8% ) . the prevalence of current obesity in the total subjects was 33.6% , previous obesity 41.5% , and a continuous lean state 24.8% . the prevalence of nephropathy was significantly different among the categories , and both currently obese ( 40.6% ) and previously obese ( 35.6% ) patients had a significantly higher prevalence of diabetic nephropathy than that in continuously lean patients ( 24.3% ) ( p < 0.017 ) . when we divided the patients into quartiles according to current bmi , the prevalence of nephropathy significantly increased as current bmi increased ( figure 1 , p < 0.001 ) . when we similarly divided them into quartiles according to previous maximum bmi , the prevalence of nephropathy significantly increased as previous maximum bmi increased ( figure 1 , p < 0.001 ) . current bmi and previous maximum bmi were highly correlated with each other ( r = 0.785 , p < 0.001 ) . in logistic regression analysis , both current obesity and previous obesity revealed a significant odds ratio for nephropathy , as well as diabetic retinopathy , independent of sex , age , disease duration , hypertension , dyslipidemia , and hba1c ( table 2 ) . we confirmed that previous obesity , as well as present obesity , was closely associated with nephropathy in type 2 diabetes . the notable finding of this study was that obesity is an independent risk factor , not only if it is present , but also if it was present in the past . the mechanism is the theme for investigation of how obesity in the past can influence diabetic complications over time . both current bmi and previous maximum bmi were associated with the nephropathy , as demonstrated in figure 1 . however , so , generally , the higher the previous bmi , the higher the current bmi . when we analyzed the effects of previous obesity , we had to separate the effects of current obesity from those of previous obesity . this was the reason we analyzed the effect of previous obesity according to the categories defined as previous maximum bmi and current bmi . as a result , we could elucidate the effect of previous obesity on diabetic nephropathy . whether nephropathy in type 2 diabetes really derives from diabetes has always been a point of discussion . however , type 2 diabetes per se is a disease so closely linked with obesity and the metabolic syndrome that we can not strictly distinguish the cause among the components of the syndrome . we here found that the effect of obesity was independent of the existence of diabetic retinopathy , and we expect this result can be applied to all type 2 diabetes patients . several groups , including us , have reported that albuminuria was the strongest predictor of the progression of diabetic nephropathy [ 1822 ] . we did not chronologically follow the decline of glomerular filtration rate ( gfr ) in this study . however , as we defined diabetic nephropathy by albuminuria , obesity , either current or past , might relate to the gfr decline through albuminuria . although this concept is strictly defined with exclusion of both nephrosclerosis and diabetic nephropathy , the suspected mechanisms , including the contraction of efferent glomerular arterioles by the activated renin - angiotensin system ( ras ) and glomerular hyperfiltration , as well as glomerular hypertrophy due to insulin resistance , are very similar to those of diabetic nephropathy . the border between the concepts of diabetic nephropathy and obesity - related nephropathy is unclear , and they can not be distinguished clinically if a patient has both . vivante et al . reported that overweight state and obesity in adolescents were associated with significantly increased risk for both diabetic and nondiabetic esrd during a 25-year period . if obesity even before the diagnosis of diabetes influences kidney function later , these concepts are continuous and indivisible . there are some limitations of this study . one is that this study was retrospective , based on self - reported body weight in the past . as for the other limitation , we might have to consider how they lost their body weight because the study subjects required metabolic interventions for poor glycemic status . however , we only have the data of maximum body weight and the body weight on admission but not the duration . so the hypothesis needs to be confirmed in a future large cohort study with more detailed information . in spite of these limitations , we therefore believe it includes important suggestions on the effect of obesity on diabetic nephropathy . our study indicated that obesity in the past , as well as present obesity , was a risk factor for diabetic nephropathy . we should consider the effect of earlier obesity on diabetic nephropathy even if it has been present before the diagnosis of diabetes .

aims . we analyzed the prevalence of nephropathy according to past body weight status in japanese subjects with type 2 diabetes because the influence of past obesity on diabetic complications is not certain . methods . we examined the prevalence of nephropathy in 2927 subjects with type 2 diabetes mellitus according to current bmi and maximum bmi in the past . we defined current obesity as bmi on hospitalization of 25 or more , previous obesity as bmi on hospitalization of less than 25 and self - reported maximum bmi in the past of 25 or more , and continuously lean as maximum bmi of less than 25 . results . the prevalence of nephropathy was significantly higher in subjects with current obesity ( 40.6% ) or previous obesity ( 35.6% ) than in those who were continuously lean ( 24.3% ) ( p < 0.017 ) . in logistic regression analysis , previous obesity , as well as current obesity , was a significant risk factor for nephropathy , independent of sex , age , disease duration , hypertension , dyslipidemia , hba1c , and diabetic retinopathy . conclusions . obesity in the past , as well as the present body weight status , was a risk factor for diabetic nephropathy .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

monoamine oxidases ( mao ) are mitochondrial enzymes responsible for the metabolic breakdown of monoamines ( serotonin , norepinephrine , and dopamine ) in neuronal tissues causing depletion of monoamines and clinical depression ; while mao inhibitors ( maois ) result in the clinical improvement of mood states . interestingly , drugs that possess maoi properties but are used for purposes unrelated to antidepressant activity are furazolidone ( an antiinfective ) ; procarbazine ( drug used for hodgkin 's disease ) ; and linezolid ( an antibiotic used for serious infections ) . we report a case of serious adverse drug interactions between escitalopram and linezolid precipitating near - fatal serotonin syndrome ( ss ) in an elderly female . relevant literature was retrieved via pubmed , embase , and psycinfo using the keywords ; linezolid , escitalopram , serotonin syndrome supplemented with a manual search of cross references . a 65-year - old elderly female , from urban and middle socioeconomic background , presented with history suggestive of depressed mood , middle and late insomnia , anorexia , lethargy , reduced interest in pleasurable activities since 1 year . she was diagnosed as depressive disorder as per icd-10 diagnostic criteria . she had no prior medical history of hypertension , diabetes , or any drug intake . escitalopram ( 5 mg / day ) and clonazepam ( 0.25 mg / day ) therapy showed partial improvement , fortnight later . escitalopram was increased to 10 mg / day , while clonazepam was discontinued due to drowsiness , a month later . patient had full remission of depressive symptoms with escitalopram ( 10 mg / day ) , 2 months later . patient presented with acute onset high - grade fever , cough with greenish - yellow expectoration , breathlessness , and asthenia of a week 's duration following recent travel . she had received antipyretics , mucolytics , expectorants , antibiotics ( amoxicillin and clavulanate ) for 5 days from medical practitioner but found no respite . later , she was referred to physician and hospitalized . on admission , she had 101f temperature , pulse rate of 126/min , and blood pressure ( bp ) of 136/88 mm hg . her general physical and systemic examination revealed no other abnormal findings , except for bilateral scattered fine crepitations and reduced bilateral air entry in lower respiratory areas . her blood glucose ( 105 mg / dl ) , blood urea ( 25 mg / dl ) , and serum creatinine ( 1.0 mg / dl ) were within normal limits . patient was treated with intravenous linezolid ( 600 mg twice daily ) , antipyretics , bronchodilators ( etophylline ) , expectorants ( guaiphenesin ) , mucolytics ( ambroxol ) , and chest physiotherapy . within the first 24 hours of antibiotic treatment , the patient had a rapid clinical deterioration with restlessness , diaphoresis , tremor , shivering , myoclonus , diarrhoea , exaggerated deep tendon reflexes , hypoxia ( spo2 - 80% with 6 - 8 l of oxygen ) and high fever ( 103f ) , along with mental status changes such as disorientation , confusion , and hallucinatory behavior . however , in view of neurological symptoms , cranial computerized tomography and lumbar puncture for the exclusion of central nervous system ( cns ) infection were performed but were unremarkable . the patient was intubated due to severe respiratory difficulties and transferred to the intensive care unit . detailed history and sequence of emergence of events ( including history of depression and escitalopram treatment from caregivers ) were observed and ss was suspected . linezolid and escitalopram were discontinued , and cyproheptadine ( 4 mg thrice daily ) via the nasogastric tube was initiated . pneumonitis was treated with intravenous cephalosporin ( cefotaxime ; 2 g twice daily ) and aminoglycoside ( amikacin ; 500 mg twice daily ) antibiotics . patient gradually regained consciousness and orientation to person , location , and time . at discharge , vital parameters were stable with pulse of 86 bpm and bp of 130/80 mm hg . in our case , addition of antibiotic linezolid ( 600 mg twice daily ) for the treatment of acute onset pneumonia in a patient receiving serotonergic antidepressant , escitalopram ( 10 mg / day ) for depressive disorder since 2 months , temporally led to the constellation of the neurological and mental state features in the absence of other cns pathology led to the diagnosis of ss . we ruled out the possibility of other drug interactions , as none of them ( paracetamol , etophylline , guaiphenesin , ambroxol ) possess either adrenergic or serotonergic properties supplemented by literature search . linezolid is a totally synthetic compound that was initially synthesized as a reversible maoi class antidepressant . due to its weak , nonspecific mao inhibition , concomitant therapy with an adrenergic or serotonergic agent or consuming tyramine ( > 100 mg / day ) may increase the risk of ss . it is believed to act through early inhibition of protein synthesis via binding to the 23s portion of the 50s ribosomal bacterial rrna subunit inducing conformational structural changes and preventing trna to enter and functionally bind to the ribosome therefore inhibiting mrna translation . its oral bioavailability is nearly equal to intravenous administration , with plasma half - life of 4 - 6 h. peak serum concentrations attain about 20 mcg / ml on 600 mg twice daily dosing in adults . linezolid is metabolized via oxidation procedure in a way independent of cytochrome p450 ( cyp-450 ) ; consequently there is no possible pharmacokinetic mechanism of interaction between linezolid and other medication metabolized through cyp450 pathways . although 80% of the dose of linezolid appears in the urine , dose modification has not been currently recommended in renal insufficiency as serum concentrations and half - life of the drug are not appreciably affected . however , linezolid and its breakdown products are eliminated by dialysis ; the drug should be administered after hemodialysis . linezolid is generally well - tolerated , with some minor side - effects like gastrointestinal disturbances , headache , and rashes . rarely , myelosuppression including anaemia , leukopenia , thrombocytopenia , and peripheral as well as optic neuropathy have been reported on prolonged use ( > 8 weeks ) . escitalopram is the s - enantiomer of racemic citalopram with antidepressant activity through selective serotonin reuptake inhibition ( ssri ) , a drug category that is believed to act through boosting of serotonin neurotransmission via blockade of serotonin reuptake pump , therefore theoretically more prone to be involved in the development of ss . it is 56% plasma protein bound with plasma half - life of 27 - 32 h and reaches steady state plasma levels in 7 days . the primary cyp isoenzymes involved in its metabolism are cyp 3a4 , cyp 2d6 , and cyp 2c19 . escitalopram displays linear and dose - proportional pharmacokinetics for single and multiple doses in the dose range of 10 - 30 mg / day . its clearance in elderly subjects ( > 65 years ) in single - dose and multiple - doses showed approximate increase of 50% in half - life . ss is a disorder typically caused by the combination of two or more medications with serotonergic properties due to increased serotonin release . it is characterized by restlessness , myoclonus , hyperreflexia , diaphoresis , shivering , tremor , and mental status changes , such as confusion . it usually consists of a constellation of neurological and mental state symptoms and commonly diagnosed according to the widely accepted criteria , as summarized in table 1 . the pathophysiological mechanism of ss does not include idiosyncratic , neither idiopathic nor pharmacokinetic drug reactions , but is considered to be a predictable and preventable pharmacodynamic consequence of the excess of serotonergic agonism in cns and peripheral serotonergic receptors . symptoms usually improve with the withdrawal of the predisposing drug agents plus supportive care , as there is no specific evidence - based treatment of the ss . cyproheptadine is a h1 histamine receptor antagonist as well as a nonspecific serotonin receptor antagonist , may have a role in the management of ss ( 4 mg thrice daily ) . widely accepted diagnostic criteria for serotonin syndrome concomitant use of maois ( including linezolid , furazolidone , and procarbazine ) along with adrenergic / serotonergic antidepressants , st . john 's wort , sibutramine , or opiate drugs that have ssri - like properties ( meperidine , tramadol , methadone , dextromethorphan , propoxyphene , and fentanyl ) have been reported to precipitate dangerous ss . rarely , ss may also be precipitated by concomitant use of ssris with metoclopramide , sibutramine , fenfluramine or dexfenfluramine , lithium , dihydroergotamine , sumatriptan ; but risk is severe when ssris and maois are combined . linezolid has been reported to induce ss as an interaction with almost every category of antidepressant medications like imipramine , amitriptyline , fluoxetine , citalopram , escitalopram , paroxetine , sertraline , l - tryptophan ( precursor of serotonin ) , mirtazapine , trazodone , buspirone , venlafaxine , and duloxetine . psychiatrists need to be aware that all ssris ( except fluoxetine ) should not be co - administered with maois within 2 weeks of discontinuing either drug , lest may precipitate ss . fluoxetine due to its long half - life is recommended to be stopped at least 5 weeks prior to initiation of maois and conversely , maois are to be discontinued at least 3 weeks prior to initiation of fluoxetine . however , in patients receiving ssris who acutely require linezolid therapy for short - term ( 10 - 14 days ) therapy , coadministration with careful monitoring is reasonable because ssris generally require tapering to avoid discontinuation symptoms . physicians utilizing these drugs ( linezolid , furazolidone , procarbazine ) need to be sensitized about potentially fatal ss when coadministered with antidepressant therapy . clinicians need to exercise reasonable degree of care and skills to prevent such interactions primarily and also be competent to detect early and manage such adverse events , lest may amount to medical negligence .

linezolid is a synthetic antimicrobial agent of the oxazolidinone class with weak , nonspecific inhibitor of monoamine oxidase enzymes . concomitant therapy with an adrenergic or serotonergic agent or consuming tyramine ( > 100 mg / day ) may induce serotonin syndrome ( ss ) . we present a case report of near - fatal adverse interaction between linezolid and escitalopram inducing ss in a 65-year - old woman with sepsis , under empirical antibiotic treatment . this report also summarizes the current relevant literature as identified via pubmed , embase , and psycinfo , supplemented with a manual search of cross references .

INTRODUCTION CASE REPORT DISCUSSION

aerobic ammonia oxidation , the first and rate - limiting step in nitrification , is the only biological process converting reduced to oxidized inorganic nitrogen species on earth . for over 100 years , this process was thought to be mediated by autotrophic beta - proteobacteria and gamma - proteobacteria ( aob ) occasionally supported by heterotrophic nitrifiers in soil environments . however , in situ measurements of nitrification in marine and terrestrial environments showed that ammonia oxidation often proceeds at substrate concentrations significantly below the growth threshold of cultured aob ( e.g. ) indicating the presence of unknown nitrifiers . the recent discovery of homologs of ammonia monooxygenase genes in archaea [ 57 ] and the cultivation of autotrophic ammonia - oxidizing archaea ( aoa ) [ 811 ] revealed that an additional group of microorganisms is able to catalyze this process . the widespread distribution of putative archaeal ammonia monooxygenase ( amo ) genes and their numerical dominance over their bacterial counterparts in most marine and terrestrial environments suggested that aoa play a major role in global nitrification [ 1215 ] , but our understanding of their evolutionary history and metabolic repertoire is still in its infancy . in 1992 , jed fuhrman 's team and ed delong reported the discovery of a novel clade of archaeal 16s rrna sequences from ocean surface waters , which formed a mesophilic sister group to the hyperthermohilic crenarchaeota . when it became apparent that this novel group contained aoa , these organisms were consequently also referred to as mesophilic crenarchaeota . this perception was questioned by phylogenetic analysis of the first available genome sequence of a putative aoa , the sponge symbiont candidatus cenarchaeum symbiosum . when brochier - armanet and colleagues analyzed a concatenated data set of 53 ribosomal proteins common to archaea and eukarya , they made the surprising observation that c. symbiosum branched off before the separation of crenarchaeota and euryarchaeota . based on this phylogenetic analysis , on gene presence / absence data , and on the diversity and wide distribution of aoa , they proposed that that these organisms belong to the phylum thaumarchaeota . recently , this analysis was extended to the ammonia - oxidizing candidatus nitrosopumilus maritimus , a marine group i.1a representative , and candidatus nitrososphaera gargensis , a soil group i.1b representative enriched from a hot spring . in this study , phylogenetic analysis of concatenated ribosomal proteins ( figure 1a ) and several other marker genes as well as presence / absence patterns of information processing machineries in archaea strongly supported the assignment of aoa to the deep - branching phylum thaumarchaeota . consistent with this finding , comparative genomics revealed that 6 conserved signature indels and > 250 proteins are unique to the thaumarchaeota c. symbiosum and n. pumilus and are not found in crenarchaeota . additional support for the phylum thaumarchaeota stems from comparative analysis of fosmid clones obtained from different deep - sea locations . among 200 phylogenetic trees of protein families present in thaumarchaeotal fosmids from these sites , thaumarchaeota sequences branched as separate cluster distinct from hyperthermophilic crenarchaeota and euryarchaeota in 162 phylogenetic trees . independent from genomic data , the presence of the lipid crenarchaeol in all analyzed aoa [ 9,2224 ] is consistent with a separate placement of these organisms in the archaeal tree as this lipid has so far not been found in any other bacterium or archaeon . thus , it seems likely that this membrane lipid , which may now be more appropriately termed thaumarchaeol , is an invention of an early thaumarchaote and represents a signature lipid for this phylum . revisiting the phylogenetic placement of thaumarchaeota in 16s rrna - based trees also reveals a clear separation from crenarchaeota and euryarchaeota ( figure 1b ) . a number of environmentally retrieved clone groups consisting of the sagmgc-1 group ( subsurface mine ) , group i.1c ( acidic soils ) , aloha group ( open ocean ) , psl12 group ( hot spring ) , and the hwcgiii / nitrosocaldus group ( hot springs / hydrothermal vents ) since this cluster is supported by all treeing methods and has a bootstrap value of 100% ( figure 1b ) , its representatives very likely all belong to the phylum thaumarchaeota and at least some of them might be aoa . supporting this hypothesis , a good correlation between copy numbers of archaeal amoa ( coding for the -subunit of ammonia monooxygenase ) and 16s rrna genes of the aloha group has been observed in the north pacific . it will be fascinating to see whether all thaumarchaeota have the capability to perform ammonia oxidation or whether certain members use a different energy metabolism . just recently two giant thaumarchaeota , candidatus giganthauma karukerense and candidatus giganthauma insulaporcus , were characterized by molecular methods but all attempts to amplify archaeal amoa genes failed . however , this could also be caused by primer bias as has been previously recognized for archaeal amoa - targeted surveys in deep ocean waters . currently , the mcg ( miscellaneous crenarchaeotic group ) , mbgb ( marine benthic group b ) , and hwcgi ( hot water crenarchaeotic group i ) clusters have no clear affiliation to any of the established archaeal phyla and show an unstable branching order when 16s rrna - based trees inferred with different treeing methods are compared ( figure 1b ) . little is known about these organisms but recently the first genome of a representative of the hwcgi cluster , that of candidatus caldiarchaeum subterraneum , was found to be distinct from other archaeal phyla including genes encoding a ubiquitin - like protein modifier system that was so far only found in eukaryotes . as a consequence , the lineage however , a comparative genome analysis by brochier - armanet and colleagues revealed some typical thaumarchaeal features in c. subterraneum and thus places it at the base of thaumarchaeota in protein trees ( for details see brochier - armanet et al . , this issue ) . with the availability of more genomes within this and related lineages , comparative genomics will show whether aigarchaeota represent a new archaeal phylum or will be classified as deep - branching members of the crenarchaeota or thaumarchaeota . the phylogenetic structure of aoa can also be analyzed by the functional marker gene amoa , which is found in all ammonia - oxidizing microorganisms . the presence of aoa within group i.1a and group i.1b thaumarchaeota as well as within the thaumarchaeota - group hwcgiii / nitrosocaldus is mirrored in the respective amoa phylogeny ( figure 1b ) . in addition , a fourth amoa - cluster with no established link to a thaumarchaeotal lineage in the 16s rrna - based tree became apparent during the accumulation of environmental amoa sequences within the last few years . since amoa sequences from a wide range of habitats ( including various marine , terrestrial , and hot water environments ) are affiliated with this lineage , we have named it the ubiquitous cluster. it is tempting to speculate that this cluster represents so - far unrecognized aoa within the sagmgc-1 , group i.1c , aloha , or psl12 cluster . almost every study that investigates ammonia - oxidizing thaumarchaeota uses the amoa gene to explore their diversity and abundance with the implicit assumption that all amoa - carrying archaea are oxidizing ammonia . however , of the > 10,000 deposited archaeal amoa sequences , thus far only four have been directly linked to archaeal strains for which experimental evidence of ammonia oxidation exists [ 811 ] . although phylogenetically closely related enzymes often perform the same function , it deserves consideration that the family of copper - containing membrane - bound monooxgenases ( cummo ) , to which archaeal ammonia monooxygenases belong , has a wide substrate range . in addition to ammonia [ ammonia monooxygenase ( amo ) in -proteobacteria , -proteobacteria , and thaumarchaeota ] , this includes methane [ particulate methane monooxygenase ( pmmo ) in -proteobacteria , -proteobacteria , verucomicrobia , and candidatus methylomirabilis oxyfera ] , and short - chained alkanes [ particulate butane monooxygenase ( pbmo ) in the gram - positive nocardioides strain cf8 ] . in addition , non - specific substrate catabolism such as oxidation of chlorinated ethenes and aromatic hydrocarbons has been observed with some members of this enzyme family , clearly indicating substrate promiscuity . therefore , it has been suggested that not necessarily the type of cummo but rather the downstream enzyme machinery defines the energy metabolism of a microorganism . for example , the -proteobacterium aob nitrosococcus oceani can oxidize methane but lacks all subsequent enzymes to gain energy by methane oxidation . likewise , co - oxidation of ammonia by methane oxidizing bacteria does not support their growth . furthermore , it is interesting to note that -proteobacterial amos are more closely related to -proteobacterial pmmos than to -proteobacterial amos and have a near equal substrate specificity for ammonia and methane . consequently , the mere presence of an amoa - like gene , transcript , or protein is insufficient to infer that the respective organism is oxidizing ammonia . currently , it is not clear whether aoa are strict autotrophs or also assimilate organic substrates . for n. maritimus , autotrophy has been shown and for n. gargensis co2-fixation has been experimentally demonstrated . incorporation of labeled bicarbonate into lipids , proteins , and cells of marine thaumarchaeota are consistent with autotrophy , which is enabled by a modified 3-hydroxypropionate/4-hydroxybutyrate ( hp / hb ) cycle for co2-fixation as found in known aoa genomes and in marine thaumarchaeal fosmids . however , analysis of the c. symbiosum and n. maritimus genomes as well as of thaumarchaeal fosmids from bathypelagic plankton also has revealed the presence of a tca cycle ( possibly incomplete ) and of potential transporters for organic substances such as amino acids , oligopeptides , and glycerol . thus , mixotrophic or even heterotrophic growth of marine thaumarchaeota as supported by other isotope labeling studies and natural distribution of radiocarbon in archaeal membrane lipids can to date not be excluded . furthermore , it has been suggested that parts of the hp / hb cycle can serve to co - assimilate organic compounds including , for example , 3-hydroxypropionate , an intermediate in the metabolism of the ubiquitous marine osmoprotectant dimethylsulphoniopropionate . for soil environments , co2-stable isotope probing revealed ammonia oxidizing activity of members of group i.1a as well as i.1b thaumarchaeota indicating an autotrophic or mixotrophic lifestyle . two of these studies found label incorporation into genes or transcripts of the 4-hydroxybutyryl - coa - dehydratase or acetyl - coa - propionyl - coa - carboxylase , respectively , with both enzymes being involved in the co2-fixing hp / hb cycle . however , growth of soil aoa with no concomitant incorporation of co2 has been also observed when nitrification was inhibited indicating that at least some soil aoa can grow heterotrophically . for comparison , heterotrophic growth of crenarchaeota that possess the hp / hb cycle is known for sulfolobus solfataricus and metallosphaera sedula with the latter being able to switch between an autotrophic and heterotrophic lifestyle . the question under which conditions aoa or aob dominate ammonia oxidation is currently attracting a lot of attention . for ammonia oxidation by the group i.1a thaumarchaeote n. maritimus , an extremely low substrate threshold ( < 10 nm total nh4 + nh3 , representing the detection limit of the used method ) and apparent km - value ( 133 nm ) were determined with the latter being very similar to in situ nitrification measurements made in oligotrophic oceans . adaptation to low ammonium concentrations has also been reported for the thermophilic group i.1b thaumarchaeote n. gargensis , indicating a widespread distribution of oligotrophic ammonia oxidation within the thaumarchaeota . in comparison , minimum total ammonium concentrations required for growth of cultured aob are 100-fold higher ( > 1 m near neutral ph ) with km - values ranging from 46 to 1780 m total ammonium . thus , a dominating activity of aoa in the large water bodies of oligotrophic oceans is highly likely with aob being restricted to organic - matter rich particles and coastal environments with higher nutrient loads . measured apparent km - values for soils range from 2 to 42 m total ammonium and may therefore be influenced by both aoa and aob . in general , activity of soil aoa was seen when total ammonia concentrations were below 15 g nh4-n ( g dw . soil ) whereas aob responded to high ammonia concentrations [ > 100 g nh4-n ( g dw . in addition , the form of supplied nitrogen might also play a critical role : aoa activity was seen when n was supplied as mineralized organic n derived from composted manure or soil organic matter and aob - dominated activity was seen with ammonia from inorganic fertilizer ( reviewed in ) . based on genome analyses of n. maritimus and c. symbiosum and due to the fact that aoa do not contain a homologue of the bacterial hydroxylamine oxidoreductase , a mechanism for ammonia oxidation distinctly different from that of aob has been proposed . here , ammonia is not oxidized via hydroxylamine ( nh2oh ) as in aob but rather via nitroxyl ( hno ) to nitrite , which possibly involves only 0.5 o2 per nh3 oxidized ( proposed by martin klotz ( louisville ) ) . this hypothesized lower oxygen demand could explain why aoa are found not only in fully areated soils and oxic marine waters but also in suboxic marine waters , sediments , and oxygen - depleted hot springs . in oxygen gradients of marine sediments and in the stratified water body of the black sea different aoa ecotypes aoa can also be found over a wide range of ph , temperature , salinity , and phosphate concentrations with some aoa being adapted to sulfidic environments , which extends the potential range of aoa niche differentiation to a multitude of environmental factors ( reviewed in ) . until recently , methanogenic euryarchaeota were the only known archaea of global relevance for element cycling . this perception changed with the discovery of ammonia - oxidizing archaea , which belong to the newly recognized archaeal phylum thaumarchaeota and contribute significantly to the global n - cycle and c - cycle . their shear abundance in the ocean ( up to 20% of all bacteria and archaea ) and extremely low substrate threshold for total ammonium provide compelling evidence for their role as dominant ammonia oxidizers in the open ocean , where they also contribute to primary production by their autotrophic ( or possibly partly mixotrophic ) lifestyle . the dominance of aoa over aob in many terrestrial environments can not be so easily explained . low km - values of unfertilized soils for ammonia oxidation might point to a contribution of certain aoa ecotypes to nitrification , especially under low ammonia availability . on the other hand , it is well possible that some soil thaumarchaeotes use other substrates than ammonia for energy generation and are heterotrophs or that they switch to ammonia oxidation only under certain environmental conditions . further dissection of the ecological interplay of aoa groups among themselves and with aob is urgently required and might reveal that aoa exhibit a similar type of niche partitioning as found for different nitrite oxidizers . here , prefer low nutrient and microoxic sites , with different nitrospira lineages adapted to different nitrite concentrations . papers of particular interest , published within the period of review , have been highlighted as: of special interest of outstanding interest of special interest of outstanding interest

thaumarchaeota range among the most abundant archaea on earth . initially classified as mesophilic crenarchaeota , comparative genomics has recently revealed that they form a separate and deep - branching phylum within the archaea . this novel phylum comprises in 16s rrna gene trees not only all known archaeal ammonia oxidizers but also several clusters of environmental sequences representing microorganisms with unknown energy metabolism . ecophysiological studies of ammonia - oxidizing thaumarchaeota suggest adaptation to low ammonia concentrations and an autotrophic or possibly mixotrophic lifestyle . extrapolating from the wide substrate range of copper - containing membrane - bound monooxygenases , to which the thaumarchaeal ammonia monooxygenases belong , the use of substrates other than ammonia for generating energy by some members of the thaumarchaeota seems likely .

Introduction From mesophilic Crenarchaeota to Thaumarchaeota Emerging ecophysiology of Thaumarchaeota Conclusion and outlook References and recommended reading

chronic obstructive pulmonary disease ( copd ) is a chronic respiratory disease characterized by a progressive decline in lung function and accompanied by respiratory symptoms , primarily dyspnea , cough , and sputum production.1,2 given the progressive nature of the disease , the aim of treatments is to reduce symptoms and exacerbations , thereby improving health - related quality of life . currently , the global initiative for chronic obstructive lung disease ( gold ) guidelines recommend initiation with a short - acting bronchodilator , followed by the addition of long - acting bronchodilators as symptoms and/or risk of exacerbations increase , and eventually adding inhaled steroids and/or roflumilast.2 commonly used bronchodilators include inhaled long - acting beta2-agonists ( labas ) ( eg , twice - daily formoterol , twice - daily salmeterol , and more recently once - daily indacaterol ) , inhaled long - acting antimuscarinic agents ( lamas ) ( eg , once - daily tiotropium , and recently twice - daily aclidinium and once - daily glycopyrronium ) , and oral methylxanthines ( eg , theophylline ) . bronchodilators improve lung function , reduce symptoms and exacerbations , and improve health - related quality of life.2 bronchodilators are frequently used in combination when higher effect sizes are warranted . in trials where a laba was administered in addition to a lama , the observed effect sizes were greater than those with either laba or lama alone,3,4 and in some cases the effects of the monotherapies have been shown to be additive when used in combination.5 however , effect sizes of bronchodilator monotherapies are not always additive , as seen in published trials of bronchodilator combinations . most recently , this was demonstrated with indacaterol , where the effect size of indacaterol administered with tiotropium compared with tiotropium monotherapy was much lower than the effect sizes observed in studies that compared indacaterol monotherapy with placebo.6 furthermore , more recent trials have found that monotherapy treatments have shown lower increases in forced expiratory volume in 1 second ( fev1 ) , compared to trials of the same investigational drug performed 5 or 10 years earlier . this may be due to evolution in trial designs , where , for example , later trials are more likely to permit concomitant treatment with other bronchodilators as part of usual care.7 additionally , there is evidence that the effect of bronchodilators varies depending on the severity of the patient s copd . patients with very severe copd show lower improvement of fev1 when treated with bronchodilators , compared with patients with moderate or severe copd.8,9 the laba olodaterol has been developed as a once - daily long - acting bronchodilator for maintenance treatment of copd . phase iii clinical trials of olodaterol have been completed , and the product , at the 5 mcg per day dose , has been approved in a number of european countries and canada , and is currently under regulatory review in the united states by the food and drug administration ( fda)10 and other regulatory agencies . to date , indacaterol is the only other once - daily laba approved and made available in many countries worldwide . indacaterol has been licensed in the united states and canada at a dose of 75 mcg per day.11,12 in most other countries , two doses are licensed : 150 mcg per day and 300 mcg per day for those patients for whom 150 mcg is not sufficient.13 in the absence of head - to - head , randomized controlled clinical trials ( rcts ) conducted on labas , the primary objective of this systematic literature review and meta - analysis was to provide estimates of relative efficacy of two new once - daily labas , olodaterol and indacaterol . a network meta - analysis was performed to indirectly compare the two treatments , linked through common treatment comparators . the review made two specific treatment comparisons : olodaterol 5 mcg compared with indacaterol 150 mcg , and olodaterol 5 mcg compared with indacaterol 75 mcg . a comprehensive and systematic literature review to identify rcts studying olodaterol and indacaterol in copd was undertaken to establish the evidence base for use in the meta - analyses . a systematic literature review was performed according to a prespecified protocol , to comply with the requirements of the national institute for health and care excellence single technology assessment.14 the following electronic databases were searched : 1 ) the cochrane library , including the cochrane database of systematic reviews , the cochrane central register of controlled trials , and the database of abstracts of reviews of effectiveness ; 2 ) medline and medline in - process ; and 3 ) embase . in addition , the following additional sources were searched to identify conference abstracts and published and unpublished studies : web sites for conference abstracts from the following organizations : american thoracic society ( 2010 and 2011 ) , european respiratory society ( 2009 and 2010 ) , and british thoracic society ( winter 2009 and winter 2010 ) ; bibliographic reference lists of the included studies and reviews ( searched for other relevant published studies ) ; trialtrove ( http://www.citeline.com/products/trialtrove/overview/ ) ; clinicaltrials.gov ( http://www.clinicaltrials.gov/ ) ; web sites for the fda and european medicines agency ; and the boehringer ingelheim trial database for olodaterol studies . the search strategies relied on three sets of terms : health condition of interest ( copd ) , study type ( rcts ) , and intervention ( olodaterol and/or indacaterol ) . appropriate terms were combined , and iterative searches were performed using other relevant terms and concepts . the searches were limited to articles published from 1 january 1990 , through 5 august 2011 , given the development timelines of the two compounds under study . articles in languages other than english were excluded . during systematic review and meta - analysis planning and execution , data for olodaterol were not publicly available , therefore , data on file with boehringer ingelheim were used . most data are now publicly available in the primary publications and/or on the fda web site , in the briefing documents for a pulmonary and allergy drug advisory committee meeting held in january 2013.10,1518 all data , including data not published in the pulmonary and allergy drug advisory committee document , are listed in the supplementary material . any disagreements were discussed with the research team to reach a consensus about study inclusion . during screening , further exclusions of studies were based on lack of outcome data , lack of a link into the treatment network , and study length ( ie , studies lasting less than 6 weeks ) . data extraction was performed by an experienced literature reviewer and quality checked by the statistician responsible for the meta - analyses . quality assessments were conducted for each included trial , using quality criteria recommended by the centre for reviews and dissemination.19 full details of this assessment can be found in the supplementary material . similar trough fev1 data at week 6 were permitted in the absence of week 12 data . other lung - function outcomes were considered for analysis , but trough fev1 was selected because it was the only outcome consistently reported across the evidence base . while the area under the fev1-time curve ( 03 hours post - dose ) was reported in all olodaterol trials , it was not reported for the indacaterol 150 or 75 mcg studies and so could not be included in the meta - analysis . st george s respiratory questionnaire ( sgrq ) total score was analyzed as change from baseline at week 12 . the proportion of responders based on sgrq total score was analyzed at week 12 , response was defined as a decrease ( improvement ) in sgrq total score of at least 4 points . transition dyspnea index ( tdi ) , by definition a change from baseline measure , was analyzed at week 12 . use of rescue medication ( eg , as - needed salbutamol ) was captured and analyzed as change from baseline in average number of puffs per day , using the maximum observed time for available data . finally , the proportion of patients experiencing at least one exacerbation , captured as a copd worsening adverse event , was analyzed for trials with a treatment duration of 24 weeks or longer reporting data for this outcome . some data imputations were required for standard errors , to maximize inclusion of change - from - baseline data into the meta - analyses . these imputations , together with further details on endpoint definitions are provided , where appropriate , in the data tables in the supplementary material . for network meta - analyses of dichotomous outcomes , a mixed log - binomial model was fit to estimate relative risks and confidence intervals . for network meta - analyses of continuous outcomes , a mixed normal - response model was fit to estimate mean differences and confidence intervals . these models included fixed treatment effects , fixed study effects , and random effects for the interaction between treatment and study . the random effects were included to allow the treatment effects to vary from study to study . the models were fit adopting an estimation approach using proc glimmix in sas version 9.2 ( sas institute inc . , cary , nc , usa ) and the methodology outlined by jones et al.20 in addition to network meta - analyses , direct meta - analyses were performed using standard techniques to assess heterogeneity within the network and to support the analysis that required use of the adjusted indirect comparison technique.2123 heterogeneity was investigated in several ways . for heterogeneity in trial designs , the a priori desire is to include a homogeneous set of trials in the network . to this end , trials were included / excluded based on permitted respiratory comedication during the trials ; patient subgroups of data were used where patient - level data were available ; and two additional indacaterol studies identified after completion of the systematic review were included,24 which allowed comparison of indacaterol with olodaterol when given with concomitant bronchodilation . for heterogeneity in analyses / results , the generalized chi - squared statistic divided by the remaining degrees of freedom ( should produce values close to 1.0 for a well - fitting model ) was calculated and heterogeneity tests for direct meta - analyses were performed where appropriate . a systematic literature review was performed according to a prespecified protocol , to comply with the requirements of the national institute for health and care excellence single technology assessment.14 the following electronic databases were searched : 1 ) the cochrane library , including the cochrane database of systematic reviews , the cochrane central register of controlled trials , and the database of abstracts of reviews of effectiveness ; 2 ) medline and medline in - process ; and 3 ) embase . in addition , the following additional sources were searched to identify conference abstracts and published and unpublished studies : web sites for conference abstracts from the following organizations : american thoracic society ( 2010 and 2011 ) , european respiratory society ( 2009 and 2010 ) , and british thoracic society ( winter 2009 and winter 2010 ) ; bibliographic reference lists of the included studies and reviews ( searched for other relevant published studies ) ; trialtrove ( http://www.citeline.com/products/trialtrove/overview/ ) ; clinicaltrials.gov ( http://www.clinicaltrials.gov/ ) ; web sites for the fda and european medicines agency ; and the boehringer ingelheim trial database for olodaterol studies . the search strategies relied on three sets of terms : health condition of interest ( copd ) , study type ( rcts ) , and intervention ( olodaterol and/or indacaterol ) . appropriate terms were combined , and iterative searches were performed using other relevant terms and concepts . the searches were limited to articles published from 1 january 1990 , through 5 august 2011 , given the development timelines of the two compounds under study . articles in languages other than english were excluded . during systematic review and meta - analysis planning and execution , data for olodaterol were not publicly available , therefore , data on file with boehringer ingelheim were used . most data are now publicly available in the primary publications and/or on the fda web site , in the briefing documents for a pulmonary and allergy drug advisory committee meeting held in january 2013.10,1518 all data , including data not published in the pulmonary and allergy drug advisory committee document , are listed in the supplementary material . any disagreements were discussed with the research team to reach a consensus about study inclusion . during screening , further exclusions of studies were based on lack of outcome data , lack of a link into the treatment network , and study length ( ie , studies lasting less than 6 weeks ) . data extraction was performed by an experienced literature reviewer and quality checked by the statistician responsible for the meta - analyses . quality assessments were conducted for each included trial , using quality criteria recommended by the centre for reviews and dissemination.19 full details of this assessment can be found in the supplementary material . similar trough fev1 data at week 6 were permitted in the absence of week 12 data . other lung - function outcomes were considered for analysis , but trough fev1 was selected because it was the only outcome consistently reported across the evidence base . while the area under the fev1-time curve ( 03 hours post - dose ) was reported in all olodaterol trials , it was not reported for the indacaterol 150 or 75 mcg studies and so could not be included in the meta - analysis . st george s respiratory questionnaire ( sgrq ) total score was analyzed as change from baseline at week 12 . the proportion of responders based on sgrq total score was analyzed at week 12 , response was defined as a decrease ( improvement ) in sgrq total score of at least 4 points . transition dyspnea index ( tdi ) , by definition a change from baseline measure , was analyzed at week 12 . use of rescue medication ( eg , as - needed salbutamol ) was captured and analyzed as change from baseline in average number of puffs per day , using the maximum observed time for available data . finally , the proportion of patients experiencing at least one exacerbation , captured as a copd worsening adverse event , was analyzed for trials with a treatment duration of 24 weeks or longer reporting data for this outcome . some data imputations were required for standard errors , to maximize inclusion of change - from - baseline data into the meta - analyses . these imputations , together with further details on endpoint definitions are provided , where appropriate , in the data tables in the supplementary material . for network meta - analyses of dichotomous outcomes , a mixed log - binomial model was fit to estimate relative risks and confidence intervals . for network meta - analyses of continuous outcomes , a mixed normal - response model was fit to estimate mean differences and confidence intervals . these models included fixed treatment effects , fixed study effects , and random effects for the interaction between treatment and study . the random effects were included to allow the treatment effects to vary from study to study . the models were fit adopting an estimation approach using proc glimmix in sas version 9.2 ( sas institute inc . , cary , nc , usa ) and the methodology outlined by jones et al.20 in addition to network meta - analyses , direct meta - analyses were performed using standard techniques to assess heterogeneity within the network and to support the analysis that required use of the adjusted indirect comparison technique.2123 heterogeneity was investigated in several ways . for heterogeneity in trial designs , the a priori desire is to include a homogeneous set of trials in the network . to this end , trials were included / excluded based on permitted respiratory comedication during the trials ; patient subgroups of data were used where patient - level data were available ; and two additional indacaterol studies identified after completion of the systematic review were included,24 which allowed comparison of indacaterol with olodaterol when given with concomitant bronchodilation . for heterogeneity in analyses / results , the generalized chi - squared statistic divided by the remaining degrees of freedom ( should produce values close to 1.0 for a well - fitting model ) was calculated and heterogeneity tests for direct meta - analyses were performed where appropriate . a total of 142 titles were retrieved through database searches and a further 31 through other sources such as conference web sites . after removal of duplicates , 110 titles and abstracts were screened . after applying the screening inclusion and exclusion criteria to both the titles / abstracts and the full - text articles , 23 publications , which reported data from a total of ten indacaterol trials ( b1302,25 b2201,26 study b2354,27 study b2355,28 inhance,29 inlight-1,30 inlight-2,31 insist,32 intensity,33 and involve34 ) , were eligible for meta - analysis , outlined in the prisma diagram in figure 1.35 from the boehringer ingelheim trial database search , eight olodaterol trials were identified that met the inclusion criteria ( study numbers 1222.11 [ nct00782210],15 1222.12 [ nct00782509],15 1222.13 [ nct00793624],16 1222.14 [ nct00796653],16 1222.24 [ nct00931385],17 1222.25 [ nct00932646],17 1222.39 [ nct01040689],18 and 1222.40 [ nct01040728]).18 during the meta - analysis phase of the project , two further publications were identified and included in the evidence base.24,36 cope et al36 presented a network meta - analysis of four indacaterol trials ( involve , inhance , inlight-1 , and inlight-2 ) already included in the evidence base . mahler et al24 presented results for two indacaterol trials ( intrust-1 and intrust-2 ) that were not otherwise identified at the time of the literature searches . table 1 lists the 20 included studies ( 18 from the systematic review and 2 identified after the review ) and provides details on the included treatments , sample sizes , concomitant bronchodilator use , and whether the trials permitted patients with very severe copd ( gold stage iv).37 further trial / baseline characteristics are presented in the supplementary material . the supplementary material also presents data for each of the outcomes for analysis and the descriptions of how the data were captured from each trial . the resulting treatment network for this evidence base is presented in the supplementary material ( figure a1 ) . the different doses of olodaterol and indacaterol were considered as unique entities in this network and in these meta - analyses . figure 2 presents an abbreviated version of the complete network and highlights the trials contributing to the indirect comparisons of primary interest ( ie , the comparison of olodaterol 5 mcg with indacaterol 75 mcg and with indacaterol 150 mcg ) . an important difference among the studies included in the evidence base is whether concomitant use of noninvestigational copd treatments was permitted in the trials by design . specifically , the olodaterol trials allowed concomitant use of lamas ( tiotropium ) , short - acting muscarinic antagonists ( samas ) ( ipratropium ) , inhaled corticosteroids , and xanthines ( theophylline ) . four of the eight included olodaterol trials used stratified randomization according to lama use to ensure a balance in tiotropium users across treatment arms . two olodaterol trials did not permit concomitant lama treatment , because tiotropium was one of the investigational drugs . none of the indacaterol trials originally identified in the systematic literature review permitted any concomitant bronchodilator use ( ie , samas and lamas were not allowed ) or xanthine use ; all of the indacaterol trials permitted use of inhaled corticosteroids . in contrast , the two intrust trials required the co - administration of indacaterol with tiotropium;24 thus , 100% of patients in those trials received tiotropium in addition to indacaterol or placebo ( inhaled steroids were also allowed , but not xanthines ) . as - needed short - acting beta - agonists were permitted as rescue medication in all olodaterol and indacaterol trials , and their use was captured via the rescue medication outcome . in addition , there were differences in the patient populations tested in the trials ; while the olodaterol trials included patients with moderate to very severe copd ( gold ii to gold iv),37 the indacaterol trials included only patients with moderate to severe copd ( ie , excluded patients with very severe copd [ gold stage iv]).37 given the findings from the trial characteristics summary ( ie , to take into account heterogeneity in trial design , specifically concomitant bronchodilator use ) , two analyses were performed using subgroups of trials or patients that could be considered to be subject to similar trial conditions and therefore comparable . given the data availability , these analyses could only be performed for the change from baseline in trough fev1 at week 12 . lama - free therapy and included all trials in which patients did not receive concomitant lama ( ie , all indacaterol trials identified in the original systematic review and the olodaterol trials 1222.39 and 1222.40 ) . lama add - on therapy and included all trials / subgroups in which all patients received concomitant or co - administered lama ( ie , stratified subgroups of olodaterol trials 1222.11 , 1222.12 , 1222.13 , and 1222.14 ; intrust trials for indacaterol ) . because intrust had only placebo as a common comparator , direct meta - analysis and the adjusted indirect comparison technique were used for this analysis . a third analysis population incorporated all trials ( full network ) identified by the systematic review and was considered a sensitivity analysis for the trough fev1 outcome . given data availability , this population was the only possible analysis population for the other outcomes . change from baseline in trough fev1 for each of the analysis populations . for the lama - free analysis , which included only trials explicitly excluding concomitant use of lama treatment , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg . for the lama add - on analysis , which included only trials / subgroups receiving either concomitant or co - administered lama treatment , no differences were seen between olodaterol 5 mcg and indacaterol 150 mcg . no data were available for indacaterol 75 mcg for the lama add - on analysis . for the sensitivity analysis of the full network , the indirect comparisons favored indacaterol , statistically significantly for the 150 mcg dose . figure 4 presents the indirect treatment comparison results for the continuous outcomes tdi , change from baseline in sgrq total score , and change from baseline in rescue medication puffs per day for the full network analysis . despite the known heterogeneity among the trials included in the full network , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg . figure 5 presents the indirect treatment comparison results for the dichotomous outcomes sgrq response and proportion of patients with exacerbations for the full network analysis . again , despite the known heterogeneity among the trials , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg , where data were available . as shown in the separate analyses for change from baseline in trough fev1 , the identified heterogeneity in trial design with respect to concomitant bronchodilator use impacted the results and conclusions of the meta - analyses . table 3 presents generalized chi - squared divided by the remaining degrees of freedom statistics for each network meta - analysis . because the estimates were all fairly close to 1 , the models could be assumed to fit the data well , but this does not eradicate the issues of known trial heterogeneity . table 4 presents direct meta - analyses heterogeneity test results for comparisons with placebo ( where possible ) . these estimates do not display significant and consistent heterogeneity of trial results within each arm of the network diagram , but it should be noted that such heterogeneity tests can lack statistical power with small trial numbers . additionally , information regarding the consistency assumption within the network as a whole is not provided due to the lack of head - to - head data between the selected treatments of interest . forest plots for the direct meta - analyses are presented in the supplementary material ( figure a2 through figure a21 ) . a total of 142 titles were retrieved through database searches and a further 31 through other sources such as conference web sites . after removal of duplicates , 110 titles and abstracts were screened . after applying the screening inclusion and exclusion criteria to both the titles / abstracts and the full - text articles , 23 publications , which reported data from a total of ten indacaterol trials ( b1302,25 b2201,26 study b2354,27 study b2355,28 inhance,29 inlight-1,30 inlight-2,31 insist,32 intensity,33 and involve34 ) , were eligible for meta - analysis , outlined in the prisma diagram in figure 1.35 from the boehringer ingelheim trial database search , eight olodaterol trials were identified that met the inclusion criteria ( study numbers 1222.11 [ nct00782210],15 1222.12 [ nct00782509],15 1222.13 [ nct00793624],16 1222.14 [ nct00796653],16 1222.24 [ nct00931385],17 1222.25 [ nct00932646],17 1222.39 [ nct01040689],18 and 1222.40 [ nct01040728]).18 during the meta - analysis phase of the project , two further publications were identified and included in the evidence base.24,36 cope et al36 presented a network meta - analysis of four indacaterol trials ( involve , inhance , inlight-1 , and inlight-2 ) already included in the evidence base . mahler et al24 presented results for two indacaterol trials ( intrust-1 and intrust-2 ) that were not otherwise identified at the time of the literature searches . table 1 lists the 20 included studies ( 18 from the systematic review and 2 identified after the review ) and provides details on the included treatments , sample sizes , concomitant bronchodilator use , and whether the trials permitted patients with very severe copd ( gold stage iv).37 further trial / baseline characteristics are presented in the supplementary material . the supplementary material also presents data for each of the outcomes for analysis and the descriptions of how the data were captured from each trial . the resulting treatment network for this evidence base is presented in the supplementary material ( figure a1 ) . the different doses of olodaterol and indacaterol were considered as unique entities in this network and in these meta - analyses . figure 2 presents an abbreviated version of the complete network and highlights the trials contributing to the indirect comparisons of primary interest ( ie , the comparison of olodaterol 5 mcg with indacaterol 75 mcg and with indacaterol 150 mcg ) . an important difference among the studies included in the evidence base is whether concomitant use of noninvestigational copd treatments was permitted in the trials by design . specifically , the olodaterol trials allowed concomitant use of lamas ( tiotropium ) , short - acting muscarinic antagonists ( samas ) ( ipratropium ) , inhaled corticosteroids , and xanthines ( theophylline ) . four of the eight included olodaterol trials used stratified randomization according to lama use to ensure a balance in tiotropium users across treatment arms . two olodaterol trials did not permit concomitant lama treatment , because tiotropium was one of the investigational drugs . none of the indacaterol trials originally identified in the systematic literature review permitted any concomitant bronchodilator use ( ie , samas and lamas were not allowed ) or xanthine use ; all of the indacaterol trials permitted use of inhaled corticosteroids . in contrast , the two intrust trials required the co - administration of indacaterol with tiotropium;24 thus , 100% of patients in those trials received tiotropium in addition to indacaterol or placebo ( inhaled steroids were also allowed , but not xanthines ) . as - needed short - acting beta - agonists were permitted as rescue medication in all olodaterol and indacaterol trials , and their use was captured via the rescue medication outcome . in addition , there were differences in the patient populations tested in the trials ; while the olodaterol trials included patients with moderate to very severe copd ( gold ii to gold iv),37 the indacaterol trials included only patients with moderate to severe copd ( ie , excluded patients with very severe copd [ gold stage iv]).37 given the findings from the trial characteristics summary ( ie , to take into account heterogeneity in trial design , specifically concomitant bronchodilator use ) , two analyses were performed using subgroups of trials or patients that could be considered to be subject to similar trial conditions and therefore comparable . given the data availability , these analyses could only be performed for the change from baseline in trough fev1 at week 12 . lama - free therapy and included all trials in which patients did not receive concomitant lama ( ie , all indacaterol trials identified in the original systematic review and the olodaterol trials 1222.39 and 1222.40 ) . the second analysis population was lama add - on therapy and included all trials / subgroups in which all patients received concomitant or co - administered lama ( ie , stratified subgroups of olodaterol trials 1222.11 , 1222.12 , 1222.13 , and 1222.14 ; intrust trials for indacaterol ) . because intrust had only placebo as a common comparator , direct meta - analysis and the adjusted indirect comparison technique were used for this analysis . a third analysis population incorporated all trials ( full network ) identified by the systematic review and was considered a sensitivity analysis for the trough fev1 outcome . given data availability , this population was the only possible analysis population for the other outcomes . figure 3 presents the indirect treatment comparison results for the outcome change from baseline in trough fev1 for each of the analysis populations . for the lama - free analysis , which included only trials explicitly excluding concomitant use of lama treatment , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg . for the lama add - on analysis , which included only trials / subgroups receiving either concomitant or co - administered lama treatment , no data were available for indacaterol 75 mcg for the lama add - on analysis . for the sensitivity analysis of the full network , the indirect comparisons favored indacaterol , statistically significantly for the 150 mcg dose . figure 4 presents the indirect treatment comparison results for the continuous outcomes tdi , change from baseline in sgrq total score , and change from baseline in rescue medication puffs per day for the full network analysis . despite the known heterogeneity among the trials included in the full network , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg . figure 5 presents the indirect treatment comparison results for the dichotomous outcomes sgrq response and proportion of patients with exacerbations for the full network analysis . again , despite the known heterogeneity among the trials , no differences were seen between olodaterol 5 mcg and either indacaterol 75 mcg or indacaterol 150 mcg , where data were available . as shown in the separate analyses for change from baseline in trough fev1 , the identified heterogeneity in trial design with respect to concomitant bronchodilator use impacted the results and conclusions of the meta - analyses . table 3 presents generalized chi - squared divided by the remaining degrees of freedom statistics for each network meta - analysis . because the estimates were all fairly close to 1 , the models could be assumed to fit the data well , but this does not eradicate the issues of known trial heterogeneity . table 4 presents direct meta - analyses heterogeneity test results for comparisons with placebo ( where possible ) . these estimates do not display significant and consistent heterogeneity of trial results within each arm of the network diagram , but it should be noted that such heterogeneity tests can lack statistical power with small trial numbers . additionally , information regarding the consistency assumption within the network as a whole is not provided due to the lack of head - to - head data between the selected treatments of interest . forest plots for the direct meta - analyses are presented in the supplementary material ( figure a2 through figure a21 ) . in the absence of a direct head - to - head comparison , indirect comparisons can provide exploratory insights into the relative effectiveness of olodaterol and indacaterol . the current study indirectly compares olodaterol and indacaterol , while accounting for the considerable systematic heterogeneity in trial design among olodaterol and indacaterol trials . evaluating lung function , trials / subgroups were selected in order to form indirect treatment comparisons based on patients subject to similar trial conditions , in which no evident differences between olodaterol and indacaterol were found . there were important differences among the olodaterol trials and indacaterol trials with respect to allowed concomitant copd medications . although all trials allowed concomitant inhaled steroid use and allowed the use of short - acting beta - agonists as rescue medication on an as - needed basis , the olodaterol trials also allowed concomitant use of lamas ( tiotropium ) , samas ( ipratropium ) , and xanthines ( theophylline ) , whereas the indacaterol trials did not . another notable difference was that olodaterol trials enrolled patients across the full disease severity spectrum , from moderate to very severe copd ( gold ii - iv),37 whereas the indacaterol trials were restricted to patients with moderate to severe copd ( gold ii / iii).37 this difference in patient populations , and therefore potential lung function response,8 could not be addressed in this meta - analysis because olodaterol trials were not stratified for disease severity and therefore using the subgroup excluding gold iv patients for the meta - analysis would not be a randomized comparison . the comparative efficacy of indacaterol and olodaterol differed depending on the subset of trials and patients included in the analyses . change from baseline in trough fev1 was similar among treatments when analyzing trials or data deemed to be comparable . in contrast , analyses not taking into consideration differences in allowed concomitant therapies can lead to inappropriate conclusions from the indirect comparisons . thus , selecting studies of similar design for the drugs of interest is important in order to estimate the true differences in effect size . acknowledging the known differences of the patient populations recruited to the trials ( very severe copd patients included in trials of olodaterol , but not indacaterol ) , it is interesting to note that the absolute difference seen in the sensitivity analysis for trough fev1 outcome is not replicated in either sgrq endpoint evaluating health - related quality of life , where there are no differences among the treatments , or in the other endpoints investigated ( exacerbations , rescue medication use , and tdi ) . assessing the results for external validity with previously published meta - analyses,36,3841 the direct meta - analyses matched closely with the estimated treatment effects for indacaterol ; however , because olodaterol data have only recently been published , the indirect comparisons have not been externally validated . the smaller effect sizes of laba administered in addition to a lama , compared with the effect sizes of a laba alone , were replicated . specifically , for indacaterol 150 mcg versus placebo , the effect size for trough fev1 change from baseline was 0.07 liters when studied in combination with concomitant lama ( supplementary material , figure a6 ) , and 0.17 liters when studied in the absence of concomitant lama ( supplementary material , figure a4 ) . as with all meta - analyses , certain limitations should be considered when interpreting the results of this meta - analysis . some between - trial differences in inclusion and exclusion criteria that influence the meta - analytic results were identified , especially with regard to the use of concomitant respiratory medication . the olodaterol trials could be considered to be studying treatment effects likely to be seen in real - world settings , whereas the indacaterol trials provide an estimate of absolute treatment effect . a limitation in the lama - add on analysis of the lung - function endpoint is that only add - on tiotropium , and no other important bronchodilators ( eg , samas or xanthines ) , could be investigated , thus limiting the generalizability of the findings . another limitation was that the add - on tiotropium in the olodaterol trials was concomitant medication , whereas in the indacaterol trials it was part of the investigational treatment . this limitation could lead to differences in application of , monitoring of , and compliance with the treatment . a limitation with regard to the lama - free analysis for the lung - function endpoint was that the included olodaterol trials were cross - over trials lasting 6 weeks , whereas the indacaterol trials were parallel - group trials lasting 12 weeks . however , this trial heterogeneity may not influence the relative treatment effects and therefore indirect comparison results , because the relative treatment differences are maintained between week 6 and week 12 , based on studies comparing olodaterol 5 mcg and formoterol 12 mcg.10,1518 finally , analysis of endpoints other than change from baseline in trough fev1 were possible only on the evidence base of trials that are inherently dissimilar with respect to concomitant bronchodilator use . thus , these analyses should be interpreted with caution . in conclusion , based on the analyses of change from baseline in trough fev1 , when compared under similar trial conditions , olodaterol 5 mcg and indacaterol 75 mcg or 150 mcg seem to be equally effective in the treatment of patients with copd . only head - to - head studies would be able to confirm the equal effectiveness of olodaterol and indacaterol . this research highlights the importance of concomitant copd medication and study population when estimating treatment effects in copd clinical trials . mr roskell is a full - time employee of bresmed health solutions , but performed this work while employed by rti health solutions . he has the following conflicts of interest : he is a member of the gold scientific committees and supports the implementation of the gold guidelines recommendations . he has also received honoraria , consulting fees , and advisory board and speaking fees from bayer , pfizer , glaxosmithkline , boehringer ingelheim , and forest laboratories . he is the principal investigator for research grants at the university of texas health science center at san antonio and was paid for participating in multicenter clinical trials sponsored by glaxosmithkline and the national institutes of health . dr hamilton , dr disse , and dr becker are full - time employees of boehringer ingelheim gmbh .

purposein the absence of head - to - head clinical trials comparing the once - daily , long - acting beta2-agonists olodaterol and indacaterol for the treatment of chronic obstructive pulmonary disease ( copd ) , an indirect treatment comparison by systematic review and synthesis of the available clinical evidence was conducted.methodsa systematic literature review of randomized , controlled clinical trials in patients with copd was performed to evaluate the efficacy and safety of olodaterol and indacaterol . network meta - analysis and adjusted indirect comparison methods were employed to evaluate treatment efficacy , using outcomes based on trough forced expiratory volume in 1 second ( fev1 ) , transition dyspnea index , st george s respiratory questionnaire total score and response , rescue medication use , and proportion of patients with exacerbations.resultseighteen trials were identified for meta - analysis ( eight , olodaterol ; ten , indacaterol ) . olodaterol trials included patients of all severities , whilst indacaterol trials excluded patients with very severe copd . concomitant maintenance bronchodilator use was allowed in most olodaterol trials , but not in indacaterol trials . when similarly designed trials / data were analyzed for change from baseline in trough fev1 ( liters ) , the following mean differences ( 95% confidence interval ) were observed : trials excluding concomitant bronchodilator : indacaterol 75 mcg versus olodaterol 5 mcg , 0.005 ( 0.077 to 0.067 ) , and indacaterol 150 mcg versus olodaterol 5 mcg , 0.020 ( 0.036 to 0.077 ) ; trials with concomitant tiotropium : indacaterol 150 mcg versus olodaterol 5 mcg , 0.000 ( 0.043 to 0.042 ) . in sensitivity analyses of the full network , results for change from baseline in trough fev1 favored indacaterol , but this dataset suffered from trial design heterogeneity . for the other endpoints investigated , no statistically significant differences were found when analyzed in the full network.conclusionwhen compared under similar trial conditions , olodaterol and indacaterol have similar efficacy in patients with copd . this research highlights the importance of considering the concomitant copd medication when evaluating treatment effects in copd .

Introduction Methods Systematic review process Outcomes Statistical analyses Results Literature search results Trial characteristics, treatment network, and data availability Meta-analysis strategy Indirect comparison results Heterogeneity Discussion and conclusion Disclosure

diabetes is a group of metabolic diseases characterized by hyperglycemia resulting from defects in insulin secretion , insulin action , or both ( 1 ) . the chronic hyperglycemia of diabetes is associated with long - term damage , dysfunction , and failure of different organs , especially of eyes , kidneys , nerves , heart , and blood vessels ( 1 ) . the main forms of diabetes are divided into those caused by lack of insulin secretion , due to damage of - cells of the pancreas ( type 1 dm ) , and those that are a consequence of insulin resistance that occurs at the level of skeletal muscles , liver and adipose tissue , with varying degrees of - cells damage ( type 2 dm ) . diabetes mellitus classification ( 2 ) the prevalence of type 2 diabetes is increasing globally and represents a heavy burden on public health and socioeconomic development of all nations ( 3 ) . type 2 diabetes is a multifactorial disease and due to a combination of environmental and genetic risk factors ( many environmental risk factors contribute to the pathogenesis of type 2 diabetes , including lifestyles such as sedentary behavior , diet , smoking and alcohol consumption , internal environmental factors such as inflammatory factors , adipocytokines and hepatocyte factors , external environmental factors such as environmental endocrine disruptors ) ( 3 ) . so no isolated known defect predominates , as is the case with hla connection with type 1 dm . . it was found that the risks for diabetes in african - americans , hispanics , and native americans are approximately 2 , 2.5 , and 5 times greater , respectively , than in caucasians . the main reason for this is that symptoms , when seen on their own , seem harmless . however , the earlier diabetes is diagnosed , the greater the chances are that serious complications , which can result from having diabetes , can be avoided . most common diabetes symptoms are : frequent urination , disproportionate thirst , intense hunger , weight gain , unusual weight loss , increased fatigue , irritability , blurred vision , cuts and bruises do not heal properly or quickly , skin and/or yeast infections , itchy skin , gums are red and/or swollen gums pulled away from teeth , frequent gum disease / infection , sexual dysfunction among men , numbness or tingling , especially in feet and hands . the aim of this paper was to evaluate questionnaires on the assessment of risk factors for diabetes mellitus type 2 in order to get information about risk of population for getting diabetes mellitus type 2 on the territory of canton sarajevo ( bosnia and herzegovina ) . a total of 540 questionnaires handed out randomly to citizens of canton sarajevo of all ages , sexes and educational levels ( in january 2016 ) were analyzed . in a survey conducted by the students of medical faculty , university of sarajevo a total of 540 people were questioned . out of that number the research was done in canton sarajevo in four municipalities : center ( 46% of questionnaires ) , novo sarajevo ( 20% ) , novi grad ( 27% ) and stari grad ( 7% ) . in determining the age of the examinees there were five categories used , the first one being the group of young people under the age of 35 years and the last group categorized as elder people with the age over 64 years ( bellow 35 years 42% , 35 - 44 years 16% , 45 - 54 years 18% , 55 - 64 years 15% , over 64 years 9% ) . in determining the height of the examinees , the answers were of an open type , so considering all the given numbers a classification has been made in total of 8 categories with a range of 5 cm in between . the first category included the height under 150 cm and the last with height over 186 cm ( the largest number of respondents , 30% of them were in the range of 170 - 175 cm ) . the weight of the patients was also of an open type , and after all the given number there has been a classification with a total of six categories , with a range of 10 kg , the first one considering all the values under 49 kg and the last all the values above 90 kg . the largest number of respondents were in the range 70 - 79 kg ( 32% ) . in the survey while asking the examinee of their body mass index ( bmi ) , this number was only approximate considering the height and weight of the examinee and was nt taken in a professional manner . bmi index of examinees after evaluating these basic information on phenotype characteristics of the examinees , the next group of questions referred to risk factors on diabetes type 2 and it s possible manifestation . did any of your close relatives have diabetes is the basic information in every family history which can roughly show us the history of this disease amongst the closest relatives of our examinee ( figure 2 ) . family history of examinees our further questions were related to the risk factors concerning the environment but which have the effect on the progress of diabetes . these questions are as follows : do you have at least 30 minutes of physical exercise daily ( including regular daily activities ) and how often do you eat fruit , vegetables , grains . the question : do you suffer from high blood pressure is a manifestation of some other chronic disease for which the examinee also has got or not genetic predispositions . risk environment factors was a high blood sugar level ever detected earlier ( e.g. during regular testing in pregnancy or during other illness ) is a question from the patients history and can also roughly show us the history of blood sugar levels in our patients ( answer yes was given from 35% of examinees ) . the last question : do you have any of the listed symptoms ( fatigue , paleness , excessive sweating , heart thumping , shaking , reduced vision , itching , often infections , cramps in legs , problems with concentration , excessive hunger , dry mouth and excessive thirst , excessive urinating , urinating at night ) is a question whether or not there are already visible manifestations of diabetes and are there chronic illnesses which may imply on further progress of diabetes type two . in the first group of symptoms we have : paleness , fatigue , excessive sweating , heart thumping , shaking , reduced vision , itching , often infections , cramps in legs , problems with concentration , excessive hunger and dry mouth . in the other group of symptoms we have : excessive thirst , excessive urinating , urinating at night ( figure 4 ) . the fact is that by development of bosnia and herzegovina and approaching european standards and norms , the awareness of the disease is growing , and also awareness of the importance of therapy including pharmacological and lifestyle changes . at the end after finalizing the points that each question carried and after finalizing the risk factor for the onset of diabetes type two in the next ten years , a total of five categories was used to describe these probabilities ( table 2 , figure 5 ) . risk groups of patients the amount of risk for the onset of diabetes type two in the next ten years diabetes disease rate of the population of the federation of bosnia and herzegovina , 20092013rate/10.000 inhabitants ( 9 ) type ii dm patients generally carry a number of risk factors for cvd , including hyperglycemia , abnormal lipid profiles , alterations in inflammatory mediators and coagulation / thrombolytic parameters , as well as other nontraditional risk factors , many of which may be closely associated with insulin resistance . therefore , successful management of cvd associated with diabetes represents a major challenge to the clinicians . the japanese trial included 458 men randomized to receive either intensive lifestyle intervention ( n = 102 ) or standard intervention ( n = 356 ) . the aims of the intensive intervention were body weight reduction if bmi was 22 kg / m2 , to consume large amounts of vegetables while reducing the amount of other foods by 10% , reduction of fat ( < 50 g / day ) and alcohol intake ( < 50 g / day ) , and physical activity > 3040 min / day , and result was that 4-year incidence of type 2 diabetes in the intervention group was 67% lower than in the control group ( 6 ) . number of people living with diabetes is expected to rise from 366 million in 2011 to 552 million by the year 2030 , if no urgent action is taken ( this equates to approximately three new cases every ten seconds or almost ten million per year ) ( 7 ) . one fifth of all adults with diabetes live in the south - east asia region ( 8) . the results of studies on the state of health of population in the federation of bosnia and herzegovina have shown that over fifth of the population older than 18 years ( 21.7% ) have value of blood glucose equal or higher than 6.1 mmol / l . ( 9 ) the rate of the population with diabetes in the federation is continuously growing and the number of diseased is considered to be undervalued because federation of bosnia and herzegovina has not established a register of people with diabetes , but the data is not comprehensive and monitoring of indicators is not enough . the fact is that this is a major problem , and also it burdens already fragile health care system in bosnia and herzegovina ( it is estimated that in bosnia and herzegovina in year 2011 , patient with diabetes gives an average of 629 usd for the treatment of diabetes and its complications , and such funds , by development of more expensive drugs , are growing from year to year ) . this is corroborated by the results of study on the state of health of the population in the federation of b&h , in which 9.6% of the population older than 18 years reported that a doctor at any time in their life diagnosed diabetes ( 9 ) . in the federation of bosnia and herzegovina , according to estimates of the international diabetes federation ( idf ) , over 166,000 persons have diabetes , or about 9.2% of adult population . this percentage will grow significantly unless decisive and systematic measures on suppression for this epidemic of modern times are taken . establish a registry of people with diabetes in the fb&h should be one of the main goals of the health system , and after that the monitoring or continuous collection of data on the disease . diabetes is a social disease because it is massive and chronic , as its treatment is expensive and lifelong , which reduces the ability to work and shortens working life of the diseased , which makes it difficult to maintain social relations of the diseased in the family , school , workplace and environment . the emergence of first chronic complications in patients creates uncertainty , which is transmitted to the family and work environment ( 10 ) . this increases already high cost of treatment of these patients and sometimes beyond economic opportunities and family health insurance . consequently , the prevention of type ii dm is imperative especially in primary health care . as seen earlier ( figure 4 ) there is a relatively low risk of getting diabetes in the next ten years in the majority of the population . these results are rather encouraging but may in some way be in confrontation with the statistics which show a rapid outburst of diabetes . the life - style is the main reason for such a thing to happen , and looking at theses questionnaires , we might get the feeling that we really do live in a , conditionally speaking , physically active society . however , good attitude and knowledge about diabetes amongst society is present which is good news and derives from all the media campaign and promotion programs in hand . this study has a lot of limitations , but it would be wise to continue doing research on this topic , perhaps making the next studies more complex , ruling out the main reasons for the onset amongst these already listed risk factors , statistically calculating each variable , and making these questionnaires more complex as well as including other means of information gathering , such as interviews , reviewing medical records etc .

introduction : diabetes is a group of metabolic diseases characterized by hyperglycemia , and represents a disease of the modern age , disease of the 21st century . prevention of this disease is listed as imperative . aim of this article was to evaluate questionnaires on the assessment of risk factors for diabetes mellitus type 2.material and methods : a total of 540 questionnaires handed out randomly to citizens of canton sarajevo of all ages , sexes and educational levels ( in january 2016 ) were analyzed.results:analyzed questionnaires showed relatively low risk of getting diabetes in the next ten years in the majority of the population . these results are rather encouraging but may in some way be in confrontation with the statistics which show a rapid outburst of diabetes.conclusion:the life - style is the main reason for such a thing to happen , and looking at these questionnaires , we might get the feeling that we really do live in a , conditionally speaking , physically active society . that , from our everyday experience is not entirely true . it would be wise to continue doing research on this topic on the territory of bosnia and herzegovina .

1. INTRODUCTION 2. AIM 3. MATERIAL AND METHODS 4. RESULTS 5. DISCUSSION 6. CONCLUSION

acute right heart syndrome ( arhs ) may be defined as sudden deterioration in the right ventricular ( rv ) function and failure of the rv of the heart to deliver adequate blood flow to the pulmonary circulation , resulting in systemic hypoperfusion . in the context of critical illness evidence of central venous pressure ( cvp ) overload in conjunction with rv contractile dysfunction , is usually present in arhs . we searched pubmed , embase , cochrane library and google scholar , for articles reporting on rv dysfunction and failure . the relevant papers were extracted in full and references from extracted papers were checked for any additional relevant articles . an overview of the arhs pathophysiology , diagnostic tools for the assessment of the acutely failing rv in critical illness and measures including vasoactive agents , ventilatory strategies and mechanical support is provided in the current paper . the main functions of the rv are : a ) maintenance of adequate pulmonary perfusion pressure in order to deliver desaturated mixed venous blood to the respiratory membrane ; b ) maintenance of low systemic venous pressure in order to prevent organ congestion . the rv is anatomically adapted for the generation of low - pressure perfusion and it is very sensitive to changes in afterload . . the differences between the structure and function of the rv compared to the left ventricle ( lv ) are outlined in table 1 and figure 1 compares the pressure - volume ( p - v ) loop of the rv with that of the lv . little time is spent in isovolumetric contraction , giving a triangular - shaped rv p - v loop , in contrast to the almost square loop of the lv ( 25 ) . the rv in critical illness arhs is not necessarily associated with an increase in pulmonary vascular resistance ( pvr ) and pulmonary arterial hypertension ( pah ) . the syndrome can be due to rv pressure / volume overload or rv contractile dysfunction . consequence is low cardiac output ( co ) with low mean arterial pressure ( map ) , exacerbating rv dysfunction . rv failure begets rv failure leading to a progressive downward spiral of worsening ischemia , myocardial dysfunction and shock . in mechanically ventilated patients with arhs , low co is multifactorial and could be due to rv systolic dysfunction , tricuspid regurgitation , ventricular interdependence ( dilatation of the rv shifting the interventricular septum toward the left and decreasing the lv distensibility and preload ) , arrhythmias or suboptimal preload . rv diastolic dysfunction causes impaired rv filling and high diastolic rv and right atrial ( ra ) pressures leading to organ congestion . the causes and precipitating events of arhs are summarized in table 2 . precipitating events / causes of arhs in the icu ( 7 - 15 ) . arhs = acute right heart syndrome ; icu = intensive care unit ; rv = right ventricular ; lv = left ventricular . arhs in acute respiratory distress syndrome ( ards ) ards is one of the most common causes of arhs secondary to rv pressure overload ( acute cor pulmonale ) . in critically ill ventilated patients with ards , arhs occurs in 61% of patients submitted to conventional tidal volume mechanical ventilation ( mv ) and 25% of those receiving lung protective mv using low tidal volumes [ 15 , 16 ] . apart from mv , the pathologic features of the syndrome per se , contribute to increased pulmonary vascular tone , acute pulmonary arterial hypertension ( pah ) and cor pulmonale . contributors to elevated pulmonary vascular resistance ( pvr ) in ards include : vasoconstrictor : vasodilator imbalance ( excess et-1 , 5ht , pde , reduced no and prostanoids ) , endothelial injury , hypoxic pulmonary vasoconstriction ( 80% arteriolar ) , hypercapnia ( including permissive hypercapnia ) , acidemia , in situ thrombosis and pulmonary vascular remodelling ( muscularization of non - muscularized arteries ) [ 8 , 16 , 17 ] . arhs in the setting of massive pulmonary embolism ( pe ) critically ill patients are at risk of pe despite thromboprophylaxis [ 3 , 18 ] . in a ten - year retrospective study , vieillard - baron et al . showed that arhs was present in 61% of medical intensive care unit ( icu ) patients with massive pe and carried a 23% mortality . the normal rv can generate a mean pulmonary artery pressure up to 40 mmhg , requiring 50 - 75% of the pulmonary vasculature to be occluded by emboli before acute rv failure occurs . hypoxemia induced by the emboli results in pulmonary vasoconstriction and the physiological response to platelet activation leading to release of vasoactive agents such as serotonin , thromboxane and histamine , causes further increase in pvr and rv pressure overload [ 19 , 20 ] . in severe sepsis and septic shock rv systolic dysfunction in sepsis is directly associated with markers of endothelial dysfunction ( endothelin 1 , vascular cellular adhesion molecule 1 ) and directly related to the severity of sepsis . a proposed mechanism for arhs in sepsis is increased pvr secondary to sepsis - induced endothelial cell injury and altered vaso - reactivity , despite concomitant decrease in systemic vascular resistance ( svr ) . substantial increases in pvr also occur when the left ventricle needs to considerably increase the cardiac output in order to compensate for the fall in the svr , causing further increase in rv afterload [ 21 , 22 ] . diagnosis of arhs in the critically ill clinical features the clinical features of arhs , including acute onset shortness of breath , orthopnea and bilateral lower extremity edema , are non - specific and difficult to identify in the sedated critically ill patient . increased oxygen requirements or sudden cardiovascular collapse might be the chief clinical manifestations of arhs in a mechanically ventilated patient . other prominent clinical signs include atrial or ventricular arrhythmias , raised jugular venous pressure and gallop rhythm at the left sternal edge , systolic murmur of tricuspid regurgitation , organomegaly , signs of deep venous thrombosis ( in the context of venous thromboembolism ) . it is important to consider arhs in persistent respiratory weaning failure ( rv dysfunction leads to an imbalance between ventilator needs and cardiorespiratory capacity ) , especially in patients with lv systolic dysfunction [ 6 , 9 , 24 , 25 ] . a high index of suspicion is needed in high risk patients such as those with pre - existing pah and recent deep venous thrombosis . available bedside studies include : chest x - ray ( cxr ) , electrocardiography ( ekg ) , arterial blood gas ( abg ) analysis , hemodynamic and echocardiographic diagnostic tools . however , cxr can not be utilized to confirm the diagnosis of arhs and should only contribute to the diagnostic approach by ruling out conditions that mimic arhs in the icu , such as atelectasis , pleural effusions , pulmonary edema and pneumothorax . showed that qr in v1 is a strong predictor of rv dysfunction , and it is highly associated with troponin leakage and myocardial shear stress . it has also been demonstrated that in patients with right bundle branch block , r duration in lead v1>100 ms is predictive of rv systolic dysfunction . other ekg findings suggestive of rv strain include inversion of t waves in leads v1-v4 and the classic s1q3t3 pattern . acute anterior q - wave pattern in leads v1-v3 , as well as a right - sided q pattern in leads v3r - v6r , might suggest rv infarction . arterial blood gas analysis abg analysis may reveal grossly impaired gas exchange and low cardiac output might result in acidemia with lactic acidosis due to tissue hypoperfusion . hemodynamic bedside diagnostic modalities central venous catheters and central venous pressure an accurately placed central venous catheter ( in the superior vena cava ) , can provide information on cvp and used as a surrogate for rv end - diastolic volume ( rvedv ) and rv end - diastolic pressure ( rvedp ) [ 25 , 28 ] . in severe tricuspid regurgitation causing arhs , a broad , tall systolic c - v wave is seen due to abnormal systolic filling of the right atrium ( ra ) and the cvp trace is said to be ventricularized because it resembles right ventricular pressure [ 25 , 28 ] . rvedp reflects rvedv ( which is proportional to preload ) only when ventricular compliance is normal . therefore , in conditions such as pah , tamponade and myocardial ischemia , where rv compliance is decreased , cvp is likely to be raised and can not be accurately assessed [ 28 , 29 ] . right heart catheterization right heart catheterization using a pulmonary artery catheter ( pac ) is frequently required when arhs is clinically suspected and interpretation of imaging studies is difficult or inconclusive . hemodynamic data obtained from an accurately placed pac , by thermodilution , may provide diagnostic clues and guide therapy . pac allows direct simultaneous measurement of ra , rv , pa and pulmonary artery wedge pressures and indirect measurement of cardiac output , cardiac index ( ci ) , rv stroke work index , mixed venous oxygen saturation , pvr and svr [ 29 , 30 ] . hemodynamically , arhs is suspected if ra pressure > 8 - 10 mmhg , or ra pressure to pulmonary capillary wedge pressure 0.8 ( isolated rv failure ) and ci is low . in the presence of rv - pa gradient > 25 mmhg , rv outflow tract obstruction should be excluded by echocardiography . in the context of pah and suspected arhs , right heart catheterization allows assessment of left - sided heart disease and its contribution to pah . besides , calculation of pvr and svr help decide whether pulmonary or systemic vasodilators / pressors are needed and monitor response to therapy . in patients with pre - existing pah , a decrease in pa pressure might reflect low rv ejection fraction and worsening rv dysfunction . arterial pulse contour analysis arterial pulse contour analysis enables calculation of co , pulse pressure variation ( ppv ) , stroke volume variation ( svv ) and svr , from the arterial pulse pressure waveform , in mechanically ventilated patients . dynamic indices ( svv , ppv ) have been used to predict preload responsiveness and monitor the hemodynamic effect of volume expansion in critically ill patients . wyler von ballmoos et al . reported that ppv is not accurate predictor of fluid responsiveness in mechanically ventilated patients with acute pah ( at risk of arhs ) , early after cardiac surgery and in septic shock . in the context of a pressure overloaded rv , increased ppv values are related to an increase in the rv afterload and not to a decrease in rv preload and therefore , further volume expansion could potentially be harmful [ 33 , 34 ] . however , it could be reasonably contended that lack of response to a fluid challenge , while ppv or svv is high , could be seen as an indicator of rv dysfunction necessitating further investigations . bedside imaging modalities transthoracic ( tte ) and transesophageal echocardiography ( tee ) are bedside diagnostic tools which also provide rapid risk stratification and could potentially direct therapeutic strategies . in experienced hands , echocardiography allows assessment of the rv performance and loading conditions . useful echocardiography - derived measures of rv function , when arhs is clinically suspected are outlined in table 3 . echocardiographic quantitative parameters pointing towards arhs ( 36 - 38 ) rv = right ventricular ; tapse = tricuspid annular plane systolic excursion ; 2drvfac = two - dimensional right ventricular fractional area change ; rimp = right ventricular index of myocardial performance ; e / a = early ( e ) to late ( a ) ventricular filling velocities ratio ; rvot = right ventricular outflow tract . tte is an easy and non - invasive way to assess the size and kinetics of the rv . the diagnosis of arhs due to rv pressure overload , with tte , has good positive predictive value for indirect diagnosis of massive pe . main limitations of tte in critically ill patients ventilated with high level of positive end - expiratory pressure ( peep ) include : inadequate imaging due to interposition of the inflated lung between the heart and the chest wall , low diagnostic accuracy in the patients with pre - existing cardiopulmonary disease , the operator dependent nature of tte . it has been suggested that in the presence of significant and otherwise unexplained rv strain without clots present on tte , tee should rapidly follow at the bedside , providing there is local availability and expertise . tee is a semi - invasive procedure and commonly reported complications associated with tee in critically ill patients receiving mv , include : hypo- or hypertension , dysrrhythmias , trauma to the gastrointestinal tract , hypoxemia and dislodgment of endotracheal or nasogastric tubes . the over - all complication rate associated with tee use is low and it is estimated to be approximately 2.6% . additional imaging modalities computed tomography ( ct ) ct pulmonary angiography ( ctpa ) is being used increasingly as a diagnostic tool in pe , with documented sensitivities of 50 - 100% and specificities of 81 - 100% . ctpa has become the preferred diagnostic modality for suspected arhs due to pe , in hemodynamically stable icu patients . chest ct signs suggestive of arhs include : flattening or displacement of the intraventricular septum toward the lv , reflux of contrast into the inferior vena cava , rv diameter ( rvd ) to lv diameter ( lvd ) ratio on axial sections greater than 1.0 ( rvdaxial / lvdaxial > 1 ) . cardiovascular magnetic resonance ( cmr ) cmr is the most sensitive method to assess the rv size and function . however , cmr is rarely used for icu patients receiving mv , as the mr environment carries significant risks to patients during transportation and prolonged periods in the mr scanner . the usefulness of laboratory tests such as d - dimmer , troponins and b - type natriuretic peptide levels , as diagnostic tests in icu patients with suspected rv failure , is limited , as they are non - specific and confounded in the context of critical illness [ 41 , 42 ] . in summary , in critically ill patients with clinically suspected arhs , echocardiography ( tte and/or tee ) and right heart catheterization are the preferred diagnostic modalities . if pe is the most likely cause of arhs , then ctpa is necessary to confirm the diagnosis , provided the patient is suitable for transfer to radiology . in any given scenario , the diagnostic approach will depend upon the expertise and availability of the different diagnostic modalities . the principles and key components of arhs management include reversal of precipitating events and control of contributing factors ( hypoxemia , hypercapnia , anemia , acidemia , sepsis , dysrrhythmias ) , fluid volume optimization , maintenance of perfusion pressure , positive inotropy , use of pulmonary vasodilators and protective mv [ 12 , 43 ] . control of contributing factors , general icu care and reversible causes of arhs infection prevention , treatment of sepsis in accordance with the surviving sepsis campaign bundles , normoxia , normocapnia , thromboprophylaxis , peptic ulcer prophylaxis , correction of acid - base imbalance and electrolytes and glycemic control are mandatory and applied to most icu patients . pulmonary vasodilators and/or inodilators ( in acutely decompensated pah ) , thrombolysis ( in massive pe ) , revascularization ( in rv infarction ) and sequential av pacing and/or cardioversion ( in significant dysrrhythmias ) , could potentially correct the abnormal rv physiology . rv ejection fraction is dependent on rv pre - load , in the abscence of pah and it is likely that rv output will be inadequate in hypovolemia . the rv can increase the stroke work through an increase in rv free wall stretch ( via the frank - starling mechanism ) . a systematic review of 24 studies demonstrated a poor relationship between cvp and intravascular fluid status and the inability of cvp / delta - cvp to predict the hemodynamic response to a fluid challenge [ 32 , 45 ] . depending on where the patient is on the frank - starling curve , some may be adequately resuscitated with a cvp of 6 - 7 mm hg , while others may still be intravascularly volume depleted at a cvp of 10 mm hg . in a recent meta - analysis , marik et al . showed that there is paucity of data to support the widespread practice of using cvp to assess intravascular fluid status and guide fluid therapy . more reliable hemodynamic assessment tools , such as pac , pulse contour analysis , tte and/or tee when available , may be utilized to guide fluid therapy in arhs . showed that in critically ill medical patients with circulatory failure ( defined by ci 2 ) , due to massive pe , fluid loading with 500 ml of colloid increased the cardiac index significantly and improved hemodynamic status . if the hemodynamic response to initial fluid challenge is poor , in the context of arhs , further volume loading may cause rv overdistension , increased ventricular interdependence , decreased lv filling and rv ischemia , leading to worsening shock . in rv volume overload , acute kidney injury due to venous congestion ( cardiorenal syndrome ) , continuous veno - venous hemofiltration ( cvvh ) facilitates greater clinical improvement compared with aggressive diuretic therapy , in heart failure patients , who are diuretic resistant . the role of vasopressors in arhs in order to preserve adequate right coronary blood flow , systemic pressure should be maintained above the pa pressures . it has been shown that in patients with sepsis , pah and rv dysfunction , norepinephrine increases systemic pressure through alpha-1 receptor agonism and may improve the rv oxygen supply / demand ratio , but this potentially beneficial effect on rv ejection fraction may be offset by a concomitant increase in pvr and rv afterload , at high doses ( > 0.5 mcg / kg / min ) [ 43 , 49 ] . besides , norepinephrine , through beta-1 receptor agonism could potentially improve rv - pa coupling and co . low dose vasopressin ( 0.033 - 0.067 u / min ) mediates pulmonary arterial vasodilation and may be useful in vasodilatory shock and pulmonary vascular dysfunction , especially in norepinephrine resistant patients [ 43 , 49 , 50 ] . inotropes and inodilators in arhs dobutamine ( beta-1 receptor agonist ) can be used as the first - line inotropic agent in arhs due to rv contractile dysfunction . low dose dobutamine ( 2 - 5 mcg / kg / min ) increases ci , sv and decreases pvr and svr [ 12 , 43 , 51 ] . at higher doses ( > 10 mcg / kg / min ) dobutamine causes tachycardia , increased oxygen consumption , increased pvr and leads to systemic hypotension and addition of a vasopressor might be required [ 12 , 51 ] . high quality evidence suggests that dopamine is associated with increased tachyarrhythmias and is not recommended in cardiogenic shock . it has been demonstrated that in patients with septic shock and arhs , who are unresponsive to fluid loading , dopamine or dobutamine , epinephrine improves rv contractility in spite of a rise in mean pap by 11% ( p<0.05 ) . selective phosphodiresterase ( pde ) iii inhibitors ( enoximone , milrinone , amrinone ) , augment myocardial contractility and cause systemic and pulmonary vasodilaton , by increasing cyclic adenosine monophosphate ( camp ) and thus reducing pa pressures and improving rv function in patients with arhs due to pressure overloaded rv . it has been demonstrated that levosimendan , a calcium sensitizer with pulmonary vasodilator properties ( inodilator ) , improves rv performance in arhs secondary to sepsis - induced ards and in experimental arhs restores rv - pa coupling better than dobutamine . in arhs , levosimendan has been shown to reduce the increased rv afterload and ventricular interdependence , improve rv contractility and rv diastolic function , without significant increase in oxygen consumption , mediated by opening of sarcolemmal and mitochondrial potassium - adenosine triphosphate channels [ 54 , 55 ] . although levosimendan is indicated for the treatment of acute heart failure ( class of recommendation iia , level of evidence b ) , it is has not yet been approved in all countries [ 54 , 55 ] . pulmonary vasodilation in arhs the goals of pulmonary vasodilation in arhs are : 1 ) decrease pvr and impedance ; 2 ) increase rv stroke volume and output ; 3 ) avoid systemic hypotension and maintain coronary perfusion ; 4 ) avoid hypoxemia from ventilation - perfusion mismatch . it is recommended that inhaled nitric oxide ( no ) , which increases intra - cellular cyclic guanosine monophosphate ( cgmp ) , should be considered as short term therapy to improve pao2/fio2 ratio and co , in ventilated patients with arhs secondary to ards . it has also been suggested that no may be effective in stabilizing patients with arhs due to massive pe until more definitive treatment is available [ 29 , 56 ] . prostanoid formulations ( epoprostenol , iloprost ) are potent pulmonary and systemic vasodilators with anti - thrombotic and anti - proliferative actions . they reduce pvr and improve rv function and they have been used in arhs due to rv pressure overload . it has been shown that use of intravenous epoprostenol in mechanically ventilated patients with ards reduces pvr and improves rv performance . sildenafil , a pde 5 inhibitor , increases downstream cgmp signaling and potentiates the beneficial effects of no . showed that mechanically ventilated patients with arhs from pah , who were dependent on dobutamine , were treated with oral sildenafil and in many cases they were successfully weaned from inotropic and ventilatory support . mechanical ventilation strategies in arhs optimal mv ventilation management in arhs consists of : avoidance of hypoxemia , hypercapnia , high levels of peep ( > 10 cmh2o ) and both high and low extremes of lung volumes and use lung protective ventilation strategies if possible [ 43 , 60,61,62 ] . the rv afterload is governed by pvr which is directly affected by changes in lung volume . this is due to the elastic recoil forces of the lung parenchyma leading to extra - alveolar vessel collapse and terminal airway collapse leading to alveolar hypoxia and hypoxic pulmonary vasoconstriction ( hpv ) and at high lung volumes due to collapse of the alveolar vessels via stretch of the alveolar wall . when pvr is plotted against lung volume , a typical u - shaped curve occurs with the lowest pvr occurring at functional residual capacity ( frc ) ( figure 2 ) . effect of changing lung volume on pulmonary vascular resistance ( pvr ) ( 62 ) . rv = residual volume ; frc = functional residual capacity ; tlc = total lung capacity . schmitt et al . assessed the impact of peep on the rv outflow impedance using doppler data obtained by tee , in mechanically ventilated icu patients with ards . they demonstrated that high peep ( 134 cmh2o ) was associated with increased rv afterload and worsening rv systolic dysfunction . the significant decrease in the incidence of arhs ( from 61% to 25% ) in ards since ardsnet trial was published , reflects a change in mv practice and suggests that lung protective strategies ( tidal volume : 6 - 8 ml / kg predicted body weight ( pbw ) , low plateau pressures and peep ) reduce the incidence of arhs . in patients with arhs , during lung protective ventilation , permissive hypercapnia should be avoided as acute hypercapnia could lead to pulmonary vasoconstriction or exacerbate hypoxic pulmonary vasoconstriction and could potentially worsen rv dysfunction . a prospective observational study , which evaluated the relative roles of acute permissive hypercapnia and peep variations on rv function , in severe ards patients , showed that increasing peep at constant pplat induces acute hypercapnia that may impair rv function and decrease ci . it is therefore recommended that in cases of arhs , lung protective ventilation should be gradually adapted to limit hypercapnia and rv overload . in mechanically ventilated icu patients with arhs , refractory hypoxemia and/or hypercapnia and high peep requirements , extracorporeal membrane oxygenation ( ecmo ) could be used as a bridge to the recovery of respiratory function . oxygenation and carbon dioxide clearance are provided by the extracorporeal circuit , minimizing pulmonary vasoconstriction due to hypoxemia and/or hypercapnia [ 66 , 67 ] . in patients with arhs due to severe ards , where lung protective ventilation may not be adequate in managing hypercapnic acidosis , extracorporeal carbon dioxide ( ecco2 ) removal devices are an option , as they are less invasive than ecmo and may play a role in instituting ultra - protective lung ventilation ( tidal volume : 4 ml / kg pbw ) . it should be noted that the cardiac consequences of weaning from mv may be responsible for weaning failure in patients with arhs . in these patients , an increase in weaning - induced rv afterload may occur due to marked increase in work of breathing , hypoxemia or high intrinsic peep , leading to further worsening rv enlargement during weaning . this may result in leftward shift of the interventricular septum , impeding lv diastolic filling and lv output ( ventricular interdependence ) , causing pulmonary edema and failure to wean from mv . mechanical circulatory support low cardiac output syndrome caused by arhs after cardiac surgery , particularly coronary artery bypass graft surgery and heart transplant , may be an indication for intra - aortic balloon pump ( iabp ) [ 70 , 71 ] . it has been demonstrated that iabp improves hemodynamics and rv efficiency in acute ischemic rv failure . however , a recent rct failed to demonstrate any mortality benefit in patients with cardiogenic shock complicating acute myocardial infarction . veno - arterial ( va ) ecmo has been used as a salvage therapy in cases of arhs due to massive pe and refractory cardiogenic shock , after systemic thrombolysis . it can be used as a means of unloading the rv and supporting systemic circulation , in medically refractory rv failure with accompanying hypotension and end - organ failure and as a bridge to transplant [ 74 , 75 ] . right ventricular assist devices ( rvads ) in arhs may be used as a bridge to recovery or transplant , or as a definitive surgical treatment , in primary rv dysfunction . in patients who are successfully weaned from the rvad , it has been suggested that rvads should be avoided in patients with arhs secondary to rv afterload resistance ( with severely elevated pvr ) , as pumping blood into the pa could potentially cause worsening pah and lung injury , whereas co and ci remain low . in such cases the use of mechanical cardiovascular support devices depends largely on local availability of specialized facilities , cardiopulmonary pathophysiology expertise and operator experience . arhs is difficult to diagnose in the critically ill as those patients have ongoing physiological derangement presenting the intensive care specialists with a diagnostic dilemma . cardiac echo and right heart catheterization are invaluable diagnostic tools in the assessment of the rv at the bedside , which also provide a rapid risk stratification and could direct treatment strategies . characterizing , identifying and correcting reversible factors is of paramount importance . minimizing rv afterload ( pulmonary vasodilators , inodilators , rv protective mv strategies ) and maximizing rv performance ( preload , inotropy , mechanical circulatory support ) are the major components of arhs management . need for mechanical circulatory support , merits referral to specialized treatment centres , if there is insufficient local expertise or capacity . there is lack of definitive data regarding the management of arhs in icu patients , without pre - existing cardiopulmonary disease . well - designed and adequately powered rcts are required to estimate the prevalence of arhs among critically patients receiving mv , improve the understanding of its mechanisms in the context of critical illness and evaluate the efficacy of therapy guided by invasive and non - invasive hemodynamic monitoring tools .

acute right heart syndrome is a sudden deterioration in right ventricular performance , resulting in right ventricular failure and confers significant in - hospital morbidity and mortality . in critically ill patients , the syndrome is often undiagnosed and untreated , as these patients do not usually exhibit the common clinical manifestations of the condition , making the diagnosis challenging for the intensivist . in this narrative review we focus on the pathophysiology of acute right heart syndrome , in critical illness , diagnostic modalities used to assess right ventricular function and management of acute right heart syndrome , including mechanical ventilation strategies and circulatory support .

Introduction Conclusion

in rare conditions , bacteria from carbuncles can spread into the bloodstream and migrate to other areas of the body , causing serious complications such as septicemia and infections in the liver , bones , joints , heart , and central nervous system . we describe an original case of forehead carbuncle with intractable headache , later confirmed as a subgaleal abscess . a 74-year - old female visited our hospital due to a 2 cm , painful , erythematous nodule with a small necrotic plug on her forehead , which had been resident for 2 days . she had suffered for 5 years from diabetes mellitus , which was not aggressively controlled . one day later , the patient visited our emergency room again due to progressive erythema and worsening headache . she had mild fever ( 37.7c ) and bilateral periorbital soft tissue swelling with local heat . laboratory data showed elevated white blood cell count ( 10.521,000 cells/l ) and c - reactive protein levels ( 78.90 preliminary diagnosis suspected cellulitis ; she was admitted to kaohsiung municipal ta - tung hospital , kaohsiung , for further management . however , her headache kept worsening and interfered with her sleep over the next 2 days . she described the headache as severe , persistent aching all over her head , which was not associated with postural change . nonsteroidal anti - inflammatory drugs and tramadol hydrochloride were administered but completely in vain . in the fear of central nervous system involvement however , brain computed tomography ( ct ) was still arranged due to intractable headache . brain ct showed no intracranial lesion , but subgaleal emphysema and abscess were suspected ( figure 1 ) . a neurosurgeon was then consulted , and operative debridement was promptly arranged . during the operation , widespread subgaleal abscess was noted and drained . as previously described in the case history section , this 74-year - old female had intractable headache , which developed in close relationship with subgaleal abscess . in addition , her headache resolved within 3 months after successful treatment of subgaleal abscess with operative debridement and antibiotics . according to the international classification of headache disorders ( ichd-2 ) criteria , headache disorders attributed to extracranial infection of the head ( such as ear , eye , and sinus infection ) are coded as subtypes 11 . headache or facial pain can be attributed to a disorder of the cranium , neck , eyes , ears , nose , sinuses , teeth , mouth , or other facial or cranial structures.1 carbuncle is a common dermatologic disease , and staphylococcus aureus is the pathogen responsible in most cases . though some authors advocate that systemic antimicrobial treatment is not needed for simple furuncles and carbuncles,2 we agree that incision and drainage with ancillary antimicrobial therapy is recommended for patients with immunosuppression or comorbidities , extremes of age ; rapid progression to cellulitis and the lack of an adequate response to incision and drainage are also indications for such treatment.3 however , empiric antibiotics for carbuncle , even vancomycin , did not work for the unusual bacterial culture of klebsiella in this patient . although klebsiella is strongly associated with infections in patients with diabetes , skin and soft tissue infections from klebsiella are still uncommon.4 this case reminds us that empiric , systemic antibiotics for carbuncles and cellulitis may respond poorly in situations as described in the case history section . the most common cause of subgaleal abscess is direct inoculation of microbes into the subgaleal space following scalp trauma . however , subgaleal abscess may result from hematogenous infection or contiguous spread , and the diagnosis may not be initially obvious.5 carbuncles may progress to cellulitis and cause redness of the skin , swelling , and pain . however , carbuncles located on the middle of the face may raise concern , especially when the patient is elderly and immune - compromised . intractable headache that is unresponsive to the standard medications and therapies utilized in the treatment of headaches also indicates the need for further survey . head ct is often needed in the diagnosis of subgaleal abscess , and if operative debridement is not promptly performed , subgaleal abscess may further progress to life - threatening septicemia , osteomyelitis , and even subdural or brain abscess or meningitis.6 there are no focal neurological signs or specific symptoms in the early stages of subgaleal abscess . thus , when encountering patients with intractable headaches , unusual causes should be kept in mind , which may include moyamoya syndrome,7 headache after botulinum a exotoxin injections,8 acquired immunodeficiency syndrome - related lymphoma confined to bone,9 migraine in obese individuals,10,11 and children with both migraine and periodic limb movement disorders in sleep.12 in conclusion , this case highlights that special attention should be paid to elderly and immune - compromised patients with carbuncles located on the middle of the face , especially when accompanied by intractable headache .

although carbuncles are commonly seen and may heal on their own or respond well to treatment , in rare conditions , bacteria from carbuncles can spread into the bloodstream and migrate to other areas of the body . herein , we report on an elderly female who suffered from forehead carbuncle with intractable headache , later confirmed as having subgaleal abscess . physicians should pay special attention to elderly and immune - compromised patients with carbuncles located on the middle of the face , especially when accompanied by intractable headache , to avoid poor outcome .

Introduction Case history Discussion

hydroxyl radicals , generated by cellular oxidative stress and inflammation , damage nucleobases or deoxyribose sugars , or both in dna . at 2-deoxyguanosines , hydroxyl radical - mediated hydrogen abstraction at the deoxyribose c5-position followed by attack at the guanine c8 carbon forms an n7-centered radical , which may be oxidized to diastereomeric 8,5-cyclo-2-deoxyguanosines ( cdg ) . the 8,5-cyclo-2-deoxyadenosines ( cda ) have also been characterized . these 8,5-cyclopurine-2-deoxynucleosides have been detected at the nucleotide level , in dna , and cells in vitro , in human urine , and in vivo . they might contribute to neurologic disease in xeroderma pigmentosum complementation group c ( xp - c ) patients . they are also believed to play roles in cockayne syndrome , breast and ovarian cancer , and familial mediterranean fever . it has been reported that s - cdg does not block primer elongation by klenow dna polymerases , and datp is preferentially incorporated opposite the lesion in vitro . however , in escherichia coli , s - cdg blocks dna replication and is refractory to repair . most are s - cdg a transitions , although s - cdg t transversions and low levels of deletions of the 5-neighbor dc are also observed . for both cdg and cda , the diastereomeric ratio at the c5-position depends on experimental conditions and dna conformation . computational studies predicted that the incorporation of the cda stereoisomers into dna would result in helical distortions at the lesion site . both the r- and the s - diastereomers of the 8,5-ca ribonucleoside have been crystallized , and both exhibit the anti conformation about the n - glycosidic bond with o4c1n9c8 = 30 or 27 , respectively . the fused six - member ring c8n9c1o4c4c5 adopts the half - chair conformation with the o4 and c4 out of plane . the ribose adopts the o4-exo ( 0 t ) pseudorotation with p = 289 and m = 48. molecular mechanics calculations predicted that the cda diasetereomers maintain the o4-exo pseudorotation when placed opposite dt in dna . the nmr data and ab initio calculations suggest that incorporation of the s - cda into di- or trinucleotides does not change the o4-exo pseudorotation . recently , we reported the structure of the s - cdgdc pair in 5-d(gtgcxtgtttgt)-35-d(acaaacacgcac)-3 , containing the dna sequence of p53 codons 272275 ( x = s - cdg , scheme 1 ) . however , the s - cdg deoxyribose shifts to the o4-exo pseudorotation with p = 280. this altered backbone torsion angles from 50 to 67 and from 120 to 149 , as compared with canonical b - dna . additionally , the torsion angles and are changed from 180 to 87 and from 120 to 157 , respectively . the twist and base pair shift helicoidal parameters are perturbed at the cg and xc base pairs . the purine ring is anti about the n - glycosidic bond , and the fused six - membered ring adopts the half - chair conformation with o4 and c4 out of plane . here , we report the structures of the duplexes 5-d(gtgcxtgtttgt)-35-d(acaaacaygcac)-3 ( x denotes s - cdg ; y denotes either da or dt , scheme 1 ) . these model the situation following mis - incorporation of dttp opposite s - cdg , leading to s - cdg a transitions , or following mis - incorporation of datp opposite s - cdg , leading to s - cdg t transversions in e. coli . the s - cdgdt mismatch pair adopts a wobble base pairing , providing a plausible rationale for the s - cdg a transitions . for the s - cdgda mismatch pair , both s - cdg and da intercalate , but no hydrogen bonding is observed between s - cdg and da . this is consistent with the lower levels of s - cdg t transitions in e. coli . the oligodeoxynucleotide 5-d(gtgcxtgtttgt)-3 ( x = s - cdg ) was synthesized and characterized as reported.the oligodeoxynucleotides 5-d(gtgcgtgtttgt)-3 and 5-d(acaaacaygcac)-3 ( y = da or dt ) were synthesized and purified by anion - exchange chromatography ( midland certified reagent co. , midland , tx ) . the oligodeoxynucleotides 5-d(gtgcgtgtttgt)-3 or 5-d(gtgcxtgtttgt)-3 were annealed at 1:1 stoichiometry with the complementary oligodeoxynucleotide 5-d(acaaacaygcac)-3 in 10 mm nah2po4 , 100 mm nacl , and 50 m na2edta ( ph 7.0 ) . the solutions were heated to 95 c for 10 min and cooled to room temperature . the duplexes were isolated using dna grade hydroxylapatite with a gradient from 10 to 200 mm nah2po4 in 100 mm nacl and 50 m na2edta ( ph 7.0 ) and desalted using sephadex g-25 . melting temperatures of the dna duplexes were measured by uv / vis spectroscopy at 260 nm in 10 mm nah2po4 , 100 mm nacl , and 50 m na2edta ( ph 7.0 ) . the thermal scans proceeded from 10 to 80 c with an interval of 1 c . samples for the nonexchangeable protons were dissolved in 500 l in 10 mm nah2po4 , 100 mm nacl , and 50 m na2edta ( ph 7.0 ) . they were exchanged with d2o and suspended in 280 l of 99.996% d2o , and the ph was adjusted with dilute dcl or naod . magnitude correlated spectroscopy ( cosy ) spectra were recorded with 512 real data in the t1 dimension and 2048 real data in the t2 dimension . total correlation spectroscopy ( tocsy ) spectra were recorded with a mixing time of 80 ms . the exclusive correlation spectroscopy ( e - cosy ) spectra were recorded with 1024 real points in the t1 dimension and 4096 real points in the t2 dimension . the spectra were zero - filled during processing to create a matrix of 2048 16384 points . nuclear overhauser effect spectroscopy ( noesy ) spectra were recorded with 512 real points in the t1 dimension and 2048 real points in the t2 dimension . noesy spectra were zero - filled during processing to create a matrix of 1024 1024 real points . noesy experiments used time - proportional phase increment ( tppi ) quadrature detection and mixing times of 60 , 150 , 200 , and 250 ms . the relaxation delay was 1.5 s. data were processed using the program topspin and analyzed with the program sparky . samples for the observation of exchangeable protons were dissolved in 500 l of 10 mm nah2po4 and 100 mm nacl , 50 m edta ( ph 7.0 ) containing 9:1 h2o : d2o ( v / v ) ( ph 7.0 ) . the watergate sequence was used for water suppression , with a nuclear overhauser enhancement ( noe ) mixing time of 250 ms . the p h experiments were carried out at the h frequency of 600 mhz . h3 j couplings were applied to determine the phosphodiester backbone conformation.p chemical shifts were referenced using indirect shift ratios . integration footprints were defined using noe cross - peaks obtained at a mixing time of 250 ms . noe intensities from data obtained at mixing times of 60 , 150 , 200 , and 250 ms to check for the presence of spin diffusion effects were determined by volume integrations . for each mixing time , these were combined as necessary with intensities generated from complete relaxation matrix analysis of a starting structure to yield a hybrid noe intensity matrix . the program mardigras iteratively refined the hybrid intensity matrix and optimized agreement between calculated and experimental noe intensities . the randmardi algorithm carried out iterations , randomizing peak volumes within limits specified by the input noise level . calculations were initiated using isotropic correlation times of 2 , 3 , and 4 ns . analysis of these data yielded distance restraints used in restrained molecular dynamics ( rmd ) calculations ( table s3 in the supporting information ) and the corresponding standard deviations for the distance restraints . the pseudorotations ( p ) were estimated by examining the jhh of deoxyribose protons . the data were fit to curves relating the coupling constants to p , deoxyribose pucker amplitude ( ) , and the percentage s type conformation . the p and ranges were converted to the dihedral angles 04 . to obtain backbone torsion angle restraints for the modified , flanking , and terminal base pairs , coupling constants measured from h p heternuclear multiple bond correlation spectroscopy ( hmbc ) spectra were applied to the karplus relationship to determine the dihedral angle ( c4c3o3p ) , related to the h3c3o3p angle by a 120 shift . the ( c3o3p o5 ) torsion angles were calculated from the correlation between and in b - dna . at all other base pairs , crick hydrogen - bonding restraints minimized propeller twisting between base pairs , except at the xt base pair in the s - cdgdt mismatched duplex and at the xa and at base pairs in the s - cdgda mismatched duplex . the partial charges for the cdg nucleotide were obtained from density functional theory ( dft ) calculations , utilizing the b3lyp/6 - 31 g * basis set and the program gaussian . the starting structures were generated from a and b type dnas by constructing a bond between g5 c8 and g c5 followed by 200 iterations of potential energy minimization using the conjugate gradients algorithm . the generalized born ( gb ) model with parameters developed by tsui and case was used for implicit water simulation . the program complete relaxation matrix analysis ( corma ) was utilized to calculate the noe intensities from the structures emergent from calculations . the duplex containing the s - cdgdt base pair exhibited a melting temperature ( tm ) of 38 1 c . the unmodified dgdt mismatched duplex exhibited a tm of 43 c under the same conditions ( figure 1a ) . thus , the incorporation of s - cdg reduced the tm by 5 c . the duplex containing the s - cdgda pair exhibited a tm of 31 1 c . the unmodified dgda mismatched duplex exhibited a tm of 39 1 c ( figure 1a ) . h nmr spectra of the duplex containing the s - cdgdt pair were compared with the unmodified mismatched duplex at different temperatures ( figure 1b ) . at the xt base pair , the t n3h resonance was not observed at 5 c . for the modified duplex , the t n3h resonance broadened at lower temperature than did the other thymine imino resonances . h nmr spectra of the duplex containing the s - cdgda base pair at different temperatures are displayed in figure 1c . the imino resonances for base pairs cg , ga , and ta of the unmodified duplex were not observed . moreover , for the unmodified duplex containing the ga mismatch , the c and c h5 h6 scalar couplings were not observed , and that of c was weak . ( a ) uv melting profiles of the mismatched duplexes as compared with the corresponding unmodified duplexes : duplex containing dgda base pair ( ) , duplex containing s - cdgda base pair ( ) , duplex containing dgdt base pair ( ) , and duplex containing s - cdgdt base pair ( ) . ( b ) h nmr of the mismatched duplex containing the s - cdgdt base pair at different temperatures . ( c ) h nmr of the mismatched duplex containing the s - cdgda base pair at different temperatures . the broad resonance at 13.1 ppm observed at 515 c was unassignable the nonexchangeable protons of the s - cdg - modified duplex were assigned based upon the noe sequential connectivity of the base proton h6 or h8 dipolar couplings with h1 deoxyribose protons ( figure 2a , b ) . for the modified strand , the sequential connectivity was observed from g to c. because the s - cdg nucleotide lacked a proton at the c8 carbon , the sequential connectivity exhibited an interruption at x. the x h1 proton was identified at 6.11 ppm ; it exhibited a weak x h1 t h6 noe . the sequential connectivity resumed from t to t. for the modified strand , all of the deoxyribose h1 protons were observed within a narrow chemical shift window , between 5.8 and 6.3 ppm . noe ( 250 ms ) connectivities of base h8/h6 protons with deoxyribose h1 protons of the s - cdg modified duplexes . ( a ) modified strand for the duplex containing the s - cdgdt base pair . ( b ) complementary strand for the duplex containing the s - cdgdt base pair . ( c ) modified strand for the duplex containing the s - cdgda base pair . ( d ) complementary strand for the duplex containing the s - cdgda base pair . the assignments of x deoxyribose protons were made by analysis of scalar and dipolar couplings . figure 3a displays a tile plot derived from a noesy spectrum obtained at 60 ms mixing time . x h1 exhibited dipolar couplings with h2 and h2 ; weak scalar couplings were also observed . h3 exhibited dipolar couplings with h2 , h2 , and h4 , whereas the scalar couplings were not observed . the geminal h2 and h2 protons were not resolved . for the remainder of the duplex , the h2 , h2 , h3 , and h4 deoxyribose resonances were unequivocally assigned . the absolute configurations of the geminal h2 and h2 protons were assigned from their noes to h1 and h3. with the exception of the unresolved resonances for x , g , and t , h2 exhibited a weaker noe with h1 than did h2 , whereas it exhibited a stronger noe with h3 than did h2. the resonance assignments of the nonexchangeable dna protons are tabulated in table s1 in the supporting information . expansions of noesy spectra ( 60 ms ) showing the assignment of s - cdg nonexchangeable protons . ( a ) duplex containing s - cdgdt base pair . ( b ) the resonances of the base imino protons were assigned based on sequential connectivity in noesy spectra , and the assignments were supported by noes to the amino protons of watson the noe sequential connectivity was observed from t g to g and from t g t t t to g. at the 5-neighbor base pair , g n1h exhibited noes with cn h1 and n h2 . at the 3-neighbor base pair , the t n3h resonance exhibited noes with a h2 and an h1 . with the exception of the terminal base pairs , the remaining noes arising from watson it exhibited an noe with xnh , which also had an noe with t n3h ( figure 4b ) . ( a ) duplex containing the s - cdgdt base pair ; noe cross - peaks are assigned as follows : a , a h2 g n1h ; b , cnh2 g n1h ; c , cnh1 g n1h ; d , an h1 t n3h ; and e , a h2 t n3h . ( b ) assignment of x n1h in the duplex containing the s - cdgdt base pair ; noe cross - peaks are assigned as follows : f , t n3h xnh ; and g , x n1h xnh . ( c ) duplex containing the s - cdgda base pair ; noe cross - peaks are assigned as follows : h , a h2 g n1h ; i , cnh2 g n1h ; and j , cnh1 g n1h . the scalar couplings of the 2-deoxyribose h1 protons with the h2 and h2 protons were measured from an e - cosy spectrum ( figure s1 in the supporting information ) . the jh1-h2 and jh1-h2 values for x were 2.1 and 4.9 hz , respectively . for t , jh1-h2 and jh1-h2 were 5.3 and 8.8 hz , respectively . with the exception of the terminal nucleotides , the jh1-h2 for other nucleotides were 810 hz , and the jh1-h2 were 57 hz . the j coupling constants for the deoxyribose protons are tabulated in table s2 in the supporting information . the p nmr spectrum of the s - cdg containing duplex was compared with the unmodified mismatched duplex ( figure s2 in the supporting information ) . at the s - cdg nucleotide , the p resonance shifted upfield . the other p resonances were clustered within a modest chemical shift range , centered in the spectral region characteristic of b - dna . chemical shifts of the nonexchangeable protons between the s - cdg - containing duplex andthe unmodified mismatched duplex were compared ( figure 5 ) . remarkable changes were observed at x and the 5- and 3-neighboring nucleotides of the modified strand . c h2 shifted downfield by 0.72 ppm ; x h2 and h2 shifted upfield by 0.21 and 0.51 ppm , respectively ; and t h6 , h1 , and h2 shifted downfield by 0.32 , 0.24 , and 0.23 ppm , respectively . the chemical shift perturbations for the complementary strand were small , with the exception of a h8 and t h1 , which shifted upfield by 0.24 and 0.31 ppm , respectively . chemical shift perturbations of the duplex containing the s - cdgdt base pair . a total of 406 distance restraints , including 263 intranucleotide and 143 internucleotide restraints , were calculated from the intensities of noe cross - peaks ( table s3 in the supporting information ) . a total of 21 noes involving the s - cdg protons were used as restraints . crick base pairing were used , as were 160 empirical torsion angle restraints that were applied to the nonterminal nucleotides . these were justified based upon nmr data , which suggested that structural perturbations were localized at and adjacent to the lesion site . weak wobble base pair restraints were used for the xt base pair , and no torsion angle restraints were used for the cg , xt , and ta base pairs . r1 = |(a0)i1/6 ( ac)i1/6|/|(a0)i1/6| , where a0 and ac are the intensities of observed ( nonzero ) and calculated noe cross - peaks , respectively . the rmd calculations for the s - cdg - containing duplex were performed from a and b form starting structures . ten emergent structures , five each for a- and b - dna starting structures , were obtained and minimized with respect to potential energy . the accuracies of the emergent structures were evaluated by comparison of theoretical noe intensities for the refined structure calculated by the program corma to the experimental noe intensities , to yield sixth root residuals ( r1 ) . these , as well as the residuals for intra- or internucleotide noes , were consistently < 0.1 ( table 1 ) . r1 values for each nucleotide were < 0.15 ( figure s3 in the supporting information ) . thus , the refined structures provided accurate depictions of the noe data . the xt pair adopted the wobble conformation ( figure 6 ) . the xt pair exhibited a shift of 0.8 , displacing c toward the major groove . this pair exhibited a greater than normal opening of 16.8. typical b - dna pairing and stacking interactions were maintained for the remaining base pairs ( table s4 in the supporting information ) . the s - cdg deoxyribose was in the o4-exo , west pseudorotation ( figure 8a ) , with p = 280 and m = 47. the heavy atoms n9 , o3 , and c5 were axial about the deoxyribose ring . pseudorotation , with p = 65 and m = 37. consequently , x h2 was farther from the x purine ring as compared to the h2 protons in b - dna , and c4 h2 was proximate to the x purine ring . with the exception of the terminal nucleotides , the six - membered ring c8n9c1o4c4c5 adopted the envelope ( half boat ) conformation . helicoidal analysis of the backbone torsion angles ( figure s4 in the supporting information ) showed that for s - cdg , the angle shifted from 180 to 78. the angle shifted from 50 to 57. perturbations of the and torsion angles from 120 to 147 and from 90 to 58 , respectively , were also observed . there was also a change for the n - glycosidic torsion angle from 120 to 162. for the complementary t , a perturbation of the torsion angle from 120 to 83 was observed . expanded views of the refined structure of the s - cdg containing duplexes at the lesion site . ( a ) duplex containing the s - cdgdt base pair , viewed from the minor groove . ( b ) duplex containing the s - cdgdt base pair , viewed from the major groove . ( c ) duplex containing the s - cdgda base pair , viewed from the minor groove . ( d ) duplex containing the s - cdgda base pair , viewed from the major groove . base pairing and base stacking of the refined structures of the s - cdg containing duplex at the lesion site . the nonexchangeable protons were assigned based upon the sequential connectivity of the base proton h6 or h8 dipolar couplings with h1 deoxyribose protons ( figure 2c , d).for the modified strand , the noe connectivity was observed from g to c. the connectivity exhibited an interruption at x due to the lack of a proton at the c8 carbon . the x h1 proton was identified at 6.12 ppm ; it exhibited a weak x h1 t h6 noe , suggesting that the distance between these two protons was greater than in b - dna . the sequential connectivity resumed from t to t. for the modified strand , the deoxyibose h1 protons were observed within a narrow chemical shift window , between 5.8 and 6.3 ppm . the resonances of a h2 and a h2 appeared at 7.41 and 7.46 ppm , respectively . in addition , a h2 exhibited an noe with g n1h ( figure 4c ) , suggesting both a and a were intercalated . as expected , both h2 protons exhibited noes with h1 protons in the minor groove ( figure 9 ) . notably , a exhibited noes with both t h1 and a h1 of the 5-flanking ta base pair but did not exhibit noes with c h1 or g h1 of the 3-flanking cg base pair . expansion of the noesy spectrum ( 250 ms ) of the duplex containing the s - cdgda base pair showing the intercalation of a and a. noe cross - peaks are assigned as follows : a , t h6 t h1 ; b , t h6 x h1 ; c , a h2 a h1 ; d , a h2 t h1 ; e , a h2 a h1 ; f , a h2 x h1 ; g , a h2 a h1 ; and h , a h2 a h1. the assignments of x deoxyribose protons were made by analysis of scalar and dipolar couplings . figure 3b displays a tile plot derived from a noesy spectrum at 60 ms mixing time . x h1 exhibited dipolar couplings with h2 and h2 ; weak scalar couplings were also observed . h3 exhibited dipolar couplings with h2 , h2 , and h4 , whereas the scalar couplings were not observed . for the remainder of the duplex , the h2 , h2 , h3 , and h4 resonances were assigned unequivocally . the absolute configurations of the geminal h2 and h2 protons were assigned from their noes to h1 and h3. with the exception of the unresolved resonances for g , t , and c , h2 exhibited a weaker noe with h1 than did h2 , whereas it exhibited a stronger noe with h3 than did h2. the resonance assignments of the nonexchangeable dna protons are tabulated in table s5 in the supporting information . the resonances of the base imino protons were assigned based on sequential connectivity in noesy spectra and noes to the amino protons of watson crick base pairs ( figure 4c).the noe connectivity was observed from t g to g and from g t t t to g. the resonances of x n1h and t n3h were not assigned although a broad resonance was observed at 13.2 ppm at temperatures below 15 c . the assignment failed due to a lack of noe interactions . at the 5-neighbor base pair , g n1h exhibited noes with cn h1 and n h2 . with the exception of the terminal base pairs , the remaining noe cross - peaks arising from watson the scalar couplings of the 2-deoxyribose h1 protons with the h2 and h2 protons were measured from an e - cosy spectrum ( figure s1 in the supporting information ) . the jh1-h2 and jh1-h2 values for x were 2.7 and 7.2 hz , respectively . the jh4-h5 was 6.7 hz , whereas the jh3-h4 was not measurable . with the exception of the terminal nucleotides , the jh1-h2 for other nucleotides were 810 hz , and the jh1-h2 were 57 hz . the j coupling constants for the deoxyribose protons are tabulated in table s6 in the supporting information . h3 hmbc spectrum . with the exception of x , each exhibited a heteronuclear coupling with h3 of the 5-neighbor nucleotide the spectrum of the s - cdg - containing duplex was compared with the unmodified mismatched duplex ( figure s2 in the supporting information ) . at the modified nucleotide , the other p resonances were clustered within a modest chemical shift range , in the spectral region characteristic of b - dna . a total of 399 distance restraints , including 260 intranucleotide and 139 internucleotide restraints were calculated from the intensities of noe cross - peaks ( table s7 in the supporting information ) . a total of 30 noes involving the s - cdg protons were used as restraints . a total of 43 empirical distance restraints arising from watson crick base pairing interactions were used , as were 165 empirical torsion angle restraints that were applied to refine the nonterminal nucleotides . these were justified based upon nmr data , which suggested that structural perturbations were localized at and adjacent to the lesion site . the data suggested that no base pairing existed at the xa and ta base pairs , so base pairing restraints were not used for these base pairs . no torsion angle restraints were used for the cg , xa , and ta base pairs . ten rmd calculations , five each for a- and b - dna starting structures , were performed . the 10 emergent structures were minimized with respect to potential energy . all converged as indicated by pairwise rmsd comparisons ( table 1 ) . the accuracies of the emergent structures were evaluated by comparison of theoretical noe intensities calculated for the refined structure by the program corma to the experimental noe intensities to yield sixth root residuals ( r1 ) . these , as well as the residuals for intra- or internucleotide noes , were consistently less than 0.1 ( table 1 ) . r1 values for each nucleotide were less than 0.15 ( figure s3 in the supporting information ) . thus , the refined structures provided accurate depictions of the noe data . both x and a intercalated into the duplex ( figure 6 ) . consequently , the helical rise values from ct to xa and from xa to ta were greater than normal , 5.4 and 4.6 , respectively . figure 7c , d shows the base stacking and base pairing at the lesion site . significant perturbations in shift were observed from base pairs ta to ga , centered at the xa base pair . the ct base pair exhibited a greater than normal base pair twist of 54. the remaining base pairs exhibited normal base stacking ( table s8 in the supporting information ) . the s - cdg nucleotide was in the o4-exo , west pseudorotation ( figure 8b ) , with p = 264 and m = 47. the heavy atoms n9 , o3 , and c5 were axial about the deoxyribose ring . consequently , x h2 was farther from the x purine ring as compared to the h2 protons in b - dna , while c4 h2 was proximate to the x purine ring . with the exception of the terminal nucleotides , the six - membered ring c8n9c1o4c4c5 adopted the envelope ( half boat ) conformation . helicoidal analysis of the backbone torsion angles ( figure s4 in the supporting information ) showed that at the lesion site , the angle shifted from the characteristic 180 to 83. the angle shifted from 50 to 59. perturbations of the and torsion angles from 120 to + 157 and from 90 to 75 , respectively , were also observed . there was also a change for the n - glycosidic torsion angle from 120 to 143. . if not repaired , s - cdg blocks dna replication in e. coli and is genotoxic . in sos - induced e. coli , a mutation frequency of 34% is observed . most mutations are s - cdg a transitions , although s - cdg t transversions and a deletion of the 5-neighbor c are also observed . accordingly , structures in which s - cdg is placed opposite dt or da , representing intermediates leading to s - cdg a transitions and s - cdg t transversions , are of interest . the dg : dt mismatch often exists as a wobble base pair with both bases in the anti conformation . one might predict that locking s - cdg into the anti conformation about the n - glycosidic bond would be consistent with the formation of a wobble s - cdg : dt mismatch pair , and this appears to be the case . the formation of a wobble pair is consistent with the upfield shift of the x n1h resonances , which was also observed for the g n1h of the corresponding unmodified duplex ( figure 1b ) . however , the t n3h resonance was not observed , indicating enhanced solvent exchange at the s - cdgdt wobble pair . the structural refinement suggests the potential formation of a three - point hydrogen bond among x n1h , xnh2 , and to and a weak hydrogen bond between xo and t n3h ( figure 7 ) . however , the observation that the s - cdgdt wobble pair exhibits a tm 5 c lower than the corresponding duplex containing a dgdt mismatch pair ( figure 1a ) suggests that the incorporation of s - cdg reduces the stability of dgdt wobble pairing . the broadening of the t n3h and t n3h resonances as compared to the other thymine imino resonances ( figure 1b ) suggests that the greatest destabilization occurs at the modified xt and 3-neighboring ta base pairs . the base pair shifts at the cg and xt base pairs are consistent with this conclusion . similarly , for the s - cdg : dc pairing interaction , a 9 c decrease in tm was observed relative to the unmodified duplex . the thermal destabilization of this duplex is likely associated with the shift of the s - cdg deoxyribose to the o4-exo ( west ) pseudorotation , as opposed to the south pseudorotation ( c2-endo ) observed in b - dna or the north pseudorotation ( c3-endo ) in a - dna . moreover , the complementary t deoxyribose shifts to the c4-exo ( north ) pseudorotation , as evidenced by the jh1-h2 and jh1-h2 of 5.3 and 8.8 hz , respectively ( table s2 in the supporting information ) . the accommodation of the constrained s - cdg nucleotide necessitates helicoidal perturbation of the phosphodiester backbone torsion angles , , , and in the modified strand . additionally , smaller perturbations of the t phosphodiester backbone torsion angle in the complementary strand ( figure s4 in the supporting information ) may factor in the reduced stability of the s - cdgdt vs dgdt mispairing interaction . both s - cdg and da are inserted into the duplex , but they do not engage in hydrogen bonding . instead , helicoidal perturbations of the modified strand allow both to intercalate , creating a gap at the mismatched region . the absence of the g n1h a h2 noe agrees with the gap between a and g caused by the intercalation of s - cdg ( figure 6c , d ) . this is also consistent with the observation that a h2 exhibits noes with both h1 protons of the 3-flanking ta pair , but not with the h1 protons of the 5-flanking cg pair , suggesting a was close to ta but further from cg ( figure 9 ) . the observation of the a h2 a h2 noe suggests a remains intercalated . the 8 c decrease of the tm as compared to the duplex containing a dgda mispair is probably related to alterations of the s - cdg phosphodiester backbone torsion angles , , , and and to perturbations of the base pair shift parameters at the cg and xa base pairs , which are necessitated to accommodate the constrained s - cdg o4-exo ( west ) pseudorotation . non - natural , non - hydrogen - bonding base pair that demonstrates excellent polymerase activity , with slower rates of extension . the s - cdgda mismatch is distinct from the dgda mismatch as dgda mismatch pairs are influenced by sequence and ph . the failure to observe the imino resonances for base pairs cg , xa , and ta of the unmodified duplex is consistent with this notion and suggests an increased rate of exchange of these protons with solvent , perhaps accompanied by structural disorder . the dg(anti)da(syn ) pair has been identified in the crystalline state at ph > 7 , while the protonated dg(syn)da(anti ) pair has been identified at ph 6.6 . in solution , the dg(anti)a(anti ) pair is observed at neutral or basic ph conditions . another type of dg(anti)da(anti ) pairing is associated with tandem dg : da mismatches . these differences between the s - cdgda and dgda mismatches are attributed to the fact that the s - cdg lesion is locked into the anti conformation about the n - glycosidic bond and the shift of the deoxyribose to the o4-exo ( west ) pseudorotation . the da(anti)dg(anti ) face - to - face conformation would predict an noe between g n1h and a h2 , which is not observed ( figure 4c ) . the wobble s - cdgdt pair ( figure 6 ) is consistent with the site - specific mutagenesis studies in sos - induced e. coli , showing a preponderance of s - cdg da transition mutations . because low levels of s - cd g dt transversions are observed in e. coli , we surmise that low levels of datp are incorporated opposite s - cdg during trans - lesion synthesis . it has been suggested that klenow dna polymerases insert datp opposite s - cdg . further studies of templateprimers containing the s - cdg lesion complexed with error - prone polymerases will be of interest . the low levels of s - cdg dt transversions might reflect the distortion of the s - cdgda mismatch , in which both s - cdg and da are intercalated but do not hydrogen bond ( figure 6 ) . have reported that a non - natural , non - hydrogen - bonding base pair exhibiting a similar structure in duplex dna demonstrates excellent polymerase activity , with slower rates of extension . the structures of s - cdg placed opposite da or dt were determined and compared with the structure when s - cdg placed opposite dc . the s - cdgdt base pair adopted a hydrogen - bonded wobble conformation , while the s - cdgda base pair differed from dgda mispairs both s - cdg and da were intercalated , but no hydrogen bonding was observed . in each instance , the s - cdg deoxyribose adopted the o4-exo ( west ) pseudorotation and was accommodated by backbone and base - pairing helicoidal perturbations . collectively , these perturbations may be important in understanding the mutagenicity and genotoxicity of s - cdg .

diastereomeric 8,5-cyclopurine 2-deoxynucleosides , containing a covalent bond between the deoxyribose and the purine base , are induced in dna by ionizing radiation . they are suspected to play a role in the etiology of neurodegeneration in xeroderma pigmentosum patients . if not repaired , the s-8,5-cyclo-2-deoxyguanosine lesion ( s - cdg ) induces pol v - dependent mutations at a frequency of 34% in escherichia coli . most are s - cdg a transitions , suggesting mis - incorporation of dttp opposite the lesion during replication bypass , although low levels of s - cdg t transversions , arising from mis - incorporation of datp , are also observed . we report the structures of 5-d(gtgcxtgtttgt)-35-d(acaaacaygcac)-3 , where x denotes s - cdg and y denotes either da or dt , corresponding to the situation following mis - insertion of either dttp or datp opposite the s - cdg lesion . the s - cdgdt mismatch pair adopts a wobble base pairing . this provides a plausible rationale for the s - cdg a transitions . the s - cdgda mismatch pair differs in conformation from the dgda mismatch pair . for the s - cdgda mismatch pair , both s - cdg and da intercalate , but no hydrogen bonding is observed between s - cdg and da . this is consistent with the lower levels of s - cdg t transitions in e. coli .

Introduction Materials and Methods Results Discussion Conclusions

the collective arrangement of the teeth in function is quite important and has been subjected to a great deal of analysis and discussion over the years . as the mandible moves laterally , the lower posterior teeth leave their centric contact with the upper teeth and travel sideways down a path dictated by the condyles in the back and by the lateral anterior guidance in the front . in the diversified literature on occlusion and its role for functional patterns of the masticatory system , two concepts stand out : ( 1 ) canine protection as described by damico is said to favor a vertical chewing pattern and to prevent wear of teeth , as in lateral occlusion where the canine guides the mandibular movement directly through contact or indirectly through periodontal receptors . ( 2 ) group function as described by beyron following his observations on australian aborigines implies contact and stress on several teeth in lateral occlusion and indicates abrasion as a positive and inevitable adjustment . the reason for bringing any teeth into lateral function is to distribute stress and wear over more teeth . group function occlusion , which is also commonly known as unilateral balanced occlusion , is a widely accepted and used method of tooth arrangement in restorative dental procedures today . , the contacting inclines must be perfectly harmonized to border movements of the condyles and the anterior guidance . kleinberg has pointed out the importance of the feedback mechanism between mechanoreceptors in the temporomandibular joint and the functional mandibular movement pattern . in addition , a probable change in the input signals from the periodontal receptors after occlusal adjustment seems to affect the functional movement of the mandible . ingervall recorded tooth contact patterns in laterotrusion , protrusion of the mandible , and in the retruded position in young men with varying types of occlusion . contact on the nonfunctional side was found in half of the subjects in a 1.5-mm laterotrusive position and in one third of them in a 3-mm laterotrusive position . yaffe & ehrlich recorded the dynamic contact pattern of teeth in lateral glide movement in 72 individuals , 19 to 35 years of age , with normal tooth alignment and angle s class i molar and canine relationship . the lateral glide movement was divided into three stages to simulate the total range of events in lateral glide movement naturally demonstrated by the patient . this study has shown that lateral glide movement is a complex movement in which the nature of tooth contact is altering in location , direction , and number of teeth participating . consequently the restoration of an occlusion in accordance with a given concept does not always apply to all patients . the present study was designed to evaluate the incidence of occlusal patterns in a group of dental students . fifty subjects ( male : 27 , female : 23 ) aged 2029 years ( mean , 24.1 years ) were included in the study . they were selected from a group of 225 undergraduate students of the faculty of dentistry , tabriz university of medical sciences . the research and ethics committee approved the study protocol and informed consent was obtained from the subjects after they were provided an explanation of the general nature of the study . the criteria for selection were as follow : all subjects ( i ) were in their twenties ; ( ii ) had normal occlusal alignment , no temporomandibluar signs and symptoms with angle s class i relationship ; ( iii ) had full dentition except for third molars ; ( iv ) had no history of orthodontic therapy ; and ( v ) had no restorations involving a cusp . the occlusal contacts were recorded with occlusion foil ( 8 m thick , occlusions pruf - folie , ghm , germany ) in three lateral excursions , after laterally sliding the mandibular incisal point on both sides , 1 , 2 and 3 mm from the maximum intercuspation ( mi ) . when recording the occlusal contacts , each patient was instructed to close in the intercuspal position and to slide the mandible laterally to the right and left side performing the three lateral excursive movements designed as lateral 1 ( 1 mm from mi ) , lateral 2 ( 2 mm from mi ) , and lateral 3 ( 3 mm from mi ) on each side . each subject was required to sit upright in a dental chair with the frankfort plane almost horizontal . marks were made on the upper central incisors with a sharp black water - resistant pencil from the mandibular midline . three lines were marked on the maxillary incisor . in case of deviation of mandibular midline , a reference line was traced at the labial surface of the mandibular incisor in the intercuspal position to serve as a guide for the measurement . the blue occlusion foil was placed on the occlusal surface of the left - side most posterior mandibular molar , and the subject was requested to close his / her mandible to the mi . while a constant pulling force was maintained on the occlusion foil , red occlusion foil was put and the subject was requested to perform gliding movement to the right with the teeth in light contact . when the subject s mandible moved 1 mm right from the intercuspal position , the presence or absence of an occlusal contact was examined . only the red marks on teeth were considered to indicate occlusal contact . to prevent movement with mandibular opening or movement without occlusal contact and lateral - protrusive excursion , the movement was observed closely , and occasionally the subject was instructed to correct the movement . when the subject could not perform the movement voluntarily , he or she was asked to practice with the use of a hand mirror . the examination was continued from the left - side most posterior molar to the left - side central incisor sequentially . for examination of the molars , the occlusion foil was placed on both the mesial and distal sides of the occlusal surface . the same procedure was performed for the 1 , 2 and 3 mm right positions and also for the 1 , 2 and 3 mm left positions . in addition , the working - side occlusal contacts were recorded in the same manner . all recordings were performed by the same examiner and were repeated . in the case of differing results , all recordings were made between 10 oclock in the morning and 4 oclock in the afternoon to avoid possible diurnal variations . working - side occlusal contact patterns were determined for the total range of lateral positions and classified into three groups : canine protection , group function or others ( occlusal patterns other than those described ) . canine protection was defined as the contact of only working - side maxillary and mandibular canines in the total range of lateral positions from 1 to 3 mm . group function was defined as the contacts of two or more working - side teeth in at least one lateral position , and/or as single tooth contacts on the working - side in different lateral positions , e.g. the contact of only first molars in the 1 mm position followed by the contact of only canines in the 2 and 3 mm positions . the others type was identified when a contact pattern other than those described above was observed , e.g. contact of only first premolars throughout the lateral positions or contact patterns with no working - side contacts . figure 1 shows the number of working occlusal contacts recorded for each dental unit on right and left sides . the working - side occlusal contacts were mostly on the first premolar in r1 ( right 1 mm ) followed by canine ; but in l1 ( left 1 mm ) , the percentage of contacts on canine and first premolar were the same . the frequency of contact on premolars decreased gradually from the 1 to 3 on both sides . in all lateral positions , the frequency of contact decreased from the canine to the first molar as the tooth type became located posteriorly . however , the contact on the first molar almost was as prevalent as that on the second premolar . the frequency of the working - side canine contact increased from the 1 to the 3 mm position . figure 2 presents the number of non - working occlusal contacts recorded for each dental unit on right and left sides . the non - working - side contacts primarily involved the first and second molars , most frequently the second molar . the prevalence of non - working - side contacts decreased as the mandible moved from the 1 to 3 mm position on the premolars and molars . table 1 shows the percentage of occlusal patterns in mandibular lateral movement on the right and left sides . most of working - side contact patterns were classified as group function ( 60% ) ; canine protection was rare ( 17.3% ) , and contact patterns other than canine protection and group function were found in 23.7% of the contact patterns on the right side . on the left side , group function was found in 51.3% , canine protection in 20.7% and others in 28% of the contact patterns . most of the subjects ( 66% ) had the same pattern on both sides : 42% group function , 8% canine protection , and 16% others . this study demonstrated that the occlusal contact pattern during lateral movement differs between 1 mm , 2 mm and 3 mm . in the position close to the maximum intercuspation the occlusal contact pattern varying with lateral positions should be a critical factor on diagnosis and treatment of occlusal disharmonies . the marked difference in the pattern of occlusal contacts between the 1 , 2 and 3 mm positions , suggests that the contact pattern in the 1 mm position reflects a pattern of occlusal contact distinct from that commonly observed during lateral excursion . in a study analyzing two working - side inter - occlusal contacts , a large number of subjects presented unclassified patterns of articulations . more individuals had canine guidance on the left side , whereas the most frequent pattern on the right side was group function . another study on occlusal contact areas using a 3-d digitization measurement system found that , at intercuspal position , estimated occlusal contact areas were 12.6 mm . however , after 3.0 mm of lateral excursion , their areas were sharply reduced to 2.2 mm . ogawa et al10 - 12 found most contact patterns belonged to group function and a few to canine protection . they also found the presence of occlusal contacts in different lateral positions may have different effects on biomechanics of the related teeth . for instance , the force on individual teeth may be more traumatic in the more lateral positions because of the increased vector of the force . occlusal force is transmitted to the teeth during four functional and parafunctional stages : mastication , swallowing , clenching and grinding . the occlusal contact during mastication and swallowing is suggested to occur mainly in lateral positions close to the mi , i.e. within 1 mm of the mi.10 - 1 in addition , forces during these two functional movements are relatively low and their durations are short . taking into consideration these various factors , the biomechanical significance of non - working - side occlusal contact may increase over the non - functional range of lateral movement corresponding to the 3 mm position . in the present study , incidence of non - working - side occlusal contact decreased from 1 to 3 mm ; so it does not seem appropriate to deduce that contact in this position produces harmful force to the teeth or periodontal structures . however , this does not exclude the possibility that the non - working - side contacts in the position close to the mi may be important in masticatory function . contact patterns other than canine protection and group function were found in 23% of the contact patterns on the right side . on the left side , group function was seen in 51% , canine protection in 21% and others patterns in 28% of the studied subjects . on laterotrusion , most subjects had group function on the working side but canine protection was rare .

background and aims this study observed occlusal contacts and their area on the teeth during lateral mandibular movements . the percentage of each occlusal pattern was determined . materials and methods fifty subjects ( male : 27 , female : 23 ) , aged 20 - 29 years , were included in the study . the criteria for selection were as follow : all subjects ( i ) were in their twenties ; ( ii ) had normal occlusal alignment , no temporomandibular signs and symptoms with angle s class i relationship ; ( iii ) had full dentition except for third molars ; ( iv ) had no history of orthodontic therapy ; and ( v ) had no restorations involving a cusp . the occlusal contacts were recorded with occlusion foil in three lateral excursions : 1 , 2 and 3 mm from the maximum intercuspation . data were analyzed with chi - square test . results most of working - side contact patterns were classified as group function ( 60% ) . canine protection was rare ( 17% ) . contact patterns other than canine protection and group function were found in 23% of the contact patterns on the right side . on the left side , group function was seen in 51% , canine protection in 21% and others patterns in 28% of the studied subjects . conclusion on laterotrusion , most subjects had group function on the working side but canine protection was rare .

Introduction Materials and Methods Results Discussion Conclusion

zinc deficiency is an important cause of morbidity due to infectious diseases and growth - faltering among young children . increased demand of zinc due to rapid growth and decreased intake of zinc due to inadequate feeding practices predispose preschool children , especially living in communities of low socioeconomic level at an elevated risk of zinc deficiency ( 1 ) . compelling evidence from intervention trials suggests that supplementation of zinc could reduce the risk of pneumonia and the risk and duration of diarrhoea , dysentery , and malaria among preschool children ( 25 ) . however , little information is available on the global prevalence of zinc deficiency . on the other hand , the population / national - level zinc - supplementation programmes have achieved limited success in alleviating zinc deficiency worldwide ( 6 ) . lack of reliable methods to determine the levels of plasma zinc , paucity of knowledge of the socioeconomic , dietary and demographic factors influencing the distribution of zinc deficiency , and inadequate documentation of rates and causes of zinc deficiency among vulnerable preschool children and its impact on childhood morbidities among different populations are some most important limiting factors ( 78 ) . traditionally , zinc deficiency at the population level has been estimated by the surrogate markers , such as total daily per - capita amount of zinc in the food - supply , compared to the likely zinc requirements , or by the rates of stunting among preschool children ( 9 ) . using the food balance - sheets , wuehler et al . estimated that about 71.2% of the total population in southeast asia was at risk of developing zinc deficiency ( 10 ) . the prevalence of zinc deficiency among a population can be assessed by a combination of techniques , such as the prevalence of clinical outcomes of zinc deficiency ( diarrhoea , pneumonia , stunting ) , assessment of intake of dietary zinc , biochemical measures of zinc concentration , or assessment of functional outcomes of zinc supplementation ( 11 ) . a community - based study conducted in the north - west frontier province in pakistan reported that one in two preschool children suffers from zinc deficiency ( 12 ) . zinc deficiency has been suspected to be prevalent among preschoolers in india due to high consumption of cereal - based weaning diets and high rates of recurrent infections . there is also limited systematically - collected information on the quantitative estimates of zinc deficiency , especially those living in communities of low socioeconomic level ( 13 ) . determining the magnitude of zinc deficiency and its association with risk of morbidities among preschool children in india can contribute to planning strategies to alleviate zinc deficiency and the related adverse health consequences . in this study , we present the descriptive epidemiology of zinc deficiency and the associated risk of morbidity due to infectious diseases among preschool children in an urban slum in northern india . the main study was a double - masked , randomized controlled zinc - supplementation trial carried out in an urban slum in new delhi , and the details of the study population , design , methods , eligibility , recruitment , and randomization have earlier been reported ( 1415 ) . briefly , 940 children aged 635 months and presenting to the community - based clinic with history of acute diarrhoea ( defined as having passed at least four unformed stools in the past 24 hours and having diarrhoea for less than seven days ) were enrolled and randomly allocated to either zinc group ( n=468 ) or control group ( n=472 ) . a randomization schedule with permuted blocks of fixed length ( 10 per block ) was employed for randomization . at the first home - visit , after recovery from diarrhoeal episode at enrollment ( passage of three or fewer stools for three consecutive days ) , 609 of these children were followed up for six months ( long follow - up ) , and for the rest , the follow - up was terminated after recovery from diarrhoeal episode ( n=331 ) . home - visits daily for supplementation and every fifth day for the assessment of morbidity were made to evaluate preventive effects of zinc on diarrhoea , dysentery , and respiratory disease - related morbidity . the prevalence and descriptive epidemiology of zinc deficiency were based on the baseline evaluation of the enrolled children ( n=940 ) . of the 609 children in the long follow - up , 116 allocated to the control group belonging to the upper and the lower 25 quartile of baseline plasma zinc status were selected for evaluating the association of zinc deficiency with prospective morbidity . the prospective morbidity was assessed for a follow - up period of 120 days . for comparison of the prevalence of zinc deficiency among children with acute diarrhoea and those without diarrhoea , 193 children from the control group who did not have diarrhoea in the three days before the collection of blood samples after 120 days of supplementation ( fig . schematic representation of study design at enrollment , a health worker collected socioeconomic and demographic data , information on the breastfeeding status , intake of non - breastmilk , frequency of consumption of zinc - rich foods ( such as green - leafy vegetables , pulses , rice , wheat bread , fruits , meat , fish , eggs , chicken , butter , etc . ) in the two weeks before enrollment and recorded anthropometric measurements . a research physician gathered a detailed morbidity history ( information regarding the episodes and duration of diarrhoea , vomiting in the last 24 hours , pneumonia , and acute respiratory tract infections [ alris ] in the last two months ) , and nutritional profile and conducted a thorough physical examination . blood sampling was done to assess the levels of plasma zinc at the baseline ( n=940 ) and after 120 days of follow - up ( n=472 ) . for the estimation of plasma zinc , venous blood sample was collected in a monovette trace element - free heparinized syringe ; the plasma was separated within 15 minutes of collection of the samples and was transferred into trace element - free eppendorf plastic tubes to be stored at 20 c . c - reactive protein was also estimated on a cobas fara analyzer ( roche products , welwyn , united kingdom ) . children were prospectively followed up by home - visits every fifth day by the health worker . using the standard definitions of the world health organization , information was gathered on days of illness , days and episodes of diarrhoea , days of dysentery , days with alri , and episodes of pneumonia . in the case of any morbidity , the children were referred to the project physician for management . for evaluating the prevalence of zinc deficiency among the study population , two cut - offs were used : plasma zinc < 60 g / dl and plasma zinc < 70 g / dl . to understand the descriptive epidemiology of zinc deficiency , we categorized the entire cohort of 940 children by baseline plasma zinc values into lower quartile ( baseline plasma zinc values below 25 percentile , i.e. plasma zinc 56.0 g / dl ) , middle quartile ( baseline plasma zinc values 25 percentile , and 75 percentile , i.e. plasma zinc > 56.0 to 70.0 g / dl ) , and upper quartile ( baseline plasma zinc values > 75 percentile , i.e. plasma zinc > 70.0 g / dl ) and compared the baseline socioeconomic , demographic and dietary factors affecting the levels of plasma zinc among the quartiles . to evaluate the impact of baseline plasma zinc on prospective morbidities , the risk of morbidities was compared among the lower and upper quartile groups after adjusting for covariates , such as socioeconomic score , education of mothers / fathers , water supply , age and gender of the child . person - time analysis was performed with actual follow - up as denominator . for the effect on the incidence of diarrhoea / dysentery , respiratory and other childhood illnesses all statistical analyses were carried out using the spss software ( version 12.0 ) ( spss inc . , chicago , illinois , usa ) and the stata software ( version 9.2 ) ( stata corp . the main study was a double - masked , randomized controlled zinc - supplementation trial carried out in an urban slum in new delhi , and the details of the study population , design , methods , eligibility , recruitment , and randomization have earlier been reported ( 1415 ) . briefly , 940 children aged 635 months and presenting to the community - based clinic with history of acute diarrhoea ( defined as having passed at least four unformed stools in the past 24 hours and having diarrhoea for less than seven days ) were enrolled and randomly allocated to either zinc group ( n=468 ) or control group ( n=472 ) . a randomization schedule with permuted blocks of fixed length ( 10 per block ) was employed for randomization . at the first home - visit , after recovery from diarrhoeal episode at enrollment ( passage of three or fewer stools for three consecutive days ) , 609 of these children were followed up for six months ( long follow - up ) , and for the rest , the follow - up was terminated after recovery from diarrhoeal episode ( n=331 ) . home - visits daily for supplementation and every fifth day for the assessment of morbidity were made to evaluate preventive effects of zinc on diarrhoea , dysentery , and respiratory disease - related morbidity . the prevalence and descriptive epidemiology of zinc deficiency were based on the baseline evaluation of the enrolled children ( n=940 ) . of the 609 children in the long follow - up , 116 allocated to the control group belonging to the upper and the lower 25 quartile of baseline plasma zinc status were selected for evaluating the association of zinc deficiency with prospective morbidity . the prospective morbidity was assessed for a follow - up period of 120 days . for comparison of the prevalence of zinc deficiency among children with acute diarrhoea and those without diarrhoea , 193 children from the control group who did not have diarrhoea in the three days before the collection of blood samples after 120 days of supplementation ( fig . at enrollment , a health worker collected socioeconomic and demographic data , information on the breastfeeding status , intake of non - breastmilk , frequency of consumption of zinc - rich foods ( such as green - leafy vegetables , pulses , rice , wheat bread , fruits , meat , fish , eggs , chicken , butter , etc . ) in the two weeks before enrollment and recorded anthropometric measurements . a research physician gathered a detailed morbidity history ( information regarding the episodes and duration of diarrhoea , vomiting in the last 24 hours , pneumonia , and acute respiratory tract infections [ alris ] in the last two months ) , and nutritional profile and conducted a thorough physical examination . blood sampling was done to assess the levels of plasma zinc at the baseline ( n=940 ) and after 120 days of follow - up ( n=472 ) . for the estimation of plasma zinc , venous blood sample was collected in a monovette trace element - free heparinized syringe ; the plasma was separated within 15 minutes of collection of the samples and was transferred into trace element - free eppendorf plastic tubes to be stored at 20 c . c - reactive protein was also estimated on a cobas fara analyzer ( roche products , welwyn , united kingdom ) . children were prospectively followed up by home - visits every fifth day by the health worker . using the standard definitions of the world health organization , information was gathered on days of illness , days and episodes of diarrhoea , days of dysentery , days with alri , and episodes of pneumonia . in the case of any morbidity for evaluating the prevalence of zinc deficiency among the study population , two cut - offs were used : plasma zinc < 60 g / dl and plasma zinc < 70 g / dl . to understand the descriptive epidemiology of zinc deficiency , we categorized the entire cohort of 940 children by baseline plasma zinc values into lower quartile ( baseline plasma zinc values below 25 percentile , i.e. plasma zinc 56.0 g / dl ) , middle quartile ( baseline plasma zinc values 25 percentile , and 75 percentile , i.e. plasma zinc > 56.0 to 70.0 g / dl ) , and upper quartile ( baseline plasma zinc values > 75 percentile , i.e. plasma zinc > 70.0 g / dl ) and compared the baseline socioeconomic , demographic and dietary factors affecting the levels of plasma zinc among the quartiles . to evaluate the impact of baseline plasma zinc on prospective morbidities , the risk of morbidities was compared among the lower and upper quartile groups after adjusting for covariates , such as socioeconomic score , education of mothers / fathers , water supply , age and gender of the child . person - time analysis was performed with actual follow - up as denominator . for the effect on the incidence of diarrhoea / dysentery , respiratory and other childhood illnesses all statistical analyses were carried out using the spss software ( version 12.0 ) ( spss inc . , chicago , illinois , usa ) and the stata software ( version 9.2 ) ( stata corp . zinc deficiency as assessed by estimation of plasma zinc showed that 73.3% of the children were zinc - deficient ( plasma zinc < 70 g / dl ) , of whom 33.8% had levels of plasma zinc below 60 g / dl . younger children were at a lower risk of zinc deficiency than were older children ; however , the prevalence was similar among male and female children ( table 1 ) . prevalence of zinc deficiency among preschool children the descriptive epidemiology of zinc deficiency is presented in table 2 . the children in the cohort were categorized into three quartiles based on levels of baseline plasma zinc . the nutritional status , breastfeeding status , recent intake of dietary zinc - rich food(s ) , including the consumption of non - breastmilk , and socioeconomic level among children were similar across the quartiles . the prevalence of zinc deficiency among children having acute diarrhoea at baseline was similar to those without diarrhoea at the end of the study ( fig . 2 ) . association of baseline zinc levels with child characteristics * lower 25 percentile plasma zinc 56.0 g / dl ; middle 50 percentile ( 25 percentile and 75 percentile ) plasma zinc > 56.0 g / dl and plasma zinc 70.0 g / dl ; n=110 , 199 , and 81 in age 12 year(s ) ; n=47 , 91 , and 29 in age > 2 years ; figures in parentheses indicate percentages ; alri = acute lower respiratory infection ; ses = socioeconomic status comparison of prevalence of zinc deficiency among children with acute diarrhoea and those without diarrhoea after 120 days of follow - up , children in the lower quartile ( based on levels of plasma zinc ) suffered a significant relative increase in the risk of days of illness by 15% ( 95% confidence interval [ ci ] 822 ) , days of diarrhoea by 22% ( 95% ci 937 ) , days with dysentery by 44% ( 95% ci 12135 ) , days with alri by 49% ( 95% ci 1692 ) , and pneumonia episodes by 5% ( 95% ci 4391 ) compared to children in the upper quartile . risk ratios did not change after adjusting for literacy of mothers , literacy of fathers , score of socioeconomic status , source of water supply , age , and gender ( table 3 ) . association of baseline zinc levels with prospective morbidity in 120-day follow - up comparison of lower 25 quartile vs upper 25 quartile * lower 25th percentile plasma zinc 56.0 g / dl ; * * upper 25th percentile plasma zinc > 70.0 g / dl ; adjusted for literacy of father , literacy of mother , socioeconomic status , water supply , age , and gender ; alri = acute lower respiratory tract infection ; ci = confidence interval ; rr = relative risk our study documents the epidemiology and magnitude of zinc deficiency among preschool children at the community level in an urban slum in india . it also describes the association between the levels of plasma zinc and the risk of morbidities due to infectious diseases . recent studies , using data on food - availability , estimated that zinc deficiency affects about one - third of the world 's population , with estimates ranging from 4% to 73% across subregions . although severe zinc deficiency is rare , mild - to - moderate zinc deficiency is quite common throughout the world ( 17 ) . the prevalence of zinc deficiency found in our study concurs with the results of the community - based study carried out in pakistan ( 12 ) and reflects the distressing magnitude and distribution of zinc deficiency . the high prevalence of zinc deficiency observed in the present study could be explained by the low bioavailability of zinc from cereal - based diets and increased rate of subclinical infection ( 18 ) . there is a lack of agreement on the normal variation in plasma zinc values according to age . found no age - dependent variation in total serum zinc among healthy dutch infants and children ( 19 ) . likewise , karr et al . used atomic absorption spectrophotometer to estimate the plasma zinc values in healthy preschool australian children and found no significant age - dependent variation ( 20 ) . however , the results of our study showed a higher proportion of children in the upper quartile ( based on levels of plasma zinc ) among the 611 months age - group compared to children in the higher age - groups . this could be due to appropriate breastfeeding practices among younger age - group which might lead to better zinc status . recent studies have shown that zinc status is influenced by consumption of test - meal among healthy adult volunteers ( 19 ) . on the other hand , bitarak wate et al . found no significant association between the nutritional status and the levels of serum zinc ( 21 ) . likewise , in our study , we observed that neither the breastfeeding status nor the consumption of zinc - rich foods , or consumption of non - breastmilk during the two weeks preceding enrollment had any significant impact on the levels of plasma zinc . although the effects of poor intake and increased micronutrient demands are well - described , the potential effects of acute infections on the body 's micronutrient status are less well - understood . there is little information on the short - term compartment changes of several micronutrients , including zinc following an infection ( 22 ) . a recent study by strand et al . reported a decline in concentrations of plasma zinc during episodes of acute diarrhoea ( 23 ) . previously , chaudhary et al . reported a significant fall in plasma zinc after acute and persistent diarrhoea in indian children ( 24 ) . similarly , bitarakwate et al . found that concentration of zinc in serum of children with persistent diarrhoea was significantly lower than that of children without diarrhoea ( 21 ) . however , our results showed that the prevalence of zinc deficiency ( plasma zinc < 70.0 g / dl ) at baseline when all the children had acute diarrhoea was comparable with the prevalence in the second sample among the children who did not have diarrhoea three days before the last blood - sampling . this could be due to the homeostatic control mechanism in the body that shifts zinc stores in the body during diarrhoea to balance the loss through excretion . there is evidence to show preventive and therapeutic effects of zinc supplementation on various childhood morbidities ( 18,2530 ) . our morbidi - ty - related results showed that children with zinc deficiency were at a higher risk of morbidities compared to zinc - sufficient children . these results substantiate the findings of a limited number of previously - published studies conducted in similar population settings relating the zinc levels to prospective morbidities ( 3132 ) . although our study children had acute diarrhoea at baseline , the findings are comparable as we have shown that the prevalence of zinc deficiency during diarrhoea was similar to diarrhoea - free days . the limitations of the study include that zinc deficiency was assessed using plasma zinc only and the intake of dietary zinc was not assessed . in conclusion , this study provides systematic information regarding the factors influencing the zinc levels among preschool children in low socioeconomic settings and substantiates the relationship between zinc levels and prospective morbidities . the authors acknowledge the contributions of parents of the study children , study team , including health workers , supervisors , physicians , technicians , data management , and other support staff . the authors also acknowledge contributions of the world health organization and the thrasher research fund for funding the study .

community - based data relating to factors influencing zinc deficiency among preschool children in india are inadequate . data of a large , double - blinded , randomized , controlled zinc - supplementation trial were used for assessing the descriptive epidemiology of zinc deficiency among children aged 635 months ( n=940 ) . in total , 609 children were followed up for 120 days for information on morbidity . of these children , 116 from the control group belonging to the upper and the lower 25th quartile of plasma zinc status at baseline were selected for assessing the association of zinc deficiency with prospective morbidity . at baseline , demographic , socioeconomic and dietary information was collected , and anthropometric measurements and levels of plasma zinc were assessed . at baseline , 73.3% of the children were zinc - deficient ( plasma zinc < 70 g / dl ) , of which 33.8% had levels of plasma zinc below 60 g / dl . a significantly higher risk of morbidity was prevalent among the subjects with lower plasma zinc compared to those with higher levels of plasma zinc .

INTRODUCTION MATERIALS AND METHODS Study subjects and sample Baseline information and follow-up Statistical analysis RESULTS DISCUSSION AKNOWLEDGEMENTS

intradural disc herniation ( idh ) is a rare disease and its incidence is reported as 0.26 - 0.30% of all disc herniations16 ) . idhs primarily occur as a result of chronic degenerative diseases and rarely occur due to traumatic events1,14 ) . traumatic lumbar spine lesions usually result in bony fractures and paraspinal soft tissue injuries rather than isolated disc herniations . in this report , we present a rare case of a patient who exhibited an intradural mass lesion at l1 , which initially mimicked a spinal subdural hematoma ( sdh ) and was later determined to be an idh without an accompanying lumbar spine bony fracture after a traumatic event . a 52-year - old man presented at the hospital with numbness in his left calf and ankle after falling accident two days ago . the patient was initially admitted at another medical center after the accident but transferred to our hospital at his request . a motor power grade was intact with slightly decreased sensation along the left l5 dermatome . bladder and bowel functions were intact , and no other significant abnormalities were found upon neurological examination . in his medical history , he had visited our hospital six weeks ago with complaints of radiating pain in his right leg along the l5 dermatome after falling down from 2 m height . at that time , his lumbar spine magnetic resonance image ( mri ) scan exhibited diffuse bulging intervertebral disc in l4 - 5 ( fig . 1 ) . the patient had received a conservative treatment with a non - steroidal anti - inflammatory drug and discharged with the improvement of symptoms . at this time , the patient 's plain radiography did not present bony abnormalities such as fractures or dislocations . in his lumbar computed tomography ( ct ) scan , a small calcified lesion was found at the l1 - 2 level , posterior to the disc ( fig . 2 ) . on his lumbar t2-weighted mri , a high signal intensity with an amorphous shape lesion was located intradurally and it compressed the spinal cord anteriorly at the l1 level ( fig . 3c ) and it presented heterogeneous low signal intensity in the gradient echo ( gre ) image ( fig . we considered the lesion to be a spinal sdh , and decided to perform a conservative treatment . at the follow up mri scan after two weeks of treatment , the lesion still remained unchanged without any improvement of numbness , so we decided to operate . a subtotal laminectomy was performed at l1 , which revealed an out - punching whitish soft particle on the dorsal dura . the particle was thought to be a ruptured disc material and removed gently , then sent for pathology . the pathologic results determined the particle to be degenerating fibrocartilagenous tissue corresponding to an intervertebral disc . after removing the extradural lesion , a midline durotomy was done from the dura defect uncovering large , cartilaginous disc particles in the middle of the intradural space ( fig . , a hard bony lesion remained adhesively to the ventral dura and a small ventral dura defect was identified around the bony lesion ( fig . the hard bony lesion was thought to be a calcified lesion at the posterior l1/2 intervertebral disc in his lumbar spinal ct scan . we tried to repair the dura defect to protect a leakage of cerebrospinal fluid ( csf ) , but the ventral dura tear could not be repaired due to its severe adhesion . a watertight closure on dorsal dura after the operation , the patient 's numbness in his left leg has gradually improved . two weeks after surgery , the patient was discharged from the hospital with free of symptoms . idhs are rare clinical diagnoses that typically occur in patients aged in their fifties11 ) . dandy4 ) first reported an intradural lumbar disc herniation in 1942 and the incidence of idhs is reported between 0.04 and 0.33% of all reported lumbar disc herniations9 ) . the most common site of intradural lumbar disc herniations is the l4 - 5 ( 55% ) area , followed by l3 - 4 ( 16% ) , and l5-s1 ( 10% ) , far fewer occur at l1 - 2 and l2 - 311,13,15 ) . furthermore , traumatic idhs are rarer events and the incidence rate has not yet been reported in the literature . most traumatic disc herniations in the lumbar spine frequently have severe bony injuries such as fractures and dislocations8 ) . in our case , however , we found an idh after a traumatic event without fractures or dislocations . although the mechanisms that cause disc herniations to pass the dura mater are unclear , the widely accepted hypothesis states that adhesion between the ventral dura and posterior - longitudinal ligament ( pll ) leads to the successive perforation of these firmly adhesive tissues , including the annulus fibrosus , due to the increased intradiscal pressure1,4,9,10 ) . dandy4 ) explained that sudden pressure on the protruded disc might erode and then penetrate the overlying ventral dura . other reports have suggested that dense adhesion , whether it is congenital or acquired , fixate the dural sac1,14 ) . diagnosing an idh is difficult due to its rarity . diagnosis using radiological images is a difficult task , because lumbar idhs can have various radiological and clinical features3,17 ) . furthermore , lesions may be ignored in simple radiography and ct scans , which are one of the most frequently used radiologic examinations in the diagnosis of spinal injuries . hidalgo - ovejero et al.6 ) reported that the presence of epidural gas in a ct scan could be a clue of the presence of an idh . in our case , however , we could not find epidural gas on the ct scan . since wasserstrom et al.18 ) made the first idh diagnosis using a gadolinium - enhanced mri in 1993 , the rim enhancement of herniated discs has been accepted as a typical mri finding in idhs . furthermore , choi et al.2 ) presented the loss of pll continuity and a sharp beak - like feature on a t2-weighted image as indicators of idh . in our case , we also observed a peripheral rim enhancement pattern on the gadolinium - enhance t1 mri , but it was not enough to consider the idhs due to the small size of portion ( fig . moreover , the loss of pll continuity was not definite on our initial lumbar spine mri . therefore , our initial impression of the intradural mass at l1 was a spinal sdh , although a traumatic spinal sdh is also very rare12 ) . on mri , the spinal sdh yielded high signals on both t1 and t2 , but the signal intensity of the spinal sdh on the mri also depend on the duration7 ) . in our case , 3a , b ) and an isosignal on the t1 scan . on the gre scan , however , the intradural lesion had a high signal - intensity with a low signal void inside the intradural lesion ( fig . an intradural abscess could be considered as another differential diagnosis , but we excluded it because there were no signs of infection such as fever or leukocytosis . additionally , the patient had visited our hospital six weeks previously for radiating pain in his right lower leg . at that time , the patient checked a lumbar mri scan , and was diagnosed with a diffuse bulging disc in l4 - 5 and there was no intradural mass lesion . compared with the mri from that visit , de - novo intradural lesion was detected . moreover , the height and the signal intensity of the intervertebral disc of l1 - 2 had decreased in the recent study ( figs . we assumed that a strong vertical pressure had been applied to cause the intervertebral disc rupture , then the ruptured particles penetrated the pll , ventral dura , and through dorsal dura to the epidural space . according to the clues mentioned above , we could assume that the idh developed from a trauma rather than a degenerative condition . we experienced a rare case of a lumbar idh after trauma without an accompanying bony fracture or dislocation . for patients with an intradural lesion at the lumbar spine after trauma as with the patient in this report , idhs should be considered as differential diagnoses and prompt removal of the intradural mass is necessary .

intradural lumbar disc herniation is a rare disease . according to the reports of intradural lumbar disc herniations , most cases have developed as a chronic degenerative disc diseases . traumatic intradural lumbar disc herniations are even rarer . a 52-year - old man visited our emergency center with numbness in his left calf and ankle after falling accident . initial impression by radiologic findings was a spinal subdural hematoma at the l1 level . a follow up image two weeks later , however , did not demonstrate any interval change . the patient was decided to have an operation . in operative findings , a ruptured disc particle penetrating the ventral and dorsal dura was indentified after laminectomy . it was assumed to be a traumatic outcome not a degenerative change .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

initially , they were considered as metastasis from an occult primary tumor in gonads , but now it is known that they arise either as a consequence of abnormal migration of germ cells during embryogenesis or from a different histogenetic origin . choriocarcinoma of liver without a detectable primary tumor in gonads , retroperitoneum or mediastinum is termed as primary hepatic choriocarcinoma . due to varied clinical presentations and extreme rarity of the tumor , diagnosis on small needle biopsy is difficult . we present a case of adult male diagnosed to have primary hepatic choriocarcinoma on histopathology and immunohistochemical studies . a 40-year - old male was referred to us with history of sudden onset pain in abdomen . he was admitted in private hospital where computed tomography ( ct ) scan of abdomen was done which was suggestive of ruptured haemangioma in left lobe of liver ( figure 1 ) . patient was resuscitated and given adequate blood transfusions and was referred to our centre . on admission abdominal exploration revealed about 1.5 to 2 l of haemoperitoneum and multiple nodular lesions in both lobes of liver with large ruptured lesions in left lobe of liver with active bleeding . after achieving adequate inflow and outflow control , left lateral segmentectomy was done in view of active bleeding ( figure 2 ) . histopathology showed atypical trophoblastic cells predominantly cytotrophoblast and few syncitiotrophoblast lying in sheets as well as in clusters with large number of mitotic figures along with the normal hepatocytes suggestive of high grade malignant tumor ( figure 3 ) . immunohistochemistry was positive for beta human chorionic gonadotrophin ( figure 4 ) and negative for ck , ema , cd-30 , afp , cd-31 and cd-34 suggestive of choriocarcinoma . his serum hcg levels were significantly raised however serum levels of afp , cea and ca 19 - 9 were normal . patient died on postoperative day 10 due to sudden cardiopulmonary arrest . on autopsy , multiple nodular lesions were present on the remaining liver . bilateral testes were grossly normal which on subsequent serial sectioning and histological examination did not show any evidence of pathologic features associated with germ cell tumor regression or a scar . based on histopathological report and autopsy findings figure 1computed tomography scan of abdomen showing ruptured haemangioma in left lobe of liver with haemoperitoneum . computed tomography scan of abdomen showing ruptured haemangioma in left lobe of liver with haemoperitoneum . figure 3atypical trophoblastic cells predominantly cytotrophoblast and few syncitiotrophoblast lying in sheets as well as in clusters along with the normal hepatocytes . atypical trophoblastic cells predominantly cytotrophoblast and few syncitiotrophoblast lying in sheets as well as in clusters along with the normal hepatocytes . majority of them are infantile type , may represent metastasis from an occult placental choriocarcinoma . primary hepatic choriocarcinoma in adults are known to arise from abnormal migration of germ cells during embryogenesis or different histogenetic origin . clinically , patient may present with right upper abdominal pain and/or abdominal lump or distension . those with advanced disease may present with symptoms due to metastasis to various organs like brain and lungs . infertility , gynaecomastia and features of thyrotoxicosis may present in some patients , attributed to over production of hcg by tumour cells . very rarely , it may rupture spontaneously producing haemoperitoneum and may present as an acute abdomen , as in our case . major issue in diagnosing primary hepatic choriocarcinoma is to exclude metastasis from an occult primary in gonads by serial sectioning and histological examination , as these tumors may be small or undergo spontaneous regression at the time of metastasis . diagnosis on small needle biopsy is difficult due to rarity of the tumor in liver . immunoshistochemical staining for beta hcg , plap , hpl , hepar-1 , may aid the diagnosis and helps to differentiate from the other tumours which mimic choriocarcinoma like giant cell variant of poorly differentiated hepatocellular carcinoma , or tumor with trophoblast like giant cells . finally imaging modalities like ultrasonography and ct scan may be useful to assess the extent of primary tumour and metastasis to various organs . treatment consists of complete surgical resection of tumor if localized to liver and without ascites followed by chemotherapy . for advanced or metastatic disease chemotherapy is given . are etoposide , methotrexate , actinomycin - d , cyclophosphamide . prognosis of primary hepatic choriocarcinoma is distinctly poor as compared to its testicular counterpart owing to lack of restrictive effect of tunica albugenia as in the testes ; hence they attain a large size and often invade adjacent vital structures by the time diagnosis is made . average survival being 2 to 8 months as reported in literature , hence further studies are needed for early diagnosis and better treatment to improve survival .

choricarcinoma is a beta human chorionic gonadotrophin secreting neoplasm pertinent to uterus and pregnancy mostly . it occurs primarily in gonads but rarely in extragonadal sites . primary hepatic choriocarcinoma is an extremely rare tumor . most of the reported cases are seen in infants representing metastasis from an occult placental choriocarcinoma . till date , only 7 cases of primary hepatic choriocarcinoma in adults have been reported in literature . we present a case of a 40-yearold male presenting as haemoperitoneum due to ruptured hepatic tumor . he underwent emergency left lateral segmentectomy . he died on 10th postoperative day . the surgical specimen and autopsy findings confirmed it to be primary hepatic choriocarcinoma . this is the first case report from indian subcontinent . a brief case report and review of literature is presented .

Introduction Case Report Discussion

human ifn-2 ( il-28a ) is a relatively new cytokine , in which the genomic structure resembles that of the il-10 family , but the protein structure is more closely related to type i ifn than to interleukin- ( il- ) 10 [ 1 , 2 ] . for example , it can induce antiviral activity in cell lines , though the potency is weaker than other ifns , and has the potential antitumor effect against human lung cancer cells . it has also been discovered that ifn-2 is capable of exacerbating t - cell - mediated autoimmune diseases such as uveitis . treatment with ifn-2 completely halts and reverses the development of collagen - induced arthritis , dramatically reduces the numbers of proinflammatory il-17-producing th17 and t cells in the joints and inguinal lymph nodes , and restricts recruitment of il-1b - expressing neutrophils . however , ifn-2 seems not effective in inducing tr1 cells and can not induce proliferation of regulatory t cells from cord blood cd4(+ ) t cells . recently , it was found that the expression level of ifn-2 mrna was significantly increased during naturally occurring respiratory viral infections in children with asthma and that ifn-2 modulates lung dendritic cells ( dc ) function to promote th1 immune skewing and suppresses allergic airway disease . these suggest that ifn-2 is not only involved in autoimmune diseases but also associated with allergic airway disorders . we therefore investigated the potential involvement of ifn-2 in allergic airway diseases in the present study . to our surprise , information on the ifn-2 expressing cells is very limited . it was found that ifn-2 expressed in tracheobronchial tissue cells from the patients with copd . dc express moderate quantity of ifn-2 when using lipopolysaccharide ( lps ) as the maturation stimulus , and vitiligo patient skin and/or peripheral blood mononuclear cells express ifn-2 mrna . in order to understand the role of ifn-2 , we examined the cell origins of ifn-2 in the present study . the aim of the study is to investigate the expression of ifn-2 in peripheral blood of allergic airway disorders , its correlation with cytokines and tryptase , and its potential cell location . we found that the levels of ifn-2 were elevated in the plasma of ar and ar + as and that several cell types express ifn-2 . trypsin , leupeptin , collagenase ( type i ) , hyaluronidase ( type i ) , rabbit anti - human ifn-2 antibody , and bovine serum albumin ( bsa , fraction v ) were purchased from sigma aldrich ( st . louis , mo , usa ) . the sequences of the active and reverse peptides were par-2 , trans - cinnamoyl - leu - ile - gly - arg - leu - orn - amide ( tc - ligrlo - nh2 ) and trans - cinnamoyl - orn - leu - arg - gly - ile - leu - amide ( tc - olrgil - nh2 ) , sligkv - nh2 , and vkgils - nh2 ; par-2 antagonist peptide phe - ser - leu - leu - arg - asn - nh2 ( fsllrn - nh2 ) was synthesized in cl bio - scientific inc . dulbecco 's modified eagle 's medium ( dmem ) and fetal calf serum ( fcs ) were obtained from hyclone ( logan , ut , usa ) . human ifn-2 , il-4 , il-10 , and il-12 elisa kits were purchased from r&d systems ( minneapolis , mn ) . foxp3 fix / perm buffer set , rbc lysis buffer ( 10x ) , fitc - anti - human cd123 , percp - anti - human cd16 , percp - anti - human hla - dr , percp / cy5.5-anti - human cd25 , percp / cy5.5-anti - human il-17a , pe / cy7-anti - human cd8 , pe / cy7-anti - human cd14 , and pe / cy7 conjugated rat anti - human il-4 antibodies were purchased from biolegend ( san diego , ca , usa ) . fixation / permeabilization solution kit , fitc - anti - human cd4 , apc - anti - human cd19 , apc - anti - human ifn- , alexa fluor 647-anti - human foxp3 , and pe conjugated rat anti - mouse igm antibodies were purchased from bd pharmingen ( san jose , ca , usa ) . fitc or pe conjugated goat anti - rabbit igg antibody was purchased from santa cruz biotec ( santa cruz , ca , usa ) . biotinylated rabbit anti - human ifn-2 was purchased from bioss ( beijing , china ) . dab + substrate chromogen system and extravidin - peroxidase conjugate were purchased from chemicon international inc . recombinant human lung -tryptase was obtained from promega ( madison , wi , usa ) . exscript rt reagent kit and sybr premix ex taq ( perfect real time ) were obtained from takara biotechnology co. , ltd . oligonucleotide primers for real - time pcr were synthesized by invitrogen biotechnology co. ( shanghai , china ) . most of the general chemicals such as salts and buffer components were of analytical grade . a total of 33 allergic rhinitis ( ar ) , 26 asthma , 12 combined rhinitis with asthma ( ar + as ) , and 20 healthy control subjects ( hc ) were recruited in the study . the diagnosing criterion of asthma was conformed to the global initiative for asthma , and diagnosis for allergic rhinitis was based on allergic rhinitis and its impact on asthma ( aria ) . all patients were asked to stop antiallergy medication for at least 2 weeks prior to attending the study ( those who could not stop antiallergy drugs were excluded ) . the informed consent from each volunteer according to the declaration of helsinki and agreement with the ethical committee of the first affiliated hospital of liaoning medical university and general hospital of shenyang military area command were obtained . the general characteristics of the patients and control subjects were summarized in table 1 . peripheral venous blood sample ( 10 ml ) was collected from each patient or hc and was immediately processed to collect cells and plasma for analysis . specimens of human tissues for immunohistochemistry and flow cytometry analysis were collected from the department of pathology , the first affiliated hospital of liaoning medical university . the protocol for ethical use of human tissue in research was according to the declaration of helsinki ( 2000 ) and approved by the committees of the first affiliated hospital of liaoning medical university . to detect ifn-2 expression on leukocytes excluding t cells , the following antibodies were added to different testing tubes : ( 1 ) to detect ifn-2 expression in basophils : fitc - anti - human cd123 and percp - anti - human hla - dr ; ( 2 ) to detect ifn-2 expression in cd16 + polynucleated cells , cd16 polynucleated cells , and cd14 + cells and cd19 + cells : percp - anti - human cd16 , pe / cy7-anti - human cd14 , and apc - anti - human cd19 before 200 l of whole blood being added at room temperature for 15 min in dark . following ligation of red blood cells , white blood cells were fixed and permeabilized by using cytofix / cytoperm fixation / permeabilization kit according to the manufacturer 's instructions . following washing with bd washing buffer , the cell pellets were resuspended and rabbit anti - human ifn-2 followed by pe or fitc conjugated goat anti - rabbit igg antibodies were added at 4c for 30 min . finally , cells were resuspended in fluorescence - activated cell sorting- ( facs- ) flow solution and analyzed with facsverse flow cytometer ( bd biosciences , san jose , ca ) . data were analyzed with cellquest software ( bd immunocytometry systems ) . for detection of ifn-2 expression in t cells , peripheral blood mononucleated cells ( pbmc ) were isolated by using lymphoprep according to the manufacturer 's instruction . the following antibodies were then added to different testing tubes : ( 1 ) fitc - anti - human cd4 , percp / cy5.5-anti - human cd25 , pe / cy7-anti - human cd8 , and rabbit anti - human ifn-2 followed by alexa fluor 647-anti - human foxp3 and pe conjugated goat anti - rabbit igg antibodies to detect cd8 + t cells and regulatory t cells ( treg ) ; ( 2 ) fitc - anti - human cd4 , apc - anti - human ifn- , pe / cy7 conjugated rat anti - human il-4 , percp / cy5.5-anti - human il-17a , and rabbit anti - human ifn-2 followed by pe conjugated goat anti - rabbit igg antibodies to detect th1 , th2 , and th17 cells . cells were then incubated with each labeled monoclonal antibody including ( 1 ) pe / cy7 conjugated mouse anti - human tryptase , anti - human chymase antibody cc4 ( igm subtype ) , pe conjugated rat anti - mouse igm , rabbit anti - human ifn-2 , and fitc conjugated goat anti - rabbit igg antibodies to detect mast cells ; ( 2 ) pe / cy7-anti - human cd14 , apc - anti - human cd19 , rabbit anti - human ifn-2 , and fitc conjugated goat anti - rabbit igg antibodies to detect macrophages and b cells at 4c for 30 min in dark . after washing , the cell pellets were resuspended in facs - flow solution and analyzed with facsverse flow cytometer . tissues were fixed in carnoy 's fixative , dehydrated , and embedded in paraffin wax . sections ( 4 m ) were dewaxed , rehydrated , and incubated for 10 min with 0.5% h2o2 in methanol followed by 0.1% sodium azide for 10 min in order to inhibit endogenous peroxidase activity . pbs containing 5% bsa was added for 1 h and the same solution was employed as the diluent for the antibodies added subsequently . sequential sections of tonsil , lung , or nasal polyps were incubated with biotinylated rabbit anti - human ifn-2 for 2 h. after washing with pbst , extravidin - peroxidase conjugate was applied to sections for 1 h. staining was developed over 4 min by using dab chromogen system before being counterstained with mayer 's haematoxylin and mounted in aquamount . for each section , the number of positively stained cells was counted in at least 30 fields ( the area of each field equals 0.19 mm ) . the human lung carcinoma cell line a549 ( morphology : epithelial ) was obtained from the american type culture collection ( manassas , va , usa ) . cells were grown in dulbecco 's modified eagle 's medium ( dmem ) , supplemented with 10% ( v / v ) fetal calf serum ( fcs ) , 100 u / ml penicillin , and 100 g / ml streptomycin . cells were cultured in 75 cm tissue culture flasks ( falcon ) at 37c in a 5% ( v / v ) co2 , water - saturated atmosphere . for challenge experiments , cells were detached from culture flasks using trypsin , seeded into 12-well cell culture plates , and grown to about 80% confluence . the cells were then cultured with the serum - free basal medium for an additional 16 h before challenge . cells were exposed to tryptase ( 2 g / ml , 1 g / ml = 7.4 nm ) with or without its inhibitor leupeptin ( 3 g / ml ) , 100 m of sligkv - nh2 with or without par-2 antagonist fsllrn - nh2 ( 400 m ) and its reverse peptide vkgils - nh2 , and 100 m of tc - ligrlo - nh2 with or without par-2 antagonist fsllrn - nh2 ( 400 m ) and its reverse peptide tc - olrgil - nh2 , respectively . cells ( 1.5 10 per well ) were collected at 2 h or 6 h , centrifuged at 4c , and stored at 80c until use . the expression of ifn-2 mrna in a549 cells was determined by qpcr following the manufacture 's protocol . briefly , after synthesizing cdna from total rna by using superscript first strand synthesis system for rt - pcr and oligo - dt primers , real - time pcr was performed by using sybr premix ex taq kit on the abi prism 7700 sequence detection system ( perkin elmer applied systems , foster city , ca , usa ) . sequence - specific standard curves were generated using 10-fold serial dilutions of plasmid dna , and the values for the initial concentrations of unknown samples were calculated by using the software ( version 1.7 ) provided with the abi 7700 system . the primers for ifn-2 were forward : 5-caccctgcaccatatcctct-3 , reverse : 5-ggagggtcagacacacaggt-3 and for -actin were forward : 5-agagctacgagctgcctgac-3 , reverse : 5-agcactgtgttggcgtacag-3. levels of tryptase , il-4 , il-10 , il-12 , and ifn-2 in the plasma of ar , asthma , ar + as , and hc were measured by using elisa kits according to the manufacturer 's instructions . data were expressed as mean sem . where analysis of variance indicated significant differences between groups with anova , student 's t - test was applied . data for allergic patients are presented as scatter plot . where kruskal - wallis analysis indicated significant differences between groups , for the preplanned comparisons of interest , the paired mann - whitney u test was employed . in order to evaluate the potential role of ifn-2 in allergic airway disorders , the most direct evidence is to examine the changes of its levels in clinical specimen . we therefore examined the levels of ifn-2 in the plasma and its cellular location in blood of the patients with ar and asthma . the results showed that the levels of ifn-2 were elevated by 17.9% and 14.2% in the plasma of ar and combined rhinitis with asthma ( ar + as ) , but not of asthma ( figure 1(a ) ) . the plasma levels of tryptase were increased by 34.7% and 38.3% in the patients with ar and asthma , but not ar + as ( figure 1(b ) ) . the plasma levels of il-4 were increased by 21.1% in the patients with asthma but decreased by 55.3% and 26.3% in ar and ar + as ( figure 1(c ) ) . the plasma levels of il-10 ( figure 1(d ) ) and il-12 ( figure 1(e ) ) were decreased by 29.8% and 100% in the patients with ar , by 54.3% and 100% in the patients with asthma , and by 100% and 100% in the patients with ar + as , respectively . there were positive correlation between ifn-2 and tryptase and negative correlation between ifn-2 and il-10 in the plasma of ar . similarly , plasma ifn-2 positively correlates with tryptase , and il-10 positively correlates with il-12 in asthma ( table 2 ) . in order to identify the potential sources of ifn-2 the results showed that ifn-2 was predominately expressed in the cd16 + ( representing neutrophils ) ( figure 2(a)(f ) ) and cd14 + cells ( representing monocytes ) ( figure 2(a)(e ) ) and weakly expressed in cd19 + ( representing b cells ) ( figure 2(a)(a ) ) , cd8 + cells ( representing cytotoxic t cells ) ( figure 2(a)(b ) ) , and basophils ( figure 2(a)(g ) ) . cd4 + t cells ( figure 2(a)(d ) ) and cd16 polynucleated cells ( representing eosinophils ) ( figure 2(a)(c ) ) seemed not to express ifn-2 in hc ( figure 2(b ) ) . however ifn-2 expression was upregulated by 43.5% and 49.1% in ar , by 125% and 42.3% in asthma , and by 99% and 72.8% in ar + as in cytotoxic t cells and eosinophils but downregulated by 57% and 76.3% in ar , by 86.4% and 81.6% in asthma , and by 58.1% and 37.2% in ar + as in monocytes and neutrophils , respectively ( figure 2(b ) ) . in order to further investigate the potential source of ifn-2 , we examined the expression of ifn-2 in cells of various tissue origins by using immunohistochemical staining technique . the results showed that ifn-2 clearly expresses in glandular epithelial cells and some large cells ( most likely mast cells or macrophages ) in tonsillar tissue ( figure 3(b ) ) and in some large cells in lung tissue ( figure 3(d ) ) and nasal polyps ( figure 3(f ) ) as compared with the negative control tissues ( figures 3(a ) , 3(c ) , and 3(f ) ) . to confirm the immunohistochemical staining observations , we examined ifn-2 expression in dispersed human tonsil and lung mast cells , b cells , and macrophages by flow cytometry analysis . the results showed that approximately 2.1% , 4.5% , and 7.0% dispersed tonsil cells are ifn-2 + mct mast cells , mctc mast cells , and macrophages . however , 2.5% , 3.3% , 0.44% , and 0.14% dispersed cells are ifn-2 + mct mast cells , mctc mast cells , macrophages , and b cells ( figure 4 ) . positive correlation of ifn-2 with tryptase implicated that the increased level of ifn-2 in the plasma of patients with ar and ar + as may be elicited by mast cell tryptase . to confirm this anticipation , we examined the effect of tryptase and agonist peptides of par-2 on ifn-2 mrna expression in a549 cells . it was found that the expression of ifn-2 mrna over baseline control was increased by approximately 1.4- and 0.5-fold when the cells were incubated with tryptase at 2 g / ml for 2 and 6 h ( figure 5 ) . similarly , sligkv - nh2 and tc - ligrlo - nh2 induced approximately 1.4- and 0.9-fold increase in expression of ifn-2 mrna over baseline control , respectively , when they were incubated with a549 cells for 2 h ( figure 5 ) . at 6 h following incubation with sligkv - nh2 and tc - ligrlo - nh2 , the expression of ifn-2 mrna was enhanced by approximately 0.6- and 1.0-fold , respectively ( figure 5 ) . the reverse peptides vkgils - nh2 and tc - olrgil - nh2 showed little effect on the expression of ifn-2 mrna in a549 cells following 2 and 6 h incubation periods ( figure 5 ) . since fsllrn - nh2 and leupeptin were able to inhibit tryptase induced upregulation of expression of ifn-2 mrna and fsllrn - nh2 suppressed sligkv - nh2 and tc - ligrlo - nh2 induced upregulation of ifn-2 mrna expression ( figure 5 ) , the action of tryptase is likely to be mediated by par-2 and requires its enzymatic activity . we have demonstrated for the first time that the levels of ifn-2 are elevated in plasma of the patients with ar and ar + as , but not with asthma , which provides the first hard evidence for proving that ifn-2 may participate in adoptive immune response such as allergic airway reactions . the recent reports that the expression level of ifn-2 mrna was significantly increased during naturally occurring respiratory viral infections in children with asthma and that ifn-2 was capable of exacerbating a t - cell - mediated autoimmune disease may support our observation . it is difficult to evaluate the role of ifn-2 in allergic airway inflammation at this stage as we do not know if the increased serum level of ifn-2 is a causative or resulting factor in the pathogenesis of the allergic airway disorders . our observation that elevated ifn-2 levels were positively correlated to tryptase level in the plasma of ar suggests that these two compounds are likely released from the same source . since tryptase is a relatively selective marker of mast cell degranulation and the most abundant secretory product from mast cells , it is likely that ifn-2 is also released from mast cells upon degranulation . indeed , we have demonstrated in the present study that large numbers of tonsil and lung mct and mctc subtypes of mast cells express ifn-2 , confirming that mast cells are the major source of ifn-2 . our previous report that ifn-1 ( il-29 ) highly expressed in mast cells may support our current observation . however , unlike tryptase acting as a potent proinflammatory mediator which is capable of provoking microvascular leakage in the skin of guinea pigs , stimulating the release of histamine from dispersed human tonsil mast cells , and inducing accumulation of eosinophils and neutrophil in the peritoneum of mice , ifn-2 appears to act as a suppressor of allergic airway diseases . for example , ifn-2 can modulate lung dc function to promote th1 immune skewing and suppress allergic airway disease . since the information on the role of ifn-2 in allergy is very limited , the study that treatment with ifn-2 completely halts and reverses the development of collagen - induced arthritis , dramatically reduces numbers of proinflammatory il-17-producing th17 and t cells in the joints and inguinal lymph nodes , and restricts recruitment of il-1b - expressing neutrophils may support the anticipation that ifn-2 may play an inhibitory role in allergic airway diseases . since a large population of macrophages express ifn-2 , it is likely one of major sources of ifn-2 , considering huge numbers of macrophages in lung and tonsil . epithelial cells could be another source of ifn-2 as tonsil glandular epithelial cells express ifn-2 , and a549 cells express ifn-2 mrna . our observation that tryptase induced upregulation of expression of ifn-2 mrna in a549 cells is mediated by par-2 and requires tryptase enzymatic activity implicates that tryptase may provoke ifn-2 production in lung epithelial cells through activation of par-2 , and released ifn-2 could contribute to the elevated plasma level of ifn-2 in allergic airway disorders . is known of the relationship between pars and ifn-s , our previous report that the actions of thrombin on a549 cells are most likely carried out through hydrolytic cleavage of n - terminal of par-1 may help to understand our observation above . we have also observed the declined plasma levels of il-10 and il-12 in the allergic patients . since the correlation between il-12 and il-10 levels in serum has been reported in the patients with atopic dermatitis , and diminished il-12 levels were previously found in the serum of allergic patients , our observation may further suggest that reduced il-10 and il-12 production may contribute to the pathogenesis of the airway allergic disorders . the negative correlation between ifn-2 and il-10 in the plasma of ar suggested they are not likely to be released from same sources , which means that if mast cells are major source of ifn-2 , they should not be the major source for il-10 in ar . in order to identify the potential source of increased ifn-2 our data showed that ifn-2 expression was downregulated in ar , in asthma , and in ar + as in monocytes and neutrophils . since neutrophils and monocytes are predominant ifn-2-expressing cells in blood of hc , the decreased expression of ifn-2 in these 2 cell types could contribute to diminished level of ifn-2 in the plasma of asthma , even though ifn-2 expression appeared to be upregulated in blood cytotoxic t cells and eosinophils in asthma as cytotoxic t cells only weakly express and eosinophils do not express ifn-2 in hc . downregulation of expression of ifn-2 in peripheral blood monocytes and neutrophils of ar and ar + as seemed to conflict with the observation of increased level of ifn-2 in the plasma of ar and ar + as , which suggests that there must be some other sources to generate large amount of ifn-2 apart from blood leukocytes . moreover since helper t cells including regulatory t cells do not express ifn-2 , they are one of the major sources of il-10 , which may at least partially explain the negative correlation between ifn-2 and il-10 in the plasma of ar . in conclusion , the elevated levels of ifn-2 in the plasma of ar and ar + as and positive correlations of plasma ifn-2 with tryptase in ar and asthma indicate that ifn-2 is likely to contribute to the pathogenesis of allergic airway disorders . mast cells , macrophages , and epithelial cells in human tonsil and lung tissues express ifn-2 , and upregulated ifn-2 expression was observed in cd8 + t cells and eosinophils of allergic airway disorders indicate that they are the potential sources of ifn-2 .

this study investigated the expression levels of interferon- ( ifn- ) 2 in peripheral blood and tissues . the results showed that the levels of ifn-2 were elevated by 17.9% and 14.2% in the plasma of allergic rhinitis ( ar ) and combined rhinitis with asthma ( ar + as ) , which was positively correlated with the level of tryptase but negatively correlated with the level of il-10 . ifn-2 was predominately expressed in the cd16 + cells and cd14 + cells in healthy control subjects ( hc ) but upregulated only in cd8 + cells of ar and in eosinophils of asthma . it was observed that approximately 6.6% and 7.0% dispersed tonsil cells and 5.8% and 0.44% dispersed lung cells are ifn-2 + mast cells and macrophages . moreover , tryptase and agonist peptides of par-2 induced enhanced ifn-2 mrna expression in a549 cells . in conclusion , the elevated levels of ifn-2 in the plasma of ar and ar + as indicate that ifn-2 is likely to contribute to the pathogenesis of allergic airway disorders . the potential origins of the elevated plasma ifn-2 include mast cells , macrophages , and epithelial cells in tissues , neutrophils , monocytes , cd8 + t cells , and eosinophils in peripheral blood . development of ifn-2 related therapy may help to treat or prevent allergic airway disorders .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

sodium nitrate ( nano2 ) is one of important environmental toxicants and poses important health risks . most countries use nano2 as food additive as a source of color and flavor preservation in meat products and this chemical can also be found in water resources . consumption of nano2 at low levels for long time caused histopathologic changes , nitrosative tissue damage , and lipid peroxidation in liver and kidney , as well as inducing chromosomal aberrations , decreased immune system , increased cancer colon risk , hypoxia , enlargement of the carotid body , and a vasodilation due to the activity with haemoglobin in the blood to form methaemoglobin , which has a much higher ( up to 20 times ) affinity for oxygen [ 4 , 5 ] . acute intraperitoneal treatment of wistar rats with nano2 ( at the dose of 50 mg / kg bw ) influences the blood rheological properties and erythrocyte hematometric indices . as very little data are available on the effort to cure the intoxication of nano2 , the aim of this work was to evaluate the curative effect of chlorophyll from sauropus androgynus ( l ) merr as antioxidant to cure its toxic effect in inducing oxidative stress . dietary chlorophyll can be found in fresh fruits and vegetables as chlorophyll a and chlorophyll b , thermally processed fruits and vegetables as metal - free pheophytins and pyropheophytins , and thermally processed green vegetables as zn - pheophytins and zn - pyropheophytins . chlorophyll in form of underutilized greens in fresh vegetables , supplements , liquid solutions , extracts , or tablets can be used effectively as healthy and beneficial nutrient supplement . antioxidant activity is one of the beneficial effects of chlorophylls to prevent oxidative dna damage and lipid peroxidation both by reducing reactive oxygen species ( ros ) and chelating metal ions [ 811 ] . chlorophylls can act as a hydrogen donor to break the chain reaction , due to the porphyrin in its chemical structure . sauropus androgynus ( l ) merr was identified as potentially rich sources of chlorophyll [ 13 , 14 ] . the antioxidant activities of the dark green leaves of s. androgynous were reported to have biologically nutritive value . among others , they have antidiabetic activity in diabetic mice induced by alloxan , reduce fever , increase breastmilk production , and prevent hoarse voice ; have antidyslipidemic activity and prevent the cardiovascular disorder in wistar male rats induced with fat - rich diet ; affect the growth performances , resist diseases , and enhance nonspecific immune responses in grouper diets . the previous study reported that antioxidant activity of chlorophyll from s. androgynous leaves is able to decrease schistocytes percentage and malondialdehyde ( mda ) level and also increase the level of haemoglobin ( hb ) and ferritin in female mice induced by nano2 . this work may provide new information for toxicological testing to validate the safety and traditional uses of these plants . cu - chlorophyllin reported has a higher antioxidant activity than that of natural chlorophylls due to the presence of the chelated metal in the porphyrin ring . the antioxidant activities of the cu - chelated compounds were found to be much higher than those of natural chlorophylls and of mg - free derivatives . this study also compared the curative effect of natural chlorophyll in s. androgynus leaves compared to cu - chlorophyllin antioxidant activity in female rats induced subacute sodium nitrite ( nano2 ) . haematological blood assays and the level of mda , ferritin , and transferrin in blood serum were analysed as curative effect indicator of chlorophyll , while the histopathologic view of liver and kidney tissues was used to evaluate its toxicity . fresh leaves of s. androgynus ( l ) merr were collected from the inhabitant park in penggaron lor village , genuk , semarang , central java , indonesia . cu - chlorophyllin from k - liquid was obtained from a drug store in semarang , central java , indonesia . a given amount ( 200 g ) of fresh leaves was cleaned and was thereafter blended with acetone : methanol ( 7 : 3 , v / v ) using an electric blender until the pigment was removed . the organic phase material that resulted was added steadily with na2so4 anhydrate to ensure no water in the extract . the solvent removal and drying process of chlorophyll used rotary evaporator and n2 gas . a suspension of 0.016 mg of chlorophyll from s. androgynus ( l ) merr leaf extract ( csa ) was dissolved in 1 ml distilled water , used as a dose 1 of csa , while for making 1/2 dose csa 0.008 mg / ml was diluted from 1 dose csa . thirty female wistar albino rats ( 150200 g ) were obtained from the faculty of pharmacy , universitas gadjah mada , yogyakarta , indonesia . rats were maintained in the animal house of faculty of medicine , universitas islam sultan agung in standard hard bottom polypropylene cages at 23c 2c , 12 : 12 h light / dark cycle and free access to laboratory chow and tap water throughout the study . ethical clearance was obtained from the ethics committee of the faculty of medicine , universitas islam sultan agung , indonesia , with document number 150/v/2015/komisi bioetika . nano2 was administered 50 mg / kg body weight ( dissolved in 1 ml distilled water ) , which refers to rate of ld50 on rats . nano2 as much as 1 ml / day was given intraperitoneally to the rats for 10 days for treated animals ( groups ii , iii , iv , v , and vi ) . the control rats ( group i ) were treated with the same volume of distilled water . during the following 14 days , the rats from groups iii and iv were given orally dose 1/2 ( 0.008 mg / ml ) and dose 1 ( 0.016 mg / ml ) of csa , respectively , whereas the rats from groups v and vi were given cu - chlorophyllin from k - liquid with dose 1/2 ( 0.008 mg / ml ) and dose 1 ( 0.016 mg / ml ) , respectively . cu - chlorophyllin was dissolved in distilled water based on the instruction in the packing . the solution of chlorophyll and cu - chlorophyllin , those given to rat , were 3 ml / head / day according to the conversion of adult man doses . blood samples were collected from the animals via the periorbital sinus 24 h after the last treatment . about 3 ml of the blood the clotted blood samples were centrifuged at 3000 rpm for 10 min to obtain the serum , which was used for biochemical analyses . another 2 ml of the blood samples was collected into heparinized tubes that were used for haematological assays . the packed cell volume ( pcv ) red blood cell ( rbc ) counts were determined using the new improved neubauer hemocytometer . schistocytes are detected in the peripheral blood smear stained using wedge procedures and observed by microscopy in 100x every 1000 erythrocytes . commercially available kits were used according to the respective manufacturer 's protocol for the measurement of mda , ferritin , and transferrin . mda level was measured using thio barbituric acid reactive substance ( tbars ) test with 532 nm wavelength spectrophotometer , whilst ferritin level was measured using enzyme linked immunosorbent assay ( elisa ) method . all the animals were then sacrificed by anesthetizing with diethyl ether 24 h after the last treatment . the organ tissues were processed and embedded in paraffin wax and sections were made of about 46 m . after staining with haematoxylin and eosin , slides were examined under the microscope ( olympus , japan ) for histopathological changes and photographed . the histopathologic parameters for liver were scored as follows : ( 1 ) showing no changes or normal , ( 2 ) parenchymatous degeneration , ( 3 ) hydropic degeneration , and ( 4 ) necrosis , while the scoring for proximal tubule epithelium was as follows : ( 1 ) lesion less than 25% indicating no change , ( 2 ) lesion 25%<50% , ( 3 ) lesion 50%<75% , and ( 4 ) lesion more than 75% showing severe changes . results are reported as mean values sem and statistically analysed by one - way anova test with 95% significance level . if the data characteristics did not allow for the one - way anova test to be conducted , then the kruskal - wallis test became the alternative . the hb in induced nano2 rats group was significantly lower ( p < 0.05 ) than that of rats in control groups . it indicated that the subacute administration of nano2 can cause anaemia which was indicated by the decrease of hb level , pcv percentage , increase the rbc concentration , and schistocytes percentage . changes in blood parameters and immune response are the direct toxic effects due to high dose administration of nano2 . pvc indicates the proportion of whole blood occupied by the rbc and depends on the hb level in rbc . the percentages of schistocytes in nano2-induced rats group were significantly higher than control group which proved that nano2 is able to damage the resulting fragmented rbcs called as schistocytes . the schistocytes may have different forms such as triangular , helmet , or comma shaped of broken or fragmented erythrocytes . nano2 affects the haematological and hemorheological parameters in mature rats [ 5 , 24 ] . the group that was treated with one - dose chlorophyll from s. androgynous showed significant difference in hb level , rbc concentration when compared with the nano2 group ( p < 0.05 ) , but no significant difference with the cu - chlorophyllin in the same dose and control group . this indicated that the natural chlorophyll from s. androgynous leave is as effective as cu - chlorophyllin to cure the oxidative stress caused by nano2 induction . the haematological parameters as pcv , hb , and schistocytes in in the lower dose group of s. androgynous chlorophyll and cu - chlorophyllin were not significantly different ( p > 0.05 ) compared to those in the nano2 group , which indicated that lower dose of chlorophyll was not more effective at ameliorating the anaemia symptoms induced by nano2 . nano2 is one of methaemoglobin - forming drugs that may exacerbate oxidative toxicity under certain chronic or acute hemolytic settings . the increasing of hb level showed that nano2 induced erythrocyte methemoglobinemia by increasing reactive oxygen species ( ros ) . the fusion of the heme moiety of hemoglobin released from red blood cells into endothelium could provide catalytically active iron to the vasculature . ferritin as a cytoprotection against free radicals in vitro will be increased in the increasing of ros . the mda level increased significantly in nano2 induction group , whereas transferrin and ferritin level were reduced significantly with exposure to nano2 when compared with control . nitrate is reduced to nitrite and nitrite is converted to nitrosonium ions which in turn reacts with amines and amides to form nitrosamines and nitrosamines , respectively . n - nitrosamines have the ability to induce rapid oxidative stress and then cause lipid peroxidation ; therefore it disturbs the cellular homoeostasis . the serum mda level is one of the molecules used as indicator of lipid peroxidation to estimate oxidative stress . present study showed that rats who received nano2 for 10 days showed increasing of the mda serum significantly compared to control group . this result is in accordance with the previous studies that elevated mda level in nano2-given mice and elevated levels of serum mda in rats given nano2 . results from this study revealed that treatment with chlorophyll of s. androgynus restored mda levels after nano2 treatments to normal values . the mda level in group ii which was not treated by the chlorophyll remained high ( see table 2 ) . the decreasing of mda levels in group iii till group vi after the nano2 treatments is the results of the antioxidant activity of chlorophyll of s. androgynus and cu - chlorophyllin . the same effects were observed for serum ferritin and transferrin . decreased serum transferrin and ferritin levels could be a result of damage , particularly protein oxidation by reactive oxygen species generated by nano2 toxicity . there was a decrease ( p < 0.05 ) in serum transferrin and ferritin in the nano2-induced rat followed by therapy with s. androgynus chlorophyll and cu - chlorophyllin group compared with the control group . the histopathologic parameters for liver and proximal tubule epithelium of kidney were not significantly different among groups ( table 3 ) , although there were increasing score of hepatocyte and proximal tubule epithelium damage in nano2-induced group . histopathology of hepatocyte of rat liver in control group showed normal or no change with score 1 , while the hepatocyte in nano2 induced group showed hydropic degeneration ( figure 1 ) . the hepatocyte and proximal tubule kidney in group treated with dose 1 cu - chlorophyllin showed the highest score of hepatocyte histopathologic view even not significantly different from the control . there was founded necrosis cell in proximal tubule kidney of rats treated by cu - chlorophyllin ( figure 2 ) . the histology of kidney in the group cured with dose 1 of chlorophyll showed that the lesion cell was less than 50% . in the present study , intake of nano2 for 10 days this result was in accordance with roth and kate smith that rats given nano2 via drinking water at 13 g / l during pregnancy and lactation showed decreasing of erythropoietic development , changing in some histopathological such as cytoplasmic vacuolization of centrilobular hepatocytes , and decreased hematopoiesis in bone marrow and spleen . have detected hydropic cellular degeneration in liver and tubular degeneration in kidney in 20 mg / kg / day nano2-induced mice for 8 months . the histopathological changes are mediated by oxidative stress produced by the action of the metabolic pathways generated against the toxic compounds . ( 2005 ) reported that cu - chlorophyllin tested by -carotene bleaching method and the stable radical 2,2-diphenyl-1-picrylhydrazyl ( dpph ) scavenging assay methods presented a higher antioxidant activity than that of natural chlorophylls , showing the importance of the nature of the chelated metal in the porphyrin ring . the mechanism of antioxidant activity displayed by the natural chlorophyll derivatives does not seem to be based on the ability to donate hydrogen but maybe , the protection of linoleic acid against oxidation , and/or preventing decomposition of hydroperoxides . this is suggestive of hepatocytes protection from antioxidant activity from chlorophyll of s. androgynus against nano2-induced damages . the histopathologic parameters for liver showed nano2-induced toxicity and ameliorative potentials of chlorophyll of s. androgynus on nano2-induced oxidative stress . chlorophyllin copper ( cu(ii)-chlorophyllin ) is one of derivatives of chlorophyll that reported increased peripheral leukocyte count and improving symptoms of dizziness and fatigue in individuals with leukopenia . chlorophyll is converted to mg - free pheophytin derivatives during digestion and then transported to peripheral tissues . chlorophylls degraded rapidly to pheophytins in response to the high acidity of the gastric phase . in the past , chlorophyll has been used to treat gastrointestinal problems , anaemia , and cancer . fahey et al . reported that chlorophyll can improve the function of essential detoxification pathways . chlorophyllin was 410-fold more potent as a phase 2 enzyme inducer than chlorophyll , since it has other detoxification properties because it is much more water - soluble than chlorophyll . . showed that sasa senanensis rehder leaf extract containing fe(ii)-chlorophyllin demonstrated superoxide anion and hydroxyl radical - scavenging activity five times higher than a similar product containing cu(ii)-chlorophyllin and comparable to a product containing cu(ii)-chlorophyllin , ginseng , and pine leaf extracts . therefore , the data obtained from this study further proved the usefulness of chlorophyll of s. androgynus as a food supplement that may be recommended to cure humans and animals from nano2 toxicity . the present study has demonstrated the curative effect of chlorophyll solution from s. androgynus leaves on haematological , serum biochemical , and histological parameters , altered by sodium nitrate exposure in female wistar rats . this amelioration may be partly due to the antioxidant activity of chlorophyll from s. androgynus leaves that possess remarkable potential to cure the oxidative stress caused by sodium nitrate . further assessment of molecular evaluations of biological activities of chlorophyll from s. androgynus needs to be studied .

sodium nitrate ( nano2 ) widely used as food additive for coloring and preserving meat has been reported to induce oxidative stress and cause histopathologic changes , nitrosative tissue damage , and lipid peroxidation in liver and kidney . therefore , the present study compared the curative effect of chlorophyll from sauropus androgynus ( l ) merr and cu - chlorophyllin as antioxidant in nano2-induced female wistar rats based on haematological , serum biochemical , and histological evaluation . thirty male wistar rats were randomly assigned into six groups of five rats each . nano2 were given at a subacute dose of 50 mg / kg bw intraperitoneally for 10 days . chlorophyll from s. androgynus and cu - chlorophyllin from k - liquid were given in the following 14 days at the two doses : 0,016 mg / ml and 0.008 mg / ml . nano2 exposure resulted in significant reductions ( p < 0.05 ) in values of packed cell volume ( pcv ) , haemoglobin ( hb ) concentration and red blood cell ( rbc ) count , transferrin , and ferritin and elevation in malondialdehyde ( mda ) level and schistocytes percentage with insignificant reductions in serum albumin and transferrin levels . histology of kidney and liver were changed insignificantly ( p > 0.05 ) to normal values . chlorophyll from s. androgynus and cu - chlorophyllin possess antioxidant potentials to protect against toxicities induced by sodium nitrate .

1. Introduction 2. Material and Methods 3. Results and Discussion 4. Conclusion

placental polyp is a somewhat pedunculated remnant of chorionic tissue retained in the uterine cavity for an indefinite time . it may result in abnormal uterine bleeding and slightly elevated detectable titers of serum -human chorionic gonadotropin ( hcg ) . these pedunculated masses of villi are often found within days to weeks following abortion or delivery of a term placenta . since trophoblastic neoplasms especially placental site trophoblastic tumor may have similar symptoms and signs , it is important to consider placental polyp in differential diagnosis in such situations . a 34-year - old g4l3ab1 woman came with abnormal uterine bleeding since her last normal vaginal delivery 3 months ago . serum -hcg level was slightly elevated ranging from 86 to 103 iu / ml during diagnostic investigations . ultrasonography revealed enlarged uterus with an echolucent intracavitary uterine mass measuring 73 mm 55 mm 24 mm . computerized topography confirmed the presence of the mass and showed no abnormality in thorax . clinical , laboratory , and imaging findings raised the suspicion of gestational trophoblastic tumors especially those arising from intermediate trophoblastic cells . macroscopically , the uterus showed slight global enlargement resulting from the presence of a polypoid mass within the endometrial cavity . the cut surface was diffusely red with some fine streaks of a gray colored tissue . it was attached to the uterine wall in the fundal region without any macroscopic permeation into the myometrium [ figure 1 ] . microscopic study showed largely necrotic villi in a network of fibrin deposition [ figures 2 and 3 ] . a large polypoid mass with smooth outer surface has completely filled the endometrial cavity necrotic chorionic villi are seen in the background of fibrin deposition ( 40 ) nuclear debris are seen in the stroma of necrotic chorionic villi ( 400 ) placental polyp is a fragment of retained placental tissue in the uterus that has undergone neovascularization after resolution of gestation . chronic uterine inversion due to placental polyp has also been reported . a case of placental these pedunculated masses of villi are often found within days to weeks following abortion or delivery of a term placenta . rarely , they persist for months or even years after pregnancy . abnormal uterine bleeding due to placental polyp has been attributed to preserved villi , clusters of destructive villi , and isolated viable cotyledons . preservation of the brush border of syncytiotrophoblastic cells and the presence of placental phosphatase maintain the anticoagulative properties of villi . thromboplastic properties of the preserved villi play an important role in the pathogenesis of uterine bleeding when necrotic villi with epithelial remnants are prevalent . computed tomographic angiography is also useful in diagnosis and management of placental polyp with neovascularization . magnetic resonance imaging may also be used in diagnosis and follow - up of placental polyps . . a hypervascular placental polyp may lead to severe hemorrhage that requires blood transfusions , interventional radiology procedures , hysteroscopic resection , and even hysterectomy to control bleeding . evaluation of neovascularization by multimodal imaging is potentially useful in management of placental polyp in women who wish to preserve fertility . successful treatment with the use of iliac artery occlusion catheters and concomitant hysteroscopic resection has been reported . intraoperative injection of prostaglandin f2 followed by hysteroscopic resection has been successful in management of these cases . serum hcg fell to undetectable level following surgery . although the patient had completed her family and did not have any desire to preserve her fertility , a proper preoperative diagnosis with accurate interpretation of imaging findings and satisfactory curettage would have prevented hysterectomy in this patient . placental polyp should be considered in any case of parous woman with unexplained abnormal uterine bleeding and slightly elevated serum hcg level . this does not exclude the possibility of the presence of a placental polyp as the source of abnormal bleeding . all authors have contributed in designing and preparation of the first draft of the manuscript . they have read and approved the content of the manuscript and confirmed the accuracy or integrity of any part of the work .

placental polyp is retained placental tissue within the endometrial cavity , which forms a nidus for inflammation and bleeding . there are very few reported cases of the clinical placental polyp . here , we report a case of 34-year - old g4l3ab1 woman with the chief complaint of intermittent vaginal bleeding since her last normal vaginal delivery 3 months ago . serum human chorionic gonadotropin ( hcg ) titer was slightly elevated . a polypoid mass was detected within the endometrial cavity by imaging studies . history of the patient , mass lesion within the endometrial cavity and slightly elevated serum hcg titer raised the suspicion of trophoblastic neoplasms . endometrial curettage yielded unsatisfactory specimen containing only fibrin deposition and was followed by total hysterectomy . the uterus showed slight global enlargement resulting from the presence of a polypoid mass within the endometrial cavity . the red - colored mass had a smooth outer surface and fragile consistency without any permeation into the myometrium . pathology reported it as the placental polyp . although very rare , placental polyp should be kept in mind as one of the reasons of abnormal uterine bleeding in parous women . definite diagnosis is made by pathology examination .

INTRODUCTION CASE REPORT DISCUSSION AUTHORS CONTRIBUTIONS

halogen bonding has emerged in recent years as an effective alternative to hydrogen bonding in directing the formation of self - assembling architectures , with fruitful applications in many chemical and biological systems . halogen bonding is an electrostatically driven noncovalent interaction between a halogen atom in one molecule and a lone - pair ( n ) or -electron donor in another . the electron - withdrawing effect of groups covalently bound to a halogen atom depletes the electron density in the n orbital to yield an electropositive -hole . halogen bonding serves as an ideal cohesive force in self - assembling systems due to its linear directionality , tunable bonding strength , and stability in hydrophobic environments . in addition to attractive intermolecular forces , self - assembling processes may be aided via cooperative effects , i.e. , nonadditive enhancement from polarization and charge transfer . the existence of cooperativity in halogen bonding has been identified in previous crystallographic and theoretical studies covering molecular complexes with varied structures and strengths . the present computational study expands upon previous efforts to quantitatively examine cooperative effects and optimal motifs for linear and multiply halogen bonded systems and to consider their potential in the construction of self - assembling architectures . by performing density functional theory ( dft ) calculations , enhanced understanding is sought on the nature of cooperativity through geometrical , energetic , and natural bonding orbital ( nbo ) analyses . factors are considered that could influence interaction strength such as polarization , secondary interactions , and spacing between halogen bonds . recently , modeling of halogen bonding interactions in supramolecular systems has been facilitated in force fields by representing the -hole as a partial positive point charge attached to the halogen atom . carter et al . also redesigned a force field for halogen bonds by including angular dependency into the standard lennard - jones potential . in the present work , model systems are considered and then extended to construct cylindrical complexes analogous to carbon nanotubes ( cnts ) . the initial focus was on 4-bromopyridine and 1-bromo-1h - imidazole as prototypical building blocks for construction of larger , self - assembling systems . the first issue was to evaluate the structures , interaction strengths , and cooperativity for linear oligomers , namely , ( 4-bromopyridine)n ( 1 ) and ( 1-bromo-1h - imidazole)n ( 2 ) with n = 16 , as shown in figure 1 for n = 4 . as described in computational methods , dft calculations were carried at the m06 - 2x/6 - 31+g(d , p)-lanl2dzdp - pp level with counterpoise corrections using geometries optimized with the b97x functional and the same basis set . as reported in table 1 , the calculated average halogen - bond lengths decline and binding energies strengthen steadily with growing oligomer size . the average halogen - bond strength increases for the 4-bromopyridine case from 2.94 to 3.08 kcal / mol for n = 26 . the interactions and cooperative effects for the imidazole case are notably stronger , advancing from 8.31 kcal / mol for the dimer to 10.30 kcal / mol for the hexamer . the halogen bonds are also significantly shorter with nbr separations near 2.5 for 2 versus 3.0 for 1 . the much stronger halogen bonds for 2 are due to the nitrogen atom being covalently bound to bromine , which simultaneously enhances electron withdrawal from bromine by induction and electron donation to the lewis basic nitrogen by resonance . most of the linear chains of both compounds exhibit nonuniform sequential arrangements , with shorter halogen - bond distances in the middle and longer ones toward the ends of the chains . this geometric characteristic has also been found in hydrogen - bonded linear chains . as also shown in table 1 ( column 3 ) , including zero - point energy ( zpe ) corrections optimized geometries of linear chains for tetramers of 4-bromopyridine ( 1 ) and 1-bromo-1h - imidazole ( 2 ) . percentage change compared to the dimer . the energy difference between the optimized complex and separated monomers including zero - point energy corrections . cooperative effects are apparent in the increasing average strengths of the halogen bonds . further quantification comes from evaluating the average cooperative energy , ecoop , according to eq 1 for oligomers of sizes greater than 2 . as shown in table 1 , the negative values for ecoop confirm the existence of cooperative effects in all cases , and they increase in magnitude as the chains grow.1 a many - body analysis was also carried out using the standard partition scheme of hankins et al . for the trimers and tetramers . this requires calculations for each constituent n - mer to yield the total interaction energy as a sum of contributions from two- , three- , and four - body interactions . the results in table 2 indicate that while the two - body interactions make the dominant contributions to the binding energies , the three - body terms are substantial and increase significantly in going from the trimers to tetramers . however , the four - body terms are negligible , as found in a previous many - body analysis of hydrogen - bonded hcn chains . to further characterize the cooperative effects , the investigations considered the changes in dipole moment and intermolecular orbital interactions via nbo analysis . the average dipole moment per molecule ( ) and the cooperative dipole moment ( coop , defined analogously to the cooperative energy , increase for addition of each monomer ( table 3 ) . the calculated average intermolecular charge transfer ( qct ) and delocalization energies ( e ) associated with the lone pair on the nitrogen atoms ( nn ) and antibonding orbitals of the c br bonds ( *c br ) are also found to increase with the size of the oligomers in table 3 . moreover , figure 2 illustrates that the average binding energy correlates linearly with average dipole moment ( correlation coefficient = 0.998 and 0.994 ) and transferred charge ( correlation coefficient = 0.954 and 0.981 ) . overall , the present results support the consensus view that polarization is a major source of the cooperativity in linear halogen - bonded systems . correlations of the average halogen bonding energy ( exb , kcal / mol ) with the average dipole moment ( debyes ) and average amount of charge transferred ( e ) for linear oligomers of ( 4-bromopyridine)26 on the left and ( 1-bromo-1h - imidazole)26 on the right . dipole moments in debyes ; transferred charges in e ; energies in kilocalories per mole . while previous studies have focused on the cooperativity in linear systems , the cooperativity in multiply halogen bonded systems was also explored here for a variety of haloazines . the goals are to identify the factors that influence halogen - bond strengths and to determine optimal halogen - bonding motifs for potential use in self - assembly of large systems . as shown in figure 3 and table 4 , results were obtained for the singly , doubly , and triply halogen bonded complexes 3a3c . these cases illustrate alternation of the donor and acceptor sites at the interface . the average length of the halogen bonds increases slightly along this series , which likely reflects the unfavorable hh repulsions across the interfaces for 3b and 3c . nevertheless , the average strength increases from 2.94 to 3.39 kcal / mol . . 10 kcal / mol , which is stronger by 1 kcal / mol than for the tetramer of 1 , also featuring three halogen bonds . thus , the cooperative effect is somewhat greater for extension of the halogen bonding system laterally rather than in a linear , head - to - tail manner . halogen bond lengths in the crystal structures from ref ( 32 ) . including zero - point energy corrections . related systems that incorporate extensive two - dimensional networks of nitrogen chlorine halogen bonds have been reported in crystallographic studies . in the present work , two of the azaaromatic chlorides were revisited : cyanuric trichloride ( 3d ) and 2,4,6,8-tetrachloropyrimido[5,4-d]pyrimidine ( 3e ) . the dimer and heptamer of 3d and the dimer and tetramer for 3e were optimized . as shown in table 4 , the dft results for the halogen - bond lengths for the oligomers of 3d and 3e are in excellent agreement with the findings from the x - ray crystallography . however , compared to the bromoazines , the dft results reveal that the halogen bonds for 3d and 3e are significantly weaker with average strengths of 1.51.9 kcal / mol . similarly , in our prior study of the complexes of bromobenzene and chlorobenzene with pyridine , binding energies of 2.7 and 1.9 kcal / mol were obtained . though the halogen bonds for 3d and 3e are weak , they clearly contribute to the packing and self - assembly reflected in the crystal structures . stronger halogen bonding interactions can be expected to lead to more robust self - assembling materials . continuing in figure 3 , 3f and 3 g remove or add a benzene spacer to 3b . the binding energy for 3f is significantly weaker at 3.37 kcal / mol owing to the repulsion between the central bromine atoms ; the monomers shift laterally such that the c brn angles are 164 rather than the optimal 180 for halogen bonds . however , the additional spacer in 3 g has little impact yielding an interaction energy nearly the same as that for 3b . complexes 3h and 3i are isomeric with 3f and 3 g ; however , both donors and both acceptors are now on the same side of the interface . for hydrogen - bonded systems , this arrangement can lead to stronger binding owing to the favorable secondary electrostatic interactions . however , in 3h the repulsion between the bromines causes them to bend away from each other with c c br angles of 125 and c brn angles of 162 , which leads to weak binding of only 3.55 kcal / mol . the problem is relieved for 3i , though its binding energy of 5.60 kcal / mol is about 0.7 kcal / mol weaker than for 3 g . there are small structural differences in this case ; the halogen bonds are more linear for 3 g than 3i with c finally , 3j and 3k explore replacement of the benzene rings in 3b and 3c with cyclohexyl spacers . the nbr halogen bond lengths are constant at 3.093.10 ; however , the partially saturated systems exhibit stronger attraction with binding energies of 7.16 and 11.34 kcal / mol for 3j and 3k . the increased attraction can be attributed to reduced hh repulsion across the interfaces . for the unsaturated cases such as 3b , 3c , and 3 g , the shortest interannular hh contacts are 2.82.9 , while they are 3.43.5 for the partially saturated 3j and 3k . thus , for the motifs in figure 3 , the strongest average halogen bond strengths occur when the donor and acceptor sites alternate on each side of the interface and when there is a spacer ring between the 4-bromopyridine subunits as in 3b and 3j . significant cooperative effects are apparent with the average nbr halogen bond strength climbing from 2.94 kcal / mol in the reference dimer 3a to 3.39 kcal / mol in 3c and to 3.78 kcal / mol in 3k . this analysis assigns all of the net interaction to the halogen bonds , which is an oversimplification since there are at least varying steric effects associated with the hh interactions at the interface . however , the results establish that multiply halogen bonded interfaces can be constructed where the net interaction is more attractive than from the sum of the individual halogen bonds . in view of the possible influence of secondary electrostatic interactions on complexation , six additional dimers related to 3b were considered ( figure 4 and table 5 ) . each complex formally has two nbr halogen bonds ; however , the interface has been modified by the arrangement of the donors and acceptors or by modification of the central ring as benzene , pyridine , or pyrazine . compound 4a is the isomer of 3b with both donors on one side of the interface and both acceptors on the other . as with 3 g and 3i , the preference is for the alternating arrangement in 3b over the parallel one in 4a by nearly 1 kcal / mol . the introduction of the interfacial nn repulsion does weaken the binding to 5.28 kcal / mol . this replaces the nn repulsion with an nh attraction , and the binding is enhanced to 6.40 kcal / mol . six alternative doubly halogen bonded complexes with their computed binding energies ebind ( kcal / mol ) from m06 - 2x/6 - 31+g(d , p)-lanl2dzdp - pp calculations . primary interactions are indicated with solid lines and secondary ones are shown with dashed lines . distances in ngstroms ; energies in kilocalories per mole . including zero - point energy corrections . complexes 4d and 4e are the analogues of 3b with the pyrazine and pyridine spacers ; they are also isomers of 4b and 4c with the donor and acceptor arrangement returned to alternating . these complexes both show some enhancement of the binding energy to 6.79 and 7.03 kcal / mol . for 4d the interannular nn repulsion is diminished by a lateral shift such that the nbr halogen bonds become somewhat bifurcated . the outer c brn angle is 173 in 4d , while the inner one is 148 , and the central nn distance is 5.0 . in 4e , compound 4f is the final possibility in this series ; it is the isomer of 4c with the three nitrogen atoms on one edge . the binding weakens to 6.06 kcal / mol , which suggests that the basicity of the nitrogens in 4f is lessened by their proximity . n bonds induces slight concave curvature to the nitrogen - containing edges in 4f that splays out the opposite bromine - containing edges . in turn , this adversely affects the linearity of the halogen bonds in 4f with c brn angles of 171 vs 178 in 4c . these results establish that 3b , 3j , 4d , and 4e represent the motifs with the most attractive interactions . they feature 4-bromopyridine units with edges of alternating donor and acceptor sites separated by a monocyclic spacer . they can all be extended to potentially yield sheetlike structures in the solid state and a foundation for construction of other self - assembling materials . the possible utility of the 3b motif for constructing tubelike structures that could self - assemble was considered . cylindrical belts were generated with alternating 4-bromopyridine and benzene rings and alternating up / down arrangement of the bromopyridines . dimers of the belts with six ( 5a ) , eight ( 5b ) , and ten ( 5c ) repeats can form six , eight , and ten halogen bonds at each interface ( figure 5 ) . the dimers were modeled with dft and molecular mechanics calculations . for the latter , the fixed - charge force field , opls / cm1ax , was used as well as the version that includes polarization via induced dipoles on non - hydrogen atoms , opls / cm1axp . both force fields incorporate partial positive charges ( x - sites ) to represent the -holes on chlorine , bromine , and iodine atoms . the energetic results for 5a , 5b , and 5c are summarized in table 6 . in view of the increasing system sizes , two alternatives for the dft method and basis sets were needed . the geometry optimizations for 5b and 5c used the smaller 6 - 31g(d)-lanl2dzdp - pp basis set with blyp , and the isolated monomer geometry was taken to be the same as in the optimized dimer . supramolecular tubes can be assembled from cylindrical belts using six ( 5a ) or ten ( 5c ) halogen bonds at each interface . using m06 - 2x//b97x with the 6 - 31+g(d , p)-lanl2dzdp - pp basis set . using m06 - 2x//b97 - 1 with the 6 - 31g(d , p)-lanl2dzdp - pp basis set . using m06l/6 - 31g(d , p)-lanl2dzdp - pp//blyp/6 - 31g(d)-lanl2dzdp - pp . for 3b and 3c as references , the binding energies from the force field calculations are found to be in near perfect agreement with the m06 - 2x results . this is not unexpected since opls / cm1ax was parametrized to reproduce halogen - bonding results from high - end ab initio calculations , specifically , mp2(full)/aug - cc - pvdz(-pp ) . 5c where the best accord is found between the nonpolarizable opls / cm1ax and dft results . as noted previously , the cm1a charges include the intramolecular electronic polarization for the monomers , and the intermolecular polarization is generally only essential for modeling interactions with small ions . notably , along the 5a5c series the binding intensifies from 20 to 27 to 35 kcal / mol . there is also a gradual increase in the average halogen bond strength from 3.24 to 3.46 kcal / mol according to the dft calculations . this cooperative effect is not mirrored in the force field results which yield the same average halogen bond strength for the two larger systems . the strong binding for 5a5c indicates that the halogen bonding motifs in 3b , 3j , 4d , and 4e could be used as the cohesive elements to build a wide range of interesting supramolecular systems and nanomaterials . furthermore , the excellent accord between the dft and opls / cm1ax results supports the use of opls / cm1ax as a computationally efficient means for modeling such systems . the present study addressed halogen binding strengths and cooperativity in linear and multiply halogen bonded systems . for the linear chains 1 and 2 , the cooperativity is largely a polarization effect , as supported by the close correlations of the cooperative dipole moments and amounts of charge transferred with the interaction energies . for multiply halogen bonded complexes such as 3a3c , the average halogen bond strength was also found to increase with increasing numbers of halogen bonds . four motifs , 3b , 3j , 4d , and 4e , emerged as having particularly strong halogen bonding and symmetries that allow their elaboration to yield large periodic systems . this notion was further explored with the demonstration that molecular belts based on 3b could be constructed that should self - assemble into nanotubes . furthermore , the opls / cm1ax force field was confirmed to accurately predict the interaction energies for halogen - bonded systems as large as the belt dimers 5a5c . the 6 - 31+g(d , p ) basis set was employed for all atoms with the exception of bromine , for which the lanl2dzdp - pp basis set with pseudopotentials was used . vibrational frequency calculations were carried out at the same level to confirm that the optimized structures were true minima . binding energies were obtained by single - point energy calculations with the m06 - 2x or m06l functional using the same basis set as the geometry optimization , and with basis set superposition error ( bsse ) removed via the boys bernardi counterpoise ( cp ) method . the accuracy of the results from such computations has been supported by numerous benchmark studies . natural bond orbital ( nbo ) analysis was performed with gaussian 09 following standard procedures . geometry optimizations were also performed using molecular mechanics as implemented in the boss 4.9 software . the opls / cm1ax force field , which features 1.14*cm1a partial atomic charges with extra point charges ( x - sites ) representing the -hole for halogen atoms , was used . the effects of inclusion of intermolecular polarization with inducible dipoles were considered with the opls / cm1axp force field . the polarizabilities , , for carbon , nitrogen , and bromine were assigned as 1.0 , 1.5 , and 2.0 .

halogen bonding , due to its directionality and tunable strength , is being increasingly utilized in self - assembling materials and crystal engineering . using density functional theory ( dft ) and molecular mechanics ( opls / cm1ax ) calculations , multiply halogen bonded complexes of brominated imidazole and pyridine are investigated along with their potential in construction of self - assembling architectures . dimers with 110 halogen bonds are considered and reveal maximal binding energies of 336 kcal / mol . cooperative ( nonadditive ) effects are found in complexes that extend both along and perpendicular to the halogen bonding axes , with interaction energies depending on polarization , secondary interactions , and ring spacers . four structural motifs were identified to yield optimal halogen bonding . for the largest systems , the excellent agreement found between the dft and opls / cm1ax results supports the utility of the latter approach for analysis and design of self - assembling supramolecular structures .

Introduction Results Conclusion Computational Methods

in recent years , the development of an integrated nanotherapeutic system which can allow for an online imaging and deliver targeted therapy has been the subject of interest in clinical oncology . this emerging nanotechnology has allowed the manipulation of nanoparticles ( nps ) to assume multiple functionalities.14 interestingly in that view , the use of multifunctional quantum dots ( qds ) as fluorescence imaging contrast agents as compared with the traditional organic fluorophores has significantly enhanced both in vitro and in vivo detection and online assessment of cancer tumors in animal models.4,5 the preference of qds as optical imaging contrast agents as compared with the latter is largely due to its intrinsic ability to resist photobleaching.6,7 fluorescence semiconductors offer advantages in that , as they have a broad and tunable absorption spectrum extending from the ultraviolet ( uv ) toward the visible ( uv - vis ) region.8 semiconductor nanocrystals such as bulk zinc sulfate ( zns ) emits high fluorescence with a color that depends on the particle size but regrettably suffers from self - quenching effects . the doping of zns with other impurities such as mn and cd are reported to significantly reduce this intrinsic quenching behavior and at the same time enhances the fluorescence efficiency of the qds toward the cut - off wavelength of the visible region.8 interestingly , the similarity in the ionic radii and valence state of the mn and those of zn ions allowed for an easy substitution to take place in the host zns crystals.9 the mn ion in this regard serves as the luminescence center by providing recombination sites for the electrons and holes as charge carriers . the resultant transfer of electrons and hole charges into the electronic level of mn ions allow for the emission of a characteristic orange red fluorescence following t1a1 transition of the mn ion.1012 by the application of appropriate bioconjugation , the orange red fluorescence emission from the doped mn in the zns nanocrystals can conveniently replace the conventional organic fluorophore in molecular imaging and quantitative cellular studies.6,7,9 several researchers have explored novel approaches for the synthesis of water - soluble qds through the selection of appropriate stabilizers such as 3-mercaptopropionic acid ( mpa ) , mercaptoacetic acid , thioglycolic acid ( tga ) , polysaccharide copolymers , etc.4,13 however , some researchers observed that the quantum yield obtained from qds stabilized by thiol - groups is usually low.1416 furthermore , the thiol - qd bond is also reported not to be very stable and precipitates readily on being dialyzed against buffer solution and water with time.17,18 in addition to this finding , mpa , one of the common stabilizers used for the synthesis of water - soluble qds , is a volatile liquid with strong odor and is reported to be carcinogenic in nature and environmentally unfriendly . thus , the use and application of mpa as water - soluble stabilizer is not entirely green chemistry approach.19 in this regard , chitosan ( cs ) , a natural copolymer of n - acetylglucosamine and d - glucosamine has drawn greater attention as stabilizer of choice for the encapsulation of qds . cs is highly biocompatible , nontoxic and environmentally friendly and helps to render qds as water soluble.4,17 in addition to these qualities , the large functional backbone of cs can equally serves as a viable platform for the encapsulation of drugs and other suitable ligands.9,20 this unique signature of cs in addition to being a stabilizer and drug delivery vehicle , also protects the conjugated qds and reduces the possibility of nonspecific protein opsonization.17,21 from a biomedical point of view , the mn - doped zns ( mn : zns ) conjugated cs nanocarrier can be made to achieve active or selective targeting and imaging of diseases by attaching suitable ligands with strong binding affinity toward the largely expressed receptors such as proteins , vitamins , monoclonal antibodies , aptamers , and peptides.22,23 these among many have been reported in the development of a number of theranostic applications that included targeted drug delivery using receptor - mediated pathways for the detection of cancerous tumors or following protein protein interactions toward the detection of proteins in blood assays.2426 the active targeting has attracted considerable interest due to its target specificity unlike the passive targeting , which takes advantage of leaky vasculature found in cancerous cells through enhanced permeability and retention effects to transport the drug.27 under these processes , there exists the possibility of the required dosage being lost on transit before reaching the diseased site.28 in that view , folic acid ( fa ) , a nontoxic low - weight vitamin is found to have strong binding affinity toward folate receptors ( frs ) largely secreted by cancerous cells as compared with the normal cells.21 though fa was successfully conjugated directly to the surface of metallic nanoparticles ( mnps ) such as qds,29 some researchers observed that this often resulted in the oxidation of the surface and possible changes in the optical chemistry of the mnps and the unprotected or naked mnps were exposed to the scavenging effects of blood matrix species.21 thus , in our work the fa was first conjugated to cs and following this conjugation , the qds were then encapsulated . it is therefore hypothesized that the functionalization of mn : zns conjugated cs with fa and encapsulation with an anticancer drug helps to achieve triple purpose : 1 ) enabling specific targeting of folate - expressed cancer cells ; 2 ) as a vehicle for stabilizing and transporting drugs to the tumor - targeted sites ; and 3 ) the highly intense fluorescent emission from mn can be used for noninvasive imaging of the cancer cells . here , we present an aqueous , room temperature synthesis of fluorescence mn : zns qds loaded onto cs biopolymer and conjugated to fa for specific targeting of fr - overexpressed cancer cells following modified protocols reported elsewhere.4 in this study , we intentionally avoided the use of lengthy spacer groups so as to retain the structural integrity of our materials as much as possible , and also avoided the rigor of chemical modification that may introduce possible structural defects and/or alteration of the electronic states of the core material.2831 it has been demonstrated that the fa conveniently binds to the surface of metals via noncovalent interactions31,32 and similar method of interaction with cs were also reported.33 in this particular instance , the conjugation of the fa and cs is initiated due to the strong electrostatic interaction of the cationic amino groups of cs with the anionic carboxylate group of fa ; the result shows a loading efficiency of approximately 30.51.2 wt.%.33 despite the successes recorded following noncovalent method of conjugation of fa to other biomolecules or mnps,2934 several work reported a superior performance following covalent methods of interactions.4,35,36 however , the greatest challenge is meeting the requirements of specific conjugation chemistry that retains qds biochemical activity as much as possible . despite the superiority of covalent coupling of fa to qds by means of 1-ethyl-3-(3-dimethylaminopropyl ) carbodiimide - based chemistry , some researchers reported that 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide has short half - life in water and results in poor coupling efficiency . although the addition of n - hydroxysuccinimide may have improved the efficiency,36 it is considered to follow lengthy pathways that may probably modify the biochemical integrity of the qds / nps . in the same vein , other researchers reported that the proteins readily lost their structural integrity upon adsorption onto monolayer - protected metal nps ( or qds ) following covalent interactions , leading to instability and subsequent denaturation.37 it is also investigated that the drug whose active site is covalently bound to the surface of nps are observed not to undergo controlled drug release readily as compared with drugs encapsulated by following noncovalent interactions.38 therefore for controlled and targeted delivery , formulation of nanocarriers with noncovalent interactions may be the probable method of preserving the active ingredients and structural integrity of the materials as much as possible . hence , the nonchemical methods adopted in this work follows simple ultrasonication , centrifugation , and controlled ph.2933 low - molecular - weight cs ( 75%85% degree of deacetylation ) was purchased from sigma - aldrich ( st louis , mo , usa ) , while the other chemicals such as ethanol ( 99.5% ) was purchased from fisher scientific ( selangor , malaysia ) and acetic acid ( 99.85% ) from benson lab chemicals ( selangor , malaysia ) . zinc acetate dehydrate ( zn ( oac)22h2o ) 99.5% , fa ( c19h9n7o6 , 98% ) , sodium sulfide ( na2sxh2o ) , manganese sulfate ( mnso4h2o , 99% ) , and sodium tripolyphosphate ( na5o10p3 , 59% ) were purchased from r&m marketing ( essex , uk ) . chitosan stabilized mndoped zns ( facs - mn : zns ) qds , the three sequential steps involved are demonstrated schematically in figure 1 . the first step involves the formation of stable fa and cs suspension and for that , we prepared 5 ml ( at 4 mg / ml concentration ) of water - soluble cs by protonating the nh2 group with 1% acetic acid39 under stirring while adjusting the ph to 5.4 using 0.1 m naoh . further , 2 ml of 1 mg / ml fa in distilled water was prepared separately and stirred for 1 hour to form fa solution and the resulting solution was then added to the cs solution dropwise under constant stirring for 2 hours . now 2 ml of 1 mg / ml tripolyphosphate was added as a cross - linker drop by drop to the mixture and stirred for 8 hours to form the stable suspension of facs . the second step involves the synthesis of highly luminescent mn : zns qds following simple modified wet method as described by mathew et al.4 briefly , 1.5 ml of mnso4 ( varying at.% ) was prepared and added dropwise to 10 ml zn(oac)2 ( 0.1 m ) under ultrasonication and stirred well by bubbling with n2 gas for 15 minutes . to the resulting mixture , 10 ml of na2s ( 0.1 m ) was added drop by drop under constant stirring to form a white precipitate in the process while maintaining the ph to ~5.4 . the doping processes were observed for the emission of orange fluorescence under handheld uv lamp . in order to suppress unwanted relaxation phenomenon from dominating the energy pathways , the obtained precursor was immediately exposed to microwave irradiation for 1 minute and further stirred for 1 hour.4,10 the conjugation of facs to the mn : zns qds was carried in the third step and for that , the mn : zns qds as prepared above was added dropwise to the 10 ml facs solution under ultrasonication , allowed to sonicate for 10 minutes and stirred for another 1 hour . following the stirring , the centrifugation and washing procedure was repeated thrice and finally , the wet pellet was collected and air dried for 2 days to obtain the powder of facs - mn : zns nanocomposite . for the characterization of facs - mn : zns composite , different instruments were applied at various stages of the analysis ; for example , the particle size and surface morphology was determined using high - resolution transmission electron microscopy ( hrtem ) collected on tecnai g2 f20 ( fei company , hillsboro , or , usa ) and the samples were prepared by dispersing the particles in distilled water and drop casted onto a carbon - coated copper grid . similarly , gold sputtered samples were prepared and collected on a sample holder attached to a constructive aluminum foil using carbon adhesive for further morphology studies using field emission scanning electron microscopy ( fesem ) on jeol jsm-7600f ( jeol , tokyo , japan ) . elemental analysis of the samples were simultaneously recorded using the same instrument attached to energy dispersive analysis x - ray ( edax ) analyzer by focusing the electron beam onto the particles and the spectrums were obtained through the random capturing of micrographs . x - ray photoelectron spectroscopy ( xps ) measurements were carried out at a pressure of 10 mbar , using phi quantera ii ( ulvac - phi , inc , chigasaki , japan ) instrument operating with an alk monochromatic source . fourier transform infrared ( ftir ) analysis was conducted on the samples over 4,500500 cm wavenumber region at a resolution of 8 cm with 1,024 scan using spectrum 100 ( perkinelmer , waltham , ma , usa ) . for that , the transparent pellets of the samples were prepared by grinding the material with dry powder of potassium bromide . for the x - ray fluorescence ( xrf ) analysis , approximately 1 g of the sample was mixed with 6 g h3bo3 and pressed under 10 tons of pressure and was used to further determine the elemental composition using xrf - energy dispersive x - ray spectroscopy ( edx ) 720 , wavelength - dispersive spectrometer ( shimadzu , kyoto , japan ) equipped with an array of five analyzing crystals fitted with rh x - ray tube target . the dynamic light scattering ( dls ) analyses were conducted to measure the average particle size and distribution of the particles in solution phase with the help of malvern nano series , zetasizer instrument ( malvern instruments , malvern , uk ) . the dispersed sample in deionized water was collected in a cuvette and triplicate measurement was taken as mean standard deviation ( sd ) . the crystallinity of the sample was determined using powder x - ray diffraction ( xrd ) instrument xrd 6000 ( shimadzu ) and the crystal structure was analyzed using nickel - filtered cuk radiation . the thermographic analysis ( tga ) was conducted on a tg 7 perkinelmer instrument at a heating rate of 10c min in nitrogen atmosphere and the weight losses up to 600c was recorded . the uv - vis spectroscopic analyses were carried out on perkinelmer lambda 35 spectrometer by dispersing the samples in deionized water in a wavelength range of 200500 nm . for the fluorescence measurements , shimadzu spectrofluorimeter , rf-5301pc was used and the samples were prepared by dispersing in deionized water and the measurements were conducted at slit width kept at 5 nm on both 328 nm excitation wavelength . the microscopic fluorescence imaging was conducted using confocal microscopy , olympus fv1000 ( singapore ) , with silicone immersion and oil- and water - immersion objectives equipped with gallium phosphine detector ( olympus ) . the cell viability was assessed based on the metabolic activity of the cells to reduce a soluble yellow tetrazolium salt ( mtt dye , 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ) to blue violet formazan crystals.40 briefly , two different human breast cancer cell lines , mcf-7 and mda - mb-231 and one healthy normal breast cell line , mcf-10 were maintained separately in dulbecco s modified eagle s medium ( dmem ) supplemented with 10% ( v / v ) fetal bovine serum ( fbs ) and 1% antibiotics ( penicillin , 100 units / ml ; streptomycin , 100 g / ml ) in an incubator at 37c , 5% co2 , and in 95% humidity . approximately 10 cells / well were seeded onto 96-well plates and allowed to grow for 24 hours . at approximately 80% cell confluence level , the medium was replaced with fresh dmem containing 2% ( v / v ) fbs and varying concentrations ( 7500 g / ml ) of facs - mn : zns with phosphate - buffered saline ( pbs ) ( ph 7.4 ) and incubated for another 24 hours . following the incubation period , 20 l of mtt ( 5 mg / ml ) was added and incubated for another 34 hours . after the incubation , the solution was removed and 100 l dimethyl sulfoxide ( dmso ) was added ; the solubilized crystals were measured at 570 nm using the quant enzyme - linked immunosorbent assay plate reader ( biotek instruments , winooski , vt , usa ) . the percentage cell viability was then calculated with respect to the untreated control ( set at 100% ) and the values were taken as mean sd of three replicate experiments . for the cell imaging study , the respective cells were separately maintained in dmem supplemented with 10% ( v / v ) fbs and 1% antibiotics ( penicillin , 100 units / ml ; streptomycin , 100 g / ml ) in an incubator at 37c , 5% co2 , and in 95% humidity . the cells were washed with pbs ( ph 7.4 ) and seeded at two different densities 210 and 310 per well onto a cover glass inside of 24-well plate . further washing of cells were conducted using pbs and replaced with a fresh media containing the facs - mn : zns composite ( 100 g / ml ) and incubated for 4 hours at 37c . the cells were finally washed with pbs and fixed with 2% formaldehyde and mounted with mounting medium and imaged . the microscopic fluorescence imaging was conducted using confocal microscopy , olympus ( fluoview f1200 ) with silicone immersion and oil- and water - immersion objectives equipped with gallium phosphine detector . the fluorescence generated by the qds was captured using effective excitation 360 nm and 550640 nm emission filters . low - molecular - weight cs ( 75%85% degree of deacetylation ) was purchased from sigma - aldrich ( st louis , mo , usa ) , while the other chemicals such as ethanol ( 99.5% ) was purchased from fisher scientific ( selangor , malaysia ) and acetic acid ( 99.85% ) from benson lab chemicals ( selangor , malaysia ) . zinc acetate dehydrate ( zn ( oac)22h2o ) 99.5% , fa ( c19h9n7o6 , 98% ) , sodium sulfide ( na2sxh2o ) , manganese sulfate ( mnso4h2o , 99% ) , and sodium tripolyphosphate ( na5o10p3 , 59% ) were purchased from r&m marketing ( essex , uk ) . for the preparation of folic acid chitosan stabilized mndoped zns ( facs - mn : zns ) qds , the three sequential steps involved are demonstrated schematically in figure 1 . the first step involves the formation of stable fa and cs suspension and for that , we prepared 5 ml ( at 4 mg / ml concentration ) of water - soluble cs by protonating the nh2 group with 1% acetic acid39 under stirring while adjusting the ph to 5.4 using 0.1 m naoh . further , 2 ml of 1 mg / ml fa in distilled water was prepared separately and stirred for 1 hour to form fa solution and the resulting solution was then added to the cs solution dropwise under constant stirring for 2 hours . now 2 ml of 1 mg / ml tripolyphosphate was added as a cross - linker drop by drop to the mixture and stirred for 8 hours to form the stable suspension of facs . the second step involves the synthesis of highly luminescent mn : zns qds following simple modified wet method as described by mathew et al.4 briefly , 1.5 ml of mnso4 ( varying at.% ) was prepared and added dropwise to 10 ml zn(oac)2 ( 0.1 m ) under ultrasonication and stirred well by bubbling with n2 gas for 15 minutes . to the resulting mixture , 10 ml of na2s ( 0.1 m ) was added drop by drop under constant stirring to form a white precipitate in the process while maintaining the ph to ~5.4 . the doping processes were observed for the emission of orange fluorescence under handheld uv lamp . in order to suppress unwanted relaxation phenomenon from dominating the energy pathways , the obtained precursor was immediately exposed to microwave irradiation for 1 minute and further stirred for 1 hour.4,10 the conjugation of facs to the mn : zns qds was carried in the third step and for that , the mn : zns qds as prepared above was added dropwise to the 10 ml facs solution under ultrasonication , allowed to sonicate for 10 minutes and stirred for another 1 hour . following the stirring , the centrifugation and washing procedure was repeated thrice and finally , the wet pellet was collected and air dried for 2 days to obtain the powder of facs - mn : zns nanocomposite . for the characterization of facs - mn : zns composite , different instruments were applied at various stages of the analysis ; for example , the particle size and surface morphology was determined using high - resolution transmission electron microscopy ( hrtem ) collected on tecnai g2 f20 ( fei company , hillsboro , or , usa ) and the samples were prepared by dispersing the particles in distilled water and drop casted onto a carbon - coated copper grid . similarly , gold sputtered samples were prepared and collected on a sample holder attached to a constructive aluminum foil using carbon adhesive for further morphology studies using field emission scanning electron microscopy ( fesem ) on jeol jsm-7600f ( jeol , tokyo , japan ) . elemental analysis of the samples were simultaneously recorded using the same instrument attached to energy dispersive analysis x - ray ( edax ) analyzer by focusing the electron beam onto the particles and the spectrums were obtained through the random capturing of micrographs . x - ray photoelectron spectroscopy ( xps ) measurements were carried out at a pressure of 10 mbar , using phi quantera ii ( ulvac - phi , inc , chigasaki , japan ) instrument operating with an alk monochromatic source . fourier transform infrared ( ftir ) analysis was conducted on the samples over 4,500500 cm wavenumber region at a resolution of 8 cm with 1,024 scan using spectrum 100 ( perkinelmer , waltham , ma , usa ) . for that , the transparent pellets of the samples were prepared by grinding the material with dry powder of potassium bromide . for the x - ray fluorescence ( xrf ) analysis , approximately 1 g of the sample was mixed with 6 g h3bo3 and pressed under 10 tons of pressure and was used to further determine the elemental composition using xrf - energy dispersive x - ray spectroscopy ( edx ) 720 , wavelength - dispersive spectrometer ( shimadzu , kyoto , japan ) equipped with an array of five analyzing crystals fitted with rh x - ray tube target . the dynamic light scattering ( dls ) analyses were conducted to measure the average particle size and distribution of the particles in solution phase with the help of malvern nano series , zetasizer instrument ( malvern instruments , malvern , uk ) . the dispersed sample in deionized water was collected in a cuvette and triplicate measurement was taken as mean standard deviation ( sd ) . the crystallinity of the sample was determined using powder x - ray diffraction ( xrd ) instrument xrd 6000 ( shimadzu ) and the crystal structure was analyzed using nickel - filtered cuk radiation . the thermographic analysis ( tga ) was conducted on a tg 7 perkinelmer instrument at a heating rate of 10c min in nitrogen atmosphere and the weight losses up to 600c was recorded . the uv - vis spectroscopic analyses were carried out on perkinelmer lambda 35 spectrometer by dispersing the samples in deionized water in a wavelength range of 200500 nm . for the fluorescence measurements , shimadzu spectrofluorimeter , rf-5301pc was used and the samples were prepared by dispersing in deionized water and the measurements were conducted at slit width kept at 5 nm on both 328 nm excitation wavelength . the microscopic fluorescence imaging was conducted using confocal microscopy , olympus fv1000 ( singapore ) , with silicone immersion and oil- and water - immersion objectives equipped with gallium phosphine detector ( olympus ) . the cell viability was assessed based on the metabolic activity of the cells to reduce a soluble yellow tetrazolium salt ( mtt dye , 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ) to blue violet formazan crystals.40 briefly , two different human breast cancer cell lines , mcf-7 and mda - mb-231 and one healthy normal breast cell line , mcf-10 were maintained separately in dulbecco s modified eagle s medium ( dmem ) supplemented with 10% ( v / v ) fetal bovine serum ( fbs ) and 1% antibiotics ( penicillin , 100 units / ml ; streptomycin , 100 g / ml ) in an incubator at 37c , 5% co2 , and in 95% humidity . approximately 10 cells / well were seeded onto 96-well plates and allowed to grow for 24 hours . at approximately 80% cell confluence level , the medium was replaced with fresh dmem containing 2% ( v / v ) fbs and varying concentrations ( 7500 g / ml ) of facs - mn : zns with phosphate - buffered saline ( pbs ) ( ph 7.4 ) and incubated for another 24 hours . following the incubation period , 20 l of mtt ( 5 mg / ml ) was added and incubated for another 34 hours . after the incubation , the solution was removed and 100 l dimethyl sulfoxide ( dmso ) was added ; the solubilized crystals were measured at 570 nm using the quant enzyme - linked immunosorbent assay plate reader ( biotek instruments , winooski , vt , usa ) . the percentage cell viability was then calculated with respect to the untreated control ( set at 100% ) and the values were taken as mean sd of three replicate experiments . for the cell imaging study , the respective cells were separately maintained in dmem supplemented with 10% ( v / v ) fbs and 1% antibiotics ( penicillin , 100 units / ml ; streptomycin , 100 g / ml ) in an incubator at 37c , 5% co2 , and in 95% humidity . the cells were washed with pbs ( ph 7.4 ) and seeded at two different densities 210 and 310 per well onto a cover glass inside of 24-well plate . further washing of cells were conducted using pbs and replaced with a fresh media containing the facs - mn : zns composite ( 100 g / ml ) and incubated for 4 hours at 37c . the cells were finally washed with pbs and fixed with 2% formaldehyde and mounted with mounting medium and imaged . the microscopic fluorescence imaging was conducted using confocal microscopy , olympus ( fluoview f1200 ) with silicone immersion and oil- and water - immersion objectives equipped with gallium phosphine detector . the fluorescence generated by the qds was captured using effective excitation 360 nm and 550640 nm emission filters . in the present study , facs - mn : zns qds were prepared specifically for theranostic applications by combining the targeted drug delivery and imaging capabilities of fa and qds , respectively . the formed composite particles were thoroughly characterized for their size , morphology , crystalline behavior , thermal stability , etc , and also tested for cytobio - compatibility studies to suite as safe drug delivery vehicles . further , the in vitro fluorescence imaging studies on cancer and noncancer cells were conducted in order to establish the luminescent efficiency of the conjugated contrast agents for live cell imaging of cancerous tumors . the fesem and edax analysis of facs - mn : zns qds are shown in figure 2a and b and from the microscopic image , the particles seem to be agglomerated due to the over conjugation of qds with that of cs biopolymer ( figure 2a ) . also , from the edax spectrum shown in figure 2b , one can clearly see the presence of corresponding peaks related to specific elements of interest in the composite . the major peaks corresponding to zn and s are the indications for the presence of zn s matrix in the composite.41 interestingly , despite the small amount of mn impurities doped into the zns matrix , we were able to see a minor peak corresponding to mn in the final composite . as seen from the spectrum , the presence of au is from the au sputtered sample grid used in the fesem analysis.42 the hrtem image , particle size distribution from tem ( in powder phase ) , and dls analysis ( in solution phase ) are shown in figure 2c e , respectively . from the figure 2c , the particles are seem to be spherical and uniform but are fully agglomerated as similar to the result of fesem ( figure 2a ) . for the facs - mn : zns particles , an average particle size of 5.31.0 nm is observed from the tem analysis ( figure 2d ) , while ~200 nm hydrodynamic size is observed from the dls analysis ( figure 2e ) . the differences in particle sizes between the tem ( recorded in powder form ) and dls analysis ( recorded in solution form ) can be attributed to the swelling behavior of the cs polymer.43 the other possible explanation for the smaller particle size recorded by tem analysis is that , at lower acidic conditions ( ph ~56 ) , more amine and carboxylate groups from cs chain that are readily made available for bonding with the zn ions , thus acting as electron donors , which reduces the electrostatic repulsion and thereby favoring the stabilization of mn : zns nanocrystals to a more smaller and compact dimensions.44 thus from the cumulative analysis , the maximum particle size recorded for facs - mn : zns in both the solution phase ( dls , ~200 nm ) and powder form ( ~5.3 nm ) still falls within nanometer range . the elemental analysis of facs - mn : zns qds following xps and xrf analyses are shown in figure 3a e and table 1 , respectively . figure 3a shows the comparison of xps scanned surveys of facs - mn : zns composite and bare mn : zns qds of which both were prepared with 15 at.% of mn doping . one can see from the spectra that , only the peaks of zn , s , mn , o , and c are vividly appeared and when compared with bare mn : zns qds , a small peak corresponding to nitrogen ( n ) appearing only in the survey analysis of facs - mn : zns , providing the information about the conjugation of fa and cs molecules . further in figure 3b , the peak of zn 2p3/2 appeared at 1,021 ev for the bare mn : zns and 1,020 ev for facs - mn : zns confirming the existence of zn largely as zn linked to a sulfur atom . the binding energies of zn 2p3/2 and s 2p were only weakly affected by the conjugation of mn : zns with facs showing a shift of ~1 ev when conjugated with cs and fa . we also observed a very weak peak for mn 2p3/2 centered at 640 and 639 ev on conjugating with facs as represented in figure 3c . the observation of a weak peak can be due to the low concentration of mn element at the surface of the qds , a similar phenomenon was reported by some researchers following the doping of mn on zns nanocrystals.45,46 figure 3d shows the peak of s 2p3/2 , where the spectra for bare mn : zns qds has its peak centered at 162 ev , while the peak shifted to 160 ev on conjugation with facs . following the anchorage of mn : zns qds with cs and fa , the xps spectrum showed a signal of n 1s corresponding to the nitrogen atom from the amine groups of either the fa or cs ( figure 3e ) . the presence of elements in the composite was further substantiated from the xrf results shown in table 1 , approximately 80% and 13% corresponding to zn and s , respectively was recorded . however , it has been reported by some researchers that the actual concentration of mn ( at.% ) incorporated into the host zns is quiet less than the amount used during the synthesis . kole et al10 using electron probe microanalyzer reported that the optimum amount of mn concentration of 1.10 ( at.% ) corresponded to 40.0 ( molar % ) concentrations used during the synthesis . as a consequence of these observations , inductively coupled plasma - optical emission spectrometry analysis was used by some researchers to determine the actual concentration of mn . in their study , kole et al used 1 and 5 at.% of mn with respect to zn during the synthesis , but from the outcome of the analysis , the actual concentration of the mn incorporated into the final product was found to be 0.04 at.% for 1 at.% used and 0.18 at.% for 5 at.% used during the synthesis.10 these findings provide a proof for the observation of only trace amounts of mn recorded by edax , xps , and xrf analysis in our study . figure 4a c shows the powdered xrd pattern , thermal analysis , and ftir spectrums of mn : zns before and after conjugation with facs , respectively . the pattern in figure 4a indicates the formation of zns in a cubic blend ( sphalerite ) structure by the observation of peaks at 28.46 , 48.16 , and 55.28 corresponding to prominent diffraction at ( 111 ) , ( 220 ) , and ( 311 ) , respectively . the pattern shows no lattice distortion of the presence of mn impurities or any differentiated lattice structure with that of zn . one probable reason can be a result of the similarity in the oxidation state and ionic radii of mn with that of zn , in addition to the lower concentration of mn . however , a slight reduction in the peak intensity of facs - mn : zns is observed probably due to the complete coverage of mn : zns qds with that of cs and fa molecules . the thermal analysis studied for cs , mn : zns , and facs - mn : zns recorded in the temperature range of up to 600c ( figure 4b ) indicates the stability of mn : zns composite due to its conjugation with fa and cs . from the tga graph for pure cs , two curves are observed ; the observation of the first curve below 200c temperature can be attributed to the moisture loss from the sample , while the second curve around 230c is due to the decarboxylation of coo groups . also , the graph of mn : zns sample has some weight loss during 60c150c and this loss can be attributed to the evaporation of occluded moisture adsorbed at the surface of the particles . the particles displayed thermal stability after 300c up to 600c and finally left with around 50% of its initial weight . as similar to the other curves , the tga curve of facs - mn : zns shows a drop in weight from 50c to 120c due to the moisture loss and a slight depression during 150c450c either from the decarboxylation of the carboxylate groups or from loss of co2 . the observation of thermal stability in accordance with bare mn : zns in the temperature range of 450c600c is an indication for the persistence of mn and zn ions in the composite . furthermore , the thermal behavior of facs - mn : zns composite at 600c remaining with the highest weight of 70% as compared with the other two samples serves as a proof for the applicability of the concept of polymer composite formation to nanomaterials . the comparison of ftir spectra of facs - mn : zns composite with that of bare mn : zns , fa , and cs are shown in figure 4c . for the as - synthesized bare mn : zns , the characteristic absorption bands originated largely from zn s mn bonds only . also , the observation of a broad band in the bare mn : zns sample at 3,254 cm corresponds to the stretching vibration of hydroxyl ( o h ) group from the occluded water absorbed by the crystals ; similar vibration mode was also observed at 3,284 cm in the facs - mn : zns composite too . the two silent peaks at 2,358 and 2,166 cm can be due to zn s microstructure vibration and from co stretching vibrations , respectively . the zn s vibration peak ( at 2,358 cm ) observed in mn : zns is not pronounced in the spectra of facs - mn : zns and can be attributed to the interaction between the zn s and the carboxylate groups of fa or cs . the peaks at 1,406 and 1,544 cm in the spectra of mn : zns can be assigned to the symmetric and asymmetric stretching of coo , respectively , while the peak at 1,113 cm corresponds to the symmetric stretching vibration of zn s mn bond . this peak is however not visible in the spectra of facs - mn : zns probably due to the masking of c o c stretching vibrations of peak at 1,077 cm on cs s peak ( at 1,030 cm ) . this can also be the reason for the observation of a shifted peak at 1,019 cm in the spectra of mn : zns to 1,020 cm as seen in the spectra of facs - mn : zns . the small peaks at 906 and 1,183 cm in the spectra of facs - mn : zns can be from the aromatic c h out - of - plan bending of fa ( 908 cm ) and c both samples shows zns band and symmetric bending due to zn s or mn s vibrations at 656 and 609 cm for mn : zns and 667 and 614 cm in the spectra of facs - mn : zns , respectively . similarly , the peaks at 475 cm in the spectra of mn : zns and 465 cm for facs - mn : zns can be due to s s or mn o or s o interactions . the comparison of uv - vis absorption spectra of fa , bare mn : zns , and facs - mn : zns qds is shown in figure 5a and the tauc plot in figure 5b . as shown in the figure 5a , the absorption of fa is observed at 280 nm , while the bare mn : zns has absorption onset at 328 nm and facs - mn : zns at 318 nm . from the spectra , the optical absorption properties of the synthesized facs - mn : zns shows an absorption peak that is slightly red shifted from the absorption band edge of bulk zns qds ( at 334 nm ) owing to quantum confinement effects47 and following the doping of host zns with mn impurities.48 figure 5b shows the tauc plot of ( hv)2 versus ( hv ) from the uv - vis spectra and by extrapolation of the linear part of the curve to the energy axis based on equation 1 , the band gap energy of our sample ( eg ) facs - mn : zns qds was calculated to be 5.08 ev , a blue shift of approximately 1.4 ev from the band gap energy of bulk zns taking from literature value,10 hv = b(hveg)12(1)where is the absorption coefficient , hv is the photon energy , eg is the direct band gap energy , and b is a constant . the mn : zns qd s characteristic fluorescence behavior and its mechanism at various stages is fully demonstrated in figure 6a c . the figure 6a shows the comparison of fluorescence spectra of bare zns qds ( without mn doping ) and facs - mn : zns ( with mn doping ) . the fluorescence comparison of the two samples provides the information that the doping of zns qds with suitable impurity such as mn and independent of particle size can significantly enhance its luminescence properties . as seen from the spectra , the doping of zns with mn induces a red shift from the blue region at 450 nm , typical of undoped zns to more biofriendly visible region . the characteristic zns spectral shifted from the blue region toward the red region on doping with mn impurities and resulted in the emission of orange fluorescence at 600 nm . similarly , figure 6b shows what actually transpired following the doping chemistry , a change in color to orange when viewed under handheld uv lamp . from the jaboliski diagram shown in figure 6c , several mechanisms interplay to produce fluorescence emission in qds following the excitation of ground state electron to the excitonic state . the excited electrons either radiatively or nonradiatively relax and in the process , they recombine with the holes in the ground state with the emission of fluorescence light . in the case of zns as diagrammatically represented , the electron in the conduction band ( cb ) of zns lattice radiatively relaxes to the hole in the valence band ( vb ) passing through interstitial pathways of sulfur ( is ) and zn ( iz ) . the emission at 470 nm is due to the relaxation that occurs when the excited state electrons are trapped by sulfur vacancy donor levels.49,50 the mn ion has a d5 configuration , where the d - electron state plays a central role as the luminescence center by interacting strongly with the s p electronic state of the host zns in response to the electronic excitation.10 the resultant transfer of electrons and holes charges into the electronic level of mn ions allow the emission of characteristic orange red fluorescence following t1a1 transition of the mn ion.10 to further buttress the phenomenon surrounding the effect of doping of atoms to zns , several pathways are reported to take part during the excitation of mn in the host zns and the subsequent orange emission ( oe ) . as can be seen in figure 6c , three main possible pathways maybe responsible for the electron hole recombination that further leads to oe:50 in the first relaxation pathway , there exists the possibility that the electron in the cb of the zns lattice radiatively relaxes to the holes in the vb through is and iz ( ie , interstitial sites of sulfur and zinc ) . due to lattice strain induced by is and the large ionic radius of sulfur ion as compared with zn ions , the electrons initiated by is has small binding energy relative to zn ion.49 in the second relaxation pathway , it is possible that the blue emission can be observed at 475 nm from the relaxation that occurs when the electrons in the excited state are trapped by the sulfur vacancy donor levels.it is further considered that : a ) the excited electrons trapped by the sulfur vacancy level can nonradiatively relax to the t1 level of mn ; and b ) the electrons in the excited state may directly relax to the t1 level of mn by nonradiative transition . as previously mentioned , the electrons generated at t1 level of mn following either of the possible paths can recombine radiatively with the holes trapped in the ground state ( a1 ) of mn ions ; this accounts for the oe recorded in our study at ~600 nm . the fluorescence emission at the visible and far red is more intense than the blue emission regions . one possible reason can be due to the nonradiative transition of electrons from the cb to the t1 level of the mn ions is much faster than the electron captured by the sulfur vacancy level.51 in the first relaxation pathway , there exists the possibility that the electron in the cb of the zns lattice radiatively relaxes to the holes in the vb through is and iz ( ie , interstitial sites of sulfur and zinc ) . due to lattice strain induced by is and the large ionic radius of sulfur ion as compared with zn ions , the electrons initiated by is has small binding energy relative to zn ion.49 in the second relaxation pathway , it is possible that the blue emission can be observed at 475 nm from the relaxation that occurs when the electrons in the excited state are trapped by the sulfur vacancy donor levels . it is further considered that : a ) the excited electrons trapped by the sulfur vacancy level can nonradiatively relax to the t1 level of mn ; and b ) the electrons in the excited state may directly relax to the t1 level of mn by nonradiative transition . as previously mentioned , the electrons generated at t1 level of mn following either of the possible paths can recombine radiatively with the holes trapped in the ground state ( a1 ) of mn ions ; this accounts for the oe recorded in our study at ~600 nm . the fluorescence emission at the visible and far red is more intense than the blue emission regions . one possible reason can be due to the nonradiative transition of electrons from the cb to the t1 level of the mn ions is much faster than the electron captured by the sulfur vacancy level.51 the comparison of fluorescence behavior of facs - mn : zns qds as against the changes in the physical parameters such as uv light , ph , and dopant concentration are shown in figure 7a d . from the comparison of fluorescence spectra shown in figure 7a and b , there is a possibility of unwanted relaxation pathways recombining to produce the defect curve observed between 400 and 470 nm regions . this characteristic phenomenon was observed to be more pronounced on the synthesized samples in the absence of uv irradiation ( figure 7a ) and however observed to be milder on samples treated under uv irradiation ( figure 7b ) . the treatment of qds with uv irradiation being used by most researchers to enhance the luminescence center of mn - doped zns suppresses the activity of unwanted nonradiative recombination.1012 however , from the spectra , after treatment with uv irradiation , we expect a significant rise in the fluorescence intensity but on the contrary , a drop in intensity was recorded for facs - mn : zns . one possible conclusion is that , the polymer conjugated to the qds may induce a restriction of the rotational motion of dipole molecules and immobilization of the electron hole charge ions , thereby interfering with the surface chemistry.52,53 geszke et al44 reported two possible mechanisms as reason for the observed quenching effects : 1 ) the fa conjugated to the qds can interfere and trap part of the excitation light intensity driven by collisions between fa and qds ; and 2 ) fa readily conjugate to mn : zns through the carboxylate groups or through the nitrogen atoms . following this strong affinity toward each other , there exists the possibility that the highest occupied molecular orbital and lowest unoccupied molecular orbital of the fa overlap with the cbs of zn ( 4s ) initiating energy transfer from the mn : zns to the fa . in order to reduce the quenching effect as a result of the conjugation of the qds with fa , they observed and reported in their experiment that the luminescence intensity of qds was only weakly altered ( ~5% ) when the concentration at molar ratios of fa : qds was maintained near to 0.01 . the fluorescence intensity behavior measured as against the changes in external factors such as ph ( figure 7c ) and dopant ion concentration ( figure 7d ) indicates that they both have significant influence toward the fluorescence efficiency . as seen from the comparison of spectra ( figure 7c ) , the fluorescence intensity increases from ph 4 to 8 and it drops from ph 12 to a level below ph 8 . from the observed pattern , due to higher acidic environment at ph 4 , there is a possibility for the dissociation of carboxylate or amino groups present at the surface of qds and thereby distorting the coordination . also , the high alkaline environment at ph 12 favors the formation of metal oxides or hydroxides as a result of the presence of large number of oh ions . based on the observed pattern , fluorescence efficiency was recorded to be more stable at low acidic and low alkaline ph ( ie , ph around 68 ) . similarly , the changes in spectra from blue to visible region on doping of zns with mn were also observed to increase following an increase in the concentration of mn ( figure 7d ) . the comparison of cell viability and proliferation studies following the treatment of mn : zns and facs - mn : zns as against different cell lines are shown in figure 8a d . the mtt assay was performed on two breast cancer cell lines , mcf-7 ( figure 8a ) , mda - mb-231 ( figure 8b ) , and normal human breast cell line ( mcf-10 , figure 8c ) grown for 24 hours with medium containing bare mn : zns qds and facs - mn : zns with concentrations ranging from 7 to 500 g / ml . from the comparative analysis of the cells cultured without the composites as control , the results demonstrated that the qds did not exhibit discernable adverse effects in vitro in all the cell lines . the results show only a slight reduction in the cells viability in response to an increase in qds concentrations , especially pronounced from 62 to 500 g / ml on cells treated with facs - mn : zns as compared with those exposed to bare mn : zns qds . one possible reason for this slight reduction in cells viability for the cells treated with facs - mn : zns can be due to the enhanced cellular binding interactions between the conjugated fa - containing qds with the fr - expressed cancer cells . these relationships were further substantiated when comparing the mtt result of normal breast cell line ( mcf-10 ) with that of cancer breast cells ( mcf-7 and mda - mb-231 ) treated with facs - mn : zns ( figure 8d ) . from the result , the reduction in cells viability was observed to be more pronounced on cells expressing frs ( mcf-7 and mda - mb-231 ) as compared with the normal cells without frs ( mcf-10 ) , suggesting that the expression of frs on cancerous cells enhances the intracellular concentrations of qds conjugated with fa . the in vitro fluorescence imaging studies conducted on human breast cancer lines ( mcf-7 and mda - mb-231 ) that expressed frs and normal breast cells ( mcf-10 ) without frs are shown in figure 9a d . from the figure , it can be seen that the composite conjugated with fa demonstrated specific attachment by emitting out cellular fluorescence from the qds attached to the frs expressed on the cancer cells ( figure 9b - iii and c - iii ) . however , just the milder fluorescence effects were observed on cells administered with nonconjugated fa composites ( mn : zns , figure 9a - iii ) and conjugated fa composites ( figure 9d - iii ) . thus , the observed fluorescence property demonstrated by the fr - overexpressing cells ( figure 9b and c ) supported the hypothesis that facs - mn : zns qds can serve as suitable contrasting agents for the online targeted imaging of cancerous cells . in conclusion , the present study indicates that the facs - mn : zns qds can be synthesized entirely at room temperature and aqueous medium following simple wet chemistry method . a fast low cost process utilizes environmentally suitable materials such as cs and fa to stabilize the qds and to formulate the composite with targeted drug delivery and imaging functionalities . with that , this report not just provides information about the synthesis of targeted mn : zns qds , but also serves as a reference for the characterization of those qds by means of various instrumental techniques such as xrd , xrf , xps , uv - vis , ftir , hrtem , fesem , edax , tga , and fluorescence . from the results obtained so far , we are convinced that the doping of mn - atom impurities will significantly enhance the luminescence centers of zns nanocrystals and will widely support the considerable interest for the use and application of doped zns qds as excellent materials for targeted fluorescence imaging studies . of greater interest , the in vitro cytotoxicity study of the composite shows that the qds are nontoxic to human breast cell lines and demonstrated specific cellular uptake by fr - expressing cancer cells , emitting fluorescence efficiency in the process . thus , following the effective encapsulation of the qds with biodegradable polymer and conjugated with a targeting ligand , the as - synthesized facs - mn : zns composite can further support the ongoing effort toward the effective targeted drug delivery and imaging of tumor - bearing cells .

in this study , we synthesized a multifunctional nanoparticulate system with specific targeting , imaging , and drug delivering functionalities by following a three - step protocol that operates at room temperature and solely in aqueous media . the synthesis involves the encapsulation of luminescent mn : zns quantum dots ( qds ) with chitosan not only as a stabilizer in biological environment , but also to further provide active binding sites for the conjugation of other biomolecules . folic acid was incorporated as targeting agent for the specific targeting of the nanocarrier toward the cells overexpressing folate receptors . thus , the formed composite emits orange red fluorescence around 600 nm and investigated to the highest intensity at mn2 + doping concentration of 15 at.% and relatively more stable at low acidic and low alkaline ph levels . the structural characteristics and optical properties were thoroughly analyzed by using fourier transform infrared , x - ray diffraction , dynamic light scattering , ultraviolet - visible , and fluorescence spectroscopy . further characterization was conducted using thermogravimetric analysis , high - resolution transmission electron microscopy , field emission scanning electron microscopy , energy dispersive x - ray spectroscopy , x - ray fluorescence , and x - ray photoelectron spectroscopy . the cell viability and proliferation studies by means of mtt assay have demonstrated that the as - synthesized composites do not exhibit any toxicity toward the human breast cell line mcf-10 ( noncancer ) and the breast cancer cell lines ( mcf-7 and mda - mb-231 ) up to a 500 g / ml concentration . the cellular uptake of the nanocomposites was assayed by confocal laser scanning microscope by taking advantage of the conjugated mn : zns qds as fluorescence makers . the result showed that the functionalization of the chitosan - encapsulated qds with folic acid enhanced the internalization and binding affinity of the nanocarrier toward folate receptor - overexpressed cells . therefore , we hypothesized that due to the nontoxic nature of the composite , the as - synthesized nanoparticulate system can be used as a promising candidate for theranostic applications , especially for a simultaneous targeted drug delivery and cellular imaging .

Introduction Materials and methods Chemicals Synthesis of folic acidchitosan stabilized Mn Instrumental analysis In vitro cell viability and fluorescent imaging study Results and discussion Conclusion

benign prostatic hyperplasia ( bph ) is found in over half of 60-year - old men and in almost all 80-year - old men who develop bladder outlet obstruction ( boo ) and lower urinary tract symptoms ( luts ) . boo is the initial pathophysiological change caused by an enlarged adenoma and is followed by detrusor overactivity ( do ) or underactivity ( dua ) . the degree of boo is an important factor that can reflect the severity of disease and that can aid in choosing a treatment method as well as in measuring the outcome of the treatment . it has been shown that one third of male patients with luts do not have definite boo and that 5 to 35% of the patients with luts and undefined boo do not have favorable symptom recovery after transurethral resection of the prostate ( turp ) [ 2 - 7 ] . relevant examinations ranging from serum prostate - specific antigen ( psa ) to urodynamics can all reflect different aspects of the severity of bph . urodynamics is the only method , however , that can quantify the degree of boo and the status of detrusor contractility . therefore , guidelines from the international scientific committee and the american urological association on the management of bph both recommend the use of urodynamics to evaluate bph patients considered as candidates for invasive therapy . however , the routine use of preoperative urodynamics is still a controversial point in published articles because of the invasiveness and high costs of the method . in this research , we attempted to determine whether other parameters could be used to measure the severity of boo through less - invasive or noninvasive examinations by analyzing correlations among parameters from clinical history , symptoms , ultrasonography , and urodynamics . this retrospective analysis was conducted on patients with bph who had received either medication or surgical treatment at this hospital between may 2010 and june 2011 . the therapeutic decision for turp all patients were evaluated with the international prostate symptom score ( ipss , including the total score ; subtotal score of storage symptoms comprising the summation of nocturia , urgency , and an increased frequency score ; and subtotal score of voiding symptoms comprising the summation of hesitancy , intermittency , and weak stream score ) and quality of life ( qol ) questionnaires in addition to undergoing basic clinical evaluations ( medical history , physical examination , urinalysis , and renal function assessment ) before treatment . free flowmetry measurement was performed for all patients with the result being adopted when the voiding volume was more than 150 ml . urodynamics was performed only for patients needing surgery by use of a multichannel system ( uds64-iii , laborie co. , quebec , canada ) . first , water - filling cystometry was done with the patients in the supine position with the use of a transurethral 12 fr double - lumen catheter and the simultaneous monitoring of rectal pressure . filling was performed at a rate of 50 ml / min with normal saline and was stopped if the patient had a strong desire to void . pressure flow study ( pfs ) was then performed by asking the patients to void in an upright position with a suprapubically placed 6 fr cystostomy tube to monitor the bladder pressure . maximum urinary flow ( qmax ) and pressure of the detrusor at qmax ( pdetqmax ) were recorded . the bladder outlet obstruction index ( booi , by " pdetqmax-2qmax " ) and the bladder contractility index ( by " pdetqmax+5qmax " ) were then calculated by use of equations from the ics . total prostate volume ( tpv ) , transitional zone volume ( tzv ) , intravesical prostatic protrusion ( ipp ) , and post - voiding residual ( pvr ) were measured by transrectal ultrasonography ( trus ) with the transitional zone index ( tzi , by " tzv / tpv " ) being calculated for all patients . the exclusion criteria for enrolled subjects were 1 ) booi less than 20 or qmax more than 20 ml / s , 2 ) disease with boo other than bph , 3 ) history of prostatic or urethral surgery , 4 ) diagnosed carcinoma of the prostate or bladder , 5 ) known bladder stones or neurogenic bladder dysfunction , and 6 ) not having taken standard medication involving both alpha - adrenergic blockers and 5-alpha - reductase inhibitors for over 6 months . the relevant clinical data of the subjects were recorded and classified by degree of ipp ( < 10 mm , 10 to 20 mm , and > 20 mm ) and tzi value ( < 0.5 , 0.5 to 0.7 , and > 0.7 ) . all quantitative variables were tested for the type of distribution by use of the one - sample kolmogorov - smirnov test . univariate analyses including one - way analysis of variance and kruskal - wallis test were used for variables with normal or skewed distributions , respectively , to assess the differences between patients receiving drug therapy and those undergoing surgical therapy and between patients with different degrees of ipp and tzi values . the -test was used for categorical variables to identify whether there were different incidences of acute urinary retention ( aur ) influenced by different ipp or tzi grade . finally , bivariate correlation and multiple regression analysis were used to assess correlations between parameters from trus and pfs . all analyses were performed by using the routines of the ibm spss ver . 19.0 ( ibm co. , new york , ny , usa ) , and the research attained ethical approval from the ethics committee of xin hua hospital , and all subjects gave written informed consent . a total of 365 patients were enrolled in the research study , with 203 patients receiving medication and the remainder having undergone turp . the clinical data of all subjects were classified according to therapy and degree of ipp and tzi and are listed in tables 1 and 2 . univariate analyses showed significant differences in the total , storage , and voiding scores of the ipss ; qol score ; tpv ; tzv ; tzi ; ipp ; and qmax between the therapy groups ( p<0.05 ) . baseline total prostate - specific antigen , tpv , tzv , ipp , qmax , pdetqmax , and booi classified by different degrees of tzi were also found to be significantly different ( p<0.05 ) . differences were also found in the voiding symptom score , tpv , tzv , tzi , qmax , and booi classified by degree of ipp ( p<0.05 ) . ipp ( p=0.000 ) and tzi ( p=0.000 ) both had statistically significant effects on the cause of aur ( table 2 ) by -test . the bivariate correlation analysis of parameters from symptom score , trus , and urodynamics showed significant correlations between tzi and qmax ( r=-0.887 , p=0.001 ) , pdetqmax ( r=0.725 , p=0.028 ) , and booi ( r=0.508 , p=0.029 ) and between ipp and voiding symptom score ( r=0.353 , p=0.033 ) , qmax ( r=-0.852 , p=0.014 ) , and booi ( r=0.469 , p=0.042 ) . multiple regression analysis in the subjects who underwent turp showed that both tzi and ipp had significant correlations with qmax and booi , whereas tzi had a significant correlation with pdetqmax ( table 3 ) . prostatic adenoma enlargement increases urethral resistance and leads to boo , further resulting in compensatory changes in bladder function . however , the elevated detrusor pressure required to maintain urinary flow in the presence of increased outflow resistance occurs at the expense of normal bladder storage function , which is the source of do . with the continuation of obstruction , decompensation of the detrusor and dua the degree of boo is correlated with the severity of obstruction - relevant symptoms , and the recovery of boo is used to evaluate the efficacy of treatment of bph . furthermore , the baseline degree of boo was recently found to influence the outcome of treatment . research has shown that patients with boo have better outcomes from turp than do those without boo [ 11 - 14 ] . one research study showed that patients with boo will still have a favorable surgical outcome even if they have do or dua . therefore , some hospitals use urodynamics as a routine preoperative examination to confirm whether the candidates have explicit boo and good detrusor contractility . however , urodynamic study is not totally innocuous , with significant evidence of discomfort and urinary infections associated with performing the examination , as well as imposing additional cost to the patient or to the institution . for this reason , some research has been initiated to find less - invasive or noninvasive examinations for evaluating the degree of boo . ipp measured as the shortest distance connecting the protruded end of the prostate into the bladder based on the bladder neck in the sagittal plane reflects the maximum longitudinal length of the prostate and may help in assessing the obstructive level of the prostate . first studied the correlation between ipp and the booi in 30 male outpatients in 2005 and found that ipp grading correlated well with the booi . analyzed 206 bph patients classified by different ipp grade and found that the ipp value positively correlated with tpv , psa , pvr , qmax , pdetqmax , and booi as well as the incidence of aur , bladder trabeculation , detrusor overactivity , and low bladder compliance . analyzed 260 men with luts and found that the booi was higher in patients with apparent ipp than in those without . the tzi calculated as tzv divided by tpv may also correlate with the obstructive level because higher volumes of the transition zone will result in harder pressure on the urethra . kaplan et al . evaluated 61 men with symptomatic bph and found a significant correlation between tzi and symptoms , qmax , and pdetqmax . analyzed 116 bph patients and found that tzi and tzv were both positively correlated with booi and ipss . milonas et al . reported that lower tzi was an independent predictor of ineffective surgical outcome . in the present study , we found significant correlations in surgical patients between both tzi and ipp with parameters reflecting the level of boo , such as qmax , pdetqmax , and booi . these results are consistent with the results of former research and suggest that tzi and ipp may be appropriate parameters in diagnosing and classifying boo . for a long period , turp has been the gold standard surgical procedure based on the concept of removing the whole enlarged adenoma involved in static and dynamic urethral obstruction . however , the development of medication such as alpha - adrenergic blockers and 5-alpha - reductase inhibitors has decreased the progression of bph and the operation rate in patients in recent years . however , some patients can not achieve favorable recovery from drug therapy and need a surgeon to relieve the symptoms . the patients needing surgical therapy in our research were found to have higher values of both ipp and tzi than the patients needing only drug therapy . this result suggests that ipp and tzi could measure the disease progression in bph patients receiving medication and might have predictive value for medication efficacy . higher ipp grade was found to correlate with higher voiding symptom score , which demonstrated that ipp could reflect the severity of bph from not only an objective aspect but also a subjective aspect . aur is one of the most serious complications of bph and an indication for surgical intervention . this research has found positive correlations between not only ipp but also tzi and the incidence of aur , which further suggests that these 2 factors might be used to predict the progression of bph and the possibility of undergoing surgical therapy . in general , this research investigated tzi and ipp from trus in bph patients and found positive correlations between these indexes and symptoms , boo level , and the incidence of aur . tzi and ipp were also found to differ significantly between bph patients receiving medication and those undergoing surgical therapy . the results demonstrated that the two parameters had favorable value for assessing severity and progression in patients with bph . however , this research was retrospective only , with inevitable bias from subject selection and follow - up time . therefore , more prospective research should be launched to investigate the predictive value of the two parameters for the progression and treatment efficacy of bph .

purposethe aim of this research was to assess the value of the transitional zone index ( tzi ) and intravesical prostatic protrusion ( ipp ) from transrectal ultrasonography in evaluating the severity and progression of disease by analyzing the relationship between the 2 parameters and symptoms , clinical history , and urodynamics in benign prostatic hyperplasia ( bph ) patients undergoing different treatment.materials and methodsa total of 203 patients receiving medication and 162 patients who underwent transurethral resection of the prostate because of bph were enrolled in this retrospective analysis . the clinical history and subjective and objective examination results of all patients were recorded and compared after being classified by tzi and ipp level . linear regression was used to find correlations between ipp , tzi , and urodynamics.resultsthe 2 parameters were found to differ significantly between patients receiving medication and patients undergoing surgical therapy ( p<0.05 ) . psa , maximum flow rate ( qmax ) , detrusor pressure at qmax ( pdetqmax ) , and the bladder outlet obstruction index ( booi ) differed according to various tzi levels ( p<0.05 ) . in addition , the voiding symptom score , qmax , and booi of subgroups with various ipp levels were also significantly different ( p<0.05 ) . both tzi and ipp had significant effects on qmax , booi , and pdetqmax ( p<0.05 ) and the incidence of acute urinary retention ( p=0.000).conclusionsthe results demonstrated that both tzi and ipp had favorable value for assessing severity and progression in patients with bph . further studies are needed to confirm whether the two parameters have predictive value in the efficacy of bph treatment and could be considered as factors in the selection of therapy .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

apert syndrome ( acrocephalosyndactylia ) is a developmental malformation characterized by craniosynostosis , a cone - shaped calvarium ( acrocephaly ) , hypertelorism , midface hypoplasia , pseudo cleft - palate , a parrot beak - shaped nose , pharyngeal attenuation , and syndactyly of the hands and feet.1 - 3 the inheritance of apert s syndrome is autosomal dominant with the locus of a mutation of fgfr2 on chromosome 10q ( 10q2526 ) . suture progenitor cells with fibroblast growth factor receptors ( fgfr2 ) that have undergone a mutation can not transduce signals from extracellular fibroblast growth factors ( fgfs ) . therefore , these cells do not receive the signal to produce the necessary fibrous material essential for a normal calvarial suture.3 apert syndrome was first reported by wheaton in 1894 and french pediatrician eugene apert published a series of nine cases in 1906.1,4 most cases are sporadic , with an incidence of 1:160 000 ; however due to high infant mortality , the incidence in the general population is lower . advanced male parental age has been consistently noted.5 during the course of the disease , growth and mental retardation can be observed.1,5 in apert cases , the spheno - occipital and spheno - ethmoidal synchondroses and the fronto - ethmoidal suture fuse early , resulting in a severely shortened posterior cranial base and a relatively short anterior cranial base with a resultant hypoplastic midface . consistent with the observation of midface hypoplasia , the maxilla also exhibits a transverse deficiency.3 the most readily observed malocclusions are a severe maxillary anterior open bite and a severely crowded and retrusive maxillary arch due to the constricted secondary palate.3 the maxillary alveolar arch is v - shaped.6 due to the narrower maxillary arch , bilateral or unilateral posterior crossbite can be observed.4,7 impactions , severe crowding of developing teeth within the alveolus , delayed eruption , thick gingiva , and sometimes supernumerary teeth or congenitally missing teeth are the hall marks of maxillary dental development in apert patients.8 the nasopharyngeal and oropharyngeal attenuation cause apert s individuals to become mouth breathers with a resultant anterior open bite.3 a 16-day - old female infant was admitted to the department of orthodontics of selcuk university because of cleft palate . from her parents history she was the second child from a normal mother s third pregnancy of a consanguineous marriage between cousins . apert syndrome was diagnosed by dna analysis and physical examination in the medical faculty . during extraoral examination of the infant , whose appearance was noted with defects , it was observed that he displayed a cone - shaped calvarium , midface hypoplasia , hypertelorism , ocular proptosis , shallow orbits , down - slanting lateral canthi and palpebral fissures , a depressed nasal bridge , low - set ears , and syndactyly of the fingers and toes ( excluding the thumbs ) ( figures 1 , 2 , and 3 ) . intraoral clinical examination revealed that upper and lower alveolar bases were normal , and a bifid uvula and secondary cleft palate ( figures 4 , and 5 ) were presented . the maxillary impression was taken by using silicon - based impression material ( zhermack spa , badia polesine , italy ) and an orthodontic plaster model was obtained ( figures 4 , and 5 ) . after the cleft was covered with the wax , the acrylic appliance was made ( figure 6 ) . feeding the baby and orientating the growth was the goal of using this appliance for treatment.9 the appliance was worn on the patient , and the parents were instructed in full - time wear and cleaning procedures of the appliance . the parents was also informed about feeding the baby in a vertical position , using a nipple with a small hole through which milk flow rate was in the form of intermittent drops ; therefore , the infants s perioral and buccal muscles would strengthen . the baby was checked at intervals of six weeks for a period of six months ( figure 5 ) . when the baby was eight months , an operation was done to correct anomalies in the skull . a silicon - based impression material was preferred to make the maxillary impression easier . during the impression the baby s head is tilted backwards by holding the left knee forward.9 it is postulated that mutation in the frfr2 gene has an effect on the mesenchymal development , which has an effect on tooth morphogenesis.10 many oral manifestations can be attributed to the presence of this mutation . failure in the anteroposterior and downward growth of the maxilla causes the maxillary hypoplasia and a resultant contraction of nasopharyngeal airway.11 therefore , one should pay attention to obstructive sleep apne syndrome and premature death.1 in patients with apert syndrome , severe skeletal class iii open bite malocclusion can be observed due to the maxillary deficiency and the inclination of the upper jaw . the infant is likely to suffer from oral hygiene problems during treatment . for the patient with apert syndrome , the new generation of electric tooth brushes and fluoride mouth rinses may make the task easier . professional care -including frequent dental examinations , oral hygiene prophylaxis , fluoride treatments , and dental sealants- are very important.4 tosun and sener s study showed that apert syndrome was in parallel with g6pd deficiency.4 g6pd deficiency is an enzymatic hereditary disorder leading to hemolytic anemia as a result of red blood cell destruction . the main problem in g6pd deficiency is that hemolysis can be precipitated by a number of factors , such as oxidant drugs , eating fava beans , or intercurrent infection . drugs that may induce hemolysis include sulphonamides , chloramphenicol , aspirin , acetaminophen , penicillin , and streptomycin . therefore , the dentist must avoid drugs that may potentially induce hemolysis as result of g6pd deficiency.4 a significant proportion of patients with apert syndrome has mental retardation . in these patients , significant social problems , speech difficulties , and attention deficit are noted.1 in apert syndrome , definite diagnosis can be made by dna analysis . crouzon syndrome -another craniosynostosis disorder- is the result of the same gene mutation occurring in different locations.1 orthodontists can achieve an improvement in the patient s appearance and function of dentoskeletal structures by a combined orthodontic and orthognathic surgical treatment plan .

the purpose of this report is to present apert syndrome patient by highlighting craniofacial characteristics and orthodontic approach to treatment.the patient , a 16-day - old female and the second child of healthy parents , was admitted to our department with primary complaint of cleft palate . she had a cone - shaped calvarium , midface hypoplasia , syndactyly of the hands and feet , hypertelorism , proptosis and cleft palate . after taking maxillary impression , an acrylic appliance was applied to orientate the growing and enable the feeding.a case with apert syndrome undergoes the orthodontic treatment for a long time and also a multidisciplinary approach is essential to determine the best collaborative corrective plan for the deficiencies of the patient .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSIONS

electrostatic potentials and free energies were calculated with a modified version of the delphi program , adapted to solve the nonlinear poisson - boltzmann equation for protein - membrane systems . delphi yields finite - difference solutions to the poisson - boltzmann equation ( the fdpb method ) for a system where the solvent is described in terms of a bulk dielectric constant and concentrations of mobile ions , whereas the solutes ( here , the proteins and membrane ) are described in atomic detail by the coordinates of the individual atoms , their atomic radii , and their partial charges . the fdpb methodology has been applied to numerous peptide - membrane and protein - membrane systems , producing results that predict successfully and with high accuracy the following : 1 ) macroscopic properties , such as quantitative differences between the membrane interactions of homologous proteins and effects of lipid composition or ionic strength ; and 2 ) microscopic properties , such as the effect of point mutations or binding of metal ions on membrane interactions ( for examples see refs . 30 , 33 , 35 - 40 ) . atomic structural models of proteins and membranes the atomic model we used for the gt heterotrimer was based on the gt / i111 crystal structure ( pdb code 1got ) solved by lambright et al . because the g subunit in this structure is a chimera of gt and gi1 ( residues 216 - 294 of bovine gt were replaced with residues 220 - 298 of rat gi1 to improve protein expression ) , a composite model was built for heterotrimeric gt by manually copying the backbone and side chains of these residues from the corresponding region of native gt , taken from the gt-gdp structure ( 1tag ) ( 41 ) . the structure of these two corresponding regions is highly similar ( 16 ) , and their backbone root mean square deviation is 0.5 . the structure of bovine g11 ( pdb code 2trc ) ( 42 ) was used in calculations for dissociated g11 , as in a previous study ( 30 ) . both g1 termini in the heterotrimeric model , which are slightly shorter than in the structure of dissociated g11 , were extended by manually copying the extra residues from the structure of dissociated g11 . the n terminus of gt , in its heterotrimeric form , is in an extended helical conformation and is stabilized by interactions with g11 ( see supplemental fig . after dissociation from g11 , this subdomain does not have any significant stabilizing interactions with the membrane ( supplemental fig . available structures of monomeric gt are not applicable to our calculations because they lack the entire n terminus , which was cleaved prior to crystallization . however , we note that the n terminus in the crystal structure of the homologous gi1-gdp ( 68% sequence identity to gt ) refolds onto the bulk of the protein to form a compact subdomain that is stabilized by a network of interacting residues that are conserved between gi1 and its homologs go and gt ( 43 ) . a folded and highly ordered gi1 n terminus was also shown for the myristoylated form of gi1 in solution , and it was suggested that this feature is conserved in homologous g subunits ( 44 ) . we therefore assumed that soluble gdp - bound gt adopts a similar conformation , and we modeled it on the structure of monomeric gi1-gdp ( pdb code 1gdd ) using the program nest ( 45 ) and remodeled unconserved side chains using scap ( 46 ) . hydrogen atoms were added to the protein structures with the program charmm , and the structures were subjected to conjugate gradient minimization with a harmonic restraint force of 50 kcal / mol / applied to the heavy atoms located at the original crystallographic coordinates . hydrogens were added to the guanine nucleotides bound to the g subunits using the builder module in insight ii ( accelrys ) . phospholipid bilayers of lateral dimensions 165 172 and ratios of 0:1 , 1:8 , 1:5 , 1:3 , 1:2 , and 1:1 acidic lipid ( phosphatidylserine ) to neutral lipids ( phosphatidylcholine ) were built as described in previous work ( 30 , 33 - 37 , 39 , 47 ) . in vivo , the distribution of acidic lipids is known to be asymmetric across the bilayer , and following previous studies ( 30 , 33 , 35 - 40 , 48 , 49 ) , we assume that all of the phosphatidylserine is located on the cytosolic leaflet of the rod outer segment membranes . except where specified otherwise , in our calculations we used bilayers with a ratio of 1:2 phosphatidylserine / phosphatidylcholine ; this ratio has been assumed to be a reasonable approximation for the lipid composition facing the transducin under physiological conditions ( 30 ) , and indeed , as shown in fig . 4 and discussed below , this membrane composition is representative of the wider range of possible compositions . as in previous work , we assume that the bilayer does not change structure or position when it interacts with the protein ( see ref . the protein / membrane model was mapped onto a fine three - dimensional grid , where each small cube represents a small region of the peptide , membrane , or solvent . as in previous studies of comparable protein - membrane systems ( 30 , 33 - 37 , 39 ) , we took the charges and radii used for the amino acids from the charmm22 parameter set and for the lipids from ref . regions inside the molecular surfaces of the protein and membrane were assigned a dielectric constant of 2 , and those outside were assigned a dielectric constant of 80 , combined with an ion exclusion layer of 2 around the solute . unless stated otherwise , the salt concentration was set to 100 mm , as in previous studies ( 30 , 33 , 35 - 40 ) . the numerical calculation of the potential was iterated to convergence , defined as the point at which the potential changes less than 10 kt / e between successive iterations . a sequence of focusing runs of increasing resolution was employed to calculate the electrostatic potentials ( e.g. 0.3 , 0.6 , 1.2 , and 2.4 grid / ) . electrostatic energies were obtained using the calculated potentials , and the electrostatic energy of a protein - membrane interaction was determined as the difference between the following : 1 ) the electrostatic free energy of the protein in a specific orientation and distance relative to the membrane surface ; and 2 ) the electrostatic free energies of the protein and membrane infinitely far apart ( i.e. calculated separately ) . the numerical error of the free energy calculations , estimated by the difference between the calculations of the two highest resolution scales , was < 0.1 kcal / mol in all calculations . the nonspecific electrostatic interactions calculated here are relatively insensitive to local changes in conformation . different combinations of composite models from two separate pdb structures or different minimization protocols , which produced global root mean square deviations of up to 2 between models , changed the calculated electrostatic energies of interactions by less than the numerical error for a given protein - membrane complex . global sampling of transducin orientations to calculate transducin - membrane interactions previous studies used visual inspection to find an approximate minimum free energy orientation of a protein relative to the membrane and then sampled extensively close to this orientation to find the minimum free energy orientation ( 30 , 33 - 37 ) . here , however , visual inspection could not reliably determine the approximate minimum - energy orientation of the gt heterotrimer and gt with respect to the membrane , because these proteins do not have prominent positively charged patches that clearly determine the orientation of minimum energy . we therefore implemented a global sampling of all nonredundant euler rotations , rotating the protein around the point in the structure closest to the lipid attachment point . this point corresponds to the n terminus in gt calculations , the c terminus of g1 in g11 calculations , and the midpoint between them for the heterotrimer structure ( where the two termini are 15 apart ) . for each orientation , the membrane was moved so as to place the molecular surfaces of the protein and membrane 3 apart ( r = 3 ) , and the electrostatic energy was calculated as above . r = 3 was chosen because at orientations where the electrostatic interaction is attractive , the energy value at this distance is minimal ( see supplemental material and refs . 30 , 33 , 35 , 40 ) . combining lipid anchor constraints with global orientation sampling the transducin structures used here do not have coordinates for the lipid anchors nor for the termini to which the anchors are covalently attached as follows : the myristoyl - gaga- at the n terminus of gt and the -ggc - farnesyl at the c terminus of g1 . for each orientation we assumed that a lipid anchor can reach the membrane if the measured distance between each relevant terminus and the membrane was equal to or less than 13 for gt and 10 for g1 , thresholds corresponding to the length of the fully extended linkers . 16 , based on their amino acid sequence ) and able to adopt fully extended conformations . when we determined that a lipid anchor can reach the membrane in a specific orientation , we assigned to this orientation an energetic contribution of -6 kcal / mol , which corresponds to the estimated energetic contribution of an individual lipid modification ( see under discussion for more details on these estimates ) . when both lipid anchors could reach the membrane , we assigned to such an orientation an energetic contribution of -12 kcal / mol . calculation of average energy and entropy previous work established that when the peripheral association between a protein and a membrane is of substantial attractive nature , the relative binding energies and the electrostatic contribution to binding are well approximated by the energy value at the minimum free energy orientation ( 30 , 33 - 37 , 39 ) . in addition to finding the minimal free energy value , we also calculated the boltzmann - weighted average energy , as in ref . 37 , and see equation 1 , where k is the boltzmann constant , and t is the absolute temperature . the calculations were repeated twice , with and without the constraints of the lipid anchor . the latter can show whether specific orientations provide sufficient attraction to the membrane to compensate for the energetic penalty associated with removing the lipid anchor out of the bilayer ( see above ) , and represent the effect of electrostatics on the soluble forms of the proteins ( i.e. before the lipid anchors attach to the membrane ) . we used the bootstrapping re - sampling method to check the statistical significance of our results ( as in ref . . the free energy cost because of the entropic penalty associated with limiting gt rotations was approximated by equation 2 , where s2 is the entropy of gt with the additional constraints ( lipid anchor and/or electrostatics ) , and s1 is the reference state ( having the same number of microstates but with an equal probability of being in each state and with all of these probabilities summing to unity ) . we estimated the error in the entropy calculation by adding a random value ( in the range of the numerical error , 0.1 kcal / mol ) to the calculated free energies and repeated the entropy calculations 100 times , reaching an estimated error of 0.02 kcal / mol . figure 1.interactions of the gt heterotrimer with the membrane . a , global orientation sampling of the gt heterotrimer . the x ( ) and y axes ( ) mark euler angles of rotation from the initial orientation ( supplemental fig . the z axis and the color code both mark the calculated electrostatic free energy of interaction with the membrane ; positive ( red ) energies will result in repulsion , whereas negative ( blue ) energies will result in attraction . the magenta and cyan lines enclose lipid - allowed orientations , which enable the g1 ( magenta ) and the gt ( cyan ) lipid anchors to reach the membrane . representative gt orientations are marked on the plot of global orientation sampling for gt , with letters corresponding to subsequent panel captions . b , gt orientation of minimum free energy , which is representative of tilted orientations ; gel = -0.8 kcal / mol . c , electrostatic potential map of the gt heterotrimer in the orientation of minimum free energy ( the same orientation as in b ) . electrostatic potential maps were visualized by drawing equi - potential contour meshes for the values + 1 kt / e ( 25mv , blue mesh ) and -1 kt / e ( -25 mv , red mesh ) . gt subunits are shown in connolly surface representation and colored pink ( ) , light green ( ) , and light blue ( ) , and the functionally relevant termini are annotated . two large negatively charged patches on gt and g11 are marked with orange and red arrows , respectively ; these patches cause the repulsion observed in the lipid - allowed orientations at 0 and > 60. d , representative parallel orientation ; gel = 1.1 kcal / mol . e , lipid - allowed orientation with moderate repulsive electrostatics ; gel = 1.8 kcal / mol . f , lipid - disallowed orientation , where the g1 lipid anchor can not reach the membrane ; gel = 4 kcal / mol . g , lipid - disallowed orientation , where both lipid anchors can not reach the membrane ; gel = 3.5 kcal / mol . b and d - g , gt subunits are shown in worm representation and are colored red ( ) , green ( ) , and blue ( ) . the n - terminal helix of gt is colored magenta , and the c terminus of gt is colored orange . interactions of the gt heterotrimer with the membrane . a , global orientation sampling of the gt heterotrimer . the x ( ) and y axes ( ) mark euler angles of rotation from the initial orientation ( supplemental fig . the z axis and the color code both mark the calculated electrostatic free energy of interaction with the membrane ; positive ( red ) energies will result in repulsion , whereas negative ( blue ) energies will result in attraction . the magenta and cyan lines enclose lipid - allowed orientations , which enable the g1 ( magenta ) and the gt ( cyan ) lipid anchors to reach the membrane . representative gt orientations are marked on the plot of global orientation sampling for gt , with letters corresponding to subsequent panel captions . b , gt orientation of minimum free energy , which is representative of tilted orientations ; gel = -0.8 kcal / mol . c , electrostatic potential map of the gt heterotrimer in the orientation of minimum free energy ( the same orientation as in b ) . electrostatic potential maps were visualized by drawing equi - potential contour meshes for the values + 1 kt / e ( 25mv , blue mesh ) and -1 kt / e ( -25 mv , red mesh ) . gt subunits are shown in connolly surface representation and colored pink ( ) , light green ( ) , and light blue ( ) , and the functionally relevant termini are annotated . two large negatively charged patches on gt and g11 are marked with orange and red arrows , respectively ; these patches cause the repulsion observed in the lipid - allowed orientations at 0 and > 60. d , representative parallel orientation ; gel = 1.1 kcal / mol . e , lipid - allowed orientation with moderate repulsive electrostatics ; gel = 1.8 kcal / mol . f , lipid - disallowed orientation , where the g1 lipid anchor can not reach the membrane ; gel = 4 kcal / mol . g , lipid - disallowed orientation , where both lipid anchors can not reach the membrane ; gel = 3.5 kcal / mol . b and d - g , gt subunits are shown in worm representation and are colored red ( ) , green ( ) , and blue ( ) . the n - terminal helix of gt is colored magenta , and the c terminus of gt is colored orange . we translated differences in the free energy of interaction to changes in association / dissociation rates ( k ) using equation 3 , ( eq.3)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation*}\;\;{\delta}k\hspace{1em}=\hspace{1em}e^{-{\delta}gi / k_{b}t}\end{equation*}\end{document } visualizing three - dimensional potential maps three - dimensional potential maps were visualized by mapping the values onto the molecular surface of the protein and by drawing equi - potential contour meshes that connect all the points in space having a specific potential value ( here 1 kt / e , which are equal to 25 mv ) . characterizing the interaction of the gt heterotrimer with the lipid bilayer we analyzed the interaction of gt with the membrane using global orientation sampling , using the fdpb method to calculate the electrostatic free energy of interaction at each orientation ( fig . at each orientation , we also measured whether each of the two lipid anchors can reach the lipid bilayer ( marked as lipid - allowed orientations in fig . these measurements show that 11% of all possible gt orientations enable both lipid anchors to reach the membrane . by calculating the effects of electrostatics and the lipid anchors separately , we can examine their individual contributions and analyze cases in which only one of these factors is significant for membrane interactions ( e.g. when soluble transducin targets back to the membrane from the cytosol , or when transducin interacts in vitro with neutral membranes ) . when we determined that a lipid anchor can reach the membrane in a specific orientation , we assigned to this orientation an energetic contribution of -6or -12 kcal / mol , corresponding to the estimated energetic contribution of one or two lipid modifications , respectively ( see discussion for more details on these estimates ) . we assumed that a lipid anchor can reach the membrane when the distance between the bilayer and the relevant terminus in the structure was equal to or less than predetermined distance thresholds ( see experimental procedures ) . this assumption considers the terminal 3 - 4 amino acids that connect to the lipid anchors and are not present in the crystal structure as conformationally flexible linkers that are able to fully extend , as was suggested previously based on their amino acid sequence ( 16 ) . nevertheless , our results are not dependent on the exact values of these distance thresholds ; because of the large size of gt , its geometry , and the close proximity of the two relevant termini , increasing or decreasing these distance thresholds by up to 50% resulted in essentially the same ensemble of lipid - allowed orientations . only a minor ensemble of orientations ( 6% ) exhibits either a small attraction ( 3% of all orientations ) or a weak repulsion . we label orientations with an interaction energy ( gel ) within 2 kcal / mol of the minimum electrostatic free energy ( -0.8 kcal / mol , see table 1 ) , as electrostatically favorable orientations . we chose this threshold because it corresponds to a substantial ( 30-fold ) decrease in the occupation probability with respect to the energy minimum . ( note that the results are relatively insensitive to the precise value of the threshold because the selected value is far enough from the minimum so that changing it by 0.5 kcal / mol has a small effect on which orientations are labeled as favorable . ) the electrostatically favorable orientations of gt are clustered around the orientation of minimum electrostatic free energy ( fig . a small positively charged patch around the attachment points of the two lipid anchors is proximal to the membrane , whereas the negative potential around most of gt is positioned further away from the membrane ( e.g. fig . this results in a weak attraction at the orientation of minimum electrostatic free energy ( -0.8 kcal / mol ) and an even smaller average energy of interaction ( -0.3 kcal / mol , see table 1 ) . table 1minimum and average electrostatic free energies of interaction of heterotrimeric / dissociated transducin with the lipid bilayerthe electrostatic free energy values are in kcal / mol , and the numerical error is < 0.1 kcal / mol.transducin stategel , min ( lipid anchor 's in membrane)gel , min ( all possible orientations)a<gel > b(lipid anchor / s in membrane)<gel > b(all possible orientations)a 0.8 0.8 0.3 ~0 3.2 3.2 2.8 2.7 + 1.8 1.2 + 2.2 0.4 acalculated by sampling of all possible orientations ( i.e. without the constraints of the lipid anchor / s).bboltzmann - weighted averaged energies ( see experimental procedures for details ) . minimum and average electrostatic free energies of interaction of heterotrimeric / dissociated transducin with the lipid bilayer the electrostatic free energy values are in kcal / mol , and the numerical error is < 0.1 kcal / mol . calculated by sampling of all possible orientations ( i.e. without the constraints of the lipid anchor / s ) . boltzmann - weighted averaged energies ( see experimental procedures for details ) . fig . the orientation of minimum free energy ( fig . 1 , b and c ) places the n - terminal helix of gt at an angle of 30 to the membrane surface and is similar to the tilted orientations suggested previously ( see above ) . 1d ) position negatively charged patches near the c terminus of gt ( marked with an orange arrow in fig . 1c ) close to the membrane and therefore result in electrostatic repulsion . because of this repulsion , parallel orientations are less favorable than the orientation of minimum free energy ( a tilted orientation ) by 2 kcal / mol , which corresponds to 30-fold difference in occupancy probability . furthermore , large negatively charged patches on g11 ( marked with a red arrow in fig . 1c ) oppose rotations of gt to orientations that position the n - terminal -helix of gt at angles > 60 to the membrane surface ( fig . 1 , a and e ) . these electrostatic repulsions limit gt rotation and constrain the gt c terminus , which is essential for binding activated rhodopsin , to face the membrane surface in all of the allowed orientations of gt . to estimate at the ensemble level how rotational electrostatic and/or lipid anchor constraints affect membrane - associated gt , we calculated the difference in the entropic component of the rotational free energy that results from these constraints . the reference state was a membrane - attached gt that can occupy all possible orientations with an equal probability ( i.e. without any rotational constraints ) . note that the effect on the degrees of freedom of gt does not depend on the strength of the gt - membrane interactions in specific orientations , but rather is a result of the global shape and characteristics of the energy - orientation landscape on gt ( as shown in fig . when we applied the rotational constraints of both lipid anchors , the entropic cost was 1.1 kcal / mol . applying only the constraint of the electrostatic interactions with the membrane results in an entropic cost of 1.3 kcal / mol ( with an estimated error of 0.02 kcal / mol , when these constraints were applied together , the entropic energy cost was 1.8 kcal / mol , i.e. electrostatics further enhance the effect of the lipid anchors by a factor of 3.5 . membrane interactions of dissociated g11electrostatic interactions of the dissociated gt and g11 with the lipid bilayer are very different from one another and from those of the transducin heterotrimer ( figs . 2 and 3 versus fig . 2a ) , we found a similar orientation of minimum electrostatic free energy ( with a similar gel = -3.2 kcal / mol ; table 1 ) as reported in a previous study ( 30 ) , which sampled around an initial orientation chosen by visual inspection . we also observed that , unlike the gt heterotrimer , g11 is attracted to the membrane in many orientations ( 18% of all possible orientations ) , allowing membrane - attached g11 to sample a wide range of dissimilar orientations that are both lipid - allowed and electrostatically favorable ( fig . 2 ) . furthermore , most of the electrostatically favorable orientations of g11 and particularly all orientations with gel less than -2 kcal / mol enable the lipid anchor to reach the membrane ( fig . the larger range of lipid - allowed orientations with significant electrostatic attraction to the membrane is also reflected in a stronger boltzmann - weighted average interactions energy ( -2.8 kcal / mol ; see table 1 for a detailed comparison ) . increasing or decreasing the distance threshold for determining whether the lipid anchor can reach the membrane by 50% had no effect on these results . additionally , when we removed the constraints of the lipid anchor and sampled all possible orientations of g11 , the electrostatic free energies of interaction did not change ( table 1 ) . taken together , these results suggest that the contributions of the lipid anchor and electrostatics to the free energy of g11 interaction with the membrane are independent of one another and therefore additive . figure 2.interactions of g11 with the membrane . a , global orientation sampling of g11 . the magenta line encloses lipid - allowed orientations , which enable the g1 c - terminal farnesyl to reach the membrane . representative lipid - allowed and electrostatically favorable g11 orientations are marked with letters corresponding to subsequent panel captions . b , g11 orientation of minimum free energy ; gel = -3.2 kcal / mol . c , electrostatic potential map of g11 in the orientation of minimum free energy ( the same orientation as in b ) , but rotated 90 around the z axis to better visualize the segregation of charges . g11 subunits and the lipid bilayer are depicted as in fig . 1 . b and d - f , the c terminus of g1 is marked with a black arrow , and the c terminus of g1 is marked with a magenta arrow . interactions of g11 with the membrane . a , global orientation sampling of g11 . the magenta line encloses lipid - allowed orientations , which enable the g1 c - terminal farnesyl to reach the membrane . representative lipid - allowed and electrostatically favorable g11 orientations are marked with letters corresponding to subsequent panel captions . b , g11 orientation of minimum free energy ; gel = -3.2 kcal / mol . c , electrostatic potential map of g11 in the orientation of minimum free energy ( the same orientation as in b ) , but rotated 90 around the z axis to better visualize the segregation of charges . g11 subunits and the lipid bilayer are depicted as in fig . 1 . b and d - f , the c terminus of g1 is marked with a black arrow , and the c terminus of g1 is marked with a magenta arrow . figure 3.interactions of gt with the membrane . a , global orientation sampling of gt. the cyan line encloses lipid - allowed orientations , which enable the gt n - terminal lipid anchor to reach the membrane . the lipid - allowed orientation with minimal free energy of interaction ( gel = 1.8 kcal / mol ) is marked with a black arrow . the lipid - disallowed orientation with minimal global electrostatic free energy ( -1.2 kcal / mol ) is marked with a yellow arrow . b , electrostatic potential map of gt in the lipid - allowed orientation with the minimal free energy of interaction , depicted as in fig . 1 . interactions of gt with the membrane . a , global orientation sampling of gt. the cyan line encloses lipid - allowed orientations , which enable the gt n - terminal lipid anchor to reach the membrane . the lipid - allowed orientation with minimal free energy of interaction ( gel = 1.8 kcal / mol ) is marked with a black arrow . the lipid - disallowed orientation with minimal global electrostatic free energy ( -1.2 kcal / mol ) is marked with a yellow arrow . b , electrostatic potential map of gt in the lipid - allowed orientation with the minimal free energy of interaction , depicted as in fig . membrane interactions of dissociated gtwithin the gt heterotrimer , the lipidated n terminus of gt assumes an extended helical conformation stabilized by interactions with g11 ( e.g. fig . however , this n - terminal helix is likely to refold into a compact conformation upon the dissociation of gt from g11 . although no available crystal structure of monomeric gt contains this part of the molecule , because of its proteolytic removal prior to crystallization , the crystal structure of the homologous gi1-gdp ( 43 ) does contain the n terminus , which is folded onto the bulk of gt and is stabilized by a network of interacting residues conserved between gi1 and gt ( and also go ) ( 43 ) . furthermore , a folded and highly ordered gi1 n terminus was shown for the myristoylated form of gi1-gdp in solution , and it was suggested that this structural feature is conserved in homologous g subunits ( 44 ) . we therefore proceeded with calculations for dissociated gt-gdp modeled on the structure of gi1-gdp ( 43 ) as a template ( fig . 3 ) . global orientation sampling of this gt conformation showed repulsion by the negatively charged membrane in most orientations ( fig . 3a ) , because the entire surface of gt is dominated by negative charges ( fig . 3b ) . in particular , all the lipid - allowed orientations of gt ( 11% of all possible orientations ) were repulsive . a few orientations that exhibited a small attraction to the membrane ( up to -1.2 kcal / mol ; see fig . 3a and table 1 ) placed the lipid attachment point on the distal face of gt relative to the membrane , and because of the energetic cost of removing the lipid anchor from the bilayer ( approximately -6 kcal / mol , see discussion ) , these orientations are disallowed . calculation of the electrostatic free energy of interaction of different gt states with bilayers of different acidic lipid composition . the vertical dashed line marks the lipid composition used in most calculations here ( 33% acidic lipids ) , whereas the two vertical dotted lines mark the range of possible lipid compositions facing transducin in rod outer segment disks ( see text for details ) . calculation of the electrostatic free energy of interaction of different gt states with bilayers of different acidic lipid composition . the vertical dashed line marks the lipid composition used in most calculations here ( 33% acidic lipids ) , whereas the two vertical dotted lines mark the range of possible lipid compositions facing transducin in rod outer segment disks ( see text for details ) . we quantified how the repulsive interactions , which characterize the lipid - allowed orientations of gt , affect its membrane affinity ( table 1 ) . for significant membrane attraction , the minimal free energy of interaction provides a good estimate and an upper bound to the membrane affinity of the protein ( 30 , 33 , 35 , 39 ) . however , for repulsive interactions , as in the case of monomeric gt , the magnitude of the minimal electrostatic repulsion in the lipid - allowed ensemble ( 1.8 kcal / mol ) provides a lower bound to the overall repulsion . because all the other lipid - allowed orientations are more repulsive , the boltzmann - weighted average of all gt lipid - allowed orientations is higher ( 2.2 kcal / mol ) , reducing the membrane affinity of gt in this conformation by 40-fold . a 50% increase in the distance threshold for determining whether the lipid anchor can reach the membrane had a small effect on these results ( < 0.2 kcal / mol ) . conversely , decreasing the distance threshold ( i.e. assuming the linker is not fully flexible ) resulted in significantly increased repulsion . dependence of the electrostatic interactions on distance and membrane composition we investigated whether the choice of protein - bilayer distance ( 3 ) influenced our major conclusions . calculation of the free energy of interaction as a function of distance showed a weak dependence ( supplemental fig . s3 ) , as long as the surfaces of the gt subunits and the membrane are 3 apart , a likely assumption given their highly charged nature and the strong repulsion at distances <3 ( see refs . 30 , 33 , 35 - 40 ) . as in previous work ( 30 ) , we used a bilayer model containing 33% acidic lipids to reproduce the bulk electrostatic properties of the cytosolic leaflet of disk membranes that faces transducin . previous investigations reported various proportions of acidic to neutral lipids in rod outer segment membranes ( 51 - 54 ) with the percentage of acidic lipids ranging from 13 to 20% . the distribution of acidic lipids is known to be asymmetric across the bilayer , and previous studies assumed that all of the phosphatidylserine is located on the cytosolic leaflet of the membrane ( 30 , 33 , 35 - 40 , 48 , 49 ) . accordingly , the percentage of acidic lipids facing gt can range from 25 to 40% . 4 shows that within this range , the membrane composition has almost no effect on the electrostatic interaction of the charged bilayer with gt / g11/gt in their minimal free - energy orientation ; these different membrane compositions change the calculated electrostatic interaction by less than 0.1 kcal / mol for gt and less than 0.3 kcal / mol for gt and g11 . dependence of the electrostatic interactions on ionic strength and implications for transducin purification protocols the membrane interactions of the transducin heterotrimer and its dissociated subunits depend on the ionic strength , with each of the three molecules exhibiting a unique salt dependence ( fig . 5 ) . increasing the salt concentration from 100 mm , at which our calculations were performed , to the physiological conditions of 150 mm , changes the membrane interaction energies of transducin and its subunits by < 10% ( < 0.03 kcal / mol for the heterotrimer , < 0.2 kcal / mol for gt , and < 0.3 kcal / mol for g11 ) and therefore does not significantly affect our major conclusions . in contrast , hypotonic conditions change the interaction energies for all three species dramatically . the small attraction of the gt heterotrimer to the membrane at physiological ionic strength changes to a strong repulsion under hypotonic conditions . as shown previously ( 30 ) , the electrostatic interaction of dissociated g11 exhibits a parabolic dependence on the ionic strength , with a maximal attraction at 50 mm salt and a reduction in affinity under more extreme hypotonic conditions . unlike g11 , gt is electrostatically repelled by the membrane at physiological ionic strength , and this repulsion increases considerably when the ionic strength is reduced ; a 10-fold reduction increases the repulsion to 8 kcal / mol , more than the membrane affinity conferred by the lipid anchor ( -6 kcal / mol , see below ) . in this study , we quantified how the interplay between lipid anchorage and electrostatics determines both membrane affinity and the range of allowed transducin orientations on the membrane surface . these properties change dramatically upon the activation - dependent dissociation of transducin into gt and g11 and are likely to significantly affect the protein - protein interactions and the subcellular localization of the transducin heterotrimer and its individual subunits . interactions of gt with the membrane and their implication for transducin activation it is well established that the membrane affinity of gt is determined predominantly by its lipid anchors ( 4 ) : the heterogeneous n - terminal acylation of gt ( 13 , 55 - 58 ) and the c - terminal farnesylation of g1 ( 59 , 60 ) . the majority of gt subunits are acylated by c12 or c14:2 lipids , which contribute approximately -6 kcal / mol to membrane binding ( 61 ) . farnesylation was shown to confer a membrane affinity comparable with that of a lauryl ( c12 ) anchor ( 62 ) and therefore can also add approximately -6 kcal / mol to membrane binding . in a maximal estimate , the contributions of both anchors are additive and sum to approximately -12 kcal / mol . our results show that under physiological conditions the electrostatic contribution to the membrane affinity of the heterotrimer is insignificant ( -0.3 kcal / mol ) , and therefore its membrane attachment is likely to be set exclusively by the lipid anchors . under hypotonic conditions , however , strong electrostatic repulsion counteracts the lipid anchors of gt ( fig . 5 ) and facilitates its release from membranes , as has been successfully utilized in several transducin purification protocols ( 26 - 29 ) . global orientation sampling enabled us to compare the probabilities of all previously proposed gt orientations on the membrane surface . the tilted orientations suggested by hessel et al . and chabre and le maire ( 24 , 25 ) are similar to the gt orientation identified by our analysis as the most favorable . on the other hand , parallel orientations ( 16 - 23 ) place the negatively charged patches around the c terminus of gt close to the negatively charged bilayer , making these orientations less favorable by 2 kcal / mol ( 30-fold difference in occupancy probability ) . although the magnitude of these energetic differences is relatively small , they are consistent with the dramatic charge distribution on gt , where most of the surface of the heterotrimer is negatively charged except for the small area around the lipid anchor attachment points ( fig . furthermore , we observe that in the electrostatically favorable orientations of gt , the gt - bilayer interface is relatively small ( e.g. fig . this small , positively charged gtfootprint on the membrane is consistent with the results of hessel et al . ( 24 ) , who showed that only a small number of negatively charged lipids directly interact with membrane - bound gt . they speculated that such a small interface might contribute to the fast diffusion of gt along the crowded membrane surface of rod outer segment disks , which is necessary for the rapid activation of many gt molecules by each rhodopsin ( see discussion in ref . 2 and see below ) . notably , these results may appear to contradict the cryo - em structure of membrane - bound gt ( 63 ) , which suggested a parallel gt orientation with a larger membrane interface and a close contact between the c terminus of gt and the membrane surface . however , the membranes used in that study contained 20% cationic lipids , which presumably attracted the negatively charged patches around the c terminus of gt. our calculations predict that these very patches are repelled by negatively charged biological membranes . our analysis also shows that electrostatic repulsion by the membrane is one of the factors limiting the rotational degrees of freedom of the heterotrimer . interestingly , all gt orientations that are lipid - allowed and electrostatically favorable are sterically predisposed to interact with rhodopsin ( supplemental fig . this suggests that the orientational confinement of transducin by lipid anchorage and electrostatics may contribute to its extremely rapid activation rate . indeed , the rate of transducin activation on the surface of photoreceptor membranes can reach several hundred gt molecules per photoexcited rhodopsin / s ( 2 , 6 , 7 ) , whereas in detergent solution the maximal speed of gt activation is only 30 - 50 gt molecules per second ( 9 , 64 ) . the faster gt activation rate in native membranes was attributed by ernst et al . ( 9 ) to the orientation of gt at the membrane surface before it encounters rhodopsin . in agreement with this hypothesis and , assuming that our calculated reduction in rotational entropy ( 1.8 kcal / mol ) lowers the activation energy for gt - rhodopsin complex formation by a similar value , this orientation confinement would accelerate gt activation by 20-fold . it should be noted that although our calculations were performed with a membrane bilayer , a significant portion of the photoreceptor membrane surface is occupied by rhodopsin . therefore , any direct projection of our analysis to transducin activation in vivo should be treated cautiously . quantification of the effect of gt orientation by the membrane on activation kinetics in vivo would require a more detailed understanding of the surface characteristics of native photoreceptor membranes and remains beyond the scope of this study . nevertheless , the ability of a single photoexcited rhodopsin to activate hundreds of gt molecules / s requires rapid diffusion of gt along the membrane bilayer ( 2 , 6 , 7 , 65 ) . therefore , any interactions between gt and nonactivated rhodopsin are expected to be weak enough not to impede this fast lateral diffusion . the orientation of transducin in relation to the membrane was also debated in the context of whether transducin binds to a monomeric or dimeric rhodopsin form ( ref . 66 for the most recent review on g protein - coupled receptor oligomerization ) . it has been suggested that monomeric rhodopsin can bind transducin in a tilted orientation ( 25 ) , whereas dimeric rhodopsin was modeled in a complex with transducin in a parallel orientation ( 67 ) . the tilted orientation we find would appear to be more consistent with monomeric rhodopsin . however , the energy differences we calculate are not large enough to preclude a reorientation of transducin so as to optimize its interaction with a rhodopsin dimer . membrane interactions of dissociated g11 and gtour analysis indicates that the electrostatic properties of gt and g11 are different from one another and from those of gt . in the case of g11 , ( 30 ) , who described a significant electrostatic attraction of g11 to the membrane , despite its negative net charge of -12 . because the averaged electrostatic affinity of gb11 to the membrane is the same with or without the constraints imposed by the farnesyl anchor , we consider these two energetic contributions as independent and additive . we estimate that electrostatics increase the membrane affinity of g11 from approximately -6 kcal / mol ( because of the farnesyl anchor alone ) to approximately -9 kcal / mol . in comparison with gt , g11 can occupy a wider range of orientations that are both lipid - allowed and electrostatically favorable ( fig . interestingly , the sites on g subunits that interact with different effectors are distributed over much of the g surface ( 68 ) , and therefore this wide range of allowed g orientations relative to the membrane can facilitate productive interaction with various effectors . calculations of gt interactions with the membrane are not as straightforward as those of g11 because the lipidated n terminus was proteolytically removed in all available gt structures . although we can not rule out the possibility that the n terminus of monomeric gt is intrinsically unstructured , previous studies of its close homolog gi1 showed that although its n terminus is present as an extended helix in the heterotrimer , in the monomer it packs against the rest of the subunit in a compact conformation ( 43 ) . a highly ordered and compact conformation of the myristoylated n terminus of gi1 was also shown in solution , and it was suggested that this property is conserved in homologous g subunits ( 44 ) . on the basis of this evidence , we assumed in our calculations that , following dissociation from g11 , the extended n - terminal helix of gt undergoes a similar conformational rearrangement . although gt and g11 have nearly identical net charges ( -13 and -12 , respectively ) , the distributions of negative charges on their surfaces are different . 3b ) , and our calculations predict that , unlike g11 , gt is repelled by the membrane in all lipid - allowed orientations . this reduces the membrane affinity of the compact gt conformation from the -6 kcal / mol provided by c12 or c14:2 lipid anchors to less than -4 kcal / mol . similarly , the membrane affinity of the minority of gt subunits that are modified by c14:1 or c14 lipids ( providing -7or -8 kcal / mol membrane affinity , respectively ) is reduced to less than -5or -6 kcal / mol . the membrane repulsion of gt could be lower if its n terminus is unstructured , or higher if the n - terminal linker of gt to its lipid anchor is not fully extended and flexible as we assumed . unlike gt and g11 , the linker length does matter for gt. a shorter or less flexible linker will increase gt repulsion by the membrane because the least repulsive orientation of gt falls right at the edge of the lipid - allowed region , where the electrostatic repulsion increases steeply ( fig . 3a ) . the repulsive gt-membrane interactions that we predict are consistent with the following experimental evidence . 1 ) gt binding to negatively charged membranes is significantly weaker than the binding of g11 ( 4 , 5 , 31 ) , despite the similar hydrophobicity of their lipid anchors . 2 ) g11 binding to nonmyristoylated gt lowers g11 affinity to negatively charged membranes ( 4 ) . 3 ) acidic ph facilitates the binding of gt to negatively charged membranes , which is non - detectable at neutral ph ( 5 ) . one of the properties of transducin that has attracted much attention in the past 5 years is its ability to undergo reversible , light - induced translocation from the rod outer segment to other subcellular compartments ( 10 , 69 - 72 ) . this massive translocation is thought to contribute to photoreceptor light adaptation and survival ( reviewed in refs . gt and g11 translocate apart from one another , and up to 90% of gt and 80% g11 move out of the rod outer segment within minutes ( 10 ) . the consensus is that transducin translocation in the light - induced direction requires subunit dissociation and is accomplished by diffusion ( 14 , 15 , 72 , 75 ) . surprisingly , the rate of this diffusion is comparable with that of soluble green fluorescent protein through the same compartment ( 75 ) , despite the fact that lipidated gt and g11 have to pass through narrow cytosolic spaces between hundreds of tightly packed membranous disks . our results suggest that the efficient translocation of monomeric gt may be facilitated by electrostatic repulsion , which is expected to reduce the affinity of gt to membranes . this may both accelerate the detachment of gt from the membrane and enable faster gt diffusion through the rod outer segment with minimal retardation by the disks . as would be expected , the translocation of the majority of gt subunits , which are modified by c12 or c14:2 lipids , is more pronounced than the translocation of the minority of gt subunits modified by slightly more hydrophobic lipids c14:1 and c14 ( 13 ) . in the case of g11 , its electrostatic properties enhance membrane binding , which is expected to impede translocation . accordingly , it has been shown that the efficient translocation of g11 requires phosducin ( 76 ) , a protein that stabilizes the binding of the farnesyl moiety inside a cleft within g1 ( 77 ) and neutralizes the electrostatic attraction of g11 to the membrane ( 30 ) . our results also reflect on how soluble transducin could reattach to the membrane from the cytosol , as occurs in rods recovering from illumination . although it remains to be determined experimentally whether transducin reattaches to the membrane in a heterotrimeric or in a dissociated state ( 14 ) , our results suggest the following . 1 ) the electrostatically favorable orientations of gt enable it to approach the membrane without experiencing an electrostatic energy barrier ( fig . 2 ) soluble g11 is actively attracted to the membrane in many orientations ( fig . 3 ) electrostatic interactions orient the lipid anchors of soluble gt or g11 toward the membrane , thereby favoring lipid anchor insertion into the membrane for both gt and g11.4)incontrast , electrostatic interactions oppose the approach of soluble gt to the membrane in orientations that enable membrane insertion of its lipid anchor ( fig . 78 that association with g11 is required to efficiently reattach gt to membranes . implications for membrane interactions of other g proteins our calculations were performed on bovine gt , but they are also applicable to all mammalian gt orthologs because they are > 98% identical in sequence . gt orthologs in more distantly related vertebrates also show > 90% sequence identity , both globally and when considering only their charged residues . similarly , murray et al . ( 30 ) showed that the electrostatic properties of not just g11 from different species , but all mammalian g subunits ( which share > 80% sequence identity ) , are generally conserved and resemble those of g11 . visualization of the gi112 heterotrimer ( pdb code 1gp2 ) in a similar orientation to that of gt in fig . the subunits are shown in connolly surface representation and colored pink ( ) , light green ( ) , and light blue ( ) . the conserved negatively charged patches discussed in the text are marked with red ( g12 ) and orange ( gi1 ) arrows . visualization of the gi112 heterotrimer ( pdb code 1gp2 ) in a similar orientation to that of gt in fig . the subunits are shown in connolly surface representation and colored pink ( ) , light green ( ) , and light blue ( ) . the conserved negatively charged patches discussed in the text are marked with red ( g12 ) and orange ( gi1 ) arrows . other members of the gi subunit subfamily ( go1 , go2 , gi1 , gi2 , and gi3 ) share a lower sequence identity with gt , ranging between 60 and 70% . nevertheless , the electrostatic potential maps of these related g subunits are similar , and in particular the dominant negative patches that produce gt-membrane repulsion are also observed in these proteins ( 32 ) . these similarities suggest that the electrostatic repulsion of dissociated g subunits by the membrane is common among all members of the gi subfamily . additionally , when we compared the electrostatic potential map of the gi112 heterotrimer ( 79 ) ( fig . in particular , the negatively charged patches that limit the rotation of gt are also present in the gi112 heterotrimer ( marked with arrows in fig . therefore , the characteristics of the dynamic interactions of the gt heterotrimer with the membrane are expected to apply to the entire gi subfamily . unlike gi subfamily members , g subunits that are palmitoylated only ( e.g. gq , gs , and g12 ) contain prominent basic patches at their n termini ( 32 ) . a number of these proteins have been shown to undergo cycles of reversible membrane association and dissociation , mediated by the cleavage and re - attachment of their labile palmitate anchors ( 11 , 80 , 81 ) . the basic electrostatic motif in these g subunits may initiate membrane binding ( 32 ) , whereas their subsequent palmitoylation would strengthen this attachment ( 80 , 81 ) . this interdependence , which could be viewed as an example of the two - signal model of membrane binding ( 80 , 81 ) , was recently observed in experiments analyzing the roles of the basic n - terminal motif and palmitoylation in membrane attachment of gq , gs , g14 , and g16 ( 82 , 83 ) . these results support the hypothesis that , unlike gt and its homologs , the subunits of the gq , gs , and g12 subfamilies are attracted to the membrane . in a broader context , it is well established that both membrane binding and subcellular localization of numerous peripheral membrane proteins are determined by various combinations of lipid anchorage and electrostatic interactions ( 30 , 33 - 40 ) . although g proteins follow this general theme , they also represent an example of how the activity - dependent dissociation of a multisubunit protein complex changes the interplay between lipid anchors and electrostatics . the unique electrostatic properties of the heterotrimer and its subunits thereby provide different membrane binding affinities and contribute to the specificity of their protein - protein interactions . therefore , extending the computational approaches used here to analyzing differences among a broad range of g proteins is a promising direction of future work .

the heterotrimeric g protein transducin is a key component of the vertebrate phototransduction cascade . transducin is peripherally attached to membranes of the rod outer segment , where it interacts with other proteins at the membrane - cytosol interface . however , upon sustained activation by light , the dissociated gt and g11 subunits of transducin translocate from the outer segment to other parts of the rod cell . here we used a computational approach to analyze the interaction strength of transducin and its subunits with acidic lipid bilayers , as well as the range of orientations that they are allowed to occupy on the membrane surface . our results suggest that the combined constraints of electrostatics and lipid anchors substantially limit the rotational degrees of freedom of the membrane - bound transducin heterotrimer . this may contribute to a faster transducin activation rate by accelerating transducin - rhodopsin complex formation . notably , the membrane interactions of the dissociated transducin subunits are very different from those of the heterotrimer . as shown previously , g11 experiences significant attractive interactions with negatively charged membranes , whereas our new results suggest that gt is electrostatically repelled by such membranes . we suggest that this repulsion could facilitate the membrane dissociation and intracellular translocation of gt. moreover , based on similarities in sequence and electrostatic properties , we propose that the properties described for transducin are common to its homologs within the gi subfamily . in a broader view , this work exemplifies how the activity - dependent association and dissociation of a g protein can change both the affinity for membranes and the range of allowed orientations , thereby modulating g protein function .

EXPERIMENTAL PROCEDURES RESULTS DISCUSSION Supplementary Material

, it accounts for the largest number of deaths from malignant neoplasms in women and the third largest number in men . however , since the recurrence rate of t1 colorectal cancer ( invasion no deeper than the submucosa ) without lymph node metastasis is approximately 1% , the outcome of t1 colorectal cancer is considered to be good . on the other hand , the incidence of synchronous liver metastases in colorectal cancer has been reported to be about 10% , yet t1 colorectal cancer with synchronous liver metastasis is considered to be rare [ 3 , 4 ] . therefore , there have been many reports of lymph node metastases , but few reports of the risk factors of synchronous or metachronous distant metastases from t1 colorectal cancer . we report a case of t1 colorectal cancer of the ascending colon with synchronous liver metastasis . the patient was a 68-year - old japanese man who was admitted to our hospital with a liver tumor that had been detected by abdominal ultrasonography . laboratory tests showed : erythrocyte count 484 10/mm ( normal 420554 ) , hemoglobin 15.9 g / dl ( normal 13.816.6 ) , leukocyte count 8,600/mm ( normal 3,5009,000 ) , platelet count 21.8 10/mm ( normal 15.536.5 ) , serum total protein 6.5 g / dl ( normal 6.38.1 ) , total bilirubin 0.69 mg / dl ( normal 0.31.2 ) , aspartate aminotransferase 28 iu / l ( normal 436 ) , alkaline phosphatase 224 iu / l ( normal 115359 ) , -glutamyl transpeptidase 53 iu / l ( normal 468 ) , blood urea nitrogen 16 mg / dl ( normal 921 ) , and creatinine 0.92 mg / dl ( normal 0.601.20 ) . carcinoembryonic antigen and ca19 - 9 were both elevated at 23.9 ng / ml ( normal 03 ) and 51 u / ml ( normal 037 ) , respectively . abdominal ultrasonography revealed a hyperechoic mass in segment 7 of the liver , 30 mm in diameter , with a circumferential hypoechoic area . abdominal computed tomography also showed mild enhancement of a liver tumor 30 mm in diameter at the portal phase ( fig . 1a ) . on colonoscopy , a pedunculated tumor with a central depression ( 20 mm in diameter ) was observed in the ascending colon , and this tumor was considered to be invading deeply into the submucosal layer ( fig . abdominal magnetic resonance imaging showed the liver tumor as a low - intensity mass in the t1 emphasis phase ( fig . 1c ) , as a high - intensity mass in the t2 emphasis phase ( fig . 1d ) and as a strongly high - intensity mass by administering the contrast medium ferumoxide ( fig . t1 colorectal carcinoma with liver metastasis was suspected , and right hemicolectomy with d3 lymphadenectomy and partial hepatectomy were performed simultaneously ( fig . the tumor was a well - differentiated tubular adenocarcinoma with 3,000 m invasion of the submucosal layer ( fig . 2c , the liver tumor showed histological findings similar to those of the primary colorectal carcinoma ( fig . the pathological stage according to the 7th edition of the tnm classification was stage iv ( t1n0m1 ) . his general condition worsened , and the patient ultimately died 14 months after the operation . a multicenter study in japan reported that 153 ( 8.5% ) of 1,806 patients with t1 colorectal cancer had lymph node metastases and 40 ( 2.2% ) of 1,806 patients had synchronous or metachronous distant metastases . among them , furthermore , when the focus was restricted to synchronous liver metastases , the incidence was 0.2% . also reported that the incidence of liver metastases from t1 colorectal cancer was 3.3% and that of synchronous liver metastases 0.9% . thus , the form of metastases from t1 colorectal cancer is mainly lymph node metastases . therefore , to date , there have been many reports of lymph node metastases but few reports of distant metastases . with respect to the risk factors of lymph node metastasis in t1 colorectal cancer , sakuragi et al . reported that the depth of submucosal invasion ( 2,000 m ) and lymphatic invasion significantly predicted the risk of lymph node metastasis in multivariate analysis . in addition , the depth of submucosal invasion ( 1,000 m ) , lymphovascular invasion , histological grade [ 7 , 8 ] and budding at the invasive front of the tumor [ 7 , 8 ] were thought to be significantly associated with lymph node metastasis . on the other hand , with respect to the risk factors of synchronous or metachronous distant metastases from t1 colorectal cancer , nodal metastases , depth of invasion and venous invasion are considered to be risk factors . these risk factors of distant metastasis are often common to those of lymph node metastases . it is considered that the highly malignant potential of t1 colorectal cancer , which can invade the submucosal layer broadly or exhibit poor differentiation , allows the tumor to invade the venous plexus of the submucosal layer and then develop distant metastases . in our case , submucosal invasion ( 3,000 m ) and venous invasion were recognized as risk factors . consequently , this case had multiple risk factors of distant metastasis . it has also been reported that the 5-year survival rate after liver resection in patients with synchronous liver metastases is 1938% , and that the prognosis of patients with resectable synchronous liver metastases is better than that of those with non - resectable liver metastases . however , even after curative resection , some cases have a poor prognosis for recurrence in the remnant liver and exhibit extrahepatic recurrence . in our case , postoperative adjuvant chemotherapy was undertaken for 6 months , however the prognosis was poor because of extrahepatic recurrence 9 months after the operation . hayashi et al . reported that extrahepatic recurrence was a prognostic factor after curative liver resection and noted that postoperative adjuvant systemic chemotherapy is necessary for patients with synchronous liver metastases because liver metastases should be considered equivalent to systemic disease . moreover , expert consensus statements by the american hepato - pancreato - biliary association also concluded that adjuvant systemic chemotherapy after curative liver resection must be supported because most patients with synchronous liver metastases concurrently exhibit extrahepatic metastases . however , the regimens and periods of postoperative adjuvant systemic chemotherapy were not fixed because of the absence of consensus for adjuvant chemotherapy after curative liver resection . there are few well - organized reports because t1 colorectal cancer with synchronous liver metastasis is extremely rare . on the other hand , the prognosis is often poor in patients with metachronous liver metastases after surgery for t1 colorectal cancer [ 13 , 14 , 15 ] . therefore , it is predictable that the prognosis of patients with synchronous liver metastasis is also poor . it is necessary to establish postoperative surveillance and a plan for adjuvant chemotherapy for t1 colorectal cancer with synchronous liver metastasis . we consider this case to be rare , and it is necessary to accumulate more cases to further elucidate the risk factors for liver metastasis from t1 colorectal cancer .

the patient was a 68-year - old man who was admitted to our hospital with a liver tumor . abdominal ultrasonography and computed tomography revealed a liver tumor 30 mm in diameter . on colonoscopy , a pedunculated tumor with a central depression ( 20 mm in diameter ) was observed in the ascending colon , and this tumor was considered to be invading deeply into the submucosal layer . right hemicolectomy with d3 lymphadenectomy and partial hepatectomy were performed simultaneously . on histopathological examination of the resected specimen , the tumor was a well - differentiated tubular adenocarcinoma with 3,000 m invasion of the submucosal layer . the liver tumor showed histological findings similar to those of the primary colorectal carcinoma . the pathological stage according to the 7th edition of the tnm classification was stage iv ( t1n0m1 ) . nine months after the operation , computed tomography revealed hepatic hilar lymph node metastases and a great deal of ascites . the patient ultimately died 14 months after the operation .

Introduction Case Report Discussion Disclosure Statement

the cases were collected from our melanoma database , and 30 patients who were treated from january 2001 to december 2010 were retrospectively reviewed . medical records were reviewed for demographics , clinical and pathological information , immediate as well as remote postoperative events and outcomes , with a minimal follow - up of 2 years or death . all patients were advanced stage ( american joint committee on cancer [ ajcc ] stage ii and iii ) melanoma patients , and for the operative treatment , we performed wide marginal surgery , which sometimes involved removal of the bone and surrounding tissue . and without considering the stage of the melanoma , we routinely performed sentinel lymph node dissection in all patients . therefore , we performed amputation with lymph node dissection for all patients who had melanoma of ajcc stage iii ( table 1 ) . after the surgery , we monitored patients for recurrence and metastasis every 3 months for the first 2 years and then gradually lengthened the interval between visits to yearly by the fifth year if no relapse of disease was observed . patients underwent history , physical examination , chest radiography , and radiography of the affected region at each visit . computed tomography , magnetic resonance imaging , and whole - body bone scans were obtained selectively , depending on whether there was evidence from the history , physical examination , and radiographs to warrant further study . data extracted included early diagnosis , sex , location of the tumor ( hand or foot ) , and for the clinical evaluation , we used the ajcc classification.10 ) also , patient 's mortality , follow - up duration , the date of the first operation , and metastasis to the sentinel lymph node were assessed . data on survival ( from the date of diagnosis to the date of last follow - up or death ) for the survival analysis was acquired from our database . for the statistical analysis , the kaplan - meier product was used to estimate curves for survival rate , and the log - rank test was used to evaluate differences between the survival curves . patients who were lost to follow - up or who were alive at the time of the last follow - up were censored at the date of their last follow - up . univariate t - test analysis was used to calculate the relative risk of each parameter . chicago , il , usa ) to perform statistical calculations and calculated confidence intervals of 95% for the statistical parameters . eighteen of the 30 patients ( 60% ) were men and 12 patients ( 40% ) were women , for a male - to - female ratio of 1.5:1 . most were diagnosed while in the sixth or seventh decade of life , with a mean age of 58.7 years ( range , 35 to 78 years ) . all of the patients had ajcc stage ii or iii disease at initial examination , and lesions were located predominantly on the sole and thumb ( fig . thirty patients who were diagnosed with high - grade malignant melanoma , underwent amputation of the tumor - involving extremity . the overall survival of patients after amputation of the malignant melanoma was 93% at 1 year , 76% at 2 years , and 67% at 5 years ( fig . fourteen of 30 patients were alive without disease , and six patients were dead with the disease at the end of the study ( table 2 ) . on the univariate analysis , diagnosis when over 70 years of age , tumor located on the lower extremity , and postoperative lymph node metastasis were found to predict poorer survival ; and this result was statistically significant ( p < 0.05 ) ( table 3 ) . and on the kaplan - meier analysis , patient 's gender and location of the tumor did not affect long term survival , whereas age at diagnosis , ajcc stage , and postoperative lymph node metastasis did impact the survival ( p < 0.05 ) ( table 4 ) . the overall survival curve was plotted according to age , sex , location , ajcc stage , and postoperative lymph node metastasis ( fig . as mentioned above , there were significant differences in early diagnosis , ajcc stage , and postoperative lymph node metastasis of malignant melanoma ( p < 0.05 ) . we also found amputation with aggressive lymph node dissection improved the 5-year overall survival of ajcc stage iii patients , with a survival rate of up to 32.1% . eighteen of the 30 patients ( 60% ) were men and 12 patients ( 40% ) were women , for a male - to - female ratio of 1.5:1 . most were diagnosed while in the sixth or seventh decade of life , with a mean age of 58.7 years ( range , 35 to 78 years ) . all of the patients had ajcc stage ii or iii disease at initial examination , and lesions were located predominantly on the sole and thumb ( fig . thirty patients who were diagnosed with high - grade malignant melanoma , underwent amputation of the tumor - involving extremity . the overall survival of patients after amputation of the malignant melanoma was 93% at 1 year , 76% at 2 years , and 67% at 5 years ( fig . fourteen of 30 patients were alive without disease , and six patients were dead with the disease at the end of the study ( table 2 ) . on the univariate analysis , diagnosis when over 70 years of age , tumor located on the lower extremity , and postoperative lymph node metastasis were found to predict poorer survival ; and this result was statistically significant ( p < 0.05 ) ( table 3 ) . and on the kaplan - meier analysis , patient 's gender and location of the tumor did not affect long term survival , whereas age at diagnosis , ajcc stage , and postoperative lymph node metastasis did impact the survival ( p < 0.05 ) ( table 4 ) . the overall survival curve was plotted according to age , sex , location , ajcc stage , and postoperative lymph node metastasis ( fig . as mentioned above , there were significant differences in early diagnosis , ajcc stage , and postoperative lymph node metastasis of malignant melanoma ( p < 0.05 ) . we also found amputation with aggressive lymph node dissection improved the 5-year overall survival of ajcc stage iii patients , with a survival rate of up to 32.1% . malignant melanoma is a relatively rare occurrence in the asian population compared to fair - skinned populations . limited data are available on skin cancer in asians , including information on the prevalence rates of malignant melanoma in different asian populations.11 ) in korea , the incidence of malignant melanoma increased from 1.02% of all skin malignancies in the 1980s to 15.6% in the 1990s.12,13 ) the mean age of diagnosis of melanoma was 58.7 years in our study , which was similar to other studies.14 ) in asian populations , malignant melanoma tends to occur 1.5 times more often in males than females , as in our study.14 ) unlike other studies , all of our patients were consulted from the dermatologic department with more than ajcc stage ii , which is advanced stage malignant melaoma . the difficulty in making the diagnosis of these malignant melanomas and the subsequent delay in proper treatment are factors likely to contribute to the preponderance of advanced lesions seen at the initial presentation.15 - 17 ) in this study , all of the patients presented with either ajcc stage ii or iii , and all cases were more than 1.5 mm thick . these factors ( stage , thickness , and level of invasion ) are important prognostic parameters in patients with advanced stage melanoma.18 - 21 ) after diagnosis of the melanoma , the affected digit must be amputated promptly . confirming a previous report,17 ) most studies of subungual melanoma have used amputation with or without lymph node dissection , yielding 5-year survival rates of 16% to 32%,22,23 ) whereas others using amputation with lymph node dissection or regional limb perfusion have reported 5-year survival rates of 25% to 32% , with minimal morbidity and no mortality.24,25 ) in addition to amputation although the use of these treatment modalities did not affect patient survival , perfusion may reduce the incidence of local disease recurrence . there is still controversy about the significance of the anatomical site of origin in prognosis . in our study , 85% of the melanomas were located on the acral area ( palm , sole , and subungal area ) . however , when compared with melanomas arising in other locations , sex and thickness of tumor were not significantly different . according to the location of the tumor , our institution performed wide marginal resection of the tumor , that is , amputation . but , treatment of melanomas on the hands and feet is particularly challenging for surgeons due to the functional uses of these body parts and the difficulty of obtaining the conventionally recommended margins . however , in cases of advanced stage melanoma as in our studies , amputation is usually required due to the paucity of soft tissue between the tumor and the bone . therefore , although amputation is not commonly recommended in general , it should be the first recommendation in cases of advanced stage melanomas that have insufficient safety margins . balch et al.26 ) reported 5-year survival rates of 13% to 37% in patients who showed lymph node metastasis at the time of diagnosis . although , in our study , patients who were diagnosed as ajcc stage iii showed a poorer survival rate than stage ii patients , with aggressive lymph node dissection during the amputation , we found an improved survival rate of ajcc stage iii patients of up to 32.1% , higher than in other reports ( table 5).27 - 30 ) in korean melanoma patients , for the treatment of high grade melanomas on the extremities after amputation , early diagnosis and postoperative follow - up for evaluation of lymph node metastasis are critical factors for long term survival . by performing lymph node dissection during amputation , we may improve the survival rate in advanced stage melanoma patients .

backgrounda retrospective study was conducted to review the overall survival and treatment outcomes of high grade melanoma in the extremity to explore the clinical features of malignant melanoma of the hand and foot , and the therapeutic efficacies and survival rate after amputation.methodsthe clinical data of 30 patients with malignant melanoma of the hand and foot ( confirmed by pathological examination ) , who were admitted and treated in our hospital between 2001 and 2010 , were analyzed retrospectively . we analyzed variables affecting overall and disease - free survival.resultsthirty patients ( 18 men and 12 women ) treated with an amputation procedure for malignant melanoma in the hand or foot constituted the study cohort . the average age of the patients at the time of diagnosis was 58.7 years . univariate analysis for overall melanoma survival revealed that diagnosis at over 70 years of age , postoperative lymph node metastasis , and location of the tumor were significant prognostic factors . and on the kaplan - meier survival curve , old age , american joint committee on cancer stage and postoperative lymph node metastasis showed statistically significant differences in the 5-year survival rate . also , amputation with aggressive lymph node dissection showed improved long term survival in advanced stage melanoma.conclusionsin korean melanoma patients , for the treatment of high grade melanomas in the extremities after amputation , early diagnosis and postoperative follow - up for evaluation of lymph node metastasis are critical factors for long - term survival . and by performing lymph node dissection during amputation , we may improve the survival rate in advanced stage melanoma patients .

METHODS RESULTS Patient Characteristics Overall Survival and Prognostic Factors DISCUSSION

granulocyte macrophage colony - stimulating factor ( gm - csf ) is a hematopoietic growth factor which was originally recognized as a stimulator for the proliferation of granulocytes and macrophages from bone marrow precursor cells . it has also been shown to promote the survival and activation of mature myeloid cells and therefore contributes to the maintenance of innate immune homeostasis . recent studies suggest that gm - csf also has proinflammatory functions and plays critical roles in the development of autoimmune and inflammatory diseases , particularly in th17 driven diseases [ 3 , 4 ] . major sources of gm - csf include activated t and b cells , monocytes / macrophages , endothelial cells , fibroblasts , and other sources such as neutrophils , eosinophils , epithelial cells , mesothelial cells , chondrocytes , paneth cells , and tumor cells [ 57 ] . the production of gm - csf in t cells is stimulated by il-1 and il-23 in mice [ 3 , 8 ] , il-1 and il-12 in humans , and also prostaglandin e2 . in fibroblasts , endothelial cells , chondrocytes , and smooth muscle cells , it is stimulated by tnf- and il-1 , and in macrophage / monocytes it is stimulated by toll like receptors ( tlrs ) . in lymphocytes , the transcription factor nuclear factor of activated t cells ( nfat ) is reported to be required for the production of gm - csf [ 11 , 12 ] . however , the production of gm - csf can be inhibited by ifn- , il-4 , il-10 , and also pharmacological agents such as cyclosporine a [ 16 , 17 ] or glucocorticoids . the gm - csf receptor is expressed on myeloid cells and on some nonhaemopoietic cells such as endothelial cells but not on t cells [ 19 , 20 ] . the gm - csf receptor is a heterodimer of an -subunit which binds gm - csf with low affinity and a signaling c - subunit which is shared with the il-3 and il-5 receptors . the c - subunit constitutively associates with janus kinase 2 ( jak2 ) and is tyrosine phosphorylated by it resulting in an assembly of dodecameric signaling complex and initiation of signaling . the effects of gm - csf are mediated in a dose - dependent manner , by two -chain residues : ser585 and tyr577 . at low concentrations of gm - csf , as in normal healthy tissues , signaling occurs via ser585 of the -chain , which leads to activation of the pi-3 kinase pathway and results in myeloid cell survival . at high concentrations of gm - csf , as at the site of inflammation , signaling via ser585 is extinguished and signaling occurs exclusively via tyr577 residue , which activates the jak2/stat5 pathway , ras / mitogen - activated protein kinase pathway and pi-3 kinase pathway , resulting in cell survival , proliferation , and activation [ 2326 ] . gm - csf stimulates proliferation and activation of macrophages , monocytes , neutrophils , eosinophils , dendritic cells , and microglia [ 1 , 27 ] . however , since gm - csf - deficient mice did not have a defect in myeloid cell development , a redundant role of gm - csf in myeloid cell development and differentiation under steady state or homeostatic conditions is predicted . in addition to its function as a hematopoietic growth factor , gm - csf is now recognized to have a variety of functions on mature hemopoietic cells . gm - csf enhances proinflammatory cytokine production , antigen presentation [ 30 , 31 ] , and phagocytosis [ 3235 ] and promotes leukocyte chemotaxis and adhesion [ 5 , 3638 ] . gm - csf deficient mice have increased susceptibility to pulmonary [ 28 , 3941 ] and intestinal infections followed by systemic infection , indicating its importance in maintaining immune homeostasis particularly in the lung and intestines , which are constitutively exposed to pathogens . gm - csf stimulates the terminal differentiation of macrophages and the acquisition of normal immune functions via the transcription factor pu.1 . gm - csf also regulates phagocytosis of microbial pathogens by macrophages through the upregulation of pathogen associated molecular pattern ( pamp ) receptors such as c - type lectins including mannose receptors or dectin-1 , scavenger receptors , integrins , or fc receptors via pu.1 [ 24 , 3234 , 43 ] . complement - dependent phagocytosis is also enhanced by gm - csf to control microbial pathogens . gm - csf also upregulates the expression of tlr2 , tlr4 , or cd14 and boosts the production of proinflammatory cytokines such as tnf , il-6 , il-12p70 , il-23 , or il-1 [ 24 , 32 , 45 , 46 ] , leading to polarization of macrophages to the m1- ( classic- ) like phenotype , thus , promoting th1th17 responses [ 29 , 47 , 48 ] and contributing to tissue destruction . on the other hand , m - csf polarizes macrophages to the m2- ( alternative- ) like phenotype , which produces anti - inflammatory cytokines such as il-10 and cc - chemokine ligand 2 ( ccl2 ) and promotes tissue repair and remodeling . gm - csf also regulates many functions in macrophages including cell adhesion , pulmonary surfactant lipid and protein catabolism , and several important antimicrobial activities such as the production of reactive oxygen species ( ros ) or expression of antimicrobial enzymes . gm - csf positively regulates the development of migratory cd103cd11b dcs but negatively regulates the development of resident cd8 dcs . gm - csf also strongly induces the development of inflammatory monocyte - derived dcs ( modcs ) in vitro . however , it has not been well established whether gm - csf also regulates the development of modcs in vivo . it was reported that the number of modcs was increased in gm - csf transgenic mice . furthermore , nf-b1-dependent gm - csf production in cd4 t cells was reported to be required for the generation of modcs in inflammatory arthritis and antigen - induced peritonitis mouse models . the number of modcs was markedly reduced in draining lymph nodes from gm - csf/ mice with inflammatory arthritis or in the spleen of mice reconstituted with nf-b1/ cd4 t cells in acute peritonitis , demonstrating that gm - csf contributes to the differentiation of these cells during inflammation in vivo . on the other hand , gm - csf was shown to be dispensable for the differentiation of modcs , at least during acute infections , since the number of modcs was not decreased in gm - csf/ mice or gm - csf receptor deficient mice during acute infections [ 55 , 56 ] . these data indicate that although gm - csf strongly regulates the production of modcs in vitro and in vivo , there may be another gm - csf - independent pathway for the development of modcs . besides the regulation of dc development , gm - csf also upregulates cross - presentation , bacterial uptake , or production of proinflammatory cytokines such as il-6 or il-23 in resident dcs . in mature neutrophils , gm - csf upregulates the expression of the integrin cd11b , which increases cellular adhesion and tissue entry . gm - csf also upregulates the antimicrobial functions of neutrophils , such as phagocytosis or ros production . however , the expression of pu.1 in neutrophils of autoimmune pulmonary alveolar proteinosis patients was normal , indicating that gm - csf is not involved in neutrophil differentiation . among b cells , the innate - like b1 b cells reside predominantly in serosal cavities such as the pleural or peritoneal cavity . in response to microbial infection , b1a b cells ( a subset of b1 b cells ) recognize bacteria via direct tlr - dependent pathogen recognition and differentiate into innate response activator ( ira ) b cells , which produce gm - csf and also express the gm - csf receptor [ 59 , 60 ] . gm - csf acts on its receptor in an autocrine manner and induces igm production from b cells [ 59 , 61 ] . mixed chimeric mice with b cell - restricted gm - csf deficiency showed high bacterial titer and morbidity after infection but did not show alveolar proteinosis , indicating that b cell - derived gm - csf is necessary for protective igm responses but dispensable for surfactant clearance by alveolar macrophages . these data indicate that the cellular source and location of gm - csf is important . although gm - csf is widely expressed in both stromal and hematopoietic cells , recent murine studies suggest that gm - csf from cd4 t cells is essential in inflammatory mouse models such as experimental autoimmune encephalomyelitis ( eae ) , arthritis models such as collagen - induced arthritis ( cia ) or skg - arthritis , interstitial lung disease in skg mice ( skg - ild ) , peritonitis , or myocarditis [ 3 , 4 , 54 , 57 , 6264 ] . although gm - csf is known as one of the th17 cytokines , th1 cells and th2 cells also express gm - csf [ 6467 ] . moreover , recent studies represent the existence of gm - csf - producing th cells distinct from th1 , th2 , or th17 cells [ 62 , 64 ] ( figure 1 ) . th17 cells have been shown to be strong inducers of tissue inflammation and autoimmune diseases . however , a number of studies determined that il-17 inhibition does not prevent but rather only ameliorates the development of eae [ 3 , 4 , 68 , 69 ] , cia , skg - arthritis , or skg - ild and that neutralizing il-17 is a rather unsatisfactory method for blocking th17 mediated diseases [ 71 , 72 ] . recently , it was reported that classical th17 cells , which mainly produce il-17 , are not pathogenic and that th17 cells have high plasticity . th1/17 cells are characterized by their ability to coproduce il-17 , ifn- , and gm - csf and are identified by the coexpression of t - bet , rort , and the chemokine receptors cxcr3 and ccr6 [ 9 , 7478 ] . human th1/17 cells also express cd161 , a hallmark of th17 progeny cells in humans that is induced by rort [ 76 , 79 , 80 ] . recent studies report that gm - csf is critical for the pathogenicity of th17 cells [ 3 , 4 ] and the presence of th1/17 cells was observed at the inflammatory site of inflammatory bowel disease ( ibd ) , multiple sclerosis ( ms ) , and juvenile idiopathic arthritis ( jia ) [ 76 , 78 , 81 , 82 ] . in mice , il-23 and il-1 induce the production of gm - csf in t cells whereas il-12 suppresses its expression [ 3 , 4 , 77 , 83 ] . in contrast , in humans il-1 renders th17 cells sensitive to il-12 and both il-1 and il-12 promote the differentiation of th1/17 cells [ 9 , 75 , 81 , 84 , 85 ] ( figure 1 ) . as described in section 2.3 , gm - csf induces the differentiation of m1-like macrophages and upregulates the production of proinflammatory cytokines such as il-6 , il-12 , il-23 , or il-1 from antigen presenting cells ( apcs ) . this results in further differentiation of th17 and th1/17 cells , thus creating a positive feedback loop [ 3 , 63 ] . studies show that gm - csf expression in cd4 t cells is not regulated by t - bet [ 3 , 4 ] and ror - responsive elements are identified in the promoter of the gene encoding gm - csf . moreover , ectopic rort expression in cd4 t cells results in gm - csf production , indicating that gm - csf production in th1/17 cells is induced by rort . conversely , rort - deficient cd4 t cells can produce gm - csf , indicating the existence of additional pathways to induce gm - csf production in cd4 t cells . recently , it was reported that il-2- or il-7-activated stat5 promotes the generation of gm - csf - producing cd4 t cells with low or undetectable expression of t - bet , gata-3 , rort transcripts . these cells represent a new distinct subset of th cells , namely , th - gm [ 62 , 64 ] . in humans , these th - gm cells are identified as ccr10ccr4cxcr3ccr6 th cells . it was reported that il-7-activated stat5 directly bound to promoter regions of the gene encoding gm - csf . the contribution of il-7 has been implicated in autoimmune diseases such as multiple sclerosis or rheumatoid arthritis [ 86 , 87 ] , which also suggests the contribution of th - gm cells in these diseases . high expression of il-3 , which is also involved in several autoimmune diseases [ 8890 ] , was also reported in th - gm cells . these cells were reported to be able to induce a more severe experimental autoimmune encephalomyelitis ( eae ) than th17 or th1 cells [ 62 , 64 ] . it is possible that th - gm cells provide gm - csf to induce the expression of il-23 from apcs and cooperate with th1/17 or th1 cells to exacerbate the development of inflammation . it was reported that th1 cells also need gm - csf to mediate inflammation in the central nervous system ( cns ) . however , the amount of gm - csf produced by th1 cells is found to be consistently lower than that produced by th17 cells , particularly during in vitro culture . although a positive correlation was found between gata-3 cells and gm - csf cells in the nasal mucosa of patients with allergic rhinitis , there is no study to our knowledge that directly analyzes the role of gata-3 in gm - csf production . further investigation is therefore needed to elucidate the precise mechanism of gm - csf production from cd4 t cells and their contribution to the development of autoimmune and inflammatory diseases . multiple sclerosis ( ms ) is a chronic inflammatory disease of the central nervous system and is pathologically characterized by demyelination and subsequent axonal degeneration . past studies have shown that cd4 t cells play a critical role in the development of ms and experimental autoimmune encephalomyelitis ( eae ) , a widely used mouse model of ms . it has been widely believed that th17 cells are the main encephalitogenic population in autoimmune inflammation ; however , il-17 has been found to be dispensable for the development of eae [ 4 , 93 ] . on the other hand , gm - csf deficiency or neutralization of gm - csf has been reported to prevent the onset of eae [ 94 , 95 ] . the administration of recombinant gm - csf worsened the disease in eae and elevated concentrations of gm - csf have been reported in the cerebrospinal fluid but not in the serum of patients with relapsing - remitting or secondary progressive ms [ 96 , 97 ] . recent findings show that gm - csf is secreted by cns - infiltrating helper t cells and is essential for encephalitogenicity in eae [ 3 , 4 , 64 ] . gm - csf induces the proliferation and activation of microglial cells , which is required for the onset of eae [ 95 , 98 ] . activated microglial cells produce highly neurotoxic substances such as ros , nitrogen species , glutamate , and tnf- [ 99102 ] . furthermore , gm - csf - producing cd4 t cells induce the differentiation of neurotoxic m1-like phenotype of microglia and upregulate the production of proinflammatory mediators such as il-1 , il-6 , and tnf , which contribute to myelin sheath damage , via upregulation of tlr and cd14 expression . studies also show that gm - csf is required for recruitment of peripheral myeloid cells that contribute to blood - brain barrier ( bbb ) and blood - spinal cord barrier ( bscb ) disruption and demyelization into the cns [ 104 , 105 ] . as we described in section 3.1 , gm - csf induces the polarization of the m1-like macrophage phenotype and exacerbates the positive feedback loop of th17 and th1/17 differentiation . indeed , an increased m1/m2 profile ratio of monocyte / macrophages in the blood as well as in the cns favors relapsing eae and a reduced m1/m2 ratio promotes an attenuated manifestation of the disease . the ability of cns - invading myeloid cells to respond to cd4 t cell - derived gm - csf was shown to be vital for the development of eae . taken together , cns - infiltrating cd4 t cells initially activate microglia and induce production of proinflammatory cytokines , which contribute to myelin sheath damage . this initial neuroinflammation results in bbb destruction and leukocyte infiltration into the cns parenchyma , followed by restimulation of t cells by resident and infiltrating apcs , leading to further apc activation . these reports indicate that gm - csf plays a central role in ms and indicate that the inhibition of gm - csf will be a useful therapeutic strategy for ms . mor103 , a fully human monoclonal antibody that binds human gm - csf , is currently being tested in a phase ib trial for ms ( table 1 ) . rheumatoid arthritis ( ra ) is a systemic chronic autoimmune disease characterized by persistent and erosive inflammatory polyarthritis . recent studies indicate that gm - csf plays a central role in the pathogenesis of ra as in ms , by activating or promoting differentiation and survival of macrophages and neutrophils [ 109 , 110 ] . the concentrations of gm - csf were elevated in the synovial fluid and plasma of ra patients [ 111 , 112 ] . a case report showed that the administration of recombinant gm - csf exacerbated the disease activity of ra . the frequency of gm - csf - producing th cells was significantly increased in synovial fluid cells compared to peripheral blood mononuclear cells ( pbmcs ) in patients with juvenile idiopathic arthritis ( jia ) and correlated with erythrocyte sedimentation rate ( esr ) levels [ 81 , 114 ] . synovial gm - csf - producing t cells were predominantly cd161 positive and coexpressed ifn- but not il-17 , indicating that these cells are th1/17 cells . alternatively , human synovial fibroblasts and chondrocytes were also reported to produce gm - csf in response to il-1 and tnf stimulation [ 115 , 116 ] . the contribution of gm - csf in the development of arthritis was also reported in several mouse models of arthritis . in the collagen - induced arthritis ( cia ) model , gm - csf deficient mice failed to develop arthritis , and the administration of anti - gm - csf neutralizing antibodies ameliorated existing disease , prevented disease progression , and reduced the concentrations of tnf and il-1 in the joints of treated mice . on the other hand , gm - csf administration exacerbated arthritis in cia . in skg mice , another model of autoimmune arthritis , gm - csf , upregulated proinflammatory cytokine production such as il-1 or il-6 from macrophages in a dose dependent manner [ 63 , 120 ] . this in turn induced further differentiation and expansion of il-17-producing and gm - csf - producing cd4 t cells . the progression of arthritis in skg mice was inhibited by the neutralization of gm - csf and slightly by the neutralization of il-17a , indicating that gm - csf plays a more critical role than il-17a in skg arthritis . mavrilimumab , a fully human anti - gm - csf receptor antibody , is currently being developed and a phase ii study in ra patients reported significant efficacy with no serious adverse events such as pulmonary alveolar proteinosis . in this study of patients with active ra despite methotrexate treatment , 55.7% of all participants treated with mavrilimumab met the primary end point of achieving 1.2 decrease from baseline in the disease activity score ( das28-crp ) at week 12 . at the highest dose of mavrilimumab ( 100 mg ) , 66.7% of subjects met the primary end point versus only 34.7% of the subjects in the placebo group . mor103 , which is also being tested for ms , has shown preliminary evidence of efficacy in a phase ib / iia trial for patients with active ra . subjects receiving higher doses of mor103 ( 1.0 and 1.5 mg / kg ) showed significant improvement in das28 scores and joint counts and significantly higher european league against rheumatism response rates than subjects receiving placebo . both mavrilimumab and mor103 showed rapid treatment responses and provided evidence of clinical efficacy that support further clinical investigation . a list of ongoing / completed clinical trials targeting gm - csf or its receptor is presented in table 1 , with more information available at clinicaltrials.gov . pulmonary alveolar proteinosis ( pap ) is a rare syndrome characterized by the accumulation of surfactant in pulmonary alveoli resulting in varying degrees of respiratory insufficiency and myeloid cell dysfunction leading to increased risk of infection [ 123 , 124 ] . several clinical forms of pap have been identified including autoimmune pap caused by gm - csf autoantibodies , hereditary pap caused by gm - csf receptor mutations , and secondary pap associated with various underlying clinical disorders which is presumed to cause this syndrome by reducing alveolar macrophage numbers or function . it is also reported that gm - csf deficient mice develop abnormal lung histology that is virtually indistinguishable from human pap . pulmonary surfactant is tightly regulated by balanced production , secretion , reuptake , and catabolism within alveoli . gm - csf regulates surfactant catabolism in alveolar macrophages via pu.1 but does not regulate surfactant endocytosis or uptake and catabolism of surfactant by alveolar epithelial cells type ii ( aec - ii ) [ 32 , 127 ] . gm - csf is also required to stimulate numerous immune functions and terminal differentiation of alveolar macrophages and induction of igm production from b cells [ 60 , 61 ] . therefore , gm - csf deficient mice have high susceptibility to pulmonary infections [ 28 , 3941 ] accompanied by systemic infections . based on the pathogenesis of pap , several new therapeutic approaches for treating autoimmune pap targeting gm - csf are in clinical trials , including plasmapheresis , gm - csf administration [ 129 , 130 ] , and rituximab [ 131 , 132 ] . the mechanism of pulmonary fibrosis in interstitial lung disease ( ild ) has been studied using idiopathic pulmonary fibrosis ( ipf ) or a bleomycin - induced mouse model of pulmonary fibrosis . pulmonary fibrosis in ipf is considered to be inflammation - independent and mainly initiated by tgf- produced by damaged epithelial cells . in fact , anti - inflammatory therapies have little benefit in ipf [ 133135 ] . however , neutrophils , which produce ros , mmps , neutrophil elastase , or myeloperoxidase and cause lung parenchymal and stromal cell injury [ 136138 ] or th2 cytokines such as il-4 or il-13 , which induce fibroblast differentiation or extracellular matrix synthesis [ 139 , 140 ] , have been reported to contribute to lung fibrosis to some extent . additionally , gm - csf was reported to take part in the progress of pulmonary fibrosis . it was reported that tnf-induced endothelin-1 ( et-1 ) upregulates gm - csf production from airway smooth muscle cells ( asmcs ) and that gm - csf was increased in the bronchoalveolar lavage fluid ( balf ) of patients with pulmonary fibrosis [ 142 , 143 ] . gm - csf stimulates macrophages to release profibrotic cytokines and also induces fibrosis by direct stimulation of airway smooth muscle cells [ 144 , 145 ] . in fact , overexpression of gm - csf in the lungs led to severe neutrophil , eosinophil , and macrophage infiltration and fibrotic reactions [ 145147 ] . in contrast with idiopathic pulmonary fibrosis ( ipf ) , connective tissue disease - associated ild ( ctd - ild ) is often characterized by a clearer response to immunosuppression , indicating that autoimmune / inflammatory mechanisms play a more significant and central role in the pathogenesis of ctd - ild [ 148 , 149 ] . skg mice , a model of autoimmune arthritis , were reported to develop chronic - progressive interstitial lung disease ( ild ) that histologically resembles ctd - ild [ 63 , 150 , 151 ] . recently , it was reported that ild in this mouse was characterized by massive infiltration of th17 cells , gm - csf - producing cd4 t cells , and cd11bgr1 neutrophils with fibrosis . naive skg t cells were skewed to differentiate into gm - csf - producing cells . furthermore , gm - csf secreted by t cells enhanced il-6 and il-1 production by macrophages , which in turn enhanced differentiation of il-17a and/or gm - csf - producing t cells and infiltration of neutrophils into the lungs . neutralization of gm - csf completely blocked the development of this ild , whereas neutralization of il-17a did not , showing that gm - csf not il-17a is critical for the development of ild in skg mice . importantly , neutralization of gm - csf ameliorated ild in skg mice even after the onset of ild , suggesting that gm - csf inhibition is a useful therapeutic strategy for ctd - ild . mavrilimumab , a fully human anti - gm - csf receptor antibody and mor103 , a fully human monoclonal anti - gm - csf antibody , are undergoing clinical trials in ra patients [ 121 , 122 ] . recent developments suggest that the development of crohn 's disease ( cd ) is caused by a mucosal innate immunodeficiency with a variety of genetic defects and a dysfunction of granulocytes , macrophages , and intestinal epithelial cells [ 153 , 154 ] . in the intestine , gm - csf contributes to gut barrier function and resistance to bacterial translocation by promoting the recruitment and activation of monocytes / macrophages , neutrophils , and dcs . gm - csf also promotes tissue repair via increased intestinal epithelial cell proliferation and increased macrophages as effectors of wound healing [ 155157 ] . however , in cd patients , the inherent defects in the mucosal barrier increase the translocation of pathogens to the bowel tissue . moreover , increased levels of gm - csf autoantibodies have been reported in patients with ileal / ileocolonic cd , compared with those with colon involvement only , ulcerative colitis ( uc ) patients , or healthy controls . the high levels of gm - csf antibodies directly correlated with disease activity and inversely correlated with neutrophil phagocytic activity . increased gm - csf autoantibodies affect mucosal integrity , bacterial killing and neutrophil migration , proliferation , and survival . gm - csf deficient mice also developed a more severe intestinal and systemic infection after enteric infection and were more susceptible to acute dextran sodium sulfate- ( dss- ) induced colitis . both severity of infection and colitis were largely prevented by gm - csf administration [ 160 , 161 ] . on the other hand , gm - csf overexpression in the stomach leads to autoimmune gastritis and experimental peritonitis or intraperitoneal lps exposure in gm - csf deficient mice resulted in blunted proinflammatory responses and mortality . the expression of gm - csf at the mrna level increases from the stomach distally down through the colon , indicating that gastrointestinal expression of gm - csf expression parallels bacterial localization . these data indicate that the threshold of gm - csf levels between inflammation and immune homeostasis can vary with tissue location or organs . these findings indicate that administration of gm - csf could be beneficial for the treatment for cd patients . initial reports indicated that the administration of gm - csf in cd patients with moderate to severe disease activity had a high rate of clinical response and remission with minimal adverse effects [ 165 , 166 ] . moreover , a randomized phase ii clinical trial demonstrated that gm - csf was significantly more effective than placebo in obtaining a corticosteroid - free clinical remission . conversely , a recent large randomized trial found that it was no more effective than placebo for induction of clinical remission or improvement in active cd . cd patients are known to have substantial heterogeneity in pathogenic mechanisms and so gm - csf as a therapy may only be appropriate for a subgroup of patients . additionally , it is also important to verify the efficacy of gm - csf not only for the induction of remission but also for the maintenance of remission . therefore , further studies are needed to elucidate the efficacy of gm - csf as a treatment as well as the appropriate patient character or phase of disease to apply gm - csf administration as a therapy . gm - csf also was reported to take part in th2 response in allergic airway inflammation via activation of dcs [ 169171 ] . in mouse models of asthma , allergen - exposed epithelial cells release gm - csf which activates dcs and also prolongs eosinophil survival [ 170 , 172 ] . consequently , gm - csf neutralization reduced allergic hyperresponsiveness in mice models [ 169 , 170 , 172 ] . anti - gm - csf antibody , is tested in a phase ii trial for severe asthma ( table 1 ) . gm - csf plays pivotal roles not only in maintaining immune homeostasis but also in exacerbating inflammatory reactions . recent findings indicate that gm - csf inhibition will be an attractive therapeutic strategy for many autoimmune and inflammatory diseases . studies also indicate that it is necessary to monitor possible side effects such as pap or cd , although gm - csf inhibition has no demonstrated serious adverse reactions so far , which is indicative of its wide therapeutic index [ 63 , 173 , 174 ] . further studies are necessary to identify the molecular mechanisms that regulate gm - csf production and the role of gm - csf in the development of inflammatory diseases to devise preventive or curative strategies for autoimmune and inflammatory diseases .

granulocyte macrophage - colony stimulating factor ( gm - csf ) is a hematopoietic growth factor , which stimulates the proliferation of granulocytes and macrophages from bone marrow precursor cells . in autoimmune and inflammatory diseases , th17 cells have been considered as strong inducers of tissue inflammation . however , recent evidence indicates that gm - csf has prominent proinflammatory functions and that this growth factor ( not il-17 ) is critical for the pathogenicity of cd4 + t cells . therefore , the mechanism of gm - csf - producing cd4 + t cell differentiation and the role of gm - csf in the development of autoimmune and inflammatory diseases are gaining increasing attention . this review summarizes the latest knowledge of gm - csf and its relationship with autoimmune and inflammatory diseases . the potential therapies targeting gm - csf as well as their possible side effects have also been addressed in this review .

1. Introduction 2. Biology of GM-CSF 3. T Cell and GM-CSF 4. GM-CSF in Autoimmune and Inflammatory Diseases 5. Conclusion

hypertrophic cardiomyopathy ( hcm ) is the most common cause of sudden death in young patients . whereas especially patients with a nonobstructive form of hcm are thought to stay stable for a long time ; a small distinct subset of patients can develop end stage heart failure , which includes a reduction of systolic function and a transition from a former hcmphenotype to a dilated phenotype.1 several mechanisms underlying this transition are discussed and may include specific genetic backgrounds and microischemiainduced damages . in addition , temporary progression of the disease can be induced because of not primarily cardiacdependent stress factors . therefore , the differential diagnosis of the socalled end stage hcm is important not to overlook specific treatment options . we report here a case from a young hcm patient where cardiac inflammatory but not primarily hcmdependent processes induced a decompensating dilated cardiomyopathy ( dcm)like phenotype and show that an antiinflammatory treatment led to a reverse remodelling under these conditions . we report about a 17yearold woman with known hcm without left ventricular ( lv ) outflow obstruction characterized by a concentric hypertrophy ( anteriorseptal wall measured 15 mm , posterior 16 mm ) , preserved lv ejection fraction ( ef ) , and a wolffparkinsonwhite ( wpw ) syndrome for which the patient was already ablated twice in her childhood . she was submitted to our department for evaluation of a progression of heart failure , indicated by a new diagnosed drop of the lvef to 40% , hypokinesia of the apical and inferior wall , an increase in lv diameters ( lv end diastolic diameter ( lvedd ) : 59 mm ; mitral valveseptum : 18 mm ) , increased filling pressures , and a mitral regurgitation grade ii . clinically , she complained of chest pain , dyspnea already at rest ( nyha iii ) , and paroxysmal palpitations with presyncopal events during the past 6 months . blood analysis showed increased nterminal probrain natriuretic peptide ( ntpbnp ) levels of 5201 pg / ml and slightly increased transaminases ( alt 40 u / l , ast 60 u / l ) , without changes in tnt , hscrp , or leukocyte numbers . over the following 7 days , based on these findings , we discussed at least four possible differential diagnosis : ( 1 ) tachycardiainduced cardiomyopathy ( cm ) , ( 2 ) progression of hcm including ( micro)angiopathyinduced changes , ( 3 ) development of a severe primary mitral valve regurgitation , and ( 4 ) another undetected acquired form of cm . in an invasive electrophysiological evaluation , no malignant heart rhythm disturbances were inducible . we found a sufficient working atrioventricular node without any signs of accessory bundles excluding a wpwsyndrome induced tachycardiomyopathy . for further evaluation of the myocardial structure , we performed cardiac magnetic resonance imaging ( mri ) . the mri showed a significant hypertrophic and dilated lv ( lv diastolic volume of 286 ml ) with a further reduced lvef ( 17% ) . there was a pronounced signal of late gadolinium enhancement ( lge ) sequences of myocardial necrosis ( scar ) and/or fibrosis to detect , especially in the septum , apical and lateral part of the lv ( reticular delayed enhancement ) ( figure 1 ) . further on , there were no signals of myocardial inflammatory processes in the t1weighted and t2weighted images detected . to investigate whether or not a primarily hcmdependent progression of the disease or other etiologies were responsible for these findings , we evaluated right ventricular endomyocardial biopsies ( embs ) after exclusion of coronary abnormalities . histological characterization of the embs demonstrated perivascular and interstitial fibrosis and significant hypertrophy of myocytes indicated by diameters up to 31 m . a hcmtypical disarray was not detected . similar , no signs of cardiac storage diseases were found using different staining techniques . however , immunohistochemical staining showed an extensive active inflammation response of the myocardium ( figure 2 ) : highly increased 2leukocyteintegrins / infiltrates ( lfa1/cd11a+ and mac1/cd11b+ ) and mixed cellular infiltrates of both lymphocytes and macrophages ( cd45ropositive and hlapositive cells ) ( table 1).2 molecular biological analyses by nested polymerase chain reaction excluded the presence of known cardiotropic viruses including enterovirus , adenovirus , epsteinbarrvirus , human herpesvirus 6 , and parvovirus b19.3 magnetic resonance images of the heart and histological / immunohistochemical staining for fibrosis and inflammation . representative pictures showing a ) four chamber view and c ) shortaxis view of t1weighted magnetic resonance imaging scan . b ) four chamber view of a pronounced positive late gadolinium enhancementmagnetic resonance imaging scan . left corner : representative azanmallory staining image for fibrosis ( original magnification 100 ) , right corner : representative lfa1/cd11a+staining image for cellular infiltration ( original magnification 200 ) from the septum of the right ventricle and d ) short axis view of b. immunohistological staining of inflammatory cells of right ventricular septal biopsies . representative images depicting a ) mac1/cd11b+=infiltrates ( original magnification 200 ) ; b ) lfa1/cd11a+=infiltrates ( original magnification 200 ) ; c ) cd45ro cellular infiltrates ( original magnification 200 ) ; and d ) hla cellular infiltrates ( original magnification 100 ) present in the endomyocardial biopsy . quantification of active inflammation in endomyocardial biopsies based on the emb results , which evidenced a virusnegative active myocarditis , which was most probably the cause of the impairment of cardiac function , we initiated an immunosuppressive therapy with corticosteroid ( prednisolone 1 mg / kg / day ) and azathioprine ( 100 mg / day ) under blood count control and liver / kidney function control . after 4 weeks , the dose of prednisolone was tapered off every 4 weeks by 10 mg until a maintenance dose of 10 mg was reached.2 within the time frame of 3 months after starting the immunosuppressive treatment , the lvef continuously improved up to 52% , and the lvedd decreased to 56 mm . also , ntprobnp levels dropped to 968 pg / ml accompanied by regular levels of transaminases , crp , and leukocytes . in addition , her clinical symptoms improved . in summary , we show that external stress triggered by myocarditis can induce a transition from a hcmphenotype to a dilated cm ( dcm)phenotype . hypertrophic cardiomyopathy generally underlies a genetic disorder : around 4060% of all causes of hcm account for gene mutations of cardiac sarcomere proteins ( e.g. myosinbinding protein c , myosin heavy chain , cardiac troponin i and t , myosin light chain 3 and tropomyosin 1 chain ) . especially in infants and adolescents with isolated cardiac hypertrophy , more than 50% of all cases are due to genetic disorders.4 in addition , mixed genetic disorders causing hcm and rhythm diseases are also known and include the socalled prkag2 cardiac syndrome defined by the presence of hcm , ventricular preexcitation and tachyarrhythmia ( wpwsyndrome ) , and progressive conduction system disease.5 this genetic disorder , first described in a frenchcanadian family by gollob6 , underlies a mutation in the gene ( prkag2 ) encoding for the 2subunit of the heterotrimer ampactivating protein kinase.7 , 8 , 9 , 10 however , the presence of a prkag2 syndrome in our patient was already excluded years ago . in addition , the evaluation of other wellknown mutations able to cause hcm , including the screening for mutations of myh7 , mybpc3 , tnnt2 , tpm1 , tnni3 , myl3 , myl2 , csrp3 , pln , actc , and tnnc1 did not lead to a definite result in our patient . it is well accepted that in up to 30% of hcm , specific mutations can not be detected or are still unknown . in addition , up to 20% of patients with the phenotype of a significant lv hypertrophy do not belong to the classical form of hcm and comprise other genetic and nongenetic causes including storage diseases.11 , 12 forms of hcm can develop a dcmphenotype under stress conditions , but this is not very common and mostly seen in severe forms of hcm with lv obstructions . additional external stress includes emotional stress , toxic substances like alcohol or chemotherapeutics , pregnancy , ischemia , tachycardiainduced heart rhythm disturbances , and inflammation . matsumori et al . reported that viral myocardial infection can belong to these risk factors , too.13 the myocardial virus itself as well as inflammatory responses can lead to a deterioration of the hcm leading together with an increased intraventricular pressure to a lv dilatation.14 this mechanism has been described in patients with hcm and myocarditis most likely belonging to the worsening of cardiac function and to the induction of electrical imbalances.15 based on the emb findings , we concluded that our patient suffered from a virusnegative active myocarditis . thus , immunohistochemical analyses evidenced a significant , partly confluent lymphocyte infiltration , and increased expression of adhesion molecules . it also showed a marked infiltrate of macrophages and other inflammatory cells , but no increased specific cytotoxic t lymphocytes ( perforin positive ) were found . in opposite to the embs , the cardiac mri did not show specific signs for cardiac inflammatory processes . the mri resulted in the detection of fibrosis ( lge ) , which could belong to the hcm phenotype or to an additional inflammatoryinduced damage . fibrosis could be detected in embs taken from the lgeareas of the septum , too ( figure 1 b ) . however , only the further staining for inflammatory cells of these embs led to the definite diagnosis of a severe virusnegative active myocarditis ( figure 2 ) . these results are in agreement with the findings of others showing that cardiac mri sensitivity ( 76% ) , specificity ( 54% ) , and accuracy ( 68% ) has important limitations for detection of inflammatory processes and might not be sufficient to diagnose myocarditis in all cases.16 a negative mriresult does not automatically exclude a myocarditis and need further evaluation by emb , as concluded by the esc working group on myocardial and pericardial diseases.17 the embbased diagnosis of a severe virusnegative active myocarditis led us immediately to start with an immunosuppressive treatment including prednisolone and azathioprine for 6 months as recommended by caforio et al.17 in accordance to the timic study,18 we evidenced an improvement in lvef and a reduction in lvedd already 3 months after immunosuppressive treatment , correlating with a clinical improvement in nyha classification ( from class iii to i ) . in conclusion , this case shows that myocardial inflammation can contribute to a transition of a hypertrophic to a dilated phenotype , which can be reversible after induction of a specific antiinflammatory therapy .

abstractwe report the case of a 17yearold female patient with known hypertrophic cardiomyopathy and a wolffparkinsonwhite syndrome . she came to our department for further evaluation of a new diagnosed dilated cardiomyopathy characterized by an enlargement of the left ventricle and a fall in ejection fraction . clinically , she complained about atypical chest pain , arrhythmic episodes with presyncopal events , and dyspnea ( nyha iii ) during the last 6 months . noninvasive and invasive examinations including magnetic resonance imaging , electrophysiological examinations , and angiography did not lead to a conclusive diagnosis . therefore , endomyocardial biopsies ( embs ) were taken to investigate whether a specific myocardial disease caused the impairment of the left ventricular function . emb analysis resulted in the diagnosis of a virusnegative , active myocarditis . based on this diagnosis , an immunosuppressive treatment with prednisolone and azathioprine was started , which led to an improvement of cardiac function and symptoms within 3 months after initiating therapy . in conclusion , we show that external stress triggered by myocarditis can induce a reversible transition from a hypertrophic cardiomyopathy to a dilated cardiomyopathy phenotype . this case strongly underlines the need for a thorough and invasive examination of heart failure of unknown causes , including emb investigations as recommend by the actual esc position statement .

Introduction Case report Discussion

bacteriocins are toxins produced by the bacteria to inhibit the growth of similar or closely related bacterial strain(s ) during stress conditions . they are structurally , functionally , and ecologically diverse , produced by almost all major lineages of eubacteria and archaebacteria . ribosomal encoded bacteriocins are generally secreted in the extracellular milieu by the producers where they recognize specific receptors on the surface of susceptible or target cells . they induce toxicity in the target cells by different mechanisms like enzymatic nuclease ( dnase or rnase ) or pore formation in cytoplasmic membrane . their structure comprises of three distinct domain organizations : ( i ) a domain involved in recognition of specific receptor r , ( ii ) a domain involved in translocation t , and ( iii ) a domain responsible for their toxic activity c. molecular mass of ribosomal encoded bacteriocins vary from ~25 to 80 kda and are broadly classified into two groups , group a and b , based on their cross - resistance . these proteins have received increasing attention due to their potential use as preservatives in the food industry or in the therapeutic applications for clinical usage . xenorhabdus nematophila is a motile gram - negative bacterium belonging to the family enterobacteriaceae , and forms a symbiotic association in the gut of soil nematode from the family steinernematidae [ 6 , 7 ] . free - living forms of the bacterium have not yet been isolated from soil or water sources , which suggests that the symbiotic association may be essential for the survival of the bacteria in the environment . juvenile ( ijs ) enters digestive tract of the insect larva and subsequently penetrates into hemocoel of the host insect . the nematode can also gain access to the hemocoel via the respiratory spiracles or by penetrating directly through insect cuticle . bacteria , in turn , are essential for effective killing of the insect host and are required by the nematode to complete its life cycle [ 8 , 9 ] . growth in vitro is probably supported by the rich nutrient supply of the laboratory growth media and lack of competition that normally exists in the soil environment . as the bacteria enter stationary phase of growth cycle , they secrete several extracellular products , which include lipase(s ) , phospholipase(s ) , and protease(s ) , and several broad spectrum antibiotics that can be assayed in the culture media [ 10 , 11 ] . these extracellular products are believed to be secreted in the insect hemolymph when the bacteria enter stationary phase . these degradative enzymes break the macromolecules from insect cadaver to provide the developing nematode with nutrient supply , while the antibiotics suppress contamination of the cadaver by other microorganisms . cytoplasmic inclusion bodies , composed of highly expressed crystalline proteins , are also produced by the bacterium during stationary - phase growth . in our earlier study recombinant xenocin - immunity protein complex is toxic to six bacterial genus like bacillus , enterobacter , enterococcus , citrobacter , serratia , and stenotrophomonas . xenocin - immunity protein complex has atypical features which include the following . ( 1 ) tol box which has been replaced by ton box from n terminal end of translocation domain of xenocin . ( 2 ) there is only 30% similarity of xenocin with other bacteriocins . ( 3 ) size of its cognate immunity protein is 42 kda , whereas 1016 kda have been reported in other prokaryotic systems . immunity protein of x. nematophila is a fusion of two different domains , immunity domain and hemolysin domain . ( 4 ) immunity protein has atpase activity , although walker motif is missing in its primary amino acid sequence . ( 5 ) xenocin - immunity protein complex is secretory in nature without any signal sequence . in this study we have cloned , expressed , and purified all the possible domains of xcina and ximb genes . exogenous toxicity assays were performed with purified recombinant xenocin - immunity domain protein complex and other domains . in silico study of the immunity protein showed its similarity with hemolysin and purine ntpase like protein ; therefore , hemolysis and atpase assays were performed . finally , secondary structural analysis of recombinant xenocin - immunity domain protein complex , catalytic - immunity domain protein complex , immunity protein , and its hemolysin domains were performed with circular dichroism . all the chemicals were purchased from sigma ( sigma - aldrich ) except where otherwise mentioned . vector pqe30 , ni - nta agarose resin and qia quick spin columns were from qiagen ( germany ) . e. coli strains dh5 ( bethesda research laboratories ) were used as the host for cloning . e. coli bl 21(de3 ) plyss strain from novagen and m 15 strain from qiagen were used in the expression studies . the plasmid vector pgem - t easy from promega ( madison , usa ) were used for pcr cloning . ampicillin , kanamycin , and chloramphenicol were used in the concentration of 100 , 35 , and 25 g ml , respectively . phylogenetic analysis of immunity protein was done by a method as described earlier . briefly , amino acids of all the protein sequences that matched with immunity protein were aligned by clustalw ( mac vector 7.0 ) , and a tree was constructed using neighbour - joining method , with the best tree mode in the mac vector version 7.0 ( oxford molecular , england ) program . all the constructs were amplified from the 4.3 kb genomic dna fragment of x. nematophila . the orf 1 encoding xcina gene and partial orf 2 encoding immunity domain of ximb gene were obtained by pcr amplification using primer 1 with a bamhi site at the 5 end and a reverse primer 6 with hindiii site at the 3 end . the amplified product ( 2 kb ) was ligated in pgem - t easy and pqe30 vector , producing pjc5 and pjc6 plasmids , respectively . the catalytic domain ( 318 bp ) of xcina gene was cloned with the immunity domain ( first 270 bp of ximb gene ) of ximb gene using primer pair 2 and 6 as described earlier . primer 1 with a bamhi site at the 5 end and a reverse primer transb with ncoi site at the 3 end were used to amplify the translocation domain of xcina gene . amplified product of 1 kb was ligated in pgem - t easy vector and pqe30 vector , producing pjc7 and pjc8 plasmids , respectively . primer 1 with a bamhi site at the 5 end and a reverse primer recb with hindiii site at the 3 end were used to amplify the translocation - receptor domain of xcina gene . the amplified product ( 1.5 kb ) was ligated in pgem - t easy vector and pqe30 vector producing pjc9 and pjc10 plasmids , respectively . primer 3 with bamhi site at the 5 end and a reverse primer 5 with hindiii site at the 3 end used for ximb cloning and forward primer 4 without any restriction site and backward primer 7 without any restriction site were used for cloning ximb hemolysin domain . the amplified products of 1 kb and 700 bp were ligated in pgem - t easy vector producing pjc11 and pjc12 plasmids . the 1 kb amplified product was further ligated in pqe30 and 700 bp amplified product was ligated in pqe31 expression vector producing pjc13 and pjc14 plasmids , respectively . a 2.330 kb dna fragment containing both xcina and immunity domain of ximb gene with native promoters was amplified using xenocinf1 ( 300 bp upstream of start codon of xcina locus ) and primer 6 and cloned in pgem - t easy vector producing pxim construct . the empty pgem - t easy vector designated as pgem was used as control . the plasmids pjc6 , pjc8 , pjc10 , pjc13 , and pjc14 were transformed in m15 cells where as pjc4 was transformed in e. coli bl 21(de3 ) plyss cells . the resulting strains jc4 , jc6 , jc8 , jc10 , jc13 , and jc14 were used for expression and purification of recombinant proteins under the control of iptg inducible t7 promoter as per the protocol described earlier . briefly , overnight grown cultures were diluted 100 fold in fresh 50 ml lb medium and grown till the od600 reached 0.5 . culture was induced by adding 1 mm final concentration of iptg and incubated at 30c for 6 hours . cells were harvested and washed with 40 ml of cold and 50 mm sodium phosphate buffer , ph 8 , containing 300 mm nacl and 50 mm benzamidine ( buffer a ) . the cell pellet was suspended in 25 ml of buffer a and cells were disrupted by sonication at 4c . the cell lysate was centrifuged at 12000 g for 30 min at 4c in a rc5 plus centrifuge , and the 6xhis - tagged recombinant proteins or protein complexes in the soluble fractions were purified as follows . the supernatant from the previous step was loaded on ni - nta agarose column preequilibrated with buffer a at 4c . the column was washed extensively with buffer a , containing 2550 mm imidazole , and the protein / protein complex was eluted with buffer a containing 300 mm imidazole . fractions containing pure protein or protein complex were concentrated using centricon ( millipore pm10 ) . recombinant protein or protein complexes were dialyzed overnight against 100 volumes of 50 mm sodium phosphate buffer , ph 8 , and the final preparations were stored at 20c in the presence of 15% glycerol . to study the neutralizing effect of the immunity domain protein , xcina gene was cloned with its native promoter along with immunity domain of ximb gene which gave rise to pxim . empty pgem - t easy vector was considered as control and transformed in e. coli dh5 to give rise to gem strain . overnight grown strains gem and xim were subcultured in fresh medium and incubated till the od600 reached 0.5 . the cultures were diluted in fresh medium 1 : 100 and induced with 0.3 g ml of mitomycin c ( an inducer of xenocin native promoter ) . the optical densities of the cultures were monitored at 600 nm during different intervals . the bacteriostatic activity of purified recombinant proteins / complexes were determined by the protocol as described earlier . briefly , lb agar plates without antibiotics were overlaid with 3 ml of soft nutrient agar containing indicator e. coli dh5 strain grown in m9 medium , and the protein complex was applied to sterile disks . the plates were incubated overnight at 37c , and the sizes of clearance zones were recorded . freshly isolated rabbit blood cells were washed thrice with phosphate buffer saline ( pbs ) by centrifuging at 1000 g , 4c for 10 minutes . washed erythrocytes were resuspended in pbs to make a final concentration of 4% . the same volume ( 100 l ) of protein ( 5 m ) sample dissolved in pbs and erythrocytes suspension were added into wells of 96-well plate . the plate was then incubated at 37c for 1 hr and centrifuged at 1000 g for 5 minutes . the resulting supernatant was transferred to new wells , and the absorbance was determined at 540 nm on a continuous spectrum microtitre plate reader . protein samples of different concentrations were incubated with 0.2 ci of [ -p ] labelled atp ( 6000 ci/ mmol , perkinelmer life sciences , usa ) in a buffer containing 20 mm tris - hcl ( ph 8.0 ) , 1 mm mgcl2 , 100 mm kcl , 8 mm dtt , and 80 g / ml of bsa in a total reaction volume of 10 l . samples were incubated at 37c for 30 minutes . at the end of the reaction , 1 l of the reaction mixture was spotted on a polyethyleneimine thin - layer chromatography ( tlc ) plate ( sigma - aldrich , usa ) and air - dried . chromatography was performed using 0.5 m licl and 1 m hcooh as the running solvent . the far - uv cd spectrum was recorded between 190 and 260 nm ( 500 l sample volume ) on a jasco j-810 spectropolarimeter equipped with a jasco peltier temperature controller at 25c using 1 mm optical path length quartz cells and the step size was 0.5 nm with 1 nm bandwidth at a scan speed of 20 nm minute . averages of 5 scans were obtained for blank and protein spectra , and the data was corrected for buffer contribution . the results were expressed as mean residue ellipticity in units of degree / cm / dmol . phylogenetic analysis of the xenocin and its immunity protein was done by preparing phylogenetic tree , using neighbour - joining method . results showed that immunity protein formed a separate cluster in the very beginning as shown figure 1(b ) . further , xcina gene was cloned along with n terminal immunity domain ( 10 kda ) of ximb gene . purification of recombinant xenocin - immunity domain ( 10 kda ) protein complex from jc6 strain was done by ni - nta chromatography under native conditions . one was at the position corresponding to 66 kda and another below 14 kda protein marker as shown in figure 2(a ) which corroborates with the size of xenocin and immunity domain of immunity protein , respectively . purification of recombinant catalytic - immunity domain protein complex with ni - nta chromatography under native conditions from jc4 strain also showed two bands corresponding to the size of catalytic domain of xcina and immunity domain of ximb as shown in figure 2(b ) . purification of recombinant translocation domain of xcina gene from jc8 strain with ni - nta chromatography showed multiple bands in sds - page as shown in figure 2(e ) . further , western blot was performed using purified fraction , probed with anti - his antibody , and the result showed single band at 38 kda which corresponds to the size of recombinant translocation domain protein as shown in figure 2(f ) . purification of recombinant translocation - receptor domain protein with ni - nta chromatography from jc10 strain showed two prominent bands in sds - page . upper band corresponded to ~52 kda whereas lower band corresponded to ~28 kda as shown in figure 2(g ) . western blot was performed using whole cell lysate and the purified fraction , probed with anti - his antibody , which showed a single band at 52 kda corresponding to a size of recombinant translocation - receptor domain protein as shown in figure 2(h ) . purification of recombinant full length immunity protein , as well as its hemolysin domain protein from jc13 and jc14 strains , showed less but stable expression as shown in figures 2(c ) and 2(d ) , respectively . neutralization of endogenous toxicity of xcina by immunity domain of ximb gene was determined by endogenous assay . endogenous assay with xim strain ( harboring pxim containing xcina with its native promoter and first 85 amino acid residues of ximb gene ) and gem strain ( harboring empty pgem t - easy vector ) in the presence of mitomycin c showed the same growth profile as shown in figure 3(a ) . exogenous toxicity assay was performed with purified recombinant xenocin - immunity domain ( 10 kda ) complex using e. coli dh5 as target cells . the zone of inhibition was observed as shown in figure 3(b ) ( i ) . purified catalytic - immunity domain protein complex was used to study for the bacteriostatic effect in the exogenous assays . the zone of inhibition was not observed in this case as shown in figure 3(b ) ( ii ) . similar results were observed when full length immunity protein ( 42 kda ) encoded by ximb gene or its hemolysin domain ( 32 kda ) was used for exogenous assay as shown in figure 3(b ) ( iii ) and ( iv ) , respectively . moreover , as expected zone of inhibition was not observed in buffer control experiment as shown in figure 3(b ) ( v ) . protein - protein blast results ( http://www.ncbi.nlm.nih.gov/blast/ ) of the immunity protein showed its similarity with hemolysin ( aaf42109 ) and purine ntpase like protein ( data not shown ) . hemolytic assay with fresh rabbit red blood cells was performed with purified full length immunity protein as well as its immunity and hemolysin domain . results showed that none of the protein had hemolytic activity ( data not shown ) . atpase assay was performed with purified recombinant full length immunity protein , its immunity domain , and hemolysin domain . atpase activity was not detected in recombinant immunity domain , hemolysin domain protein , and even in the purified bsa which was used as negative control as shown in figure 4(a ) lane 1 . however , full length recombinant immunity protein ( 42 kda ) showed atpase activity with increasing concentration of protein and was comparable to the atpase activity of purified groel protein of x. nematophila which was used as the positive control , as shown in figure 4(a ) lane 2 . the far uv spectra of purified recombinant xenocin - immunity domain ( 10 kda ) protein complex , catalytic - immunity domain protein complex , immunity , and its hemolysin domain were recorded at 25c as shown in figure 5 . recombinant xenocin - immunity domain protein complex was found to contain 41% -helical structure and 21% -sheet . catalytic - immunity domain protein complex was found to contain 51% -sheet and only 7% -helical structure . in case of full length immunity protein 30% of the secondary structure hemolysin domain of the immunity protein also had the same secondary conformation with 30% -helical and 11% -sheet content . recombinant xenocin-(66 kda- ) immunity ( 42 kda ) protein complex has a broad range bacteriostatic property , inhibiting the growth of six insect gut resident bacterial species . due to only 30 - 31% primary sequence similarity with other bacteriocins , xenocin from the x. nematophila forms a distinct cluster in phylogenetic tree . phylogenetic analysis of immunity protein showed similar results , in which immunity protein from x. nematophila forms a separate cluster in the very beginning . this could be due to variable length of immunity protein from x. nematophila . cognate immunity protein of xenocin consists of 368 amino acid residues and is a unique fusion of two different domains . its n terminal ( first 85 amino acid residues ) showed similarity with immunity protein from other prokaryotic systems , whereas the c terminal showed similarity with hemolysin ( n. meningitidis accession no . three - dimensional structure of xenocin has been recently deciphered by homology modelling in my lab . it is a multidomain protein which consists of 576 amino acid residues . from its n terminal 1327 amino acid residues form translocation domain ( t ) , 328476 amino acid residues form the middle receptor domain ( r ) , and amino acid residues from 477576 form the catalytic domain ( c ) at the c terminal . while cloning xcina gene alone in expression vector , not a single transformant was observed . one reason for this result could be the leaky expression of toxic xcina gene . to address this question , xcina gene was cloned along with n terminal immunity domain ( 10 kda ) of ximb gene . when the recombinant protein from jc6 strain was purified by ni - nta chromatography , xenocin was visible in sds - page at position corresponding to 66 kda whereas immunity domain of immunity protein was observed below 14 kda protein marker . this result showed that n terminal immunity domain ( 10 kda ) of immunity protein ( 42 kda ) encoded by ximb gene is enough to bind with and neutralize the in vivo toxic effect of xcina gene . to confirm this result and to map the minimum functional domain of immunity protein required to abolish the xcina gene toxicity in vivo , first 85 amino acids of immunity protein were cloned along with xcina gene under its native promoter . same growth profile of xim strain ( harboring pxim ) and gem strain ( harboring empty pgem t - easy vector ) in the presence of mitomycin c confirmed that first 85 amino acid residues of ximb gene were able to neutralize the toxic activity of xenocin in vivo . further , purification of recombinant catalytic - immunity domain protein complex with ni - nta chromatography under native conditions from jc4 strain confirmed the minimal domains of xcina and ximb genes that could be expressed and purified . as we were unable to express xcina gene alone which is composed of translocation , receptor , and catalytic domain an attempt had been made to clone , express , and purify the translocation domain alone or along with receptor domain of xcina gene . in native conformation , translocation domain of bacteriocin like colicin e3 interacts with catalytic domain of e3 and immunity protein via receptor domain , and this interaction further provides stability to the translocation domain . however , in recombinant translocation domain of xcina , receptor and catalytic domains as well as immunity protein were missing which may be probably made it to attain an open conformation and be susceptible to proteases from the host cells . hence , during the purification of translocation domain from pjc8 , multiple bands were observed in sds - page . however , western blot with purified fraction when probed with anti - his antibody showed a single band corresponding to the size of translocation domain which confirmed the expression of translocation domain alone . further , purification of recombinant translocation - receptor domain protein with ni - nta chromatography from jc10 strain , showed two prominent bands in sds - page rather than multiple bands . upper band corresponded to ~52 kda whereas lower band corresponded to ~28 kda . western blot using whole cells and purified fraction when probed with anti - his antibody showed a single band at 52 kda which is corresponding to a size of recombinant translocation - receptor domain protein . therefore , we inferred that recombinant translocation domain along with receptor domain of the xcina gene was more stable as compared to the recombinant translocation domain alone , but due to the absence of catalytic domain and immunity protein it was still prone to proteases of the host cell . endogenous toxicity assays with xim and gem strains were performed to identify the minimum domain required to neutralize the xcina toxicity . results showed that first 85 amino acids of the immunity protein were able to neutralize xenocin endogenous toxicity as both strains had the same growth profile . moreover , from this experiment we inferred that expression of cognate immunity protein domain and its binding to the catalytic domain of xenocin occurs in the host cell simultaneously . receptor domain in bacteriocin plays a major role in the exogenous toxic effect , as it is the first domain which binds to ligand present on the surface of its target cells . binding is followed by import of bacteriocin into the cells with the assistance of either ton proteins ( exbb , exbd , and tonb ) or tol proteins ( tola , -b , -q , and -r ) of periplasm and facilitate the translocation of the catalytic domain of bacteriocins into the periplasmic space of the target cell for further processing [ 5 , 1618 ] . interaction of bacteriocins either with ton or tol proteins of periplasm occurs via ton or tol box present at their n terminal end of the translocation domain . interestingly , although xenocin has rnase activity , tol box in its translocation domain has been replaced by ton box . this could be due to the domain swapping which generally occurs during the horizontal gene transfer in prokaryotes . in the colicin e3-immunity complex , binding of the receptor domain of e3 to the surface protein on target cells leads to the conformational changes which assisted the immunity protein to dissociate from the protein complex [ 4 , 18 ] . the immunity protein from x. nematophila is a unique fusion of immunity domain ( 10 kda ) and hemolysin domain ( 32 kda ) protein , and endogenous assay confirmed that immunity domain of ximb gene is enough to neutralize the detrimental effect of xcina gene . therefore , exogenous assay was performed with purified recombinant xenocin - immunity domain ( 10 kda ) complex using e. coli dh5 as target cells to determine translocational ability of xenocin - immunity domain ( 10 kda ) complex into the cytoplasm of target cells . clear zone of inhibition was observed in the exogenous toxicity assay due to the detrimental effect of xenocin - immunity domain ( 10 kda ) protein complex . this result confirmed the functionality of translocation as well as receptor domain of xenocin and their individual roles in internalization of xenocin into the cytoplasm of target cells . moreover , it also confirmed that hemolysin domain ( 32 kda ) of ximb gene has no role in the internalization of xenocin as well as in exogenous toxicity . catalytic domain of xcina gene along with immunity domain of ximb gene was the minimum domain which could be expressed and purified . therefore , purified catalytic - immunity domain protein complex was studied for the bacteriostatic effect in the exogenous assays . results showed that zone of inhibition was not observed , which again confirmed the role of translocation as well as receptor domain of xcina gene for its internalization into the cytoplasm on the target cells . similar results were observed when full length immunity protein ( 42 kda ) encoded by ximb gene or its hemolysin domain ( 32 kda ) was used for exogenous assay . moreover , as expected zone of inhibition was not observed in the experiment in which buffer was used as a negative control . to neutralize the detrimental effect of bacteriocins , the molecular weight of the immunity protein in other prokaryotic systems is between 10 and 16 kda ; however , immunity protein encoded by ximb gene corresponds to 42 kda . protein - protein blast using blastp ( http://www.ncbi.nlm.nih.gov/blast/ ) of the immunity protein showed similarity with hemolysin ( aaf42109 ) and purine ntpase like protein . hemolytic assay with fresh rabbit red blood cells was performed with purified full length immunity protein as well as its immunity and hemolysin domains . due to the partial primary amino acid sequence similarity with hemolysin protein , none of the protein / protein domains showed hemolytic activity . as immunity protein also showed similarity with protein like purine ntpase 's atpase assay was performed with purified recombinant full length immunity protein , its immunity domain , and hemolysin domain . although full length immunity protein showed atpase activity , in silico analysis did not show walker motif in its primary amino acid sequence , which is generally present in the proteins having atpase activity . possibility of atpase activity in immunity protein towards the secretion of recombinant xenocin - immunity protein complex can not be ruled out at this stage as none of the proteins have any signal sequence at their either ends . secondary structure analysis of purified recombinant xenocin - immunity domain ( 10 kda ) protein complex , catalytic - immunity domain protein complex , immunity , and its hemolysin domain was done with far uv spectra . high percentage of -helical structure of xenocin - immunity complex is attributed due to the helix turn helix structure of receptor domain of xenocin which corroborates with its recently deciphered three - dimensional structure . catalytic - immunity domain protein complex was found to contain 51% -sheet and only 7% -helical structure . this open conformation with high -sheet might be beneficial to bind with its substrate ( rna ) and act upon it [ 20 , 21 ] . in case of full length immunity protein 30% of hemolysin domain of the immunity protein also had the same secondary conformation with 30% -helical and 11% -sheet content . since immunity protein is a novel fusion of two different domains the role of its secondary is not deciphered yet .

xenorhabdus nematophila , a gram - negative bacterium belonging to the family enterobacteriaceae is a natural symbiont of a soil nematode from the family steinernematidae . in this study cloning , expression , and purification of broad range iron regulated multidomain bacteriocin called xenocin from x. nematophila ( 66 kda , encoded by xcina gene ) and its multidomain immunity protein ( 42 kda , encoded by ximb gene ) have been done . xcina - ximb ( n terminal 270 bp ) , translocation , and translocation - receptor domain of xcina , ximb , and its hemolysin domain were cloned , expressed , and purified by single step ni - nta chromatography under native conditions . in the functional characterization , neutralization of xcina toxicity by immunity domain of ximb gene was determined by endogenous assay . exogenous toxic assays results showed that only the purified recombinant xenocin - immunity domain ( 10 kda ) protein complex had toxic activity . atypical cognate immunity protein ( 42 kda ) of xenocin was fusion of immunity domain ( 10 kda ) and hemolysin domain ( 32 kda ) . in silico analysis of immunity protein revealed its similarity with hemolysin and purine ntpase like proteins . hemolytic activity was not observed in immunity protein or in its various domains ; however , full - length immunity protein lacking walker motif showed atpase activity . finally , using circular dichroism performed secondary structural analyses of all the recombinant proteins / protein complexes .

1. Introduction 2. Material and Methods 3. Results 4. Discussion

comet lysis buffer ( 2.5 m sodium chloride , 100 mm edta ( ph 8.0 ) , 1% sarkosyl , 10 mm tris hcl ( ph 8.0 ) , 10% dmso , 10% triton x-100 ) . comet alkali solution ( 0.3 m sodium hydroxide , 1 mm edta ) . cryopreservation medium ( 50% foetal calf serum [ fcs ] , 10% dmso , 40% dulbecco 's modified eagle 's medium [ dmem ] ) . culture medium for hepg2 cells ( dmem , 10% fcs , 50 u / ml penicillin , 50 u / ml streptomycin , 2 mm l - glutamine ) . all chemicals were purchased from sigma chemicals co. , dorset , uk . hepg2 cells were obtained from the european cell culture collection ( eccc , uk ) . hepg2 cells are human caucasian hepatocyte carcinoma cells taken from a primary hepatoblastoma ( liver biopsy ) from an 11-year - old male from argentina in 1979 . the frozen vials of the cells were held at room temperature for 1 min and then placed in a 37c incubator for 1 min until thawed and the cells were pipetted into a flask containing 10 ml of pre - warmed dmem . hepg2 cells were grown in dmem supplemented with 10% fcs , 2 mm glutamine , 100 g / ml penicillin and 100 g / ml streptomycin . the cells were fed three times a week and split when confluence was reached . to split the cells , the medium was removed , the cells were washed with hank 's buffered salt solution ( hbss ) , and then gently harvested with 1 ml detachment trypsin neutralising solution . once all the cells were loosened from the plate , 1 ml of detachment trypsin neutralising solution was added . the cell suspension was pipetted into a sterile falcon tube and centrifuged at 1,200 rpm for 5 min . the supernatant was removed and the pellet was gently resuspended in an appropriate volume of medium . cells were plated in a multi - well plate : 1 ml at 510 cells / ml in dmem . supplemented with 10% fcs , 2 mm glutamine , 100 g / ml penicillin and 100 g / ml streptomycin . the cells were allowed to attach for 24 h at 37c . then the medium was replaced by demem containing 25 m or 50 m h2o2 and duplicate cultures were incubated at 37c for 5 min , 30 min , 40 min , 1 h , or 24 h. at the end of incubation the cells were harvested and used in comet assay analysis of dna damage . the principle of the comet assay is that smaller dna molecules migrate faster in an electric field than larger molecules . the treated cells are encapsulated in gel and lysed by alkali , which also denatures the dna . subsequent electrophoresis causes migration of the dna . while the undamaged dna appears as a head , fragmented dna move faster , giving the characteristic appearance of a comet tail ( fig . 1 ) . levels of dna damage after exposure to hydrogen peroxide evaluated by the comet assay . fig . partly frosted microscope slides were pre - coated with a smear of 1% low melting - point agarose ( lmpa ) and allowed to dry for 1 h at 37c . the slides were then placed on a bed of ice to pre - cool them before adding an agarose sandwich . an aliquot of 170 l of 1% lmpa was placed onto the slide and immediately covered with a coverslip . whilst this was setting , an aliquot of 170 l of the agarose / lymphocyte mix was placed on top of the first layer and again covered immediately with a coverslip . once set , the coverslip was removed and a final layer of 170 l 1% lmpa was applied to the existing gel to form an agarose sandwich , with the cells in the middle layer . the lights were switched off and the remainder of the assay was performed using indirect light . flowchart showing the comet assay for single - cell gel electrophoresis to determine dna damage ( 12 ) . a pyrex tray containing 500 ml of ice - cold lysis buffer was placed onto a bed of ice and the slides were gently lowered into it . after 1 h , the slides were removed and washed by placing them in 500 ml ice - cold pbs ( again in a pyrex tray on a bed of ice ) and allowing them to sit for 15 min . this removed the salt from the lysis buffer and prepared the slides for the next step . a horizontal electrophoresis tank was surrounded by ice and filled with 2 l of ice - cold lysis buffer . then the slides were gently lowered into a horizontal electrophoresis tank filled with 2 l of cold lysis buffer and surrounded by ice . the slides were placed for 30 min to allow the dna to unwind in the alkali buffer . next , the slides were removed and rinsed by placing them in 500 ml of ice - cold neutralising buffer for 10 min and then in 500 ml of ice - cold pbs for 15 min . dna damage was measured using the comet assay and expressed as olive tail moment ( otm ) . results are given as meansem for the 50 cells ( 25 per slide ) . to determine cell viability ( 14 ) , 100 l of cell suspension was mixed 1:1 with trypan blue stain ( 0.4% w / v , biowhittaker ) and pipetted into a neubauer haemocytometer ( vwr scientifics , west chester , pa ) . if membrane integrity has been compromised ( dead cells ) , the cells absorb the dye and appear blue . in our study , if cell viability < 80% , the cells were discarded and a new batch was started . for the experiments we report , one - way anova was performed when more than two groups were compared with a single control . differences between individual groups were assessed by a dunnett post hock test , using prism software ( version 4 ) . the slide was visualised using either a biorad mrc 600 confocal microscope or a leica tcs sp2 uv confocal microscope . images were obtained with the biorad using a krypton / argon laser , 20 magnification , and excitation wavelength at 568 nm , lens aperture of 0.4 and z series slices of 3-m steps . images were obtained with the leica using a 543 helium / neon ( he / ne ) laser at 55% power and 20 magnification , and the emission was collected using a detection window of 570655 nm wavelength . comet lysis buffer ( 2.5 m sodium chloride , 100 mm edta ( ph 8.0 ) , 1% sarkosyl , 10 mm tris hcl ( ph 8.0 ) , 10% dmso , 10% triton x-100 ) . comet alkali solution ( 0.3 m sodium hydroxide , 1 mm edta ) . cryopreservation medium ( 50% foetal calf serum [ fcs ] , 10% dmso , 40% dulbecco 's modified eagle 's medium [ dmem ] ) . culture medium for hepg2 cells ( dmem , 10% fcs , 50 u / ml penicillin , 50 u / ml streptomycin , 2 mm l - glutamine ) . all chemicals were purchased from sigma chemicals co. , dorset , uk . hepg2 cells were obtained from the european cell culture collection ( eccc , uk ) . hepg2 cells are human caucasian hepatocyte carcinoma cells taken from a primary hepatoblastoma ( liver biopsy ) from an 11-year - old male from argentina in 1979 . the frozen vials of the cells were held at room temperature for 1 min and then placed in a 37c incubator for 1 min until thawed and the cells were pipetted into a flask containing 10 ml of pre - warmed dmem . hepg2 cells were grown in dmem supplemented with 10% fcs , 2 mm glutamine , 100 g / ml penicillin and 100 g / ml streptomycin . the cells were fed three times a week and split when confluence was reached . to split the cells , the medium was removed , the cells were washed with hank 's buffered salt solution ( hbss ) , and then gently harvested with 1 ml detachment trypsin neutralising solution . once all the cells were loosened from the plate , 1 ml of detachment trypsin neutralising solution was added . the cell suspension was pipetted into a sterile falcon tube and centrifuged at 1,200 rpm for 5 min . the supernatant was removed and the pellet was gently resuspended in an appropriate volume of medium . cells were plated in a multi - well plate : 1 ml at 510 cells / ml in dmem . supplemented with 10% fcs , 2 mm glutamine , 100 g / ml penicillin and 100 g / ml streptomycin . the cells were allowed to attach for 24 h at 37c . then the medium was replaced by demem containing 25 m or 50 m h2o2 and duplicate cultures were incubated at 37c for 5 min , 30 min , 40 min , 1 h , or 24 h. at the end of incubation the cells were harvested and used in comet assay analysis of dna damage . the principle of the comet assay is that smaller dna molecules migrate faster in an electric field than larger molecules . the treated cells are encapsulated in gel and lysed by alkali , which also denatures the dna . subsequent electrophoresis causes migration of the dna . while the undamaged dna appears as a head , fragmented dna move faster , giving the characteristic appearance of a comet tail ( fig . 1 ) . levels of dna damage after exposure to hydrogen peroxide evaluated by the comet assay . fig . partly frosted microscope slides were pre - coated with a smear of 1% low melting - point agarose ( lmpa ) and allowed to dry for 1 h at 37c . the slides were then placed on a bed of ice to pre - cool them before adding an agarose sandwich . an aliquot of 170 l of 1% lmpa was placed onto the slide and immediately covered with a coverslip . whilst this was setting , an aliquot of 170 l of the agarose / lymphocyte mix was placed on top of the first layer and again covered immediately with a coverslip . once set , the coverslip was removed and a final layer of 170 l 1% lmpa was applied to the existing gel to form an agarose sandwich , with the cells in the middle layer . the lights were switched off and the remainder of the assay was performed using indirect light . flowchart showing the comet assay for single - cell gel electrophoresis to determine dna damage ( 12 ) . a pyrex tray containing 500 ml of ice - cold lysis buffer was placed onto a bed of ice and the slides were gently lowered into it . after 1 h , the slides were removed and washed by placing them in 500 ml ice - cold pbs ( again in a pyrex tray on a bed of ice ) and allowing them to sit for 15 min . this removed the salt from the lysis buffer and prepared the slides for the next step . a horizontal electrophoresis tank was surrounded by ice and filled with 2 l of ice - cold lysis buffer . then the slides were gently lowered into a horizontal electrophoresis tank filled with 2 l of cold lysis buffer and surrounded by ice . the slides were placed for 30 min to allow the dna to unwind in the alkali buffer . next , the slides were removed and rinsed by placing them in 500 ml of ice - cold neutralising buffer for 10 min and then in 500 ml of ice - cold pbs for 15 min . dna damage was measured using the comet assay and expressed as olive tail moment ( otm ) . to determine cell viability ( 14 ) , 100 l of cell suspension was mixed 1:1 with trypan blue stain ( 0.4% w / v , biowhittaker ) and pipetted into a neubauer haemocytometer ( vwr scientifics , west chester , pa ) . if membrane integrity has been compromised ( dead cells ) , the cells absorb the dye and appear blue . in our study , if cell viability < 80% , the cells were discarded and a new batch was started . for the experiments we report , cell viability was 9095% after culturing and before starting the comet assay . one - way anova was performed when more than two groups were compared with a single control . differences between individual groups were assessed by a dunnett post hock test , using prism software ( version 4 ) . the slide was visualised using either a biorad mrc 600 confocal microscope or a leica tcs sp2 uv confocal microscope . images were obtained with the biorad using a krypton / argon laser , 20 magnification , and excitation wavelength at 568 nm , lens aperture of 0.4 and z series slices of 3-m steps . images were obtained with the leica using a 543 helium / neon ( he / ne ) laser at 55% power and 20 magnification , and the emission was collected using a detection window of 570655 nm wavelength . cell viability following different treatments was 9095% and no floating cells were noticed in the medium . we analysed dna damage by the comet assay . following single - cell electrophoresis , the lengths of the comets ( dna trails ) depended on the treatment , with longer tails indicating more dna damage . however , cells incubated with h2o2 for 24 h appeared similar to untreated control cells ( fig . comet assay of the effect of duration of incubation with hydrogen peroxide on dna damage : untreated hepg2 cells ( a ) and hepg2 cells treated with 50 m h2o2 for 5 min ( b ) , 1 h ( c ) or 24 h ( d ) . the extent of dna damage , measured in otm , increased rapidly and significantly ( p<0.001 ) from baseline levels of 1.4 otm0.2 sem to 13.41.3 otm after 5 min of treatment with 25 m h2o2 and 15.50.6 otm after 5 min of treatment with 25 m h2o2 ( fig . the extent of damage increased further with time but at a slower rate , reaching about 2530 otm after 1 h of treatment . however , at the 24-h time - point the values for treatment with 25 and 50 m h2o2 ( 5.91.3 and 3.70.6 otm , respectively ) were not significantly higher than the baseline levels . the extent of dna damage was higher for cells treated with 50 m h2o2 than for those treated with a 25 m concentration at the 5 , 30 , 40 and 60 min time - points ( fig . hepg2 cells were treated with 25 m or 50 m h2o2 for 5 , 30 , 40 min , 1 h or 24 h and dna damage was assessed by the comet assay . the values are the meansem of 50 cells from two pooled wells ( 25 cells per slide ) . when formation of ros exceeds the biological defence capacity , the result is oxidative stress and tissue injury ( 15 ) . h2o2 can cause oxidative stress because it uses water channels ( aquaporins ) to rapidly cross - cell membranes ( 20 ) , reach the nucleus and cause damage to dna by generating hydroxyl - free radicals ( oh ) ( 21 ) . these radicals attack dna at the sugar residue of the dna backbone , leading to single strand breaks . they also modify purines and pyrimidines to their hydroxyl derivatives , such as 8-hydroxyguanine ( 16 ) . one study examined dna damage resulting from treatment of cultured human leukocytes with h2o2 concentrations of 25 , 50 , 100 and 200 m for 4 h. dna damage , assessed by the comet assay , increased significantly with increasing dose ( 17 ) . in our study , we treated hepg2 cells with 25 m or 50 m h2o2 for different durations : 5 min , 30 min , 40 min or 1 h. dna damage was both dose and duration dependent . dna damage increased with increasing time of incubation with h2o2 , but only between 5 and 60 mins of incubation . after 24 h of incubation with h2o2 , the extent of dna damage was not different from that in control cells , quite likely due to the action of dna repair mechanisms . as we did not use incubation times longer than an hour but shorter than 24 h , we do not know at what time point the effects of such repair mechanisms became evident . however , a similar study on colonocytes ( 18 ) showed that at a h2o2 concentration of 15 mm the dna damage was reduced when incubation times were > 30 min . similarly , treatment of human lymphocytes with 20 m h2o2 for 5 min induced dna damage but incubation of the cells for 2 h led to a considerable decrease in dna damage ( 19 ) . based on these reports we suggest that dna damage in our setup starts to decrease shortly after 1 h of incubation . in conclusion , the extent of dna damage was dose - dependent and incubation time - dependent . dna damage increased with time but later decreased , likely due to metabolism of h2o2 to water and the effects of dna repair . the authors have not received any funding or benefits from industry to conduct this study .

backgroundhydrogen peroxide ( h2o2 ) is a common reactive oxygen intermediate generated by various forms of oxidative stress.aimthe aim of this study was to investigate the dna damage capacity of h2o2 in hepg2 cells.methodscells were treated with h2o2 at concentrations of 25 m or 50 m for 5 min , 30 min , 40 min , 1 h , or 24 h in parallel . the extent of dna damage was assessed by the comet assay.resultscompared to the control , dna damage by 25 and 50 m h2o2 increased significantly with increasing incubation time up to 1 h , but it was not increased at 24 h.conclusionsour findings confirm that h2o2 is a typical dna damage - inducing agent and thus is a good model system to study the effects of oxidative stress . dna damage in hepg2 cells increased significantly with h2o2 concentration and time of incubation but later decreased likely due to dna repair mechanisms and antioxidant enzymes .

Materials and methods Chemicals Cell culture Hydrogen peroxide (H Comet assay Cell viability Statistical analysis Scoring DNA damage Result Discussion Conflict of interest and funding

telemedicine utilization is rising due to the increased availability and decreased cost of communication technology , in parallel with growing recognition of key areas of health care that may benefit from its use . although phone communication continues to be a common form of patient - provider communication , internet - based video communication is being deployed in several settings as well . the portion of the population with internet access is rapidly growing74% of english - speaking americans have access , an absolute increase of 30% from 2000 to 2009 . given the widespread availability of internet access and the decreasing costs of video communication via computer , it is important to understand preferences and potential barriers , from the patient perspective , to facilitate telemedicine implementation . telemedicine can be employed in a synchronous or asynchronous manner . in asynchronous telemedicine , also known as store and forward , health information is obtained and communicated between visits , at which point discussion of that information may occur . this aspect of telemedicine is already commonly practiced in many settings ; examples include remote transmission of information from specialists ( such as radiology ) as well as patient use of email or weblogs for conveying information . by comparison , synchronous telemedicine involves real time interaction between provider and patient , such as by telephone or video . use of this method is growing in several settings as follows : providing acute decision making , such as in telestroke ; facilitating intermittent , low - level management of chronic illnesses ; increasing accessibility for patients who are either geographically isolated or find local travel challenging ; enabling patients with uncommon diseases to access specialists [ 4 , 5 ] . the potential benefits of synchronous telemedicine include improved access to healthcare , reduced waiting times for appointments , and increased patient adherence to chronic illness treatment plans . chronic diseases account for 75% of healthcare spending and represent a key target for both cost reduction and care improvement via telemedicine . although payer organizations have been reluctant to accept telemedicine due to uncertainties in its efficacy , an increasing body of literature demonstrates that telemedicine may be as effective ( and in some cases superior to ) the current standard of care in the treatment of chronic diseases such as diabetes , hypertension , and aids . obstructive sleep apnea ( osa ) is present in 420% of adults ( depending on the study and the operational definition ) and remains underdiagnosed [ 7 , 8 ] . osa is often comorbid with other chronic conditions such as heart disease and hypertension , and requires long - term management . home sleep testing devices are increasingly common , and even telemetric continuous positive airway pressure ( cpap ) titration has been shown to be effective . patients receiving in - person visits or video visits were equivalent in terms of satisfaction and treatment adherence . we undertook the current study to answer three important questions regarding patient perceptions of in - person versus telemedicine forms of patient care in an academic sleep disorders clinic population as follows : ( 1 ) what are the barriers to in - person clinic visits ? we administered a brief survey , consisting of 14 multiple choice questions and one open - ended free text question , to patients seen in the sleep disorders clinic at our institution between 20092011 ( see supplemtaery material at doi:10.5402/2012/135329 ) . the survey included questions pertaining to waiting times to be seen at primary care and specialist offices as well as communication practices , frequency , and preferences in regards to email , phone , video chat , and patient gateway ( see supplemtaery material ) . patient gateway is a local service offered by partners health care system ( massachusetts general hospital and brigham and women 's hospital ma , usa ) that allows patients to electronically communicate with their doctors through a secure platform . we included adult sleep disorder patients who had been seen by one of two board - certified sleep neurologists at massachusetts general hospital in boston , massachusetts for a variety of complaints ( the majority being for sleepiness , sleep apnea , and insomnia evaluations ) . this is an academic center serving a range of patient demographics ; most reside in massachusetts , with a minority traveling from neighboring states . we sent an email survey to patients if they had a viable email address on file ( n = 282 ) . an additional 156 patients , who did not provide an email address during routine clinical intake , were mailed a hardcopy of the questionnaire . these values do not include the 18 patients with invalid emails and the four patients for whom the hardcopy survey was returned due to invalid mailing address . the partners research committee determined that this study was exempt from institutional review board approval ; patients provided implied consent by their participation in the survey . study data were collected and managed using redcap ( research electronic data capture ) software developed at vanderbilt university , and hosted at massachusetts general hospital . redcap is a secure , web - based application designed to support data capture for research studies . redcap provides an intuitive interface for validated data entry ; audit trails for tracking data manipulation and export procedures ; automated export procedures for seamless data downloads to common statistical packages ; procedures for importing data from external sources . survey responses were analyzed with prism ( graphpad software , la jolla , ca , usa ) . the kruskall - wallis nonparametric test ( with dunn 's post hoc test ) was used for group comparisons . for some survey questions , we combined certain answers in order to preserve the ordinal nature of the list for statistical analysis . for example , the question regarding comfort with video telemedicine , we combined the not comfortable with not sure , which is a conservative change regarding estimation of opinion regarding video . to address the question of whether nonresponders differed in terms of age or sex , we selected a random sample of 50 nonresponders from the email cohort and the mail cohort . we found no significant difference in response rate according to sex for either mail or email surveys ( p > 0.05 , fisher 's exact test ) . for the email survey cohort , we found no difference in age between responders and the sample of nonresponders . however , for the mailed survey cohort , the respondents were older than nonresponders ( 62 versus 51 years of age ; p < 0.05 , anova with bonferroni correction ) . the response rate from those who were emailed was similar to those who received the survey by postal mail ( 30% versus 24% , p > 0.2 , fisher 's exact test ) , yielding an overall response rate of 28% ( table 1 ) . 83% of patients reported waiting under three months to be seen for their initial sleep consultation and for their follow - up visits ( figure 1(a ) ) . the waiting time for follow - up appointments with primary care physicians was similar , except that waiting times of less than 1 month were more common . satisfaction with sleep clinic waiting times was modest , with 41% of patients reporting they were either somewhat satisfied or not satisfied ( figure 1(b ) ) . patients indicated several important concerns regarding routine in - person clinic visits ( table 2 ) . the most common challenges for face - to - face appointments were cost of parking ( 44% ) , time away from work / school ( 34% ) , cost of gas ( 26% ) , and requiring family or other support to travel ( 19% ) . about 28% of patients reported they were sometimes or frequently late for in - person appointments ( data not shown ) . telephone contact was the most common form of telemedicine , with a large majority ( 89% ) of respondents employing this method at least 1 - 2 times per six months ( figure 2 ) . more than half of respondents reported contacting their doctors by email , with the most common frequency being 1 - 2 times per six months . about 30% of respondents reported using the encrypted electronic e - mail communication platform ( see methods ) . only 20% of those surveyed reported using a health diary as part of their care plan ( data not shown ) . despite the lack of experience using video for clinical purposes , the majority of patients ( 63% ) reported being very comfortable or willing to try this method of telemedicine ( figure 3(a ) ) . more than half ( 54% ) of respondents indicated they would be willing to pay a copay for a video appointment , and not surprisingly , they felt $ 10 or $ 25 was preferable to a $ 50 copay ( figure 3(b ) ) . of the 14% of respondents who were uncomfortable with video communication , the two most common reasons were that in - person visits feel more natural and that the doctor might need to perform an examination ( table 3 ) . only 13% of respondents felt video technology was too difficult or reported that they did not have a computer or internet connection . we tested whether respondent comfort with video telemedicine was related to age , sex , internet availability , willingness to pay a copay , or availability of an email address on file . uncertain and not comfortable responses ( see figure 3(a ) ) , a conservative assumption that allowed the responses to remain ordered for statistical testing ( nonparametric anova ) . there was no difference in comfort level with video telemedicine by age , sex , or by method of survey response ( mail versus email ) . of those who reported being uncomfortable or unsure about video telemedicine , 11% reported lacking a computer or internet access as a reason , and only 2% indicated it was too difficult . this subgroup of responders was also less willing to pay a copay ( p < 0.001 ) . this survey study indicates that a substantial portion of patients seen in an academic sleep disorders clinic are willing to consider video telemedicine as an option for their care . patients identified several practical barriers to in - person visits , including cost and inconvenience . their main concerns regarding video visits , including feeling less natural and the need for physical examination , are already inherent in telephone communication , which they reported commonly utilizing . these results are encouraging for the development of video appointments in sleep medicine and is consistent with previous evidence that patients find tele - consultation equivalent to in - person consultation [ 14 , 15 ] , as well as a forward - looking editorial suggesting the importance of telemedicine in the care of sleep disorders . indirect benefits include avoidance of barriers to in - person visits , such as the time and cost associated with travel or missed work . to decrease wait times by changing the medium of communication from in - person to virtual , either the visit duration would have to be shorter or the filling of cancellations would have to be more efficient . regarding the sense that video chat does not seem as natural as in - person visits , it is worth mentioning that phone and email , which are arguably even less natural - feeling , were commonly utilized by this cohort . it is possible that sentiments towards video communication will evolve to be even more accepted by patients as it becomes commonplace . regarding the concern that the doctor might need to perform some physical examination , in sleep medicine it may be that certain stable patients could be adequately assessed without performing a physical exam that requires the physician to be present in the same room . in addition , certain elements of the examination such as weight or blood pressure could be performed at home or at a local health clinic . additionally , many patients using video visits reported the absence of a physical exam to be acceptable and gave the experience high satisfaction scores . although we did not assess this aspect directly , one respondent did express privacy concerns in the free text field . the majority of patients were willing to pay either $ 10 or $ 25 per video appointment . with the increasing evidence of the treatment efficacy and patient support of telemedicine in a variety of medical settings , sleep medicine may experience similar benefits in terms of their chronic management . the extent to which third party payers might reimburse for virtual visits in sleep medicine remains uncertain but there are emerging mechanisms for supporting these types of visits financially if they can be shown to lower costs . physician acceptance of telemedicine incorporates personal preference , prior experience , reimbursement potential , and demonstration of improved or equivalent satisfaction and outcomes compared to in - person visits . telephone contact with patients between clinic visits is employed across many specialties , especially for low - level decision making . the majority of physicians do not charge for telephone services , yet most are in agreement that compensation for their time is appropriate , whether in person or electronically . concerns about telephone - based care from the physician standpoint include limited access to the patient 's health record , legal concerns about advice delivered in this setting , and challenges of documentation . in specialties with particularly nuanced and complex examinations , such as neurology , telemedicine for diagnostic purposes neurologists were also reported to universally feel that they were able to appropriately communicate management advice to their patients by video . in sleep medicine , the extent to which physical examination influences chronic decision making in common disorders such as insomnia and sleep apnea remains untested . in regards to the rising costs of health care , telemedicine may be a promising solution , as many studies have shown scheduling video chat appointments results in cost - savings for patients and hospitals . in one economic review of video telemedicine , 22 of 36 studies reported this method to be more cost effective than standard office appointments . video appointments could address a variety of the burdens associated with in - person visits listed by patients in this survey . for example , the time , cost , and inconvenience associated with travel could be ameliorated by a video visit option ( table 2 ) , as has been reported for example in pediatrics and oncology . in addition , the decreased utilization of scarce outpatient practice space due to offloading to telemedicine - based practice could free up space for patients requiring in - person consultation . telemedicine visits might also be useful for deciding which chronic patients require further in person care . sleep medicine may be an ideal specialty in which video visits could accommodate routine chronic follow - up appointments . patient - specific data , such as diaries for the insomnia patient and cpap machine downloads for the osa patient , could be reviewed at such visits , as could routine challenges with medications or equipment . seeing the patient in their home environment may assist the clinician in more accurately diagnosing reasons for sleep dysfunction including ill - fitting equipment , certain aspects of poor sleep hygiene , or an overly illuminated bedroom . in a recent editorial , telemedicine was proposed as an important method to approach the ongoing challenges of cost - effective and outcomes - oriented chronic care of patients with sleep disorders . one study recently reported the successful use of video telemedicine in osa patients , with similar treatment adherence and satisfaction levels compared to those with in - person visits . this opportunity may extend to management of other chronic diseases in which evaluations and decision making may be considered using only remotely obtainable information . the main limitations of this study include the 28% response rate and the single - center population . nevertheless , our findings highlight several important points and lay the groundwork for future development of sleep telemedicine . patients experience multiple barriers to in - person visits that could be circumvented with virtual visits , and the majority of respondents were willing to pay a copay for a video visit despite none of the respondents having any personal experience with video telemedicine .

telemedicine is an increasingly recognized option for cost - effective management of chronic conditions . we surveyed sleep clinic patients about their experiences and preferences regarding different forms of telemedicine . adult sleep clinic patients seen between 2009 and 2011 received a brief survey either by postal mail ( n = 156 ) or , for those with an available email address , electronically ( n = 282 ) . the overall response rate was 28.1% ( n = 123 responses ) , with email response rates being higher than postal mail responses . the most commonly reported barriers to in - person physician visits were parking cost ( 44% ) , time away from work / school ( 34% ) , and cost of gas ( 26% ) . whereas 89% of respondents indicated using telephone and 55% of respondents indicated using email to communicate with providers , none reported experience with video telemedicine . despite this lack of experience , over 60% reported feeling comfortable or willing to try it . of those who were uncomfortable about video telemedicine , the two main reasons were that in - person visits feel more natural ( 48% ) and that the doctor might need to perform an examination ( 24% ) . more than half of respondents reported willingness to pay a copay for a video visit . video telemedicine represents a feasible option for chronic sleep disorders management .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusion

chromosome 22q13.3 deletion syndrome is a well - recognized cause of global developmental delay ( gdd ) [ 1 , 2 ] while duplication of the same chromosome is a rare occurrence [ 35 ] . the presence of both abnormalities in the same family has never been reported , to our knowledge . we report the presence of 22q13.3 deletion and 22q13.3 duplication in two siblings , with the mother carrying an inversion of chromosome 22 ( 46 , xx , inv ( 22 ) ( p13q13.32 ) ) a 6 year - old male was noted in infancy to have mild global developmental delay without dysmorphic features . his 4 year - old brother was noted in early infancy to have severe global developmental delay and dysmorphic features related to 22q13.3 deletion to the terminus . the mother 's inversion may rearrange to form 22q duplication or deletion when passed on to children . the chance of a child born with a chromosome imbalance is as high as 50% . he had calcaneo - valgus deformity of the right foot which improved with manipulation with each diaper change . at 9-month - old , his mother noticed that he would not engage with her and would stare into space . he was referred to a neurodevelopmental pediatrician at age 18 months because all developmental milestones were delayed . his height and weight were at 50th percentile , and fronto - occipital circumference ( foc ) was at 98th percentile ( large head ) . neuropsychological evaluation revealed significant difficulty in social skills and adaptive functioning , consistent with a diagnosis of pervasive developmental disorder nos . it further revealed that receptive language was better than expressive language skills . a metabolic disorder screen ( plasma for amino acids , urine for organic acids , smith - lemli opitz , thyroid ) and fragile - x screening were normal . chromosomal analysis revealed 46 , xy , rec ( 22 ) dup ( 22q ) inv ( 22 ) ( p13 ; q13.32 ) mat ( figures 1 and 2 ) . jc is the younger sibling who was born by normal vaginal delivery , after a term gestation , when his mother was 38 yrs old . his birth weight was 9 lb . 3 oz . he had transient tachypnea of the newborn which responded to oxygen administration . jc was referred to a neurodevelopmental pediatrician at the age of 13 mos . because of delayed language and motor development . height and weight were in the 90th percentile , and foc was between 70 and 90th percentile . he had downslanting palpebral fissures , fleshy hands , dysplastic toe nails , and clinodactyly . he has generalized coarse facial features , broad nasal bridge , relatively flat midface , and prominent chin and ears . he has heat intolerance ( because of decreased perspiration ) , a high pain threshold , and a wobbly gait ( because of hypotonia ) . behavior characteristics included mouthing and chewing of nonfood items and autistic - like behavior and affect , typical of the 22q13.3 deletion syndrome . newborn genetic screening ( amino academia , congenital adrenal hyperplasia , congenital hypothyroidism , smith - lemli opitz , galactosemia , hemoglobinopathy ) was normal . chromosomal analysis revealed 46 , xy , rec ( 22 ) dup ( 22p ) inv ( 22 ) ( p13q13.32 ) mat ( figures 1 and 2 ) . medication management for his disruptive behaviors was strongly recommended , but the family refused this option because of the potential sideeffects . the mother ( hc ) has an inversion in one of her number 22 chromosomes : 46 , xx , inv(22 ) ( p13 ; q13.32)indicating that one of the mother 's number 22 chromosomes contains a large piece that is inverted or flipped backwards ( figure 3 ) . her mother 's first paternal cousin has an intellectual disability but went on to have 3 children , and one of them is intellectually disabled . the father ( tc ) has entirely normal chromosomes . 22q13 would not be considered a classic hot spot for genomic rearrangements , which are generally regions flanked by highly homologous segmental duplications which predispose to nonhomologous allelic recombination during meiosis in one of the parental lines , yielding identical and recurrent deletions or the reciprocal duplication . although such individuals are completely healthy , a certain proportion of their gametes will contain a rearranged form of the inverted 22 chromosome . a parent with an inversion or a balanced translocation could transmit the unbalanced form of the translocation to the offspring , or deletions and duplications may occur through recombination between the normal allele and the inverted allele . a child with this unbalanced rearrangement would be expected to have developmental delay and possible birth defects . this rearrangement can be in the form of deletion or duplication of the chromosomal segment in question . in the remaining off - springs , where the rearrangement remains balanced alternately , the mother may pass on her normal number 22 chromosome , and the child will be normal . cc , the older sibling ( 46 , xy , rec ( 22 ) dup ( 22q ) inv ( 22 ) ( p13 ; q13.32 ) mat , ) has no dysmorphic features , yet has significant developmental delay . the 22 chromosome duplications are very rare , and the ones cited in the literature have breakpoints on 22q12 rather than 22q13 . jc , with monosomy of 22q13.3 , has findings typical of 22q13.3 deletion syndrome patients including global developmental delay , generalized hypotonia , absent or severely delayed speech , and normal or accelerated growth . the true prevalence of 22q13.3 deletion may be underestimated because routine karyotyping may only detect a fraction of the cases . when this condition is suspected based on clinical features or there is a history of mild gdd in an older sibling , early genetic testing should be instituted employing new and more assertive methods like genomic microarray and fluorescent in situ hybridization ( fish ) . it is worth noting that our case ( jc ) acquired the deletion from his mother . in addition , jc also received music therapy , picture exchange communication , and sign language instruction . it is believed that these interventions contributed to improving behavioral issues ( autistic features ) in jc and global developmental delay in both . to facilitate communication and decrease frustration within the family , all family members should be encouraged to learn sign language [ phelan , personal communication ] . as is true for most chromosomal abnormalities , and as was done with the presented cases , individuals with 22q13.3 deletion or duplication should also undergo base - line investigations like renal ultrasound ( for renal cysts and other structural problems ) , echocardiogram ( for septal defects ) , eeg ( for seizure activity ) , audiology tests ( to r / o hearing deficits ) , and brain imaging studies ( arachnoid cysts , etc . ) . as these individuals are expected to have a reasonably normal life expectancy [ phelan , personal communication ] , they should receive the recommended health maintenance preventive services ( pap smears , colon cancer screening , prostate exam , cholesterol check , etc . ) . some screening tests like colon cancer screening may need to be expedited , as there may be an increased predisposition towards colon cancer . amniocentesis for prenatal testing in pregnancies at increased risk for chromosomal abnormalities may not be diagnostic , as in jc 's case [ dr . grati , european genetics conf . 2008 ] , and fish , chorionic villus sampling , or micro - array testing should be considered , as they are more specific . behavioral interventions and medication management such as atypical neuroleptics are often recommended to control behavior problems .

chromosome 22q13.3 deletion syndrome is a well - recognized cause of global developmental delay , while duplication of the same chromosome is a rare occurrence . the presence of both abnormalities in the same family has never been reported , to our knowledge . we report a rare occurrence of 22q13.3 duplication and 22q13.3 deletion in siblings , as a consequence of a mother 's inversion on her 22nd chromosome ( p13;q13.32 ) . a 6 year old male was noted in infancy to have mild global developmental delay without dysmorphic features . his genetic testing revealed he had 22q13.3 duplication to the terminus . his 4 year old brother was noted in early infancy to have severe global developmental delay and dysmorphic features related to 22q13.3 deletion to the terminus . their mother had a long inversion on her 22nd chromosome . genetic tests for their father and eldest brother were unremarkable . the mother 's inversion may rearrange to form 22q duplication or deletion when passed on to children . the chance of a child born with a chromosome imbalance is as high as 50% .

1. Introduction 2. Case Report 3. Discussion

in this study , we retrospectively selected 75 cases of formalin - fixed , paraffin - embedded hair - bearing adult skin samples between 2002 and 2009 at asan medical center . samples were taken from the margins of routine surgical procedures such as excisional biopsy or excision for benign / malignant skin lesions that were diagnosed as following : various inflammatory lesions with parakeratosis ( n=16 ) , keratinocytic tumors ( n=11 ) , benign tumors with apocrine and eccrine differentiation ( n=14 ) , malignant tumors with follicular differentiation ( n=1 ) , benign tumors with follicular differentiation ( n=17 ) , and tumors with sebaceous differentiation ( n=12 ) . the rest were retrieved from mature cystic teratoma ( n=2 ) and normal scalp tissues biopsied for therapeutic reasons ( n=2 ) . to analyze cd99 expression patterns in fetal skin , gestational ages of the collected cases were 16 , 17 , 19 ( 2 cases ) , 20 , 25 , 26 , and 28 weeks . all tissues were immediately fixed in 10% buffered formalin , and then processed in paraffin wax using standard procedures . sections were serially cut into 4-m sections and stained with hematoxylin and eosin for examination . the study protocol was approved by the institutional review board ( project number 2009 - 440 ) of asan medical center . when multiple blocks were available in a single case , one block containing representative tissue was selected . ihc staining for cd99 was performed using a benchmark xt autoimmunostianer ( ventana medical systems , tucson , az , usa ) according to the manufacturer s instructions and using the reagents supplied with the kit . in brief , 4-m sections were mounted on silanized charged slides , dried for 10 minutes at room temperature and then further dried for 20 minutes at 65c . after deparaffinization , heat - induced epitope retrieval using standard cell conditioning solution 1 was performed for 24 minutes . subsequently , primary anti - cd99 ( 1:100 , clone dn16 , dinona , seoul , korea ) was applied by an automated immunostaining system with the ultraview dab detection kit ( ventana medical systems ) . analysis of whole tissue section slides stained for cd99 by ihc was performed under a light microscope as previously described [ 14 - 16 ] . the results of cd99 immunostaining were classified into the following groups : consistently complete and strong membrane staining was assigned a value + + , weak to moderate membrane staining was assigned a value of + , variable membrane staining was assigned a value of + / , and no staining was assigned a value of . occasional cytoplasmic staining was minimal and weak . for immunofluorescence ( if ) staining , 4-m sections were incubated with mouse anti - cd99 ( 1:200 , clone dn16 , dinona ) and rabbit anti - cd34 ( 1:10 , # ab64480 , rabbit polyclonal , abcam , cambridge , uk ) for 60 minutes at room temperature . sections were then incubated with tetramethylrhodamine - conjugated host anti - mouse igg antibody and fluorescein isothiocyanate - conjugated host anti - rabbit igg antibody for 60 minutes at room temperature . sections incubated with the appropriate isotype control primary antibodies and fluorescently labeled secondary antibodies were utilized as necessary . results were analyzed using confocal microscopy ( leica tcs_np / sp , leica microsystems , mannheim , germany ) . in this study , we retrospectively selected 75 cases of formalin - fixed , paraffin - embedded hair - bearing adult skin samples between 2002 and 2009 at asan medical center . samples were taken from the margins of routine surgical procedures such as excisional biopsy or excision for benign / malignant skin lesions that were diagnosed as following : various inflammatory lesions with parakeratosis ( n=16 ) , keratinocytic tumors ( n=11 ) , benign tumors with apocrine and eccrine differentiation ( n=14 ) , malignant tumors with follicular differentiation ( n=1 ) , benign tumors with follicular differentiation ( n=17 ) , and tumors with sebaceous differentiation ( n=12 ) . the rest were retrieved from mature cystic teratoma ( n=2 ) and normal scalp tissues biopsied for therapeutic reasons ( n=2 ) . to analyze cd99 expression patterns in fetal skin , gestational ages of the collected cases were 16 , 17 , 19 ( 2 cases ) , 20 , 25 , 26 , and 28 weeks . all tissues were immediately fixed in 10% buffered formalin , and then processed in paraffin wax using standard procedures . sections were serially cut into 4-m sections and stained with hematoxylin and eosin for examination . the study protocol was approved by the institutional review board ( project number 2009 - 440 ) of asan medical center . all hematoxylin and eosin stained slides were reviewed to ensure quality . when multiple blocks were available in a single case , one block containing representative tissue was selected . ihc staining for cd99 was performed using a benchmark xt autoimmunostianer ( ventana medical systems , tucson , az , usa ) according to the manufacturer s instructions and using the reagents supplied with the kit . in brief , 4-m sections were mounted on silanized charged slides , dried for 10 minutes at room temperature and then further dried for 20 minutes at 65c . after deparaffinization , heat - induced epitope retrieval using standard cell conditioning solution 1 was performed for 24 minutes . subsequently , primary anti - cd99 ( 1:100 , clone dn16 , dinona , seoul , korea ) was applied by an automated immunostaining system with the ultraview dab detection kit ( ventana medical systems ) . analysis of whole tissue section slides stained for cd99 by ihc was performed under a light microscope as previously described [ 14 - 16 ] . the results of cd99 immunostaining were classified into the following groups : consistently complete and strong membrane staining was assigned a value + + , weak to moderate membrane staining was assigned a value of + , variable membrane staining was assigned a value of + / , and no staining was assigned a value of . occasional cytoplasmic staining was minimal and weak . for immunofluorescence ( if ) staining , 4-m sections were incubated with mouse anti - cd99 ( 1:200 , clone dn16 , dinona ) and rabbit anti - cd34 ( 1:10 , # ab64480 , rabbit polyclonal , abcam , cambridge , uk ) for 60 minutes at room temperature . sections were then incubated with tetramethylrhodamine - conjugated host anti - mouse igg antibody and fluorescein isothiocyanate - conjugated host anti - rabbit igg antibody for 60 minutes at room temperature . sections incubated with the appropriate isotype control primary antibodies and fluorescently labeled secondary antibodies were utilized as necessary . results were analyzed using confocal microscopy ( leica tcs_np / sp , leica microsystems , mannheim , germany ) . to examine the expression pattern of cd99 in epidermal keratinocytes , immunostaining for cd99 was performed on nonpathologic adult skin samples ( fig . 1a ) . in the epidermis , cell membranes in the basal cell layer were strongly stained ( fig . 1b ) , whereas the keratinocytes in the prickle cell layer just above the basal cell layer showed markedly reduced staining and cells in the granular and hornified layers did not express cd99 . we also identified intense cd99 expression in langerhans cells in the epidermal layer ( fig . infundibula of hair follicles possessed a cd99 expression pattern similar to that of the epidermis . 1c ) at the bulges , and basal cells of the follicular ors were also strongly stained ( fig . other subpopulations of hair follicles showed varying immunoreactivity . when observing cd99 staining in the central shaft of hair follicles , the cuticle was negative for cd99 , the lower irs was weakly positive , and the ors was strongly positive ( fig . to flat cell - lined apocrine glands were negative for cd99 , but relatively tall cell - lined apocrine glands were positive for cd99 . the apical luminal surfaces of both flat and tall cell - lined glands were cd99-negative ( fig . secretory coils of eccrine sweat glands are composed of outer clear cells and inner cuboidal cells ; the outer clear cells were immunonegative and scattered inner cuboidal cells were immunopositive for cd99 ( fig . the excretory duct is composed of two - layered cuboidal cells , and both layers were immunopositive for cd99 ( fig . the apical luminal surfaces of inner eccrine cells and inner excretory ducts also lacked cd99 expression ( fig . 2b , c ) . in the sebaceous glands , basal cells surrounding the sebaceous alveolus were cd99 immunopositive , but mature sebocytes containing central lipid droplets were immunonegative for cd99 ( fig . cells that were positive for cd99 immunostaining in normal adult epidermis and skin appendages are summarized in table 1 . eight developing fetal human skin samples were obtained from aborted fetuses of 1628 gestational weeks . in early stages , fetal skin is called periderm and is composed of 23 epidermal cell layers . at 16 weeks of gestation , the periderm , including the epidermal basal layer and hair follicle germ , was negative for cd99 , whereas mesenchymal cells around the hair germ were strongly positive for cd99 ( fig . , the fetal epidermis and skin appendages start to resemble normal adult skin ; basal cell layer , intermediate cell layer , hair follicles , sweat glands , and sebaceous glands appear at this stage . cd99 was expressed in the epidermal basal cell layer , hair bulge , ors , and dermal papilla ( fig . fetal skin is histologically similar to adult skin , showing cd99 immunoreactivity patterns identical to those of adult skins ( fig . 3c , d ) . in our study , cd99 staining was particularly strongly positive in immature epidermal basal cells and cells at the bulge . we therefore compared cd99-positive subpopulations of normal epidermis and skin appendages to cd34-positive subpopulations that have been reported as cutaneous precursor cells using double - if . we focused on expression patterns of these markers in the basal cells of epidermis and hair follicles . in the adult epidermis and skin appendages , cd99 and cd34 expression partially overlapped at the lower ors ( fig . c ) . in the 20-week - old fetal skin , cd99 and cd34 were not co - expressed in the basal cells of epidermis ( fig . 5c ) , or ors ; however , mesencymal cells of dermal papilla showed co - expression ( fig . to examine the expression pattern of cd99 in epidermal keratinocytes , immunostaining for cd99 was performed on nonpathologic adult skin samples ( fig . 1a ) . in the epidermis , cell membranes in the basal cell layer were strongly stained ( fig . 1b ) , whereas the keratinocytes in the prickle cell layer just above the basal cell layer showed markedly reduced staining and cells in the granular and hornified layers did not express cd99 . we also identified intense cd99 expression in langerhans cells in the epidermal layer ( fig . infundibula of hair follicles possessed a cd99 expression pattern similar to that of the epidermis . 1c ) at the bulges , and basal cells of the follicular ors were also strongly stained ( fig . other subpopulations of hair follicles showed varying immunoreactivity . when observing cd99 staining in the central shaft of hair follicles , the cuticle was negative for cd99 , the lower irs was weakly positive , and the ors was strongly positive ( fig . secretory apocrine glands showed variable cd99 expression . relatively thin to flat cell - lined apocrine glands were negative for cd99 , but relatively tall cell - lined apocrine glands were positive for cd99 . the apical luminal surfaces of both flat and tall cell - lined glands were cd99-negative ( fig . secretory coils of eccrine sweat glands are composed of outer clear cells and inner cuboidal cells ; the outer clear cells were immunonegative and scattered inner cuboidal cells were immunopositive for cd99 ( fig . the excretory duct is composed of two - layered cuboidal cells , and both layers were immunopositive for cd99 ( fig . the apical luminal surfaces of inner eccrine cells and inner excretory ducts also lacked cd99 expression ( fig . basal cells surrounding the sebaceous alveolus were cd99 immunopositive , but mature sebocytes containing central lipid droplets were immunonegative for cd99 ( fig . cells that were positive for cd99 immunostaining in normal adult epidermis and skin appendages are summarized in table 1 . eight developing fetal human skin samples were obtained from aborted fetuses of 1628 gestational weeks . in early stages , fetal skin is called periderm and is composed of 23 epidermal cell layers . at 16 weeks of gestation , the periderm , including the epidermal basal layer and hair follicle germ , was negative for cd99 , whereas mesenchymal cells around the hair germ were strongly positive for cd99 ( fig . , the fetal epidermis and skin appendages start to resemble normal adult skin ; basal cell layer , intermediate cell layer , hair follicles , sweat glands , and sebaceous glands appear at this stage . cd99 was expressed in the epidermal basal cell layer , hair bulge , ors , and dermal papilla ( fig . fetal skin is histologically similar to adult skin , showing cd99 immunoreactivity patterns identical to those of adult skins ( fig . in our study , cd99 staining was particularly strongly positive in immature epidermal basal cells and cells at the bulge . we therefore compared cd99-positive subpopulations of normal epidermis and skin appendages to cd34-positive subpopulations that have been reported as cutaneous precursor cells using double - if . we focused on expression patterns of these markers in the basal cells of epidermis and hair follicles . in the adult epidermis and skin appendages , cd99 and cd34 expression partially overlapped at the lower ors ( fig . c ) . in the 20-week - old fetal skin , cd99 and cd34 were not co - expressed in the basal cells of epidermis ( fig . 5c ) , or ors ; however , mesencymal cells of dermal papilla showed co - expression ( fig . the aim of the current study was to examine cd99 expression in normal human skin and skin appendages ; no such study has been performed to date . we demonstrated that cd99 was strongly expressed in the immature epidermal basal cells , but the fully differentiated granular layer did not show cd99 positivity in normal adult skin . this result is consistent with the findings of a previous study , in which cd99 expression was evaluated in a large series of cutaneous melanoma samples and was described briefly as a crisp membranous staining on normal epidermal basal cells . our study showed that in skin appendages , cd99 showed differential immunoreactivity in each subpopulation . bulge cells , basal cells of the ors , and eccrine inner cuboidal cells were consistently and strongly positive . however , cd99 expression was variably positive in apocrine secretory glands . relatively tall cells with luminal decapitation tended to be cd99-positive , but thin to flat cells without decapitation tended to be negative . analysis of cd99 expression was also performed during different developmental stages of fetal skin . in fetal skin , peridermal cells persist until about week 21 and gradually disappear as stratum corneum . in the early stages of epidermal development , mitotic activity occurs in all the epidermal layers ; however , when differentiation begins , mitotic activity becomes restricted to the cells of the basal layer . angiotensin converting enzyme ( ace ) , keratin 19 , 1-integrin , and p63 were used as stem cell markers in examining the various developmental stages of fetal skin by double if . the expression of ace , 1-integrin , keratin 19 , and p63 was seen in all epidermal layers of the developing fetal skin at 1120 weeks of gestation . from 21 weeks of gestation onward , their expression was mainly confined to the basal layer of epidermal cells . in our study , cd99 was not seen in the periderm at 16 weeks of gestation but was consistently expressed at 19 weeks of gestation . based on this result , we suggest that cd99 expression precedes the expression of ace , 1-integrin , keratin 19 , and p63 in the fetal basal layer . based on the particularly strong cd99 expression in immature thymic t - lineage cells , tonsillar lymphoid progenitor cells , and subventricular zone of fetal brain ( c .- s . park , unpublished data ) , we attempted to correlate cd99 expression with immature subpopulations of epidermis and appendages . there is evidence for populations of stem cells located at the basal layer of the epidermis and the hair follicle bulge . cd99 is also strongly expressed in the bulge . according to previous reports that analyzed expression patterns of various precursor markers , cd34 is more specific for the peripheral layer of the ors , cytokeratin ( ck ) 15 for bulge and epidermal basal cells , nestin for inner portions of the ors , ck19 for basal keratinocytes in the upper and lower third of the ors , p63 for the basal / suprabasal layer , hair matrix , and ors , and cd200 for the bulge [ 20 - 24 ] . we showed that cd34 , which was thought to have similar expressions patterns to cd99 , shows different expression by double if . in the present study , cd34 and cd99 were only co - expressed in the lower ors . therefore , we assumed that precursor cell subpopulations in the skin are more varied than previously thought . in conclusion , this study examined cd99 expression in normal adult and fetal skin . cd99 is strongly expressed in the immature epidermal basal cells in the bulge and basal cells of the hair follicle ors . these findings suggest that cd99 may carry out a specific function in the structures where it is expressed . therefore , we present that cd99 is a unique and previously unreported marker of epidermis and its appendages . future studies should focus on functions of cd99 in the epidermis and its appendages and investigate its feasibility as a novel target for the treatment of dermatologic lesions .

backgroundcd99 is a cell surface transmembrane glycoprotein expressed in various tissues . cd99 is differentially expressed between subpopulations of each tissue and is highly expressed in certain hematopoietic and precursor cells . however , there has been no comprehensive study of cd99 expression in normal skin . we evaluated cd99 expression in normal human skin and developing fetal skin . methodsseventy - five adult skin samples containing normal skin and eight fetal skin samples of different gestational ages were collected . cd99 immunohistochemical staining was performed to evaluate expression pattern in adult and fetal skin samples . cd99 and cd34 expression were compared by double immunofluorescence . resultsin normal adult skin , cd99 was strongly expressed in the membrane of epidermal basal keratinocytes , hair follicle bulges and outer root sheaths , and inner secretory cells of eccrine sweat glands . in fetal skin , cd99 was not expressed on the periderm at 16 weeks of gestation but was expressed in basal cells of fetal skin at around 19 weeks of gestation . cd99 expression became comparable to that of the adult skin after 20 weeks of gestation . cd99 and cd34 were co - expressed in hair follicle outer root sheaths , as seen by double immunofluorescence study . conclusionsthis is the first study examining cd99 expression pattern in normal adult and fetal skin . cd99 tends to be expressed in the basal / precursor cells of epidermis and in hair follicles . these results provide a basis for future investigation on functions of cd99 in the skin and provide a novel potential target for the treatment of dermatologic lesions .

MATERIALS AND METHODS Skin samples Immunohistochemical staining Immunofluorescence assay RESULTS Basal cells showed strong CD99 expression in normal adult epidermis Basaloid cells of bulge and ORS showed strong CD99 expression in normal adult hair follicle CD99 was differentially expressed in subpopulations of normal adult sweat glands and sebaceous glands CD99-positive epidermal basal cells appeared in fetal skin early in the second trimester CD99 and CD34 were co-expressed in lower ORS cells, but they did not co-localize DISCUSSION

glaucoma remains the third or fourth most common cause of blindness in different regions around the globe . since this is a treatable disease , early diagnosis and adequate follow - up are gaining importance . also , direct and indirect economic burdens tend to increase for governments with patients extended lifetime expectancy and complexity of disease stage . so far standard automated perimetry ( sap ) is still considered the gold standard method for function analysis even though defects are only detectable after substantial cell loss . since its introduction , optical coherence tomography ( oct ) has turned into a fundamental tool in the evaluation of a variety of different retinal diseases , in particular primary open angle glaucoma ( poag ) . thinning of the peripapillary retinal nerve fiber layer ( rnfl ) and full macular thickness ( mt ) have been largely used in poag evaluation [ 3 , 4 ] . in addition , recent improvements in oct technology ( i.e. , spectral oct and software analysis ) not only increased image resolution but also allowed customized analysis of the individual retinal layers . glaucoma damage is primarily related to the ganglion cells . thus oct retinal layer segmentation allows us to directly analyze the ganglion cell layer separately and thereby look directly at the site of damage . indeed , ganglion cell - inner plexiform layer ( gcipl ) segmentation can identify changes and correctly diagnose glaucoma with a similar sensitivity as the rnfl or optic nerve head ( onh ) parameters [ 68 ] . thus segmentation may allow a more sensitive structure - function correlation in different stages of disease . although the increased number of oct manufacturing companies may contribute positively to price competition as well as hardware and software improvements , it also leads to variability in measurements and analysis methodology . in this study , we determined if the brand of the spectral - domain oct used and their respective segmentation programs influence structure - function analysis differently . to the best of our knowledge , this is the first study to compare two different oct systems and their respective macula layer segmentation software and associate them with sap in structure - function analysis . the study protocol was approved by the ethics committee of the university of basel , and informed consent was obtained from all participants before the examination . all procedures followed the tenets of the declaration of helsinki . the inclusion criteria included a visual acuity of 0.8 or better , and a refractive error between 6 diopters of hyperopia or myopia . all glaucoma patients had a cup - to - disc ratio of at least 0.5 and a localized thinning of the neuroretinal rim on oct ( cirrus ) corresponding to the fundus examination . the oct thinning should have at least one red sector or two yellow sectors on the thickness map ( less than 1% and 5% of the normal population , resp . preperimetric glaucoma was defined by the presence of optic nerve abnormalities consistent with glaucoma and a normal visual field as tested with sap . other glaucoma patients had to present a reproducible glaucomatous visual field defect on at least three examinations with a mean defect ( md ) higher than 2.0 db and/or a squared root of loss variance ( slv ) over 2.5 db . individuals with previous ocular surgery , systemic diseases , or regular use of medications that could influence the eye ( e.g. , antidepressant , chloroquine ) were excluded from the study . the right eye was included in the study , if it did not fulfill any exclusion criteria . when not possible , visual field examination was performed at a maximum interval of 7 months from oct examination . technical details from the two different commercially available oct instruments used are displayed in table 1 . the pupil of the study eye was dilated with a solution of tropicamide 0.5% and phenylephrine 1% ( spital - pharmazie usb , switzerland ) before examination . oct images were obtained in cirrus using the fast macular cube protocol 512 218 ( 128 horizontal scan lines each composed of 512 a - scans , cirrus sd - oct , carl zeiss , usa ) , and the fast volume scan in spectralis hra + oct ( 25 section scans and 26 art frames , heidelberg engineering , inc . , heidelberg , germany ) . both instruments have a scan area of 6 6 mm and macular retinal thickness is calculated in microns in an area correspondent to the early treatment diabetic retinopathy study ( etdrs ) grid . the mt values used in this study corresponded to the 1 and 3 mm circles of the etdrs grid . gcipl thickness is calculated by cirrus software in the area of an elliptical annulus with a 2.0 mm vertical and 2.4 mm horizontal radius , excluding a central elliptical area ( 0.5 mm vertical and 0.6 mm horizontal radius ) that corresponded to the foveola . according to studies of human retina , the highest density of ganglion cells occurs in this area . as spectralis software ( version 6.0.3 ) uses the etdrs grid also for gcipl thickness calculation , values in the 3 mm circle were averaged , excluding the 1 mm circle , and compared to cirrus ( figure 1 , top ) . cirrus software excluded the macular rnfl layer from the gcipl analysis while spectralis software calculated each retina layer separately ( figure 1 , bottom ) . therefore , in spectralis , only the layers of interest in this study ( ganglion cell and inner plexiform layers ) were added in a separate microsoft excel spreadsheet . the exclusion of rnfl in cirrus was based on the histologic observation that the macular gcipl layer presents less variation than the rnfl among normal individuals . differences between the octs are that while both allow for manual corrections of the macular thickness boundaries , only spectralis allows for manual correction of possible errors in gcipl segmentation . cirrus , but not spectralis , separately analyses the minimum value of gcipl thickness ( mgcipl ) measured within the areas analyzed . thus parameters included in this analysis were averaged mt and the gcipl from both octs , and in addition , their average after manual correction ( cmt and cgcipl ) in spectralis and the mgcipl value given in cirrus . all images included in this study had signal strength over 7 for cirrus and a quality score over 25 for spectralis ( limits considered as good / acceptable image quality for analysis , according to each instrument 's manual ) . standard automated perimetry was performed using an octopus perimeter ( octopus 101 , g2 program , haag - streit ag , switzerland ) . total field md ( mean defect ) values in db were included in the analysis . all sap exams used in this study were inside reliability parameters ( fixation loss < 33% , false - positive and false - negative rates < 25% ) . differentiation between glaucoma and controls within each measurement was assessed with a t - test and p values posteriorly adjusted with fdr ( false discovery rate ) . the predictive diagnostic performance for each parameter , that is , the ability to differentiate glaucoma from control , was assessed calculating the receiver operating characteristics ( roc ) curves and the respective area under the roc curve ( auc ) . a perfect predictive performance is represented by an auc of 1.0 which means that this parameter can differentiate glaucoma from control with 100% sensitivity and specificity , while an auc value of 0.5 means a prediction mostly influenced by chance . aucs from different octs were compared with the delong test . for prediction of structure - function relationship all calculations were adjusted to age . as oct values are linear values but sap are reported in db , a logarithmic value , oct values were transformed to logarithmic scale for better comparisons with sap . results were expressed as the regressive slope coefficients ( on log - scale ) with corresponding standard errors and p values . statistical analyses were performed using spss ( ibm spss statistics , version 22 ) , and the statistical package r ( version 3.0.2 ) . in this study , the mean age was 59.5 years ( sd 13.9 ) for the glaucoma group and 49.2 years ( sd 7.0 ) for the controls ( p = 0.013 ) . median md was 2.2 ( range : 0.417.0 ) db in poag ( including ppg ) and 0.2 ( range : 3.82.0 ) db in controls ( p = 0.024 ) . table 3 shows averages from mt and gcipl in both octs in the poag and control groups . spectralis and cirrus showed a significant difference between patients and controls in both mt ( p = 0.018 , p = 0.028 , resp . ) and gcipl ( p < 0.001 , both ) . manual correction of the software segmentation parameters in spectralis produced a significant difference between measurements in gcipl ( p < 0.05 ) but not in mt ( p = 0.715 ) . a total of 2 controls ( 12.5% ) and 7 patients ( 41.1% ) needed posterior manual correction of retina thickness segmentation . bland - altman analysis showed disagreement between octs in mt and gcipl values ( figure 2(b ) ) . on average , measurements with spectralis were thicker than with cirrus . for mt the difference was 21.64 m ( sd 4.5 ) before and 21.65 m ( sd 4.5 ) after manual correction ( p < 0.001 ) . for average gcipl thickness the difference was 9.8 m ( sd 5.4 ) before and 10.0 m ( sd 5.3 ) after manual correction ( p < 0.001 ) . with higher values measurements obtained with spectralis tended to differ more from those measured with cirrus . this difference increased when we compared spectralis averages before ( 14.1 m , sd 5.9 ) and after correction ( 14.4 m , sd 5.8 ) with mgcipl ( p < 0.001 ) . there was no significant difference between the age - adjusted aucs from mt in cirrus ( 0.798 ) and spectralis , before ( 0.801 ) and after ( 0.805 ) manual correction . this was also observed between octs for gcipl measurements : 0.879 in cirrus and 0.886 before and 0.886 after correction in spectralis . minimum gcipl value in cirrus had an auc of 0.930 ( table 3 ; figure 3 ) . mt and gcipl had a negative significant association with md ( p < 0.001 ) , in both poag ( p < 0.001 ) and controls ( p < 0.001 ) for cirrus and spectralis ( table 4 , figure 4 ) . the aim of this study was to compare thickness measurements between two commercially available octs using their respective segmentation programs and assess if the brand of spectral - domain oct used might influence structure function analysis differently in glaucoma . using two different spectral - domain octs , cirrus and spectralis , we observed that there is a significant difference in full macula and gcipl thickness measurements between machines . therefore measurements are not interchangeable . nevertheless , when assessing structure function relationship individually , all measurements from both machines demonstrated a statistically significant relationship with function measured by standard automated perimetry . further , age - adjusted aucs demonstrated that all measurements had a similar predictive performance and could correctly differentiate patients from controls . a literature review in pubmed using specific terms ( optical coherence tomography , glaucoma , ganglion cell , macula , thickness , and segmentation software ) did not reveal any other study which we could directly compare to this one . while we compared the entire area within the central 3 mm diameters , most studies either refer to the central 1 mm area [ 1116 ] or compare the areas within the etdrs sectors calculated by the respective octs ( i.e. , the superior , inferior , temporal , and nasal sectors ) [ 11 , 16 ] . here this is in accordance with a study from mylonas et al . , where spectralis macula thickness also showed the highest values , in the central retinal thickness ( crt , 1 mm diameter ) and individual sectors of the 3 mm area , in comparison to other octs ( including cirrus ) . though the study was conducted in neovascular age - related macular degeneration patients ( 28 individuals ) , its control group ( 10 individuals ) showed the same pattern . other studies found the same difference between cirrus and spectralis in crt [ 12 , 14 , 15 ] . the gcipl average in early glaucoma patients from these studies ( 69.7 m ) is comparable to our study average ( 68.5 m ) . a comparison of layer segmentation reproducibility was conducted at the iowa university using cirrus and their own segmentation software . here , the overall average from cirrus gcipl was reported as 70.0 m ( sd 11.4 ) in glaucoma , which also did not differ much from the patient group average in our study ( cirrus ) . recently , martinez - de - la - casa et al . demonstrated that , using spectralis layer segmentation software , macular rnfl thickness was the only parameter to differentiate healthy subjects from glaucoma suspects . we have not found a study comparing spectralis and cirrus segmentation software , most probably because spectralis software was made commercially available only recently . the clear difference in macula thickness between octs could be explained analyzing the specific retina boundaries established by each manufacturer . while the inner boundary is always the vitreoretinal interface , the outer retinal boundary varies between manufacturers . for cirrus the outer boundary corresponds to the level of the interdigitations of the external layers of the photoreceptors in the retinal pigment epithelium ( verhoeff 's membrane ) , while in spectralis it is at bruch membrane [ 11 , 13 , 15 ] . nevertheless , the establishment of different boundaries for total macula thickness calculation can not explain the significant difference between gcipl thicknesses we found in this study . different image resolution , intrinsic reflectance , and analysis algorithms within each software may influence this calculation . we also can not exclude an influence from the different areas analyzed , that is , ellipsoid in cirrus versus the annular in spectralis . however both areas differ only slightly and include the highest density area for ganglion cells . while total macula thickness boundaries can be manually corrected in both cirrus and spectralis , individual layer segmentation correction is possible only in spectralis . we did not observe a significant difference in total macula averages before and after manual correction of inner and outer retinal boundaries in spectralis . this could be explained by the observation that , specifically for the internal limiting membrane and bruch 's membrane , delineation errors occurred mostly in the extreme periphery of the image slice . however , for the gcipl segmentation errors also occur within the 3 mm ring averages . thus gcipl layer segmentation corrections made in spectralis resulted in significantly different values , while values remained significantly higher than with cirrus . in addition , the same difference in thickness measure will impact less on the thicker total macula thickness but more on the thinner gcipl thickness . . a significant correlation between function ( global md ) and morphology ( mt [ 23 , 24 ] or gcipl [ 20 , 25 , 26 ] ) has been demonstrated previously . in agreement , despite the significant difference between cirrus and spectralis measurements , both octs demonstrated a significant positive association with global md . we are not aware of studies directly comparing the diagnostic performance between mt and gcipl in glaucoma . when compared to rnfl , mt had an inferior diagnostic performance in cirrus and in stratus [ 3 , 23 ] . in our study , even though we found no other studies directly comparing auc between mt and gcipl , the auc values found in this study are in accordance with findings from other studies using mt and gcipl [ 7 , 8 , 17 , 20 , 28 ] . though we found a significant difference between oct measurements , the small population analyzed here may limit our findings . also , stage of disease might influence results given that the relationship between structural and functional damage is still not completely understood . including in addition , knowing that age may influence our results , we adjusted all calculations for age . difference in gender distribution is also a concern : cohn et al . did not observe a significant difference between males and females when comparing total db from sap . total macular thickness is about 7.5 m thicker in men than in women . while age and sex differences should be considered when performing disease diagnostics , this is not the main scope of this study as we aimed to analyze measurements from two different octs within the same subject . once this is incorporated , comparison between deviation maps from these octs could contribute to understanding differences between calculations . finally , the spectralis segmentation software used here is a beta version . a definite version , without many changes , the significant difference between measurements from cirrus and spectralis octs does not allow free interchange of machines , for instance , in the follow - up of patients . in a clinical setting , clinicians must be aware that once you change the machine and software analysis , a new baseline for the patient is needed . nevertheless both machines showed similar capability of diagnostic performance in early glaucoma and also in their correlation to functional changes such as standard automated perimetry .

purpose . to compare two different spectral - domain optical coherence tomography ( oct ) systems in regard to full macular thickness ( mt ) and ganglion cell layer - inner plexiform layer ( gcipl ) measures and in regard to structure - function correlation when compared to standard automated perimetry ( sap ) . methods . seventeen primary open angle glaucoma patients and 16 controls ( one eye per subject ) were enrolled . mt and gcipl thicknesses were measured by cirrus and spectralis octs . octopus perimeter 101 ( g2 protocol ) reports sensitivity in mean defect ( db ) . differences between measurements were assessed with student 's t - test and bland altman . diagnostic performance was also compared between each parameter calculating the areas under the operator receiver ( roc ) . linear models were used to investigate structure - function association between oct and sap . results . disagreement between octs in both mt and gcipl values was significant . spectralis values were thicker than cirrus . average difference between octs was 21.64 m ( sd 4.5 ) for mt and 9.8 m ( sd 5.4 ) for gcipl ( p < 0.001 ) . patients differed significantly from controls in both octs , in both measurements . mt and gcipl were negatively associated with md ( p < 0.001 ) . conclusions . although oct values were not interchangeable , both machines differentiated patients from controls with statistical significance . structure - function analysis results were comparable , when either oct was compared to sap .

1. Introduction 2. Materials and Methods 3. Statistical Analysis 4. Results 5. Discussion

in order to introduce a new plant variety to the markets commercially , it is necessary to register a newly bred variety , which relies upon the results of dus ( distinctness , uniformity , and stability ) tests ; that is , for a new genotype to be registered as a commercial variety , it needs to be distinct ( d ) from all other released varieties , uniform ( u ) , and stable ( s ) for morphological and other evaluated traits [ 1 , 2 ] . therefore , dus test has been established to be the foundation of plant variety protection and also to identify a new variety from reference collection . the new variety should pass legal examinations to be commercialized and receive the certificate for the plant breeder 's rights , a part of which consists of dus tests according to morphological characteristics . the varieties to be assessed are increasing in number where their variability reduces , and the reference collections are expanding because of their internationalization , both of which result in the dramatic increase in expenses associated with these methods . moreover , the existing methods are time consuming , which have altogether led to more necessity for developing a substitutionary , less costly system . thus , the studies on the use of molecular markers in dus testing proving the expected capability of molecular markers have encouraged international union for the protection of new varieties of plants ( upov ) to contemplate the introduction of molecular markers to the dus testing system . nevertheless , before this decision could be made dus testing would benefit from the use as molecular markers that have been shown to be more rapid and cost effective in comparison with morphological traits . in several registration processes such as cultivar identification , primarily , studies were restricted to using the dominant type of markers [ 5 , 6 ] where continuous development of simple sequence repeat ( ssr ) markers has recently resulted in the prevalence of mentioned markers [ 2 , 3 , 7 ] . microsatellite markers have been characterized with multiallelic nature , codominance inheritance , and relative abundance as well as requiring small quantities of dna for amplification which have made these markers efficiently applicable in dus test of rice varieties [ 9 , 10 ] . upov has confirmed the application of ssr markers as one of the commonly practical molecular marker systems for the identification of plant varieties . this marker was previously confirmed to be applied to the distinction between plant varieties as well as complementary features in dus tests where microsatellites were used in dus tests on pepper , canola , and corn . in this study , the efficiencies of ssr markers were evaluated as complementary tools for the distinction of these varieties . in this study , 40 rice varieties consist of 27 varieties created in rice research institute of iran ( rrii ) and 10 local varieties from three regions of guilan , mazandaran , and isfahan in iran , and three international rice research institute ( irri ) varieties were used ( table 1 ) . fifteen seeds of each variety were selected and then 5 g of young and healthy leaves was used for dna extraction . the dna was extracted using the ctab method with minor modifications ( increasing extraction buffer density in two times and replacing mercaptoethanol ( 0.2 percent ) with dithiothreitol ( 30 mm ) ) . twelve pairs of ssr primers ( a pair of primers of each chromosome ) were selected from the panel of 50 from gramene database ( http://gramene.org/markers/microsat/50_ssr.html ) ( table 2 ) . it selected a pair of primers from a mitochondrial dna sequence ( drrcms marker ) ( forward : 5 acctttgggcgatggtt 3 ; reverse : 5 gggtttagagtcgccac 3 ) to detect the impurities in cms line ( ir58025a ) from its cognate isogenic maintainer line ( ir58025b ) which is a prerequisite to obtain pure seeds of hybrid rice as well . pcr reaction was carried out in a total volume of 15 l containing 3 l ( 25 ng ) of template dna , 1 l ( 0.66 mol / l ) primers , 1.5 l 10x pcr buffer , 1.5 l dntps ( 0.2 mmol / l ) , 1.2 l mgcl2 ( two mmol / l ) , 0.2 l taq dna polymerase ( 0.6 u/15 l ) , and 5.6 l ddh2o . an initial denaturation period of five min at 94c was followed by 35 cycles of 60 s at 94c , 30 s at 5666c , 120 s at 72c , and then five min at 72c for final extension . after amplification , the pcr products were separated on 6% ( w / v ) polyacrylamide gel and the frequency of microsatellite polymorphism was calculated based on presence ( 1 ) or absence ( 0 ) of common bands . the genetic similarity between varieties was calculated using the dice coefficient , and a dendrogram showing the genetic relationship of the 40 varieties was constructed using the unweighted pair group method with the arithmetic mean ( upgma ) features of the ntsyspc v2.02 statistical analysis package : ( 1)gdnl=2n112n11+n10+n01 . accordingly , n11 is the number of bands ( alleles ) in both individuals ; n00 is the number of bands ( alleles ) absent in both individuals ; n10 is the number of bands ( alleles ) in i , n01 is the number of bands ( alleles ) present in j , and n is the total number of all bands ( alleles ) . effective number of alleles ( ae ) in each ssr locus was calculated by the following formula : ( 2)ae=1pi2 , where pi is the frequency of ith allele for each locus . the polymorphic information content ( pic ) of microsatellite loci was calculated according to the following formula : ( 3)pic=1j=1npij2 , where pij is the frequency of the jth allele for ith marker and the summation extends over n alleles . moreover , the discriminative power of molecular markers ( dj ) and the best combination of microsatellite markers ( xk ) were estimated using the following steps and formulas . there are n(n 1)/2 different pairs in a set of n individuals . based on this , ci is the ith pattern of the given jth primer in which formula is ( 4)ci = pinpi1n1 . moreover , for the jth primer , cj is equivalent to the summation of the different ci for all i patterns generated by the primer : ( 5)cj=i=1ici=i=1ipinpi1n1 . therefore , the discriminating power of the jth primer and the best combination of k primers are equal to ( 6)dj1cj=1i=1ipinpi1n1,xknn12j=1kcj . the 12 microsatellite primers used for this study generated totally 83 polymorphic fragments with an average of 6.91 alleles per locus . among these markers , rm316 with 13 alleles and rm55 with three alleles had the highest and lowest variation , respectively . effective number of alleles was calculated from 2.44 ( rm161 ) to 9.52 ( rm316 ) with an average of 4.90 per locus . additionally , the pic was estimated from 0.52 ( rm161 ) to 0.9 ( rm316 ) with an average of 0.74 per locus . the discriminating power ( dj ) ranged between 0.57 ( rm161 ) and 0.93 ( rm316 ) with an average of 0.78 per locus ( table 2 ) . the most of microsatellite markers had a high pic and discriminating power . however , a few markers had a low range of pic and discriminating power such as rm55 and rm161 . our results agree partially with those of hashemi et al . , who utilized 10 microsatellite markers to characterize the genetic diversity in a group of 16 iranian rice hybrids . pic is regarded as one of the important features of the molecular markers and can be used to evaluate the differentiation ability of the markers . the range of similarity among varieties was from 0 to 1 with an average of 0.26 and variance of 0.063 for all microsatellite markers . similarity values in between varieties were 0 for 66 pairs of varieties ( supplementary file 1 ; see supplementary material available online at http://dx.doi.org/10.1155/2015/965073 ) and similarity value had been 1 just for one pair of varieties ( ir58025a versus ir58025b ) . ir58025a is a cms line , and , for detecting the cms line from its cognate , isogenic maintainer line ( ir58025b ) was used ; the polymorphism of a mitochondrial dna sequence ( drrcms marker ) between some of cms population and their fertile lines is verified in both lines ( figure 1 ) . dendrogram resulted from cluster analysis using upgma algorithm based on the dice similarity coefficient and could discriminate all varieties from each other except for two isonuclear lines ( ir58025a and ir58025b ) ( figure 2 ) . as a result , total microsatellite markers could detect most of the improved varieties ( group a ) from local varieties ( group b ) . however , sang - e - jo and hassan - saraie as local varieties stood with improved varieties in group a , because sang - e - jo and sepid - rood were used as recipient parents for ghaem-1 variety . as can be observed in the dendrogram , sang - e - jo , sepid - rood , and ghaem-1 have been in the same subcluster . these varieties are shafagh and kadous that improved from two irri lines as ir67015 - 94 - 2 - 3 and ir64669 - 153 - 2 - 3 , respectively . sazandegi , purified from lenjan local mass , and shiroudi improved by cross between deylamani as a local variety and khazar as an improved variety . consequently , jahesh stood with other varieties obtained from tarom such as tarom - jolodar , sang - e - tarom , and tarom - milad in group b , and sazandegi with lenjan and shiroudi with deylamani constructed identical subcluster in group b. there is an interesting result in the third group ( group c ) , in which three varieties , namely , tabesh , pouya , and parto , constructed the same subcluster with tarom - mahali . these varieties are mutant of tarom - mahali . although the rice varieties in this study were from different rice breeding programs in iran , microsatellite markers correctly grouped them depending on their respective group , local or improved varieties , in the dendrogram . , who analyzed 43 rice samples using microsatellite markers and obtained a similar classification of varieties according to their breeding programs . in addition , it obtained results from cluster analysis of each marker which have shown the ability of some of the markers as unique identification key for some of the varieties ( table 3 ) . for finding the best combination of markers that result in the obtained result of using all markers in discrimination of all varieties , first , markers were chosen one after another in a way to minimize xk , that is , the number of pairs of distinct varieties for each primary compound in each step . in the first step , rm316 was chosen which distinguished the highest pairs of varieties from each other among n(n 1)/2 pairs of varieties and made the amount of dj maximum . in the second step , the compound of each n 1 remaining marker with the chosen marker of previous step was tested in order to determine the most efficient compound that minimizes the amount of xk . in this step , compounding the rm271 with previous marker left the lower number of variety pairs undetermined . in subsequent steps , finally , adding rm154 to previous markers could decrease expected number of undetermined pairs of varieties calculated from 39.27 to 0.03 which should practically reach one pair of variety . there were 41 pairs of varieties nondistinct from each other in calculating similarity coefficient among varieties and then cluster analysis of varieties using rm316 that had the highest discriminating power ( 0.93 ) among markers . by adding consequent markers in accordance to distinguish the ability to this marker , the number of undistinguished pairs of varieties was decreased to one ( table 4 ) . reliable identification of similar varieties is so difficult in plant species by morphological characteristics alone , because morphological and physiological characteristics are limited [ 25 , 26 ] . accordingly , using molecular markers as additional information is inevitable in registering plant varieties considering their benefits . dna markers can be utilized to simply and rapidly detect varieties or approve the distinctiveness of a varietal impostor . for identification and characterization of rice varieties and the testing of hybrid rice lines , using sts and ssr markers was significantly easier than using typical grow - out tests that included growing plants to maturity and evaluating purity based on morphological characteristics [ 28 , 29 ] . also , microsatellite markers have been utilized in the previous same study to distinguish traditional rice ( oryza sativa l. ) varieties from each other in cuba . in this research , the results showed that microsatellite markers easily could be used for identification of rice varieties .

identification and registration of new rice varieties are very important to be free from environmental effects and using molecular markers that are more reliable . the objectives of this study were , first , the identification and distinction of 40 rice varieties consisting of local varieties of iran , improved varieties , and irri varieties using pic , and discriminating power , second , cluster analysis based on dice similarity coefficient and upgma algorithm , and , third , determining the ability of microsatellite markers to separate varieties utilizing the best combination of markers . for this research , 12 microsatellite markers were used . in total , 83 polymorphic alleles ( 6.91 alleles per locus ) were found . in addition , the variation of pic was calculated from 0.52 to 0.9 . the results of cluster analysis showed the complete discrimination of varieties from each other except for ir58025a and ir58025b . moreover , cluster analysis could detect the most of the improved varieties from local varieties . based on the best combination of markers analysis , five pair primers together have shown the same results of all markers for detection among all varieties . considering the results of this research , we can propose that microsatellite markers can be used as a complementary tool for morphological characteristics in dus tests .

1. Introduction 2. Materials and Methods 3. Results and Discussion

sequence - defined biopolymers , such as proteins and nucleic acids , incorporate backbone and side - chain constituents that endow these macromolecules with the ability to fold into well - defined secondary and tertiary structures . the complexity and functionality of these folded biopolymers has spurred intensive research toward a predictive understanding of the relationships between their sequences , structures , and functions . computational strategies to engineer proteins and nucleic acids have matured to the point where de novo design of elaborate new protein and nucleic acid structures can be conducted with some reliability . the development of computational tools for the design of proteins also provides a valuable blueprint for building analogous tools to enable design of other abiotic folded oligomeric systems , termed foldamers . a key component of many protein design programs is the discretization of side - chain degrees of freedom by representing side chains as conformational isomers , termed we describe general methods to build rotamer libraries for peptidomimetic foldamers , and apply these methods specifically to a family of peptoid foldamers composed of n - substituted glycine monomers . in this way , we aim to remove a fundamental roadblock and enable design methods for diverse foldamers incorporating abiotic monomer types . foldamers are a class of oligomeric molecules for which noncovalent interactions dictate the self - organization of stable secondary and tertiary structures . there is now a veritable bestiary of foldamer species and hybrids . a large community of researchers are actively developing functional peptoids to address a diverse set of goals . the intensity and diversity of these efforts punctuates the need for general computational tools to aid in the pursuit of many complex design tasks . in this study , we provide the computational tools and develop the theoretical background necessary to design the next generation of folded and functional peptoid oligomers . the solid phase submonomer peptoid synthesis protocol introduced by zuckermann et al . facilitates the introduction of a myriad of side - chain types by utilization of readily available primary amines as synthons . peptoids have been the subject of considerable research aimed at developing sequence structure as well as structure function relationships . these efforts have established that peptoids can populate a range of secondary structure types and that peptoids exhibit strong interactions between side chain and backbone degrees of freedom . despite the absence of stabilizing backbone hydrogen - bonds , peptoids have been shown to fold , and their folds can be predictably controlled by variation of the monomer sequence to achive a desired functionality . additionally , new native chemical ligation strategies have been developed to ligate peptoids to peptides . this ligation protocol will enable the synthesis of hybrid biomacromolecules aimed at achieving advanced functions . rotamer libraries are an essential part of the protein design toolbox . based upon the observation that protein side chains populate distinct areas of side - chain dihedral angle conformation space and that dihedral angle conformations are in some cases strongly dependent on the adjacent and backbone dihedral angles , side - chain conformations have been grouped together into bins that represent frequent rotational - isomers and given the moniker rotamer . for canonical amino acids ( caas ) , methods to find these regular clusters of conformations rely on statistical analysis of the protein data bank ( pdb ) . the large number of structures for each side chain across the spectrum of allowed backbone dihedral angles allows for the determination of relative rotamer energies by fitting a boltzmann distribution to the population of side - chain conformations . current rotamer libraries are backbone dependent : given and backbone torsion angles , the rotamer library specifies a set of allowable rotamers , the estimated probability of each rotamer , and some measure of the deviation within the cluster of similar conformations represented by that rotamer . enumerating the set of side - chain conformations and their likelihoods allows for rapid searching of low energy side - chain conformation in discrete steps . these libraries are key constituents in several structural bioinformatics approaches including methods for placing side chains on homology models , protein structure prediction , and protein design . statistically derived rotamer libraries are not feasible for systems with few experimental structures . in the case of peptoids , there are fewer than 20 experimentally determined high - resolution peptoid structures , the largest of which includes only 16 residues . this limitation necessitates the use of mm based force - field energy calculations and qm calculations to derive estimates for the relative conformer energies of peptoid foldamers . from these computed estimates , we can then establish a rotamer - like treatment of side - chain probabilities . previous attempts at developing rotamer libraries for noncanonical -amino acid and -amino acid side chains have also used mm - based force - fields . there are many conceivable algorithmic options to determine rotamer minima placement . in this study , we devised two distinct rotamer library development methods and find they achieve similar levels of quality in structure prediction and design task performance . we evaluated the quality of these rotamer libraries within the context of the molecular modeling suite rosetta . in addition to creating rotamer libraries for peptoids , we introduce several substantial modifications to the rosetta code to enable design with noncanonical backbone chemistry . rosetta was initially built to predict protein function , but has been expanded to include protocols for docking , protein design , rna structure prediction , and other macromolecular structure and design tasks . the code is widely distributed and used by more than 1500 research groups worldwide . by incorporating our work on peptidomimetic design into rosetta , we make available a large number of computational protocols for scoring , kinematics ( moving the backbone ) , docking , and optimization . this enables utilization of peptoids in existing rosetta design protocols , such as designing peptoid sequences to interact with proteins . below we describe the methods used for the creation of rotamer libraries , methods used to evaluate the assumptions made in utilizing rotamers , as well as methods used to characterize the performance of the resultant rotamer libraries . we have recently compiled a database of all high - resolution peptoid structures ( the peptoid data bank ) . we additionally included structures of peptoid / peptide hybrids bound to sh3 and ww domains . selection criteria and modifications to structures are detailed in the supporting information . in the set of oligo - peptoid structures , there are 9 different peptoid side chains , at 87 positions and with 93 unique conformations . four of the most commonly observed peptoid side chains ( nspe , 21 ; nmeo , 17 ; nphe , 15 ; ns1ne , 11 ) , making up 69% of unique conformations in the peptoid data bank , are described in the main body of the text and are shown in scheme 1 . side chains for which fewer experimental examples exist ( nary , 16 ; nrch , 5 ; npe , 4 ; n1nap , 3 ; nrpe , 1 ) are detailed in the supporting information . in addition to the 9 side chains mentioned above , we chose 45 side chains to include within the rosetta framework , based on their prevalence in the literature and the ease with which they could be incorporated into oligomers via standard synthetic routes . a full list of the 54 peptoid side chains that were incorporated into rosetta and for which we created rotamer libraries are shown in figures s1s7 . previous studies of oligo - peptoid structures have defined both atom names and dihedral angles in different ways . our choice of atom names was strongly influenced by peptide atom naming for compatibility with protein modeling programs and is similar to that used by huang and co - workers . whereas previous studies have defined the 1 dihedral angle relative to the preceding carbonyl carbon , rosetta requires that the atoms that define a dihedral angle be contained within the residue unit . we therefore deviated from past work by defining 1 with respect to the c1 atom ( c in peptides ) . our atom name and torsion angle naming conventions are shown for an nspe residue in scheme 2 . atom names shown as red italics in torsion angle definitions are atoms in the preceding ( ) or following ( ) residues in a oligo - peptoid chain and not shown in scheme . in our analysis of peptoid side chain conformations below , we use the rotamer notation originally set forth by lovell et al . for its clarity and brevity , where p is used to represent plus ( trans , 180 ) . for side chains with dihedral angles that are commonly found at angles other than 60 , 60 , or 180 , the angle is shown in the notation . when referring to the 1 rotamer wells , unless otherwise noted , we use m and p to refer to 90 and 90 , respectively ( e.g. , a side chain listed with a rotamer of mm would have a 1 dihedral angle near 90 and a 2 dihedral angle near 60 , while an m90 rotamer would have a 1 dihedral near 90 and a 2 dihedral near 90 ) . qm energy landscapes of 1 , n , and c as a function of the preceding- dihedral in the context of a tertiary amide bond ( tab ) model ( scheme 3 ) were computed . the tab model contains the minimum set of atoms needed to simultaneously describe the preceding- and 1 dihedral angle of an oligo - peptoid residue . all qm geometry optimizations and single point energy calculations of tab models were evaluated at the b3lyp/6 - 311+g(d , p ) level of theory using gaussian09 . atoms are named as in scheme 2 , and names shown as green italics represent atoms from preceding residues in a oligo - peptoid chain . two sets of tab models were constructed that combinatorially sample the dihedral angle and the 1 dihedral angle when the dihedral is in either a cis or trans conformation . the set of cis- input tab models sampled from 40 to 40 in 10 intervals . the set of trans- input tab models sampled from 140 to 140 in 10 intervals . both sets of tab model inputs sample the 1 dihedral angle through a full rotation in 10 intervals . two additional sets of tab model inputs were constructed to quantify the changes in the location of the energy minima . these additional sets sample the same cis and trans ranges but set 1 to 90 or 90. both sets of inputs were subjected to qm geometry optimization where only the dihedral angle values were fixed followed by a single point energy calculation . the calculations of the versus c and versus n energy landscapes are detailed in the supporting information . the results are shown in figures 2 and s8 . to compare the qm based energy landscape to the rosetta mm_std(34 ) ( a mm - based force - field ) based energy landscape , we calculated the energy landscapes for four of the most common side chains in the context of both backbone - independent ( bbi ) and backbone - dependent ( bbd ) model compounds ( scheme 4 ) . the bbi model was used to quantify the dependence of side - chain energy landscapes . models were initialized at 10 intervals for each angle , keeping and the other dihedral angles fixed . all other parameters were allowed to optimize . to further quantify the concerted effects that , , and might have on the energetic landscape , we repeated the dihedral scan on the bbd model system while keeping the , , and angles fixed at 0 , 90 , and 180 , respectively , as a majority of peptoid structures have these approximate backbone dihedral configurations . all qm geometry optimizations and single point energies were evaluated at the b3lyp/6 - 311+g(d , p ) level of theory using gaussian09 . similar energy scans were repeated with the same model compounds using the rosetta mm_std force - field without geometrical optimization . we have previously shown that using the mm - based mm_std energy function in rosetta , we can produce rotamer libraries for proteins and noncanonical -amino acids that are comparable to statistically derived rotamer libraries . to explore and compare the relative merits of context and scoring approximations we describe two methods : ( 1 ) quantum mechanically seeded ( qms ) : which uses a highly accurate qm based scoring function , but a minimal model of the peptoid backbone / environment , and ( 2 ) k - means clustering ( kmc ) : which uses a more efficient molecular mechanics scoring function , but more extensively explores a model of the peptoid backbone . both protocols require a residuetype parameter file that instructs rosetta how the side chain is allowed to move and how the energy of the residue is to be calculated . drew et al . the residuetype parameter file describes the atom names and types , the chemical connectivity of the side chain and an ideal internal - coordinate representation used when rosetta needs to create new instances of the side chain . a qm geometry optimization of a bbd dipeptoid , using gaussian09 at the b3lyp/6 - 311+g(d , p ) level of theory , is used to generate the idealized internal coordinates that serve as a starting point for the kmc and qms protocols . workflow for the k - means clustering ( kmc ) and quantum mechanically seeded ( qms ) rotamer library construction protocols . boxes shaded in green are qm geometry optimizations of backbone - dependent ( bbd ) or backbone - independent ( bbi ) models ; red , inputs to rosetta ; blue , geometry optimization using the rosetta mm_std energy function ; yellow , identification of local energy minima . our previously described rotamer library construction protocol was adapted for peptoids as shown in figure 1 . model system , a peptoid residue with an acetylated n - terminus and a n - dimethylamide c - terminus , has been previously used to examine backbone - side - chain interactions in peptoids as it mimics the environment of the side chain with its own backbone and the backbones of the preceding and following residues . the additional dependence of peptoid side chain conformations on the preceding- backbone dihedral angle necessitated modification to the protocol to sample and produce rotamer libraries that are dependent on the preceding- angle as well as and dihedrals . the and backbone dihedrals were sampled through a complete rotation in 10 intervals to produce 36 and 36 bins . in the set of rosetta compatible peptoid data bank structures , cis and trans preceding- backbone dihedrals were sampled between 30 to 30 and 150 to 150 in 10 intervals to produce 14 bins . a combinatorial sampling of all ,, bins yields 18 144 backbone bins . for each backbone bin , dipeptoids were constructed that combinatorially sample the side - chain dihedral angles . side - chain dihedral angles were sampled at user - defined sets of angles relating to the number of angles , the chemical connectivity and the expected number of rotamers ; typically 10 intervals ( e.g. , nspe has 36 1 and 36 2 samples to produce 1296 dipeptoids for each ,, bin ) . the set of minimized dipeptoids was then k - means clustered based on the similarity of the minimized side - chain dihedral angles . the final rotamers for a given backbone dihedral bin are the side - chain dihedral angles of the lowest energy dipeptoid from each cluster in that bin . the side - chain conformation of each final rotamer was sampled about the local minima until the energy increased by 0.5 rosetta energy units ( reu ) to obtain an approximation of the width of the local energy minima . this local energy minima width is used as a proxy for the standard deviation of the side - chain conformations in a single rotamer bin . we devised an alternative methodology to use qm energy scans of a bbi model of the peptoid side chains as shown in figure 1 . the minimum energy wells identified from qm energy landscapes were used as starting points for lower level mm optimization and energy evaluation on a bbd model system . the bbi model containing each side chain is initialized in gaussian09 into discrete intervals spanning the entire 1n ( where n is the total number of angles ) with a fixed backbone dihedral angle at either 0 for cis or 180 for trans conformations and allowed to geometrically minimize while keeping the dihedral fixed . the qm derived minima from those single point energy scans converge to small clusters . from each cluster , this set of angles for both cis and trans conformations serves as the complete set of bbi energy wells . the bbi energy well dihedral angle coordinates were then initialized onto the bbd model in rosetta in the same range of backbone bins as the kmc protocol . the bbi energy well coordinates were then minimized using the rosetta mm_std scoring functions and their relative energies were used to determine rotamer probabilities assuming a boltzmann distribution of the resulting energies . all geometry optimizations of the molecules in the bbi qm - derived minima scans were performed at the b3lyp/6 - 311+g(d , p ) level of theory . rotamer recovery benchmarks tested the performance of the two rotamer libraries at reproducing the low energy packed side - chain conformations observed in experimental structures in both the presence ( when applicable ) and absence of the symmetry related partner molecules in the oligo - peptoid structures . a rosetta protocol was written to carry out fixed - backbone side - chain repacking using the packrotamersmover followed by a comparison between the original and repacked side - chain conformations . the packrotamersmover simultaneously repacks all side - chain positions using a metropolis monte carlo simulated annealing procedure that attempts to find the lowest energy set of side - chain conformations given the current backbone conformation . calculations were performed with the ex1 , ex2 , and ex3 command line flags set to true ; and the extrachi_cutoff flag set to 0 . these flags force rosetta to sample 1 , 2 , and 3 rotamers at their mean one standard deviation at all positions . in order to model only side - chain conformations described by the rotamer library , the use_input_sc flag is set to false to exclude the experimentally determined side - chain conformation of the input structures in sampling . a residue s side chain is considered predicted correctly if the angle of the repacked model was within 20 of the position in the native structure . although peptoid oligomers can readily be synthesized to incorporate a wide diversity of side chains , there are only a handful of experimentally determined peptoid structures . there has yet to be a systematic analysis of side - chain conformations in all peptoid structures that explores side - chain conformations given all energetically feasible backbone conformations . additionally , to determine if a rotameric treatment of peptoid side chains is appropriate , it is necessary to establish that the dihedral angle values of the experimental side - chain conformations cluster and that there is a multidimensional interdependence between the locations and frequency of those clusters . here we briefly describe our results for a small set of side chains for which there are sufficient experimental data to allow for proper validation . following these case studies , first , we explore our ability to fit existing structures by quantifying the distance between experimental side - chain conformations and the corresponding closest rotamers in our library . second , we evaluate the performance of our rotamer library in the context of a peptoid design task by evaluating repacking of peptoid side chains within existing peptoid crystal structures . lastly , we evaluate our ability to model peptoid side chain conformation at an experimentally validated protein - peptoid interface ( in comparison to x - ray crystal structures of the interfaces ) . in all three cases , we achieved good performance for rotamers developed from both the quantum mechanically seeded ( qms ) and k - means clustering ( kmc ) methods . this strongly indicates that peptoid side chain conformations can be approximated by a rotameric treatment and that our rotamer libraries are suitable for several design tasks . peptoids , unlike peptides , have greater flexibility around , with some monomer types readily populating both cis and trans ( e / z ) angle conformations with a substantial range of deviation around the ideal angles of 0 and 180 for cis and trans , respectively . the rotation of the preceding- torsion angle has been both predicted and observed to alter the preferred 1 value , as well as pyramidalization of the backbone nitrogen ( n ) and backbone carbonyl carbon ( c ) atoms . to quantify the effect has on these side - chain conformations , and to justify development of a backbone dependent rotamer library that includes this additional dihedral angle variability , we explored the -dependent energy landscapes . in the development of rotamers based upon the tab ( scheme 3 ) , system we sought to ensure that rotamers developed using an inflexible amide bond model would be applicable for design in systems with slight deviations from ideal bond lengths , angles , and dihedral parameters . the rotamer libraries used by rosetta only include information about side - chain torsion angles with respect to the backbone torsion angle values . in order to use a rotameric treatment of peptoid side - chain conformations , the degrees of freedom that are not described in the rotamer library need to be relatively stable or invariant to perturbations of the backbone torsion angles . to verify that this was the case for peptoids , we quantified the relationships between the backbone dihedral angle and the 1 dihedral angle ( figure 2 ) as well as carbon ( c ) and nitrogen ( n ) dunitz amide bond puckering parameters ( figure s8 ) . from these energy landscapes , there are several notable dihedral angle dependencies . we found that the 1 rotamer energetic preferences for the tab model were most significant ( 0.5 kcal / mol ) at extreme dihedral angle deviations from planarity . the 1 dihedral angle minima as denoted by the solid and dashed lines ( figure 2 ) had notable ( 20 ) deviations from 90 and 90 , dependent upon the dihedral angle . this result confirms the necessity to develop rotamer libraries dependent on not only the and , but also on backbone dihedral angles , as the effects of deviations on 1 have now been quantified and have been found to be significant . the n and c dunitz parameters varied as a linear function of . these puckering trends are built into the 1 energy landscapes , resulting in the observation that even with extreme dihedral angles and deviation of the amide bond from planarity , the 1 energetic preferences vary by only 0.5 kcal / mol . this stability buttresses our confidence that idealized amide bonds are a reasonable starting approximation for -dependent peptoid rotamer libraries . from this result , we are confident that rotamer libraries that include an dependence will be able to accurately capture the energetic preferences of diverse peptoid oligomer species . energy landscapes were generated by fixing the dihedral angles of the tab model to simultaneously achieve the desired 1 or . cis- angles can be found on the left , trans- can be found at the right . crystal structure data are shown as circles and crosses for angles and parameters found in cyclic and linear peptoid structures , respectively . in the trans- energy landscapes , crystal structure values for the nary monomer are not plotted , as this parameter does not match the chemistry of the tab model system . the minimum energy parameters are plotted across the full range of values as well as for positive ( solid line ) and negative ( dashed line ) 1 values . all molecules were minimized and energies evaluated at the b3lyp/6 - 311+g(d , p ) level of theory , and heatmaps generated using the lowest energy for each plot as the zero kcal / mol baseline . we used two protocols to generate backbone dependent ( bbd ) rotamer libraries for peptoid side chains in order to enable comparisons between approaches for identifying rotamers , scoring conformations , and modeling backbone - side - chain conformation interdependence . the first protocol is a modification of the method previously published to calculate -amino acid side - chain rotamer libraries , referred to as the kmc method . it uses the molecular mechanics ( mm ) based rosetta mm_std energy function in the context of a bbd molecule to evaluate rotamer energies . previous studies using quantum mechanics ( qm ) have shown a complex interaction between the peptoid side chain and backbone . while qm is accurate , it is also computationally intensive and can not solely be used to create a full rotamer library or for side - chain repacking and design calculations . our second method is a new rotamer library creation protocol that uses input from qm calculations carried out on backbone - independent ( bbi ) molecules and is referred to as the qms method . the qms method then passes these qm - bbi minima to rosetta to estimate interactions with the backbone . thus , each method uses a different strategy to reduce the complexity of the problem and arrive at a protocol with computational efficiency sufficient to allow calculation of rotamer libraries for multiple side chains . there are more than 200 peptoid side chains that are synthetically feasible ; however , only 9 different side chains have been used in experimentally determined peptoid structures . it is therefore essential that both protocols are general methods that do not incorporate or require structural information from experimentally determined peptoid structures as training data . we tested these two methods to determine if our rotamers , in conjunction with the mm based rosetta mm_std energy function , could accurately capture the behavior of peptoid side chains to the extent required by tools developed for protein modeling . we show that the two methods , despite taking different approaches , ultimately find similar rotamers . a discussion of the rotameric states of the side - chain conformations observed in the current set of peptoid structures and how they compare to the side - chain conformations of the rotamer libraries produced here are included in the supporting information . additionally , an excerpt of the side - chain dihedral angles from the rotamer library are included in supporting information tables s1s4 . the energy landscape generated in the initial steps of the qms protocol uses the bbi model ( scheme 4 ) . this minimal model was chosen due to the fact that qms single point energy evaluation of the energy landscape including the backbone and torsions for all possible dihedral angles is computationally intractable . the reduced representation contains all of the side - chain atoms but only the torsion angle of the preceding residue . to investigate if this model is sufficient , we computed side - chain dihedral ( 1 and 2 ) energy landscapes of four common side chains with bbd dipeptoid models at common low energy backbone conformations using qm and the rosetta mm_std energy function and compared them to the landscape of bbi models ( figure 3 ) . most notable is the absence of the 1 minima near 90 that are present in the bbi model energy landscape but absent in the bbd energy landscape for the four common side chains . the absence is the result of steric interaction between the c1 of the side chain and the c atom of the backbone which has a fixed dihedral of 90. if the angles are fixed at 90 , we observe an absence of 1 minima near 90. these results can be rationalized by the similar repulsive effects observed in the syn - pentane model system . the loss of the 90 minima seen in the backbone - dependent energy landscapes is analogous to the repulsive effects observed in syn - pentane which has been extrapolated to explain forbidden rotamers at certain and dihedral angles of amino acids . additionally , the appearance of the m0 and p0 rotamers of nspe and nphe in the bbd molecule in peptoid structures indicates that the bbi screen is not always successful in capturing the complete ensemble of side - chain conformations observed in peptoid structures . the qms protocol is also limited to two angles , as a complete screen of side chains with many rotatable bonds is computationally intensive and often intractable with qm . differences between cis and trans bbi models show that while the relative energy varies , the location of the minima remain similar between the two ( figure s9 ) . the minima from the bbi model landscape found as small clustered circles in figure s9 are represented as large diamonds in the bbi portion of figure 3 . these minima are then initiated onto a bbd model and the model is allowed to minimize using linear gradient minimization and the rosetta mm_std scoring function . the diamonds on the bbd portion of figure 3 represent these minimized rotamer positions in the presence of the backbone model . it can also be observed that the qm and mm bbd energy landscapes closely resemble one another , with only minor differences . rosetta and other computational protein modeling packages use side - chain dihedral angles in rotamer libraries to discretize the search for low energy side - chain conformations ( protein repacking ) or sequences ( protein design ) for a given backbone conformation . an accurate rotamer library will contain side - chain dihedral angle values close to values observed in experimentally determined structures . rotamer libraries should be succinct for computational efficiency , but also sufficiently comprehensive to enable sampling of a large fraction of energetically accessible conformations . to test the completeness of the rotamer libraries produced by the kmc and qms rotamer library creation protocols , we carried out rotamer library coverage tests . these tests calculate the rmsd ( in degrees ) between the experimentally observed side - chain rotamer conformation and the closest rotamer in the given rotamer library . results of the rotamer library coverage tests for the four frequently observed side chains are shown in figure 4 and table 1 . results of the other experimental side chains are shown in figures s10s14 and table s5 . for comparison , these tests were additionally carried out for phenylalanine and methionine side chains in protein structures in the top 8000 data set using the dunbrack 2002 bbd rotamer library , tables 1 and s7 . fixed backbone rotamer energy landscapes for nphe , nspe , ns1ne , and n-(propyl)-glycine side chains in a backbone - independent ( bbi ) and backbone - dependent ( bbd ) context . crystal structure dihedral angle values are shown as circles and crosses for those observed in cyclic and linear peptoid structures , respectively . x - ray crystal dihedral angles for the different side chains are plotted only for the monomers in which the backbone dihedral angles were observed to be within 20 of the fixed backbone dihedral angles used in the energy landscape calculations . the minima from the bbi model landscapes ( figure s9 ) are represented as large diamonds in the bbi portion of the figure on the left . the diamonds on the right portion of the figure represent these rotamer positions in the context of the bbd model after rosetta mm_std energy function minimization . all landscapes underneath a qm header had energies evaluated at the b3lyp/6 - 311+g(d , p ) level of theory . heatmaps were generated using the lowest energy as each plot s zero kcal / mol and zero reu ( rosetta energy units ) baseline for qm and rosetta , respectively . for each of the four most frequent peptoid side chains , either the kmc or qms rotamer libraries contained rotamers with angles that are , on average , within less than 20 of experimental side chain values . for the nspe side chain , only the p90 and p0 rotamers are experimentally observed and accurately modeled by rotamers created with both the kmc and qms method . the experimental points occupy a wide energy valley that spans from a 2 of 90 to 30. the kmc method performs better than the qms as it is able to find a low probability rotamer in this valley while the qms method predicts p0 rotamers closer to a 2 of 30. for the nmeo side chain , the experimental conformations adopt the traditional m , p , and t positions . the 3 dihedral angle values did not form tight clusters in the kmc protocol ( data not shown ) . this results in a relatively large rmsd value ( table 1 ) despite 1 and 2 values being accurately predicted ( figure 4c ) . for the nphe side chains , the rmsd value for the kmc rotamers is just over the 20 threshold while the qms is significantly higher at 38. the bbi screen of the qms method misses the high energy m0 and p0 rotamers ( figure 3a ) , and the qms rotamer library does not include these conformations . the qm energy landscape with the backbone present shows an elongated energy valley for 2 ( figure 3a ) . the five experimental examples with 2 near 0 are missed by the qms method and contribute to the high rmsd in table 1 . the three experimental points near the m0 rotamer are also significantly different from the values in the kmc library . deviations in 1 can arise from pyramidalization which can greatly affect the positioning of the atoms making up the 1 dihedral angle , potentially influencing the 1 calculated value . when the experimental points with a 2 near 0 are omitted , the qms rotamers have almost the same rmsd to the experimental values as the kmc rotamers for m90 and p90 rotamers ( 18.25 and 18.71 , respectively ) . for the ns1ne side chain , both the kmc and qms protocols perform as well as the dunbrack 2002 library for protein data . the large steric bulk of the naphthyl group interacting with the c2 atom of the ns1ne side chain and peptoid backbone restricts the allowed conformations of the side chain . only the pp rotamer is observed in the experimental data set , and both methods predict this rotamer accurately . with few exceptions , rotamers observed in peptoid structures are found in the rotamer libraries produced by both methods . both the kmc and qms protocols produce similar rotamers with similar dihedral angles . the kmc protocol suitably evaluates longer side chains and is able to find side - chain conformations that involve backbone interactions such as the nphe rotamers with 2 near 0. the dunbrack 2002 rotamer library for the 20 canonical peptide amino acids performs better than our rotamer libraries perform on peptoid side chains . however , compared to the top 8000 data set , there are far fewer examples of peptoid structures than protein . additionally , the data set employed for the protein comparison is heavily pruned to only include the highest quality structures available ; an option we do not have for peptoids . we investigated if the combination of the peptoid rotamer libraries and the mm_std scoring function have sufficient discriminatory power to recapitulate the side - chain conformations in the experimentally determined structures . we therefore undertook side - chain conformation recovery benchmarks similar to those employed in the early development of protein design methodologies . all non - hydrogen atoms in the monomer were used to calculate the rmsd . positions from the top 8000 data set with less than eight neighbors ; two residues are considered neighbors if their neighbor atoms ( c for glycine , c for all others ) are within 10 of each other . rotamer library coverage plot for nphe , ns1ne , nmeo , and nspe peptoid side chains . interpolated torsions and standard deviations of the closest rotamer in the rotamer library based on the backbone dihedral angles of each experimental point are shown as crosses , where the center of the cross is at the mean and the length represents 1 standard deviation . rotamers for the k - means clustering ( kmc ) method are shown as red crosses and quantum mechanically seeded ( qms ) method are shown in blue . each example in the set of rosetta compatible peptoid structures was repacked with rosetta using rotamer libraries from the kmc and qms protocols and in the presence ( where applicable ) or absence of crystal contacts from symmetry related partners . the predicted side - chain dihedral angles of the repacked structures were compared to those in the experimental structure . a angle is judged to be correctly predicted ( recovered ) if it is within 20 of the experimental value . results of the rotamer recovery benchmark in structures containing only peptoid residues are shown in table 2 and figure 5 . rotamer recovery rates in proteins improve with additional context about the environment the side chain is in . for surface positions , that additional context can be provided by the atoms from neighboring chains in the symmetery related cyrstalographic neighbors . the surrounding atoms in a protein s core also provide additional context and can help determine correct rotamer position . previous studies on proteins found that rosetta achieved an over all rotamer recovery of 75% for 1 and 53% for 1 + 2 using the mm_std energy function and the dunbrack 2002 rotamer library . a recovery of 59% for 1 and 37% for 1 + 2 was achieved for surface positions , and a recovery of 91% for 1 and 71% for 1 + 2 was achieved for core positions using the same energy function and rotamer library . the increased recovery of protein cores strongly suggests that , for a given position , the influence of surrounding side chains can enhance the discretization of low energy side - chain conformations . in the currently available set of peptoid structures , the number of neighbors a given side chain has is more comparable to the surfaces rather than cores of proteins . both the kmc and qms rotamer libraries are able to correctly predict the 1 conformations of more than 60% of peptoid positions both in the absence and presence of crystal structure contacts ( table 2 ) . the kmc and qms rotamer libraries achieve rates of peptoid side - chain recovery comparable to the recovery rate of the dunbrack 2002 library for protein side chains at surface positions . percent rotamer recovery absent crystal contacts totals have been adjusted to account for structures determined by nmr . our ability to recover correct rotamers is dependent on the quality of the rotamer library coverage . the 12ac1 - 9-c structure , an nspe 9-mer , has the highest rate of side chains recovered ( figure 5 ) because the rotamers produced by the kmc and qms protocols have a low averaged rmsd compared to the experimental side chain conformations for nspe ( table 1 ) . in contrast , the 12ab4 - 16-m structure contains only nmeo and nary side chains and has the lowest fraction of rotamers recovered in the set . the rotamer library coverage for the nmeo and nary side chains is more complete relative to nspe ( tables 1 and s5 ) , and the effect is that we poorly predict the side - chain conformations within the 12ab4 - 16-m structure . to get a better understanding of how rosetta will behave in repacking a peptoid side chain in the core of a globular protein or buried at protein protein interfaces , we carried out rotamer recovery benchmarks in the context of the neighboring peptoid molecules in the solid state defined by the crystallographic symmetry transformations ( table 2 ) . the addition of crystallographic partners has been shown to increase the rate of rotamer recovery at protein surface positions . although not a perfect analogue of a protein s hydrophobic core , increasing the number of neighboring residues through the addition of crystal contacts reduces the number of conformations assessable to the given peptoid position . additionally , crystal contacts can direct the side chain into conformations that are lower in energy as a result of the additional contacts . this allows rosetta to choose a rotamer closer to those observed in the crystal structures . for example , nspe-4 and nspe-8 monomers in the peptoid data bank structure 12ac1 - 9-c are both correctly predicted by both the kmc and qms rotamer libraries . however , the angles of the selected conformations are closer to the values in the experimental structure when crystal contacts are included in rotamer repacking . this effect is highlighted in figure 5 with the side - chain conformation predicted with crystal partners ( red ) closer to the experimental conformation ( gray ) than without the crystal information ( blue ) . there are currently too few structures to determine if crystal contacts direct side chains into off - rotamer conformations . however , for the two available nmr solution structures , rosetta has a 1/2 recovery of 67%/75% for kmc and 80%/75% for qms . our ability to accurately model peptoid side chain conformations with a rotameric treatment in rotamer recovery benchmarks supports the notion that peptoids are indeed rotameric . like peptides , each peptoid side chain is rotameric at varying levels as a result of complex side chain to backbone intraresidue and steric interactions . overall , we find that the currently available set of experimental side - chain conformations are sufficiently modeled with our predicted rotamer conformations . to more thoroughly evaluate the degree to which peptoids are rotameric will likely require additional peptoid structures with greater numbers of side - chain - side - chain contacts , tighter packing , and a more diverse palate of side chains . however , with the currently available set of rosetta - compatible peptoid data bank structures , we find that experimental side - chain conformations cluster well and that those clusters correspond to minima found in qm and rosetta mm_std energy landscapes . it is clear that some rotamers will simply not be observed due to steric clashes with the backbone ; other predicted rotamers have not been observed due to the small size of the current database of peptoid structures . this initial study indicates that similar to peptides , peptoids also exhibit rotamer preferences . furthermore , this finding suggests that protein modeling tools can be readily adapted to accommodate them . nguyen and co - workers have deposited three structures of sh3 domains bound to inhibitory peptides in which each peptide has a single proline position mutated to a different peptoid side chain . these three structures provide us an opportunity to test our ability to recover native rotamers in hybrid design contexts . structure 1b07 contains two chains ( labeled a and c in the deposited structure ) , while 2sem and 3sem contain four chains each , two pairs of protein / peptide interactions ( a / c and b / d , respectively ) . as with the rotamer recovery of the oligo - peptoid structures , each structure here was repacked and the side - chain dihedral angles were compared to those in the experimental structure . results of the rotamer recovery benchmark in structures of peptoid / peptide hybrids are shown in table s9 and figure s15 . rosetta is able to recover the rotamers of the 1b07 and 2sem structures using both the kmc and qms rotamer libraries . we are not able to recover the rotamer of the peptoid side chain from the 3sem structure . rosetta places the side chain in an alternative conformation ( data not shown ) . the peptoid side chain in the 3sem structure branches at the second side chain atom and makes few contacts in the crystal structure . additionally , the average b - factors of the atoms in the 3sem side chains are greater than 40 , indicating uncertainty in the exact position of the peptoid side chain in this experimental structure ( table s9 ) . for these reasons we exhibit good performance for both structures with well - resolved peptoid side chains , but recognize that the small sample size prevents us from generalizing further . we present a general method for creating rotamer libraries needed for rational design of peptidomimetic oligomer structures . we apply this method to the peptoid backbone and show performance is comparable to protein side - chain rotamer libraries derived from statistical analysis of the protein data bank ( pdb ) for protein surface positions . this pipeline relies on mm and qm simulations in lieu of statistical analysis because far fewer crystal structures of peptoids exist than for proteins . given the reliance on physics - based methods , we expect this method can be applied to several other diverse peptidomimetic scaffolds ( such as -peptides , d - amino acid , and hybrid oligomeric systems ) . a notable advantage of this method is that it can be used to build rotamer libraries for any specified side chain . this is demonstrated by the development of rotamers for over 50 peptoid side chains ( shown in figures s1s7 ) that are capable of being incorporated via standard peptoid synthesis protocols . peptoid data bank structure 12ac1 - 9-c and side - chain conformations after being repacked with ( a ) kmc rotamer libraries or ( b ) the qms rotamer libraries . experimental side - chain conformations are shown in gray , repacked side chains in blue , and repacked in the context of the symmetry related crystal partners in red . positions for which the same rotamer was chosen in both contexts are shown in purple . comparisons between qm evaluations of peptoid side - chain conformations and our rotamers show good agreement between the qms and kmc rotamer library construction pipelines . our comparisons with qm suggest we capture key features of the side - chain conformational landscape . we also find agreement with the side - chain conformations observed in x - ray crystal and nmr structures of peptoid oligomers ( figure 4 ) . there are currently too few experimentally determined peptoid structures to derive peptoid rotamer libraries by statistical analysis . the currently available peptoid structures are of small oligomers ( < 20 residues ) and are dominated by crystal contacts and local structure interactions ( comparable to protein surface positions ) . we show that our rotamers agree with experimental side - chain conformations with rmsd values comparable to best - in - class protein rotamer libraries for -amino acids at surface positions ( figure 4 and table 1 ) . a large number of modifications to the rosetta design framework were required to enable peptoid design with these rotamer libraries ( described in the supporting information ) ; most notably , allowing for the use of bbd rotamer libraries that include preceding- in addition to and . these modifications to the rosetta design procedure allowed us to evaluate our performance on repacking tasks , and again we find that these rotamer libraries will be sufficient for peptoids and hybrid peptoid - protein design tasks ( such as designing peptoids to interrupt protein protein interfaces ) . despite the rosetta energy function being optimized for biological molecules in aqueous media , it performs surprisingly well at reproducing the side - chain conformations of relatively short oligo - peptoid structures in nonaqueous media . this indicates that the side - chain conformations of peptoids are primarily determined through local interactions . adding peptoid design capabilities to rosetta allows access to kinematics , optimization , and scoring methods that enable a vast array of design and modeling tasks for peptoid , peptoid these rotamer library development methods are also extendable to other noncanonical backbones and peptidomimetic scaffolds . future work will include adding capabilities to model and design several other peptidomimetic oligomer scaffolds . a key remaining challenge not addressed here , is to model mixed oligomeric systems such as oligomers containing -amino acids and peptoids . additional study is required to determine if rotamer libraries derived individually for peptoid and -amino acids will perform well in these hybrid settings . in cases where a peptide side chain precedes a peptoid side chain , both side chains would be separated by only two bonds along the backbone and we speculate that this mixed system would require rotamer libraries specific to the joint between the two oligomeric systems . for cases in which peptoid side chains are n - terminal to peptide , the proximal side chains will be separated by four bonds and it is likely that the rotamers derived in this study would perform well in this mixed setting . other key areas for future work include the need for developing better methods to estimate the unfolded state energies ( sometimes referred to as the reference energy ) as well as new methods for dealing with larger side chains . as we design , build , and refine peptoids , we will increase the diversity and number of structures and thus increase our ability to score and judge peptoid designs . we thus intend to bootstrap our way toward design capabilities for both peptoid and mixed protein peptidomimetic systems that approach pure protein design in accuracy and breadth of application .

peptoids are a family of synthetic oligomers composed of n - substituted glycine units . along with other foldamer systems , peptoid oligomer sequences can be predictably designed to form a variety of stable secondary structures . it is not yet evident if foldamer design can be extended to reliably create tertiary structure features that mimic more complex biomolecular folds and functions . computational modeling and prediction of peptoid conformations will likely play a critical role in enabling complex biomimetic designs . we introduce a computational approach to provide accurate conformational and energetic parameters for peptoid side chains needed for successful modeling and design . we find that peptoids can be described by a rotamer treatment , similar to that established for proteins , in which the peptoid side chains display rotational isomerism to populate discrete regions of the conformational landscape . because of the insufficient number of solved peptoid structures , we have calculated the relative energies of side - chain conformational states to provide a backbone - dependent ( bbd ) rotamer library for a set of 54 different peptoid side chains . we evaluated two rotamer library development methods that employ quantum mechanics ( qm ) and/or molecular mechanics ( mm ) energy calculations to identify side - chain rotamers . we show by comparison to experimental peptoid structures that both methods provide an accurate prediction of peptoid side chain placements in folded peptoid oligomers and at protein interfaces . we have incorporated our peptoid rotamer libraries into rosetta , a molecular design package previously validated in the context of protein design and structure prediction .

Introduction Methods Results Discussion

malaria remains a serious global health problem , killing more than one million people per year . the number of malaria cases has fallen by more than 50% in 43 countries over the past decade . a modeling analysis of malaria prevention activities in 34 african countries suggested that about 730,000 lives were saved between 2000 and 2010 , with nearly three quarters of those since 2006 . funding commitments for malaria have increased nearly 15-fold , from approximately us$ 100 million in 2003 to nearly us$ 1.6 billion in 2010 ; interest and commitment at global and country levels are very high . however , the problem of malaria parasite transmission remains enormously grave in sub - saharan africa where at least 85 to 90% of deaths are attributable to the disease [ 47 ] . malaria transmission is driven by a complex interaction of the vector , parasite , human host , and the environment , and is governed by different ecological and social determinants [ 8 , 9 ] . globalization and urbanization with their inherent developmental activities and associated ecological transformations have a significant impact on malaria epidemiology [ 10 , 11 ] and have invariably exacerbated the situation . malaria transmission depends markedly on local environmental conditions and other compounding factors , that is , presence of drug - resistant parasites and insecticide resistant vectors [ 12 , 13 ] , environmental changes , economically driven human population increase and migration , poverty levels , climatic changes , natural disasters and political upheavals , adaptability of malaria vectors to changing environments [ 17 , 18 ] and limited investment in research , drug discovery , and optimisation of malaria vector control programmes . transmission patterns and severity of malaria are influenced by the geographic attributes and the socioeconomic environment that vary significantly by city , season , and age group . accordingly , entomological profiles and clinical patterns are known to vary between urban , periurban , and rural environments . well - developed urban areas are mostly fringed by underdeveloped and inadequately serviced periurban areas experiencing the highest population growth rates and often lacking infrastructure . malaria transmission in peri - urban areas is mostly ascribed to increased vector breeding created by the agricultural and construction activities , lack of drainage of surface water [ 18 , 22 , 23 ] , human vector contact due to poor housing and overcrowding , and low immunity in children under five and pregnant women , thus increasing the risk of severe disease . in zambia , between 1950 and early 1980s , vector control reduced malaria cases to a notifiable disease in most urban areas . ngandu and coworkers reported the resurgence of malaria cases in urban and peri - urban lusaka . in vivo sensitivity tests were also conducted with plasmodium falciparum patients in lusaka , but whether these infections were acquired in urban lusaka itself or in rural areas was not clear . owing to malaria cases resurgence and paucity of entomological data , specific local investigations to appraise and confirm malaria transmission in peri - urban lusaka were required before approaches to malaria vector control could be considered . we report here on malaria vectors , parasite prevalence rates in febrile patients and knowledge and attitudes of the community pertaining to malaria , precedent to the implementation of the integrated vector management ( ivm ) strategy . zambia is a landlocked country in southern africa with an estimated population of 13 million people , 45% are children below 15 years of age . malaria is endemic across the entire country with transmission peaks coinciding with the rainy season from november to april . this study was conducted in two spatially segregated and randomly selected peri - urban locations of lusaka district ; chazanga and kalikiliki ( figure 1 ) during the cold - dry season from may to july 2003 . the two sites have similar ecological characteristics and stretch out in an epidemiological zone characterized by low malaria transmission . mosquito larvae were collected from breeding sites using who - standard 250 ml dippers , transported to the insectary at the national malaria control centre in lusaka , and reared to adults while being fed on 1 part yeast and 2 parts dog biscuit . adults were maintained on 10% sugar solution at 25 2 centigrade temperature and 7080% relative humidity . mosquito breeding sites were characterized into three different categories : transient , semipermanent , and permanent . transient breeding site refers to temporal water collections , semi - permanent ones are those that would persist for a considerable period of time . adult mosquitoes were collected by the pyrethrum spray catch ( psc ) between 06:00 hrs and 08:00 hrs in randomly selected households . anopheles mosquitoes were identified morphologically using standard keys for anophelines of southern africa [ 29 , 30 ] and to species by the polymerase chain reaction ( pcr ) molecular method of scott et al . . plasmodium falciparum infection was determined among febrile patients at health facilities in the study sites . blood from randomly selected subjects who presented to the health center with febrile symptoms and consenting to participate was screened for parasite species and gametocytes by microscopy using 4% giemsa thick and thin blood smears for 30 minutes . the age range of subjects was stratified into three age categories : 6 months < 5 , 5 to < 15 , and 15 years and over . participants with positive slide tests were offered free treatment with artemisinin - based combination therapy ( act ) according to zambia national malaria control programme treatment policy guidelines . a pretested structured questionnaire was administered to 150 randomly selected respondents , tested for malaria , to determine community knowledge and attitudes as regards malaria , family demographic data , and possibility of malaria importation from rural areas . data was collected and entered in excel spread sheets ( microsoft corporation ) and statistically analyzed by employing epi info version 3.2.2 . the chi - square ( ) test was used to determine the differences in parasite prevalence between age categories . ethical approval for the research a freely administered informed consent was given to respondents and householders for participation in the study . of 1840 larvae collected , 66% ( 95% ci : 65.768.1 ) were from transient ( gardens and abandoned building foundations ) , 28% ( 95% ci : 25.629.6 ) semipermanent ( abandoned shallow wells and ditches that followed in the wake excavations for building sand or quarrying ) and 6% ( 95% ci : 5.47.7 ) permanent water bodies ( perennial streams and dams ) ( figure 2 ) . the density of anopheles larvae was comparatively higher in semipermanent ( 31.7% ) followed by the permanent ( 25% ) and transient habitats ( 17.5% ) ( figure 2 and table 1 ) . anophelines constituted 12.83% ( 95% ci : 8.717.9 ) of the 203 adult mosquitoes collected ( table 1 ) . the mosquito male - to - female ratios and densities per room was 0.59 to 0.26 and 1.7 to 15 for anopheles and culex , respectively . all specimens from kalikiliki ( n = 11 ) and chazanga ( n = 7 ) , amplified for an . gambiae ss . and only 1 from chazanga amplified for an . arabiensis ( figures 3 and 4 ) . a total of 297 randomly selected febrile patients were recruited into the study ( table 2 ) . seventy - six ( 25.6% ) were positive for malaria parasites with 100% plasmodium falciparum parasite monoinfection . among the positive slides , 75 ( 98.7% ) exhibited ring form trophozoites and only 1 ( 1.3% ) showed gametocytaemia . the parasitemia in febrile patients per age group was 31.8% ( 95% ci : 23.242.2 ) for the 04 years group , 25.7% ( 95% ci : 13.541.3 ) for 5 to 15 years , and 23.3% ( 95% ci : 17.429.6 ) for the 15 years and over ( p > 0.05 ) . of the 150 respondents 18% ( 95% ci : 12.424.6 ) were male and 82% ( 95% ci : 75.487.3 ) were female . sixty - two per cent showed awareness of what to do when they suspected malaria and only forty - six per cent were knowledgeable about vector control interventions . family demographic data showed an average of seven residents with at least one child under five years per household . there was positive association between knowledge and malaria prevalence in peri - urban lusaka ( p < 0.05 ) . funestus [ 34 , 35 ] , with great divergence in their malaria transmission potential , spatial segregation , and temporal heterogeneity [ 36 , 37 ] . the pioneering malaria control efforts in the country [ 38 , 39 ] stimulated unprecedented enthuse in entomological studies [ 36 , 4044 ] . rivulorum although their role in malaria transmission in zambia is yet to be established . urban areas are perceived not to support significant levels of malaria transmission . in this study , three kinds of mosquito breeding habitats : transient , semipermanent , and permanent were characterized with appreciable spatial heterogeneity ( figure 2 ) . gambiae is known to exploit small open temporal habitats with less predation , increased warmth , and more algae . however , more anopheles larvae were collected from semipermanent habitats than from permanent and transient habitats ( figure 2 and table 1 ) . this could explain the role of urban development related activities in supporting high malaria transmission levels as observed in peri - urban lusaka . while formal urban development typically reduces mosquito densities , informal urbanization has been shown to alter the vector species composition within the an . gambiae complex in sub - saharan africa , . to illustrate , earlier studies conducted in zambia indicated 100% an . nevertheless , the profound demographic and extensive environmental changes that have followed in the wake of urbanization have changed the stratification of the vectors . gambiae ss . validates the premise that informal urban development does transform vector species composition . arabiensis , a species that is typically difficulty to control by irs and itns , and the predominance of the an . gambiae ss . which is characteristically amenable to control by irs and itns could have implications for the malaria control programme . the sympatric - existence of these vectors demonstrates the need for an integrated approach for malaria vector control . this study was characterized by low number of mosquito collections due to the unfavorable prevailing environmental conditions during the cold season , lack of data on chromosomal forms of an . transmission determining parameters , that is , vector infectivity . however , early entomological work in zambia reported a sporozoite rate of 1.4% in an . notably , there is still a clear paucity of data on malaria vector bionomics in the country . malaria had been known to be hyperendemic in hot riverine valleys with perennial transmission , meso - to hypoendemic on plateaus , and hypo - endemic in urban areas of zambia . between 1969 and 2000 , parasite rates ranged from 2.0 to 26.4% across the country , with parasite species of 86.8% p. falciparum and 13.2% p. malariae in ndola rural . by 1999 , parasite species was over 97% p. falciparum . these findings are corroborated in this study with 25.3% parasitaemia among febrile patients with 100% p. falciparum monoinfections . this upsurge of frequency of febrile malaria was further aggravated by the development of chloroquine resistance . deployment of effective control tools has transformed the epidemiological profile from countrywide high endemicity to three distinct epidemiological strata : very low transmission and parasite prevalence of < 1% , low transmission ( < 10% ) , and persistent high transmission ( > 20% ) . the prevalence rate of malaria in children under five years is dependent on the intensity of transmission and declines with age as immunity develops and is thus a good indicator of a recent transmission of malaria . the highest prevalence of malaria in zambia occurs in this age group across the country . in this study , frequency of febrile malaria was highest ( 31.8% ) in the 04 years age group and lowest ( 23.3% ) in the 15 years and above group . there was no significant difference in parasitaemia in febrile patients of the three age categories ( p > 0.05 ) suggesting a nonimmune population and an area of low transmission . the above 10% parasitaemia observed in children under 5 years of age confirmed that malaria had again become endemic in peri - urban lusaka . the knowledge and attitudes survey indicated the need for intensified information , education and communication ( iec ) on malaria and its prevention . the 46% knowledge level on vector control interventions indicated a weakness in individual efforts to prevent the disease . population expansion and its health impact has been epitomized by sub - saharan africa . in many malaria endemic countries , including zambia , the population has doubled in the past two decades , thus greatly increasing the absolute numbers of those at risk . this was demonstrated in peri - urban lusaka where family demographic data showed an average of seven residents with at least one child less than five years per household . thus , suggesting that congestion in households was probably one of the factors contributing to the increased transmission of malaria in these settings . it has equally been established that human migration contributes markedly to malaria transmission . in areas of endemicity , encroaching transmission has been demonstrated in areas previously free of transmission and local transmission has been conclusively demonstrated in many african cities [ 55 , 56 ] . these findings are corroborated in this study which confirmed local transmission in lusaka as 80% subjects with definitively diagnosed malaria had no history of travel . it was established that there is no significant contribution of migration towards malaria transmission in peri - urban lusaka ( p > 0.05 ) . local transmission of malaria was further strongly inferred by high parasitaemia in children under the age of five and the presence of gametocyte bearers and efficient vectors in the community that perpetuated the transmission cycle . congestion in households together with the appreciably low levels of knowledge on control and prevention compounded the situation . the pragmatic data reported on here was an essential prerequisite of evidence - based and effective vector control efforts . the high malaria infection rates in peri - urban lusaka could be ascribed to the definitively demonstrated local transmission . gambiae complex species and characterization of their breeding attributes required an integrated vector management ( ivm ) approach to effectively control transmission . it is noteworthy , that this preintervention study had limitations as the surveys were conducted during the dry season which markedly influenced the malaria vector and parasite populations . clearly , the malaria epidemiology in peri - urban lusaka required an integrated approach involving irs and itns against the adults and larval source management ( lsm ) against the aquatic stages . information education and communication ( iec ) to increase awareness and knowledge about malaria vector control needed to be intensified . following this study , ivm was introduced in lusaka with irs and itns as main thrust interventions and iec has been strengthened . this has reduced malaria parasite rates to appreciably minimal levels ( < 1% ) . to clear the residual transmission , lsm is being implemented in lusaka . while monitoring and evaluation of vector control interventions has been strengthened , it is imperative that a comprehensive entomological and epidemiological surveillance system is established to detect any increase in the malaria case load .

globalization and urbanization with their inherent developmental activities and ecological transformations impact on malaria epidemiology . entomological factors involved in malaria transmission in periurban lusaka were assessed prior to vector control reintroduction . data was collected through standard entomological and epidemiological protocols and a pretested structured questionnaire . larval habitats were characterized as transient ( 43% ) , semipermanent ( 36% ) , and permanent ( 21% ) . anopheles arabiensis and an . gambiae ss . were the only vectors identified . a shift in vector population was noted , with the later outnumbering the former . plasmodium falciparum monoinfection rates were 25.6% ( 95% ci : 20.930.7 ) ( n = 297 ) . parasitaemia was 31.8% ( 95% ci : 23.242.2 ) , 25.7% ( 95% ci : 13.541.3 ) , and 23.3% ( 95% ci : 17.429.6 ) in under 5 , 5 to 14 , and above 15 age groups , respectively . low knowledge levels on vector control tools with an average of 7 residents per household were also observed . this study confirmed a local malaria transmission paradigm . the epidemiology necessitated deployment of an integrated vector management strategy with intensified information education and communication .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

hydrocephalus refers to the accumulation of excessive cerebrospinal fluid ( csf ) within the brain or cranial vault . medical treatment of hydrocephalus , which aims to reduce csf production , is usually only palliative . surgical shunting of csf from the ventricular system to another body cavity , usually the peritoneum and less often the right atrium , is the gold standard treatment in people , and can provide a superior long - term prognosis . ventriculoperitoneal shunt ( vps ) placement is the most commonly utilised surgical procedure in human and veterinary patients with hydrocephalus . despite this , complications following vps surgery are common , with failure rates in people of up to 50% within the first year . mechanical failure remains the most common cause of vps malfunction in people , with shunt obstruction being the leading cause ( 46% ) , followed by shunt disconnection , infection ( with reported rates of 410% and 7.6% ) and over - drainage . recent veterinary studies have reported complication rates of 22% , 25% and 29% . in one study , shunt occlusion and infection occurred in 11% and 8.5% of animals , respectively , although the patient numbers were vastly lower than those in human studies . retrograde migration of the peritoneal catheter ( pc ) to the ventricle , the subgaleal space and the subcutaneous tissues of the head , neck and chest , often with coiling of the catheter in areas of loose skin , has been described in several human case reports , although this remains a much less common mechanical complication . martinez - lage et al reported an incidence of 0.6% in 500 human shunt procedures , and sayers reported pc migration resulting in shunt malfunctions in only 3/1390 cases . there is very limited literature regarding postoperative complications of vps in veterinary patients and a distinct lack of information regarding the incidence of retrograde migration of the pc , especially in cats . to our knowledge only a single case report exists in the japanese veterinary literature , describing pc migration to the subcutaneous tissue of the dorsal chest in a cat and drainage tube obstruction 5 years postoperatively in another cat , along with a further report describing multiple episodes of kinking of the pc in a cat . this case report describes the retrograde migration and subcutaneous coiling of the pc of a vps , detected 72 h following percutaneous aspiration of a vps - associated seroma in a cat with non - communicating , unilateral hydrocephalus . a male neutered domestic shorthair cat , aged 4 years and 10 months , was presented with a 3 week history of episodic , anticlockwise circling . neurological examination revealed mild generalised ataxia and proprioceptive deficits , a wide - based pelvic limb stance , bilaterally absent menace responses , poor visual tracking and good visual placing responses . t2-weighted hyperintense material , which was suppressed on fluid - attenuated inversion recovery images , filled the uniformly enlarged ventricle . a moderate - to - severe mass effect was evident , with contralateral deviation of the midline and compression of the thalamus , the rostral colliculus and the rostral aspect of the mesencephalon , indicating caudal subtentorial herniation and raised intracranial pressure . there was a reduction in thickness of the cerebral mantle overlying the enlarged ventricle and asymmetry of the calvarium . there was rostral bulging of the frontal bone with subsequent reduction in the volume of the right frontal sinus , within which an incidental small frontal sinus cyst was identified ( figure 1 ) . mris of the brain demonstrating right unilateral congenital hydrocephalus : ( a ) axial t2-weighted , ( b ) axial t2 fluid - attenuated inversion recovery and ( c ) dorsal three - dimensional fast imaging employing steady - state acquisition the mri findings were compatible with non - communicating hydrocephalus , with gross changes indicative of chronicity , although no underlying aetiology could be identified . levetiracetam ( 25 mg / kg iv q12h , keppra ; ucb ) and prednisolone ( 1 mg / kg po q24h for 2 weeks followed by 0.5 mg / kg q24h , prednidale ; dechra ) were initiated , with minimal response after 2 months . a pc ( open end with wall slits , standard , pliant , barium impregnated , 90 cm [ reference 43551 ; medtronic ] ) was placed intraperitoneally via a right lateral laparotomy and anchored to the abdominal wall with a chinese finger - trap nylon suture . the pc was subcutaneously tunnelled cranially in a straight line to the level of c1c2 on the dorsal midline . using a right lateral rostrotentorial approach , a semi - lunar incision was made over the right calvarium from the caudal aspect of the frontal sinus to the level of c1c2 . two holes were drilled in the skull approximately 30 mm and 25 mm cranial to the occiput and 1.4 mm lateral to the midline . the dura was incised and the cerebral cortex perforated with a rivulet ventricular catheter ( barium - impregnated , 15 cm [ reference 41701 ; medtronic ] ) via the first hole , which was secured into the right ventricle with two nylon sutures anchored to the second hole . the ventricular catheter was connected to a csf flow control valve ( fcv ) ( ultra - small , low - low pressure [ reference 22017 b - ll ; medtronic ] ) at the level of c1c2 , which was secured to the pc caudally . the pc was concertinaed into three loops ( perpendicular to the axis of the neck ) before connection to the fcv , to allow for movement . satisfactory positioning of the vps was confirmed on postoperative ct scan ( figure 2 ) . recovery was unremarkable and postoperative neurological examination revealed mild generalised ataxia and proprioceptive deficits , bilateral mydriasis and reduced menace responses with good vision . postoperative analgesia was provided with methadone ( 0.10.2 mg / kg iv q46h , comfortan ; dechra veterinary products ) and subsequently with buprenorphine ( 0.02 mg / kg iv q68 h , vetergesic ; ceva animal health ) . the patient was discharged 48 h postoperatively with gabapentin ( 10 mg / kg po q12h for 1 week ) , amoxicillin / clavulanic acid ( 12.5 mg / kg po q12h for 2 weeks , synulox ; zoetis uk ) , levetiracetam ( 25 mg / kg po q12h for 2 months , then q24h for 1 month ) and prednisolone ( 1 mg / kg po q24h for 1 week , then 0.5 mg / kg q24h for 3 weeks , then 0.5 mg / kg q48h for 6 weeks ) . there was mild deterioration of the neurological examination 12 h postoperatively ; bilaterally , mildly reduced nasal sensation and mydriasis had developed , both of which had resolved at 36 h and 2 weeks postoperatively , respectively . ct rendering sagittal image demonstrating satisfactory positioning of the ventriculoperitoneal shunt a 48 h period of loose faeces was reported 2 weeks postoperatively , which resolved spontaneously . increased vocalisation and polyphagia was reported until at least 8 weeks postoperatively , likely secondarily to prednisolone . neurological examination had improved 13 weeks postoperatively ; a very mild generalised ataxia and proprioceptive deficits and bilaterally reduced menace responses were detected . persistent , generalised pruritus was reported ; a flea infestation had been identified and treated with selamectin ( stronghold ; zoetis uk ) ; however , no environmental parasiticide treatment had been applied . a soft , non - painful , 4 cm diameter subcutaneous swelling was present at the level of the csf fcv , which had developed over the previous 3 weeks . ultrasound performed prior to seroma aspiration revealed a small length of coiled vps tubing within the seroma ( consistent with original placement ) and thus radiography was not performed . serous fluid ( 15 ml ) was aspirated using a 5 ml syringe and 23 g needle . in - house cytology ( cytospin ) revealed a mixed - cell population consisting of non - degenerate neutrophils and macrophages , and no evidence of intra- or extracellular bacteria . palpation post - aspiration did not reveal an abnormal volume of coiled catheter within the seroma . meloxicam ( 0.05 mg / kg po q24h , metacam ; boehringer ingelheim ) was instituted along with cold packing of the region q8h . the swelling reformed after 3 days but was palpably firm and approximately 7 cm in diameter . radiography confirmed cranial migration and subcutaneous coiling of the entire pc within the subcutaneous tissues at the level of the fcv ( figure 3 ) . lateral radiograph demonstrating proximal migration and coiling of the entire peritoneal catheter within a seroma at the level of c1 the swelling was surgically explored under general anaesthesia . no adhesions between the subcutaneous tissues and the catheter tubing were noted . the pc was flushed to confirm patency and re - tunnelled to the right abdominal wall and secured intraperitoneally . at the time of writing , the owners reported a persistent , marked improvement in coordination and gait , and cessation of circling and compulsive pacing since vps placement . to our knowledge , this is the second report of migration of the pc of a vps in a cat . in people , pc migration mostly occurs within the first 3 months of shunt placement , as occurred in this case . multiple episodes of under - shunting due to kinking of the pc , requiring invasive care , were reported in a cat within the first 3 months of surgery , although subcutaneous coiling of the pc was not reported in that case . no shunt complications were seen 360 days postoperatively compared with 24 months in the current case . the current treatment recommendation is surgical removal and replacement of the pc within a new subcutaneous tunnel . ultrasonographical evaluation of the seroma in this case confirmed a normal length of pc at the level of the fcv and thus radiography to confirm the intra - abdominal positioning of the pc was not performed prior to seroma aspiration . consequently , it is unclear whether pc migration began prior to or following seroma aspiration . if the former is true , then perhaps this afforded increased mobility of the fcv and contributed to seroma formation . conversely , the size of the fcv represents a significant foreign body in a cat and thus seroma formation would have been feasible in the absence of pc migration . pang and wilberger suggested that subgaleal fluid re - absorption may create negative pressure , drawing the pc proximally . alternatively , upward migration may be afforded by a combination of suction from negative intraventricular pressure created due to csf drainage , pushing from positive intra - abdominal pressure ( iap ) secondarily to physiological processes or excessive csf volume within the abdomen , a tortuous subcutaneous tunnel and a lack of appropriate fixation of the proximal and distal ends of the vps tubing . in the current case , the subcutaneous tunnel was created in a straight line using minimal dissection and the pc was secured in the abdomen by a nylon chinese finger - trap suture , ensuring adequate fixation . soft faeces were documented for 48 h within the initial postoperative period , although the occurrence of significant tenesmus could not be confirmed . the owners also reported a noticeable and persistent ( for at least 8 weeks postoperatively ) increase in vocalisation , seemingly associated with polyphagia , which was thought to be related to tapering prednisolone therapy . it is feasible that raised iap generated by increased vocalisation and possibly tenesmus may have facilitated pc migration prior to seroma aspiration . windlass effect , whereby a proximal anchoring point , such as granulation tissue , allows tension from repeated flexion extension movements of the head , noted in some hydrocephalic infants , to be transmitted to the pc , creating a proximal winching effect . no obvious adhesions anchoring the pc to the surrounding tissues ( which might have created a however , considering the range of motion of the feline head and neck it is possible that a similar windlass effect may be generated by the repetitive flexion , extension and twisting movements that occur during self - grooming and scratching , potentially increasing the risk of pc migration in cats . a high frequency of self - grooming and pruritus was observed in this case prior to representation and seroma aspiration , likely secondary to a flea infestation , which may have contributed to pc migration and also possibly to seroma formation due to increased movement of the fcv . windlass effect to cause pc migration in an infant with compulsive flexion extension head movements . they subsequently re - tunnelled the pc away from the axis of the head movements . further studies would be required to establish whether an optimal shunt pathway exists in cats that would significantly reduce the risk of pc migration . it is possible that the seroma itself may have caused irritation and increased self - grooming , exacerbating the risk of pc migration . however , the owners reported a generalised pruritus which was not specifically at the level of the seroma and there was no reaction to seroma palpation , making this less likely . a facilitatory role of loose subcutaneous tissue has been suggested , whereby reduced resistance to catheter movement augments the proximal migration and coiling process . several human reports describe the coiling of a migrated catheter within subcutaneous regions with a previous history of fluid accumulation . softer , more mobile skin may further explain the higher incidence of catheter migration to the proximal subcutaneous regions in children than in adults . the seroma in the current case created an area of loose subcutaneous tissue , which may have aided pc migration and coiling . furthermore , compared with human infants , cats have more substantial amounts of loose , mobile skin , especially along the dorsolateral occipital , cervical and cranial thoracic regions , which may further predispose this species to proximal pc migration . minimal undermining of the subcutaneous tissues when creating the tract for the shunt tubing may be even more crucial in cats than in people . martinez - lage et al proposed a mechanism whereby rapid release of the pc from its anchoring point around the abdominal scar could be facilitated by abrupt stretching . subsequent leakage of csf from the catheter and distension of the subcutaneous tunnel could reduce resistance to retrograde movement of the catheter . the distension of the subcutaneous tract could act as a buffer and account for the initial lack of neurological signs of raised intracranial pressure seen in some people with vps migration , as was seen in this case . normal feline activities ( eg , jumping , climbing and hunting ) could trigger the above proposed mechanism , perhaps creating an increased risk of pc migration in cats that are younger , more active and/or have an outdoor lifestyle compared with those cats that are older , less active and/or confined indoors . seroma aspiration may have exerted negative pressure on the pc , drawing it proximally and facilitating either dislocation of the catheter from the peritoneum , or proximal migration of an already displaced , extraperitoneal catheter , or perhaps both . gentle suction was applied using a small - volume ( 5 ml ) syringe to minimise negative pressure . however , considering that ultrasound identified a normal volume of catheter within the seroma prior to aspiration , that the entire pc was radiographically confirmed to be coiled within the seroma within 3 days of aspiration and that no further complications occurred following revision surgery , seroma aspiration may have been a significant contributor to pc migration and subcutaneous coiling in this case . dominguez et al considered that the memory of the shunting device , due to coiled packaging , could enable recoiling within the subgaleal space . however , a similar case of upward catheter migration and subgaleal coiling has been described with uncoiled catheter packaging . furthermore , head motion of this infant was prevented , discrediting the windlass mechanism in this case . in addition , no marked dissection or subgaleal fluid was documented at the revision surgery , making reduced resistance to tube movement and negative suction pressure less likely mechanisms , respectively . no association was found between the type of shunting device employed and the tendency towards upward migration . the main limitations of this case report are the lack of imaging of the distal pc to confirm its location prior to seroma aspiration and the lack of veterinary literature documenting vps catheter migration in cats to assess the significance of the observations made . migration of the pc of a vps most commonly occurs within the first 3 months following placement , with several possible mechanisms of migration suggested . preventive measures include proper fixation of the proximal and distal ends of the vps , minimal dissection when creating the subcutaneous tunnel and straight placement of the tubing . shunt positioning away from the axis of repetitive head movements may also be beneficial , although the optimal shunt pathway in the cat is yet to be determined . in the current case , an increased frequency of vocalisation ( possibly associated with polyphagia secondary to prednisolone therapy ) and diarrhoea causing subsequent raised iap and repetitive self - grooming / scratching creating a windlass effect may have contributed to catheter migration . thus , cats displaying a high frequency of vocalisation , tenesmus and/or self - grooming , including long - haired cats and those receiving treatment ( eg , prednisolone ) , or with comorbidities that may exacerbate these behaviours , may be at a higher risk of vps shunt migration . measures to reduce the frequency of postoperative self - grooming and/or pruritus ( eg , encouraging owners to groom their cat , reducing stress , minimising the duration of steroid treatment and preventing / treating comorbidities ) , appropriate prevention and/or prompt treatment of conditions predisposing to raised iap and moderate exercise restriction , particularly within the first 3 months , may help reduce the risk of peritoneal catheter migration in feline patients following vps placement . negative suction pressure exerted by aspiration of a fcv - associated seroma may have initiated or contributed to pc migration and subcutaneous coiling in the current case . subsequently , diagnostic imaging should be offered , ideally pre- and postaspiration of a vps - associated seroma , with appropriate aspiration technique and equipment employed ( applying slow , controlled suction using a small - volume syringe with or without a butterfly catheter ) to minimise negative suction pressure and the potential risk of catheter migration .

case summary ventriculoperitoneal shunt placement is the most commonly utilised surgical treatment for hydrocephalus in human and veterinary patients . migration of the peritoneal catheter is an uncommon but well - documented complication in people , usually occurring within the first 3 months postoperatively , although only a single feline case report exists . a ventriculoperitoneal shunt was placed in a domestic shorthair cat , aged 4 years and 10 months , following a diagnosis , with mri , of unilateral , non - communicating hydrocephalus . diarrhoea , increased vocalisation and pruritus were reported within the first 3 months postoperatively . a shunt - associated seroma developed , which was aspirated under ultrasound guidance . within 3 days , the entire peritoneal catheter was subcutaneously coiled at the level of the seroma . the peritoneal catheter was replaced within the abdomen via a new subcutaneous tunnel . no further complications had occurred 24 months following revision surgery.relevance and novel information this is the second report describing peritoneal catheter migration in a cat . repetitive head and neck movements during self - grooming , raised intra - abdominal pressure secondary to vocalisation and tenesmus , and negative pressure exerted during seroma aspiration may have contributed to ventriculoperitoneal shunt migration . excessive loose skin and increased activity may further increase the risk of migration in cats . diagnostic imaging should be offered prior to and following aspiration of shunt - associated swellings , and minimal negative pressure should be exerted . attempts to reduce the frequency of postoperative self - grooming , prevention and prompt treatment of conditions predisposing to raised intra - abdominal pressure and moderate exercise restriction , particularly within the first 3 months , may help reduce the risk of peritoneal catheter migration .

Introduction Case description Discussion Conclusions

between 25% and 30% of non - small cell lung cancer ( nsclc ) patients will develop metastatic disease in the brain ( brain metastases from non - small cell lung cancer frequently they are the first site of recurrence in early - stage nsclc patients treated with definitive therapies [ 15 ] . the prognosis is poor for untreated patients with bmf - nsclc , with median overall survival ( os ) 12 months [ 1 , 4 , 5 ] . the combination of neurosurgery with stereotactic radiosurgery ( srs ) and/or whole - brain radiotherapy ( wbrt ) can increase the os up to 36 months , and in selected cases over 12 months [ 1 , 4 , 610 ] . currently , the role of systemic treatment of bmf - nsclc patients is being widely discussed [ 3 , 4 , 10 ] . historically , chemotherapy was considered as a poorly effective method of treatment , mainly because of predicted difficulties in penetrating the blood - brain - barrier ( bbb ) . for a long period of time , patients with bmf - nsclc were excluded from controlled clinical trials for chemotherapy of nsclc [ 1 , 3 , 4 , 11 , 12 ] . nowadays it seems that even if most of the drugs can not penetrate normal bbb , the integrity of the bbb is significantly altered , e.g. in bmf - nsclc patients , which can be proved by oedema and increased contrast uptake around the metastatic site . the significant amount of information indicates the possibility of efficient palliative systemic treatment of chosen patients with bmf - nsclc [ 2 , 3 , 10 , 11 , 13 ] . the role of targeted therapies , besides chemotherapy , is significantly increasing [ 1 , 4 , 10 , 13 , 14 ] . the purpose of this work is to review , relying on the literature , the actual knowledge on the methods and results of systemic treatment of brain metastases from non - small cell lung cancer . recent phase ii trials indicate efficacy , however limited , of platinum - based chemotherapy of bmf - nsclc patients [ 1520 ] , which is presented in table 1 . efficacy of platinum - based chemotherapy of bmf - nsclc patients in phase ii trials phase ii trials demonstrating efficacy of first - line bmf - nsclc chemotherapy . as outlined in table 1 , the response rates after platinum - based chemotherapy range from 23% to 45% ; chaubet - houdu and basse report 2350% . literature indicates that temozolomide ( tmz ) combined with radiotherapy , in bmf - nsclc , has a slight influence on survival , but it might increase the toxicity of the treatment [ 2 , 11 , 2123 ] . development of epidermal growth factor receptor tyrosine kinase inhibitors ( egfr - tkis ) : gefitinib or erlotinib , has clearly improved the treatment of advanced nsclc patients [ 3 , 4 , 9 , 10 , 13 , 2445 ] . egfr mutations are present in 1025% of nsclc , with the highest prevalence found in never - smoking women of east asian descent ( up to 55% ) [ 13 , 24 ] . pao et al . found egfr mutations to be present in 63% and 50% of bmf - nsclc patients , respectively , which suggests increased risk of developing brain metastases among patients with these mutations [ 25 , 26 ] . in a non - selected group of patients with bmf - nsclc the overall response rates after gefitinib range from 10% to 38% , and the duration of response ranges from 9 to 13.5 months [ 2730 ] ; erlotinib has similar efficacy [ 3135 ] . it seems that erlotinib achieves higher central nervous system ( cns ) concentration in comparison to gefitinib [ 10 , 13 ] . gefitinib and erlotinib are both approved as first - line treatment , palliative treatment ( second- and third - line ) , and in combination with radiotherapy ( wbrt srs ) , their efficacy was presented in case reports , case series , and nonrandomised phase ii trials [ 2 , 27 , 31 , 38 , 40 , 42 , 45 ] . two phase ii trials evaluated the efficacy of tki in the first - line setting on patients with bmf - nsclc [ 38 , 40 ] . both trials did not include data for egfr mutations , whereas the studies included never - smokers . reported 10 patients ; seven demonstrated an objective response to gefitinib , one had a stable disease , and two had a progressive disease after a median 48-week follow - up period . kim et al . presented a group of 23 patients with synchronous bmf - nsclc with a response rate to gefitinib or erlotinib of 69% and median overall survival of 18.8 months . the rate of cns progression was lower among egrf - mutant patients treated with gefitinib or erlotinib compared with upfront chemotherapy ( patients without egfr mutation ) 33% vs. 48% , respectively , at a median follow - up of 25 months . two phase ii trials assessed the role of gefitinib in the palliative setting in non - selected patients with bmf - nsclc [ 27 , 31 ] . reported 41 patients with a 10% response rate and median overall survival of five months , wu et al . reported 40 patients ( adenocarcinoma , never - smokers ) with a 32% response rate and median overall survival of 15 months . + gefitinib vs. wbrt + tmz , failed to show an advantage of gefitinib in a non - selected group of patients with bmf - nsclc ; os 6.3 months in the gefitinib arm and 4.9 months in the tmz arm , the difference was statistically irrelevant . . showed that tmz or erlotinib combined with wbrt + srs in a non - selected group of patients with 13 bmp - nsclc did not improve the os ; however , it increased the toxicity of the treatment . study evaluated the efficacy of erlotinib in combination with wbrt in 40 patients with bmf - nsclc . patients negative for egfr mutations had a median overall survival of 9.3 months , whereas patients positive for egfr mutations had 19.1 months . it is also undoubted that either gefitinib or erlotinib can be safely combined with wbrt [ 43 , 44 ] . some authors suggest that in selected groups of patients with bmf - nsclc , commencing treatment with gefitinib or erlotinib , with delayed wbrt , is acceptable . it relates to women with adenocarcinoma , never - smokers , and patients positive for egfr mutations . iuchi et al . presented good efficacy of gefitinib alone ( without radiotherapy ) in patients with adenocarcinoma bmf - nsclc , positive for egfr mutation the phase ii aprage trial , comparing wbrt + gefitinib with gefitinib alone in bmf - nsclc patients , is ongoing [ 3 , 12 ] . in conclusion , tki ( gefitinib , erlotinib ) overall response rate depends essentially on the presence of egfr gene activating mutation [ 10 , 12 , 13 , 36 , 37 ] ; if mutation is present , orr reaches more than 50% . in non - selected groups of patients ( adenocarcinoma , asian descents , never - smokers , asymptomatic bmf - nsclc ) after tkis therapy , it is possible to reach 70% orr [ 13 , 38 ] . tkis improve survival of bmf - nsclc patients with egfr mutations in comparison to patients without these mutations [ 10 , 12 , 13 , 39 ] . in approximately 35% of patients with nsclc , an alk ( anaplastic lymphoma kinase ) rearrangement occurs . it results in forming an eml4-alk fusion gene ; it relates to mostly young , male , never - smokers , with adenocarcinoma [ 10 , 1214 , 46 ] . in this group , administration of crizotinib , an anti - eml4-alk ( echinoderm microtubule - associated protein - like 4-anaplastic lymphoma kinase ) drug , is reasonable and effective [ 10 , 14 , 4648 ] . reported a 57% response rate , and a randomised phase iii trial presented by shaw et al . indicated statistically relevant improvement of progression - free survival of subjects treated with crizotinib , compared to patients treated with a second - line chemotherapy ( pemetrexed or docetaxel ) . unfortunately , crizotinib has a poor bbb penetration , so its efficacy in bmf - nsclc patients is doubtful [ 10 , 13 , 14 , 46 , 4951 ] . the available literature provides poor corresponding data [ 12 , 49 , 50 , 52 ] . presented a case of bmf - nsclc progression during crizotinib treatment , despite regression of the disease outside cns . . reported on crizotinib in 38 alk ( + ) patients ; 28 demonstrated progressive disease , and in 46% the first site of recurrence was bmf - nsclc . among patients with isolated recurrence in bmf - nsclc , treated with radiotherapy ( wbrt or srs ) followed by crizotinib , progression - free survival of 7.1 months single cases of bmf - nsclc responsive to crizotinib were reported by kaneda et al . and kinoshita et al . . kinoshita suggest that administering ionising radiotherapy before crizotinib treatment may play an important role in both cases [ 43 , 48 ] . in 2006 yuan et al . indicated in a murine model that cns radiotherapy increases penetrability of the bbb . mehra et al . , in a phase i trial , demonstrated responses in bmf - nsclc patients treated with one of the new generation of alk inhibitors ldk 378 . bevacizumab is a humanised monoclonal antibody that binds selectively to vegf vascular endothelial growth factor . eventually , cancer cells should not develop their own blood supply , causing a lack of oxygen and nutrients , helping to slow down the growth of the tumour . treatment of advanced nsclc with bevacizumab remains controversial [ 1 , 12 , 13 ] . results of two randomised phase iii trials , ecog 4599 and avail , reported that bevacizumab combined with chemotherapy improved the response rate and progression - free survival compared to chemotherapy alone in nsclc . ecog 4599 also reported a significantly longer os ( 12.3 vs. 10.3 months ) [ 5658 ] . hypertension , massive haemoptysis , disorders in blood coagulation , and bmf - nsclc were also qualified as exclusion criteria . the restriction of the patient population to non - squamous histology was based on the research of johnson et al . , which indicated the occurrence of life - threatening haemoptysis in this group ( 4/13 patients ) . exclusion of bmf - nsclc patients was based on the current opinion that bevacizumab significantly increase the risk of intracranial bleeding in this group [ 1 , 12 , 13 ] . in both trials , the incidence of cns haemorrhages among patients receiving bevacizumab was similar to the incidence of those reported in patients who did not receive bevacizumab . based on the results of these trials , bevacizumab is currently licensed for use ase first - line therapy in combination with chemotherapy ( carboplatin + paclitaxel ) in the usa , or in addition to platinum - based chemotherapy in europe in patients with advanced non - squamous nsclc . however , it does not mean it is commonly used ; this is because of absent or poor benefit compared to chemotherapy alone , with a slightly increased toxicity . it is obvious that there are no reasons to exclude patients with brain metastases from clinical trials on antiangiogenic agents , as took place in the recent past [ 1 , 13 , 56 ] . despite antiangiogenic therapy , patients with or without brain metastases have similar risk of intracranial bleeding ( 90.83.3% ) [ 6064 ] . several retro- and prospective clinical trials conducted in the past few years indicate that the combination of bevacizumab with chemotherapy or erlotinib is safe in the treatment of bmf - nsclc , with a slight risk of intracranial bleeding [ 60 , 6268 ] . a prospective phase iv study aries evaluated the safety and efficacy of the first - line setting in patients with non - squamous nsclc treated with bevacizumab combined with chemotherapy . a total of 150 patients with bmf - nsclc were enrolled , median pfs and os were 6.0 and 11.7 months , respectively , and no grade 3 to 5 cns haemorrhage occurred . the phase ii study passport enrolled 115 nsclc patients with previously treated bmf - nsclc with wbrt and/or surgery . patients received as a first - line bevacizumab , with platinum - based doublet chemotherapy or erlotinib , and as a second - line , bevacizumab with single - agent chemotherapy or erlotinib ; no grades 1 to 5 cns haemorrhage , among patients who received bevacizumab - based therapy were reported . the phase iii atlas study was designed to evaluate the combination of bevacizumab / erlotinib versus bevacizumab / placebo as maintenance therapy after four cycles of induction platinum - containing chemotherapy plus bevacizumab as first - line treatment in advanced nsclc patients . among 25 evaluable patients with a history of cns metastases pretreated with wbrt and/or neurosurgery , one grade 2 cns bleeding was observed in a patient on post - progression therapy after 14 cycles of bevacizumab [ 66 , 67 ] . the sail study assessed the safety and efficacy of the addition of bevacizumab to first - line chemotherapy . this study proved that bevacizumab - based therapy resulted in median os of 14.6 months , with a median time to disease progression of 7.8 months . the specific safety of bevacizumab was assessed in patients who either developed bmf - nsclc during treatment or had occult bmf - nsclc at study entry . of the 281 patients evaluated , five ( 2% ) had cns bleeding . the phase iii betalung study evaluated the addition of bevacizumab to erlotinib for the second - line treatment of advanced nsclc patients . a total of 636 patients were randomised to receive bevacizumab in combination with either erlotinib or erlotinib alone . the addition of bevacizumab to erlotinib increased pfs compared to erlotinib alone ( 3.4 vs. 1.7 months , respectively ) . this trial included patients with bmf - nsclc , previously treated with wbrt and neurosurgery or wbrt + srs . among 68 bmf - nsclc patients , 37 received erlotinib + bevacizumab and 31 erlotinib alone . besse et al . presented an analysis including more than 12,000 advanced / metastatic breast cancer , nsclc , renal , and colorectal cancer patients , with previously treated cns metastases , from 13 phase ii / iii randomised controlled trials , two open - label , single - arm safety studies , and two prospective studies . the rate of cerebral haemorrhage in the bevacizumab - treated group was 3.3% , compared to 1% in the group not treated with bevacizumab . this study suggests that the administration of bevacizumab should no longer be contraindicated based solely on the presence of cns metastases . several clinical trials have been launched to determine the safety and efficacy of various other antiangiogenic agents in the treatment of new or progressive brain metastases from solid tumours : sunitinib , cediranib , and vatalanib . chemotherapy is generally effective in bmf - nsclc , and platinum - based provides response rates ranging from 23% to 45% . epidermal growth factor receptor tyrosine kinase inhibitors ( egfr tkis ) gefitinib and erlotinib have a definite activity in bmf - nsclc with activating egfr mutation , or in selected groups of patients ( woman of east asian descent , never - smokers , those with adenocarcinoma ) ; the response rate ranges from 38% to 70% . both egfr - tkis have been investigated in first - line , palliative , and in combination with radiotherapy . patients with bmf - nsclc - egfr - mutant have improved overall survival compared with egfr wild - type tumours , when receiving an egfr inhibitor . there is no data on the activity of the agent ani - eml4-alk - crizotinib in patients with bmf - nsclc . data from a clinical trial enrolling patients with pretreated or occult bmf - nsclc showed that the addition of bevacizumab to various chemotherapy agents or erlotinib is a safe and efficient treatment , associated with a low incidence of cns haemorrhage . however , bevacizumab should be used with caution in patients with active bmf - nsclc .

in the systemic treatment of brain metastases from non - small cell lung cancer ( bmf - nsclc ) chemo- and targeted therapy are used . response rates after platinum - based chemotherapy , range from 23% to 45% . development of epidermal growth factor receptor tyrosine kinase inhibitors ( egfr - tkis ) : gefitinib or erlotinib , was an improvement in treatment of advanced nsclc patients . egfr mutations are present in 1025% of nsclc ( mostly adenocarcinoma ) , and up to 55% in never - smoking women of east asian descent . in the non - selected group of patients with bmf - nsclc , the overall response rates after gefitinib or erlotinib treatment range from 10% to 38% , and the duration of response ranges from 9 to 13.5 months . in the case of present activating egfr mutation , the response rate after egrf - tkis is greater than 50% , and in selected groups ( adenocarcinoma , patients of asian descent , never - smokers , asymptomatic bmf - nsclc ) even 70% . gefitinib or erlotinib treatment improves survival of bmf - nsclc patients with egfr mutation in comparison to cases without the presence of this mutation . there is no data on the activity of the anti - eml4-alk agent crizotinib . bevacizumab , recombinant humanised monoclonal antibody anti - vegf , in the treatment of advanced non - squamous nsclc patients is a subject of intense research . data from a clinical trial enrolling patients with pretreated or occult bmf - nsclc proved that the addition of bevacizumab to various chemotherapy agents or erlotinib is a safe and efficient treatment , associated with a low incidence of csn haemorrhages . however , the efficacy and safety of bevacizumab used for therapeutic intent , regarding active brain metastases is unknown .

Introduction Chemotherapy Tyrosine kinase inhibitors Crizotinib Bevacizumab

many organs can be herniated into the scrotum such as small intestine , appendix , colon , and ovaries . ureteral herniation is extremely rare , usually asymptomatic and is reported as isolated case report or small series . we report the case of an 88-year - old man treated for inguinoscrotal hernia where the left ureter was incidentally found in the herniated retroperitoneal fat . presenting symptoms , diagnostic evaluation , and surgical management an 88-year - old man was admitted for a left moderately sized inguinoscrotal hernia . his medical history included hypertension and benign prostatic hyperplasia . the herniated parts were dislocated from the scrotum , as well as the testicle , and cord strictures . the cord was separated from the herniated parts and was partially covered from preperitoneal fat . a large amount of retroperitoneal fat surrounded from a sac - like formation was found adjacent to the cordis [ figure 1a and b ] . these adhesions , as well as a part of this fat , were excised because of the irreducibility of the mass . during the excision , 24 h later , an abdominal ultrasound was performed to rule out any structural abnormality , which may have been missed preoperatively . ( a and b ) the left extraperitoneal inguinoscrotal hernia the ureter identified into the herniated retroperitoneal fat ureteral herniation is rare , and approximately 140 cases have been reported in the literature , mainly as isolated case reports or small series . ureteric hernia is also reported as spontaneous , postoperative or as a complication of renal transplantation . ureteral herniation presents as a groin mass usually asymptomatic although many cases describe association with dysuria , hematuria , and hydronephrosis . the hernia has the classical aspect of an indirect hernia ; it is formed by the sac anteromedially that contain viscera that make up the wall of the sac , and the ureter lying posterolaterally . the ureter slides into the canal drawn by the posterior peritoneum that follows the herniated viscera . paraperitoneal hernias are more common in men , usually located on the right side , are often large in size , usually reducible and rarely symptomatic . there is not a clear association with kidney or ureteric abnormalities . on the other hand , the hernia is often accompanied by the large amount of retroperitoneal fat , is often nonreducible , usually small and commonly associated with urinary symptoms . authors consider this type of hernia congenital and related to developmental abnormalities of differentiation of the ureter from the wolffian duct . the ureter slides along with the testis into the scrotum ; a process also favored by adhesions between the ureter and genitoinguinal ligaments . many extraperitoneal hernias have a congenital association to renal or ureteral malformation such as crossed renal ectopia or nephroptosis . however , in our case the hernia was sizable , partially reducible and was no associated with urinary symptoms . the diagnosis of ureteral hernia is often missed due to lack of urinary symptoms or signs or symptoms that could lead doctors to apply an extended preoperative work up . although computed tomography may determine the type and the contents of hernias and the intravenous urography may determine abnormalities before surgery , they are not justifiable on every inguinal hernia repair . considering the fact that ureteric injuries are serious complications and require additional surgical approaches , we emphasize the high index of suspicion needed by surgeons when repairing hernias identifying gross amount of sliding fat and resecting fat trying to reduce hernia into the abdomen .

an inguinoscrotal hernia is a common disorder that usually contains intraperitoneal organs ( small intestine , colon , appendix , ovaries ) . extraperitoneal ureteral herniation into an inguinoscrotal hernia is a rare condition and often associated with congenital abnormalities or postoperative anatomic changes . a high index of suspicion is needed in order to avoid intraoperative ureteric injuries . we herein report the case of a ureteric herniation into an inguinoscrotal hernia incidentally found during a scheduled hernia repair .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflict of interest

in the closed structure of the p2x cation channel , three -helical transmembrane domains cross the membrane obliquely : in rat p2x2 receptors , these intersect at thr339 . replacing thr339 by lysine in one , two or three subunits progressively increased chloride permeability and reduced unitary conductance . this implies that the closed - open transition involves a symmetrical separation of the three subunits , and that thr339 from each contributes symmetrically to the open channel permeation pathway .

Supplementary Material

the incidence of non - hodgkin lymphoma ( nhl ) is 100200-fold higher in hiv - infected individuals than in the general population . nhl is an aids - defining illness and in 35% of cases , the lymphoma is the initial manifestation of aids . the most common hiv - associated lymphomas are diffuse large b cell lymphoma ( dlbcl ; often primary in the central nervous system ) , burkitt lymphoma , primary effusion lymphoma , and plasmablastic lymphoma of the oral cavity . primary mediastinal large b cell lymphoma is a subtype of diffuse large b cell lymphoma arising in the mediastinum with distinctive clinical , morphologic , and genotypic features . most patients are young adult females presenting with localized mediastinal mass and symptoms often related to local effects of the large mediastinal tumor such as superior vena cava syndrome . dlbcl is one of the most common lymphomas in the setting of hiv , but the incidence of pmlbcl in hiv is not well established . only one reported case of hiv - associated pmlbcl has been found in the english literature . a 25-year - old female presented to her physician with 1 week of worsening shortness of breath , cough , and chest pain . she gave birth to her fourth child 5 weeks ago , and her cough and shortness of birth was developed a few days prior to delivery . she was diagnosed with hiv 1 year before ; however , she had no previous manifestation of aids . chest computed tomography ( ct ) revealed a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusions ( fig . 1 ) . the infiltrating cells were mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderately abundant cytoplasm . the tumor cells were cd45 + , cd20 + , cd23 + , partially cd30 + , weak partial positive for bcl-2 and bcl-6 , and negative for cd3 , cd5 , cd10 , cd15 , cd21 , and alk-1 . eber in situ hybridization was positive in approximately 30% of the tumor cells ( fig . 2 ) . flow cytomeric immunophenotyping showed a decreased cd4/cd8 ratio of 0.3 and evidence of an abnormal b cell population with expression of cd19 and cd20 but lack of surface immunoglobulin light chain expression . lumbar puncture and a magnetic resonance imaging of the brain showed no evidence of central nervous system involvement of lymphoma . her symptoms initially improved ; however , after the third cycle , her disease progressed and the treatment was changed to vp-16 , ifosfamide , and ara - c with concurrent mesna . her symptoms continued worsening and she died of respiratory failure 5 months after the diagnosis of the lymphoma . 1chest ct of case 1 reveals a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusionsfig . 2pathologic examination of case 1 shows varying degrees of compartmentalizing fibrosis associated with lymphocytic infiltrate . the infiltrating cells are mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderate cytoplasm . chest ct of case 1 reveals a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusions pathologic examination of case 1 shows varying degrees of compartmentalizing fibrosis associated with lymphocytic infiltrate . the infiltrating cells are mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderate cytoplasm . eber in situ hybridization is positive in approximately 30% of the tumor cells a 38-year - old male with history of hiv for 7 years and no prior aids - defining illness presented with complaints of progressive shortness of breath for 10 days and one episode of fever 2 weeks prior to the onset of his symptoms . he had night sweats for about 3 years , but he denied weight loss , cough , or hemoptysis . on admission , his laboratory values showed a cd4 count of 140/l and a markedly elevated ldh value of 886 . imaging studies of the chest revealed an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion was present , and several nodular opacities were noted in the left lung ( fig . 3 ) . the patient was admitted , and highly active antiretroviral therapy ( haart ) was started . the biopsy showed a variably dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which focal clusters , and rounded nests surrounded by delicate fibrous bands . immunohistochemistry showed that the tumor cells were positive for cd45 , cd20 , cd30 , bcl-2 , and bcl-6 , were focally positive for cd23 , and were negative for cytokeratin , cd3 , cd10 , cd15 , and alk-1 . eber in situ hybridization was mostly negative , with only very rare scattered positively staining cells ( fig . flow cytometric analysis showed a population of t lymphocytes with a cd4/cd8 ratio of 1.4 , but no discrete cd19 + or cd20 + b cell cluster was identified . a positron emission tomography scan , however , revealed multifocal extranodal thoracic , both nodal and extranodal abdominal , and possible acetabular involvement by the lymphoma . the patient was treated with steroids followed by combination chemotherapy with rituxan - hypercvad / intrathecal metothrexate in addition to haart and antimicrobial medication including bactrim , acyclovir , and diflucan . after 2 cycles of therapy , the mediastinal mass decreased in size , and the ldh level dropped to 168 . the patient responded well to the therapy and after 9 months of follow - up , he is without detectable disease . 3chest x - ray of case 2 shows an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion is present , and several nodular opacities are noted in the left lungfig . 4microscopic sections of case 2 show dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which form clusters and rounded nests surrounded by delicate fibrous bands . eber in situ hybridization was negative chest x - ray of case 2 shows an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion is present , and several nodular opacities are noted in the left lung microscopic sections of case 2 show dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which form clusters and rounded nests surrounded by delicate fibrous bands . a 25-year - old female presented to her physician with 1 week of worsening shortness of breath , cough , and chest pain . she gave birth to her fourth child 5 weeks ago , and her cough and shortness of birth was developed a few days prior to delivery . she was diagnosed with hiv 1 year before ; however , she had no previous manifestation of aids . chest computed tomography ( ct ) revealed a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusions ( fig . 1 ) . the infiltrating cells were mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderately abundant cytoplasm . the tumor cells were cd45 + , cd20 + , cd23 + , partially cd30 + , weak partial positive for bcl-2 and bcl-6 , and negative for cd3 , cd5 , cd10 , cd15 , cd21 , and alk-1 . eber in situ hybridization was positive in approximately 30% of the tumor cells ( fig . 2 ) . flow cytomeric immunophenotyping showed a decreased cd4/cd8 ratio of 0.3 and evidence of an abnormal b cell population with expression of cd19 and cd20 but lack of surface immunoglobulin light chain expression . lumbar puncture and a magnetic resonance imaging of the brain showed no evidence of central nervous system involvement of lymphoma . her symptoms initially improved ; however , after the third cycle , her disease progressed and the treatment was changed to vp-16 , ifosfamide , and ara - c with concurrent mesna . her symptoms continued worsening and she died of respiratory failure 5 months after the diagnosis of the lymphoma . 1chest ct of case 1 reveals a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusionsfig . 2pathologic examination of case 1 shows varying degrees of compartmentalizing fibrosis associated with lymphocytic infiltrate . the infiltrating cells are mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderate cytoplasm . chest ct of case 1 reveals a 13.7 9.2-cm superior mediastinal mass , multiple left pleural masses ranging from 2.42.7 cm , a 1.6-cm left upper lobe lung nodule , and bilateral pleural effusions pathologic examination of case 1 shows varying degrees of compartmentalizing fibrosis associated with lymphocytic infiltrate . the infiltrating cells are mostly large with irregular and convoluted vesicular nuclei , 13 visible nucleoli , and moderate cytoplasm . a 38-year - old male with history of hiv for 7 years and no prior aids - defining illness presented with complaints of progressive shortness of breath for 10 days and one episode of fever 2 weeks prior to the onset of his symptoms . he had night sweats for about 3 years , but he denied weight loss , cough , or hemoptysis . on admission , his laboratory values showed a cd4 count of 140/l and a markedly elevated ldh value of 886 . imaging studies of the chest revealed an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion was present , and several nodular opacities were noted in the left lung ( fig . 3 ) . the patient was admitted , and highly active antiretroviral therapy ( haart ) was started . the biopsy showed a variably dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which focal clusters , and rounded nests surrounded by delicate fibrous bands . immunohistochemistry showed that the tumor cells were positive for cd45 , cd20 , cd30 , bcl-2 , and bcl-6 , were focally positive for cd23 , and were negative for cytokeratin , cd3 , cd10 , cd15 , and alk-1 . eber in situ hybridization was mostly negative , with only very rare scattered positively staining cells ( fig . flow cytometric analysis showed a population of t lymphocytes with a cd4/cd8 ratio of 1.4 , but no discrete cd19 + or cd20 + b cell cluster was identified . a positron emission tomography scan , however , revealed multifocal extranodal thoracic , both nodal and extranodal abdominal , and possible acetabular involvement by the lymphoma . the patient was treated with steroids followed by combination chemotherapy with rituxan - hypercvad / intrathecal metothrexate in addition to haart and antimicrobial medication including bactrim , acyclovir , and diflucan . after 2 cycles of therapy , the mediastinal mass decreased in size , and the ldh level dropped to 168 . the patient responded well to the therapy and after 9 months of follow - up , he is without detectable disease . 3chest x - ray of case 2 shows an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion is present , and several nodular opacities are noted in the left lungfig . 4microscopic sections of case 2 show dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which form clusters and rounded nests surrounded by delicate fibrous bands . eber in situ hybridization was negative chest x - ray of case 2 shows an abnormal cardiomediastinal silhouette caused by a large left - sided mediastinal mass extending within the superior hemithorax medially . in addition , large left - sided pleural effusion is present , and several nodular opacities are noted in the left lung microscopic sections of case 2 show dense lymphoid infiltrate composed of large lymphoid cells with abundant pale cytoplasm , pleomorphic nuclei which form clusters and rounded nests surrounded by delicate fibrous bands . the world health organization classification of hematopoietic malignancies recognizes aids - associated lymphomas as a specific category to acknowledge the significant impact of hiv on the pathophysiology and prognosis of lymphomas . the pathogenetic mechanisms contributing to lymphoma genesis are complex and include chronic antigen stimulation , genetic abnormalities , cytokine dysregulation , and the role of herpes viruses : epstein barr virus ( ebv ) and kaposi sarcoma human virus ( kshv , hhv8 ) . the overall survival of patients with hiv - related nhls is inferior compared to hiv - negative patients , and in hiv , the majority of patients present with widespread disease and with higher risk for central nervous system involvement . the introduction of haart extended the lifespan of aids patients and some studies indicated a decrease of the incidence of lymphomas in aids since widespread availability of haart . the combination of haart with aggressive chemotherapy , such as chop , not only is tolerable and effective treatment in patients with hiv and nhl but the initial good response to haart is also associated with higher complete response rates to the chemotherapy ( 77% response to chop versus 50% in nonresponders ) . the association between hiv and classical hodgkin lymphoma is less clear , and , unexpectedly , the incidence of hodgkin lymphoma in aids has increased since haart was introduced . of note , hiv - related hodgkin lymphoma is associated with ebv in nearly all cases , and it has been postulated that the ebv - encoded latent membrane protein ( lmp1 ; which is functionally homologous to activated cd40 ) , is essential to the antiapoptotic phenotype of the reed sternberg cells , replacing the cd40/cd40 ligand interaction by cd4 + t cells , which are decreased in aids . though diffuse large b cell lymphoma is one of the most common nhl associated with aids , so far , only one case of pmlbcl has been described in the literature in the setting of aids . this patient , a 29-year - old woman with 12 years of history of hiv infection without prior aids - defining illness , presented with fever , night sweats , cough , and a cd4 count of 316/l . haart therapy was initiated but had to be discontinued within a few days due to development of stevens johnson syndrome . biopsies via mediastinotomy established the diagnosis of pmlbcl , with no evidence of extrathoracic disease upon staging . chemotherapy with chop and granulocyte colony - stimulating factor was started ; however , 6 days after the first cycle of treatment , the patient died from neutropenic sepsis . in our current report , the clinical presentation in case 1 is classical in terms that the patient is a young woman who presents with a mediastinal mass and her disease is localized to the mediastinum ( table 1 summarizes the clinical findings of cases 1 and 2 in comparison to the case reported by milling et al . ) . this patient was known to have hiv but because she was pregnant , she only received azt monotherapy and had very low cd4 t - cell count ( 152/l ) at diagnosis . in contrast , the clinical presentation of case 2 is unusual in several aspects . the patient is a male and in addition to a large mediastinal mass , he has widespread disease at presentation . similarly to case 1 , he did not receive haart therapy prior to his presentation and his cd4 t - cell count was low ( 140/l ) . neither of the two patients had evidence of bone marrow or central nervous system involvement . the immunophenotype of the lymphoma cells of both cases is consistent with previously described phenotype of pmlbcl : cd45 + , cd20 + , cd23 + , and partially cd30 + . in case 2 , but not in case 1 , the lymphoma cells also express bcl-6 , a finding unusual but not excluding the diagnosis of pmlbcl . an important finding in case 1 is the ebv positivity in approximately 30% of the lymphoma cells by eber in situ hybridization . the role of ebv in the pathogenesis of pmlbcl in the immunocompetent host was previously dismissed . in one study , only two cases were positive for ebv of 41 pmlbcl cases ; others reported complete absence of ebv . the previously reported case of pmlbcl in hiv - infected patient also was negative for ebv with eber in situ hybridization . in our case , it is not clear as to what extent the ebv positivity contributes to lymphoma pathogenesis or represents ebv infection acquired during the course of disease . yet , the finding of 30% eber - positive lymphoma cells is likely to be clinically significant , since park et al . recently reported that eber positivity of 20% or more in lymphoma cells in dlbcl is associated with significantly poorer overall survival and progression - free survival compared to ebv - negative dlbcls . in the immunocompromised , such as aids or post - transplant state , ebv infection even in a minority of lymphoma cells might have significant impact on disease pathogenesis and outcome . since the molecular signature of pmlbcl resembles that of classical hodgkin lymphoma , ebv infection might contribute to an anti - apoptotic phenotype of the lymphoma cells with a similar mechanism as observed in hiv - associated hodgkin lymphoma . in our patient with ebv - associated pmlbcl , despite the localized nature of the lymphoma , the tumor continued to progress during chemotherapy resulting in death of the patient after 5 months of diagnosis . unlike case 1 , case 2 responded well to a combination of haart and chemotherapy and improved rapidly , despite widespread disease at diagnosis . table 1comparison of the clinical features of case 1 , case 2 , and the case reported by milling et al . 2004age / sex25/female38/male29/femalepresentationshortness of breath , cough , chest painshortness of breath , fever , night sweatsfever , night sweats and coughduration of hiv+ status1 year7 years12 yearsprior therapy for hivazathyoprinenonenonecd4 count at presentation152/l140/l316/lldh at presentation379 iu / l ( high)886 iu / l ( high)542 iu / l ( high)stage of diseasestage ivstage ivnot statedbone marrow involvementnegativenegativenegativeextramediastinal involvementpleural masses , pleural effusions , left lung nodulepleural effusion , left lung nodules , multifocal abdominal and acetabular massesnonetherapy receivedhaart , 3 cycles of epoch then vp-16 , ifosfamide , ara - c , mesnahaart , 6 cycles of rituxan - hyper cvad1 cycle of chop and g - csfoutcomedeath 5 months after diagnosisno detectable disease after 9 months follow - updeath 6 days after chemotherapy comparison of the clinical features of case 1 , case 2 , and the case reported by milling et al . 2004 in summary , though increased incidence of pmlbcl has not been established in aids due to the rarity of these cases , pmlbcl occurs in hiv and appears to present in the setting of low cd4 t - cell count as a rapidly growing mediastinal mass . a good response to a combination of haart and chemotherapy more cases are necessary to characterize the relationship between pmlbcl and hiv and to determine the impact of ebv infection on disease pathogenesis and prognosis in the immunocompromised .

primary mediastinal large b cell lymphoma ( pmlbcl ) is a subtype of diffuse large b cell lymphoma arising in the mediastinum with distinctive clinical and morphological features . though diffuse large b cell lymphoma is one of the most common non - hodgkin lymphoma associated with aids , there are no data available regarding the association of hiv and pmlbcl . we report here two cases of pmlbcl arising in aids patients . in both cases , pmlbcl presented in a setting of low cd4 t - cell count as rapidly enlarging mediastinal mass . the morphologic and immunophenotypic findings are characteristic of pmlbcl . one of the two patients , a 25-year - old woman who had localized disease and evidence of epstein barr virus in lymphoma cells , did not respond to chemotherapy and died of disease progression 5 months after diagnosis . the second patient , a 38-year - old male with disseminated disease , responded to therapy and is disease - free after 9 months of follow - up .

Introduction Case reports Case 1 Case 2 Discussion

cardiovascular disease ( cvd ) is the main cause of death in maintenance hemodialysis ( mhd ) patients . both aortic artery calcification ( aac ) and cardiac valve calcification ( cvc ) have a high incidence in dialysis patients . the diagnosis of vascular calcification is usually based on very expensive and highly technical devices such as electron beam computed tomography ( ebct ) or multislice spiral computed tomography ( ct ) . however , lateral lumbar x - ray is a useful approach to detect aac with cheap price and low radiation . in addition , the use of plain radiographic films of bone has already been suggested in kidney disease improve global outcomes ( kdigo ) chronic kidney disease mineral and bone disorder ( ckd - mbd ) clinic practice guideline . our previous studies have already showed the high incidence of aac and cvc in dialysis patients and increased fgf23 ( fibroblast growth factor 23 ) was associated with aac and cvc . now , in this study , we aimed to investigate the relationship among aac , cvc , and mortality , and to figure out that , which factor could predict the outcome of mhd patients . two hundred forty - seven mhd patients were treated in ruijin hospital affiliated to shanghai jiao tong university , school of medicine in july 2011 . two hundred seventeen patients met the following inclusion criteria : ( 1 ) age over 18 years , ( 2 ) patients received hemodialysis 3 times a week , on a 4 h schedule , using a dialysate calcium concentration of 1.5 mmol / l , ( 3 ) no rapidly progressive kidney disease . among these patients , 74 patients refused to take part in this study , 18 patients with cancer , 15 patients dialysis vintage less than 3 months . this study was approved by the institutional review board of the ruijin hospital , shanghai jiao tong university , school of medicine and was in accordance with the principle of the helsinki declaration . all clinic data of mhd patients were collected , including blood pressure , which were recorded using the mean of the previous 1-month , height and weight , and medical history . predialysis blood tests were collected , which include prealbumin , alanine aminotransferase , aspartate aminotransferase , alkaline phosphatase , total protein , albumin , blood urea nitrogen , serum creatinine , uric acid , parathyroid hormone ( pth ) , 25-hydroxy vitamin d ( 25(oh)d ) , triglyceride , cholesterol , high density lipoprotein , low density lipoprotein , serum phosphate , and calcium . pth was measured using an intact assay by a chemiluminescent method ( abbott i2000 ) ; serum 25(oh)d was measured by electrochemiluminescence immunoassay ( roche cobas e601 ) . we collected all the samples with other blood test samples on the same day in july 2011 before dialysis . after centrifugation for 10 min at 2000 rpm , all plasmas were stored at 80c as soon as possible . plasma fgf23 level was measured using a c - terminal assay ( fgf23 [ c - term ] elisa , immutopics inc . body mass index was calculated as weight in kilograms divided by height in meters squared . all echocardiographic measurements were performed according to the recommendations of the american society of echocardiography by 2 sonographers unaware of biochemical results . two - dimensional assessment of the aortic valve and mitral valve , together with continuous - wave doppler ultrasonography , was performed according to parasternal long - axis and short - axis views . cvc is defined as bright echoes of more than 1 mm on 1 or more cusps of the aortic or mitral valve or mitral annulus . aac was detected by a lateral lumbar x - ray plain radiography at a voltage of 70 kv in 120 mhd patients and read by two radiologists using a semi - quantitative score [ figure 1 ] . this semi - quantitative score also used by others and summarized as follows : calcified deposits along the anterior and posterior longitudinal walls of the abdominal aorta adjacent to each lumbar vertebra from l1 to l4 were assessed using the midpoint of the intervertebral space above and below the vertebrae as the boundaries . calcifications were graded as follows : 0 , no aortic calcific deposits ; 1 , less than one - third of the corresponding vertebral length ; 2 , one - third or more , but less than two - thirds of the corresponding length ; 3 , more than two - thirds of corresponding length . each patient 's radiological semi - quantitative score ranged from 0 to 4 for segment affected , 06 for each vertebral level , and 024 for the total score . statistical package for social analysis ( spss for windows , ibm corp , usa ) version 19.0 was used for data analysis . results are expressed as mean standard error of mean , median ( and range ) , or frequency ( as percentage ) . comparison between groups was performed by an unpaired t - test or the nonparametric wilcoxon rank sum test in case of nonnormally distributed variables . the kaplan meier method was used to estimate survival probabilities using the log - rank test . two hundred forty - seven mhd patients were treated in ruijin hospital affiliated to shanghai jiao tong university , school of medicine in july 2011 . two hundred seventeen patients met the following inclusion criteria : ( 1 ) age over 18 years , ( 2 ) patients received hemodialysis 3 times a week , on a 4 h schedule , using a dialysate calcium concentration of 1.5 mmol / l , ( 3 ) no rapidly progressive kidney disease . among these patients , 74 patients refused to take part in this study , 18 patients with cancer , 15 patients dialysis vintage less than 3 months . this study was approved by the institutional review board of the ruijin hospital , shanghai jiao tong university , school of medicine and was in accordance with the principle of the helsinki declaration . all clinic data of mhd patients were collected , including blood pressure , which were recorded using the mean of the previous 1-month , height and weight , and medical history . predialysis blood tests were collected , which include prealbumin , alanine aminotransferase , aspartate aminotransferase , alkaline phosphatase , total protein , albumin , blood urea nitrogen , serum creatinine , uric acid , parathyroid hormone ( pth ) , 25-hydroxy vitamin d ( 25(oh)d ) , triglyceride , cholesterol , high density lipoprotein , low density lipoprotein , serum phosphate , and calcium . pth was measured using an intact assay by a chemiluminescent method ( abbott i2000 ) ; serum 25(oh)d was measured by electrochemiluminescence immunoassay ( roche cobas e601 ) . we collected all the samples with other blood test samples on the same day in july 2011 before dialysis . after centrifugation for 10 min at 2000 rpm , all plasmas were stored at 80c as soon as possible . plasma fgf23 level was measured using a c - terminal assay ( fgf23 [ c - term ] elisa , immutopics inc . body mass index was calculated as weight in kilograms divided by height in meters squared . all echocardiographic measurements were performed according to the recommendations of the american society of echocardiography by 2 sonographers unaware of biochemical results . two - dimensional assessment of the aortic valve and mitral valve , together with continuous - wave doppler ultrasonography , was performed according to parasternal long - axis and short - axis views . cvc is defined as bright echoes of more than 1 mm on 1 or more cusps of the aortic or mitral valve or mitral annulus . aac was detected by a lateral lumbar x - ray plain radiography at a voltage of 70 kv in 120 mhd patients and read by two radiologists using a semi - quantitative score [ figure 1 ] . this semi - quantitative score also used by others and summarized as follows : calcified deposits along the anterior and posterior longitudinal walls of the abdominal aorta adjacent to each lumbar vertebra from l1 to l4 were assessed using the midpoint of the intervertebral space above and below the vertebrae as the boundaries . calcifications were graded as follows : 0 , no aortic calcific deposits ; 1 , less than one - third of the corresponding vertebral length ; 2 , one - third or more , but less than two - thirds of the corresponding length ; 3 , more than two - thirds of corresponding length . each patient 's radiological semi - quantitative score ranged from 0 to 4 for segment affected , 06 for each vertebral level , and 024 for the total score . the blood tests and x - ray plain radiography statistical package for social analysis ( spss for windows , ibm corp , usa ) version 19.0 was used for data analysis . results are expressed as mean standard error of mean , median ( and range ) , or frequency ( as percentage ) . comparison between groups was performed by an unpaired t - test or the nonparametric wilcoxon rank sum test in case of nonnormally distributed variables . the kaplan meier method was used to estimate survival probabilities using the log - rank test . totally , 110 mhd patients were involved in this study . of whom , 64 ( 58.2% ) patients were male , the mean age was 55.2 1.4 years , and the median dialysis duration was 29.85 ( 3.0225.5 ) months . the demographic and clinical characteristics of mhd patients are shown in table 1 . among 110 mhd patients , only one patient received parathyroidectomy and 15 ( 13.6% ) patients had diabetes mellitus . clinical characteristics of mhd patients ( n = 110 ) * our previous study has shown that fgf23 level in general population is < 100 ru / ml , which is consistent with other study ; reference range according to kdigo ckd - mbd guideline . bmi : body mass index ; sbp : systolic blood pressure ; dbp : diastolic blood pressure ; alt : alanine aminotransferase ; ast : aspartate aminotransferase ; alp : alkaline phosphatase ; tp : total protein ; bun : blood urea nitrogen ; scr : serum creatinine ; ua : uric acid ; ipth : intact parathyroid hormone ; 25(oh)d : 25-hydroxy vitamin d ; tg : triglyceride ; tc : total cholesterol ; hdl : high density lipoprotein ; ldl : low density lipoprotein ; fgf23 : fibroblast growth factor 23 ; p : phosphate ; ca : calcium ; mhd : maintenance hemodialysis ; alb : albumin ; ckd - mbd : chronic kidney disease mineral and bone disorder ; kdigo : kidney disease improve global outcomes : improving global outcomes . : not available . twenty - eight ( 25.5% ) of 110 mhd patients had cvc from echocardiography , 25 ( 22.7% ) with aortic valve calcification , 10 ( 9.1% ) with mitral valve calcification , and only 1 ( 0.9% ) with tricuspid valve calcification . sixteen ( 25.0% ) of male and 12 ( 26.1% ) of female patients have cvc in our study . there is no gender difference in the incidence of cvc ( p = 0.897 ) . sixty - eight ( 61.8% ) of 110 mhd patients had visible calcification of aorta from lateral lumbar x - ray plain radiography , and the mean involved segments were 1.59 with mean aacs 4.21 0.51 scores . in analysis of the incidence of each segment of aac , l1 segment was 25.5% , l2 41.8% , l3 42.7% and l4 49.1% . thirty - eight ( 59.4% ) of male and 30 ( 65.2% ) of female have aac . there is no gender difference in the incidence of aac ( p = 0.534 ) . after 42 months follow - up , 25 ( 22.7% ) patients died , including 16 cases from cardiovascular events , 6 respiratory failure , 2 abandon treatment , and 1 deep venous thrombosis of lower extremity . in our study , 19 ( 29.7% ) male patients and 6 ( 13.0% ) female patients died during follow - up . meier analyses were performed to examine the univariate association between the presence of abdominal aortic calcification , cvc , and outcome . figure 2 shows the relationship among aac , cvc , and death from all - causes mortality and cardiovascular mortality . patients with aac had a significantly greater number of deaths from all - cause than those without aac ( log - rank test , p = 0.002 ) . similarly , patients with valve calcification also had a significantly greater number of deaths ( log - rank test , p = 0.001 ) . figure 3 shows the kaplan meier analysis of cardiovascular mortality ( log - rank test , p = 0.049 in aac and meier analysis of all - cause mortality ( p = 0.002 and p = 0.001 ) . kaplan meier analysis of cardiovascular mortality ( p = 0.049 and p < 0.001 ) . multivariate cox proportional hazards analyses were performed to identify factors associated with mortality . in multivariate analyses , factors that showed p univariate cox proportional hazards analysis for aac , cvc , and mortality are shown in figures 4 and 5 . the presence of aac was a significant factor associated with all - cause mortality ( hazard ratio [ hr ] : 3.149 , p = 0.025 ) in addition to lower albumin level and lower 25(oh)d level . the presence of cvc was a significant factor associated with cardiovascular mortality ( hr : 3.800 , p = 0.029 ) in addition to lower albumin level and lower 25(oh)d level . univariate cox proportional hazards analysis for aortic artery calcification , cardiac valve calcification , and all - cause mortality . univariate cox proportional hazards analysis for aortic artery calcification , cardiac valve calcification , and cardiovascular mortality . univariate and multivariate cox proportional hazards analysis for all - cause mortality bmi : body mass index ; tp : total protein ; alb : albumin ; bun : blood urea nitrogen ; scr : serum creatinine ; ua : uric acid ; ipth : intact parathyroid hormone ; 25(oh)d : 25-hydroxy vitamin d ; tg : triglyceride ; tc : total cholesterol ; hdl : high density lipoprotein ; ldl : low density lipoprotein ; fgf23 : fibroblast growth factor 23 ; p : phosphate ; ca : calcium ; cvc : cardiac valve calcification ; aac : aortic artery calcification ; hr : hazard ratio ; ci : confidence interval . univariate and multivariate cox proportional hazards analysis for cardiovascular mortality bmi : body mass index ; tp : total protein ; alb : albumin ; bun : blood urea nitrogen ; scr : serum creatinine ; ua : uric acid ; pth : parathyroid hormone ; 25(oh)d : 25-hydroxy vitamin d ; tg : triglyceride ; tc : total cholesterol ; hdl : high density lipoprotein ; ldl : low density lipoprotein ; fgf23 : fibroblast growth factor 23 ; p : phosphate ; ca : calcium ; cvc : cardiac valve calcification ; aac : aortic artery calcification ; hr : hazard ratio ; ci : confidence interval . twenty - eight ( 25.5% ) of 110 mhd patients had cvc from echocardiography , 25 ( 22.7% ) with aortic valve calcification , 10 ( 9.1% ) with mitral valve calcification , and only 1 ( 0.9% ) with tricuspid valve calcification . sixteen ( 25.0% ) of male and 12 ( 26.1% ) of female patients have cvc in our study . there is no gender difference in the incidence of cvc ( p = 0.897 ) . sixty - eight ( 61.8% ) of 110 mhd patients had visible calcification of aorta from lateral lumbar x - ray plain radiography , and the mean involved segments were 1.59 with mean aacs 4.21 0.51 scores . in analysis of the incidence of each segment of aac , thirty - eight ( 59.4% ) of male and 30 ( 65.2% ) of female have aac . there is no gender difference in the incidence of aac ( p = 0.534 ) . after 42 months follow - up , 25 ( 22.7% ) patients died , including 16 cases from cardiovascular events , 6 respiratory failure , 2 abandon treatment , and 1 deep venous thrombosis of lower extremity . in our study , 19 ( 29.7% ) male patients and 6 ( 13.0% ) female patients died during follow - up . kaplan meier analyses were performed to examine the univariate association between the presence of abdominal aortic calcification , cvc , and outcome . figure 2 shows the relationship among aac , cvc , and death from all - causes mortality and cardiovascular mortality . patients with aac had a significantly greater number of deaths from all - cause than those without aac ( log - rank test , p = 0.002 ) . similarly , patients with valve calcification also had a significantly greater number of deaths ( log - rank test , p = 0.001 ) . figure 3 shows the kaplan meier analysis of cardiovascular mortality ( log - rank test , p = 0.049 in aac and p < 0.001 in cvc ) . meier analysis of all - cause mortality ( p = 0.002 and p = 0.001 ) . kaplan meier analysis of cardiovascular mortality ( p = 0.049 and p < 0.001 ) . multivariate cox proportional hazards analyses were performed to identify factors associated with mortality . in multivariate analyses , factors that showed p < 0.05 on univariate analyses were entered as possible factors associated with mortality . univariate cox proportional hazards analysis for aac , cvc , and mortality are shown in figures 4 and 5 . the presence of aac was a significant factor associated with all - cause mortality ( hazard ratio [ hr ] : 3.149 , p = 0.025 ) in addition to lower albumin level and lower 25(oh)d level . the presence of cvc was a significant factor associated with cardiovascular mortality ( hr : 3.800 , p = 0.029 ) in addition to lower albumin level and lower 25(oh)d level . univariate cox proportional hazards analysis for aortic artery calcification , cardiac valve calcification , and all - cause mortality . univariate cox proportional hazards analysis for aortic artery calcification , cardiac valve calcification , and cardiovascular mortality . univariate and multivariate cox proportional hazards analysis for all - cause mortality bmi : body mass index ; tp : total protein ; alb : albumin ; bun : blood urea nitrogen ; scr : serum creatinine ; ua : uric acid ; ipth : intact parathyroid hormone ; 25(oh)d : 25-hydroxy vitamin d ; tg : triglyceride ; tc : total cholesterol ; hdl : high density lipoprotein ; ldl : low density lipoprotein ; fgf23 : fibroblast growth factor 23 ; p : phosphate ; ca : calcium ; cvc : cardiac valve calcification ; aac : aortic artery calcification ; hr : hazard ratio ; ci : confidence interval . univariate and multivariate cox proportional hazards analysis for cardiovascular mortality bmi : body mass index ; tp : total protein ; alb : albumin ; bun : blood urea nitrogen ; scr : serum creatinine ; ua : uric acid ; pth : parathyroid hormone ; 25(oh)d : 25-hydroxy vitamin d ; tg : triglyceride ; tc : total cholesterol ; hdl : high density lipoprotein ; ldl : low density lipoprotein ; fgf23 : fibroblast growth factor 23 ; p : phosphate ; ca : calcium ; cvc : cardiac valve calcification ; aac : aortic artery calcification ; hr : hazard ratio ; ci : confidence interval . the goal of our study is to investigate the relationship among aac , cvc and the mortality in chinese mhd patients , and which would be the better method to predict the outcome . now different vascular calcification scores have been evaluated in dialysis patient by various methods , such as x - ray plain radiography , b - mode ultrasound , and ct . the use of ct for diagnosis of aac is highly reliable and sensitive , but expensive and delivering a substantial dose of radiation . lateral lumbar x - ray is a simple method for detecting aac with cheap price , available device , and low radiation . aac score is a convenient score for clinic doctors to evaluate the severity of calcification and associated with mortality . about 94.4% of the mhd patients in australia , 56.5% in japan , and 81.0% in europe had visible aac . our previous study showed that the prevalence of aac was 60.83% in chinese mhd patients . in general population aortic arch calcification could also predict cardiovascular and all - cause mortality in mhd patients . komatsu et al . found that aortic arch calcification is linked to an increased risk of cad and is associated with cardiovascular risk factors such as age , hypertension , dyslipidemia , and dm in general population . the incidence of cvc in dialysis patients is also high , and the incidence of avc is higher than the mvc , which is similar to the result of our study . cvc is associated with the presence and severity of cad in predialysis ckd . in dialysis patients , cvc is related to mortality and age ; calcium - phosphorus product and hypoprealbuminemia are independent risk factors for cvc . the post - hoc analysis of advance study showed that cvc is a predictor of cac progression , and of greater cardiovascular vulnerability . in our study , we analyzed the association among aac , cvc , and mortality . in kaplan meier analyses and univariate analyses , both aac and cvc could predict all - cause and cardiovascular mortality in mhd patients . however , in cox proportional hazards models , only aac was a significant factor associated with all - cause mortality and cvc was a significant factor associated with cardiovascular mortality . this may be because the semi - quantitative method for evaluating aac and small size of our study . in spite of this , the results of the present study still can support the additional value of lateral lumbar x - ray films and echocardiography in mhd patients to predict their short - term outcome . it is well - known that the incidence of cardiovascular disease is relative to gender . allison et al . performed whole - body ebct scans on 650 asymptomatic subjects and found that male had higher percentage of calcification than female . although there is no gender difference in the incidence of aav and cvc in our study , male dialysis patients had a higher mortality than female . fgf23 is a novel bone - derived phosphaturic factors involved in mineral metabolism disorder and increased with the decreased kidney function and phosphate accumulates . it promotes renal phosphorus wasting and inhibits conversion of 25(oh)d to the active 1,25-dihydroxy vitamin d form . many studies showed that fgf23 has been linked to cardiovascular disease such as left ventricle hypertrophy and vascular calcification in ckd . our previous study also found that fgf23 is associated with the presence of aac in mhd patients . not just in ckd patients , a french cohort study , including 1130 healthy males , also shows that circulating fgf23 is associated with severe aac independent of other traditional risk factors . however , we did not find this relationship between fgf23 and all - cause mortality . this may be caused by the method of qualitative measurement of aortic calcification in the present study , and this study is only short - term follow - up ( 42 months ) . we need to continue to follow - up mhd patients to investigate fgf23 and long - term outcome . in ckd patients , hyperphosphatemia and calcium load the treatment of hyperphosphatemia with phosphate binder would give beneficial effect on vascular calcification progression . in our study , we did not find that phosphate and calcium are related to all - cause mortality . in cox analyses , albumin level is a protective factor for aac . huang et al . found that c - reactive protein is a predictor of aac . other inflammation factor , such as mcp-1 , was also related to all - cause and cardiovascular mortality in peritoneal dialysis patients . s100a12 , the pro - inflammatory rage - ligand , elevated in ckd 5 stage patients and is an independent predictor of mortality risk . hence , in our study , patients with low albumin level may have severe inflammation reaction and may have a link to aac . one of the important findings of this study is the association between 25(oh)d level and short - term outcome . we found that 25(oh)d is an independent predictor of cardiovascular and all - cause mortality . vitamin d deficiency has been linked to cardiovascular disease and early mortality in patients on hemodialysis , and the same association exists at earlier stages of ckd . found that plasma 25(oh)d predicted both time to death and esrd . in some studies , low doses and more physiology doses of active vitamin d previous studies demonstrated that alfa - calcidol therapy was associated with a significantly lower risk of cardiovascular and all - cause mortality in chronic hd patients . shoji et al . reported that mhd patients treated with alfa - calcidol were at reduced risk of cardiovascular death . reported that a mean daily oral vitamin d dose below 0.25 g can reduce the mortality rate by 53% in mhd patients whose serum pth levels were below 150 pg / ml . all these findings suggest that low 25(oh)d level and vitamin d3 therapy may improve cardiovascular and all - cause mortality . second , the population size in this study was small . in the future , a larger multiple - center , prospective study should be done to analyze the value of aac in dialysis patients . in conclusion , lateral lumbar x - ray plain radiography and echocardiography are simple methods to detect aac and cvc in dialysis patients . regular follow - up by x - ray and echocardiography could be useful method to stratify mortality risk in mhd patients .

background : this study was to investigate the relationship among aortic artery calcification ( aac ) , cardiac valve calcification ( cvc ) , and mortality in maintenance hemodialysis ( mhd ) patients.methods:all mhd patients in shanghai ruijin hospital in july 2011 were included . to follow up for 42 months , clinical data , predialysis blood tests , echocardiography , and lateral lumbar x - ray plain radiography results were collected . plasma fgf23 level was measured using a c - terminal assay.results:totally , 110 mhd patients were involved in this study . of which , 64 ( 58.2% ) patients were male , the mean age was 55.2 1.4 years old , and the median dialysis duration was 29.85 ( 3.0225.5 ) months . about 25.5% of the 110 mhd patients had cvc from echocardiography while 61.8% of the patients had visible calcification of aorta from lateral lumbar x - ray plain radiography . after 42 months follow - up , 25 ( 22.7% ) patients died . kaplan meier analysis showed that patients with aac or cvc had a significant greater number of all - cause and cardiovascular deaths than those without . in multivariate analyses , the presence of aac was a significant factor associated with all - cause mortality ( hazard ratio [ hr ] : 3.149 , p = 0.025 ) in addition to lower albumin level and lower 25-hydroxy vitamin d ( 25(oh)d ) level . the presence of cvc was a significant factor associated with cardiovascular mortality ( hr : 3.800 , p = 0.029 ) in addition to lower albumin level and lower 25(oh)d level.conclusion:lateral lumbar x - ray plain radiography and echocardiography are simple methods to detect aac and cvc in dialysis patients . the presence of aac and cvc was independently associated with mortality in mhd patients . regular follow - up by x - ray and echocardiography could be a useful method to stratify mortality risk in mhd patients .

I M Patients Laboratory measurements Echocardiography Lateral lumbar X-ray plain radiography Statistical analysis R Cardiac valve calcification Aortic artery calcification Mortality KaplanMeier analyses Multivariate analysis with Cox proportional hazards models D Financial support and sponsorship Conflicts of interest

in an era of finite resources and ever - increasing medical possibilities , every health care system faces challenges in determining which new health technologies , including medical devices , should be introduced into clinical practice.1 while technology can improve safety2 and have other benefits , it can also bring new risks35 and contribute to the increasing cost of care.6,7 ideally , health organizations should have a systematic process both to gather relevant scientific information about a technology s safety and effectiveness and to decide whether the technology is suitable for the local setting . however , several studies have concluded that the decision - making process for the adoption of new technologies could be improved at the institutional level.810 the international network of agencies for health technology assessment defines health technology assessment ( hta ) as : [ ] the systematic evaluation of properties , effects , and/or impacts of health care technology . it may address the direct , intended consequences of technologies as well as their indirect , unintended consequences . its main purpose is to inform technology - related policymaking in health care.11 hta reports from various international , national , and provincial agencies provide comprehensive , objective , evidence - informed analyses about the safety , clinical effectiveness , cost - effectiveness , and the broader impact of health technologies , including devices , drugs , and procedures . despite the exponential growth in the numbers and the types of hta reports over the past decade and their documented impact on health care,1215 it has been observed that recommendations are not put into practice as often as their envisioned potential.1618 there are several possible reasons for this . first , local decision makers may be unaware of the wealth of hta information available to them.19,20 second , external hta agencies may not be able to consider operational factors that are critical for local decision - making , such as local needs , financial impact , and the presence of local alternatives , trained personnel , or sufficient resources . third , health care organizations may lack a systematic process by which to integrate and translate context - free hta reports with context - sensitive considerations , particularly as decision making on technology adoption at the local level is a complex process , involving many disciplines and players within an organization.2123 indeed , it has been shown that a key determinant of successful hta uptake is a clear , fair , and consistent decision - making process for the approval and introduction of new health technologies.24 to address this issue , the department of surgery and surgical services in the former calgary health region ( calgary , ab , canada ) developed and implemented a systematic decision - making process to introduce new health technologies called the local hta decision support program , which comprises sets of forms and tools.25 the forms gather context - free , scientific evidence about the technology , such as hta reports , and context - sensitive information about local needs and constraints . the tools provide decision guides based on explicit criteria26 to assist an interdisciplinary advisory committee in translating the evidence to make a recommendation to the surgical executive committee , who then makes the final decision on whether and under what conditions the technology will be used . over a five - year period , 68 technology requests were reviewed using this program . as well as producing yes or no decisions on some technologies , the local hta decision support program gave other technologies restricted approval , with full approval contingent on satisfying clinical outcomes reporting , training protocol development , or funding.25 thus , the program provides a strong link between hta , outcomes measures and research , and improvement in the quality of care . we have observed considerable interest on the part of health care organizations in developing a similar program to combine the evidence of hta reports with local operational considerations to produce technology adoption decisions for their own needs . an alternative would be to adapt a preexisting program to the needs of the new setting rather than developing one de novo . the present project was launched to develop a framework and tools for adapting the local hta decision support program for use by other departments in the calgary health region . the operation of the program itself has been described in detail elsewhere.25 the purpose of this article is to describe the adaptation framework and tools , identify the key elements required for successful participation , and describe the lessons learned to support others who wish to use this framework for adapting our local hta decision support program , or a similar one , for their local needs . at the time of this project , the calgary health region was an integrated , primarily urban health authority in alberta , canada . it provided services across the continuum of care , from community health services to acute tertiary care , and served about one million people . its administrative structure comprised 14 major regional clinical departments , which worked within a portfolio structure . each portfolio was overseen by an executive director ( administrator ) and a medical director ( physician ) , who worked with the senior management team in the region . since then , the calgary health region has been restructured as part of a single provincial health services organization ( alberta health services ) . the department of surgery and surgical services in the calgary area comprises 286 surgeons in 14 divisions . following an extensive hta education initiative , there was a desire to see the local hta decision support program originally developed by the department of surgery and surgical services adopted by other departments within the calgary health region.19,27 with strong support by senior management , the present project was launched to develop a framework and tools for adapting the local hta decision support program for use by other departments in the region . adaptation of the local hta decision support program involved six steps organized into three main phases : set - up , review and adaptation , and finalization . each phase included a set of objectives , tasks , and documents ( table 1 ) modified from the adapte framework.28 the set - up phase consisted of tasks to be completed before the adaptation process . step 1 was the development of a local health technology assessment decision support program : review and adaptation manual,29 which contained a description of the local hta decision support program , hta - related reference materials for education purposes ( for example , table 2 ) , a project time line , and tips on program administration and evaluation . step 2 involved identification , education , and selection of departments ready and willing to review and adapt the program . in addition to surgery and surgical services , we approached ten other departments within the calgary health region we scheduled semi - structured interviews and meetings with each department s clinical and administrative heads and their executive committees to introduce the project , gather initial feedback , and gain approval for their participation in the adaptation process . each department s readiness for the project was determined using an assessment of readiness tool ( table 3 ) . outcomes required to proceed included the department s desire to change its manner of introducing new health technologies and a commitment of resources and personnel , namely the appointment of the local hta leaders ( a physician and administrator team ) to oversee the review and adaptation phase . we then met with these leaders to ensure they understood the local hta decision support program , the material in the review and adaptation manual,29 and what would be required for the review and adaptation process . the review and adaptation phase involved independent and joint reviews of the source program by participating departments . for step 3 , each department s appointed local hta leaders were charged with conducting an independent review with their membership either in principle by evaluating the structure , forms , and processes of the program or in practice by evaluating actual requests for new technologies from their members . each participating department was asked to provide written feedback using the points to consider questionnaire ( table 4 ) . step 4 consisted of a joint review by all participating departments in the form of full - day retreats . the retreat objectives were to learn from each department s experience in reviewing the program , to share input and ideas for improvement , to explore the need for consistency and the need for flexibility , and to determine future directions and next steps . retreats were divided into five sessions that followed the outline of the points to consider questionnaire ( table 4 ) to systematically review the program s policy , flow , structure , content , and funding . participants were asked to share their observations and to make joint recommendations to improve the program . retreat reports were produced that incorporated structured feedback from participants during working sessions and notes made by the facilitator and research team members . the finalization phase involved revision of the local hta decision support program and review of the adaptation process itself . for step 5 , feedback was compiled from the semi - structured interviews and meetings held with each of the local hta leaders from individual departments , written comments provided on the points to consider questionnaire reporting form , and the retreat reports . data were analyzed using a content analysis - type approach.30 major themes and subthemes were developed through comparison and categorization of information gathered . the team met to discuss the outcomes and reached consensus in cases where discrepancies arose . the outcomes were then interpreted into meaningful concepts pertaining to the local hta decision support program , and the program was revised accordingly . for step 6 , we developed a project evaluation questionnaire and gave it to all participants at the end of each retreat to evaluate the review and adaptation process used in this project . at the time of this project , the calgary health region was an integrated , primarily urban health authority in alberta , canada . it provided services across the continuum of care , from community health services to acute tertiary care , and served about one million people . its administrative structure comprised 14 major regional clinical departments , which worked within a portfolio structure . each portfolio was overseen by an executive director ( administrator ) and a medical director ( physician ) , who worked with the senior management team in the region . since then , the calgary health region has been restructured as part of a single provincial health services organization ( alberta health services ) . the department of surgery and surgical services in the calgary area comprises 286 surgeons in 14 divisions . following an extensive hta education initiative , there was a desire to see the local hta decision support program originally developed by the department of surgery and surgical services adopted by other departments within the calgary health region.19,27 with strong support by senior management , the present project was launched to develop a framework and tools for adapting the local hta decision support program for use by other departments in the region . adaptation of the local hta decision support program involved six steps organized into three main phases : set - up , review and adaptation , and finalization . each phase included a set of objectives , tasks , and documents ( table 1 ) modified from the adapte framework.28 the set - up phase consisted of tasks to be completed before the adaptation process . step 1 was the development of a local health technology assessment decision support program : review and adaptation manual,29 which contained a description of the local hta decision support program , hta - related reference materials for education purposes ( for example , table 2 ) , a project time line , and tips on program administration and evaluation . step 2 involved identification , education , and selection of departments ready and willing to review and adapt the program . in addition to surgery and surgical services , we approached ten other departments within the calgary health region we scheduled semi - structured interviews and meetings with each department s clinical and administrative heads and their executive committees to introduce the project , gather initial feedback , and gain approval for their participation in the adaptation process . each department s readiness for the project was determined using an assessment of readiness tool ( table 3 ) . outcomes required to proceed included the department s desire to change its manner of introducing new health technologies and a commitment of resources and personnel , namely the appointment of the local hta leaders ( a physician and administrator team ) to oversee the review and adaptation phase . we then met with these leaders to ensure they understood the local hta decision support program , the material in the review and adaptation manual,29 and what would be required for the review and adaptation process . the review and adaptation phase involved independent and joint reviews of the source program by participating departments . for step 3 , each department s appointed local hta leaders were charged with conducting an independent review with their membership either in principle by evaluating the structure , forms , and processes of the program or in practice by evaluating actual requests for new technologies from their members . each participating department was asked to provide written feedback using the points to consider questionnaire ( table 4 ) . step 4 consisted of a joint review by all participating departments in the form of full - day retreats . the retreat objectives were to learn from each department s experience in reviewing the program , to share input and ideas for improvement , to explore the need for consistency and the need for flexibility , and to determine future directions and next steps . retreats were divided into five sessions that followed the outline of the points to consider questionnaire ( table 4 ) to systematically review the program s policy , flow , structure , content , and funding . participants were asked to share their observations and to make joint recommendations to improve the program . retreat reports were produced that incorporated structured feedback from participants during working sessions and notes made by the facilitator and research team members . the finalization phase involved revision of the local hta decision support program and review of the adaptation process itself . for step 5 , feedback was compiled from the semi - structured interviews and meetings held with each of the local hta leaders from individual departments , written comments provided on the points to consider questionnaire reporting form , and the retreat reports . data were analyzed using a content analysis - type approach.30 major themes and subthemes were developed through comparison and categorization of information gathered . the team met to discuss the outcomes and reached consensus in cases where discrepancies arose . the outcomes were then interpreted into meaningful concepts pertaining to the local hta decision support program , and the program was revised accordingly . for step 6 , we developed a project evaluation questionnaire and gave it to all participants at the end of each retreat to evaluate the review and adaptation process used in this project . comments provided described how some technologies were introduced , removed , or replaced with alternatives without adequate evidence review or input from clinicians . to give some examples , however , the upgraded device was incompatible with existing hand pieces and added a large generator to an already tight space . although hta reports indicated good evidence for efficacy , the device failed to improve patient outcomes in our local setting , due to the lack of lead time to allow for appropriate training . however , no funds were given for its high operating cost , and this unbudgeted expense then fell to the health care system . new endoscopes were purchased , but they required specialized sterilization equipment , which was not available in all operating rooms . numerous examples were also given of requests for technologies that were based only on information obtained from the manufacturers representatives . consequently , department administrators and physician leaders wanted a system that would provide greater accountability and broader review for technology adoption . there was also some resistance to change particularly around the perceived time and work required to run a local hta decision support program . in addition to the department of surgery and surgical services , we were successful in recruiting eight out of the ten departments originally approached for a total of nine departments : six clinical departments and three administrative departments . all the clinical departments appointed a physician and an administrator as local hta coleaders , while the administrative departments appointed only an administrator as their hta leader . the department of surgery and surgical services already had a functioning physician - administrator team as the hta coleaders . of the two departments that declined to participate in the project , one was in the midst of organizational transition after hiring a new department head and the other was not interested in developing its own program as its technology purchasing was overseen by the department of surgery and surgical services . four departments reviewed the local hta decision support program in practice ( three invited departments as well as surgery and surgical services ) , and five departments reviewed the program in principle . all participating departments submitted their individual review feedback questionnaire and participated in the joint retreats . in total , we met with 67 individuals during the semi - structured interviews and meetings with each department s clinical and administrative heads and their executive committees , including physicians , program managers , nurse clinicians , patient care managers , health services directors , health services managers , clinical product specialists , clinical safety leaders , researchers , and financial analysts , as well as the senior administrators . thirteen individuals participated in the retreat for the first review cycle ; 16 participated in the retreat for the second review cycle . during the joint retreats , a significant amount of time what section of the points to consider questionnaire ( table 4 ) ; that is , what information needs to be gathered to ensure that the department s local hta committee would have enough information to decide if a technology could be simply approved or if it needed further assessment ? this was a contentious issue , because it is difficult to strike a balance between avoiding unnecessary work while still being able to protect patient safety and reduce risk when introducing new technologies . there was good consensus on the why section of the questionnaire ; that is , the need for a systematic and transparent decision support program for technology review and adoption and a clear policy statement . there was also good consensus on the how , who , and funding sections of the questionnaire , with the general recommendation that the details of program operation should be left to the discretion of individual departments . similar comments were brought forward by those who reviewed the program in practice as compared with those who reviewed in principle . to evaluate the review and adaptation process used in this project , the research team reviewed the responses to the project evaluation questionnaire that was given to participants after each of the two retreats . for the may 2007 retreat , 89%100% of respondents ( n=9 ) agreed or strongly agreed that the retreat objectives were met and 100% agreed or strongly agreed that the desired outcomes were achieved . these outcomes were the revised local hta decision - support program is adaptable to the needs of various clinical departments and i am committed to the next steps . for the november 2007 retreat , 80%100% of respondents ( n=10 ) agreed or strongly agreed that the retreat objectives were met , and 90%100% agreed or strongly agreed that the desired outcomes were achieved . these outcomes were : the revised local hta decision support program is adequate to go live for january 2008 implementation , and i am committed to continued participation . one person disagreed with the first outcome statement , but no other participants scored disagree or strongly disagree for any of the other objective or outcome statements . open - ended comments on the project evaluation questionnaire revealed an overwhelming desire to continue face - to - face meetings . participants found value in hearing the experiences of others using or reviewing the program , gathering feedback from different perspectives , and working collaboratively to come to consensus . as well , participants affirmed the value in having a fair , standardized , and consistent process for technology adoption across the various specialties within the calgary health region . using the above described methodology , two cycles of the review and adaptation and finalization phases were performed with invited departments . as part of another project,26 an additional cycle of review comments provided described how some technologies were introduced , removed , or replaced with alternatives without adequate evidence review or input from clinicians . to give some examples , however , the upgraded device was incompatible with existing hand pieces and added a large generator to an already tight space . although hta reports indicated good evidence for efficacy , the device failed to improve patient outcomes in our local setting , due to the lack of lead time to allow for appropriate training . however , no funds were given for its high operating cost , and this unbudgeted expense then fell to the health care system . new endoscopes were purchased , but they required specialized sterilization equipment , which was not available in all operating rooms . numerous examples were also given of requests for technologies that were based only on information obtained from the manufacturers representatives . consequently , department administrators and physician leaders wanted a system that would provide greater accountability and broader review for technology adoption . there was also some resistance to change particularly around the perceived time and work required to run a local hta decision support program . in addition to the department of surgery and surgical services , we were successful in recruiting eight out of the ten departments originally approached for a total of nine departments : six clinical departments and three administrative departments . all the clinical departments appointed a physician and an administrator as local hta coleaders , while the administrative departments appointed only an administrator as their hta leader . the department of surgery and surgical services already had a functioning physician - administrator team as the hta coleaders . of the two departments that declined to participate in the project , one was in the midst of organizational transition after hiring a new department head and the other was not interested in developing its own program as its technology purchasing was overseen by the department of surgery and surgical services . four departments reviewed the local hta decision support program in practice ( three invited departments as well as surgery and surgical services ) , and five departments reviewed the program in principle . all participating departments submitted their individual review feedback questionnaire and participated in the joint retreats . in total , we met with 67 individuals during the semi - structured interviews and meetings with each department s clinical and administrative heads and their executive committees , including physicians , program managers , nurse clinicians , patient care managers , health services directors , health services managers , clinical product specialists , clinical safety leaders , researchers , and financial analysts , as well as the senior administrators . thirteen individuals participated in the retreat for the first review cycle ; 16 participated in the retreat for the second review cycle . during the joint retreats , a significant amount of time what section of the points to consider questionnaire ( table 4 ) ; that is , what information needs to be gathered to ensure that the department s local hta committee would have enough information to decide if a technology could be simply approved or if it needed further assessment ? this was a contentious issue , because it is difficult to strike a balance between avoiding unnecessary work while still being able to protect patient safety and reduce risk when introducing new technologies . there was good consensus on the why section of the questionnaire ; that is , the need for a systematic and transparent decision support program for technology review and adoption and a clear policy statement . there was also good consensus on the how , who , and funding sections of the questionnaire , with the general recommendation that the details of program operation should be left to the discretion of individual departments . similar comments were brought forward by those who reviewed the program in practice as compared with those who reviewed in principle . to evaluate the review and adaptation process used in this project , the research team reviewed the responses to the project evaluation questionnaire that was given to participants after each of the two retreats . for the may 2007 retreat , 89%100% of respondents ( n=9 ) agreed or strongly agreed that the retreat objectives were met and 100% agreed or strongly agreed that the desired outcomes were achieved . these outcomes were the revised local hta decision - support program is adaptable to the needs of various clinical departments and i am committed to the next steps . no participant scored disagree or strongly disagree for any of the objective or outcome statements . for the november 2007 retreat , 80%100% of respondents ( n=10 ) agreed or strongly agreed that the retreat objectives were met , and 90%100% agreed or strongly agreed that the desired outcomes were achieved . these outcomes were : the revised local hta decision support program is adequate to go live for january 2008 implementation , and i am committed to continued participation . one person disagreed with the first outcome statement , but no other participants scored disagree or strongly disagree for any of the other objective or outcome statements . open - ended comments on the project evaluation questionnaire revealed an overwhelming desire to continue face - to - face meetings . participants found value in hearing the experiences of others using or reviewing the program , gathering feedback from different perspectives , and working collaboratively to come to consensus . as well , participants affirmed the value in having a fair , standardized , and consistent process for technology adoption across the various specialties within the calgary health region . using the above described methodology , two cycles of the review and adaptation and finalization phases were performed with invited departments . as part of another project,26 an additional cycle of review decision making is a complex process , involving many disciplines and players within an organization when introducing new health technologies , including medical devices.23 because of cultural and organizational differences , a recommendation for technology adoption in one local setting may not be appropriate in another , even when the scientific evidence , such as that supplied by hta reports , is the same . thus , careful consideration of the specific questions relevant to local needs , priorities , legislation , policies , values , norms , as well as human and material resources , is as necessary as acquiring impartial scientific evidence . the local hta decision support program developed initially by the department of surgery and surgical services of the calgary health region is one attempt to provide a model ( structure , processes , criteria , and decision tools ) for decision making that systematically gathers scientific , operational , and value - based information for consideration when introducing new health technologies . similar programs exist elsewhere.3134 any program that attempts to integrate context - free scientific evidence about a technology with context - sensitive information about the setting in which it will be used must be appropriate and relevant for each local organizational body . however , small rural and community hospitals or health authorities with fewer financial , personnel , and community resources may be poorly positioned for the investment required for de novo decision support program development . programs developed by large health care systems can be adapted and applied successfully to rural settings , provided that needed tools are provided for the adaptation process.35 this paper provides an adaptation process that can be used in lieu of de novo program development , much like processes for adapting clinical practice guidelines.36,37 the adaptation process described and used in this article involved six steps organized into three main phases : the set - up phase involved the development of a manual and identifying and educating interested departments , the review and adaptation phase involved assisting the departments to conduct an actual review and adaptation of the program , and the finalization phase involved program revision and evaluation of the adaptation process . during the set - up phase , we found a general dissatisfaction of each department with its traditional decision - making processes when introducing new health technologies . similar dissatisfaction has been observed by others10 and provides a good opportunity to restructure these processes . to do this , we found that provision of a clearly written document , the local health technology assessment decision support program : review and adaptation manual , was vital to educate members about the value of hta and a structured decision support program and to capture interest and buy - in . hta , therefore having well - written program documents and educational reference materials was vital to ensure their learning and understanding . a key document proved to be the table that explained the distinction between hta producers and hta users . we found that understanding this difference was important for understanding the rationale for a local hta decision support program . the program does not duplicate the efforts of hta producers ; it complements their work by acting as the receptor to use hta reports . the assessment of readiness tool was a critical element of the set - up phase . it required that participating departments demonstrate readiness for change and appoint local hta physician and administrative leaders . during the review and adaptation phase , the research team provided ongoing assistance to participating departments by means of phone , email , and face - to - face meetings and education . we ensured that we provided a variety of methods to solicit feedback , as recommended by others.38 we found that the points to consider questionnaire ( why , how , who , what , funding ) was essential to ensure that all important program review questions would be systematically discussed by reviewing departments . the request that each department appoint an hta physician leader and an hta administrative leader was crucial to the success of the project . while physicians were more focused on clinical evidence , training and credentialing issues , and other such clinically relevant topics , their administrative counterparts ensured that infrastructure implications , cost , and organizational impact were reviewed . similarly , the presence of relevant stakeholders , such as physicians , program managers , nurse clinicians , patient care managers , health services directors , health services managers , clinical product specialists , clinical safety leaders , researchers , financial analysts , and high - level health services administrators in the review and adaptation process can provide critical advantages . first , it ensures that those most likely to use the program have an opportunity to offer feedback and to identify problems before it is finalized . second , it gives administrators the opportunity to consider the impact on the organization of implementing the program and to begin preparing for its future adoption . third , the solicitation of practitioner feedback serves as the first wave of dissemination of the proposed program . fourth , experience elsewhere has shown that when surgeons guide the appraisal of new and emerging surgical technologies , the benefits of an evidence - informed approach in the provision of high - quality patient care are realized.39 the recommendation taken forward to the finalization phase was that the content ( what ) should be standardized across departments and an interdisciplinary team should review the application , but that administrative details ( who and how ) should be left to the discretion of each department . this reflects the importance participants saw in having a fair , standardized , and consistent decision support program for technology adoption across specialties within the institution while acknowledging flexibility of operation . participants demonstrated a strong desire to adopt the decision support program and to keep the review process going by engaging in regular face - to - face group collaboration and interaction . in fact , the review and adaptation and finalization phases can be repeated on a regular scheduled basis in a retreat setting , resulting in a continuous improvement cycle , as well as developing a community of practice , which is known to be effective in sustaining the viability and improvement of programs of interest.40 we identified several obstacles to long - term implementation of the program . first , staff turnover during the course of implementation can result in a continual need to educate and update decision makers . second , there is yet no process by which any cost savings realized by the adoption of new technologies can be attributed back to the operation of the program . third , shifting priorities of a health care system ( for example , funds diverted to pandemic flu inoculations ) may result in the cancellation or delay in the implementation of a recommended new technology . these obstacles are in addition to challenges encountered during the project itself , including finding common meeting times among all stakeholders , some resistance to change ( ie , the perceived fear that running a decision support program when introducing new health technologies may be labor intensive ) , and finding funding for the appointment of hta leaders and support personnel . benefits of the project included increased research - mindedness among clinicians , staff , and administrators who participated in the decision support program review and adaptation process , increased awareness of hta , increased understanding and appreciation of clinicians and administrators in the complexity of evidence - informed technology introduction process , and reduced barriers to implementation of the proposed program as a result of buy - in from the participating stakeholders . these observations will need to be confirmed as others use the decision - making program review and adaptation framework . in summary , we present a three - phase framework for reviewing and adapting a well - developed local hta decision support program for application in different settings . this adaptation process divides a complicated process into a discrete step - by - step approach , which can be repeated regularly to improve quality , and ensures that the adaptation process is systematic , rigorous , and interdisciplinary . we conclude that the adaptation of a preexisting program may reduce duplication of effort , save resources , raise health care providers awareness of hta , and foster constructive stakeholder engagement , which enhances the legitimacy of evidence - informed recommendations for introducing new health technologies . we encourage others to use this framework for decision support program adaptation and report their experiences .

purposeintroducing new health technologies , including medical devices , into a local setting in a safe , effective , and transparent manner is a complex process , involving many disciplines and players within an organization . decision making should be systematic , consistent , and transparent . it should involve translating and integrating scientific evidence , such as health technology assessment ( hta ) reports , with context - sensitive evidence to develop recommendations on whether and under what conditions a new technology will be introduced . however , the development of a program to support such decision making can require considerable time and resources . an alternative is to adapt a preexisting program to the new setting.materials and methodswe describe a framework for adapting the local hta decision support program , originally developed by the department of surgery and surgical services ( calgary , ab , canada ) , for use by other departments . the framework consists of six steps : 1 ) development of a program review and adaptation manual , 2 ) education and readiness assessment of interested departments , 3 ) evaluation of the program by individual departments , 4 ) joint evaluation via retreats , 5 ) synthesis of feedback and program revision , and 6 ) evaluation of the adaptation process.resultsnine departments revised the local hta decision support program and expressed strong satisfaction with the adaptation process . key elements for success were identified.conclusionadaptation of a preexisting program may reduce duplication of effort , save resources , raise the health care providers awareness of hta , and foster constructive stakeholder engagement , which enhances the legitimacy of evidence - informed recommendations for introducing new health technologies . we encourage others to use this framework for program adaptation and to report their experiences .

Introduction Materials and methods Setting and overview Set-up phase Review and adaptation phase Finalization phase Results Set-up phase Review and adaptation phase Finalization phase Discussion Conclusion

in anterior cruciate ligament ( acl ) reconstruction , the use of bone patellar tendon bone graft ( bptb ) has been decreasing due to increased anterior knee pain , weakness of extensor power and difficulty of kneeling position . instead , the use of hamstring tendon has been increasing1,2 ) ; however , the disadvantages of hamstring grafts include weaker fixation strength compared to bptb grafts and 24-week period for complete bone - to - tendon healing3 ) . adequate fixation has been considered essential for good outcomes of acl reconstruction and a variety of graft fixation methods have been introduced . the compression method allows for early firm fixation and healing with tight bone - tendon interface and enables close fixation to the acl footprint , but it has low failure load and stability4,5 ) . the expansion fixation mechanism can be advantageous in obtaining secure fixation because two cross pins transversely inserted through a graft provides a centrifugal pressure on the femoral tunnel , but treatment results depend on the press - fit of the graft , bone density around the femoral tunnel , and correct placement of cross pins through the graft tendon6,7,8 ) . the suspension methods are sub - classified into cortical , cancellous and , cortio - cancellous suspension methods9 ) . the cortical suspension method provides good fixation strength , but it has a bungee cord effect10 ) and a windshield wiper effect11 ) due to the long fixation point from the articular surface . the cortico - cancellous suspension method has strong stability and stiffness due to the use of a metaphyseal crosspin . to et al.12 ) reported that stiffness of the graft fixation complex was more affected by fixation method than the graft type in a cadaver study . intercondylar cortico - cancellous fixation close to the articular surface is expected to offer better results than the endobutton fixation . speirs et al.13 ) reported that the cortico - cancellous suspensory fixation method required a short graft length due to fixation of the cross pin within the metaphysis , the lowest creep and cyclic elongation amplitude , and the highest strength and stiffness of all the tested devices . in particular , the pinn - acl crosspin ( conmed linvatec , largo , fl , usa ) system was found to be the most rigid and strongest of all the tested reconstruction systems . therefore , the cortico - cancellous fixation method seems to have the advantages of short graft , stability , and stiffness , and the pinn - acl crosspin implant features the proprietary self - reinforced poly - l - lactide acid polymer enabling it to be the strongest bioabsorbable implant . the cross pin absorption begins in vivo approximately within 15 to 24 weeks after insertion , the continuous loop is composed of high strength polyethylene fiber , and the ultimate pullout tensile strength is 1700n14 ) ( fig . , we analyzed the mid - term results of acl reconstruction using the pinn - acl crosspin system , a cortico - cancellous suspension method device . we hypothesized that acl reconstruction using the pinn - acl crosspin system would significantly improve manual stability , anterior - posterior laxity measured by instrument , and functional score . from june 2007 to july 2008 , 43 of 46 patients with ruptured acls were evaluated . the patients underwent single - bundle acl reconstruction using a 4-strand semitendinosus tendon ( semi - t ) with the pinn - acl crosspin system . three patients were excluded due to conditions that might affect the results : articular cartilage damage and osteoarthritis in 1 patient , subtotal meniscectomy in 1 patient , and total meniscectomy in 1 patient . all included patients were male with a mean age of 28.7 years ( range , 18 to 54 years ) . the acl reconstruction was performed on the right knee in 24 patients and on the left knee in 19 patients . the mean follow - up period was 50 months ( range , 48 to 61 months ) . associated lesions were meniscal tear in 15 patients , which required meniscus repair in 5 and partial meniscectomy in 10 , and medial collateral ligament injury in 2 patients , which was treated by conservative methods . a 4-strand semi - t was used as a graft . a longer than 28 cm semi - t was harvested with an additional 2 cm of periosteum extension and was folded twice to be a 4-strand graft15 ) . the mean length of the graft was 7.2 cm and the diameter was 8.2 cm ( fig . depending on the diameter of the femoral tunnel , a positioning rod ( 8 mm or 9 mm ) of appropriate size was selected and assembled onto the u - guide . when the u - guide assembly was fully inserted , the laser etch marks on the positioning rod indicated the length of the femoral tunnel . after the u - guide was fully inserted into the tunnel , the u - guide body was rotated until the transverse cannula mounted on the u - guide body was directed toward the lateral condyle . each cross pin had a cortical length designed to occupy the cortical side of the transverse tunnel . a cross pin of proper length was determined as the one whose cortical length was less than , or equal to , the measured cortical tunnel length . after selecting the proper size cross pin , the hamstring graft construct ( i.e. , graft harness and graft bundle assembly ) was drawn into the knee using the graft passing guide pin . the lead suture was passed on the graft harness through the eyelet of the graft passing guide pin and , while maintaining lateral to medial alignment of the axis of the eyelet in the graft harness , the graft construct was passed into the tibial tunnel . it was firmly pulled on the graft construct until fullly seated in the femoral socket . a sheathed scope could be placed into the transverse cannula to visualize the alignment of the axis of the graft harness eyelet with the axis of the transverse tunnel . the crosspin driver was inserted into the proximal end of the implant and tapped with a mallet to move the implant through the transverse cannula and into the transverse tunnels . the corsspin implant , pressed into the lateral transverse tunnel , was advanced with the driver and a mallet until it stops while pulling out the transverse cannula . the position of the femoral tunnel was at the center of the footprint , directed 10:30 ( or 1:30 ) o'clock position . 3 ) . we tried to preserve the remnants of acl as much as possible . tibial side fixation was done using a bioabsorbable screw and then post - tied with a washer and screw . range of motion exercises were allowed at 2 weeks after surgery with extension locking braces applied . up to 90 of active range of motion was permitted for 4 weeks and full range of motion exercise was performed thereafter . from 6 weeks after surgery , patients followed a usual rehabilitation program17 ) . in patients who had undergone concomitant meniscal repair , anterior instability was evaluated on the day of admission using the lachman test and the kneelax3 arthrometer ( monitored rehab systems , haarlem , netherlands)18 ) . rotational instability was evaluated using the pivot - shift test with the patient under anesthesia immediately before surgery . functional knee score was evaluated using the international knee documentation committee ( ikdc ) subjective score and objective grade . student 's t - test was used to analyze parametric continuous data and chi - square test was used for non - parametric data . statistical significance was accepted for p - values of < 0.05 , and spss ver . 21.0 ( ibm corp . the range of motion was improved to normal without limitation at final follow - up . the lachman test results were improved form grade ii ( n=40 ) or iii ( n=3 ) to grade i ( n=3 ) or grade 0 ( n=40 ) at final follow - up ( p=0.001 ) . the pivot - shift test results were improved from grade i ( n=20 ) or ii ( n=10 ) to grade i ( n=8 ) or grade 0 ( n=22 ) at final follow - up ( p=0.001 ) . the ikdc subjective score was improved to 88.7 and the objective grades a and b were noted in 93% of the patients at final follow - up ( p=0.039 , 0.001 ) . anterior laxity measured by the kneelax3 arthrometer was improved from 6.74.5 mm preoperatively to 2.11.0 mm at final follow - up ( p=0.021 ) ( table 1 ) . three cases of complications occurred : a graft re - rupture was treated with revision reconstruction at 2 years after surgery ; a superficial infection on the tibial side was improved after debridement ; and a deep knee infection on the tibial side found at 2 weeks after surgery was identified as methicillin resistance staphylococcus aureus and treated with thorough arthroscopic debridement , massive irrigation , and 4 weeks of antibiotic injection . in this study , anterior instability evaluated using the lachman test and kneelax3 arthrometer , and rotational instability evaluated by the pivot - shift test were significantly improved after surgery . the functional knee score evaluated using the ikdc score & grade was also remarkably improved after surgery . seo et al.19 ) reported on 56 cases of acl reconstruction using the pinn - acl crosspin system . in the study , the side - to - side difference measured by the kt-1000 arthrometer was 2.4 mm at a mean of 14.5-month follow - up and the mean ikdc score was 87.3 . kong et al.20 ) reported on 56 cases of acl reconstruction using rigidfix , another crosspin system . in their study , the mean side - to - side difference was 2.1 mm and 98.2% of the cases had ikdc grades a or b. streich et al.21 ) reported about 25 cases of single bundle acl reconstruction with a single semi - t : the mean side - to - side difference was 0.94 mm , the pivot - shift test was grade 0 in 19 cases , more than grade 1 in 6 cases , and the mean ikdc score was 88.6 . seo et al.19 ) reported that the incidence of crosspin - femoral tunnel mismatch was high . to prevent this problem , they tried to firmly fix the drill guide sheath to the femur or create a short femoral tunnel to perform drilling at almost perpendicular direction to the cortical bone , but this technique requires further improvement of tools for minimization of complications . in our study , we encountered a mismatch between the harness hole within the femoral tunnel and the crosspin tunnel caused by rotation of the harness in bone tunnel . we solved this problem by firmly fixing the guide assembly and switching from a small sized stick to a larger one of the same size of the harness hole to make 90% of the harness hole coincide with the crosspin tunnel . yamazaki et al.22 ) and zantop et al.23 ) reported on the optimal length of the soft - tissue graft within a bone tunnel . they concluded that a graft length of over 15 mm does not influence the kinematic or structural properties of the knee joint . although lipscomb et al.24 ) indicated that slight or no deficits were observed in the knee flexor strength , most reports suggested that deficits of 10% to 20% in the knee flexor strength are common after acl reconstruction using both semi - t and gracilis tendon autograft25,26 ) . the single 4-strand semi - t tendon acl graft was shorter but could be made thicker , had biomechanical benefits , and decreased donor site morbidity by not harvesting the gracilis tendon27 ) . for a four - strand hamstring graft , at least a graft length of 7 cm is recommended15 ) ( fig . , the minimum required semi - t tendon length is 28 cm for a four - strand semi - t graft . it is possible to obtain an additional 2 cm of semi - t tendon by including the periosteum15 ) . in this study the mean graft length was 7.2 cm , the mean diameter was 8.2 mm , which was thicker than the semi - t / gracilis 4-strand graft . so , we could expect less decrease of the knee flexor strength without harvesting of the gracilis tendon , enhanced tendon healing to the bone tunnel due to inclusion of the periosteum in the graft and a thicker graft28 ) . the pinn - acl crosspin instrument could be one of the useful cortio - cancellous suspensory devices for femoral fixation , allowing for easy fixation with a shorter graft ( single semi - t 4-strand ) and reducing donor site morbidity . the other crosspin , rigidfix system , requires a 3-cm long graft in the femoral bone tunnel for adequate fixation . however , the pinn - acl crosspin needs a 1.5 - 2 cm graft for adequate fixation . one case of graft re - rupture occurred , but it was not related to the fixation method . regarding the one case of deep infection and another case of superficial infection , these two infections were improved after debridement . we suspect that the cause of infection might have been contamination of the guide assembly because the pinn - acl crosspin instrument was complex and composed of several small parts and guide assembly . so , we believe there is a need for thorough cleansing and sterilization including foreign body particle removal from the guide assembly before surgery . maletis et al.29 ) evaluated the incidence of postoperative acl reconstruction infections in the total 10,626 cases and concluded that graft choice would make a difference . the overall incidence of surgical site infection ( ssi ) was 0.48% ( n=51 ) , with 17 ( 0.16% ) superficial infections and 34 ( 0.32% ) deep infections . hamstring tendon autografts ( 0.61% ) had the highest incidence of deep ssis of the total graft types ( bptb autograft 0.07% vs. allograft 0.27% ) . after adjusting for age , sex , and body mass index , the likelihood of a patient with a hamstring autograft having a deep ssi was 8.24 times higher than someone receiving a bptb autograft . van tongel et al.30 ) reported the incidence of septic arthritis after acl reconstruction using semi - t / gracilis autograft was 0.51% . the limitations of this study are no inclusion of a control group , retrospective study design , and no performance of radiologic evaluation . this study demonstrated that good results can be obtained after single - bundle acl reconstruction using 4-strand semi - t tendon with the pinn - acl crosspin system at a minimum follow - up of 48 months . we believe the pinn - acl crosspin system is a useful instrument for shorter graft fixation .

purposethis study evaluated mid - term results of anterior cruciate ligament ( acl ) reconstruction using the pinn - acl crosspin system that allowed for short graft fixation.materials and methodsforty - three patients underwent single - bundle acl reconstruction with a 4-strand semitendinosus tendon graft using the pinn - acl crosspin system . femoral fixation was done using the pinn - acl crosspin system , and the tibial side was fixed with post - tie and a bioabsorbable interference screw . the mean follow - up period was 50 months . evaluation was done using the lachman test , pivot - shift test , international knee documentation committee ( ikdc ) score and grade . anterior displacement was assessed.resultsthere was improvement in the lachman test and pivot - shift test at final follow - up , form grade ii ( n=40 ) or iii ( n=3 ) to grade i ( n=3 ) or 0 ( n=40 ) and from grade i ( n=20 ) or ii ( n=10 ) to grade i ( n=8 ) or 0 ( n=22 ) , respectively . the mean ikdc score was 88.7 , and grade a and b were 93.0% at final follow - up . side - to - side difference was improved from 6.7 mm to 2.1 mm at final follow - up . complications occurred in 3 patients , a re - ruptured due to trauma at 2 years after surgery and a deep infection and a superficial infection.conclusionsthe mid - term follow - up results of acl reconstruction with the pinn - acl crosspin system were satisfactory . the pinn - acl crosspin can be considered as a useful instrument for short graft fixation .

Introduction Materials and Methods Results Discussion Conclusions

autosomal - recessive renal tubular dysgenesis ( ar - rtd ) is a rare inherited disorder caused by mutations in the genes encoding any of the components of the renin angiotensin system ( ras ) including renin , angiotensinogen , angiotensin - converting enzyme ( ace ) and type 1 angiotensin ii receptor . fetuses may die in utero , and most neonates die soon after birth with persistent anuria , respiratory failure and refractory hypotension . the histopathological hallmark of the disease is the absence or incomplete development of cortical convoluted proximal tubules [ 2 , 3 ] . since this disease was first described by allanson et al . in 1983 , > 100 cases of rtd with or without genetic defects have been reported . while most previous reports have described ar - rtd as a lethal disease , five recent cases have reportedly survived the neonatal period [ 58 ] . here , we report another case of ar - rtd associated with ace mutations who survived for over 2 years . the first and second pregnancies were uneventful but the third pregnancy was complicated by anhydramnios and was terminated at 28 weeks of gestation . the patient was born at 32 weeks and 4 days of gestation due to pre - term labor . the weight was 1960 g ( 1050th percentile ) and the height was 41.5 cm ( 1050th percentile ) . the baby required assisted ventilation immediately after birth due to respiratory distress , and inotropes were started at 1 h after birth due to hypotension . the patient developed a pneumoperitoneum due to ileal perforation at 7 h after birth and he underwent emergency ileostomy . hypotension was aggravated after surgery and the patient responded poorly to plasma expanders and inotropes . while urination began to increase since day 4 , hypotension persisted and was even aggravated by diuresis . since day 25 , his blood pressure became relatively stable , and inotropes were tapered off for 2 weeks . the peak serum creatinine level was 2.2 mg / dl ( 194 mol / l ) on day 6 . laboratory tests at the age of 14 days showed that the plasma renin activity was 22.3 ng / ml / h [ 6 ng / l / s , normal , < 15 ng / ml / h ( < 4 ng / l / s ) ] , serum ace < 5 u / l ( normal , 8.321.4 u / l ) , plasma angiotensin i 2114 pg / ml [ 2114 ng / l , normal , < 180 pg / ml ( < 180 ng / l ) ] , plasma angiotensin ii 61 pg / ml [ 61 ng / l , normal , < 50 pg / ml ( < 50 ng / l ) ] and serum aldosterone 371 pg / ml [ 371 ng / l , normal , 5194 pg / ml ( 5194 ng / l ) ] . mutational analysis of the ace gene revealed novel compound heterozygous mutations , c.g776a [ p.arg(cgc)259his(gag ) ] inherited from the mother and c.1454delc [ p.pro(cct)485leu(ctt)fs ] inherited from the mother . at the age of 1 month , oral fludrocortisone treatment ( 0.1 mg / day ) was started to correct intermittent hyponatremia and hypokalemia . the baby was discharged at the age of 4 months with a serum creatinine level of 0.6 mg / dl ( 53 umol / l ) . the patient is currently 2 years old with normal blood pressure and serum electrolyte levels and mild impairment of renal function [ serum creatinine 0.5 mg / dl ( 44 mol / l ) and estimated glomerular filtration rate 69 ml / min/1.73 m ( 1.15 ml / s/1.73 m ) ] . his weight and height are below the third percentile for his age , but his motor and cognitive functions are normal . to date , five cases surviving the neonatal period of ar - rtd have been reported [ 58 ] . all of the patients except patient 3 had one or more affected siblings , all of which died during the perinatal period . although all of the patients subsequently developed chronic kidney disease , their psychomotor and cognitive development was normal . case reports of ar - rtd patients surviving the neonatal perioda ckd , chronic kidney disease ; tpl , kidney transplantation ; pd , peritoneal dialysis ; tx , treatment . the patient 's elder sibling had been born at 33 weeks gestation and died of respiratory impairment just 15 h after birth . however , no autopsy was performed . spontaneous ileal perforation could have resulted from low perfusion pressure , and another case of rtd with multiple ileal perforation has previously been described . hypocalvaria is also the consequence of low blood pressure because skull membranous bones require high oxygen tension for normal growth [ 4 , 10 ] . renal hypoperfusion is probably the cardinal lesion leading to ar - rtd because the same tubular lesions can be produced secondarily by various fetal conditions associated with insufficient renal blood supply and consequent marked stimulation of the ras , including renal artery stenosis and fetal exposure to ras blockers . therefore , the presumed consequence of all mutations observed in ar - rtd is the absence of angiotensin ii production or function . however , the profiles of ras components vary according to the underlying genetic defect of individual patient . a patient with ace mutations revealed a high plasma renin activity , high active renin concentration and low ace concentration , as shown in the present case . in addition , the present case revealed markedly increased angiotensin i level with mildly increased angiotensin ii and aldosterone levels . the interpretation of the hormonal changes in the present case may be as follows : ( i ) production of angiotensin i , the substrate of ace , is markedly increased to overcome the defective ace activity , ( ii ) the missense ( p.r259h ) mutant ace has minimal residual function or other proteolytic enzyme systems are activated due to defective ace function and ( iii ) a small portion of markedly increased angiotensin i is converted to angiotensin ii by minimally functioning mutant ace or via other proteolytic enzyme systems ( figure 1 ) . the compensatory increase of angiotensin ii may be the cause of survival and milder course of the patient . schreiber et al . recommended an early trial of mineralocorticoids to overcome extreme hypotension and hyperkalemia in patients with rtd . possible sequential changes in the renin angiotensin aldosterone system in the present case . decreased or absent ace activity due to genetic mutations , compensatory overproduction of angiotensin i , the substrate of ace and conversion of a small portion of angiotensin i to angiotensin ii by minimally functioning mutant ( p.r259h ) ace or via other proteolytic enzyme systems such as chymases and tissue plasminogen activators ( t - pa ) . in conclusion , ar - rtd is not a uniformly fatal disease , although all of the surviving cases subsequently developed chronic kidney disease . collection of more surviving cases is required to find out possible prognostic factors and to develop effective treatment .

autosomal - recessive renal tubular dysgenesis ( ar - rtd ) is a rare disorder caused by a genetic defect in the renin angiotensin system . although ar - rtd has typically been known as a lethal disease due to refractory hypotension and renal failure immediately after birth , few cases have reported survival of the neonatal period . we report here an additional case of ar - rtd , who had novel ace mutations and survived over 2 years and provide a review of the five previously reported surviving cases . in conclusion , ar - rtd is not a uniformly fatal disease , although factors affecting the survival remain unknown .

Background Case report Discussion

patients with ibd should be periodically examined regarding their dermatologic conditions . in a previous report from iran , the prevalence of dermatological manifestations was reported to be 5.9% in patients with ibd with a higher rate in crohn s disease ( 7.29% ) compared with patients with ulcerative colitis ( 4.07% ) . they were more common in women ( 52% ) than in men ( 48% ) . one of the rare dermatological manifestations in patients with ibd is pyoderma gangrenosum . which is more common in patients with ulcerative colitis . since pyoderma gangrenosum is a rare occurrence , its explicit prevalence is unknown , but generally it has been estimated to occur in 3 - 10 million patients annually . in iran , the prevalence of pyoderma gangrenosum in patients with ulcerative colitis has been reported to be 1.4% . the diagnosis of pyoderma gangrenosum is based on physical examination , and examining the lesions regarding its type , number , size , and location as well as associated symptoms of ulcerative colitis . most pustular lesions in patients with ibd should be considered as pyoderma gangrenosum variants and be treated accordingly . even though histopathologic examination is not deemed diagnostic for pyoderma gangrenosum , skin biopsy should be performed to rule out other conditions simulating pyoderma gangrenosum . pyoderma vegetans is a sign of ibd , but rarely occurs in iranian patients . in case of facing pyoderma vegetans in a patient without significant medical history , the mean age for the onset of dermatological manifestations in iranian patients with ibd is 31 years . the patient is a known case of ulcerative colitis limited to her left colon for 15 years under irregular treatments . she was receiving unknown herbal medications for a long time and discontinued her standard treatments in the past three years . she had intermittently developed skin lesions diagnosed as pyoderma gangrenosum in her shoulder , thigh , and genital areas during the past 4 years ( figure 1 ) . ( a ) pyoderma gangrenosum on the right thigh , ( b ) pyoderma gangrenosum on the shoulder , ( c ) pyoderma gangrenosum on the genital area six months before admission to our center , she developed a small mucosal lesion in her nose . she was referred to shariati hospital gastrointestinal clinic because of the rapid growth of the lesions and unresponsiveness to local treatments used by her dermatologist . the only remarkable findings were old skin scars on her extremities and genital area and a lobular dermato - mucosal lesion measured 345 cm in her left nasal lumen ( figure 2 ) . ( a ) the dermato - mucosal lesion in her nose in the first month , ( b ) the dermato - mucosal nasal lesion in month 6 , ( c ) scar of the skin lesion after surgery laboratory assays showed white blood count ( wbc)=6,300/mm , hemoglobin=10.6gr / dlit , platelet count=405,000/mm , esr=61 mm 1st hr , crp=37mg / l with normal stool smear and culture . during the preceding 6 months , the dermatologist who referred the patient had injected corticosteroids into the lesion several times . oral cyclosporine followed by dapsone was administered by the dermatologist with no significant effect on her nasal lesion . since the lesion was large and patient complained of respiratory difficulty , surgical intervention was done and the lesion was excised completely . ( a , b ) microscopic features of the verrucous plaques are acanthotis and papillomatous hyperplasia of epidermis along with multiple micro - abscesses ( pustules ) in dermis ( h&e stain , original magnification 60x ) , ( c , d ) higher power view of the lesion shows acanthotic papillomatous epidermis and subepidermal micro - abscess ( pustule ) ( h&e stain , original magnification 150x ) . no evidence was detected in favor of cytomegalovirus or clostridium difficile on laboratory or pathological examination . after initial evaluation and ruling out latent infections such as tuberculosis , intravenous infliximab ( 300 mg ) was started on weeks 0 , 2 , and 6 and then every 8 weeks . simultaneously oral asacol ( 4.8 grams per day ) was started and she underwent regular monitoring every 8 weeks until week 48 of injection . after 2 months , the clinical symptoms improved significantly and in a 1-year follow - up no recurrence of the nasal lesion was found . in case of simultaneous pyoderma gangrenosum and ulcerative colitis , treatments are delivered directly targeting the skin lesions as well as systemic agents to control ulcerative colitis . topical therapeutics include highly potent steroids , calcineurin inhibitors ( tacrolimus , pimecrolimus ) , human platelet releasing growth factor , and intralesional injection of cyclosporine . systemic treatment for pyoderma gangrenosum involves cyclosporine ( 3 - 5 mg / kg / day ) which is effective for extensive pyoderma gangrenosum and is usually administered with steroids . in most cases , cyclosporine could be applied instead of steroids . dapsone ( maximum dose of 200 mg / day ) is effective in mild cases . when the patient does not respond to routine treatments , infliximab which is a chimeric anti - tumor necrosis factor alpha antibody is an appropriate option . however , it is mandatory that the patient be evaluated regarding latent / active infections such as tuberculosis and be monitored during treatment with infliximab in terms of appearance of infective signs . despite various treatments reported in the literature , an exact treatment guideline does not exist for pyoderma gangrenosum . in the presented patient , in view of the presence of active colitis ( evident in colonoscopy ) and mucosal lesion of pyoderma vegetans in her nose associated with other dermatologic manifestations of pyoderma gangrenosum , intravenous infliximab ( 300 mg , 5 mg / kg ) with oral asacol ( 4.8 gr per day ) was initiated . after 2 months , complete resolution of symptoms as well as improvement in macroscopic and microscopic views in colonoscopy was observed . in a one - year follow - up , it seems that infliximab was effective not only for her ulcerative colitis signs , but also on extra - intestinal manifestation ( i.e. , pyoderma vegetans ) .

some dermatologic manifestations are common in ulcerative colitis ( uc ) . herein , we present a 36-year - old woman with ulcerative colitis and uncommon nasal mucosa pyoderma vegetans . the patient presented to our hospital with symptoms of active colitis and a concomitant 345 cm dermato - mucosal lesion in her left nasal lumen . after surgery of the mucosal lesion , the treatment for her active colitis was initiated with intravenous infliximab and oral asacol . after a 1-year follow - up , no sign of recurrence favoring mucosal lesion was noted and symptoms of ulcerative colitis were managed properly .

INTRODUCTION CASE REPORT DISCUSSION CONFLICT OF INTEREST

sepsis is the main cause of mortality in pediatric intensive care units ( picus ) . it is caused by numerous infectious agents , inducing multiple organ dysfunction syndrome ( mods ) , multiple organ failure ( mof ) , and even death . several studies have demonstrated that the severity of sepsis , as well as early diagnosis and prognosis were directly related to mortality . early diagnosis and prognosis are essential to effectively control sepsis , prevent the incidence of mods or mof , and reduce mortality in children with sepsis . currently , the second - generation pediatric index of mortality ( pim-2 ) or pediatric risk of mortality score ( prism ) are used to assess the severity and prognosis of children with sepsis internationally , while pediatric critical illness score ( pcis ) is more commonly used in china . pcis is based on patients heart rate , blood pressure , pao2 , ph , na , k , cr , and hb . a lower pcis score indicates higher disease severity . in addition , a few non - specific inflammatory markers , such as cd15s , nt - probnp , soluble urokinase plasminogen activator receptor ( supar ) , procalcitonin ( pct ) , high - sensitivity c - reactive protein ( hs - crp ) , and pancreatic stone protein ( psp ) are established markers for prognostic evaluation of patients with sepsis [ 1012 ] . baseline procalcitonin levels are linked to severity of pediatric sepsis , while the persistent elevation in procalcitonin despite therapy are associated with increased mortality risk scores . crp , which is one of the most widely available , most studied , and most used laboratory tests for bacterial infection , has the best diagnostic accuracy when combined with another infection marker during the early phases of sepsis . recent studies suggest that psp is a possible biomarker of multiorgan failure and mortality in sepsis . however , its prognostic value in children with sepsis is not entirely clear . in this study , we conducted a prospective analysis of 214 children with sepsis , to investigate the prognostic value of pct , hs - crp , and psp . we enrolled 214 children with sepsis admitted to intensive care units ( icu ) of our hospital between march 2014 and october 2015 . every patient was diagnosed with sepsis according to clinical criteria defined in international sepsis definitions conference in 2001 . severe sepsis was diagnosed when organ dysfunction , hypoperfusion , or hypotension including lactic acidosis , oliguria , or acute altered mental status occurred in septic patients . patients enrolled included 99 males and 115 females , with an average age of 4.61.5 years . all the patients in this study signed informed consent , which was approved by the ethics committee of the first people s hospital of yichang . age , sex , body height , weight , body mass index ( bmi ) , blood pressure , and surgical history were recorded by specialists in the icu . pcis was evaluated by two specialists . if the two scores differed by more than 5 points , another icu physician was invited to perform the final assessment . supernatants were obtained after centrifugation ( 4c , 3,000 rev / minutes , 10 minutes ) and stored at 80c until further analysis . the serum levels of pct and hs - crp were tested by microparticle enzyme immunoassay ( meia ) . continuous variables were expressed as mean standard deviation ( sd ) , and categorical variables were displayed as counts or percentages . student s t - test was used for the analysis of continuous variables and -test for categorical variables ; p<0.05 was considered significant . spearman correlation was used to analyze the relationship between pct , hs - crp , psp , and pcis . multivariate logistic regression was used to analyze the risk factors for 28-day mortality in patients with sepsis . receiver operating characteristic ( roc ) analysis was used to compare the prognostic value of pct , hs - crp , and psp in children with sepsis . furthermore , standard indices of validity , such as youden index , sensitivity , and specificity were calculated based on the roc results . we enrolled 214 children with sepsis admitted to intensive care units ( icu ) of our hospital between march 2014 and october 2015 . every patient was diagnosed with sepsis according to clinical criteria defined in international sepsis definitions conference in 2001 . severe sepsis was diagnosed when organ dysfunction , hypoperfusion , or hypotension including lactic acidosis , oliguria , or acute altered mental status occurred in septic patients . patients enrolled included 99 males and 115 females , with an average age of 4.61.5 years . all the patients in this study signed informed consent , which was approved by the ethics committee of the first people s hospital of yichang . age , sex , body height , weight , body mass index ( bmi ) , blood pressure , and surgical history were recorded by specialists in the icu . pcis was evaluated by two specialists . if the two scores differed by more than 5 points , another icu physician was invited to perform the final assessment . supernatants were obtained after centrifugation ( 4c , 3,000 rev / minutes , 10 minutes ) and stored at 80c until further analysis . the serum levels of pct and hs - crp were tested by microparticle enzyme immunoassay ( meia ) . continuous variables were expressed as mean standard deviation ( sd ) , and categorical variables were displayed as counts or percentages . student s t - test was used for the analysis of continuous variables and -test for categorical variables ; p<0.05 was considered significant . spearman correlation was used to analyze the relationship between pct , hs - crp , psp , and pcis . multivariate logistic regression was used to analyze the risk factors for 28-day mortality in patients with sepsis . receiver operating characteristic ( roc ) analysis was used to compare the prognostic value of pct , hs - crp , and psp in children with sepsis . furthermore , standard indices of validity , such as youden index , sensitivity , and specificity were calculated based on the roc results . a total of 214 patients were enrolled in this study , with an average age of 4.61.5 years , and including 99 males and 115 females . after a follow - up of 28 days , no significant differences in patients age , sex , or weight were found between the dying and surviving groups of patients . pcis scores in the dying patients were lower than in the surviving group ( p<0.001 ) . further , the serum pct , hs - crp , and psp levels were higher in the dying group than in the surviving group of patients ( p<0.001 ; table 1 ) . as shown in figure 1 , pct was negatively correlated with pcis , r=0.4474 ( p<0.001 ; figure 1a ) ; hs - crp was negatively correlated with pcis , significantly ( r=0.3479 , p<0.001 ; figure 1b ) ; and psp showed a distinctly negative correlation with pcis ( figure 1c ) . the results indicated that the levels of pct , hs - crp , and psp were correlated with disease severity . as shown in table 2 , multivariate logistic regression analysis revealed pcis as a protective factor in the 28-day mortality of children with sepsis ( or=0.79 ; 95% ci=0.670.89 ) . furthermore , psp ( or=2.38 , 95% ci=1.465.76 ) was more sensitive than pct ( or=1.34 , 95% ci=1.022.25 ) , p=0.0031 . the serum concentrations of pct , hs - crp , and psp were higher in the dying group of patients ( p<0.01 ; figures 24 ) . to further determine the prognostic value of the three markers in children with sepsis , receiver operating characteristic ( roc ) curves were used to evaluate the predictive power . the results indicated that area under the curve ( auc ) values of pct , hs - crp , and psp were 0.83 ( 95% ci , 0.770.88 ) , 0.76 ( 95% ci , 0.700.82 ) and 0.73 ( 95% ci , 0.670.79 ) , respectively . as illustrated in table 3 , the sensitivity and specificity of cutoff values were calculated according to roc curve analysis . subsequently , the roc curve comparison revealed a higher prognostic value of pct compared with hs - crp and psp ( p<0.001 ) as shown in figure 5 . multivariate logistic regression was conducted to calculate the coefficients of these biomarkers when used in predicting mortality in patients with sepsis ( pct & hs - crp & psp ) = 12.3125 + 0.068404*pct + 0.058065*hs - crp + 0.012057*psp . the results of roc analysis of ( pct & hs - crp & psp ) are shown in table 3 . the prognostic value of the combined pct , hs - crp , and psp levels in children with sepsis was higher than the individual levels ( p<0.001 ; figure 5 ) . a total of 214 patients were enrolled in this study , with an average age of 4.61.5 years , and including 99 males and 115 females . after a follow - up of 28 days , no significant differences in patients age , sex , or weight were found between the dying and surviving groups of patients . pcis scores in the dying patients were lower than in the surviving group ( p<0.001 ) . further , the serum pct , hs - crp , and psp levels were higher in the dying group than in the surviving group of patients ( p<0.001 ; table 1 ) . as shown in figure 1 , pct was negatively correlated with pcis , r=0.4474 ( p<0.001 ; figure 1a ) ; hs - crp was negatively correlated with pcis , significantly ( r=0.3479 , p<0.001 ; figure 1b ) ; and psp showed a distinctly negative correlation with pcis ( figure 1c ) . the results indicated that the levels of pct , hs - crp , and psp were correlated with disease severity . as shown in table 2 , multivariate logistic regression analysis revealed pcis as a protective factor in the 28-day mortality of children with sepsis ( or=0.79 ; 95% ci=0.670.89 ) . furthermore , psp ( or=2.38 , 95% ci=1.465.76 ) was more sensitive than pct ( or=1.34 , 95% ci=1.022.25 ) , p=0.0031 . the serum concentrations of pct , hs - crp , and psp were higher in the dying group of patients ( p<0.01 ; figures 24 ) . to further determine the prognostic value of the three markers in children with sepsis , receiver operating characteristic ( roc ) curves were used to evaluate the predictive power . the results indicated that area under the curve ( auc ) values of pct , hs - crp , and psp were 0.83 ( 95% ci , 0.770.88 ) , 0.76 ( 95% ci , 0.700.82 ) and 0.73 ( 95% ci , 0.670.79 ) , respectively . as illustrated in table 3 , the sensitivity and specificity of cutoff values were calculated according to roc curve analysis . subsequently , the roc curve comparison revealed a higher prognostic value of pct compared with hs - crp and psp ( p<0.001 ) as shown in figure 5 . multivariate logistic regression was conducted to calculate the coefficients of these biomarkers when used in predicting mortality in patients with sepsis ( pct & hs - crp & psp ) = 12.3125 + 0.068404*pct + 0.058065*hs - crp + 0.012057*psp . the results of roc analysis of ( pct & hs - crp & psp ) are shown in table 3 . the prognostic value of the combined pct , hs - crp , and psp levels in children with sepsis was higher than the individual levels ( p<0.001 ; figure 5 ) . it develops into severe sepsis or septic shock , resulting in mods , mof , or even death . interestingly , recent studies suggest that nonspecific inflammation and abnormal expression of inflammatory cytokines rather than microbial infection leads to organ damage . early diagnosis and intervention has been shown to reduce the risk of sepsis - related mortality . in our study , the overall mortality was relatively high , which might be due to the high percentage ( 40.5% ) of post - surgery patients . its diagnostic and predictive value in patients with sepsis has been confirmed in several studies . found that serum pct was an early systemic marker of sepsis , which was correlated closely with mortality and inversely with serum calcium in bacterial peritonitis of hamster . found that serum pct increased sharply during early sepsis , and that the persistent levels decreased only after effective antibiotic treatment . in addition , nakamura et al . found that pct level was a good indicator of the severity of infection , with prognostic value in 393 adult patients with sepsis . similarly , zurek et al . reported that serum levels of pct were positively correlated with prognosis of pediatric sepsis . our results showed that pct levels were significantly higher in the dying patients than in the surviving group , and were negatively correlated with pcis , reminding us that pct was related to the severity of sepsis . furthermore , the results of roc curve analysis indicated that an auc value of 0.83 ( 95% ci , 0.770.88 , supported the prognostic value of pct in children with sepsis . high - sensitivity c - reactive protein ( hs - crp ) is a key inflammatory cytokine , which is present in small amounts under normal conditions . plasma hs - crp is an early marker of sepsis severity and poor prognosis , and is one of the risk factors for cardiovascular disease . pancreatic stone protein ( psp ) belongs to the family of lectin - binding proteins , and is constitutively secreted by pancreatic acinar cells into pancreatic juice along with zymogens . palmiere et al . reported that psp and pct were positively correlated with mortality in patients with or without sepsis , and that the psp levels were distinctly higher than in sepsis . peng et al . observed a significant positive correlation between psp and wbc , as well as serum pct levels . dynamic monitoring of psp was used to evaluate a patient s condition and assess their risk of death . our study showed that serum hs - crp and psp levels increased in dying patients and were negatively correlated with pcis . these results indicated that serum hs - crp and psp levels were correlated with the severity of sepsis . furthermore , multivariate logistic regression analysis revealed that both hs - crp and psp were independent risk factors for pediatric sepsis , with hrs of 1.79 ( 95% ci , 1.312.42 ) and 2.38 ( 95% ci , 1.465.76 ) . in addition , roc analysis showed that both hs - crp and psp levels were appropriate for clinical application . it is unlikely that any single biomarker is a predictor of outcomes in the pediatric population . the complexity of interactions driving host immune response and genetic variation suggests that multiple biomarkers are involved in predicting outcomes . stratification of pediatric patients based on their genome expression is a reasonable approach to identify high- and low - risk groups . in our study , we used multivariate logistic regression to calculate each index before using the three markers : ( pct & hs - crp & psp ) = 12.3125 + 0.068404*pct + 0.058065*hs - crp + 0.012057*psp . the roc curve analysis yielded an auc value ( pct & hs - crp & psp ) up to 0.92 , which was clearly superior to pct , hs - crp , or psp alone . technological advances facilitate testing of multiple inflammatory cytokines rapidly and sensitively using small amounts of serum sample . therefore , the joint detection of pct , hs - crp , and psp clearly improves the sensitivity and specificity of prognosis in children with sepsis , and represents a useful serum biomarker . our study found that serum pct , hs - crp , and psp levels were promising biomarkers of risk and useful clinical tools for risk stratification of pediatric sepsis . furthermore , the combination of serum pct , hs - crp , and psp is potentially a very useful biomarker with high sensitivity and specificity , and remarkable prognostic value in pediatric sepsis .

backgroundto investigate the prognostic value of procalcitonin ( pct ) , high - sensitivity c - reactive protein ( hs - crp ) , and pancreatic stone protein ( psp ) in children with sepsis.material/methodsa total of 214 patients with sepsis during hospitalization were enrolled . serum levels of pct , hs - crp , and psp were measured on day 1 of hospitalization and the survival rates of children were recorded after a follow - up of 28 days . pearson s correlation analysis was conducted to test the association of pct , hs - crp , and psp with pediatric critical illness score ( pcis ) . logistic regression models were used to analyze the risk factors contributing to patients death . the auc was used to determine the value of pct , hs - crp , and psp in the prognosis of patients with sepsis.resultsthe expression of pct , hs - crp , and psp in the dying patients was higher than in the surviving patients ( p<0.001 ) . pearson s correlation analysis showed that serum pct , hs - crp , and psp levels were negatively correlated with pcis ( p<0.001 ) . multivariate logistic regression revealed that pct , hs - crp , and psp were independent risk factors for the prognosis of patients with sepsis ( p<0.001 ) . roc analysis showed the auc values of pct , hs - crp , and psp were 0.83 ( 95% ci , 0.770.88 ) , 0.76 ( 95% ci , 0.700.82 ) , and 0.73 ( 95% ci , 0.670.79 ) , respectively . the combined auc value of pct , hs - crp , and psp , was 0.92 ( 95% ci , 0.870.95 ) , which was significantly increased compared with pct , hs - crp , or psp ( p<0.001).conclusionsthe combination of serum pct , hs - crp , and psp represents a promising biomarker of risk , and is a useful clinical tool for risk stratification of children with sepsis .

Background Material and Methods Patients Data collection Serum collection and testing Statistical analysis Results Baseline patient demographics Correlation of PCT, hs-CRP, and PSP with PCIS Analysis of risk factors for 28-day mortality Prognostic value of PCT, hs-CRP and PSP: ROC curves Discussion Conclusions

rna can play an important functional role in catalysis , e.g. ribozymes are rna enzymes that cleave rna phosphodiester bonds at specific sites ( 1 ) ; see ( 2 ) for an overview of potential therapeutic applications of ribozymes to cleave mrnas of oncogenes ( ras or bcr - abl ) and viral transcripts ( hiv-1 ) , to overcome drug resistance , control arthritis , etc . such is the case for the aminoglycoside and macrolide families of antibiotics , which disrupt rna translation in prokaryotes by targeting ribosomal ( rrna ) ( 3 ) . in contrast to mrna , noncoding rna ( ncrna ) is transcribed from genomic dna and plays a biologically important role , although it is not translated into protein . examples of ncrna include ribozymes , riboswitches , micro rna , small interfering rna ( 4 ) , trna , rrna , etc . riboswitches have recently been discovered to interact with small ligands and up- or down - regulate certain genes . breaker and co - workers ( 5 ) report the crystal structures of the add a - riboswitch and xpt g - riboswitch aptamer modules , which distinguish between bound adenine and guanine ; see ( 6 ) for an overview of bacterial riboswitches , and ( 7 ) for the structure , as given in the pdb code 1u8d of a guanine - responsive riboswitch with the metabolite hypoxanthine . rnaomics ( 8) , analogous to proteomics , concerns aspects of the secondary and tertiary structure , folding pathway , kinetics , comparison , function and regulation of all rna in a living organism . rnaomics requires the application of numerous existent tools , as well as the development of new computational methods . well - known rna computational tools include secondary structure prediction web servers mfold ( 9 ) and vienna rna package ( 10 ) , the sfold web server ( 11 ) to sample secondary structures according to the boltzmann probability distribution , the trnascan - se gene finder for trna ( 12 ) , multiple sequence alignment for the statistical detection of rna secondary structure msari ( 13 ) , dynamic programming pairwise sequence - structure alignment dynalign ( 14 ) , tertiary structure modeling tool mc - sym ( 15 ) , etc . only a few of the many important computational tools for rna structure prediction , gene finding , alignment , etc . have been listed . in this paper , we describe the web server rnaloss , based on the algorithm of clote ( 16 ) , which computes an aspect of the folding landscape of an rna nucleotide sequence s = s1 , , sn . given s , this algorithm runs in time o(n ) and space o(n ) , and computes for each k , the number of k - locally optimal secondary structures ( explained below ) . work by clote ( 16 ) was motivated by the following question , as has been suggested for proteins ( 17 ) : is it the case that rna has been under selective pressure to fold rapidly ? using the algorithm of the web server rnaloss , it appears that structural rna has a different folding landscape than random rna of the same dinucleotide frequency ; specifically , for small values of k , there appear to be fewer k - locally optimal secondary structures than in random rna . related , but distinct work has appeared in ( 1821 ) , for discussion see ( 16 ) . a secondary structure for an rna sequence s = s1, ,sn is an expression s = s1, ,sn involving dot , left and right parenthesis , which is well balanced , such that nucleotides corresponding to matching parentheses are either watson crick complements or gu wobble pairs . a secondary structure s on rna sequence s = s1, ,sn is defined to be a set of ordered pairs ( i , j ) , such that i + 3 < j and the following conditions are satisfied . watson crick or gu wobble pairs : if ( i , j ) belongs to s , then pair ( ai , aj ) must be one of the following canonical base pairs : ( a , u ) , ( u , a ) , ( g , c ) , ( c , g ) , ( g , u ) and ( u , g).threshold requirement : if ( i , j ) belongs to s , then j i > 3 ; i.e. there must be at least three unpaired bases in a hairpin loop.non-existence of pseudoknots : if ( i , j ) and ( k , l ) belong to s , then it is not the case that i < k < j < l.no base triples : if ( i , j ) and ( i , k ) belong to s , then j = k ; if ( i , j ) and ( k , j ) belong to s , then i = k. watson crick or gu wobble pairs : if ( i , j ) belongs to s , then pair ( ai , aj ) must be one of the following canonical base pairs : ( a , u ) , ( u , a ) , ( g , c ) , ( c , g ) , ( g , u ) and ( u , g ) . threshold requirement : if ( i , j ) belongs to s , then j i > 3 ; i.e. there must be at least three unpaired bases in a hairpin loop . non - existence of pseudoknots : if ( i , j ) and ( k , l ) belong to s , then it is not the case that i < k < j < l. no base triples : if ( i , j ) and ( i , k ) belong to s , then j = k ; if ( i , j ) and ( k , j ) belong to s , then i = k. a secondary structure is k - locally optimal if it has k fewer base pairs than the maximum possible number [ i.e. than in the nussinov jacobson optimal structure ( 22,23 ) ] , and yet no base pairs can be added without violating the definition of secondary structure ( e.g. without introducing a pseudoknot ) . to illustrate this notion , consider the rna sequence ggggccccc , which has three as the maximum possible number of base pairs , as given in the structure ( ( ( ) ) ) . there is only one structure having 3 bp , so the number of 0-locally optimal secondary structures is 1 . on the other hand , the latter are listed as follows : ( i ) ( ) .... ( ii ) ( .... ) .. ( iii ) ( ..... ) . the algorithm of ( 16 ) uses dynamic programming to compute , for each i < j and each k , the number of k - locally optimal secondary structures on the subsequence s = si, ,sj . additionally , the algorithm must keep track of visible nucleotides and positions , i.e. those external to any base pair [ for technical details see ( 16 ) ] . a secondary structure s on rna sequence s = s1, ,sn is defined to be a set of ordered pairs ( i , j ) , such that i + 3 < j and the following conditions are satisfied . watson crick or gu wobble pairs : if ( i , j ) belongs to s , then pair ( ai , aj ) must be one of the following canonical base pairs : ( a , u ) , ( u , a ) , ( g , c ) , ( c , g ) , ( g , u ) and ( u , g).threshold requirement : if ( i , j ) belongs to s , then j i > 3 ; i.e. there must be at least three unpaired bases in a hairpin loop.non-existence of pseudoknots : if ( i , j ) and ( k , l ) belong to s , then it is not the case that i < k < j < l.no base triples : if ( i , j ) and ( i , k ) belong to s , then j = k ; if ( i , j ) and ( k , j ) belong to s , then i = k. watson crick or gu wobble pairs : if ( i , j ) belongs to s , then pair ( ai , aj ) must be one of the following canonical base pairs : ( a , u ) , ( u , a ) , ( g , c ) , ( c , g ) , ( g , u ) and ( u , g ) . threshold requirement : if ( i , j ) belongs to s , then j i > 3 ; i.e. there must be at least three unpaired bases in a hairpin loop . non - existence of pseudoknots : if ( i , j ) and ( k , l ) belong to s , then it is not the case that i < k < j < l. no base triples : if ( i , j ) and ( i , k ) belong to s , then j = k ; if ( i , j ) and ( k , j ) belong to s , then i = k. a secondary structure is k - locally optimal if it has k fewer base pairs than the maximum possible number [ i.e. than in the nussinov jacobson optimal structure ( 22,23 ) ] , and yet no base pairs can be added without violating the definition of secondary structure ( e.g. without introducing a pseudoknot ) . to illustrate this notion , consider the rna sequence ggggccccc , which has three as the maximum possible number of base pairs , as given in the structure ( ( ( ) ) ) . there is only one structure having 3 bp , so the number of 0-locally optimal secondary structures is 1 . on the other hand , the latter are listed as follows : ( i ) ( ) .... ( ii ) ( .... ) .. ( iii ) ( ..... ) . the algorithm of ( 16 ) uses dynamic programming to compute , for each i < j and each k , the number of k - locally optimal secondary structures on the subsequence s = si, ,sj . additionally , the algorithm must keep track of visible nucleotides and positions , i.e. those external to any base pair [ for technical details see ( 16 ) ] . the web server rnaloss implements a new algorithm , described in ( 16 ) , running in o(n ) time and o(n ) space , which computes for a given rna sequence s = s1, ,sn and all k 0 , the number of k - locally optimal secondary structures for s. an rna nucleotide sequence may be input by uploading a fasta - format file or by entering a nucleotide sequence in the blank provided on the web server form . three tables are returned by rnaloss : the number of k - locally optimal secondary structures , the relative density of states ( i.e. the ratio of number of k - locally optimal structures over the total number of locally optimal structures ) and the minimum free energy ( mfe ) of a sample k - locally optimal secondary structure ( for each value of k , rnaloss computes a single k - locally optimal secondary structure , denoted here as sk , among the many possible k - locally optimal structures . since this feature was implemented for debugging purposes , the current version of rnaloss does not guarantee that sk has lowest mfe as evaluated by rnaeval , over all k - locally optimal secondary structures . for this reason , the energy of sample structures sk does not necessarily increase monotonically with increasing value of k ) . for the latter , mfe is computed using rnafold from the vienna rna package . figure 2 lists the number of k - locally optimal secondary structures as computed by rnaloss for type iii hammerhead ribozyme af170517 from rfam ( 24 ) . figure 3 presents the relative density of states for k - locally optimal secondary structures for af170517 . owing to algorithmic time and space constraints , the rnaloss web server immediately processes rna of length at most 60 nt , while for rna of length 61100 nt , the results are emailed to the user . currently , rnaloss refuses to process any sequence of length > 100 nt . current hardware supporting rnaloss web server consists of a beowulf - style cluster comprising 6 dell 1650 , 2 1300 mhz pentium iii , 2 gb ram with 4 apple xserve , 2 1333 mhz g4 , 2 gb ram and finally 6 dell 1850 , 2 2800 mhz xeon em64 t , 2 gb ram . pentium iii nodes are running redhat linux 9 , xeon em64 t nodes are running whitebox linux 3 and g4 nodes are running macos 10.2.8 . upon testing , structurally important rna , such as selenocysteine insertion sequence elements , precursor mrnas , type iii hammerhead ribozymes and trna , all have a markedly smaller number of k - locally optimal structures than that of random rna of the same dinucleotide frequency , for small and moderate values of k. since the free energy of k - locally optimal secondary structures is generally closer to that of the native state for small k , this suggests that structural rna has been optimized not only to have low folding energy ( 25 ) , but also to have relatively few potential kinetic traps . this suggests that rnaloss might be of use in designing rna sequences for rapid folding . users may input an rna sequence consisting of upper or lower case nucleotides a , c , g , t , u , either by uploading a fasta - format file ( a ) or by pasting a nucleotide sequence into ( b ) . output of web server rnaloss on type iii hammerhead ribozyme af170517 from rfam ( 24 ) . the web server rnaloss outputs a table of number of k - locally optimal secondary structures , for each possible value of k 0 ( shown here ) . additionally , tables for the relative density of states and mfe values of sample k - locally optimal secondary structures are displayed in the browser ( data not shown ) . column graph of relative density of states is obtained by clicking a hot link from the previous screen shot . for each value of k 0 , the ratio of number of k - locally optimal secondary structures over the total number of locally optimal secondary structures is displayed .

rnaomics , analogous to proteomics , concerns aspects of the secondary and tertiary structure , folding pathway , kinetics , comparison , function and regulation of all rna in a living organism . given recently discovered roles played by micro rna , small interfering rna , riboswitches , ribozymes , etc . , it is important to gain insight into the folding process of rna sequences . we describe the web server rnaloss , which provides information about the distribution of locally optimal secondary structures , that possibly form kinetic traps in the folding process . the tool rnaloss may be useful in designing rna sequences which not only have low folding energy , but whose distribution of locally optimal secondary structures would suggest rapid and robust folding . website : .

INTRODUCTION METHODS Definition WEB SERVER DISCUSSION Figures and Tables

central neuropathic pain ( central pain ) is pain caused by a disease or lesion in the central nervous system . central pain develops in about 8% of stroke patients ( andersen et al 1995 ) , 25% of patients with multiple sclerosis ( osterberg et al 2005 ) , and 40%50% of patients with spinal cord injury ( budh et al 2003 ; siddall et al 2003 ; werhagen et al 2004 ) and may develop secondary to brain and spinal cord tumors and other diseases affecting the central nervous system . central pain thus affects a large number of patients worldwide and often it has a substantial impact on the quality of life , mood , sleep , cognition , social relations , etc . central pain is characterized by ongoing pain , which may be burning , squeezing , pricking , and shooting and/or evoked types of pain , eg , pain evoked by light touch . the pain is located within an area of sensory disturbance covering various proportions of the deafferented body regions . treatment of central pain is often difficult and requires a different approach than nociceptive pain . central pain is usually treated with antidepressants , anticonvulsants , and opioids ; treatments which provide partial pain relief at best and which are often associated with side - effects . pregabalin is a novel , centrally acting neuromodulating agent that was approved by the us food and drug administration ( fda ) in 2004 for the treatment of painful diabetic peripheral neuropathy and post - herpetic neuralgia . in 2005 it was approved as adjunctive therapy in adults with partial seizures and recently it has been approved for the treatment of fibromyalgia . pregabalin is approved by the european medicines agency ( emea ) for the treatment of peripheral and central neuropathic pain in adults , as adjunctive therapy in adults with partial seizures , and for the treatment of generalized anxiety disorder ( gad ) in adults ( emea 2006 ; pfizer 2007 ) . pregabalin ( ( s)-3-(aminomethyl)-5-methylhexanoic acid ) is a structural derivative of the inhibitory neurotransmitter -aminobutyric acid ( gaba ) . pregabalin is structurally related to gabapentin and has a similar pharmacological profile and anticonvulsant and analgesic activity ( ben - menachem 2004 ) . the predominant mechanism of action is thought to be through its presynaptic binding to the 2 subunit of voltage - gated calcium channels which in turns leads to reduced release of neurotransmitters , eg , glutamate , substance p , and calcitonin gene - related peptide ( fehrenbacher et al 2003 ; sills 2006 ; li et al 2006 ; dooley et al 2007 ; taylor et al 2007 ) . such decrease in neurotransmitter release from synapses in several neuronal tissues in the spinal cord and brain is likely to attenuate neuronal hyperexcitability and abnormal synchronization and may thus explain its anticonvulsant , analgesic , and anxiolytic activity ( taylor et al 2007 ) . pregabalin does not appear to act through the gabaergic neurotransmitter system ( reviewed in , eg , ( sills 2006 ) and ( taylor et al 2007 ) ) and although it has been shown to act on voltage - gated potassium channels ( mcclelland et al 2004 ) , this mechanism of action is not thought to contribute significantly to the pharmacological profile ( sills 2006 ) . the pharmacokinetic and safety properties of pregabalin have been studied in healthy subjects and patients with renal impairment ( randinitis et al 2003 ) . the oral bioavailability is 90% and dose - independent , and pregabalin is rapidly absorbed in the fasting state with a tmax of 1 hour which is reduced by food consumption by 35% . food does not alter the area under the curve and has no clinically significant effect . pregabalin does not bind to plasma proteins and thus readily penetrates the blood - brain barrier . over 98% of pregabalin the elimination half - time is 4.86.3 hours but is increased in patients with renal impairment and dependent on the creatinine clearance . therefore , dose reduction is needed in patients with impaired renal function ( ie creatinine clearance < 60 ml / min ) ( randinitis et al 2003 ) ( table 1 ) . pregabalin is not metabolized in the liver and has no effect on the cytochrome p450 system or other liver enzymes and has no plasma protein binding consistent with the lack of interactions with other anticonvulsants , certain antidiabetics , and oral contraceptives ( ben - menachem 2004 ; tassone et al 2007 ) . additive adverse effects on cognitive and gross motor functioning have been seen with pregabalin co - administered with oxycodone , lorazepam , and ethanol , and concomitant treatment with pregabalin and a thiazolidinedione anti - diabetic agent may lead to an additive effect on edema and weight gain ( emea 2004 ; pfizer 2007 ) . pregabalin has in large published parallel - group design studies consistently been shown to relieve post - herpetic neuralgia ( dworkin et al 2003 ; sabatowski et al 2004 ; freynhagen et al 2005 ; van seventer et al 2006 ) and painful diabetic neuropathy ( lesser et al 2004 ; rosenstock et al 2004 ; freynhagen et al 2005 ; richter et al 2005 ) with a combined number needed to treat ( nnt ) for doses ranging from 300 mg to 600 mg of 3.9 ( 3.34.7 ) . for comparison , the nnt values in peripheral neuropathic pain are 2.3 ( 2.12.7 ) for tricyclic antidepressants , 2.7 ( 2.13.6 ) for opioids , 3.9 ( 2.76.7 ) for tramadol , 4.4 ( 2.517 ) for topical lidocaine , and 5.5 ( 3.414 ) for serotonin noradrenaline reuptake inhibitors , but differences in design and study population may make direct comparison of nnt values difficult ( finnerup et al 2005 ) . the total number of patients included 1028 exposed to pregabalin and 575 to placebo in the 300600 mg dose range . two studies in painful diabetic neuropathy reported by the european medicines agency in 2004 ( emea 2004 ) are still unpublished ; one study including 396 patients showed efficacy of pregabalin 300/600 mg daily , while a 3-armed study with pregabalin 600 mg ( n = 87 ) , amitriptyline 75 mg ( n = 88 ) and placebo ( n = 81 ) failed to show a significant pain - relieving effect with pregabalin ( p = 0.08 ) . the difference in mean endpoint score between pregabalin and placebo for all peripheral neuropathic pain studies ranged from 0.18 to 1.57 points for the 300 mg daily score and from 0.64 to 2.02 points for the 600 mg daily score ( emea 2004 ) . there was no effect of pregabalin 75 mg daily and inconsistent efficacy for 150 mg daily . the first studies on pregabalin ( dworkin et al 2003 ; lesser et al 2004 ; rosenstock et al 2004 ; sabatowski et al 2004 ) excluded patients who failed to respond to previous treatment with gabapentin , which may bias the efficacy outcome measures in favor of pregabalin ( finnerup et al 2005 ) , but more recent trials without this exclusion criterion have comparable nnt values ( freynhagen et al 2005 ; richter et al 2005 ; van seventer et al 2006 ) . somnolence is a frequent adverse event present in 20%30% and subanalyses have shown that the pain relieving effect was larger in patients experiencing somnolence as an adverse effect ( emea 2004 ) . however , pregabalin still had a pain relieving effect in those patients not experiencing somnolence as an adverse effect ( emea 2004 ) . the published clinical trials found dose - dependent efficacy in pain relief as well as improvements in sleep and global impressions of changes ( integrating the effect of treatment and side - effects ) , and some studies also in quality of life measures ( lesser et al 2004 ; sabatowski et al 2004 ) and mood ( rosenstock et al 2004 ) . two randomized placebo - controlled trials have been conducted in central pain ( table 2 ) . the first study published is a parallel group design study in central neuropathic pain due to spinal cord injury ( siddall et al 2006 ) . a baseline week was followed by a 3-week titration period where pregabalin was increased up to 300 mg bid and a 9-week fixed dose period . concurrent pain medication was kept constant during the trial and included tricyclic antidepressants in 33% in the pregabalin group and 18% in the placebo group , opioids in 30% and 48% , and antiepileptic drugs except gabapentin in 11% and 9 % respectively . muscle relaxants ( including baclofen ) were used by 54% in the pregabalin group and 37% in the placebo group while benzodiazepines were used by 40% and 39% respectively . pain was evaluated daily on a numeric rating scale ( nrs , 010 ) and the primary efficacy measure was the weekly mean pain score at endpoint ( last week on study drug ) . the improvement in pain score from baseline ( pregabalin placebo ) was 1.53 ( 0.92 to 2.15 ) , similar to values observed in studies in peripheral neuropathic pain . the effect was significant from week 1 and remained so for the duration of the study . the nnt for 50% pain relief ( 7.1 ( 3.937 ) ) was higher than in most peripheral neuropathic pain studies ; however , the nnt for 30% pain relief ( 3.9 ( 2.59.1 ) ) and pain improvement on the patient global impression of change ( 2.9 ( 205.1 ) ) was similar to what is observed in post - herpetic neuralgia and painful diabetic neuropathy ( lesser et al 2004 ; rosenstock et al 2004 ; sabatowski et al 2004 ; freynhagen et al 2005 ; van seventer et al 2006 ) . recently , pregabalin was studied in a parallel group design study in patients with central pain following stroke or spinal cord injury ( vranken et al 2007 ) . the etiology was stroke in 19 patients ( of these thalamic lesion in 4 and brainstem infarction in 3 ) and spinal cord injury in 21 patients ( of these 11 had a complete injury ) . the diagnoses were evenly distributed among patients allocated to pregabalin ( n = 20 ) and to placebo ( n = 20 ) . for the diagnosis of central pain , the pain should be described as burning , paroxysmal episodes of shooting pain , or pain on light touch , and patients had to score above 12 on the leeds assessment of neuropathic symptoms and signs questionnaire ( lanss ) ( bennett 2001 ) . a baseline pain score above 6 ( visual analog scale , vas ) was required . in a flexible - dose regime and with no base - line period , patients received escalating doses of either pregabalin tablets 150 mg or matching placebo capsules bid titrated at 3-day intervals until a pain reduction of 1.8 on a vas was obtained , they reached the maximum daily dose of 600 mg , or had intolerable side - effects . the patients then remained on the final dose during the remainder of the study period , which was 4 weeks . patients treated with gabapentin discontinued this treatment at least 3 days before receiving study medication . pain medication that was continued during the trial was opioids in 53% , antidepressants in 30% , and carbamazepine in 10% . seventeen patients in the pregabalin group completed the study : nine received 600 mg and eight received 300 mg daily . the primary efficacy parameter was the pain intensity based on the average of 3 vas pain scores measured during the 24 hours prior to baseline and at the end of the 4-week treatment period . the improvement in pain score from baseline ( pregabalin placebo ) was 2.18 ( 0.57 to 3.80 ) with no difference in efficacy between the groups with spinal and brain injury . the nnt for 50% pain relief was low , 3.3 ( 1.914.3 ) , and for 30% pain relief it was 4.0 ( 2.0328 ) . in both studies , pregabalin was an add - on analgesic , which suggests that responses may be due to synergistic interactions . in painful diabetic neuropathy pregabalin was effective as monotherapy ( lesser et al 2004 ; rosenstock et al 2004 ; richer et al 2005 ) , and in both studies in central pain , effect sizes were similar regardless of whether patients used any concomitant analgesics ( siddall et al 2004 ; vranken et al 2007 ) . this would suggest that pregabalin is effective as monotherapy also in central pain , but potential synergistic effects need to be studied in appropriately designed studies . pregabalin is generally well tolerated with no contraindications except for known hypersensitivity to pregabalin or its components . the most common adverse reactions in the peripheral neuropathic pain studies were dose - related dizziness ( 22%38% ) and somnolence ( 11%25% ) , which does not resolve in about one third of patients . these side - effects pose a risk for accidental injury in the elderly . other adverse reactions were dry mouth , asthenia , blurred vision , ataxia , peripheral edema , and weight gain not limited to patients with edema . pregabalin treatment is not associated with clinical significant withdrawal syndromes ( frampton and foster 2006 ) , but abrupt discontinuation may cause insomnia , nausea , headache , or diarrhea and it is recommended to taper off during at least one week ( pfizer 2007 ) . in case of persistent blurred vision , a visual field testing and funduscopic examination may be considered , and patients are advised to report unexplained muscle pain particularly if accompanied with malaise and fever ( pfizer 2007 ) due to unsettled relation of pregabalin to rhabdomyolysis and creatine kinase elevations . pregabalin is recommended to be used with caution in patients with congestive heart failure ( nyha , ( new york heart association ) class iii and iv ) because of limited data in this population ( pfizer 2007 ) . in the two studies in central pain , the frequency of somnolence in the trial by siddall et al ( 2006 ) ( 41% in the pregabalin group and 9% in the placebo group ) was more common than in studies in peripheral neuropathic pain , which may be attributed to additive effects of concomitant medications such as baclofen and benzodiazepines in this patient population . in the study by vranken et al ( 2007 ) , somnolence occurred in 45% but was equally common in the placebo group . other more frequent adverse reactions in the pregabalin group in the siddall study included : dizziness observed in 24% , edema in 20% , asthenia and dry mouth each in 16% , constipation in 13% , amnesia in 10% , and blurred vision in 9% . the frequency of peripheral edema ( 10% ) was not higher than that observed in peripheral neuropathic pain . two patients in the placebo group and eight in the pregabalin group had a weight gain 7% . the median time to onset of somnolence and dizziness was within 8 and 6 withdrawal due to side - effects occurred in 15 pregabalin- and 9 placebo - treated patients . two adverse reactions were considered related to treatment : one had a withdrawal reaction 1 day following pregabalin discontinuation with increased spasticity and impaired coordination , and one had edema , hypervolemia and reduced platelet count caused by an infection . in the study by vranken et al ( 2007 ) , side - effects were mild to moderate with no difference in frequency of adverse reactions in the two study groups . pregabalin has in large published parallel - group design studies consistently been shown to relieve post - herpetic neuralgia ( dworkin et al 2003 ; sabatowski et al 2004 ; freynhagen et al 2005 ; van seventer et al 2006 ) and painful diabetic neuropathy ( lesser et al 2004 ; rosenstock et al 2004 ; freynhagen et al 2005 ; richter et al 2005 ) with a combined number needed to treat ( nnt ) for doses ranging from 300 mg to 600 mg of 3.9 ( 3.34.7 ) . for comparison , the nnt values in peripheral neuropathic pain are 2.3 ( 2.12.7 ) for tricyclic antidepressants , 2.7 ( 2.13.6 ) for opioids , 3.9 ( 2.76.7 ) for tramadol , 4.4 ( 2.517 ) for topical lidocaine , and 5.5 ( 3.414 ) for serotonin noradrenaline reuptake inhibitors , but differences in design and study population may make direct comparison of nnt values difficult ( finnerup et al 2005 ) . the total number of patients included 1028 exposed to pregabalin and 575 to placebo in the 300600 mg dose range . two studies in painful diabetic neuropathy reported by the european medicines agency in 2004 ( emea 2004 ) are still unpublished ; one study including 396 patients showed efficacy of pregabalin 300/600 mg daily , while a 3-armed study with pregabalin 600 mg ( n = 87 ) , amitriptyline 75 mg ( n = 88 ) and placebo ( n = 81 ) failed to show a significant pain - relieving effect with pregabalin ( p = 0.08 ) . the difference in mean endpoint score between pregabalin and placebo for all peripheral neuropathic pain studies ranged from 0.18 to 1.57 points for the 300 mg daily score and from 0.64 to 2.02 points for the 600 mg daily score ( emea 2004 ) . there was no effect of pregabalin 75 mg daily and inconsistent efficacy for 150 mg daily . the first studies on pregabalin ( dworkin et al 2003 ; lesser et al 2004 ; rosenstock et al 2004 ; sabatowski et al 2004 ) excluded patients who failed to respond to previous treatment with gabapentin , which may bias the efficacy outcome measures in favor of pregabalin ( finnerup et al 2005 ) , but more recent trials without this exclusion criterion have comparable nnt values ( freynhagen et al 2005 ; richter et al 2005 ; van seventer et al 2006 ) . somnolence is a frequent adverse event present in 20%30% and subanalyses have shown that the pain relieving effect was larger in patients experiencing somnolence as an adverse effect ( emea 2004 ) . however , pregabalin still had a pain relieving effect in those patients not experiencing somnolence as an adverse effect ( emea 2004 ) . the published clinical trials found dose - dependent efficacy in pain relief as well as improvements in sleep and global impressions of changes ( integrating the effect of treatment and side - effects ) , and some studies also in quality of life measures ( lesser et al 2004 ; sabatowski et al 2004 ) and mood ( rosenstock et al 2004 ) . two randomized placebo - controlled trials have been conducted in central pain ( table 2 ) . the first study published is a parallel group design study in central neuropathic pain due to spinal cord injury ( siddall et al 2006 ) . a baseline week was followed by a 3-week titration period where pregabalin was increased up to 300 mg bid and a 9-week fixed dose period . concurrent pain medication was kept constant during the trial and included tricyclic antidepressants in 33% in the pregabalin group and 18% in the placebo group , opioids in 30% and 48% , and antiepileptic drugs except gabapentin in 11% and 9 % respectively . muscle relaxants ( including baclofen ) were used by 54% in the pregabalin group and 37% in the placebo group while benzodiazepines were used by 40% and 39% respectively . pain was evaluated daily on a numeric rating scale ( nrs , 010 ) and the primary efficacy measure was the weekly mean pain score at endpoint ( last week on study drug ) . the improvement in pain score from baseline ( pregabalin placebo ) was 1.53 ( 0.92 to 2.15 ) , similar to values observed in studies in peripheral neuropathic pain . the effect was significant from week 1 and remained so for the duration of the study . the nnt for 50% pain relief ( 7.1 ( 3.937 ) ) was higher than in most peripheral neuropathic pain studies ; however , the nnt for 30% pain relief ( 3.9 ( 2.59.1 ) ) and pain improvement on the patient global impression of change ( 2.9 ( 205.1 ) ) was similar to what is observed in post - herpetic neuralgia and painful diabetic neuropathy ( lesser et al 2004 ; rosenstock et al 2004 ; sabatowski et al 2004 ; freynhagen et al 2005 ; van seventer et al 2006 ) . recently , pregabalin was studied in a parallel group design study in patients with central pain following stroke or spinal cord injury ( vranken et al 2007 ) . the etiology was stroke in 19 patients ( of these thalamic lesion in 4 and brainstem infarction in 3 ) and spinal cord injury in 21 patients ( of these 11 had a complete injury ) . the diagnoses were evenly distributed among patients allocated to pregabalin ( n = 20 ) and to placebo ( n = 20 ) . for the diagnosis of central pain , the pain should be described as burning , paroxysmal episodes of shooting pain , or pain on light touch , and patients had to score above 12 on the leeds assessment of neuropathic symptoms and signs questionnaire ( lanss ) ( bennett 2001 ) . a baseline pain score above 6 ( visual analog scale , vas ) was required . in a flexible - dose regime and with no base - line period , patients received escalating doses of either pregabalin tablets 150 mg or matching placebo capsules bid titrated at 3-day intervals until a pain reduction of 1.8 on a vas was obtained , they reached the maximum daily dose of 600 mg , or had intolerable side - effects . the patients then remained on the final dose during the remainder of the study period , which was 4 weeks . patients treated with gabapentin discontinued this treatment at least 3 days before receiving study medication . pain medication that was continued during the trial was opioids in 53% , antidepressants in 30% , and carbamazepine in 10% . seventeen patients in the pregabalin group completed the study : nine received 600 mg and eight received 300 mg daily . the primary efficacy parameter was the pain intensity based on the average of 3 vas pain scores measured during the 24 hours prior to baseline and at the end of the 4-week treatment period . the improvement in pain score from baseline ( pregabalin placebo ) was 2.18 ( 0.57 to 3.80 ) with no difference in efficacy between the groups with spinal and brain injury . the nnt for 50% pain relief was low , 3.3 ( 1.914.3 ) , and for 30% pain relief it was 4.0 ( 2.0328 ) . in both studies , pregabalin was an add - on analgesic , which suggests that responses may be due to synergistic interactions . in painful diabetic neuropathy pregabalin was effective as monotherapy ( lesser et al 2004 ; rosenstock et al 2004 ; richer et al 2005 ) , and in both studies in central pain , effect sizes were similar regardless of whether patients used any concomitant analgesics ( siddall et al 2004 ; vranken et al 2007 ) . this would suggest that pregabalin is effective as monotherapy also in central pain , but potential synergistic effects need to be studied in appropriately designed studies . pregabalin is generally well tolerated with no contraindications except for known hypersensitivity to pregabalin or its components . the most common adverse reactions in the peripheral neuropathic pain studies were dose - related dizziness ( 22%38% ) and somnolence ( 11%25% ) , which does not resolve in about one third of patients . other adverse reactions were dry mouth , asthenia , blurred vision , ataxia , peripheral edema , and weight gain not limited to patients with edema . pregabalin treatment is not associated with clinical significant withdrawal syndromes ( frampton and foster 2006 ) , but abrupt discontinuation may cause insomnia , nausea , headache , or diarrhea and it is recommended to taper off during at least one week ( pfizer 2007 ) . in case of persistent blurred vision , a visual field testing and funduscopic examination may be considered , and patients are advised to report unexplained muscle pain particularly if accompanied with malaise and fever ( pfizer 2007 ) due to unsettled relation of pregabalin to rhabdomyolysis and creatine kinase elevations . pregabalin is recommended to be used with caution in patients with congestive heart failure ( nyha , ( new york heart association ) class iii and iv ) because of limited data in this population ( pfizer 2007 ) . in the two studies in central pain , the frequency of somnolence in the trial by siddall et al ( 2006 ) ( 41% in the pregabalin group and 9% in the placebo group ) was more common than in studies in peripheral neuropathic pain , which may be attributed to additive effects of concomitant medications such as baclofen and benzodiazepines in this patient population . in the study by vranken et al ( 2007 ) , somnolence occurred in 45% but was equally common in the placebo group . other more frequent adverse reactions in the pregabalin group in the siddall study included : dizziness observed in 24% , edema in 20% , asthenia and dry mouth each in 16% , constipation in 13% , amnesia in 10% , and blurred vision in 9% . the frequency of peripheral edema ( 10% ) was not higher than that observed in peripheral neuropathic pain . two patients in the placebo group and eight in the pregabalin group had a weight gain 7% . the median time to onset of somnolence and dizziness was within 8 and 6 withdrawal due to side - effects occurred in 15 pregabalin- and 9 placebo - treated patients . two adverse reactions were considered related to treatment : one had a withdrawal reaction 1 day following pregabalin discontinuation with increased spasticity and impaired coordination , and one had edema , hypervolemia and reduced platelet count caused by an infection . in the study by vranken et al ( 2007 ) , side - effects were mild to moderate with no difference in frequency of adverse reactions in the two study groups . few other randomized trials have been performed in central pain ( finnerup and sindrup 2007 ) . the related drug gabapentin has been studied in spinal cord injury pain ( levendoglu et al 2004 ) . gabapentin up to 3600 mg relieved intensity and frequency of pain and several pain descriptors in 20 paraplegics with complete spinal cord injury . the tricyclic antidepressant ( tca ) amitriptyline has been studied in a three - way crossover study in post - stroke pain ( leijon and boivie 1989 ) . amitriptyline in doses up to 75 mg daily had a significant pain - relieving effect , which correlated with total plasma concentration . amitriptyline did not relieve nociceptive and neuropathic pain in spinal cord injury , but neuropathic pain was not evaluated separately ( cardenas et al 2002 ) . the anticonvulsant and sodium blocker lamotrigine reduced central post - stroke pain in doses of 200 mg / day as well as cold allodynia ( vestergaard et al 2001 ) , but in spinal cord injury pain , lamotrigine 200400 mg daily was not more effective than placebo in reducing pain , although a post - hoc analysis suggested that it may be effective in a subgroup of patients with incomplete injury and evoked pain ( finnerup et al 2002 ) . in multiple sclerosis , cannabinoids have been shown to relieve central pain ( svendsen et al 2004 ; rog et al 2005 ) . carbamazepine did not relieve post - stroke pain ( leijon and boivie 1989 ) and mexiletine ( chiou - tan et al 1996 ) and valproate ( drewes et al 1994 ) had no significant effect in spinal cord injury pain , but these studies all include a low number of patients with a risk of a type ii error . treatment of central and peripheral neuropathic pain is limited by side - effects and high potential for drug interaction . side - effects to tcas attributed to anticholinergic actions are common , eg , dry mouth , constipation , and urinary retention , and there is a risk of somnolence and confusion , orthostatic hypotension , and gait disturbances . the most serious side effect is cardiotoxicity ( ray et al 2004 ) , and tcas are contraindicated in patients with heart failure and cardiac conduction blocks , and ecg is therefore needed before initiating treatment . lamotrigine treatment is associated with dizziness , ataxia , diplopia , somnolence , nausea , and allergic exanthema and stevens - johnson syndrome , and very slow - dose escalation is recommended . side - effects to cannabinoids include dizziness , drowsiness , impaired psychomotor function , and other psychoactive effects like dysphoria , and there is an unsettled issue with respect to risk of precipitating psychosis or schizophrenia ( semple et al 2005 ) . other side - effects include confusion , especially in elderly patients , urinary retention , dizziness , and dysphoria as well as risk of abuse and addiction . it is therefore recommended to consider long - term opioids for non - cancer pain only when other reasonable therapies fail to provide adequate pain relief ( kalso et al 2003 ) . in summary , amitriptyline ( central post - stroke pain ) , lamotrigine ( central post - stroke pain but a negative trial in spinal cord injury pain ) , gabapentin ( spinal cord injury pain ) , and pregabalin ( spinal cord injury and central post - stroke pain ) , and cannabinoids ( central pain in multiple sclerosis ) have proven to be effective , but large - scale randomized controlled studies are lacking , and a treatment algorithm for central pain still needs to be based partly on established treatments for peripheral neuropathic pain for which tcas , serotonin - noradrenaline reuptake inhibitors , gabapentin / pregabalin , and opioids / tramadol have consistently shown efficacy ( finnerup et al 2005 ) . there is no evidence to suggest that pregabalin and gabapentin have different efficacy or side effects determined by nnt or nnh values ( finnerup et al 2005 ) . differences between the two drugs relates to slightly higher expenses for pregabalin at the moment but more favorable dosing ( twice daily dose possible ) and linear kinetics with pregabalin . thus , based on evidence for efficacy , gabapentin , pregabalin , and tcas consistently relieve peripheral neuropathic pain as well as central pain ( except for the lack of efficacy of amitriptyline in spinal cord injury mixed pain ) . of these , gabapentin and pregabalin may be considered the first - line drugs for the treatment of central pain due to their consistent efficacy , safety , and minimal potential for drug - drug interactions , and tcas a second line - treatment if no contraindications exist . possible third - line treatments for central pain include opioids and tramadol , cannabinoids in multiple sclerosis , lamotrigine , and serotonin - noradrenaline reuptake inhibitors , which have not yet been tested in central pain but have a better side - effect profile than tcas . in many cases , treatment provides no or only partial pain relief , and often combination therapy is used . there is a strong rational for combining drugs with different mode of actions ( backonja et al 2006 ) , but little clinical evidence . in one randomized trial , gabapentin and morphine combined achieved better analgesia at lower doses than with either drug alone ( gilron et al 2005 ) . the recommended dose of pregabalin is 75150 mg twice daily or 50100 mg 3 times a day in patients with a creatinine clearance of at least 60 ml / min . dosing is usually started at 75 mg once or twice daily and may be increased to 300 mg / day within 1 week based on efficacy and tolerability . patients with post - stroke pain may be more susceptible to medication than other patient populations . for that reason it is advisable in some patients to start with a low pregabalin dose of 25 mg and increase slowly . based on efficacy and safety , pregabalin is considered a first - line drug together with gabapentin in the treatment of central pain . pregabalin and gabapentin may especially have a primary role in patients with anxiety and sleep disturbances and in patients who are taking multiple drugs . somnolence , dizziness , and accidental falls may be a concern , especially in the elderly and in those treated with other drugs with cns - related side - effects .

central neuropathic pain ( central pain ) is treated with antidepressants , various anticonvulsants , opioids , and cannabinoids , but in many cases treatment is insufficient and associated with a range of side - effects . this review addresses a new treatment for neuropathic pain , the anticonvulsant pregabalin . we review the pharmacology , mode of action , pharmacokinetics , and safety of pregabalin as well as two randomized efficacy studies in central pain and a brief overview of efficacy in peripheral neuropathic pain . pregabalin appears to have efficacy in treating central pain comparable to that in peripheral neuropathic pain as well as efficacy of other recommended drugs for central pain . pregabalin also improves disturbed sleep and anxiety . pregabalin is well tolerated ; the most common side - effects are somnolence , dizziness , ataxia , and weight gain . pregabalin is suitable for patients on multiple drugs although there may be additive cns - related side - effects . thus , pregabalin has a primary role in central pain patients .

Introduction Pregabalin pharmacology, mode of action and pharmacokinetics Efficacy studies Peripheral neuropathic pain Central pain Safety and tolerability Discussion Conclusion

toxic cyanobacterial blooms in eutrophic lakes , ponds , and reservoirs are a common occurrence around the world [ 13 ] . cyanobacteria of the genera microcystis , anabaena , nostoc , and planktothrix produces a wide range of potent toxins , including a family of heptapeptide hepatotoxins , referred to as microcystins ( mcs ) . microcystins are the most frequently detected cyanobacterial toxins , which cause hepatotoxicity and tumor promotion in wild animals , livestock , and humans [ 2 , 4 , 5 ] . epidemiological studies of primary liver cancer in china and the death of 56 patients during a dialysis treatment in caruaru , brazil triggered worldwide concern about toxicity of mcs [ 4 , 5 ] . approximately 75 variants of mcs have been identified and mc - l ( leucine ) r ( arginine ) is the most common variant of mc worldwide [ 1 , 69 ] . limited studies in new zealand ( nz ) have reported the occurrence of the [ dha]mc - lr variant occurring with high frequency in nz waters [ 3 , 10 , 11 ] . microcystins are chemically stable over a wide range of temperature and ph , possibly as a result of their cyclic structure . the toxins are also resistant to enzymatic hydrolysis by some general proteases , such as pepsin , trypsin , collagenase and chymotrypsin . however , in the presence of natural microbial populations , degradation of mcs can take place . in 1994 , jones et al . successfully isolated from australian river water sphingomonas strain mj - pv ( acm-3962 ) , a single bacterial strain that utilized mc - lr as its sole source of carbon , and nitrogen needed for growth . further research led to the elucidation of mc - lr degradation pathways of the bacterial strain acm-3962 . two intermediate degradation products were identified , suggesting that at least three intracellular hydrolytic enzymes were involved in the degradation of mc - lr . the first enzyme identified in the degradation pathway , a metalloprotease named microcystinase , cleaves the aromatic ring of mc - lr at the arg - adda peptide bond . this step yields a linearized mc - lr , which has a 160-fold reduction in toxic activity compared with the parent mc - lr . next , a serine peptidase catalyzes the linearized mc - lr at the ala - leu peptide bond , producing a tetrapeptide . finally , the third enzyme , another metalloprotease , cuts the peptide bonds randomly resulting in undetectable peptide fragments and amino acids . further performed cloning and molecular characterization of four genes ( mlra , b , c , and d ) that encode the three hydrolytic enzymes plus a putative oligopeptide transporter , all involved in the mc degradation metabolic pathway of the sphingomonas strain acm-3962 . cyanobacterial blooms and mc production in nz water bodies have been investigated by wood who detected mcs in 102 water samples from 54 different locations . the samples collected from lake rotoiti , lake hakanoa , lake horowhenua , and lake waitawa in april 2003 contained high levels of mcs , ranging from 0.02 g ml to a maximum of 36,500 g ml . wood revealed the presence of [ dha]mc - lr , mc - lr , mc - rr , mc - ar , mc - fr , mc - la , mc - wr , mc - yr , and mc - ly from lake horowhenua , and mc - lr , mc - rr , mc - ar , mc - fr , mc - la , mc - wr , and mc - yr from lake rotoiti . somdee purified seven mc variants from lyophilized bloom samples ( 20 g each ) of microcystis aeruginosa collected from lake horowhenua in may 2005 , with [ dha]mc - lr , the major variant ( purity of 93% and total yield of 51.84 mg ) , along with moderate amounts of mc - lr , mc - rr , mc - dme - rr , mc - ar , mc - fr , and mc - yr . contamination of drinking water sources by cyanotoxins remains a serious threat to animal and human health and thus degradation of mcs by naturally occurring bacteria is an attractive bioremediation option for removing mcs from drinking and recreational water sources and supplies . the objectives of this research were to ( a ) isolate and identify natural aquatic bacteria from nz water bodies capable of degrading mcs , ( b ) ascertain optimal biodegradation conditions for the identified nz mc - degrading bacteria , and ( c ) determine the biodegradation pathway by the identified nz mc - degrading bacteria for [ dha]mc - lr , the most common mc variant in nz waters . water samples taken from lake rotoiti , lake rotorua , lake rotoehu , and lake horowhenua , during blooms of microcystis aeruginosa , were used as potential sources of mc - degrading bacteria . 10 ml samples of lake water were inoculated into 190 ml of a sterile mineral salts medium ( msm ) broth containing [ dha]mc - lr and mc - lr as the main food source for 5 days and incubated in the dark at 30c in a shaking incubator ( 200 rpm ) . mc - degrading bacteria were isolated by streaking serial dilutions of 10 to 10 onto peptone - yeast extract medium agar plates ( pyem ) and incubated at 30c . a single colony of each bacterial isolate was grown on 5 ml pyem broth overnight at 30c in a shaking incubator ( 200 rpm ) . 1 ml of overnight culture was inoculated into 19 ml of fresh msm broth containing mcs at a final concentration of 25 g ml and incubated at 30c in a shaking incubator ( 200 rpm ) for 7 days . a 1 ml sample was withdrawn at 1 day intervals , centrifuged ( 12000 rpm for 10 min ) , and the supernatant analyzed on hplc ( uv detector ) . sequencing of 16s rrna was carried out by esr , new zealand , using an abi prism bigdye terminator dna sequencing kit and analyzed on a model 3730xl abi dna sequencer ( applied biosystems ) . the dna sequences were compared with the genbank , embl , and djb prokaryote databases using the default settings of the fasta3 alignment programme through the ebi server . a mix of [ dha]mc - lr and mc - lr was considered ideal as a substrate for the biodegradation experiments ( determination of optimal degradation conditions and examination of biodegradative by - products ) , as extracts rich in [ dha]mc - lr have not previously been studied , and new zealand natural bloom sources were deemed more appropriate than pure commercial forms of mc . extraction and purification of [ dha]mc - lr and mc - lr mcs from lyophilized bloom samples were performed as described by somdee . the pure bacterial isolate nv-3 was cultured in a pyem broth for 36 h ( late exponential growth phase determined from bacterial growth curve experiment ) in a shaking incubator at 30c and 200 rpm . the bacterium was centrifuged at 12,000 rpm for 5 min ( 4c ) . the supernatant was decanted , and the pellet was resuspended in 0.05 m phosphate buffer , ph 7.0 . the final pellet was resuspended in 5 ml of sterile msm broth , and this bacterial culture was used for examining the effect of temperature , bacterial , and mc concentrations on mc degradation by the bacterium isolate nv-3 . sterile msm broth was added to the prepared bacterial culture to adjust the concentration of the stock culture to give an optical density of 1.0 ( od600 ) and bacterial concentration of approximately 1.0 10 cfu / ml . to establish the effect of temperature on mc degradation , 9 ml of the nv-3 bacterial culture was mixed with 1 ml of [ dha]mc - lr and mc - lr ( 25 g / ml final concentration ) . the experiment was carried out in triplicate at 6 different temperatures , 10 , 15 , 20 , 25 , 30 , and 35c , in a shaking incubator at 200 rpm . the biodegradation of mcs was monitored for each experiment over a period of 28 days . an aliquot ( 1 ml ) of the bacterial / cyanotoxin mix was withdrawn after 0 , 1 , 3 , 5 , 7 , 10 , 14 , 21 , and 28 days of incubation and centrifuged at 12,000 rpm for 10 min . the mc concentration was determined in the supernatant using hplc . using the optimum temperature for mc degradation , experiments to determine the effect of bacterial concentration on mc degradation were carried out at different bacterial concentrations with a fixed mc concentration of 25 g / ml . five bacterial concentrations were prepared od600 = 0.1 ( bacterial concentration approximately 7.9 10 cfu / ml ) , od600 = 0.3 ( 2.5 10 cfu / ml ) , od600 = 0.5 ( 4.9 10 cfu / ml ) , od600 = 1.0 ( 1.0 10cfu / ml ) , and od600 = 1.5 ( 1.45 10 cfu / ml ) , using the prepared bacterial culture and adding sterile msm broth until the required od at 600 nm was obtained . a 9 ml sample of each bacterial concentration was mixed with 1 ml of [ dha]mc - lr and mc - lr ( 25 g / ml final concentration ) . the experiments were carried out in a shaking incubator at the optimum temperature ( 30c ) and at 200 rpm . the optimum temperature and bacterial concentration were used to establish optimum mc concentration for bacterial degradation . 9 ml of the bacterial culture ( od600 = 1.0 ) was mixed with 1 ml of [ dha]mc - lr and mc - lr , yielding final mc concentrations of 1 , 10 , 25 , and 50 g / ml , and incubated in a shaking incubator at 30c and 200 rpm . the [ dha]mc - lr and mc - lr variants extracted and purified from natural algal bloom were used in the biodegradation assays for detection of mc - degradation by - products by the nv-3 isolate . the pure nv-3 isolate was transferred to 19 ml of fresh msm broth , containing mcs at a final concentration of 25 g ml and incubated in a shaking incubator at 30c and 200 rpm . samples ( 1 ml ) were taken every 6 h until 48 h , and the mc - degradation by - products were detected and analyzed using lc / ms - ms at cawthron institute , nelson , new zealand . the isolated bacterium ( nv-3 isolate ) was cultured in peptone - yeast extract broth for 36 h at 30c and 200 rpm . genomic dna was extracted using the wizard genomic dna purification kit ( promega ) and quantified by a biophotometer ( eppendorf ) with a260/280 ratio . and for mlrb , mlrc , and mlrd genes are described in ho et al . . the pcr reactions were composed of 1 ng genomic dna , 1 pmol of each primer , 1 pcr buffer ( invitrogen ) , 2 mm dntps ( invitrogen ) , 2.5 mm mgcl2 ( invitrogen ) , and 1.25 units of amplitaq gold dna polymerase ( applied biosystems ) , giving a final volume of 20 l . the amplification was performed on a programmable thermal cycler ( hybaid p2 thermal cycler ) with temperatures and times as previously described by saito et al . for mlra and were then purified using the wizard sv gel and pcr clean - up system ( promega ) , and both strands were directly sequenced on an abi-3730 automated sequencer ( applied biosystems ) , at allan wilson centre ( awc ) genome sequencing centre , massey university , nz . assembled sequences were aligned using a clustalw with mega 4.0 program ( retrieved december 10 , 2008 , from http://www.megasoftware.net/ ) and then subjected to a nucleotide blast search . water samples obtained from lake rotoiti , lake rotoehu , lake rotorua , and lake horowhenua were plated on msm broth with [ dha]mc - lr and mc - lr as the sole carbon and nitrogen source . a total of 27 isolates of different types , shapes , and colors of colony were selected ; however , only three isolates that were obtained from lake rotoiti , designated nv-1 , nv-2 and nv-3 , were truly able to break , down the mcs ( data not shown ) . nv-3 isolate showed greatest degradation activity and was used for characterization and further experiments . the 16s rrna sequence of the isolate nv-3 was determined and compared with the genbank , embl , and djb prokaryote databases . the databases revealed that the 16s rrna sequences of the nv-3 isolate resemble the sequences of sphingomonas strain md-1 ( ab110635 ) , with 100% sequence homology for 1436 continuous nucleotides , and exhibits 98.5% homology with 16s rrna of sphingomonas stygia ( ab025013 ) . the nv-3 isolate was classified as a sphingomonas sp . , indistinguishable from the sphingomonas strain md1 . the effect of temperature on the ability of nv-3 ( 1.0 10 cfu / ml ) to degrade 25 g / ml mcs was investigated . mc degradation by nv-3 began on day 1 under all temperatures tested ( figure 1(a ) ) ; however , the rate of mc degradation varied with temperature . the degradation rate was slowest at 10c ( 0.89 g / ml / day ) and steadily increased with increasing temperatures to 35c ( 8.30 g / ml / day ) . mc concentrations rapidly decreased at temperatures from 20 to 35c , with complete degradation occurring within 5 days ( figure 1(a ) ) . however , at these temperatures a noticeable drop off in degradation rate occurred after the initial rapid phase . the highest degradation rate was reached with temperatures of 30c ( 8.33 g / ml / day ) ; however , the rate of degradation during the initial rapid phase was similar between temperatures of 25 , 30 , and 35c and was calculated to be approximately 8.30 g / ml / day . these experiments demonstrated that the optimum temperature for nv-3 isolate biodegradation of [ dha]mc - lr and mc - lr variants was 30c . the optimum bacterial concentration of nv-3 isolate for degradation of 25 g / ml mcs was then investigated at 30c ( being the optimum temperature for mc degradation by nv-3 ) . bacterial concentrations of 7.9 10 , 2.5 10 , 1.0 10 , and 1.45 10 cfu / ml completely degraded the mcs within 3 days ( figure 1(b ) ) . however , the degradation rate was slow with the lowest bacterial concentrations 7.9 10 and 2.5 10 cfu / ml . after one day of incubation with 7.9 10 and 2.5 10 cfu / ml nv-3 isolate , the amount of [ dha]mc - lr remaining was 80% and 40% , respectively . by contrast , after incubation with the higher nv-3 isolate concentrations of 4.9 10 , 1.0 10 , and 1.45 10 cfu / ml , less than 20% of [ dha]mc - lr remained . the mc degradation rate in general increased with increasing bacterial concentration . at bacterial concentrations of 4.9 10 , 1.0 10 and 1.45 10 cfu / ml , the degradation rates were not significantly different with the same degradation rate of 8.33 g / ml / day . however , the degradation rate actually decreased slightly at the highest bacterial concentration of 1.45 10 cfu / ml . these experiments demonstrated that the optimum bacterial concentration for nv-3 isolate biodegradation of [ dha]mc - lr and mc - lr variants was 1.0 10 cfu / ml . the effect of variation in mc concentration on nv-3 isolate degradation capability was also investigated at 30c and nv-3 concentration 1.0 10 cfu / ml . at low mc concentrations ( 1 and10 g / ml ) , the toxins were completely degraded in one day , whereas at higher concentrations of toxins ( 25 and 50 g / ml ) degradation took longer , reaching undetectable levels by day 3 and 6 respectively ( figure 1(c ) ) . the rate of degradation for concentrations of 25 and 50 g / ml was equal at 8.33 g / ml / day . biodegradation of mcs was induced using a mixture of [ dha]mc - lr and mc - lr ( 25 g / ml final concentration ) with cell suspensions of the isolate nv-3 ( 1.0 10 cfu / ml ) . the toxin concentration began to decline , and two peaks , referred to as by - products a and b , were detected in a hplc chromatogram . the peaks corresponding to the by - products increased gradually , while the peak corresponding to the parent toxins decreased . the by - products from microbial catabolism were further analyzed using lc / ms - ms . [ dha]mc - lr is 14 mass units less than mc - lr due to the loss of a methyl group at mdha , and the m / z at 981.75 and 995.75 confirmed that [ dha]mc - lr , and mc - lr , respectively , were present in the biodegradation assay samples ( figures 2(a ) and 2(b ) ) . by - product a revealed the base peak at m / z 999 ( figure 2(c ) ) and was analogous to the linearized peptide of [ dha]mc - lr ( nh2-adda - d - glu - dha - d - ala - l - leu - d - measp - l - arg - oh ) . the ion spectra of the prominent ion at m / z 848.4 ( figure 2(c ) ) , which was from the loss of phch2chome from the linearized peptide of [ dha]mc - lr , confirmed the ring opening of [ dha]mc - lr . the biodegradation by - product b revealed the base peak at m / z 601.2 ( figure 2(d ) ) . the [ m+h ] ion 601.2 is the tetrapeptide of [ dha]mc - lr ( nh2-adda - d - glu - dha - d - ala - oh ) , 14 mass units less than the tetrapeptide of mc - lr microbial degradation reported in bourne et al . . dna fragments of the nv-3 isolate mlra ( 720 bp ) , b ( 340 bp ) , c ( 590 bp ) , and d ( 600 bp ) genes were pcr amplified and then directly sequenced . the dna sequences were investigated using blastn search . the mlra nucleotides ( 721 bp ) exhibited a 99% dna sequence similarity to the 807 base pair nucleotide sequence of the mlra gene from sphingomonas strain md-1 ( ncbi accession number ab114202 ) . the mlrb337 bp revealed a 94% similarity to the 448 nucleotide base pair sequence of the mlrb gene from sphingopyxis sp . lh21 ( dq423530 ) , whereas the nucleotide sequence of mlrc ( 588 bp ) and mlrd ( 597 bp ) genes was 99% and 97% similar to the respective genes ( with 666 bp and 671 bp ) from sphingomonas sp . the presence of microcystins ( mcs ) in freshwater is becoming an increasing problem and poses a potential threat to human health around the world . the mc toxin is well recognized as a stable and persistent compound ; however , reports have shown that mcs are vulnerable to break down by indigenous bacteria established in natural water [ 2 , 14 , 2225 ] . this is the first study to isolate and characterize indigenous mc - degrading bacteria in new zealand waters . we have demonstrated that the bacterium isolate nv-3 from lake rotoiti is able to utilise [ dha]mc - lr and mc - lr as a sole source of carbon and energy . on the basis of 16s rrna sequences the isolate nv-3 is indistinguishable from the sphingomonas strain md-1 from japan . the rate of mc degradation by any bacterial isolate , including nv-3 , relies mainly on the incubation temperature as well as bacterial concentration . biodegradation of mcs by the bacterium occurred under a wide range of temperatures between 10c and 35c . at 10c , the biodegradation was very slow and identical to that of the mc degrading - bacterium sphingopyxis strain lh21 , isolated from australia , suggesting that it would similarly not be able to degrade mcs at 4c . the ability of bacteria to degrade toxins in low temperatures is relevant to the degradation of toxins in winter , for example , when the water temperature is low . for nv-3 , increases in water temperature from 15c to 30c were associated with an increase in biodegradation rate ; however , temperatures higher than the optimum temperature ( 30c ) for nv-3 bacterial growth resulted in slightly decreased degradative ability . it is likely that at high temperatures , nv-3 bacterial cells are unable to produce mc - degrading enzymes , or the cells might be inactive or growing slowly . the highest rate of mc - degradation by the isolate nv-3 was achieved at 30c , a similar temperature observed for maximum mc - degradation by the sphingomonas strain y2 , isolated from lake suwa , japan , and for sphingopyxis strain tt25 isolated from australian waters , the highest rate was achieved at 25c . at the optimum temperature of bacterial growth , the bacterial metabolism is very active , producing a lot of enzymes responsible for mc degradation . by contrast , at temperatures that are lower or higher than that for optimum growth , bacterial metabolism and the production of biodegradation enzymes are presumably less active , slowing the rate of mc degradation . the degradation rate increased with increasing bacterial cell concentration ; however , concentrations above 1.0 10 cfu / ml resulted in a decrease in degradative ability . this decrease might be due to competition or inhibition between the cells at very high cell numbers , and , therefore , the optimum cell density is also crucial for toxin degradation . in this study , the optimum cell density of the bacterium isolate nv-3 , required for mc degradation experiments , was between 4.9 10 to 1.0 10 cfu / ml and the minimum number of cells required was approximately 7.9 10 cfu / ml . it is interesting that at the minimum cell density , mcs were completely degraded within 3 days , the same length of time taken with higher concentrations of bacteria . this confirms the ability of the bacterium isolate nv-3 to utilise the toxins as their own food and to multiply itself to a cell density sufficient to completely degrade the mcs . the effect of toxin concentrations on mc degradation by nv-3 was also examined . in this study , at the optimum temperature ( 30c ) and bacterial concentration ( 1.0 10 cfu / ml ) , the biodegradation rate increased with increasing concentrations of the toxins ( the mixture of [ dha]mc - lr , and mc - lr ) . the degradation rate by the bacterial isolate was identical ( i.e. , 8.33 g / ml / day ) for moderate to high concentrations of the toxins ( 25 g / ml to 50 g / ml ) . it is possible that as the sole carbon and nitrogen sources for bacterial growth , high concentrations of mcs were beneficial to growth of the isolated bacteria . however , the apparent inhibitory effects of very high toxin concentrations ( i.e. , > 50 g / ml ) and the limit to the amount of mcs that nv-3 can degrade need to be further investigated , as the effects on bacterial growth and metabolism are unknown . biodegradation studies of mcs have been mainly focused on the mc - lr variant since it is found worldwide and possesses high toxicity ( ld50 ( ip ) = 50 g / kg in mice ) [ 1 , 8 , 9 , 28 ] . other analogues of mcs such as mc - rr , yr , lw , and lf have also been examined [ 13 , 26 , 2935 ] . in new zealand waters it appears that [ dha]mc - lr is in greater quantity than mc - lr [ 3 , 10 , 11 ] . in this study , in addition to mc - lr , [ dha]mc - lr was used as a substrate to characterize the biodegradation pathway of [ dha]mc - lr using the bacteriumisolate nv-3 . previous studies have shown that at least three hydrolytic enzymes are involved in degradation of mc - lr [ 15 , 16 ] . our study has shown that the by - products a and b of [ dha]mc - lr ( figures 2(c ) and 2(d ) ) are degradation products equivalent to what happens to mc - lr ( figure 3 ) in an enzymatic pathway identical to that described by bourne et al . . it is important to note that the mc - degradation by - products , namely linearized peptides , tetrapeptides and peptide fragments are significantly less toxic than the parent molecules of mcs . demonstrated that the toxicity of the linearized peptides of mc - lr is reduced 160-fold compared with the parent compound , while other studies have demonstrated that tetrapeptide and amino acids are nontoxic . these findings strongly indicate that microbial degradation is a potentially safe and natural treatment for removing mcs from water . in summary , ( 1 ) bacteria were found in new zealand lakes with the ability to degrade [ dha]mc - lr and mc - lr as the sole carbon and nitrogen sources ; ( 2 ) 16s rna of the mc - degrading bacteria isolated were indistinguishable from a previously identified bacterium md-1 which was located in japan ; ( 3 ) optimal nv-3 degradation of 25 g / ml [ dha]mc - lr and mc - lr prepared form a natural algal bloom , occurred at 30c with bacterial concentration of 1.0 10 cfu / ml , and(4 ) the by - products a and b from biodegradation of [ dha]mc - lr and the detection of mlra , mlrb , mlrc , and mlrd genes in nv-3 genome indicate that degradation of [ dha]mc - lr is via a similar mechanism for degradation of mc - lr as described by bourne et al . [ 15 , 16 ] . this study has demonstrated that microcystin - degrading bacteria are present in new zealand water bodies , and that these bacteria could be used potentially on a larger scale for removing microcystins from water . the four gene sequences mlra , mlrb , mlrc , and mlrd obtained for sphingomonas nv-3 isolate have been deposited in genbank under accession numbers jn256930 , jn256929 , jn256928 , and jn256927 , respectively .

for the first time a microcystin - degrading bacterium ( nv-3 isolate ) has been isolated and characterized from a nz lake . cyanobacterial blooms in new zealand ( nz ) waters contain microcystin ( mc ) hepatotoxins at concentrations which are a risk to animal and human health . degradation of mcs by naturally occurring bacteria is an attractive bioremediation option for removing mcs from drinking and recreational water sources . the nv-3 isolate was identified by 16s rrna sequence analysis and found to have 100% nucleotide sequence homology with the sphingomonas mc - degrading bacterial strain md-1 from japan . the nv-3 isolate ( concentration of 1.0 108 cfu / ml ) at 30c degraded a mixture of [ dha7]mc - lr and mc - lr ( concentration 25 g / ml ) at a maximum rate of 8.33 g / ml / day . the intermediate by - products of [ dha7]mc - lr degradation were detected and similar to mc - lr degradation by - products . the presence of three genes ( mlra , mlrb , and mlrc ) , that encode three enzymes involved in the degradation of mc - lr , were identified in the nv-3 isolate . this study confirmed that degradation of [ dha7]mc - lr by the sphingomonas isolate nv-3 occurred by a similar mechanism previously described for mc - lr by sphingomonas strain mj - pv ( acm-3962 ) . this has important implications for potential bioremediation of toxic blooms containing a variety of mcs in nz waters .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

pancreatic heterotopia is defined as the presence , outside its usual location , of pancreatic tissue which lacks anatomical and vascular continuity with the pancreas proper ( 1 ) . the heterotopic pancreas ( hp ) is a relatively uncommon congenital anomaly , with an incidence between 0.55% and 13.7% in autopsy series and mean frequency between 1 and 2% . hp has been found in all age groups , predominantly in the sixth decade of life ( 2 ) . the usual locations of hp are in the stomach in 25 - 38% cases , the duodenum in 17 - 36% and the jejunum in 15 - 22% of cases . it is usually silent but it may become clinically evident when complicated by inflammation , bleeding , obstruction or malignant transformation ( 3 ) . symptomatic patients require surgical exploration in order to obtain a definitive diagnosis and to exclude malignancy . a 12 years old male child presented with severe abdominal pain and intermittent vomiting , not relieved with medications . usg showed telescopy of gut loop along with its mesentry into other infraumblical region at the level of anterior superior iliac spine suggestive of ileoileal intesusception . an ileal polyp was found to be the cause of intussusceptions which was removed along with small segment of adjacent bowel and sent for histopathological examination . surgical specimen of resected ileal polyp with adjacent bowel loop ( 1a ) cut surface of which was pale yellow ( 1b ) . histological examination revealed presence of pancreatic tissue in muscularis propria of ileum ( 1c ) ( h&e , x40 ) with overlying mucosa showing congestion and metaplasia ( 1d ) ( h&e , x40 ) on gross examination , the polyp was brown , oval sessile mass with a broad base measuring 63.52 cm ( fig . the histological examination revealed the presence of pancreatic tissue in the muscularis propria of ileum ( fig . 1c ) made up of pancreatic acini and dialated ducts interspersed by smooth muscle bundles ( fig . photomicrograph showing pancreatic acini and ducts ( h&e , x100 ) the patient had an uneventful recovery and remains asymptomatic postoperatively . as stated by hunt and bonesteel ( 5 ) the first case of heterotopic pancreas was reported by schultz in 1729 , and klob provided its histological confirmation in 1859 ( 6 ) . the reported incidence in autopsy studies is 0.5 - 13% ( 3 ) . in adults it is found mainly in the stomach , duodenum and jejunum , in much smaller proportions in the ileum and meckel s diverticulum , and it is rarely found in the esophagus , liver , gallbladder , omentum , lungs , mediastinum , fallopian tubes and umbilicus ( 2 ) . in adults the incidence is higher in males , while in pediatric patients the female gender prevails . the proposed theory is that during rotation of foregut in a fetus and fusion of dorsal and ventral parts of pancreas , small islands of pancreas are carried away and continue to develop at its aberrant location ( 2 ) . most patients with ectopic pancreas are asymptomatic and diagnosis is usually performed during radiological examination or endoscopy of the digestive tract or during surgical explorations motivated by other diseases ( 2 ) . when symptomatic , about 30% of total mimic clinical symptoms similar to diseases that affect the organ in which the heterotopia is located ( 3 ) . usually they present in the form of small yellowish nodules , ranging from 1 mm to 5 cm , typically covered by intact mucosa , and often exhibit a central hole representing exteriorization of the rudimentary pancreatic duct . however , lesions smaller than 1.5 cm do not usually show such an orifice ( 8) . the ectopic pancreatic tissue is detected more frequently in the submucosa and muscularis propria layers of the gastrointestinal tract and may be observed in the sub - serosa or even in the serosa of the affected segment ( 2 ) . the heinrich classification system is frequently used to classify heterotopic pancreas : type 1 ( containing acini , islets and ducts ) , type 2 ( acini and ducts , no islets ) and type 3 ( ducts alone ) ( 9 ) . the preoperative imaging studies ( ultrasonography , endoscopic ultrasonography and computerized tomography ) are not very specific ( 3 ) . hence , in the majority of cases , the diagnosis is made by histological evaluation following resection of a symptomatic or suspicious lesion ( 10 ) . the management of asymptomatic , histologically verified heterotopic pancreas or those found incidentally during other surgery is under debate . although , in the majority of the cases of heterotopic pancreas reported surgical resections were done ; endoscopic mucosal removal can be an attractive , less invasive option for the resection of accessible lesions ( 3 ) . although there have been studies describing clinicopathological analysis of patients presenting with heterotopic pancreas(2,10 ) , ileal heterotopic pancreas has been rarely reported in children . heterotopic pancreas is a rare congenital lesion , often diagnosed incidentally on histopathological examination and should be considered in the differential diagnosis of intestinal mass lesions .

heterotopic , aberrant or ectopic pancreas is defined as the presence of pancreatic tissue in topographic anomaly , with no anatomical , neural or vascular connection to the normal pancreas . it is a rare condition found mainly in stomach , duodenum and jejunum . ileal heterotopic pancreas is an uncommon condition and has been rarely reported in children so far . hereby we report a case of heterotopic pancreas presenting as ileal poyp leading to ileoileal intussusception in a 12 year child .

INTRODUCTION CASE REPORT DISCUSSION

cytomegalovirus ( cmv ) infection still remains a major cause of morbidity and mortality in allogeneic stem cell transplantation ( sct ) recipients . while cmv infection of the central nervous system ( cns ) in acquired immune deficiency syndrome patients has been reported relatively frequently , it is an unusual presentation in allogeneic sct recipients , but fatal in all cases ( 1 - 4 ) . recently , unrelated cord blood or t - cell depleted grafts have been increasingly used as an alternative source of hematopoietic stem cells . however , the use of these grafts has been associated with an increased frequency of unusual cmv infections . here , we report a case of cmv ventriculoencephalitis after unrelated double cord blood sct with an alemtuzumab - containing preparative regimen for philadelphia - positive acute lymphoblastic leukemia . the patient had recurrent cmv dnaemia despite long - term treatment with antiviral agents ( foscarnet combined with ganciclovir ) and anti - cmv immunoglobulin . a 20-yr - old man underwent unrelated cord blood sct using two cord blood units to treat philadelphia - positive acute lymphoblastic leukemia . the patient was treated with total body irradiation ( 1,200 cgy ) , fludarabine ( 150 mg / m ) , cytarabine ( 9 g / m ) , and alemtuzumab ( 20 mg ) as a preparative regimen . for prophylaxis of cmv reactivation , acyclovir ( 10 mg / kg intravenously every 8 hr ) and anti - cmv immunoglobulin ( 150 mg / kg intravenously biweekly ) were given from day -7 until engraftment . the patients achieved successful neutrophil and platelet engraftment on day 27 and 51 , respectively . on day 33 , cmv dnaemia was detected by real - time quantitative polymerase chain reaction ( rq - pcr ) as 3,775 copies / ml and the viral load increased steadily thereafter . the patient was treated preemptively for cmv dnaemia with foscarnet ( 60 mg / kg intravenously every 12 hr for 7 days , followed by 90 mg / kg intravenously daily ) from day 39 to day 93 . during this period , foscarnet had been chosen , instead of ganciclovir , since it had less potential bone marrow toxicity . thirteen days after discontinuation of the foscarnet , cmv retinitis developed with an increase in cmv dna titer . the foscarnet ( 90 mg / kg intravenously every 12 hr ) and anti - cmv immunoglobulin ( 150 mg / kg intravenously biweekly ) were re - administered . however , 7 days later , the cmv rq - pcr titers increased despite the treatment . then we added ganciclovir ( 5 mg / kg intravenously daily ) on top of foscarnet ( 90 mg / kg intravenously daily ) . clinically , the cmv retinitis improved and the cmv dnaemia resolved 40 days after the combination therapy . on day 171 , he was re - admitted complaining of progressive weakness of all four extremities . the peripheral blood showed pancytopenia without leukemic cells ; a wbc count of 1,160/l , hemoglobin of 6.9 g / dl , and a platelet count of 6,000/l . despite administration of foscarnet and 1 ) showed multiple nodularity with high signal intensities in the bilateral fronto - parietal subcortical white matter , periventricular white matter , and the basal ganglia in the t2-weighted and flair images . diffuse high signal changes in the t2-weighted and flair images were also noted along the wall of the lateral ventricles , which were enhanced with gadolinium on the t1-weighted images . lumbar puncture was performed on day 186 ; the results showed a protein concentrate of 66.5 mg / dl , a glucose concentrate of 62 mg / dl ( serum glucose concentrate , 145 mg / dl ) , no white blood cells , and no red blood cells . the microbiology of the cerebrospinal fluid ( csf ) was negative for bacteria , mycobacterium species , and fungi . there was no skin lesion that suggested a varicella zoster virus infection , and the pcr analysis of the csf for herpes simplex virus ( type 1 & 2 ) and human herpes virus 6 were all negative . 2 ) . based on the typical radiologic findings , the positive pcr for cmv from the csf , and recurrent cmv dnaemia in the peripheral blood in spite of long - term antiviral therapy , recently , posttransplant immune reconstitution after sct varies because of availability of alternative donor and variety of preparative regimens and graft manipulations . the unrelated cord blood sct and haploidentical transplantation themselves may be correlated with a high incidence of cmv reactivation , when compared to matched sibling or unrelated sct ( 5 , 6 ) , as well as the use of antithymocyte globulin , fludarabine , and alemtuzumab ( humanized monoclonal cd52 antibody ) as part of the preparative regimen ( 7 - 13 ) . in particular , the combination of fludarabine and alemtuzumab might cause a higher risk of cmv infection and earlier cmv infection following allogeneic sct compared to other preparations ( 8) . ( 7 ) suggested that the patients receiving alemtuzumab , a total dose of 100 mg , had a higher incidence of cmv infection ; a lower dose of alemtuzumab might be related with a reduced risk of cmv infection . our patient received a much lower dose of alemtuzumab , a total dose of 20 mg . however , he had a recurrent cmv reactivation and finally developed cmv retinitis and ventriculoencephalitis . a combination of intravenous foscarnet and ganciclovir has been advocated for treatment of single drug - resistant cmv disease ( 14 , 15 ) . we tried the combination regimen of foscarnet and ganciclovir , expected to have synergistic effects , for the treatment of cmv retinitis because of two reasons ; 1 ) we used the combination of fludarabine and alemtuzumab for cbt preparation , which might have made the patient highly susceptible to cmv reactivation ; 2 ) cmv retinitis developed after treatment with cmv dnaemia despite the recent prolonged treatment with foscarnet . clinically , the treatment failure of cmv disease with antiviral drugs may be associated with antiviral resistance and/or inadequate penetration of the drug into the infected tissue ( 1 , 3 , 16 , 17 ) . the recurrent cmv dnaemia and progressive cmv disease unresponsive to antiviral agents and anti - cmv immunoglobulin for about 150 days , suggest antiviral resistant - mutant cmv in the case . however , it is the limitation of the current study that we could not perform drug susceptibility analysis , cmv genotyping or phenotyping for drug resistance - associated mutations , or measurement of the drug levels in the plasma and csf . in summary , more aggressive prophylaxis as well as preemptive therapy for cmv infection and more diligent monitoring for progression to cmv diseases should be considered for a certain proportion of sct recipients with multiple risk factors of delayed immune reconstitution .

despite the prophylaxis and preemptive strategies using potent antiviral agents , cytomegalovirus ( cmv ) remains a major infectious cause of morbidity and mortality in allogeneic stem cell transplantation ( sct ) recipients . delayed immune reconstitution after sct , such as cord blood and t - cell depleted sct with the use of alemtuzumab , has been associated with an increased frequency of cmv disease as well as cmv reactivation . cmv disease involving central nervous system is an unusual presentation in the setting of sct . we report a case of cmv ventriculoencephalitis after unrelated double cord blood sct with an alemtuzumab - containing preparative regimen for philadelphia - positive acute lymphoblastic leukemia .

INTRODUCTION CASE REPORT DISCUSSION

lateral gene transfer ( lgt ) is a phenomenon central to prokaryotic evolution and adaptation . with the increasing use and sophistication of genomics technologies and bioinformatics tools , estimates of the extent of laterally transferred genes a recent study estimated that an average of 81% of the genes in any given prokaryote had been transferred at some point in their history . the existence and extent of lgt has long been a vexing issue in biology . in respect of microbiology it has led to a long debate of the species concept as it applies to prokaryotes . in the broader evolutionary debate lgt has also challenged aspects of neo darwinism especially in regards to the notion of evolution by gradual change . while all microbiologists accept lgt as a fact , there are still difficulties in reconciling the observation of its large contribution to genomes in the long - term and the likely fitness impact on a genome of acquiring one or more gene units of dna in the short - term . with as little as 20% of a bacterial genome being comprised of genes that respect the classical evolutionary laws of inheritance by vertical descent it follows that most laterally acquired genes must be integrated into essential interconnected metabolic or regulatory pathways ( cell networks ) . neo - darwinism argues that evolution of genes integrated into cell networks occurs by mutational changes in existing genes or duplicated genes either of which randomly generates subtle fitness advantages . over time these can lead to networks with distinct properties in different species and , indeed , facilitate the process of speciation itself . in contrast , the sudden introduction of a new gene or genes into a bacterium is an instantaneous in contrast to a subtle point mutation in an existing or duplicated gene , this is much less likely to provide an opportunity for the new gene to co evolve with , and adapt to , existing cell networks . in the absence of other changes a partial explanation for this dilemma may be in the finding that mobile dna might be silenced by host defenses preventing detrimental short - term effects . putting aside the difficulties of integrating an instantaneously acquired innovation into a cellular network , it is universally understood that some types of laterally transferred genes can have enormous positive fitness impacts on a bacterial cell . an obvious example is antibiotic resistance . with the clinical introduction of antibiotics in the mid 20th century the rapid emergence and spread of antibiotic resistance was one of the earliest indicators of evolution by lgt . today , the ubiquitous presence of multi drug resistant bacteria has led the world health organization to recognize the resulting decline in antibiotic efficacy as one of the great health challenges of the 21st century . most identified antibiotic resistance genes are part of the mobile genome and the selection for antibiotic resistance has facilitated the assembly and concentration of the genes conferring resistance into a plethora of mobilizing elements . this enormous resistance gene diaspora can be attributed to strong artificial selection by human activities and is very recent . the presence of these laterally transferred genes in diverse bacteria is relatively easy to understand . thus , in many contexts , the fitness of cells lacking resistance genes is essentially zero . also , resistant bacteria are predicted to persist in the environment even if all uses of antibiotics ceased . the reasons for persistence in the absence of selection are not all entirely clear although one explanation for the reduced fitness cost is that most acquired resistance genes or gene pathways act autonomously and outside cell metabolic networks . this in itself helps to account for the rapid dissemination of genes through diverse pathogens since a resistance gene will work in any cellular context . thus , the same gene can be found to be mediating resistance in many disparate pathogens . prior to the genomic era , the bulk of our understanding of lgt was drawn from highly mobile genes and the elements that mobilized them . lgt was then considered a marginal process which did not concern most genes , including those used to reconstruct a phylogenetic universal tree of life . the compatibility of our understanding of prokaryotic evolution to neo - darwinian concepts was not questioned , as lgt was only viewed to affect a minority of specialized genes . the microbial genomics era , which began in 1995 , with every passing year and additional sequenced genome , progressively led to the incontrovertible conclusion that lgt has been a dominant force in microbial evolution . thus , rather than just adding on genes in response to strong selection that act independent of the cell network , laterally transferred genes were key integrated components in the cell . several recent studies have shown that phylogenies of gene families that are involved in cell networks do not conform to a simple bifurcating tree type model as would be expected for vertical inheritance . pal et al . have argued that lgt has played an important role in building up complex networks via involvement in pathways that allow bacteria to niche adapt to specialized environment types . thus , an influx of genes at the periphery is most likely to assist bacteria in adapting to new environments and not by optimization in fixed environments . this model is attractive in that it is consistent with the diverse ecological niches that prokaryotes have come to inhabit . by analogy with the complexity hypothesis , this model predicts that metabolic genes rather than core informational genes are more likely to show evidence of lgt . there is clear evidence that this is true in a relative sense , however it is also the case that some informational genes also display evidence of frequent lgt . even if mostly added at the periphery , it is clear that newly acquired genes need to be able to communicate with existing cell networks to some extent even if only , for example , to channel partially processed substrates into central metabolic networks . it has thus been argued that the evolution of new integrated pathways requires the evolution or acquisition of regulatory proteins as well as enzymatic ones . understanding how networks are impacted by lgt is crucial to fully integrating this phenomenon in evolutionary theory . it also has relevance to more applied branches of science , as cellular networks are critical in the evolution of pathogenicity and impact on the evolution of pathogenic bacteria . thus , although the genomics era has told us a lot about the extent of lgt and where it has occurred , as pointed out by davids and zhang , plausible mechanisms as to the events that lead to integration of acquired genes are lacking . for several years our laboratories have been investigating the biology of the integron / gene cassette system . this system is an important component of the mobile genome in gram - negative bacteria . it was first characterized in the context of its role in spreading antibiotic resistance genes in human pathogens . in that regard , it is an exemplar of the power of the adaptive potential of mobile dna since , although it was selected for and spread as a result of the heavy use of antibiotics by humans , the integron is an ancient structure that has been a feature of many bacterial genomes for a long period of evolutionary time . the defining feature of all integrons is their ability to capture genes when the latter are part of mobilizable elements known as gene cassettes . what makes integrons arguably unique in the plethora of mobile elements is that they appear to be highly adapted as a tool kit for natural experimental evolution . their key feature is their ability to insert any gene cassette at a defined integron associated recombination site by site - specific recombination . the advantage of this process is that it allows insertion of a dna sequence at a defined location in the genome which otherwise does not disrupt any other gene in the cell by insertional inactivation . it also allows the immediate expression of the newly acquired gene , as a promoter is located next to the insertion site . unlike other site specific recombination systems however , insertion does not involve a single discrete dna sequence such as a lysogenic phage but rather , a diversity of sequences most of which include defined genes , that to date has no definable upper limit in terms of numbers . thus mobilized genes acquired by lgt can be inserted and expressed in a way that does not otherwise impact on cellular gene content . other evidence that this system is designed to facilitate adaptive innovation is the fact that the site - specific recombination reaction is genetically regulated such that the sos response leads to an increase in mobile cassette rearrangement frequencies . therefore , this provides a mechanism for generating diversity at times when cells have to rapidly adjust to new or changing environments . apart from the large number of mobile genes known to exist , another defining feature of the cassette metagenome is the extraordinary amount of novelty it contains . this novelty extends to the point that most genes found within the cassette metagenome either possess no identified homologs or are homologous to genes encoding proteins that are identified only as one of the great challenges in this area of research is in understanding what these mobile genes do , especially given the fact that they , collectively , comprise a resource that must be many orders of magnitude larger than any single bacterial genome . in our view , however , there is no question that the vast majority of cassette - encoded proteins are adaptive . for example , structural biology approaches ( by obtaining high resolution crystal structures ) have revealed functions for many such proteins . thus , we have found via these approaches that some cassette proteins include putative house cleaning functions and ligand binding domains commonly associated with two component transcriptional regulators both of which are likely to impact on cell networks . this latter example is particularly interesting as it implies that the modular rearrangement of protein domains via cassette shuffling may be a precursor for the evolution of multi domain proteins . one could envisage a scenario whereby two adjacent cassettes providing complementary functions may become fused by loss of the cassette recombination site creating a new multi domain protein . cassette fusion has been previously observed . in any event , the notion that mobile cassettes may encode transcription regulators as well as enzymatic proteins is consistent with this genetic element constituting an adaptive toolbox . apart from potentially evolving new proteins , cassette uptake in natural environments and shuffling may be a process for operon creation by bringing together functionally distinct proteins that can cooperate to form a co - regulated biochemical pathway . other approaches besides structural biology have been used to understand what role cassette - encoded proteins play in the cell . our major model for this is the vibrio rotiferanus strain dat722 , the genome of which we have recently sequenced . from an integron perspective , this species is typical of the vibrios in that it has large cassette arrays composed of 116 cassettes in the case of dat722with most of the associated proteins having no identifiable function . this makes it and its close relatives useful models for testing of specific hypotheses . in a recent study we examined the impact of cassette array deletions on the metabolic capacity of the dat722 cells this was initially done by examining the ability of the mutants to grow on a variety of carbon sources in a biolog screening assay . our intent was to try and identify mutants with a varied capacity to metabolize specific substrates . surprisingly , we found that some mutants concomitantly had a greatly reduced viability in minimal media in the presence of a number of different carbon substrates including glucose . furthermore , these mutants exhibited a hypermutative phenotype ( labbate m. , unpublished ) indicating the deletion had resulted in the loss of a significant gene which made the bacterium maladapted to its environment . this change of phenotype was ascribed to one specific protein , encoded within cassette 11 ( the 11th cassette in the 116 cassette array ) . the cassette 11 protein was demonstrated to have a role in porin regulation and the altered growth profiles were a consequence of changes in porins . the reduction in fitness on deletion of cassette 11 is substantial to the point of making the cell nearly non viable in certain carbon - containing minimal growth media . to our knowledge this is the first experimental data that demonstrates the integration of an apparently unique mobile gene into an important cell network . one particularly interesting aspect to this is the fact that the negative impact on growth is specific for a media that closely resembles the environment in which free living vibrios are most commonly found namely estuarine water . to test whether cassette 11 protein can impact on the fitness of other vibrio strains , we introduced the cassette 11 gene containing recombinant vector pmaq1082 into a v. cholerae strain designated s25 to determine whether fitness was affected . pmaq1082 comprises the cloning vector pjak16 into which the cassette 11 gene has been cloned under the control of an iptg inducible promoter . s25 is an environmental nono1/nono139 v. cholerae strain isolated from a sydney , australia , estuarine environment . it has a large integron array but does not possess cassette 11 or a close homolog based on pcr using primers targeting this cassette . 1 ) in complete media a result identical to that for dat722 with and without this cassette . in contrast to dat722 however , which had greatly altered growth rates in most minimal media , including 2 m + glucose , when isogenic strains with and without cassette 11 were compared , the growth of s25 in the same media was unaffected by the presence or absence of this cassette and was identical to the growth seen in complete media ( fig . 1 ) . the simplest interpretation of this is that the cassette 11 protein does not interact with any s25 cell networks in stark contrast to its influence on networks in dat722 . while more data are needed , we speculate that integration of some mobile genes into cell networks may be analogous to the evolution of duplicated genes in eukaryotes . in eukaryotes duplication is most commonly via the generation of identical copies of an existing gene . in contrast , the introduction of cassette 11 into the ancestor of dat722 initially may have had no impact on the cell as this progenitor possessed a non identical gene that nonetheless encoded a protein with a related function . as this strain evolved however incremental changes led to cassette 11 protein replacing this pre existing protein in terms of its central network role . v. cholerae s25 ( pmaq1082 ) may be a useful experimental evolution model for exploring this hypothesis . growth curves of v. cholerae s25 ( squares ) , v. cholerae s25/pjak16 ( circles ) and v. cholerae s25/pmaq1082 ( triangles ) induced with 0.1 mm iptg in lb20 ( a ) and 2 m + glucose ( b ) . what is the cassette 11 encoded protein ? at this time we do not have a definitive answer although its main target is most likely dna and consequently it may play a role in regulation of dna supercoiling . this potential link is inferred by the presence of two distinct domains in the protein . one of these is a c - terminal zinc finger domain commonly associated with prokaryotic dna topoisomerase i proteins and in these proteins catalyzes the relaxation of supercoiled dna . the second is a recently identified nuclease related nerd domain inferred to have a role in dna processing . we have found this domain is present in proteins found in diverse bacteria ( fig . 2 ) , a distribution suggestive of spread by lgt as is the case for the cassette 11 protein family overall . interestingly this bioinformatic analysis reveals examples of this nerd domain being encoded by genes in highly mobilized elements ( gene cassettes and transposons ) as well as being fixed in cell lines for ( presumably ) longer periods of time as a result of the gene being located on a chromosome . obtaining a crystal structure and identifying a precise biochemical function of the cassette 11 protein would be of great interest . an implied role in dna processing is tantalizing as this type of information processing function is one of the least likely candidates for successful lgt according to the complexity hypothesis or the network evolution model advanced by pal . understanding its precise role is likely to shed light on the forces that allow and provide for rapid integration of lgt derived genes into cell networks . if a gene can be integrated into a cell line specific network such that its loss is nearly fatal , this integration event may represent the first step in a process that represents sympatric speciation . each taxon name is followed by the accession number of the protein it contains , as well as the genetic element the protein is associated with . confidence values over 80% are displayed on nodes of interest , representing the proportion of bootstrap pseudo - replicates supporting topology . in summary , core prokaryotic genes defined by little identifiable evidence of lgt over long evolutionary periods constitute only a small minority of the genes in extant genomes . the majority of genes have at some point been acquired by lgt , including those that are now fixed on chromosomes and integrated into the cell networks that support prokaryotic life . it is these genes that have allowed niche specialization and adaptation of bacteria to novel environments . a complete understanding of the process of lgt requires an understanding of how new genes integrate into cell networks . this systems biology understanding will require hypothesis driven experimental approaches as well as those involving genomics and bioinformatics .

lateral gene transfer ( lgt ) impacts on the evolution of prokaryotes in both the short and long - term . the short - term impacts of mobilized genes are a concern to humans since lgt explains the global rise of multi drug resistant pathogens seen in the past 70 years . however , lgt has been a feature of prokaryotes from the earliest days of their existence and the concept of a bifurcating tree of life is not entirely applicable to prokaryotes since most genes in extant prokaryotic genomes have probably been acquired from other lineages . successful transfer and maintenance of a gene in a new host is understandable if it acts independently of cell networks and confers an advantage . antibiotic resistance provides an example of this whereby a gene can be advantageous in virtually any cell across broad species backgrounds . in a longer evolutionary context however laterally transferred genes can be assimilated into even essential cell networks . how this happens is not well understood and we discuss recent work that identifies a mobile gene , unique to a cell lineage , which is detrimental to the cell when lost . we also present some additional data and believe our emerging model will be helpful in understanding how mobile genes integrate into cell networks .

Lateral Gene Transfer and Bacterial Evolution Integration of Acquired Genes into Cell Networks The Integron/Gene Cassette System Lineage-Specific Integration of a Recently Acquired Gene into an Essential Cell Network Results Conclusions

diabetes mellitus ( dm ) is a clinical syndrome characterized by hyperglycemia because of absolute or relative deficiency of insulin . the diagnosis of dm is based on blood glucose estimations . blood collection is an invasive procedure , and may be traumatizing , especially in diabetic patients who require routine daily monitoring of blood glucose levels . ongoing research in the past few decades has focussed on alternative methodologies that involve incorporating various other body fluids that could be used as a substitute for blood for diagnostic purposes . alterations in the salivary flow and composition of saliva in diabetics have been reported in numerous previous studies , although the findings have frequently been contradictory . there still is no consensus about which parameters should be followed in saliva of type 2 dm patients to enable a salivary diagnosis of type 2 dm . participants were informed about the study protocol , and only those who provided their written consent were included in the study . this cross - sectional study was conducted over a period of 8 months from june 2010 to february 2011 . based on the available literature of cross - sectional , observational studies which included sample sizes that ranged 40180 , in this study the sample size was considered to be 100 , which included 60 diabetics and 40 healthy controls . sixty patients previously diagnosed with type 2 dm and with no other systemic illness , and 40 healthy volunteers with no apparent medical history in the age group of 3060 years were randomly selected and included in the study . completely edentulous patientspatients with any oral mucosal lesionspatients on any medications other than for type 2 dmtobacco / betel chewing habits . completely edentulous patients patients with any oral mucosal lesions patients on any medications other than for type 2 dm tobacco / betel chewing habits . random capillary blood glucose ( rcbg ) was estimated using sterile lancets and sd check gold glucometer with glucose reagent strips using the finger prick method . saliva samples were collected in the morning between 9 am and 12 pm . before collecting the saliva samples , they were asked to spit into the graduated disposable collecting cup at the end of every minute for 5 minutes and the average was calculated to estimate the unstimulated whole salivary flow rate . salivary ph was estimated by placing the gc saliva ph strip for 10 seconds in the saliva sample , which was then removed and matched with the color - coded table provided along with the kit . pipettes provided along with the kit were used to draw saliva sample from the collecting cup and 3 drops added over the 3 slots of the strips . after 2 minutes , the color change was matched with the color - coded table scores provided by the manufacturer . decayed missing filled teeth ( dmft ) index was recorded to assess the status of teeth . using a micropipette , 10 l of saliva was drawn from the disposable collecting cup and added into a cuvette to which 1000 l of glucose oxidase peroxidase enzyme reagent was added ; the sample was then incubated at 37c for 10 minutes . similarly , 10 l of standard glucose solution was drawn into a cuvette to which 1000 l of enzyme reagent was added , and the sample was incubated at 37c for 10 minutes . the optical absorbance readings were recorded using the digital photocolorimeter using the green filter with a peak of 540 nm wavelength [ figure 1 ] . armamentarium used to assess unstimulated whole salivary glucose uwsg was calculated using the formula : salivary glucose in mg / dl = absorbance of sample concentration of standard / absorbance of standard concentration of the standard glucose was 100 mg / dl statistical analysis was done using contingency coefficient analysis , independent samples t - test , multivariate analysis of variance ( manova ) , and correlations using pearson coefficient . the statistical package for the social sciences ( spss ) for windows ( spss , version 16.0 , chicago , spss inc . ) was used for statistical analysis . sixty patients previously diagnosed with type 2 dm and with no other systemic illness , and 40 healthy volunteers with no apparent medical history in the age group of 3060 years were randomly selected and included in the study . completely edentulous patientspatients with any oral mucosal lesionspatients on any medications other than for type 2 dmtobacco / betel chewing habits . completely edentulous patients patients with any oral mucosal lesions patients on any medications other than for type 2 dm tobacco / betel chewing habits . random capillary blood glucose ( rcbg ) was estimated using sterile lancets and sd check gold glucometer with glucose reagent strips using the finger prick method . saliva samples were collected in the morning between 9 am and 12 pm . before collecting the saliva samples , patients were asked to rinse their mouth with 200 ml water . they were asked to spit into the graduated disposable collecting cup at the end of every minute for 5 minutes and the average was calculated to estimate the unstimulated whole salivary flow rate . salivary ph was estimated by placing the gc saliva ph strip for 10 seconds in the saliva sample , which was then removed and matched with the color - coded table provided along with the kit . pipettes provided along with the kit were used to draw saliva sample from the collecting cup and 3 drops added over the 3 slots of the strips . after 2 minutes , the color change was matched with the color - coded table scores provided by the manufacturer . decayed missing filled teeth ( dmft ) index was recorded to assess the status of teeth . using a micropipette , 10 l of saliva was drawn from the disposable collecting cup and added into a cuvette to which 1000 l of glucose oxidase peroxidase enzyme reagent was added ; the sample was then incubated at 37c for 10 minutes . similarly , 10 l of standard glucose solution was drawn into a cuvette to which 1000 l of enzyme reagent was added , and the sample was incubated at 37c for 10 minutes . the optical absorbance readings were recorded using the digital photocolorimeter using the green filter with a peak of 540 nm wavelength [ figure 1 ] . armamentarium used to assess unstimulated whole salivary glucose uwsg was calculated using the formula : salivary glucose in mg / dl = absorbance of sample concentration of standard / absorbance of standard concentration of the standard glucose was 100 mg / dl statistical analysis was done using contingency coefficient analysis , independent samples t - test , multivariate analysis of variance ( manova ) , and correlations using pearson coefficient . the statistical package for the social sciences ( spss ) for windows ( spss , version 16.0 , chicago , spss inc . ) was used for statistical analysis . the mean rcbg and uwsg levels in type 2 diabetics were 180 mg / dl and 12.9 mg / dl , respectively [ table 1 ] . the mean rcbg and uwsg levels in healthy controls were 95.1 mg / dl and 9.46 mg / dl , respectively [ table 1 ] . the difference between the groups was statistically significant ( p = 0.000 ) [ table 2 ] . descriptive statistics independent samples test : control and type 2 dm a positive correlation between rcbg and uwsg was observed in both the study and control groups [ graphs 1 and 2 ] . the mean unstimulated whole salivary flow rate in type 2 diabetics was 0.6 ml / min and in the healthy controls it was 0.67 ml / min [ table 1 ] . the difference in unstimulated whole salivary flow rate between the groups was statistically significant ( p = 0.029 ) [ table 2 ] . the mean unstimulated salivary ph in type 2 diabetics was 6.8 and in the healthy controls it was 7.1 [ table 1 ] . scatter plot no.1 correlation between random capillary blood glucose and unstimulated whole salivary glucose in control group scatter plot no 2 : correlation between random capillary blood glucose and unstimulated whole salivary glucose in experimental group the mean salivary buffering capacity in type 2 diabetics was 7 and in the healthy controls it was 8.4 [ table 1 ] . there was a statistically significant difference in the salivary buffering capacity between the groups ( p = 0.021 ) [ table 2 ] . no significant correlation between salivary flow rate and the salivary buffering capacity was observed in type 2 diabetics , however , a statistically significant correlation ( p = 0.000 ) was found between salivary flow rate and salivary ph [ table 3 ] . correlations in the study group ( type 2 diabetics and healthy volunteers ) among various parameters the values of salivary ph and salivary buffering capacity showed good correlation in both the type 2 diabetics and the control group , as the salivary ph decreased the salivary buffering capacity also decreased and the relationship was highly significant statistically ( p = 0.000 ) [ table 2 ] . the mean values for rpi in the type 2 diabetics was found to be 2.1 , and in the healthy controls it was 1.2 [ table 1 ] . the difference in the rpi scores between the groups was significant statistically ( p = 0.000 ) [ table 2 ] . the mean dmft scores in type 2 diabetics was 5.7 and in the healthy controls it was 5.8 [ table 1 ] . the rpi scores of type 2 diabetics showed positive correlation with only the salivary glucose levels among the various tested parameters . none of the tested salivary factors showed any statistically significant effect on the rpi scores in the control group . the caries experience of both type 2 diabetics and controls in our study was similar with no statistical difference in the dmft scores [ table 3 ] . epidemiological studies in india have shown high prevalence of type 2 dm ; in the year 2002 , it was estimated that there were 19.4 million individuals affected by type 2 dm , which is likely to increase up to 57.2 million by the year 2025 . routine blood examination for glucose assessment can be traumatizing to the patient , and hence , other alternatives have been explored , among which salivary diagnostics hold much promise . saliva - based diagnostics are not limited to oral diseases but have been extended to the entire physiologic system , as most compounds found in the blood are also present in the saliva . accordingly , saliva can reflect the physiologic state of the body including emotional , endocrinal , nutritional , and metabolic variations , and acts as a source for monitoring oral and systemic health . a systematic review of previously published studies reflects the fact that salivary glucose concentration increases in type 2 dm , and a positive correlation exists between blood glucose and salivary glucose ; hence , it can be a useful biomarker to monitor type 2 dm . in the present study type 2 diabetics had significantly higher uswg / rcbg levels than the controls , a fact which has been documented in previous studies . the correlation between rcbg and uwsg could plausibly be because of leakage of glucose from blood across the basement membrane of salivary glands . microvascular alterations in the blood vessels that are commonly seen in type 2 diabetics could also contribute to increased salivary glucose levels . saliva samples collected in the present study represented the whole mouth fluid , and therefore , reflects glucose levels not only due to leakage across the basement membrane of major and minor salivary glands but also from the gingival crevicular fluid . furthermore , it has been proposed by belazi that the basement membrane alterations lead to enhanced leakage of serum components including glucose into the gingival crevicular fluid rather than into saliva . however , in contrast to the present study , various other authors could not establish any correlation between rcbg and uwsg . the decrease in the unstimulated whole salivary flow rate in type 2 diabetics is in accordance with previous studies . type 2 dm is known to affect the sympathetic and parasympathetic nervous system of the salivary glands , resulting in decreased salivary secretion , microangiopathy , dehydration , and hormonal changes , which may contribute to the decrease in the salivary flow rate . however , few authors were not able to establish significant difference in salivary flow rates between type 2 dm and healthy controls . we found a significant difference in the salivary ph between the type 2 dm patients and control ( p < 0.01 ) , which was similar to other studies . in accordance with previous studies , we found significant differences ( p < 0.05 ) in the buffering capacity between type 2 dm and control groups . this can also be attributed to the hormonal and metabolic changes in diabetic patients causing altered levels of salivary buffering systems . results contrary to our study have been reported by collin et al . in the present study , there was significant correlation ( p < 0.01 ) between the salivary flow rate and salivary ph in the diabetics , and such correlation was not observed in the control group individuals . even though type 2 dm patients had significant decrease in salivary flow rate in our study , it was observed that salivary flow rates were not as low as those in patients suffering from hyposalivation . this could be caused by increased fluid intake by diabetics due to polydipsia . because buffering capacity is dependent on the ph levels , type 2 dm had salivary buffering capacity correlating with the salivary ph . interestingly , it was observed that , in the control group , salivary ph levels were within the normal limits independent of the salivary flow rate . this could be due to reduced acidogenic flora in the oral cavity and increased salivary clearance activity maintaining normal ph levels . reported that , in patients with type 2 dm , the risk of periodontal disease is three times higher than that in the general population . similarly , we found that the type 2 dm patients had significantly poor periodontal status than the healthy controls . it has been shown that dm causes alterations in the connective tissue metabolism by uncoupling the resorptive and formative processes , thus leading to increased levels of loss of periodontal attachment and bone loss . among all the parameters tested in our study , only rcbg and uwsg showed significant positive correlation ( p < 0.01 ) with the rpi scores in type 2 dm patients . none of the other salivary parameters studied correlated with the rpi scores , indicating that the level of glycemic control is an important determinant in being a risk factor for the development of gingivitis and periodontitis in type 2 dm . studies concerning the occurrence of caries in diabetic patients have yielded controversial results . in the present study , no significant difference was observed in the dmft scores between the type 2 dm and controls , similar to earlier studies . lack of significant difference in the dmft scores between the groups could be due to modification in the diet with reduced amounts of refined carbohydrate intake by the type 2 dm patients , thereby reducing the formation of an acidogenic environment . the fact that most of the patients who formed the study group belonged to the urban population and had unproblematic access to dental care could have also contributed to no significant differences in the mean dmft scores between the type 2 dm and control groups . our results are contrary to a few authors who have reported that diabetics have slightly higher mean dmft scores than the controls . from our results , it can be concluded that the salivary glucose levels reflect the random blood glucose levels . type 2 diabetics have significantly lower salivary flow rate , ph , and buffering capacity and present with advanced periodontal destruction than the healthy population . further studies with larger sample size are warranted to substantiate the correlation between blood glucose and salivary glucose to devise saliva - based tests for diagnosing dm .

aims and objectives : the purpose of this study was to estimate and assess any correlation between random capillary blood glucose ( rcbg ) and unstimulated whole salivary glucose ( uwsg ) , as well as to estimate various salivary parameters , such as flow rate , ph , buffering capacity , and the influence of these factors on the oral health status in type 2 diabetes mellitus ( dm).materials and methods : sixty individuals suffering from type 2 dm and 40 healthy individuals in the age group of 3060 years were included in the study . rcbg was estimated using glucometer and uwsg was estimated using photocolorimeter . salivary parameters such as flow rate , ph , and buffering capacity were assessed using gc saliva kit . oral health status was recorded using the russell 's periodontal index ( rpi ) and the decayed missing filled teeth ( dmft ) index . the statistical package for the social sciences version 16 was used for statistical analysis.results:type 2 diabetics had higher mean values for rcbg levels and uwsg . type 2 diabetics had low mean salivary flow rate , ph , and buffering capacity . type 2 diabetics had higher mean values for rpi.conclusion:among the salivary factors studied , salivary glucose significantly influenced the periodontal status in type 2 diabetics .

I M I E R D C F C

due to increasing life expectancy of the dentition , older adults are experiencing root caries and gingival recession , putting them at even higher risk for periodontal disease . root caries is the major cause of tooth loss in older adults , and tooth loss is the most significant oral health - related negative variable of quality of life for the elderly . one prominent goal of the dental profession is to preserve and maintain dentitions throughout life . population projections suggest that the proportion of the population aged 65 years and older will nearly double between 2000 ( 12.6 percent ) and 2030 ( 20.0 percent ) , and that the proportion of those aged 85 years and older will increase dramatically over the next 10 to 15 years . this population trend coupled with compelling evidence that people are retaining their teeth into old age suggests that there will be an increased number of older adults with many more natural teeth in the years to come . there are known clinical and behavioral risk factors involved in the production and progression of root caries in the elderly . risks are described in a number of levels , from socioeconomic status to salivary flow to presence of dentures . data have shown correlations of dietary and oral habits and other variables on root caries . many risk factors can compromise an older adult 's systemic health such as sociodemographic variables , nutrition / diet , and weakened immune system . this paper examines salivary hypofunction , the systemic and oral immune system ( immunoglobulins found in saliva ) in older adults , and their manifestations . there are several indicators that provide insight into the incidence and prevalence of caries in healthy people and the medical or disability conditions that place individuals at increased caries risk . one indicator is the presence of mutans streptococci , an established etiologic agent for caries activity . one of the main oral behaviors to reduce the amount of bacteria in the oral cavity is regular tooth brushing with a fluoride - containing dentifrice . conditions that compromise good oral hygiene behaviors and oral health are also positively associated with caries risk . these include certain illnesses , physical and mental disabilities , and the presence of existing restorations or oral appliances . fermentable carbohydrate consumption fuels acid formation and demineralization and is associated with caries , particularly in the absence of fluoride . long - term regular doses of medications containing glucose , fructose , or sucrose may also contribute to caries risk . medical conditions such as sjgren 's syndrome , pharmacological agents with xerostomic side effects , and therapeutic radiation to the head and neck lower salivary flow rate to pathological levels and dramatically elevate a patient 's risk of caries . some studies indicate that low buffering capacity , low salivary immunoglobulin a , and low salivary calcium and phosphate may also be linked to increased caries . the inability to maintain good oral hygiene and xerostomia are risk factors of special significance among the elderly , and gingival recession uniquely increases the risk of root caries in elderly populations by exposing previously protected root surfaces to cariogenesis . low indices of socioeconomic status have been associated with elevation in caries and are also associated with reduced access to care , reduced oral health aspirations , low self - efficacy , and health behaviors that may enhance caries risk . older age is positively associated with the prevalence of root caries . over half evidence also suggests that adults who have lived in fluoridated areas throughout most of their lives , including the time of tooth formation , have a lower prevalence of root caries . there appear to be a wide variety of risk indicators and risk factors implicated in root caries . these factors include not only oral factors , but also medical , behavioral , and social factors . it is likely that numerous microbial , genetic , immunological , behavioral , and environmental contributors to risk are at play in determining the occurrence and severity of clinical disease . prevention and treatment can be achieved by identifying and arresting or reversing the disease at an early stage . treatments include application of fluorides , chlorhexidine , sealants , antimicrobials , salivary enhancers , and patient education . studies have shown that one 's preference to sweet carbohydrates may put one at risk for caries . this preference may be determined by socioeconomic status but also be under genetic control . studies have examined genetically determined taste sensitivity to 6-n - propylthiouracil demonstrating that individuals with low taste sensitivity experience a lower caries risk than those with high tasting sensitivity [ 16 , 17 ] . the examination of genetic variation in taste pathway genes ( taste receptor , type 2 , member 38 ( tas2r38 ) , taste receptor type 1 member 2 ( tas1r2 ) , and guanine nucleotide - binding protein g(t ) subunit alpha-3 ( gnat3 ) ) and their relation to caries revealed some associations . tas1r2 is a member of sweet taste receptor family , and gnat3 codes for the g protein gustducin , which mediates taste receptor signaling in the taste buds of the lingual epithelium . a significant association was found for certain alleles in tas2r38 that were protective from caries , while other haplotypes were associated with caries risk . this association held true only for the primary dentition with individuals with a mean age of 3.4 years . there was no significant association in the mixed and permanent dentitions , which had individuals with mean ages of 9.8 and 29.4 years , respectively . the tas2r38 single nucleotide polymorphisms that were found to be protective for caries cause amino acid changes in the taste receptor that are associated with bitter sensitivity . variations of the genetic makeup of these genes may contribute to differences in dietary habits that influence the caries risk of these children . evaluation of children classified with different tasting abilities has also been associated with body weight and dietary habit differences . at this point , these studies have not targeted the elderly and/or root caries . to support the notion that caries is a disease with a genetic component , one study used dna samples collected from 110 individuals older than 12 years of age from guatemala and documented who had a higher or lower caries experience using dmft ( decayed , missing due to caries , filled teeth ) scores . enamel proteins such as ameloblastin and tuftelin are associated and crucial for proper enamel formation . single - nucleotide polymorphism markers were genotyped in selected candidate genes ( ameloblastin , amelogenin , enamelin , tuftelin-1 , and tuftelin interacting protein 11 ) that influence enamel formation . having at least one copy of the rare amelogenin marker allele was associated with increased age - adjusted caries experience . this association was stronger in individuals with higher dmft ( dmft 20 ; p = .0000001 ) , suggesting that a variation in amelogenin may contribute to caries susceptibility in the population studied . these results were confirmed in an independent cohort from turkey . besides genes related to taste preferences and enamel formation , three single nucleotide polymorphisms in defb1 ( beta defensin 1 ) were tested in a cohort of unrelated adult individuals . carrying a copy of the variant allele of the defb1 marker rs11362 increased the dmft and dmfs scores more than fivefold . also , carrying a copy of the variant allele of the defb1 marker rs179946 correlated with low dmft scores . a high caries experience promoter haplotype ( gca ) increased dmft scores twofold , and a low caries experience promoter haplotype ( acg ) decreased dmft scores two - fold . as we age our immune system weakens and fewer antimicrobial immunoglobulins are produced and found in saliva . medications that are prescribed to the elderly in fact can cause impaired salivary flow with no change in the immune system . many medications , chemotherapy , radiation treatments , and some diseases can decrease salivary gland function and therefore make caries and other oral diseases more likely to occur . some common drugs that may cause dry mouth are high blood pressure drugs , cholesterol lowering drugs , pain medications , muscle relaxants , allergy , and asthma medications . no matter what the cause , it is undisputed that saliva is essential in neutralizing the acidic environment , thus inhibiting the growth of bacteria . any decreased levels of saliva can put one at increased risk for developing caries . when studying the elderly population , researchers have looked at age - related differences in whole and parotid saliva secretion related to the production of saliva , as well as the immune factors in saliva . the levels of serum immunoglobulin g ( igg ) and igm were significantly reduced in older individuals , whereas no significant reduction in the level of iga with age was observed . no significant changes in any immunoglobulin levels with age were found in parotid saliva , but significant reductions in the secretion rates of iga and igm , but not igg , in whole saliva were detected in the oldest age individuals . the results demonstrate a decline in immunoglobulin concentrations with increased age , which may contribute to the increased susceptibility of elderly individuals to oral diseases . one hundred and sixty of the 1,328 parotid gland genes show more than a twofold change in expression . the effects of age on specific gene expression in the human parotid gland may provide insight into functional and morphological changes in the oral cavity and its associations to oral disease . when examining unstimulated and stimulated submandibular / sublingual saliva flow rates , unstimulated and stimulated parotid saliva flow rates , and different proteins ( lactoferrin , secretory iga , albumin , lysozyme , mucin , and cystatin ) , significant associations were found between caries , age , and specific individual submandibular / sublingual salivary protein levels . therefore , these changes in saliva components over age may represent caries risk indicators . age has a significant influence on the expression of genes associated with reduced protein biosynthesis of salivary gland secretion . the expressions of both hla - dqa1 ( major histocompatibility complex , class ii , dq alpha 1 ) and hla - dqb1 ( major histocompatibility complex , class ii , dq beta 1 ) , genes involved in immuneresponse , were decreased in the parotid gland in the elderly . several other proteins known to be involved in different immune response pathways showed altered expression in aged population ( e.g. , irf1 , irf7 , gbp1 , ifitm1 , ifitm2 , ifitm3 , psmb8 , and psmb9 ) . complex remodeling of the immune system occurs during aging , which may contribute significantly to systemic diseases in the elderly . diseases such as infections , autoimmune , and neoplastic pathologies that aged individuals are particularly susceptible to involve dysregulation of immune function . the number of elderly is dramatically increasing , and consequently , geriatric pathology is becoming a more important aspect of clinical practice . in light of this , salivary gland function may prove to be a risk factor worth evaluating in the elderly . diet is a very important factor in preventing caries since certain foods and snacks can greatly increase the number of bacteria that forms the decay - causing plaque . the more sweetened snacks consumed and the more frequently they are consumed increase the risk for developing caries . the frequency of sugar intake is more important than the amount of sugar consumed in the development of caries . therefore , minimizing snacking is recommended since snacking creates a continual supply of nutrition for acid - creating bacteria in the mouth . also , chewy and sticky foods ( such as dried fruit or candy ) tend to adhere to teeth longer and consequently are best eaten as part of a meal . when studying the elderly population , it is beneficial to look at other factors such as diet , which together with decreased salivary flow make one more susceptible to root caries . when dietary habits , microbial factors , and salivary factors were analyzed together in older adults who had root caries compared to adults who did not have root caries , individuals with root caries ate a greater number of meals a day and had higher sugar intake . root caries subjects had significantly higher lactobacilli counts and less salivary buffering capacity suggesting that higher microbial counts and less salivary flow may be risk factors associated with root caries in older adults . plaque consists of bacteria and an extracellular matrix that contains lipids , proteins , and polysaccharides . teeth are more vulnerable to an increase in bacterial plaque when carbohydrates in the food are left on teeth after every meal . in the presence of sugar and other carbohydrates , bacteria in the mouth produce acids that can demineralize enamel , dentin , and cementum . the more frequently teeth are exposed to this environment , the more likely caries are to occur . certain bacterial species appear to be strongly associated with health , as they are rarely detected or are absent from root caries carriers but are commonly found in healthy subjects . in root caries , veillonella parvula , veillonella dispar , selenomolas noxia , campylobacter gracilis , streptococcus mutans , selenomonass putigena , and fusobacterium nucleatum are found at high levels . lactobacilli appears to be associated with disease , as they are common in carious lesions , while rare or absent in healthy teeth . in individuals with no caries , streptococcus mutans are less common and lactobacilli are absent , while for individuals with root caries , levels of streptococcus mutans and lactobacilli are increased . the prevalence of streptococcus mutans alone or in combination with lactobacilli is similar in root caries lesions . lactobacilli are absent in healthy subjects but highly present in carious dentin , supporting the suggestion that lactobacilli might play a significant role in the progression of root caries . bacterial species typically associated with root caries can be detected , such as streptococcus mutans , lactobacilli , and actinomyces . although many variables influence the production and progression of oral disease , the one variable that shows an immediate and long lasting significant effect on one 's oral health is oral hygiene . the purpose of oral hygiene ( brushing and flossing daily ) is to minimize , remove , and prevent the formation of plaque . three monthly applications of chlorhexidine - thymol varnish ( cervitec ) over one - year limits the progress of existing root caries lesions and reduces the incidence of root caries . when fluoride varnish , 1% chlorhexidine , 40% chlorhexidine , and professional tooth cleanings were compared in regard to root caries , all methods showed significant reduction in the amount of microbiota ( bacteria ) . these data suggested that tooth cleaning alone might be as effective in reducing plaque formation ( and subsequently root caries ) as fluoride or chlorhexidine . one of the more groundbreaking studies of oral disease today is examining the associations between oral and systemic diseases . data from the national health and nutrition examination survey 19992004 showed that individuals with rheumatoid arthritis , diabetes , or a liver condition were twice as likely to have an urgent need for dental treatment . the data also showed that arthritis , cardiovascular diseases , diabetes , emphysema , hepatitis c , obesity , and stroke were all associated with dental disease . others may interpret this association as meaning that those with systemic disease tend to neglect their oral health and so show a higher incidence of oral disease . in an attempt to evaluate whether self - reported systemic diseases were associated with caries experience , data from the university of pittsburgh school of dental medicine dental registry and dna repository regarding medical history and caries experience ( dmft and dmfs ; decayed , missing due to caries , filled teeth / surface ) were analyzed . an association was found between higher caries experience ( dmft above 15 and dmfs above 50 ) and asthma and epilepsy . cardiovascular diseases have also been associated with higher caries experience , particularly in individuals 80 years or older . individuals with three or more active root caries lesions have more than twice the odds of cardiac arrhythmias than ones without active root caries . these results did not notably change after adjusting for age , medications that reduce saliva , and number of teeth . the findings indicate that there may be a link between active root caries and cardiac arrhythmias in those aged 80 and older . one explanation for these findings is that both cardiac arrhythmias and caries are simply markers of declining general health . xerostomia , commonly associated with oral disease , has also been associated with type 2 diabetes mellitus . the prevalence of xerostomia is higher ( 62% ) in subjects with type 2 diabetes mellitus in comparison to the nondiabetic controls ( 36% prevalence ; p = .001 ) . in the same way , the prevalence of hyposalivation is higher in individuals with type 2 diabetes mellitus ( 46% ) , whereas only 28% of the controls had hyposalivation ( p = .03 ) . subjects with hyposalivation had significantly higher numbers of mutans streptococci , lactobacillus , and candida in the saliva compared to those without hyposalivation . the higher number of pathogens and decreased salivary flow may very well explain why diabetics have or are at higher risk for oral disease . these papers revisit aspects related to diet , microbial colonization , oral hygiene , and concomitant systemic illnesses , as well as several topics not covered in this section , such as nonimmunoglobulin salivary agents , chewing ability , sugar clearance , antimicrobial mouthwashes , saliva substitutes , and sugar substitutes . for further information on these areas as the us population ages , and more teeth are retained , there will be a higher prevalence of root caries and untreated dental decay . therefore , the demand for dental services in the population of the oldest elderly people is likely to increase . the evaluation of a cohort of elderly aged 79 years or older ( mean age 85.1 years ) with a mean of 19.4 remaining teeth showed that nearly all subjects ( 96 percent ) had coronal decay experience and nearly two - thirds ( 64 percent ) of the individuals had root caries experience , with 23 percent having untreated root caries . utilization of dental services was high among the dentate elderly , with nearly three - quarters reporting having visited a dentist within the past year . those with active coronal or root decay are more likely to be male and to have a history of tobacco use ; they are less likely to have visited a dentist within the past year or report regular use of dental services . the most recent look at caries frequency clearly indicates a marked increase in the prevalence of caries . there are a wide variety of risk factors associated with the development of caries , and although there are differences of opinion regarding the cause of the increase in caries it should be agreed upon that public health strategies are needed to renew the fight against caries and promote prevention of future oral disease . awareness and promotion of water fluoridation , fluoride applications , emphasis on proper tooth brushing with a fluoride dentifrice , flossing , a proper diet , and regular dental office visits can hinder the progression of future caries and can result in an increase in the oral health of all individuals . more programs such as school oral health educational programs are needed to benefit and enhance the oral health ( and systemic health ) of individuals worldwide .

root caries is one of the most significant dental problems among older adults today . many studies have demonstrated that older adults are at greater risk for developing root caries . here we examine what risk factors older adults are prone to and explain how they contribute to higher rates of oral disease , in particular root caries . the elderly are at risk for root caries due to dentures , lack of dexterity , a shift from complex to simple sugars , and poor oral hygiene . decreased salivary flow and its manifestations with other social / behavioral and medical factors may provide a more comprehensive explanation to a higher frequency of root caries in older adults .

1. Introduction 2. Etiology of Caries 3. Genetics of Caries 4. Saliva and Immure Response 5. Brief Discussion on Other Risk Factors 6. Conclusion

overweight and obesity is an increasing problem globally . the prevalence is often estimated by body mass index ( bmi ; weight in kg divided by squared height in meters ) . in epidemiological surveys , height and weight are often gathered using self - report questionnaires . this type of data collection is advantageous because it is cost - effective , rapid , and easy to administer when sampling large numbers of individuals , particularly when spread over large areas.1 however , the validity of self - reported data for body measurements has been questioned because some participants overestimate height and underestimate weight , resulting in a lower estimated bmi.15 a review including 64 studies published between 1979 and 2005 examined the validity of self - reported bmi and found that the mean errors varied , and the discrepancies were greatest in obese populations.1 weight status has been shown to predict misreporting of bmi in several large studies , with overweight and obese persons being more likely to under - report bmi.2,610 women have a greater tendency to underestimate bmi than men in many studies,9,11,12 but not all.2 age has been found to predict misreporting of weight and height , with younger women under - reporting weight more than older women , while the chance of over - reporting height increases with age.6,7,11,12 however , these observed associations of age with misreporting are not universal.5 the amount of discrepancy between self - reported bmi and measured bmi varies between studies , and average discrepancies of 0.670.80 kg / m among women have been reported.2,59 even though most studies find relatively small differences between self - reported and measured bmi,8,9 there is a risk that even small deviations can lead to misclassification of bmi and incorrectly estimate associations between bmi categories and incidence of disease.10 the world health organization classifies bmi into four categories : underweight , bmi < 18.5 kg / m ; normal weight , bmi 18.524.9 kg / m ; overweight , bmi 2529.9 kg / m ; and obese , bmi 30 kg / m.13 inaccurate reporting of weight and height may also result in incorrect estimates of the prevalence of overweight . for large studies covering geographically scattered participants , self - reported data are paramount , and examinations of the validity of these data are central to interpretation of the results . validity is a feature of the source population , and can not be inferred from studies from other countries or groups.14 it might change over time and as social and cultural norms about the phenomenon changes.1 to the best of our knowledge , the validity of self - reported height and weight has not been described in a norwegian population . the purpose of this study was to examine whether self - reported weight and height in a sample of women from a large norwegian cohort are valid indicators of bmi for use in epidemiological studies . the norwegian women and cancer ( nowac ) study is a large nationally representative prospective cohort study of women aged 3070 years at recruitment . started in 1991 , the original purpose of the nowac study was to explore the relationship between oral contraceptive use and breast cancer , and the cohort currently includes over 172,000 participants ( figure 1 ) . the study is described in detail by lund et al.15 during 20032006 , the nowac study collected blood samples and a new questionnaire ( hereafter referred to as the secondary questionnaire ) from recent participants born between 1943 and 1957 . the blood collection took place via mail , and the women were asked to contact their general practitioners for taking the blood sample . we focused on a random subsample of 4,498 of the women who were contacted to donate a sample of blood , and therefore were subject to a second data collection within a relatively short time span . of the women contacted , 71% complied ( n=3,194 , figure 1 ) . to limit the time between repeated questionnaires , this study includes the 1,837 women from the random subsample who were asked for and provided a blood sample within 1 year of their primary questionnaire . the primary questionnaire included questions on hormonal and reproductive factors , smoking , alcohol , diet , height , weight , physical activity , self - reported health and some diseases and medications , socioeconomic factors , and sun tanning habits . women were also asked to complete an additional two - page questionnaire , which accompanied the blood sample . this secondary questionnaire collected information that could influence biomarker measurements and updated some of the information from the primary questionnaire , eg , fasting status , menstruation / menopausal status , smoking , height , weight , use of dietary supplements , and medications taken in the previous 7 days . height and weight were self - reported in the primary questionnaire , but could be either self - reported or measured at the secondary questionnaire , and the participants were asked to indicate whether they had been measured by medical staff on the day of the blood sample . no instructions were given with regard to clothing or weight calibration to the participants or medical staff . values producing differences between the two measurements of more than 10 cm for height and 5 kg for weight were checked for data entry errors , but values entered on the original paper questionnaires were assumed to be accurate . missing values for the anthropometric measurements were rare in the primary and secondary questionnaires , with 3% missing for weight and 2% missing for height observed for each questionnaire . there appeared to be a slight tendency to round to the nearest 5 kg for self - reported weight measurements when comparing the frequency of weights ending in 0 or 5 in the primary questionnaire ( 35% ) and secondary questionnaire ( 31% ) , compared with weights measured by medical staff ( 25% ) . bmi was grouped into four categories according to the world health organization classification.13 information about age was based on birth year and provided by the national population register at statistics norway . education , marital status , and perceived health were reported as part of the nowac study . total years of education were categorized into basic or primary education ( 9 years ) , secondary school ( 1012 years ) , and college educated ( 13 years ) . marital status was categorized into married / living together , widowed or divorced , and unmarried . perceived health ( do you think of your own health as : ) was reported as very good , good , poor , or very poor . because few women in the blood sampling group reported very poor health ( n=3 ) equality of group means was tested with two - sample t - tests with pooled variance , while categorical variables were tested using a chi - square test of independence . statistical analyses were performed in sas version 9.4 ( sas institute , cary , nc , usa ) , and statistical significance was defined as a test resulting in a p - value less than 0.05 . repeated measurements of height , weight , and bmi were tested for equality using paired t - tests with pooled variance . differences between self - reported values on the primary questionnaire and values measured by medical staff when blood was sampled ( secondary questionnaire ) represent both changes over time and error . differences between repeated self - reported values are an estimate of changes in weight over time , assuming reporting bias is constant within 1 year . two - sample t - tests with pooled variance were used to test if the differences between types of measurements ( self - reported followed by medical staff - reported ) were larger than repeated self - reported measurements over time . the difference in differences since bmi is often categorized when used as a risk factor , categories were created for both measurements and cross - classified . the percentage correctly classified was calculated , and the agreement between repeated bmi classifications was assessed using a weighted cohen s kappa coefficient.16 this coefficient measures the agreement beyond what is expected by chance . the weighting penalizes errors based upon the level of disagreement ; for example , a misclassification of two categories has a greater penalty than a misclassification of only one category . altman analysis was used to compare the agreement between bmi based on self - reporting and values measured by medical staff , as well as between the two self - reported measurements.17 the average difference between the bmi values indicates the overall bias present in the data , while the limits of agreement ( mean 1.96 standard deviation ) indicate the precision of the measurements . for the comparison with values measured by medical staff , negative differences indicate that the bmi using medical staff values was higher than the self - reported bmi values , ie , negative differences indicate under - reporting . in order to examine representativeness , a comparison was made of basic demographic variables between the study sample group and the independent set of women remaining in the eligible cohort . specifically , the group of women who donated blood within a year of their questionnaire and supplied information on their anthropometric measurements ( n=1,723 ) were compared with those in the eligible cohort , who were willing to donate a blood sample , minus the random subsample ( n=91,828 ) using chi - square tests of independence and two sample t - tests . participants received mailed information about the study together with the questionnaires , and indicated their consent to participate . the study received approval from the regional committee for medical research ethics for the basic collection and storing of questionnaire information and blood sampling . equality of group means was tested with two - sample t - tests with pooled variance , while categorical variables were tested using a chi - square test of independence . statistical analyses were performed in sas version 9.4 ( sas institute , cary , nc , usa ) , and statistical significance was defined as a test resulting in a p - value less than 0.05 . repeated measurements of height , weight , and bmi were tested for equality using paired t - tests with pooled variance . differences between self - reported values on the primary questionnaire and values measured by medical staff when blood was sampled ( secondary questionnaire ) represent both changes over time and error . differences between repeated self - reported values are an estimate of changes in weight over time , assuming reporting bias is constant within 1 year . two - sample t - tests with pooled variance were used to test if the differences between types of measurements ( self - reported followed by medical staff - reported ) were larger than repeated self - reported measurements over time . the difference in differences provides an estimate of any self - report bias . since bmi is often categorized when used as a risk factor , categories were created for both measurements and cross - classified . the percentage correctly classified was calculated , and the agreement between repeated bmi classifications was assessed using a weighted cohen s kappa coefficient.16 this coefficient measures the agreement beyond what is expected by chance . the weighting penalizes errors based upon the level of disagreement ; for example , a misclassification of two categories has a greater penalty than a misclassification of only one category . altman analysis was used to compare the agreement between bmi based on self - reporting and values measured by medical staff , as well as between the two self - reported measurements.17 the average difference between the bmi values indicates the overall bias present in the data , while the limits of agreement ( mean 1.96 standard deviation ) indicate the precision of the measurements . for the comparison with values measured by medical staff , negative differences indicate that the bmi using medical staff values was higher than the self - reported bmi values , ie , negative differences indicate under - reporting . in order to examine representativeness , a comparison was made of basic demographic variables between the study sample group and the independent set of women remaining in the eligible cohort . specifically , the group of women who donated blood within a year of their questionnaire and supplied information on their anthropometric measurements ( n=1,723 ) were compared with those in the eligible cohort , who were willing to donate a blood sample , minus the random subsample ( n=91,828 ) using chi - square tests of independence and two sample t - tests . participants received mailed information about the study together with the questionnaires , and indicated their consent to participate . the study received approval from the regional committee for medical research ethics for the basic collection and storing of questionnaire information and blood sampling . the study sample consisted of 1,837 women who donated blood within a year of their primary questionnaire . of those , 280 women had their height and weight measured by medical staff at the time of their blood sample ( ie , secondary questionnaire ) . the rest either self - reported their height and weight ( n=1,443 ) or failed to indicate how the measurement was taken ( n=114 ) . women who self - reported their weight and height in the secondary questionnaire were similar to those who had their measurements taken by medical staff in terms of demographic characteristics ( table 1 ) . the women had an average age of 53.7 years at the time of their primary questionnaire , with a range of 4664 years . on average , they donated the blood sample 8 months after their primary questionnaire , with a range of 50365 days . comparisons of mean age and days between measurements failed to find any differences between those who self - reported anthropometric measurements at the secondary questionnaire and those who had their measurements taken by medical staff . there were no statistically significant differences between the two groups in terms of education level , marital status , or bmi category from the primary questionnaire . women who self - reported their weight and height at both questionnaires were more likely to have reported very good health status on the primary questionnaire than those who had their values measured at the secondary questionnaire ( p=0.05 ) , but both groups had few women reporting poor health . at the secondary measurement , the prevalence of the different bmi categories were : underweight 1% ( both groups ) , normal weight 51% in the self - reported group versus 49% in the measured group , overweight 34% ( self - reported ) versus 35% ( measured ) , and obesity 14% ( self - reported ) versus 15% ( measured ; see data in tables 3 and 5 ) . the majority of the study sample ( 79% ) self - reported their height and weight at the secondary questionnaire . the repeated self - measurements provide an estimate of changes over time , assuming any bias in reporting remains equal over the time period . on average , women reported little variation in their weight and height , with average differences of 0.6 kg and 0.1 cm ( table 2 ) . only 10% of women reported a weight difference of more than 5 kg ( gain or loss ) and only 10% reported a height difference of more than 1 cm . the mean differences in weight and bmi , although small in value , were statistically significant . for the women who self - reported values on both occasions ( n=1,380 ) , 11% ( n=152 ) were assigned a different bmi category at the secondary questionnaire when compared with the primary questionnaire ( table 3 ) , with 99% ( n=150 ) changing only one category . of those who changed category , the majority ( n=99 , 65% ) increased in bmi . when examining the women who changed bmi category either upward or downward , there were no statistically significant differences . women who increased a bmi category did not differ from those who were classified in the same category on both questionnaires in terms of education level , marital status , perceived health status , mean age , or mean days between measurements . however , there was a tendency for women who moved to a lower bmi category to report poorer health status ( 13% poor , 23% very good ) when compared with those who did not change in bmi category ( 7% and 34% respectively , p=0.07 ) . the normal weight bmi group at the secondary questionnaire had the highest percent agreement with the previously calculated bmi ( 95% ) , followed by the overweight ( 83% ) and obese ( 80% ) groups . few women had bmi values that corresponded to the underweight category . when examining the baseline classification ( row percentages ) in table 3 , there was not much variation with regard to how many women stayed in the same bmi category at the secondary questionnaire among those who self - reported their weight on both occasions , ie , 91% among the normal weight , 86% among the overweight , and 88% among the obese . when donating blood , 15% of the participating women ( n=280 ) had one of the medical staff measure their height and weight for the secondary questionnaire . mean weight as reported by medical staff was on average 1.5 kg higher than that self - reported by women in the primary questionnaire ( table 4 ) . height , on average , was 0.2 cm less than the self - reported values , and bmi calculated from the medical staff values was 0.6 kg / m higher than bmi calculated from self - reported values . while the differences are all small in value , they are statistically significant in paired t - tests . repeated measurements over time can be expected to change , and we estimated these changes for the study sample in the previous section ( table 2 ) . comparisons of the differences in reporting method ( self - reported , measured by medical staff ) and changes over time give an indication of self - report bias . weight measured by medical staff showed a larger increase on average than expected by changes over time ( 0.9 kg ) and the mean difference between reporting methods was significantly larger than that observed between repeated self - reports ( p<0.001 ) . height did not differ significantly more between reporting methods than expected through repeated self - reports . in line with the mean increase in weight , bmi measured by medical staff increased on average by 0.4 kg / m more than observed through repeated self - reports , which is a statistically significant increase ( p=0.002 ) . calculated bmi categories from self - reporting and values measured by medical staff differed for 20% of the women ( n=54 ) by one category ( table 5 ) . of those who changed category , the majority ( n=43 , 80% ) increased in bmi . women who increased one bmi category did not differ from those who were classified in the same category on both questionnaires in terms of education level , marital status , perceived health status , mean age , or mean days between measurements . while the majority of women in the sample were married ( table 1 ) , the 11 women who decreased in bmi category between self - reporting and values measured by medical staff were almost evenly split between married / cohabiting and unmarried ( fisher s exact test , p=0.04 ) . women with normal weight as measured by the medical staff had the highest agreement with the self - reported measure ( 94% ) , followed by obese women ( 80% ) . the highest level of misclassification was among overweight women , where 36% had self - reported values that corresponded to normal weight and 3% had self - reported bmi in the obese range ( table 5 ) . the weighted kappa assessing the agreement between values measured by medical staff and self - reported values was 0.73 ( 95% confidence interval 0.670.80 ) which corresponds to substantial agreement.18 in comparison , the expected agreement was 0.39 ( data not shown ) . when examining the baseline classification ( row percentages ) in table 5 , a slightly different picture emerges . among the self - reported obese , 91% were obese when objectively measured , while among the normal weight ( 78% ) and overweight ( 79% ) , this percentage was lower . in the self - reported normal weight group , most of the misreporters belonged to the overweight category when measured by medical staff ( 21% ) , while the misreporters among the overweight were fairly evenly spread among normal weight and obese when measured by medical staff ( 10% and 11% , respectively ) . the overall mean difference between the average of self - reported bmi and that measured by medical staff was 0.29 kg / m , indicating a small bias toward under - reporting of bmi in self - reported values . the 95% limits of agreement ( figure 2 ) for the differences between the two measurements demonstrate both high overall precision and higher variation between measurements for women in the obese bmi category compared with those in the normal range . women with an average bmi in the obese range were more likely to have under - reported their bmi beyond the 95% limits of agreement ( 18% , 6/33 ) than those with an average bmi in the overweight range ( 5% , 4/82 ) . over the entire range of bmi values , the level of agreement between the two measurements was substantial , as demonstrated by very similar cumulative distribution curves ( figure s1 ) . the under - reporting was slightly greater than that observed for repeated self - reports , which also showed greater variation in the obese bmi range , with 12% of women outside the 95% limits of agreement compared with only 6% outside the limits for the remaining women ( figure 2 ) . there were no statistically significant differences between the eligible cohort and those in the study sample in terms of self - reported weight or perceived health status . there were small but statistically significant differences in terms of mean age at the time of the primary questionnaire ( 53.9 years in the eligible cohort compared with 53.7 years in the study sample p=0.04 ) , marital status ( p=0.04 ) , and height ( 166.8 cm compared with 166.4 cm , p=0.008 ) . women in the study sample were more likely to be married ( 83% ) than those in the eligible cohort ( 81% ) . there was a significant difference between the two groups of women in level of education , with a higher proportion of women in the study sample having a college degree ( 52% ) than those in the comparison group ( 46% , p<0.001 ) . the majority of the study sample ( 79% ) self - reported their height and weight at the secondary questionnaire . the repeated self - measurements provide an estimate of changes over time , assuming any bias in reporting remains equal over the time period . on average , women reported little variation in their weight and height , with average differences of 0.6 kg and 0.1 cm ( table 2 ) . only 10% of women reported a weight difference of more than 5 kg ( gain or loss ) and only 10% reported a height difference of more than 1 cm . the mean differences in weight and bmi , although small in value , were statistically significant . for the women who self - reported values on both occasions ( n=1,380 ) , 11% ( n=152 ) were assigned a different bmi category at the secondary questionnaire when compared with the primary questionnaire ( table 3 ) , with 99% ( n=150 ) changing only one category . of those who changed category , the majority ( n=99 , 65% ) increased in bmi . when examining the women who changed bmi category either upward or downward , there were no statistically significant differences . women who increased a bmi category did not differ from those who were classified in the same category on both questionnaires in terms of education level , marital status , perceived health status , mean age , or mean days between measurements . however , there was a tendency for women who moved to a lower bmi category to report poorer health status ( 13% poor , 23% very good ) when compared with those who did not change in bmi category ( 7% and 34% respectively , p=0.07 ) . the normal weight bmi group at the secondary questionnaire had the highest percent agreement with the previously calculated bmi ( 95% ) , followed by the overweight ( 83% ) and obese ( 80% ) groups . few women had bmi values that corresponded to the underweight category . when examining the baseline classification ( row percentages ) in table 3 , there was not much variation with regard to how many women stayed in the same bmi category at the secondary questionnaire among those who self - reported their weight on both occasions , ie , 91% among the normal weight , 86% among the overweight , and 88% among the obese . when donating blood , 15% of the participating women ( n=280 ) had one of the medical staff measure their height and weight for the secondary questionnaire . mean weight as reported by medical staff was on average 1.5 kg higher than that self - reported by women in the primary questionnaire ( table 4 ) . height , on average , was 0.2 cm less than the self - reported values , and bmi calculated from the medical staff values was 0.6 kg / m higher than bmi calculated from self - reported values . while the differences are all small in value , they are statistically significant in paired t - tests . repeated measurements over time can be expected to change , and we estimated these changes for the study sample in the previous section ( table 2 ) . comparisons of the differences in reporting method ( self - reported , measured by medical staff ) and changes over time give an indication of self - report bias . weight measured by medical staff showed a larger increase on average than expected by changes over time ( 0.9 kg ) and the mean difference between reporting methods was significantly larger than that observed between repeated self - reports ( p<0.001 ) . height did not differ significantly more between reporting methods than expected through repeated self - reports . in line with the mean increase in weight , bmi measured by medical staff increased on average by 0.4 kg / m more than observed through repeated self - reports , which is a statistically significant increase ( p=0.002 ) . calculated bmi categories from self - reporting and values measured by medical staff differed for 20% of the women ( n=54 ) by one category ( table 5 ) . of those who changed category , the majority ( n=43 , 80% ) increased in bmi . women who increased one bmi category did not differ from those who were classified in the same category on both questionnaires in terms of education level , marital status , perceived health status , mean age , or mean days between measurements . while the majority of women in the sample were married ( table 1 ) , the 11 women who decreased in bmi category between self - reporting and values measured by medical staff were almost evenly split between married / cohabiting and unmarried ( fisher s exact test , p=0.04 ) . women with normal weight as measured by the medical staff had the highest agreement with the self - reported measure ( 94% ) , followed by obese women ( 80% ) . the highest level of misclassification was among overweight women , where 36% had self - reported values that corresponded to normal weight and 3% had self - reported bmi in the obese range ( table 5 ) . the weighted kappa assessing the agreement between values measured by medical staff and self - reported values was 0.73 ( 95% confidence interval 0.670.80 ) which corresponds to substantial agreement.18 in comparison , the expected agreement was 0.39 ( data not shown ) . when examining the baseline classification ( row percentages ) in table 5 , a slightly different picture emerges . among the self - reported obese , 91% were obese when objectively measured , while among the normal weight ( 78% ) and overweight ( 79% ) , this percentage was lower . in the self - reported normal weight group , most of the misreporters belonged to the overweight category when measured by medical staff ( 21% ) , while the misreporters among the overweight were fairly evenly spread among normal weight and obese when measured by medical staff ( 10% and 11% , respectively ) . the overall mean difference between the average of self - reported bmi and that measured by medical staff was 0.29 kg / m , indicating a small bias toward under - reporting of bmi in self - reported values . the 95% limits of agreement ( figure 2 ) for the differences between the two measurements demonstrate both high overall precision and higher variation between measurements for women in the obese bmi category compared with those in the normal range . women with an average bmi in the obese range were more likely to have under - reported their bmi beyond the 95% limits of agreement ( 18% , 6/33 ) than those with an average bmi in the overweight range ( 5% , 4/82 ) . over the entire range of bmi values , the level of agreement between the two measurements was substantial , as demonstrated by very similar cumulative distribution curves ( figure s1 ) . the under - reporting was slightly greater than that observed for repeated self - reports , which also showed greater variation in the obese bmi range , with 12% of women outside the 95% limits of agreement compared with only 6% outside the limits for the remaining women ( figure 2 ) . there were no statistically significant differences between the eligible cohort and those in the study sample in terms of self - reported weight or perceived health status . there were small but statistically significant differences in terms of mean age at the time of the primary questionnaire ( 53.9 years in the eligible cohort compared with 53.7 years in the study sample p=0.04 ) , marital status ( p=0.04 ) , and height ( 166.8 cm compared with 166.4 cm , p=0.008 ) . women in the study sample were more likely to be married ( 83% ) than those in the eligible cohort ( 81% ) . there was a significant difference between the two groups of women in level of education , with a higher proportion of women in the study sample having a college degree ( 52% ) than those in the comparison group ( 46% , p<0.001 ) . in this study , we estimated the misreporting of self - reported weight and height by comparing repeated self - reports with self - reported values followed by values measured by medical staff . the two groups did not differ except for better perceived health among those who gave repeated self - reports . the distribution of bmi categories did not differ between self - reported and measured values . weight and bmi were under - reported more by the repeated self - reporting group , but there was substantial agreement between self - reported values and those measured by medical staff ( weighted kappa for bmi 0.73 ) . under - reporting leading to misclassification of bmi category was most common among overweight women ( 36% ) , but the highest proportion of extreme under - reporters was found in the obese women ( 18% outside the 95% limits of agreement ) . the highest proportion of correctly classified women based on the primary self - reported measurement was found among the obese women . although the design of this validation study differs from that of most other studies , our findings are in accordance with studies comparing self - reported weight and height with weight and height measured by medical staff within a short time period . the difference in self - reported bmi and bmi measured by medical staff in our study was small but statistically significant , ie , 0.4 kg / m , and lower than what was found in women in the adventist health study ( 0.7 kg / m),2 epic - norfolk ( 0.92 kg / m),19 multiethnic cohort ( 0.67 kg / m),8 the sister study ( 0.7 kg / m),6 and in the skaraborg project ( 0.8 kg / m),7 women attending a us family medicine clinic ( 0.8 kg / m),5 and female participants in the national health and nutrition education survey iii ( 0.67 kg / m).9 the results were similar to those found for women in an austrian study ( 0.43 kg / m),20 but the difference was larger than what was found in australian women ( 0.12 kg / m).21 an earlier review found mean differences between self - reported and measured bmi of 0.9 to 1.2 kg / m in women from the general population.1 as in most other studies , the errors in bmi were due to under - reporting of weight , and there was no significant misreporting of height . in the national health and nutrition education survey iii , high correlations was found between self - reported and measured bmi , and also between self - reported and measured bmi and disease biomarkers.9 the correlations did not differ much by age , sex , or obesity status . further , the results were the same when the analyses were done with percent body fat rather than bmi as the measure of adiposity . stommel et al found that women aged 4255 years reported bmi more in accordance with direct measures than either their younger or older counterparts,22 and most of our participants were in that age range . a more recent paper found that there have been temporal changes in the precision of self - reported height and weight , leading to more accurate bmi estimations.23 as the opposite has also been found,24 there could be cultural differences in accuracy of self - reported anthropometric values , but we have not found other norwegian publications for comparison . correlations between self - reported and measured bmi are generally high ( > 0.90 in all ethnic groups9 ) , but they are not adequate for measuring reliability , because they are testing associations rather than agreement , and are not able to identify systematic errors.25 the percentage of agreement includes both the precision of the measurement and the frequency of errors , and has clinical meaning , while graphical presentations are useful for displaying distributions and the magnitude of error.25 in general , substantial agreement between bmi categorizations based on self - reporting and measured values has been found , but self - reported values tend to give a lower bmi category,1,2,7,11,20 especially in overweight and obese subjects.3,4,12,26,27 kappa values between 0.66 and 0.81 have been reported,2,12,19,21 and our value of 0.73 fits well with this . in our study , 80% of the women were correctly classified , similar to what others have found.2,5,21 studies vary as to whether the percentage of correctly classified women is lowest among the overweight5,21 or obese.68,12,19,20 in our study , the percentage was lowest among the overweight when the underweight group ( n=2 measured by medical staff ) was disregarded . when examining those who were measured by medical staff based on their self - reported bmi category at baseline , the highest percentage of correctly classified participants was found in the obese group ( 91% ) . hence , the lower percentage of correctly classified obese women based on the measured values was due to misclassification ( under - reporting ) among those who were self - reported overweight rather than misclassification ( over - reporting ) among the obese . the repeated self - reported values indicated a greater range of values for those with an average bmi in the obese range compared with other women . this may indicate errors in measurement or changes in reporting bias , but could also indicate greater variation in weight over time for women in the obese range . in a large public health study from spain , after adjusting for predictors of under - reporting of bmi , especially dissatisfaction with body size , the estimated overweight prevalence increased from 15.0% to 18.5%.3 a large validity study of self - reported bmi in the national health and nutrition education survey concluded that self - reports are sufficient for most epidemiological studies , but not for prevalence studies.9 in our study , the prevalence of overweight and obesity did not differ when using self - reported and measured values . since the validation subsample was representative , and there was no difference between the self - reported and measured group , except in perceived health status , it seems that the self - reported values may be utilized for estimating prevalence of overweight and , in particular , obesity . comparisons failed to find any differences between those whose anthropometric measurements were self - reported in the secondary questionnaire and those who were measured by medical staff , except that women who gave repeated self - reports were more likely to report very good health status on the primary questionnaire than those who had their values measured for the secondary questionnaire . it is likely that perceived health influences what kind of questions a woman asks the medical staff ( blood sample only , or also anthropometric measurements ) . also , women who perceived their health as good might not be interested in receiving feedback from medical staff or in spending any additional time in the office . there was no difference in the prevalence of self - perceived poor health between the two groups . we have previously shown that participants in the nowac study are representative of the female norwegian population as a whole,28 except for higher education than non - responders , and that cancer rates are the same in our cohort as in the general female population of the same age.15 in the current study , education was the only factor where significant differences were found between women who gave blood and the remaining cohort . there were no significant differences in bmi between the different education groups , so the validity of the present study is not threatened . the strengths of this study include the representativeness of the study sample and the unbiased study design . participants were not aware that their anthropometric measurements might be checked when providing their primary height and weight information . knowledge of future measurement of weight by medical staff may lead to more accurate reporting.27 this study has some limitations . different measurement instruments were used for different participants ; they were not calibrated nor were precise instructions provided . participants with values measured by medical staff would have used a different scale and measuring tape at home when providing the primary self - reported values . this variation in instruments undoubtedly increased the variability in the measurements and the measurement error . failure to calibrate instruments has been shown to increase the prevalence of overweight and obesity in population - based samples.29 however , digital home bathroom scales have been shown to provide sufficiently accurate and consistent weights for public health research purposes.30 further , the mean time lapse between measurements was quite long ( 8 months ) , but as the difference was equal in both groups , this complicates only the study design and not the final results . body weight may naturally shift up and down over time , so we studied differences in excess of what was found with repeated self - reports , assuming constant misreporting over the year . this could be questioned , but since the data collection took place over years , the results should be robust to seasonal variations . the results of this study show that self - reported data successfully distinguish between the obese and nonobese , and although there were some more misreporters among the overweight , the results are comparable with those of other studies . being able to correctly classify the obese is important , given that the association between bmi and mortality or morbidity is strongest for this group.31,32 women who had their weight measured after having self - reported had a significantly higher weight than those who self - reported twice . the tendency of under - reporting was largest among overweight women , while the most extreme under - reporters were found in the obese group . despite the under - reporting , the discrepancies between self - reported and directly measured bmi in women were small , and the agreement between self - reported and measured values was substantial , as demonstrated by the cumulative distribution of the bmi curves . our self - reported weight and height data provide a valid ranking of bmi for middle - aged norwegian women . cumulative distribution plot of self - reported and measured bmi . abbreviation : bmi , body mass index .

backgroundbody mass index ( bmi ) based on self - reported height and weight has been criticized as being biased because of an observed tendency for overweight and obese people to overestimate height and underestimate weight , resulting in higher misclassification for these groups . we examined the validity of bmi based on self - reported values in a sample of norwegian women aged 4464 years.methodsthe study sample of 1,837 participants in the norwegian women and cancer study self - reported height and weight , and then , within 1 year , either self - reported anthropometric again , or were measured by medical staff . demographic and anthropometric were compared using t - tests and chi - square tests of independence . misclassification of bmi categories was assessed by weighted cohen s kappa and bland altman plot.resultson average , the two measurements were taken 8 months apart , and self - reported weight increased by 0.6 kg ( p<0.05 ) , and bmi by 0.2 kg / m2 ( p<0.05 ) . the distribution of bmi categories did not differ between self - reported and measured values . there was substantial agreement between self - reported values and those measured by medical staff ( weighted kappa 0.73 ) . under - reporting resulting in misclassification of bmi category was most common among overweight women ( 36% ) , but the highest proportion of extreme under - reporting was found in obese women ( 18% outside the 95% limits of agreement ) . the cumulative distribution curves for the measured and self - reported values closely followed each other , but measurements by medical staff were shifted slightly toward higher bmi values.conclusionwhile there was substantial agreement between self - reported and measured bmi values , there was small but statistically significant under - reporting of weight and thus self - reported bmi . the tendency to under - report was largest among overweight women , while the largest degree of under - reporting was found in the obese group . self - reported weight and height provide a valid ranking of bmi for middle - aged norwegian women .

Background Subjects and methods Statistical analysis Ethical issues Results Variation in self-reported BMI over time Self-reporting versus measurement by medical staff Representativeness Discussion Conclusion Supplementary material

the functions of the salivary glands are controlled by the autonomic nervous system and influenced by the sensory nervous system . when parasympathetic impulses dominate , salivary flow is greatly enhanced and the saliva has a low protein content . studies of animal and human innervation have revealed that parasympathetic nerve fibers are present around acinar cells , ducts , and blood vessels in the major salivary glands . a research has also shown that beside the classic transmitters noradrenaline and acetylcholine , neuropeptides such as substance p ( sp ) , calcitonin gene - related peptide ( cgrp ) , and vasoactive intestinal polypeptide ( vip ) ( figure 1 ) are present in the nerve fibers of the autonomic nervous system as well as in the auriculotemporal nerve , facial nerve , and cervical dorsal root fibers . these neuropeptides are known to cause salivation in rats [ 27 ] . in recent years , the mechanisms of actions of drugs that used to treat xerostomia have been elucidated pharmacologically from the viewpoint of salivary neuropeptide levels . anethole trithione and pilocarpine have been shown to elevate sp and cgrp levels in human saliva [ 811 ] . cevimeline hydrochloride hydrate ( cevimeline ) ( figure 2 ) is a novel muscarinic acetylcholine receptor agonist currently being developed as a therapeutic agent for sjgren 's syndrome . sjgren 's syndrome is a serious and chronic autoimmune disorder characterized by inflammation in the exocrine glands such as the salivary and lacrimal glands , leading to xerostomia ( dry mouth ) and xerophthalmia ( dry eyes ) . cevimeline acts as a stimulator of the m3 acetylcholine receptor expressed on salivary glands and has been shown to increase saliva secretion in patients with sjgren 's syndrome . although cevimeline is useful for the treatment of dry mouth , it only enhances saliva production in 60% of the patients , and the mechanism of the drug response is still unknown . it is possible that individual variability of neuropeptide nerve stimulation in response to cevimeline may be involved in the variable drug response to cevimeline . the objective of the present study is to examine the effects of cevimeline on saliva and plasma levels of sp- , cgrp- , and vip - like immunoreactive substances ( iss ) in humans , as markers of nerve stimulation of these neuropeptides . cevimeline hydrochloride hydrate ( saligren capsule 30 mg ) was purchased from nippon kayaku co. ltd . lactose ( merck hoei co. ltd . , osaka , japan ) was used as placebo . synthetic human sp , cgrp and its fragment ( 837 ) , and vip were purchased from peptide institute , inc . vip fragment ( 1128 ) was supplied by professor yajima ( kyoto university , kyoto , japan ) . substance p antiserum ( y150 ) was purchased from yanaihara institute ( shizuoka , japan ) , cgrp antiserum ( 14160 ) from peptide institute , inc . , and vip antiserum ( t-4116 ) from peninsula laboratories ( california , usa ) . seven healthy nonsmoking male volunteers aged 2431 ( median 27 ) years and weighing 5670 ( median 64 ) kg participated in this study . all subjects had no history of xerostomia , and their baseline fasting salivary and plasma levels of sp- , cgrp- , and vip - is were within the normal ranges for healthy subjects reported previously [ 811 , 15 , 16 ] . each subject gave informed consent after receiving explanation on the scientific purpose of the study . the subjects fasted for at least 2 hours before the study was commenced and during the experiments . we performed an open - labeled , crossover study between may and october 2010 . in each subject , cevimeline and placebo were studied in random order , in a crossover manner with an interval of one month between the two studies . on the day of study , all subjects finished lunch ( standardized lunch of less than 800 kcal ) before 12:00 . each study was conducted from 14:00 to 18:00 in a room with temperature controlled at 25c , during which the subjects maintained a resting and relaxed state . a single dose of cevimeline 30 mg ( cevimeline group ) or placebo ( placebo group ) was administered orally with 100 ml water . at scheduled times after the test drug was administered , saliva production was measured , and saliva samples were collected for assaying salivary neuropeptide levels , while blood samples were collected for measuring plasma neuropeptide levels . the dose of cevimeline in this study was the normal daily dose used in clinical therapy . saliva and venous blood samples were collected before and at 30 , 60 , 90 , 120 , 180 , and 240 min after administration of cevimeline or placebo . the volume of saliva produced in 5 min was measured by the saxon test , an oral equivalent of the schirmer test . 14 , kawamoto houtai zairyou , osaka , japan ) and a polyethylene pouch were weighed . after swallowing to remove any existing oral fluid , saliva was collected by placing the two cotton balls onto the vestibule of the mouth for exactly 5 min . the weight of saliva was determined by subtracting the original weight of the pouch and cotton balls from the weight obtained after the cotton balls were placed in the mouth . the weight of the liquid was taken to be the salivary volume ( ml ) produced in 5 minutes . unstimulated whole saliva specimens were collected by the spitting method according to navazesh and christensen . the subjects rinsed their mouth thoroughly with deionized water and rested for a few minutes before saliva collection began . after one minute practice collection , which was discarded , subsequently 3 ml of saliva was collected into a test tube containing 500 kallikrein inhibitor units / ml of aprotinin and 1.2 mg / ml of edta . blood samples were collected into chilled tubes containing 500 kallikrein inhibitor units / ml of aprotinin and 1.2 mg / ml of edta . the saliva samples were diluted 1 : 1 with 4% acetate buffer ( ph 4.0 ) , centrifuged at 3500 rpm for 5 min at 4c , and then the supernatant was diluted 2 : 3 with 4% acetate buffer ( ph 4.0 ) and loaded onto c18 reverse - phase cartridges ( sep - pak c18 ; millipore corp . , milford , ma , usa ) . blood samples were centrifuged , and the plasma samples were diluted 1 : 4 with 4% acetate buffer ( ph 4.0 ) and loaded onto c18 reverse - phase cartridges . after washing with 4% acetate buffer , neuropeptides in the columns were eluted with 70% acetonitrile in 0.5% acetate buffer ( ph 4.0 ) . eluates were concentrated by spin - vacuum evaporation , lyophilized , and stored at 40c until use . the recovery of sp- , cgrp- , and vip - is in saliva and plasma was greater than 90% using this extraction procedure [ 1921 ] . neuropeptide levels in saliva and plasma were measured using highly sensitive enzyme immunoassays for sp , cgrp , and vip as described previously . an immunoplate ( nunc - immuno module maxisorp f8 , intermed , denmark ) coated with anti - rabbit igg ( 55641 , icn pharmaceuticals , inc . , human sp , cgrp fragment ( 837 ) , or vip fragment ( 1128 ) was conjugated with -d - galactosidase by n-(-maleimido - caproyloxy)-succinimide according to the methods of kitagawa et al . . the enzyme immunoassays were specific and highly sensitive , with detection limits of 0.08 , 0.40 , and 1.00 fmol / well for sp- , cgrp- , and vip - is , respectively . total release of each neuropeptide or saliva was calculated as the area under the level or volume time curve ( auc0240 ) using the trapezoidal method . differences in neuropeptide - is level , salivary volume , and their auc0240 between the cevimeline and placebo groups were analyzed by paired t - test or mann - whitney u test . the relationship between auc0240 of neuropeptide - is level and auc0240 of salivary volume was analyzed by pearson 's product - moment correlation coefficient . statistical analyses were performed using the spss software package ( version 17.0 ; spss inc . , il , usa ) . the salivary sp - is level - time profile and total release of sp - is ( auc0240 ) after a single oral dose of cevimeline or placebo are shown in figure 3(a ) and table 1 . oral administration of cevimeline resulted in significant increases in salivary sp - is level at 30 , 60 , 90 , and 120 min ( 7.5 3.4 , 19.1 15.1 , 12.5 5.1 , and 9.9 4.1 pg / ml , resp . ) compared with the corresponding levels after placebo administration ( 4.0 1.5 , 5.2 1.8 , 5.6 2.4 , and 5.3 2.7 pg / ml ) . furthermore , auc0240 was significantly higher after cevimeline administration ( 2420.9 744.6 pgmin / ml ) compared with placebo ( 1185.8 398.6 pgmin / ml ) . on the other hand , no significant changes in salivary cgrp- and vip - is levels and auc0240 were observed after the administration of cevimeline ( figures 3(b ) and 3(c ) and table 1 ) compared with placebo . the plasma sp- , cgrp- , and vip - is level - time profiles and total releases of sp- , cgrp- , and vip - is ( auc0240 ) after a single oral dose of cevimeline or placebo are shown in figure 4 and table 2 . cevimeline administration did not alter the plasma levels or auc0240 of sp- , cgrp- , or vip - is compared with placebo . the changes in salivary volume and total release of saliva ( auc0240 ) after cevimeline or placebo administration are shown in figure 5 and table 3 . cevimeline administration resulted in significant increases in salivary volume at 90 , 180 , and 240 min ( 5.6 2.8 , 5.7 1.8 , and 5.1 1.2 ml , resp . ) compared with the corresponding levels after placebo administration ( 3.4 1.3 , 3.4 1.5 , and 3.2 1.6 ml ) . the auc0240 was also significantly higher after cevimeline administration ( 1200.8 403.4 mlmin ) compared with placebo ( 804.9 369.8 mlmin ) . the relationship between auc0240 of sp - is level and salivary volume after administration of cevimeline or placebo is shown in figure 6 . a significant correlation was observed between auc0240 of sp - is level and auc0240 salivary volume ( r = 0.55 , p = 0.042 ) . in this study , we investigated the effects of cevimeline on saliva and plasma levels of sp- , cgrp- , and vip - is in healthy subjects . past studies have established that salivary and plasma levels of sp- , cgrp- , and vip - is vary within 30 min after a meal and then maintain constant from 1 hour after a meal [ 8 , 9 , 1921 ] . furthermore , it is known that the absorption of cevimeline is little affected by a meal . these data support our study design , and the present study appropriately evaluates the effects of cevimeline on neuropeptide levels and saliva production without being affected by a meal . sp is mainly localized in submandibular and parotid glands and increases blood flow via its vasodilatory effect in salivary glands , stimulates the production of saliva and amylase , and influences ionic flow in rats [ 23 , 24 ] . previous report indicates that cgrp also enhances the release of saliva and amylase in rats [ 3 , 6 ] , and vip induces alterations in salivary fluid and protein secretion [ 4 , 25 ] . in the present study , a single oral dose of cevimeline resulted in significant increases in salivary sp - is level at 30 , 60 , 90 , and 120 min and in the auc0240 of sp - is compared with placebo administration , whereas cevimeline did not alter the plasma levels or auc0240 of sp - is . anethole trithione and pilocarpine have also been reported to increase sp - is in saliva but not in plasma [ 811 ] . these results indicate a close association of sp with the enhancement of salivary secretion by cevimeline , in the same manner as anethole trithione and pilocarpine . in addition , these findings suggest that cevimeline may mainly promote salivary secretion from submandibular and parotid glands by increasing sp . on the other hand , no significant changes in salivary and plasma levels and auc0240 of cgrp- and vip these findings suggest that pathways via cgrp and vip nerves may not be involved in the stimulatory effect on salivation by cevimeline . on the other hand , anethole trithione and pilocarpine increase not only sp but also cgrp levels in human saliva [ 811 ] . cevimeline acts as a selective stimulator of the m3 acetylcholine receptor expressed on salivary glands , and this selectivity may reflect the specificity of the cevimeline action on sp nerves in salivary glands . oral cevimeline administration resulted in significant increases in salivary volumes at 90 , 180 , and 240 min and in the auc0240 compared with placebo administration . furthermore , a significant correlation was observed between auc0240 of sp - is level and auc0240 of salivary volume , suggesting the possible involvement of sp in the cevimeline - enhanced saliva secretory activity . a lag time was observed between elevation of salivary sp level and increase in salivary volume , suggesting that sp secreted from the sp nerves stimulated by cevimeline may initially increase blood flow and cause vasodilatation in salivary glands , followed by a gradual increase in salivary production . however , some reports have suggested that human salivary glands are thought to lack an sp innervation of the acinar cells , and in vitro pieces of human submandibular glands do not respond with fluid secretion to the administration of sp , as judged by the release of potassium [ 26 , 27 ] . furthermore , other neuropeptides not tested in this study may also be involved in the mechanism of enhancement of salivary secretion by cevimeline . therefore , this notion requires verification by further studies . cevimeline is known to enhance saliva production in only 60% of the treated patients , and the mechanism of drug response remains unknown . the present study shows a possibility that individual variability of sp nerve stimulation in response to cevimeline may account for the variable drug response to cevimeline , although it is uncertain whether this trend in healthy volunteers is also observed in patients . therefore , further studies are required to investigate the effects of cevimeline in patients with conditions such as xerostomia . this study demonstrated the effects of cevimeline on salivary and plasma levels of neuropeptides in humans . a single oral dose of cevimeline resulted in a significant increase in salivary but not plasma sp - is level , and a significant correlation was observed between the total release of salivary sp - is and of salivary volume . these findings suggest a close association of sp with the enhancement of salivary secretion by cevimeline . a large - scale controlled study evaluating multiple dosing conditions of cevimeline would help to better understand the effects of cevimeline .

cevimeline is a novel muscarinic acetylcholine receptor agonist currently being developed as a therapeutic agent for xerostomia . we examined the effects of cevimeline on salivary and plasma levels of substance - p- ( sp- ) , calcitonin - gene - related - peptide- ( cgrp- ) , and vasoactive - intestinal - polypeptide- ( vip- ) like immunoreactive substances ( iss ) in humans . an open - labeled crossover study was conducted on seven healthy volunteers . saliva volume was measured , and saliva and venous blood samples were collected before and 30240 min after a single oral dose of cevimeline or placebo . salivary and plasma levels of sp- , cgrp- , and vip - is were measured using a highly sensitive enzyme immunoassay . a single oral dose of cevimeline resulted in significant increases in salivary but not plasma sp - is level compared to placebo . cevimeline administration did not alter the salivary or plasma levels of cgrp - is or vip - is compared to placebo . significant increases in salivary volume were observed after cevimeline administration compared to placebo . a significant correlation was observed between the total release of sp - is and that of salivary volume . these findings suggest an association of sp with the enhancement of salivary secretion by cevimeline .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

the technique of lymphatic mapping and sentinel lymph node biopsy ( slnb ) has emerged in the last two decades as a minimally invasive approach to evaluate regional lymph node basins in patients with intermediate and high - risk primary cutaneous melanoma . in particular , slnb is now recommended as a staging procedure for patients with t2 , t3 or t4 melanomas and clinical uninvolved regional lymph nodes ( clinical stage ib and ii ) and suggested also for patients with t1 melanomas and pathologic features associated with an increased risk of nodal micrometastases ( ulceration , high mitotic rate , ) . also positron emission tomography ( pet ) with 18f - fluorodeoxyglucose ( 18f - fdg ) has been extensively investigated in patients with melanoma and plenty of studies have shown its effective role in detecting distant metastases , further increased after the introduction of co - registered computed tomography ( ct ) scan ( 18f - fdg pet / ct ) . in this article , we introduce a case of pt4b thigh melanoma , in which both procedures were performed , together with ultrasonography . an 82-year - old white male , with a clinically - confirmed cutaneous melanoma of the right thigh , presented to our unit to undergo lymphoscintigraphy , in order to perform slnb at the same time of tumor excision . lymphoscintigraphy with tc - nanocolloids was performed on a hybrid system philips single - photon emission computed tomography / computed tomography ( spect / ct ) precedence 16 slices ( philips healthcare , eindhoven , the netherlands ) after intradermal injection of the radiopharmaceutical around the primary lesion ( four separate injections , 0.1 ml for each aliquot , total activity 100 mbq ) . low dose helical ct scan was performed : 120 kv , 100 ma , d - dom control dose , 3 mm slice thickness , 1.5 mm detector collimation , pitch 0.8 , rotation time 0.75 s. spect scan was acquired with the following parameters : 128 128 matrix size , 120 view angle , 10 s time / angle , 5 mm pixel size . spect / ct images showed uptake of the radiocolloids in a right inguinal lymph node . on ct co - registered images , anyway , another lymph node with no radiopharmaceutical uptake but with suspicious aspect ( globular morphology , absence of hilum ) was detectable in the crural region , much closer to the primary tumor [ figures 1 and 2 - left panel ] . axial views of single - photon emission computed tomography / computed tomography ( ct ) lymphoscintigraphy with tc - nanocolloids . tracer uptake can be seen in the site of injection / primary tumor ( green arrow ) and in a right inguinal node ( yellow arrow ) , while there is no uptake in a crural node with suspicious aspect on ct images ( red arrow ) volume rendering of technetium - labeled radiocolloids single - photon emission computed tomography / computed tomography ( left panel ) and f - fluorodeoxyglucose positron emission tomography / computed tomography ( right panel ) . the arrows show the sites of primary lesion ( green ) , true sentinel crural node ( red ) , false sentinel inguinal node ( yellow ) for this reason , and due to the adverse pathologic features of the removed lesion ( clark 's level iv , breslow 's depth 4.6 mm , ulceration , 89 mitoses / mm , poor inflammatory infiltrate , pt4b ) , the patient was further staged with a f - fdg pet / ct scan after surgery . pet / ct showed pathologic uptake of the tracer in the suspected right crural lymph node , which was removed : no other nodal or visceral metastases were seen [ figures 2 - right panel and 3 ] . histology demonstrated signs of chronic inflammation and no neoplastic cells in the inguinal lymph node ( analysis of slices from the whole node with hematoxylin and eosin ( h and e ) stain and confirmation with immunohistochemical staining for s-100 protein in each blank slide ) , while a massive metastasis from melanoma was seen in the crural node ( h and e ) . no significant uptake can be seen in the site of the removed primary tumor ( green arrow ) and right inguinal node ( yellow arrow ) , while high metabolic activity is demonstrated in the crural node ( red arrow ) neither inguinal lymphadenectomy nor systemic therapy was proposed , due to age and co - morbidity ( hypertensive cardiomyopathy ) and a follow - up based on abdominal , and inguinal ultrasonography was organized . ten months after surgery the patient developed a metastatic disease , further depicted by a follow - up f - fdg pet / ct scan [ figure 4 ] . follow - up f - fluorodeoxyglucose positron emission tomography / computed tomography scan ( 1 year after tumor excision ) : multiple secondary lesions can be seen in right inguinal nodes , in the liver and in many skeletal segments the prognostic factors for cutaneous melanoma have been recently revised in the 7 edition of the american joint committee on cancer ( ajcc ) ( 2009 ) , based on analysis of data for over 50,000 patients of ajcc database . apart from the features of the primary lesion ( thickness , mitotic rate , ulceration ) , the histologic status of regional nodes has been confirmed as the most powerful independent predictor of survival in clinically node - negative patients . the technique of slnb , first proposed in the 1980s , made inroads once it was clear that the treatment of regional node disease while still microscopic afforded a survival benefit compared to waiting for clinically evident disease . this strategy , minimally invasive , allows the use of more aggressive surgical approaches and systemic therapies only in higher - risk patients , with occult stage iii disease . it has shown high sensitivity ( especially when performed with spect / ct - aided lymphatic mapping and multiple peri - tumour injections ) with very low false - negative rate , mainly related to technical problems associated with identification of the true sentinel node ( sn ) by nuclear medicine physicians and surgeons and errors in tissue sampling and interpretation by pathologists . thus , even if new and more sensitive molecular techniques have already shown promising results , slnb with pathological assessment is now the recommended staging procedure for all stage i and ii patients with primary melanomas > 1.0 mm in thickness . nonetheless , with the introduction and the development of noninvasive metabolic imaging techniques ( such as f - fdg pet / ct ) also in patients affected by melanoma , the hypothesis that even slnb could be avoided and replaced by the analysis of tumor metabolism in the lymphatic basin has emerged . in the last 15 years , almost 20 papers concerning the diagnostic performance of f - fdg pet / ct in comparison to slnb ( and ultrasonography ) can be found in literature , all pointing out , with few exceptions , a very low sensitivity of f - fdg pet / ct in discovering small lymph node metastases if compared with slnb . in this scenario , our report looks somewhat interesting , suggesting the possible utility of pet / ct even in the evaluation of regional disease in selected patients . the key point seems to be the missed identification of sentinel lymph node by lymphoscintigraphy , probably due to the obstruction of lymphatic flow to the true sn and the consequent deviation of the flow to another node . this situation has already been described in some papers about sns in melanoma and also in breast cancer . in 2009 , for example , lam et al . described three cases in which preoperative lymphoscintigraphy failed to show sns containing metastatic melanoma ( all with significant tumor involvement ) , that were discovered by ultrasound and then confirmed by fine - needle aspiration biopsy and histopathology . the same circumstance was previously described by estourgie in 2003 in two breast cancer patients : in that report , both lymphoscintigraphy with tc - nanocolloid and patent blue dye administration failed to identify the true sn , completely invaded by tumor and discovered by intra - operative palpation of the biopsy wound . what seems new here is that not only lymphoscintigraphy , but even preoperative ultrasonography failed to identify the metastatic crural node . in this setting , in our opinion , a double lesson can be learnt . first , this report confirms that a small risk of missing sentinel lymph node by lymphoscintigraphy exists ( especially in thick melanoma ) and highlights the added value of a hybrid tomographic study ( spect / ct ) , that allows a morphologic evaluation of the interested region too . second , it shows that f - fdg pet / ct , usually performed for n staging ( for the well - known lack of sensitivity in the study of the lymphatic basin ) , could give important information also about regional disease in selected patients . the selection of the staging procedures to perform should always be individualized , considering general and local features of the disease , and evaluating together with the patient the risks and benefits of each technique .

the american society of clinical oncology guidelines recommend sentinel lymph node biopsy ( slnb ) for all patients with melanoma tumors of intermediate thickness ( between 1 and 4 mm ) . in case of patients with thick melanoma tumors ( > 4 mm ) , slnb may be recommended as well , for staging purposes and to facilitate regional disease control . we report a case of an 82-year - old man , undergone excision of a cutaneous melanoma of the right thigh , which shows some limitation of slnb in thick melanoma . lymphoscintigraphy , performed as single - photon emission computed tomography / computed tomography ( spect / ct ) , failed to identify the real sentinel lymph node , as tracer uptake was seen in a right inguinal node . due to the presence on ct co - registered images of another suspicious node ( with no radiopharmaceutical uptake ) in the crural region , and considering the high - risk pathologic features of the removed primary lesion , a 18f - fluorodeoxyglucose positron emission tomography / ct ( 18f - fdg pet / ct ) staging scan was planned . pet / ct showed high metabolic activity in the suspected crural lymphadenopathy . histopathology demonstrated massive invasion of the crural ( sentinel ) node and no metastatic cells in the inguinal node . this report highlights both the higher accuracy of lymphoscintigraphy , when performed as spect / ct and the potential utility of 18f - fdg pet / ct in regional staging .

INTRODUCTION CASE REPORT DISCUSSION

the chronic diseases like cardiovascular diseases , diabetes and cancer contributes to almost half of the all - cause mortality in india . weighted prevalence of ischemic heart diseases was observed as 25.3/1000 population , and 118.0/1000 population for diabetes mellitus in an urban area of india . it was observed due to common risk factors like physical inactivity , unhealthy diet , tobacco use and stress . along with growth and development , reduction in common risk factors was considered to be one of the essential preventive and control strategies for chronic diseases . like modern medicine , the complementary and alternative medicine ( cam ) - ayurveda ( knowledge or science of life ) - primarily concerned with the body . it had been mentioned in ayurveda , about the three pillars for healthy and long life ; proper diet ( ahar ) , proper activities ( vihar ) , and divine life - style and control of sexuality ( brahmacharya ) . improper and unbalanced diet like undigested , junk , and accumulated food was also considered toxic for the body . ayurveda had been oldest and most organized scientific discipline , which was providing health - care . once upon a time , their classical text like charak samhita ( 100 ad ) is an excellent source of information about the holistic health , herbs , diseases , and surgical treatment for the entire country and the world . like yoga , ayurveda derived its origin to the hoary vedas and considering one of the sub - vedas ( upa - veda ) . therefore , its traditional holistic approach and principles observed to be have a potential in order to reduce the risk factors of chronic diseases in the community . it was already evident that cam had been widely used in africa ( 80.0% ) , australia ( 49.0% ) , indonesia ( 40.0% ) , france ( 75.0% ) , and even in united states ( 29.0 - 42.0% ) . in india as well , people are using the cam services through 2860 large hospitals across the country . cam has been integrated into primary health - care of the country under the national rural health mission . pattern of reported diseases at the cam facilities has not been shared with the modern medicine in india despite the provision of care to a significant group of the population . therefore , the present study was undertaken to describe the clinical profile of patients with chronic diseases at a tertiary care ayurvedic hospital in north india . the study was a part of assignment for the fellows appeared for 3 months course on non - communicable disease and health promotion at department of community medicine , dr . total 4 fellows appeared for the course and a 1 month field based assignment was allotted . during the course period fellows were assigned a mentor and a topic for study . present study was hospital based record based descriptive study carried out at department of kayachikitsa , rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh . as per census 2011 , the provisional population of the himachal pradesh was 68 56 509 ( 49.3% females ) and 15 07 223 ( 50.3% females ) of kangra district of the state . complied monthly data were accessed from the outpatient department ( opd ) records section from january 2011 to october 2011 . a single person collected the number of patients with an available diagnosis for every month . in addition , 30 case records ( patient file ) of admitted patients of hypertension and diabetes mellitus were selected randomly - using a random number table - from the inpatient department ( ipd ) . a total 30 case records were decided to study treatment practice at a tertiary care center . data were entered and analyzed by epiinfo 3.2 statistical software . before the data collection , ethical clearance form institution ethics committee and consent from studied health institutions was obtained . significantly ( p = 0.00 ) more males ( 51.1% ) reported at opd more than males . total 10,276 ( 15.8% ) children up to 5 years of age also sought treatment . almost half ( 53.1% ) of the patients were remained unclassified and kept under other category . commonly reported morbidities were related to respiratory ( 10.5% ) , neuromuscular ( 9.5% ) , digestive ( 9.2% ) , circulatory ( 9.1% ) , and eye ( 8.4% ) system . monthly trend of reported patients in the opd of kayachikitsa at rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh , 2011 ipd records of 30 hypertensive patients at ayurvedic tertiary hospital showed that the chest pain was the chief complaint ( 63.3% ) with mild to moderate intensity ( 70.0% ) and of radiating ( 56.7% ) in nature . it was observed that more than half ( 56.7% ) of the patients sought treatment from private practitioners before the admission [ table 2 ] . admitted patients had a history of hypertension for average 9 months and were on regular treatment for 21.3% of disease duration . diabetes mellitus had long standing history of average 145 month among the admitted patients , and since diagnosis ( 90.3% ) were on regular treatment . majority of patients with hypertension were being managed with aswaganda ( 66.0% ) and tagar powder ( 56.6% ) . symptomatic and management profile of patients in ipd of kayachikitsa at rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh , 2011 elevated blood pressure along with overweight and high cholesterol is a known risk factor for many chronic diseases . the chronic diseases are contributing about 46.0% of the all - cause mortality in india . evidence from india reported prevalence of chronic diseases up to 30.0% in the general population . it had been found to be prevalent in urban ( 36.4% ) along with slum ( 25.4% ) and rural ( 24.0% ) area . the present study at rural tertiary care health institute of ayurveda , showed that most of the patients were suffering from disorders related to respiratory , neuromuscular , and circulatory system , mostly suggestive of chronic diseases . based upon the grouped opd data it was observed to be difficult to further ascertain the causes of morbidity such as heart attack , brain attack , diabetes mellitus etc . , majority of patients were even not classified at all despite the complete diagnosis at the opd . it hindered the information that could ascertain that whether these patients were affected with the exact cause of chronic or acute disease . in the studied state , a total 27 ayurvedic hospitals with 580 beds , 1105 dispensaries and 7326 registered practitioners exist at the time of study . in the country , a total of 254 graduate and 64 post graduate ayurvedic colleges were producing 1197 under and 1110 post graduates every year . in addition , a total of 2458 hospitals with 44820 beds , 15353 dispensaries , 478750 registered practitioners . in ayurveda , dietary factors like unhealthy diet considered as a known risk factor for chronic diseases like consumption of high glycemic index , junk and salted food . however , food was being considered as medicine in ayurveda like barley / turmeric for obesity , kulatha for rheumatoid arthritis , ashwagandha as a general tonic . ayurveda had been playing a vial - role in the provision of treatment for common morbidities in india . ayurvedic products like jams , jellys , juices , biscuits , ice - cream , candies , chocolates , granules , flour , tea etc . , were recommended as healthy food and to be promoted to the crowd out the junk food in the existing market . therefore , with a vast human resource and the available ayurvedic treatment potential in the country , the rising trend of chronic diseases due to non - healthy life - style and dietary behavior could be managed successfully . furthermore , the actual burden and types of chronic disease in cam discipline need to be studied and shared . in this respect , standard method of case reporting modified as per the discipline to integrated disease surveillance project ( idsp ) at all levels and types of cam health facilities would certainly help to capture exact disease burden . as , government of india had already declared the mainstreaming of cam in modern health - care delivery system as it had recommended by appointment of at least one cam specialist at the community health center . ayurveda was being the oldest and the largest cam discipline in india , so , the integration of information from the ayurvedic health institution through idsp would be required to help for formulation of healthy public policy .

since a very long time , a significant number of patients have been seeking treatment at complementary and alternative medicine health facilities , but the disease burden at these facilities has never been assessed and documented . present cross - sectional study was carried out at ayurvedic tertiary care hospital to document and to assess the rationale of disease reporting at ayurvedic institutions of the northern state of india from january 2011 to october 2011 . almost half of the patients morbidities were not classified at all into any of the disease categories . the common reported morbidities at study hospital were : respiratory ( 10.5% ) , neuromuscular ( 9.5% ) , digestive ( 9.2% ) and circulatory ( 9.1% ) disorders . as the majority of diseases were unclassified , so mainstreaming of the effective disease surveillance would be required to understand the morbidity pattern and successful treatment practices at health facilities .

INTRODUCTION METHODOLOGY RESULTS DISCUSSION

proinflammatory cytokines ( il-1 , il-6 , and tnf- ) may significantly influence the development of obesity and concomitant disorders such as type 2 diabetes , arterial hypertension and metabolic disorders . it is suggested , that il-6 may affect the increase of free fatty acids level . tnf- is secreted mainly by macrophages and lymphocytes in response to cell damage caused by infection or malignant transformation . however , it can be also secreted by many other type of cells and tissues , e.g. , adipocytes . tnf- , similarly to il-6 , is a proinflammatory cytokine , characterized by a broad spectrum of functions which also include cytotoxic and cytostatic effects against cancer cells . it is able to inhibit lipoprotein lipase ( lpl ) at both mrna and protein levels . it also inhibits the expression of two major adipose tissue differentiation regulators : ccaat transcription factor that increases binding of alpha proteins ( cebp- ) and nuclear receptor ppar-2 . in consequence , changes in the expression of adipose tissue proteins , such as lpl , ap2 , fatty acid synthase , acetyl - coa carboxylase , glycerol 3-phosphate dehydrogenase ( gpdh ) , glucose receptor glut-4 , and others are observed . the aim of the present study was to assess the relation between il-6 and tnf- levels in serum of obese and normal weight subjects and to relate it to the crp concentration in obese subjects . the study was performed in accordance with the declaration of helsinki for human research and study protocol was approved by the ethics committee of warsaw medical university in warsaw , poland . kg / m , including 54 males aged 31 - 77 ( mean 53 1se years ) and 26 females aged 39 - 75 ( mean 61 2 years ) . a control group included 53 healthy subjects with normal weight , bmi < 25 ; 24 males aged 22 - 72 ( mean 39 2.3 years ) and 29 females aged 23 - 78 ( mean 47 2.4 years ) . in the studied population the tests were performed in a disease - free period , at least 3 weeks after any last infection , antibiotic treatment , and at least 3 months after any severe disease . blood samples were collected using edta as anticoagulant . to determine blood plasma concentration of il-6 and tnf , ' quantikine human il-6 ' and ' quantikine human tnf ' ( r&d systems , mn , usa ) elisa assay kits , respectively , were used . the measurements were taken using a microplate reader stat fax 2100 ( awareness technology , usa ) . crp plasma concentration was determined with fixed - point immuno - rate method ( ortho - clinical - diagnostics ) . results were analyzed for the whole population as well as in relation to gender , and compared with the control group . mean cytokine levels in different groups were compared with the mann - whitney u test . the mean il-6 level was generally lower in the control group in comparison with the population of patients population . however , a statistically significant difference in il-6 was found only between obese and normal weight women ( p = 0.001 ) , and not in males . the highest difference was found again with respect to the group of women ( p < 0.001 ) . in addition , il-6 level was higher in the obese patients with type 2 diabetes in comparison with the non - diabetic obese patients . here again , a statistically significant difference was observed only in the group of women ( p = 0.01 ) . the obese diabetic patients had a slightly higher tnf concentration than the obese non - diabetic patients ; the highest , albeit insignificant , difference being in the group of obese women . statistical analysis showed a positive correlation between il-6 and tnf concentrations ; significant values were achieved for the whole groups of overweight and obese patients ( p = 0.005 ) ( figure 1 ) . in whole populations , regardless of gender , a simultaneous elevation of both proinflammatory cytokines was observed . correlation between serum concentrations of il-6 and tnf ( r = 0.3 ; p = 0.005 ) . the crp level positively correlated with the il-6 concentration . here , the results for the whole overweight and obese group as well as in the women group were statistically significant . no statistically significant correlation between tnf and crp concentrations in overweight and obese patients was evident . correlation between il-6 concentration and crp level in the population of overweight and obese patients ( r = 0.3 ; p = 0.007 ) . the crp level significantly correlated with the obesity index expressed by bmi ; the correlation was observed in all analyzed subgroups ( figure 3 ) . correlation between bmi values and crp levels in the population of overweight and obese patients ( r = 0.4 ; p < 0.001 ) . it is widely suggested that overweight and obese subjects have elevated concentrations of inflammatory cytokines in serum . a possible mechanism of obesity - induced inflammatory response is based on the development of oxidative stress which , in consequence , leads to the inflammatory response induced by excessive intake of carbohydrates , mainly glucose . recent studies have shown that up to 30% of il-6 in the blood stream is secreted by adipose tissue , and the cytokine level positively correlates with body mass index ( bmi ) . intraperitoneal adipose tissue secretes three times more of il-6 than does subcutaneous adipose tissue . in the present study , moreover , a difference was observed in the population of obese , diabetic women in comparison with the women with no symptoms of diabetes . the obtained results suggest that gender is a major factor influencing the regulation of inflammatory factors ; possibly due to a specific hormonal balance or adipose tissue distribution in women . some authors consider both type 2 diabetes and insulin resistance as symptoms of an inflammatory response in the organism . the hypothesis can be confirmed by the increase in acute phase proteins , such as crp , amyloid a , alpha-1-acid glycoprotein , sialic acid , and cortisone in diabetic patients . the increase in il-6 , parallel to the elevated glucose and insulin concentrations , suggest a possible involvement of the cytokine in glucose metabolism , especially in adipocytes . likewise , in the present study we observed that cytokines positively correlated with the crp level , while crp , in turn , positively correlated with bmi in all analyzed subpopulations of obese patients . the increase in tnf expression in muscles and adipose tissue , through the tnf ability to phosphorylate serine residues in irs - i ( insulin receptor substrate 1 ) and a consequent decrease of insulin receptor tyrosine kinase activity , can lead to insulin resistance . the increase of tnf expression in the obese patients definitely demonstrated in the present study , can be a limiting factor for further enlargement of adipose tissue through the induction of insulin resistance of adipocytes . insulin resistance can influence lipoprotein lipase ( lpl ) activity and hence prevent excessive growth of adipose tissue . a high adipose tissue lpl to muscle lpl ratio observed in hyperinsulinemia leads to increased transport of lipids to the adipose tissue . so , rising insulin resistance will cause the reversal of the adipose tissue lpl to muscle lpl ratio , and in that way prevent further growth of adipose tissue . we suppose that tnf - induced insulin resistance , hyperinsulinemia , and higher lpl activity in adipocytes can cause body fat accumulation . on the other hand , the increase in body fat may lead to increased secretion of tnf that , in consequence , can cause insulin resistance . it is hard to state unambiguously whether the body fat content is a cause or a consequence of the observed differences in tnf concentration . however , it seems that the development type 2 diabetes depends on a number of other factors being more potent that tnf , as we did not find any differences in the tnf levels between the obese diabetics and non - obese patients with no diabetes .

backgroundthe development of obesity and related disorders , e.g. , type ii diabetes ( t2d ) , hypertension , and metabolic disturbances is strongly related to increased levels in proinflammatory cytokines ( il-1 , il-6 , and tnf- ) . both il-6 and tnf- are secreted by adipocytes and their concentration correlates with the percentage and distribution of fat tissue in the body . both cytokines are the main factors responsible for the induction of acute phase proteins production ( e.g. , crp ) and to inflammatory state.objectiveto compare of tnf- and il-6 concentrations in serum from obese subjects with those in subjects with normal bmi and to analyze the relation between tnf- , il-6 , bmi and the inflammatory state as measured by the level of crp.material and methodsthe study included 80 obese subject ( 54 males and 26 females ) bmi > 25 kg / m2 . a control group consisted of 53 healthy subjects ( 24 males and 29 females ) with bmi < 25 kg / m2 . to determine the blood plasma concentration of il-6 and tnf , commercial elisa assay kits were used.resultsthe concentration of il-6 was lower in the control compared with the obese patients , but a significance difference concerned only female subjects ( p = 0.001 ) . tnf- concentration was significantly higher in all obese subjects ( p < 0.001 ) . a higher level of this cytokine was also found in patients with obesity suffering from t2 dm . a positive correlation was present between il-6 and tnf- concentrations . only did the il-6 level correlate with the concentration of crp in serum.conclusionsthe study confirmed that increased inflammatory cytokines lead to the persistence of inflammation in obese subjects . however , some other factors , such as gender , may contribute to the development of obesity - related inflammatory states .

Introduction Materials and methods Results Discussion Conflicts of interest

the empa - reg outcome trial ( clinicaltrials.gov identifier , nct01131676 ) recently announced the effects of empagliflozin on the cardiovascular outcomes ( cvo ) and mortality in persons with type 2 diabetes mellitus ( t2 dm ) . in this seminal cvo trial ( cvot ) , 7020 patients with t2 dm with coexisting cardiovascular disease ( cvd ; myocardial infarction [ mi ] , stroke , or peripheral arterial disease ) were randomized to either 10 mg empagliflozin , 25 mg empagliflozin , or placebo , over and above standard of care . the primary composite outcome was a total of three endpoints ( death from cv causes , non - fatal mi , and non - fatal stroke ) , while the key secondary endpoint included a fourth endpoint the results of this study revealed a statistically significant reduction in the primary endpoint with empagliflozin use ( 10.5% in the empagliflozin group vs. 12.1% in the placebo group ; hazard ratio 0.86 ; relative risk reduction ( rrr ) 14% , 95% confidence interval 0.740.99 ; p = 0.04 ) . similarly , a rrr reduction is noted in death from cv causes ( rrr 38% ; 3.7% vs. 5.9% ) , hospitalization for heart failure ( rrr 35% ; 2.7% vs. 4.1% ) , and all - cause death ( rrr 32% ; 5.7% vs. 8.3% ) . however , the difference in rates of non - fatal mi and non - fatal stroke did not reach statistical significance . this article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by the author . the university group diabetes program ( ugdp ) study , published nearly half a century ago , highlighted the negative effects of tolbutamide on cv health . the united kingdom prospective diabetes study ( ukpds ) , a large study with multiple arms , unearthed the beneficial impact of metformin in contrast to other drugs such as chlorpropamide in improving cvo in t2 dm . the stop - niddm trial , breaking new ground , suggested cvo improvement when acarbose was administered to persons with impaired glucose tolerance . similarly , the proactive trial on pioglitazone reported a reduction in the composite of all - cause mortality , non - fatal mi , and stroke in patients with t2 dm who have a high risk of macrovascular events . however , all of these studies were not designed as a cvot , and their primary aim was to assess glucose - lowering efficacy rather than improvement in cv health . advances in the understanding of the interlink between diabetes and cv disease ( cvd ) , an appreciation of the need to improve cvo in diabetes care , and the realization that effective glucose - lowering drugs could end up worsening cvo ( e.g. , muraglitazar ) , have led to a mandatory requirement for cvots in anti - diabetic drugs pending regulatory approval . it then became imperative for all newly developed glucose - lowering molecules to undergo cv safety analysis by performing a cvot . the first drug to report such an analysis , after institution of new regulatory requirements , was quick - release bromocriptine , which demonstrated cv safety in a trial which recruited 3070 subjects for a mean follow up of 52 weeks . since then , various data on dipeptidyl - peptidase 4 inhibitors [ 810 ] and insulins have been published from large - scale cvots which have suggested their cv safety . while these cvots follow similar trial designs and protocols , subtle variations are present [ 811 ] . differences in inclusion / exclusion criteria , the duration of follow up , and the choice of primary / secondary endpoints can be easily discerned . though debate around the validity of various trial designs is never ending , there is broad consensus that modern cvots are well designed and have good reliability . all recent cvots have been designed to demonstrate cv safety ( non - inferiority ) , rather than superiority , as requested by regulators . over the past few decades the standard of care for cv prevention has improved markedly across the globe . use of medical interventions such as aspirin , statins , angiotensin - converting - enzyme inhibitors ( acei ) , angiotensin receptor blockers ( arbs ) , and beta blockers has helped to enhance cvo , especially in persons with t2 dm . though widespread use of these standard of care drugs allow easier demonstration of cv safety , their use makes it difficult for a new add - on therapy to demonstrate improvement in cvo . this is exactly what empagliflozin has achieved . in a high - risk cohort of subjects , with over 75% usage of statins , over 80% use of acei / arbs , and over 60% beta - blocker therapy , administration of empagliflozin was able to demonstrate added benefit in terms of cvo . this speaks for the strength of the molecule being studied , as well as the robust quality of trial methodology followed by the authors of the study . inclusion of a wide variety of high - risk subjects , from 42 different nationalities , enhances the global applicability of these results . the benefits of empagliflozin were noted early on in the empa - reg outcome trial , and continued throughout the study . this finding makes empagliflozin stand apart from other cvd preventive drugs , such as statins and ramipril , which demonstrated a cv benefit after a longer duration of therapy . whether this means that empagliflozin is an effective drug for secondary prevention of cvd , that is , the prevention of progression of cvd to death is open to debate . detractors point to the lack of statistical significance noted with respect to occurrence of non - fatal mi and stroke . however , this finding may be thought to reinforce the preventive power of empagliflozin : it may even be used in tertiary cvd prevention , as it helps improve outcomes in persons with t2 dm who experience an mi or stroke , ensuring that they survive the acute illness . thus , empagliflozin may be useful for tertiary prevention , rather than secondary prevention , of cvd . the number needed to treat , ( for all - cause mortality ) , which was 39 for empagliflozin over a period of 3 years , is much lower than that reported for other drugs , including ramipril and simvastatin [ 12 , 13 ] . the highly significant benefit of empagliflozin ( p = 0.002 ) in preventing hospitalization for heart failure raises hope for its use in this clinical situation . this finding is especially welcome considering the controversy related to the increased risk of heart failure hospitalization with other glucose - lowering therapies . empagliflozin , therefore , gets evidence - backed justification for use not only as a glucose - lowering therapy , but also raises hope for its potential as adjunctive therapy for cvd prevention ( table 1).table 1impact of empa - reg outcome study strengths robust methodology / clinical design multinational coverage ( 42 countries ) applicability across age , gender , cv phenotype clinically relevant inclusion / exclusion criteria clear - cut answers from straightforward statistical analysispositive answers empagliflozin is safe in high - risk cv patients with t2 dm empagliflozin improves cv outcomes in high - risk cv patients with t2 dm empagliflozin can be used safely in combination with other vascular - tropic drugs over an extended period of time empagliflozin can be used for prevention of cvd empagliflozin does not increase the risk of diabetic ketoacidosis or bone fracturesunanswered questions is the beneficial effect of empagliflozin a class effect , or a property unique to this molecule ? what are the mechanisms that account for the potential of empagliflozin to reduce cv outcomes ? is the beneficial cv effect of empagliflozin relevant to patients with t2 dm and low cv risk , and to patients with type 1 diabetes mellitus ? can empagliflozin be prescribed in acute coronary settings ? can empagliflozin be considered an adjuvant preventive therapy for cvd ? cv cardiovascular , cvd cardiovascular disease , t2 dm type 2 diabetes mellitus impact of empa - reg outcome study cv cardiovascular , cvd cardiovascular disease , t2 dm type 2 diabetes mellitus the empa - reg outcome results should be carefully interpreted to assess their impact on diabetes care and outcomes . while the findings for different subsets of patients need to be studied separately , the empa - reg outcome study also throws up a few interesting questions ( table 1 ) . will these beneficial results be relevant to persons with t2 dm and low cv risk , or to persons with type 1 diabetes mellitus ? whether the findings of empagliflozin can be extrapolated to other sodium - glucose co - transporter 2 inhibitors ( sglt2i ) are open to discussion . cvots are underway for both canagliflozin and dapagliflozin , and their results will decide whether the cv benefits of empagliflozin are a class effect or not . it is also uncertain if empagliflozin can be initiated , or continue to be used , in acute coronary settings , including unstable angina , mi , and heart failure . however , while translating cvot evidence to practice one should not lose sight of good clinical sense . this therapy should be accompanied by appropriate medication counseling and should not be prescribed to persons at risk of ketoacidosis or recurrent genital infections . while the empa - reg outcome study findings should be interpreted carefully to assess their impact on diabetes care and outcomes , the results go far beyond proving the superiority of empagliflozin in improving cvo . the seminal importance of these findings will ensure that this trial acts as a milestone in the fields of diabetology and cv medicine . the empa - reg outcome study raises the bar for future glucose - lowering drugs . such a development will help improve not only cvo , but also diabetes outcomes overall . the empa - reg outcome study may be just a small step for empagliflozin , but is a giant leap for diabetes care .

this article discusses the recently published empa - reg outcome trial , which assessed cardiovascular outcomes with empagliflozin therapy in persons with type 2 diabetes mellitus and coexisting cardiovascular disease . the article describes the background and challenges of modern cardiovascular outcome trials , points out the strengths of the empa - reg outcome study , and places the results in perspective . it highlights the significant impact that these results will have on cardiovascular preventive pharmacotherapy , and on future drug development in diabetes . at the same time , it reminds readers of the limitations of the results , and lists the questions raised by , or left unanswered by , the trial .

Introduction Earlier Cardiovascular Outcome Trials Improvement in Cardiovascular Care Empagliflozin: Better Benefit Empagliflozin: Expanding Boundaries Summary

primary neuroendocrine carcinoma ( nec ) of the breast is a rare distinct clinicopathological entity , comprising 0.5 - 2% of breast carcinomas world - wide . in 2003 , primary nec of the breast was identified as a distinct entity by the world health organization ( who ) classification of tumors . the who classification defines primary nec of the breast as tumors that express 50% or more of ne markers there are no previous reports of f-18 fluorodeoxyglucose ( fdg ) positron emission tomography / computed tomography ( pet / ct ) in patients with primary nec of breast with liver and bone metastasis . here we describe a case of a 45-year - old female patient who presented with jaundice and was evaluated to have multiple liver lesions and biopsy from liver showed metastatic neuroendocrine tumor . her chromogranin level was 886 ng / ml ( normal < 78 ng / ml ) . she was referred for the whole body pet / ct for detection of the primary site . pet / ct showed an intense uptake in the soft- tissue necrotic lesion in the inner quadrant of the left breast [ figure 1a and b ] with the same charecteristic feature of multiple hypodense liver lesions [ figure 1c ] . furthermore uptake noted in a lytic lesion in the d4 vertebra [ figure 1d and e ] . patient underwent fine - needle aspiration of the breast lesion , which confirmed neuroendocrine origin [ figure 2a and b ] . a diagnosis of primary nec of the left breast with metastasis was made and she was treated with peptide receptor radionuclide therapy and is on follow - up now . whole body fluorodeoxyglucose - positron emission tomography / computed tomography ( pet / ct ) maximum intensity projection image ( a ) , axial fused pet / ct showed a intense uptake in the soft - tissue lesion in the left breast ( b ) , liver lesions ( c ) and bone lesion ( d ) , axial ct showing lytic bone lesion in d4 vertebra ( e ) immunohistochemistry staining showing positive for chromogranin ( a ) and synaptophysin ( b ) primary nec of the breast is extremely rare with the first reported case in 1983 . the most frequent reported age varies from 40 to 70 years , with a higher incidence in women greater than 60 years . as metastatic neuroendocrine tumors of the breast are more common than that of primary neuroendocrine tumors of the breast , it is , therefore , important to differentiate primary breast neuroendocrine tumor from metastatic disease to the breast because of the differences in treatment focus . primary nec of the breast can be diagnosed if the presence of a non - mammary primary site can be clinically ruled out or if an in situ component is histologically detected or both . however , findings of certain studies have revealed that ne - differentiated tumors of the breast present as dense round or irregular masses with spiculated or lobular margins on the mammogram . definitive diagnosis is made with core needle biopsy , allowing for the immunohistochemical evaluation of the specimen for the ne markers . although the use of pet for the evaluation of ne tumors has been limited , tumors with moderate or high proliferative activity can be identified by fdg pet . there are reports of fdg pet / ct in a case of neuroendocrine differentiated breast carcinoma with pleural metastases using indium-111 octreotide . there are case reports of synchronous metastases to the liver and pancreas from a primary nec of the breast . our case is the first demonstrates that 18f - fdg pet / ct provides the most significant additional information related to the accurate detection of primary nec of breast and bone metastasis and guiding treatment .

cases of primary neuroendocrine carcinoma ( nec ) of the breast have been reported , though rare . we report the case of a 45-year - old woman presented with jaundice and evaluated to have liver metastasis from neuroendocrine origin . she underwent whole body positron emission tomography / computed tomography , which showed left breast lesion and bone metastasis . fine - needle aspiration ( fna ) of breast revealed a nec . a diagnosis of a primary nec of the breast was rendered with hepatic and bone metastasis . she was treated with peptide receptor radionuclide therapy and is on follow - up .

INTRODUCTION CASE REPORT DISCUSSION

malignant unilateral or bilateral ureteral obstruction may be secondary to direct tumor invasion , extrinsic compression , or encasement by metastatic retroperitoneal or pelvic lymph nodes . the selection of cancer patients for diversion should take into account factors such as tumor stage , prognosis of the primary cancer , likelihood of additional antineoplastic therapy , and quality of life . contemporary management options include external drainage via percutaneous nephrostomy ( pcn ) and internal drainage via the insertion of double - j stents . regular double - j stents used to relieve ureteral obstructions that are secondary to extrinsic causes , such as malignancies , have high rates of failure . pcn is commonly used as an alternative , either as a primary procedure or after the failure of transurethral procedures . however , pcn is more invasive than double - j stent insertion and may also have a greater incidence of accidental tube dislodgement . the invasiveness of the procedure and the high incidence of tube dislodgement may result in a reduction in patient quality of life . in addition , some patients are unwilling to accept a pcn tube because it requires an external collecting device . the limitations associated with conventional treatments for ureteral obstructions highlight the need for a novel treatment that can maintain ureteral patency while minimizing the deterioration of patient quality of life . several types of metallic stents have been used in the palliative treatment of malignant ureteral obstructions , but implantation of these stents has yielded results that are not uniform and the stents have been associated with various complications . a novel polytetrafluoroethylene ( ptfe ) membrane - covered metal mesh stent prevents obstruction from tissue ingrowth and reduces stent migration as a result of its unique structure . here we report our initial experience with a ptfe membrane - covered self - expandable metallic stent ( uventa stent ) for the palliative care of malignant ureteral obstruction . between october 2010 and november 2011 , 18 consecutive patients ( 5 men and 13 women ; mean age , 57 years ) underwent placement of uventa stents ( taewoong medical , seoul , korea ) for unilateral or bilateral malignant ureteral obstruction . the ureteral obstructions were caused by compression by a localized primary tumor in 1 ureter , remote metastatic disease or direct tumor infiltration in 6 ureters , and encasement by retroperitoneal lymphadenopathy in 13 ureters . six patients had uterine cervical cancer , 7 had colorectal cancer , 4 had stomach cancer , and 1 had retroperitoneal sarcoma ( table 1 ) . diagnostic imaging of obstructions was performed by using transabdominal ultrasound , computerized tomography ( ct ) , or intravenous urography ( ivu ) . a single urologist ( jwp ) candidates for uventa stent placement had pre - existing double - j stents that were either nonfunctional or caused excessive bladder irritation . the outer and inner meshes are made of nickel plus titanium alloy and there is a ptfe membrane between them ( fig . the inner shaft is pierced to the tip by the central lumen to allow the passage of a 0.035-inch guidewire . the stent is deployed by pulling the outer sheath back without moving the inner shaft . we used a uventa stent with a 7-mm nominal diameter that ranged in length from 6 to 12 cm . retrograde pyelography was performed to identify the obstructed ureteral segment shape , level , and length ( fig . stricture traversal was attempted by an appropriate combination of a 0.035-inch straight percutaneous transluminal angioplasty guidewire with hydrophilic coating or ptfe - coated guidewire and a 5.0 fr/70 cm ureteral catheter ( open - end flexi - tip , cook urological inc . , spencer , in , usa ) . gentle interventional maneuvers were necessary to prevent ureteral rupture and contrast extravasation , which might blur the fluoroscopic field and promote periureteral fibrosis . after successfully traversing the stricture , the guidewire was forwarded into the renal pelvis and exchanged for a rigid 0.035-inch amplatz super stiff guidewire ( boston scientific , miami , fl , usa ) to strengthen the ureteral course and secure the luminal passage during balloon dilation and stent placement ( figs . the stent was placed such that its upper and lower ends bypassed the stricture by 2 cm . when the obstruction site was in the distal ureter , the lower end of the stent was positioned intravesically , extending approximately 0.5 to 1 cm from the ureteral orifice ( fig . in long strictures requiring two or more uventa stents , the stents were placed sequentially , overlapping by 2 to 3 cm . balloon dilation was performed with a 6-mm balloon dilation catheter ( uromax ultra , boston scientific , galway , ireland ) . repeated high - pressure balloon dilation ( post - dilation pressure up to 20 atm ) was necessary in cases of resistant stricture and suboptimal stent expansion . after the intervention was completed , we planned follow - up visits with patients at 1 , 3 , 6 , and 12 months after stent implantation and yearly thereafter . urine culture , blood biochemistry tests , and ivu or ct were performed at the follow - up examinations to detect any recurrent strictures . all patients received specific instructions to return to our hospital in case of ipsilateral flank pain , abdominal pain , fever , dysuria , urgency , frequency , hematuria , or vomiting . additional uventa stent insertion was planned for any recurrent ureteral obstruction during follow - up . the outer and inner meshes are made of nickel plus titanium alloy and there is a ptfe membrane between them ( fig . the inner shaft is pierced to the tip by the central lumen to allow the passage of a 0.035-inch guidewire . the stent is deployed by pulling the outer sheath back without moving the inner shaft . we used a uventa stent with a 7-mm nominal diameter that ranged in length from 6 to 12 cm . retrograde pyelography was performed to identify the obstructed ureteral segment shape , level , and length ( fig . stricture traversal was attempted by an appropriate combination of a 0.035-inch straight percutaneous transluminal angioplasty guidewire with hydrophilic coating or ptfe - coated guidewire and a 5.0 fr/70 cm ureteral catheter ( open - end flexi - tip , cook urological inc . gentle interventional maneuvers were necessary to prevent ureteral rupture and contrast extravasation , which might blur the fluoroscopic field and promote periureteral fibrosis . after successfully traversing the stricture , the guidewire was forwarded into the renal pelvis and exchanged for a rigid 0.035-inch amplatz super stiff guidewire ( boston scientific , miami , fl , usa ) to strengthen the ureteral course and secure the luminal passage during balloon dilation and stent placement ( figs . the stent was placed such that its upper and lower ends bypassed the stricture by 2 cm . when the obstruction site was in the distal ureter , the lower end of the stent was positioned intravesically , extending approximately 0.5 to 1 cm from the ureteral orifice ( fig . in long strictures requiring two or more uventa stents , the stents were placed sequentially , overlapping by 2 to 3 cm . balloon dilation was performed with a 6-mm balloon dilation catheter ( uromax ultra , boston scientific , galway , ireland ) . repeated high - pressure balloon dilation ( post - dilation pressure up to 20 atm ) was necessary in cases of resistant stricture and suboptimal stent expansion . after the intervention was completed , we planned follow - up visits with patients at 1 , 3 , 6 , and 12 months after stent implantation and yearly thereafter . urine culture , blood biochemistry tests , and ivu or ct were performed at the follow - up examinations to detect any recurrent strictures . all patients received specific instructions to return to our hospital in case of ipsilateral flank pain , abdominal pain , fever , dysuria , urgency , frequency , hematuria , or vomiting . additional uventa stent insertion was planned for any recurrent ureteral obstruction during follow - up . two patients had bilateral ureteral obstructions , resulting in a total of 20 ureters that were managed by uventa implantation . mean ureteral obstruction length was 10.6 cm ( range , 2 to 20 cm ) . the first cystoscopic attempt failed in one patient because direct tumor invasion into the uretero - vesical junction made it impossible to find a ureteral orifice . the patient then underwent an anterograde double - j stent insertion , and we used the double - j stent as a guide for cystoscopic retrograde uventa insertion . we performed simultaneous balloon dilation in 12 ureters ( 60% ) because there was insufficient expansion of the uventa stent ( < 50% of diameter ) after deployment . the procedure time varied with the length and severity of obstruction , but ranged between 30 and 60 minutes . abnormally elevated serum creatinine decreased to normal levels ( table 1 ) and hydronephrosis gradually resolved by 4 weeks after uventa insertion ( fig . two patients experienced mild lower abdominal pain and discomfort for a few days after uventa deployment , probably as a result of the expanding force of the endoprostheses . two patients reported irritative bladder symptoms that may have been due to the protrusion of the distal end of the uventa stent into the bladder . mean follow - up time was 7.3 months ( range , 3 to 15 months ) . follow - up imaging studies ( ct or ivu ) indicated no stent obstruction by hyperplastic reaction or tumor ingrowth and the uventa stents maintained their shape . there were no instances of stone formation , encrustation , or migration of the uventa stents . the first report of double - j stents as a treatment for ureteral obstruction was published in 1978 . subsequently , these stents have been widely used for patients with extrinsic ureteral obstructions due to malignancy . however , the use of double - j stents in malignant ureteral obstructions has a high rate of failure . metallic stents have been applied in cardiac , gastroenterological , hepatobiliary , and vascular systems . several authors have proposed metal stents to ameliorate obstructive urinary tract pathology , including benign prostatic hyperplasia , urethral stenosis , ureteroileal anastomotic stricture , benign and malignant ureteral obstruction , and even kidney transplantation ureteral stenosis . self - expandable metallic stents have been used to treat malignant ureteral obstruction with acceptable results , but they can be obstructed by hyperplastic reactions or tumor ingrowth through the stent struts . in a description of their 10 years of experience with metal mesh stents , liatsikos et al . reported that the most common complications that jeopardized ureteral patency were hyperplastic reactions and tumor ingrowth . these complications developed in 45 of 119 ureters . the externally coated ureteral metallic stents and thermo - expandable metallic ureteral stents that were introduced to limit the ingrowth of hyperplastic tissue through stent struts frequently migrate , with migration occurring in 17.5 to 81.2% of these stents . this stent migration may be attributed to the lack of an appropriate anchor to the ureteral wall for the prostheses and propulsion by anterograde peristalsis . the unique structure of the uventa stents used in the present study prevents not only tissue ingrowth but also stent migration . the inner mesh and ptfe membrane prevent tissue ingrowth into the stent and the outer mesh induces ingrowth of tissue that acts as an anchor between the stent and the ureteral wall , thereby preventing migration . in a study comparing ptfe - covered metallic stents with uncovered metallic stents in canine ureters , chung et al . observed tissue proliferation on the outside of the covered stents but not within the lumen . we found no evidence of migration or obstruction of the stents in any of the follow - up imaging studies . an important complication associated with long - standing double - j stents is encrustation and stone formation with subsequent urinary tract infection and obstruction . stent encrustation rates were reported to be 12 to 27% in series of studies with memokath 051 thermoexpandable metallic stents . the encrustation rates of covered metal mesh stents are not yet well known . because metal stents are usually implanted in situ rather than being regularly changed like double - j stents , encrustation is a serious concern . in the present study , although we did not search for stone formation or encrustation by use of endoscopy , there was no stent obstruction from stones or visible encrustation in radiologic studies . some of the patients in this study experienced minor postoperative complications , such as gross hematuria , abdominal pain , or irritative urinary symptoms . however , there were no serious complications of grade iii or higher by clavien classification . variable patency rates ( 51.2 to 100% ) are reported for various types of metallic ureteral stents used in the treatment of ureteral obstruction irrespective of cause . in our study , the uventa stents were not obstructed during follow - up , so that the overall patency rate was 100% . however , de novo ureteral obstruction by tumor progression occurred in 4 ureters : 3 adjacent to the lower end , and 1 adjacent to the upper end of the implanted uventa stent . the other 2 patients were in the terminal stage of cancer , and no additional procedure was performed . however , a percutaneous approach requires the assistance of an interventional radiologist and an additional invasive pcn procedure . many urologists are already familiar with the cystoscopic retrograde double - j stent insertion , and the procedure for insertion of uventa stents is virtually the same . we performed all procedures by using a retrograde approach and easily implanted the stents in all but one patient . if the obstruction is in the lower ureter and uretero - vesical junction and may be due to invading cancer , it is helpful to use cystoscopy to identify an ipsilateral ureteral orifice before the procedure . when such an orifice can not be identified , preoperative pcn and anterograde double - j stent insertion is necessary for successful uventa stent implantation . when the obstruction site is in the upper or midureter , it is better to conduct balloon dilatation after uventa insertion because the proximal and the distal ends of the stricture site can not be accurately identified after balloon dilation is complete . when the obstruction is in the distal ureter , we advise positioning the lower end of the stent intravesically , extending approximately 0.5 to 1 cm from the ureteral orifice . this will reduce the risk of possible uretero - vesical junction obstruction by later tumor invasion . the recently developed uventa stent prevents tumor ingrowth through the mesh and is resistant to stent - related complications . therefore , it obviates the need for regular stent changes and thus offers significant benefits for patients with limited life expectancy . although we did not find any serious stent - related complications in the short term , a longer follow - up period is required to confirm the safety and efficacy of uventa stent insertion . additionally , we did not evaluate stent - related symptoms and quality of life changes by use of validated questionnaires . it is essential to determine whether there are any benefits of uventa stents over double - j stents by conducting a comparative study . we are planning a prospective comparative study of this type to better evaluate the potential of uventa stents for the treatment of ureteral obstruction . ptfe membrane - covered self - expandable metallic stents can relieve malignant ureteral obstructions safely and easily . long - term follow - up is required to assess the role of these stents in the treatment of malignant ureteral obstructions .

purposewe assessed the efficacy and safety of insertion of a polytetrafluoroethylene membrane - covered self - expandable metallic stent ( uventa stent ) for palliation of malignant ureteral obstruction on the basis of our early results.materials and methodseighteen patients underwent uventa stent insertion for extrinsic malignant ureteral obstructions of 20 ureters . the uventa stents were deployed retrogradely under cystoscopy and fluoroscopy . candidates for the procedure had preexisting double - j stents that were nonfunctional or caused excessive bladder irritation . we recorded the success and patency rate in addition to any complications associated with the procedure.resultsthe mean length of obstruction was 10.6 cm ( range , 2 to 20 cm ) . two ureters were obstructed in the upper ureter , 9 in the lower ureter , and 9 in multiple levels of ureter . simultaneous balloon dilation was performed in 12 ureters . uventa stents were successfully inserted in all patients . no obstruction of the uventa stents occurred during the mean follow - up period of 7.3 months ( patency rate 100% ) , but de novo ureteral obstruction developed in 4 ureters . there were no instances of stone formation , hyperplastic reaction , encrustation , or migration . abnormally elevated serum creatinine decreased to normal levels and hydronephrosis gradually resolved during the 4 weeks after uventa insertion . no significant complications developed except for transient and self - limiting hematuria and mild lower abdominal pain.conclusionsuventa stents may relieve malignant ureteral obstruction safely and easily . long - term follow - up is necessary to assess the role of this stent in the treatment of malignant ureteral obstruction .

INTRODUCTION MATERIALS AND METHODS 1. Insertion technique 2. Patient follow-up RESULTS DISCUSSION CONCLUSIONS

typically , using standard assessment criteria , approximately 50 to 100 channel targets are detected in chondrocytes . not surprisingly the dataset from each study are rather different to each other , but there is a common set of 7 probes that are detected in all 10 of these studies . it is important to note that this analysis does not select particular ion channel genes to study , but reveals all the genes commonly expressed in the above microarray datasets ( note that there are over 300 ion channel gene probes encoded on each of the cited affymetrix chips ; accessory proteins such as the channel tetramerization domain proteins are excluded ) . with such a large number of ion channel transcripts on the affymetrix chips one would expect the random co - detection of transcripts across datasets . to quantify this we used the following statistical analysis . the probability of more than n transcripts being co - localised in d datasets is given by : where p is the probability of a given gene appearing in a datasets , and there are a total of g genes on each array . this gives a p - value for 7 ( or more ) transcripts appearing in all 10 datasets by chance as p < 1e-14 . it should be noted that these microarray datasets were derived from different species ( 3 rat , 3 mouse , 3 human and 1 bovine ) and there are potential differences in chondrocyte isolation protocols . constraining analysis to just rodent ( 6 datasets ) returns a set of 23 commonly expressed ion channel genes ( table 2 ) . figure 1 quantitatively illustrates both the overlap of genes commonly expressed between species ( fig . 1a ) and the overlap between each of the transcripts from human , mouse and rat ( fig . it is evident that far more transcripts were detected in all 3 of the mouse datasets than in all 3 of the human datasets . this could be for three reasons ; firstly , it is possible that the sensitivity of the mouse chips is greater , but we have seen no specific evidence for this . secondly , each of the protocols requires manual dissection and separation of chondrocytes from the subchondral bone and adnexa . samples are inherently contaminated with non - chondrocyte tissue . in an electrophysiological or immunohistochemical study such contamination would be relatively easy to detect , but in a biochemical protocol , where harvested tissue is macerated and then processed , it could be missed . thirdly , it is conceivable that there are genuine phenotypic differences between chondrocytes in mice and other animals . these represent transcripts present in each of the 3 datasets for each of the human , mouse , and rat datasets ( i.e. , includes 9 datasets total ) . the human studies used tissue harvested from either adolescents receiving limb length correction surgery ( e - geod-1277 ) , adults receiving acl surgery ( e - geod-16464 ) , or post mortem ( e - geod-10024 ) . samples were taken from knee ( e - geod-16464 ) , distal femur ( e - geod-1277 ) , or shoulder ( e - geod-10024 ) and focussed on articular ( e - geod-10024 ) , mixed ( e - geod-16464 ) , or growth plate ( e - geod-1277 ) chondrocytes . chip ids ; e - geod-10024 used hg - u133a and e - geod-16464 used the slightly newer hg - u133a_plus_2 , but e - geod-1277 used the u95av2 genechip . all 3 human studies used expanded chondrocytes , but e - geod-10024 and e - geod-16464 re - constituted those into 3d cultures . extraction enzymes were collagenase p ( e - geod-10024 ) , clostridial collagenase and deoxyribonuclease i ( e - geod-16464 ) and trypsin ( e - geod-1277 ) . rodent studies suffer from inherent difficulties in extraction of tissue since cartilage is thinner than larger animals . tissue used from the microarray studies analysed in this letter came from a variety of joints from immature mice and are likely to include mixed chondrocyte phenotypes . where stated explicitly , chondrocytes were expanded in monolayer cultures following collagenase based isolation ( e - geod-8052 and e - geod-7683 ) . all 3 studies ( e - geod-10556 , e - geod-18052 and e - geod-7683 ) used the same affymetrix mouse430_2 chips . the rat femoral head ( e - geod-6119 , e - geod-14402 ) or knee ( e - geod-8077 ) tissue was harvested from a range of ages from one day old neonates ( from which only the outer two - thirds of cartilage was used to select for articular chondrocytes , e - geod-14402 ) to several month old rats ( 300 - 320 g , e - geod-8077 ) . strain was either wistar ( e - geod-6119 ) , sprague - dawley ( e - geod-8077 ) or not stated . e - geod-6119 and e - geod-14402 both used monolayer expanded chondrocytes following collagenase ii based isolation . e - geod-6119 also included pronase , but e - geod-8077 used direct rna extraction from macerated tissue . one bovine dataset derived from chondrocytes 3d cultured from carpal bones of 3 to 6 mo old calves was also analyzed ( e - geod-18394 , affymetrix bovine chip , annotated with version since there was only 1 bovine chondrocyte dataset on ebi ( albeit including a number of replicates ) this is not included in the venn diagrams . note that each of the 3 species sets in ( a ) is equivalent to the commonly expressed regions of the venn diagrams in ( b , c , and d ) . the remainder of this letter focuses on whether the microarray data provides useful clues as to which channels are expressed in chondrocytes , and whether , therefore , initial processing of microarray data will improve the rate of channel detection in chondrocytes , or potentially other tissues . the chloride channel superfamily is huge and includes the large clc family , cftr protein , calcium - activated , volume - activated , p64 related chloride channels ( clns ) , and intracellular chloride channels ( clic ) . in many systems chloride channels have been less well studied than cation channels , although they were some of the earliest ion channels identified in chondrocytes . analysis of the current datasets reveals that both p64-related ( clic1 , clic4 ) and clns1a ion channels were detected in all 10 microarray experiments . the function of the corresponding channels are unknown , complex , controversial , or a combination of all these . clic1 , clic4 , and other members of the clic family of proteins appear to be legitimate anion channels . they are often referred to as p64-related simply because their earliest characterization appeared to be of a 64kda protein . they appear to be of relatively low conductance for a chloride channel ( 8 - 40ps , depending on experimental conditions ) . whilst , as their name implies , these channels can localize to intracellular compartments , in some cell types they also appear to be in the plasma membrane and could serve a role in secretion . one possibility is that the channel shuttles to and from the membrane in a cell cycle dependent way . the pcln channel ( sometimes referred to as p - glycoprotein , picln ) , also detected in 10 out of 10 datasets , was first identified by paulmichl et al as a putative rather ubiquitous volume - sensitive chloride channel . more recently , this volume regulator role has been refuted and roles in gene - regulation and development have been proposed . the controversy surrounding the nature of this channel is discussed in detail by strange and furst . the particular issue is that it can not be clearly determined whether this is a volume - sensitive channel , another type of channel , or is a regulator of a channel endogenous in the various expression systems in which it has been studied . even the fundamental property of ion selectivity is controversial , since recent studies have shown a rather higher permeability of pcln to cations than would be expected for a chloride channel . it is possible that one or other of these channels does constitute the chloride channel identified by tsuga et al in chondrocytes , but it is unlikely since that channel is more typical of a classical maxi - type chloride channel in electrophysiological and pharmacological terms . the associated channels are thought of , generally , as mitochondrial ion channels , found in the outer membrane of this organelle . the proteins have also been detected in the plasma membrane , where they exhibit voltage - gated anion channel activity ( based on data in the ncbinr and uniprot databases ) . vdac channels are also implicated in apoptosis and , as such , they will be of profound importance to all cells in which they are expressed . it has also now been suggested by a number of authors that some vdac protein expression is also of plasma membrane ion channels . this would be very much in line with the original chondrocyte chloride channel work of tsuga and sugimoto . the channel identified in these studies was the maxi - chloride channel , which is remarkably similar to the maxi - cl / vdac channel . in our own unpublished work , we see clear expression of a large conductance , niflumic acid and sits - sensitive chloride channel which appears likely to be maxi - chloride . it is no surprise that kcnma1 ( bk ) has been detected in all of the 10 datasets analyzed here . currents either broadly , or specifically , identified as being through bk channels have been described in a number of papers . in our own work we have shown not only that bk currents are present by electrophysiology , but also that the kcnma1 was detectable by immunohistochemical methods . interestingly , whilst the bk function modifying -subunit kcnmb1 was detected in our own immunohistochemical studies it was not detected in any of the 10 microarray studies discussed here . there was detection of kcnmb2 and kcnb4 in 2 and 3 out of the 10 studies respectively . activation of bk results in such large currents that it is likely to be involved with regulation of intracellular osmolarity and volume . early work did not show whether this activation was direct or indirect via an increase of intracellular calcium ions , but our more recent studies show rather convincingly that trpv4 is activated by stretch and that this results in the opening of a potassium channel . the detection of the sodium 1-subunit scn1b in all 10 studies is interesting , since the -subunits were undetectable in most studies . this subunit has been shown , in neurons to convey subtle changes to expression patterns and functional properties of voltage - gated sodium channels . there has been 1 electrophysiological study , which identified voltage - gated sodium channels in chondrocytes . this work has not been followed up on and , since chondrocytes do not fire action potentials , it is difficult to see what the role of a voltage - gated sodium channel might be . for completeness : scn7a ( nav2.1 ) , a somewhat atypical na channel was detected in 4/10 experiments , and the classical sodium channel scn2a1 in 3/10 , and the transient type sodium channel scn11a and scn10a in 2/10 datasets . this list includes trpc1 , of the canonical trp , and trpv4 , a vanilloid channel , both of which were identified in 9/10 microarray studies . in traditional protein and pharmacological studies , however , three trp channels have been identified in chondrocytes trpv4 , trpv5 , and trpv6 but not trpc1 . trpv5 appears important for setting the membrane potential , crucial to maintenance of cell volume in chondrocytes . trpv4 , however , appears to be critical for allowing entry of ca and activation of bk channels during imposed volume increase , and thus the process of regulatory volume decrease in epithelial cells . also , however , we find that 2 transient receptor potential channels are commonly detected . to use traditional methods to identify changes in channel expression between populations of cells from different tissues is probably not feasible unless high throughput automated ion channel recording equipment can be adapted for this purpose . however , observation of changes in cellular properties and mathematical models may provide clues as to which channels have changed in oa . an alternative approach would be to use microarray comparisons between normal and oa tissue , detect changes in channel mrna abundance and then follow - up with functional or histochemical experiments . generally , differential expression patterns from microarray studies are used to identify changed pathways , however , this process could miss changes which take place in individual ion channels not associated with an established pathway . the next microarray study considered in this review specifically compared transcript abundance from chondrocytes in human normal and oa cartilage . the authors focused on ( and verified ) changes in many cartilage phenotypic markers , but did not specifically consider changes in other proteins such as ion channels . probing this list for ion channels and porins significantly changed ( greater than 2-fold change ) produces the data in table 4 . the data clearly show an approximately 3-fold change in enac , tmem16a and bk ( kcnma1 ) transcript abundance and a 38-fold change in the aquaporin aqp1 channel transcript abundance . interestingly each of these channels are important for chondrocyte cell volume control . from this , by way of proof of principle we verified bk channel changes with immunohistochemistry and aquaporin channel changes with a functional assay . negative is fold decrease in abundance ratio , positive is fold increase in abundance ratio . note that whilst there were probes for trpv4 present on the chip , the huge variability between abundance scores between samples for this particular probe set make it unlikely that any change would be detectable , even if there was one . tissue was taken from stifle joints of horses with and without oa ( see fig . we investigated the expression of both - and -subunits of bk ( only kcnma1 was included in karlsson 2010 , there were no probe sets for kcnmb1 on the chip ) . semi - quantitative analysis of protein expression density shows that both bk subunits were significantly increased in oa , in the middle zone ( fig . immunohistochemical identification of kcnma1 ( bk -subunit ) and kcnb1 ( bk -subunit ) in sections of healthy and oa equine cartilage . macroscopically normal articular cartilage samples were obtained from weight - bearing regions of the metacarpophalangeal joints of horses of mixed breed , age , and sex . animals were euthanized for non - research purposes having been stunned before slaughter for meat in accordance with welfare of animals ( slaughter or killing ) regulations 1995 . sections of normal ( n=6 ) and oa ( n=3 ) equine cartilage were probed for channel expression by immunohistochemistry essentially as previously described . sections were incubated overnight at 4c with rabbit polyclonal antibodies to the kcnma1 and kcnb1 . antibody dilutions used ranged from 1:200 to 1:1500 in tris - buffered saline containing 1% bovine serum albumin . slides were incubated with horseradish peroxidase - labelled polymer conjugated to affinity - purified goat anti - rabbit immunoglobulins . photomicrographs of immunostained tissue sections captured using nikon digital sight ds-5 m camera driven by nikon eclipsenet image capture software ( nikon ) . positive staining is indicated by brown staining and particular evident at middle / superficial zones . the largest increase in expression density ( from data such as that illustrated in fig . 2 ) is in the middle zone , for both kcnma1 ( c ) and kcnmb1 ( d ) ( - and - subunit respectively ) . cells are challenged with a hypotonic solution , causing them to swell , and the rate of swell can be measured to determine the aquaporin expression . the bioinformatics showed a 38-fold increase in aqp1 transcript abundance in oa and we see a significant increase in functional aquaporin expression in tissue from oa joints ( fig . 3a ) , although the increase is much smaller than the change in aqp1 transcript abundance . current pharmacological tools do not allow categorical determination of aquaporin subtype , however , here , water permeability of chondrocytes was blocked by concentrations of bumetanide , tea , and hgcl2 consistent with that expected for aqp1 ( fig . water permeability can be calculated from the initial slope of the relative volume ( v / vo ) against time curve . where v is the volume at time ( a ) permeability is 303% ( p<0.05 , n=4 ) greater in chondrocytes from dogs with osteoarthritis ( oa ) . tea ( a blocker of aqp1 ) , bumetanide ( pic50 5.170.11 m , n=6 , bumex , a blocker of aqp1 and 4 ) , and mercuric chloride ( hgcl2 a non - specific aqp blocker reversed by 2-mercaptoethanol ) me ) are included to determine aqp type ( b and c ) . solution including 120 mm sucrose ( osmolarity 300mosm ) , then moved to an identical physiological saline without the sucrose . live cell imaging was achieved with a nikon diaphot microscope equipped with a sony icx098qb high sensitivity ccd . images were analysed offline with imagejvolume was calculated from the 2d surface area ( a ) of the cell disc by assuming the cell is approximately spherical as described previously , using the following equation : vol=43(a)3 ( equation 2 ) . except where stated , data are presented normalized for starting volume ( v0 ) as v / v0 , where v is the volume at time t. visual data were analyzed with imagej and anova performed with spss ( spss inc . ) . note that canine tissue was harvested from clinical waste tissue with local ethical approval , no dogs were harmed for the study . in summary , there appears to be considerable agreement between transcriptomic studies and physiological or immunohistochemical studies . it would seem that most channels common to all 10 datasets can be identified by these other techniques . there are examples , however , of proteins which have been identified in chondrocytes yet show up in few datasets . for example , the asic channel ( accn2 gene ) has been shown by immunohistochemistry and rt - pcr yet shows up in only one of the three rat datasets discussed here . therefore , combining these approaches should massively speed up the rate of discovery of ion channels in cell types which can be isolated in sufficient quantities to perform such studies . there are tissues , such as the brain , where cell types are too intermingled to allow identification of unique cell types , but for many tissues in the musculoskeletal system ( or cell lines ) , the combination of transcriptomics and protein studies seems ideal . with regard to oa , this strategy has allowed us to very rapidly pinpoint some phenotypic changes in the expression of two important channels in oa : an aquaporin and the bk channel . further protein and functional experiments will be necessary to establish whether the other kca channels are also altered , and in particular whether these changes contribute to or result from progression of oa .

to date , a range of ion channels have been identified in chondrocytes using a number of different techniques , predominantly electrophysiological and/or biomolecular ; each of these has its advantages and disadvantages . here we aim to compare and contrast the data available from biophysical and microarray experiments . this letter analyses recent transcriptomics datasets from chondrocytes , accessible from the european bioinformatics institute ( ebi ) . we discuss whether such bioinformatic analysis of microarray datasets can potentially accelerate identification and discovery of ion channels in chondrocytes . the ion channels which appear most frequently across these microarray datasets are discussed , along with their possible functions . we discuss whether functional or protein data exist which support the microarray data . a microarray experiment comparing gene expression in osteoarthritis and healthy cartilage is also discussed and we verify the differential expression of 2 of these genes , namely the genes encoding large calcium - activated potassium ( bk ) and aquaporin channels .

Commonality between Datasets Chloride Channels The Voltage Dependent Anion Channels The Large Calcium-Activated Potassium Channel The Sodium Channel -Subunit Transient Receptor Potential (TRP) Channels Changes of Transcript Levels with Onset of Osteoarthritis

chronic obstructive pulmonary disease ( copd ) is characterized by progressive and partially reversible airflow limitation , and it is among the leading causes of mortality worldwide.1 copd is a multicomponent disease , and patients present a range of comorbidities that have an impact on prognosis and may increase the risk of mortality.2 the effects of copd on respiratory and physical function have been well studied ; moreover , due to the heavy burden of psychological disturbance , psychiatric morbidity , and disability in daily life , the mental health of copd patients has received growing attention in recent years.3,4 the prevalence of cognitive impairment in patients with copd ranges from 12% to 88%5 and is associated with depression , poor quality of life , which may affect patients ability to manage their disease , and reduced compliance with medication and oxygen therapy,6,7 leading to adverse clinical outcomes.811 therefore , cognitive function as well as emotional function are important aspects of the overall clinical care of patients with copd . it has been suggested that a multidimensional assessment and personalized disease management approach could be an optimal strategy for addressing comorbidities , self - management education , and risk factor modification in copd patients.7 the early identification of cognitive dysfunction is critical if outcomes are to be improved in this population , and an understanding of the characteristics associated with a higher risk of cognitive impairment may assist health care professionals to address this challenge . the primary aim of this study was to examine the cross - sectional prevalence of cognitive impairment in an unselected population of copd patients ; the secondary objective was to determine the relationships between cognitive impairment and major demographic and clinical variables , such as lung function , depression , and quality of life . the present study is a post hoc analysis of a cross - sectional , observational study conducted in respiratory medicine departments and primary care centers in spain.11 this study was aimed at examining the prevalence of depressive symptoms and moderate - to - severe depression in copd and included ambulatory patients who were 40 years of age or older , with stable copd ( confirmed by postbronchodilator forced expiratory volume in 1 second / forced vital capacity < 70% and absence of exacerbations in the previous 3 months ) . all patients that completed the mini - mental state examination ( mmse ) were included in this post hoc analysis . the study was approved by the institutional ethics committee of the hospital clinic ( barcelona , spain ) and was conducted in accordance with the principles of the declaration of helsinki . prior to participation , all patients signed written documentation that the informed consent process was completed . investigators recorded patients sociodemographic data and clinical information on copd severity using the modified medical research council dyspnea scale12 and the body mass index , airflow obstruction , dyspnea and exacerbations ( bodex ) index,13 comorbidity according to the charlson index,14 exacerbations in the previous year , and treatment . this instrument explores spatial and temporal orientation , registration , attention , and calculation , recall , language , and visual construction in 12 items and 30 questions . a correct answer to one question a score of less than 27 indicated cognitive impairment.17 depressive symptoms were measured using the short beck depression inventory questionnaire.18,19 this tool is a 13-item self - administered inventory that assesses affective , cognitive , motivational , and vegetative symptoms of depression . items use a 4-point scale that ranges from 0 to 3 and a total score is calculated by adding up the item responses . health - related quality of life was assessed by the generic euroqol-5 dimensions ( eq-5d ) questionnaire and the specific copd assessment test ( cat ) . the eq-5d consists of a 5-item descriptive system ( including mobility , self - care , usual activities , pain / discomfort , and anxiety / depression ) , with each item rated as no problems , some problems , or severe problems , and an overall health state score for the day of the assessment , measured on a visual analog scale ( 0100 ; 100 represents best overall health).20 the cat is a short , specific quality of life questionnaire for measuring the impact of copd on the patient s well - being and daily life . it consists of eight items , each presented as a 6-point semantic differential scale , providing a score out of 40 , indicating the impact of the disease.21 we used the validated spanish version of cat.22 physical activity was measured by asking patients how many minutes , on average , they walked every weekday , as previously described.23,24 depending on their daily walking activity , patients were classified into three groups : patients who walked < 30 minutes , patients who walked between 30 and 60 minutes , and patients who walked 60 minutes . fisher s exact test was used for comparisons of qualitative variables , with the bonferroni correction for all pairwise comparisons . student s t - test was used to determine the relationship between qualitative variables by group . odds ratio ( or ) univariates were calculated by logistic regression to evaluate the different risks contemplated in the study , including all demographic , clinical , and questionnaires variables . the first model was developed with cognitive status as a dependent variable and all variables that showed a significant association with cognition in univariate analysis as independent variables ( model 1 ) . a second model ( model 2 ) excluded any variables derived from the use of the questionnaires from the independent variables . the objective of model 2 was to identify the factors associated with cognitive impairment that could be identified in routine clinical practice without the administration of questionnaires . statistical analyses were performed using sas version 9.1.3 service pack 3 software ( sas institute inc . , cary , nc , usa ) . the present study is a post hoc analysis of a cross - sectional , observational study conducted in respiratory medicine departments and primary care centers in spain.11 this study was aimed at examining the prevalence of depressive symptoms and moderate - to - severe depression in copd and included ambulatory patients who were 40 years of age or older , with stable copd ( confirmed by postbronchodilator forced expiratory volume in 1 second / forced vital capacity < 70% and absence of exacerbations in the previous 3 months ) . all patients that completed the mini - mental state examination ( mmse ) were included in this post hoc analysis . the study was approved by the institutional ethics committee of the hospital clinic ( barcelona , spain ) and was conducted in accordance with the principles of the declaration of helsinki . prior to participation , all patients signed written documentation that the informed consent process was completed . investigators recorded patients sociodemographic data and clinical information on copd severity using the modified medical research council dyspnea scale12 and the body mass index , airflow obstruction , dyspnea and exacerbations ( bodex ) index,13 comorbidity according to the charlson index,14 exacerbations in the previous year , and treatment . this instrument explores spatial and temporal orientation , registration , attention , and calculation , recall , language , and visual construction in 12 items and 30 questions . a correct answer to one question a score of less than 27 indicated cognitive impairment.17 depressive symptoms were measured using the short beck depression inventory questionnaire.18,19 this tool is a 13-item self - administered inventory that assesses affective , cognitive , motivational , and vegetative symptoms of depression . items use a 4-point scale that ranges from 0 to 3 and a total score is calculated by adding up the item responses . health - related quality of life was assessed by the generic euroqol-5 dimensions ( eq-5d ) questionnaire and the specific copd assessment test ( cat ) . the eq-5d consists of a 5-item descriptive system ( including mobility , self - care , usual activities , pain / discomfort , and anxiety / depression ) , with each item rated as no problems , some problems , or severe problems , and an overall health state score for the day of the assessment , measured on a visual analog scale ( 0100 ; 100 represents best overall health).20 the cat is a short , specific quality of life questionnaire for measuring the impact of copd on the patient s well - being and daily life . it consists of eight items , each presented as a 6-point semantic differential scale , providing a score out of 40 , indicating the impact of the disease.21 we used the validated spanish version of cat.22 physical activity was measured by asking patients how many minutes , on average , they walked every weekday , as previously described.23,24 depending on their daily walking activity , patients were classified into three groups : patients who walked < 30 minutes , patients who walked between 30 and 60 minutes , and patients who walked 60 minutes . fisher s exact test was used for comparisons of qualitative variables , with the bonferroni correction for all pairwise comparisons . student s t - test was used to determine the relationship between qualitative variables by group . odds ratio ( or ) univariates were calculated by logistic regression to evaluate the different risks contemplated in the study , including all demographic , clinical , and questionnaires variables . the first model was developed with cognitive status as a dependent variable and all variables that showed a significant association with cognition in univariate analysis as independent variables ( model 1 ) . a second model ( model 2 ) excluded any variables derived from the use of the questionnaires from the independent variables . the objective of model 2 was to identify the factors associated with cognitive impairment that could be identified in routine clinical practice without the administration of questionnaires statistical analyses were performed using sas version 9.1.3 service pack 3 software ( sas institute inc . , cary , nc , usa ) . of 1,273 screened patients , 333 had not had the mmse evaluation and were excluded from the analysis . both populations ( excluded and included ones ) included patients were predominantly male , with an age ranging from 40 to 90 years . a total of 370 patients ( 39.4% ) scored below the threshold of 27 for suspicion of mild cognitive impairment ( mci ; figure 1 ) . patients with mmse scores < 27 were older , had a lower level of formal education , had heavier smoking exposure , presented more respiratory symptoms , had more frequently domiciliary oxygen , suffered a higher number of and more severe exacerbations during the previous year , and had a greater comorbidity burden . in addition , higher levels of depression , more suicidal ideation , poorer quality of life , and less physical activity were more frequent in cognitively impaired patients . in the univariate analysis , cognitive impairment was associated with higher age , lower educational level , worse lung function and more severe copd , more frequent respiratory symptoms and exacerbations , and oxygen therapy requirement . higher comorbidity burden , more depressive symptoms , and more impaired health status ( eq-5d and cat ) were also associated with cognitive impairment . higher levels of physical activity were associated with better cognitive function ( table 2 ) . in the multivariate analysis , only educational level and the eq-5d social tariff were independently and significantly associated with cognitive impairment ( table 2 ) . when the analysis was limited to the usual demographic and clinical variables , and the questionnaires were excluded from the model , the significant factors in the multivariate analysis were educational level , history of exacerbations , the bodex index , and the charlson comorbidity index ( table 3 ) . of 1,273 screened patients , 333 had not had the mmse evaluation and were excluded from the analysis . both populations ( excluded and included ones ) included patients were predominantly male , with an age ranging from 40 to 90 years . a total of 370 patients ( 39.4% ) scored below the threshold of 27 for suspicion of mild cognitive impairment ( mci ; figure 1 ) . patients with mmse scores < 27 were older , had a lower level of formal education , had heavier smoking exposure , presented more respiratory symptoms , had more frequently domiciliary oxygen , suffered a higher number of and more severe exacerbations during the previous year , and had a greater comorbidity burden . in addition , higher levels of depression , more suicidal ideation , poorer quality of life , and less physical activity were more frequent in cognitively impaired patients . in the univariate analysis , cognitive impairment was associated with higher age , lower educational level , worse lung function and more severe copd , more frequent respiratory symptoms and exacerbations , and oxygen therapy requirement . higher comorbidity burden , more depressive symptoms , and more impaired health status ( eq-5d and cat ) were also associated with cognitive impairment . higher levels of physical activity were associated with better cognitive function ( table 2 ) . in the multivariate analysis , only educational level and the eq-5d social tariff were independently and significantly associated with cognitive impairment ( table 2 ) . when the analysis was limited to the usual demographic and clinical variables , and the questionnaires were excluded from the model , the significant factors in the multivariate analysis were educational level , history of exacerbations , the bodex index , and the charlson comorbidity index ( table 3 ) . copd is a multicomponent inflammatory disease that affects physical and nonphysical functions , one of which is cognition . in our study , we found some degree of cognitive impairment in almost 40% of unselected copd patients , as determined by a mmse score < 27 . previous estimates of cognitive dysfunction in copd patients ranged from 12% to 88% , depending on the study population and the tools used for neuropsychological assessment.5,9 a recent study in a very similar population ( including not only elderly patients , but also young patients ) to ours17 found mci in 36% of copd patients after comprehensive neuropsychological testing . the authors reported that a mmse score of 27 provided optimal maximum accuracy and a diagnostic cutoff ( < 27 indicated impairment ) , with 97% specificity and 73% of patients correctly classified . however , they also found that the montreal cognitive assessment performed better as a screening test for detecting mci in patients with copd . so , this threshold for mild impairment is not necessarily indicative of a clinically significant cognitive decline associated with functional impairment , but could serve as an early identification of an affected cognitive function . cognitive symptoms are core symptoms in many mental disorders;25 they impact on cognitive functioning , which deteriorates as patients get older , particularly after the age of 60.26 copd patients score lower on standard cognitive performance tests over time , compared with individuals of the same age without the disease.27 one hypothesis for this accelerated decline in copd patients is altered brain perfusion.28 changes in brain perfusion due to hypoxemia in subjects with severe copd may increase cognitive impairment.29 in our population , more cognitively affected patients were receiving domiciliary oxygen that could be a correlate of higher disease severity and sustained periods of hypoxemia . in contrast , a recent study indicated that long - term home oxygen therapy allowed to preserve cognitive functions from the copd - induced deterioration,30 so the role of supplemental oxygen in preventing copd - induced cognitive deterioration is still controversial . indeed , other factors , such as hypercapnia or oxidative stress , may also be involved.31 other authors have suggested that intermittent and continuous hypoxia resulting from poor lung function may lead to transient deficits in neurotransmitter metabolism in the central nervous system.3234 several mechanisms , then , appear to be involved in cognitive decline in this population . prospective neuroimaging studies are required to characterize brain changes and corresponding disturbances in cognitive function in these patients over time . cognitive impairment represents a critical health care burden in terms of costs.35 individuals with mci have a higher risk of developing dementia than the general population.36 moreover , cognitive dysfunction in copd has been associated with poorer outcomes and even with an increase in disability and mortality.8,37,38 thus , it is essential that this condition is identified early in copd patients , in order to prevent or delay progression to clinical dementia or increased morbidity . if the factors affecting cognition are recognized , cognitive impairment may be detected earlier and copd patients at higher risk may be identified . in our study , the multivariate analysis showed that educational level and quality of life assessed by eq-5d were significantly and independently associated with the presence of cognitive impairment . however , the use of health - related quality of life or other questionnaires is not a routine practice in most primary care offices , so we ran a multivariate model , discarding the scores of these questionnaires and including only demographic and clinical variables . in this model , cognitive impairment was associated with exacerbations in the previous year , the severity of copd measured by the bodex index , and a higher comorbidity burden . they have been associated with increased health care costs,39 a significant decline in health status,40 and substantial mortality.41 our results suggest that frequent exacerbations also have negative consequences on cognitive function . this is in line with a previous study that investigated the cognitive function of copd patients who were hospitalized following an acute exacerbation . these patients had significantly poorer cognitive function compared with control participants 3 months after discharge from the hospital.10 other studies have shown that cognitive impairment during the exacerbation period resolves during periods of stability.4244 more exacerbations and increased copd severity could reflect the poorer compliance with medication associated with cognitive impairment.6,7 the systemic inflammation seen in severe copd and during acute exacerbations45 may participate in neurocognitive impairment via a direct neurotoxic effect or by affecting cerebral atherosclerosis.9 a high comorbidity burden may also contribute to persistent brain injury : multiple concomitant diseases , such as cerebrovascular disease and related mechanisms , including endothelial dysfunction and oxidation , may lead to neuronal death , synaptic dysfunction , and cognitive impairment.46 all these data confirm that the cognitive impairment that occurs in copd patients is associated with disease severity . neuropsychiatric assessment should become a routine part of the diagnostic procedure for these patients , to help physicians grade the overall impact of copd and determine the most effective treatment and strategies . the cross - sectional design of our study limits any type of causal inferences , and the directionality between copd and cognition remains unclear . despite the frequent use of the mmse in clinical research and practice , this tool for cognitive impairment detection could have missed key domains of cognition often affected in copd ( ie , executive functioning ) . an additional limitation of our study is the lack of data on our patients medical treatment . as treatment may have great impact on the symptom burden and mental health of the patients , such information should be collected in future studies . in particular , prospective studies are urgently needed to determine the most effective behavioral and medical interventions for reducing the risk of poor neurocognitive outcomes in patients with copd . early detection of cognitive decline is crucial , in view of its association with poorer copd outcomes , including increased mortality , and patients with frequent exacerbations and or when the bodex index appears concerning the clinician may want to ask the patient and/or caregivers about cognitive function . these patients may need more individualized educational and care interventions to help them manage their daily lives . clinicians must involve family caregivers in the care plan of patients with severe copd and cognitive deficits .

purposewe investigated the association between cognitive impairment and chronic obstructive pulmonary disease ( copd ) , taking into account demographic and clinical variables evaluated during routine practice.patients and methodswe performed a post hoc analysis of a cross - sectional study that included subjects with stable copd . sociodemographic and clinical information was recorded using the body mass index , airflow obstruction , dyspnea and exacerbations index and the charlson comorbidity index . cognitive performance was studied by the mini - mental state examination , with a score less than 27 indicating clinical impairment . depressive symptoms , physical activity , and quality of life ( euroqol-5 dimensions and copd assessment test ) were also evaluated.resultsthe analysis included 940 subjects . the prevalence of cognitive impairment was 39.4% . multivariate logistic regression models revealed that cognitive impairment was associated with educational level ( odds ratio [ or ] = 0.096 , 95% confidence interval [ ci ] = 0.0110.447 ) and poorer quality of life measured by the euroqol-5 dimensions social tariff ( or = 0.967 , 95% ci = 0.9500.983 ) . when questionnaires were not included in the analysis , cognitive impairment was associated with educational level ( or = 0.063 , 95% ci = 0.0100.934 ) , number of exacerbations ( or = 11.070 , 95% ci = 1.45084.534 ) , body mass index , airflow obstruction , dyspnea and exacerbations index score ( or = 1.261 , 95% ci = 1.0491.515 ) , and the charlson comorbidity index ( or = 1.412 , 95% ci = 1.1181.783).conclusioncognitive impairment is common in copd and is associated with low educational level , higher disease severity , and increased comorbidity . this could have therapeutic implications for this population .

Introduction Materials and methods Study design and sample Study assessments Statistical analysis Results Sample characteristics and cognitive status Factors associated with the presence of cognitive impairment Discussion Conclusion

intestinal helminths are among the most common and widespread of human infections , contributing to poor nutritional status , anemia and impaired growth ( 1 ) . intestinal helminthiases are also known to aggravate pre - existing anemia by decreasing appetite and thus food and iron intake ( 2 , 3 ) . worldwide , anemia is an important reproductive health problem because of its association with adverse pregnancy outcome such as increased rates of maternal and perinatal mortality , premature delivery , low birth weight , etc ( 4 ) . women in developing countries spend half of their reproductive lives pregnant and lactating and a high proportion of women in developing countries become anemic during this period . women of reproductive age who are iron deficient but not anemic may become anemic during pregnancy as a consequence of increased iron requirements and expanded plasma volume . epidemiological surveys have revealed that poor sanitation and inappropriate environmental conditions coupled with indiscriminate defaecation , geophagy and contamination of water bodies are the most important predisposing factors to intestinal worm infection ( 5 ) . practices such as hand washing , disposal of refuse , personal hygiene , wearing of shoes and others , when not done properly may contribute to the infection or picking of these worms from the environments ( 6 ) . this research investigates the prevalence of helminth infection and its hematological alterations during pregnancy findings of this study will serve as a tool in evidence based health education on the need to intensify efforts at preventing helminthiases and its attendant risk of anemia during pregnancy . two hundred and eighty - two pregnant women between the ages of 18 45 years , in their various trimesters and of various parities ( 0 10 ) were enlisted . fresh stool samples for helminth screening were collected from each of the 282 subjects in dry , clean , leak proof and sterilized sample containers . the samples were examined for consistency and presence of cysts , proglottids and adult worms . concentrated saturated sodium chloride floatation and formol - ether concentration techniques were used for fecal analysis . the total number of eggs was counted under x40 magnification of a compound microscope stool samples were processed within 8 hours of collection and examined microscopically within one hour of preparation to avoid over clearance of hookworm ova . based on the thresholds recommended by the world health organization ( who ) , helminth intensities were classified as light , moderate or severe ( 7 ) . using a sterile syringe , 3mls of venous blood was collected from each of the subjects and transferred into a capillary tube . the pcv of each specimen was determined using a hewkley microhematocrit reader and classified as follows : mild ( pcv 2729% ) , moderate ( pcv 1926% ) , and severe ( pcv below 19% ) . 4g / dl- very severe anemia , hb < 8g / dl- severe anemia , hb < 9g / dl- moderate anemia and hb < 11g / dl- mild anemia. data entry and validation was performed in excel , and statistical analysis was done using statistical package for social sciences ( spss ) version 17.0 . values were considered statistically significant when p - values were less than 0.05 ( p<0.05 ) . pearson chi - square , t - test and correlations were used to determine the association between hemoglobin concentrations and helminth infection as indicators of anemia . at the onset of the study , thereafter , they were given informed consent forms to sign for their communities and households after their contents were translated to them in local languages . two hundred and eighty - two pregnant women between the ages of 18 45 years , in their various trimesters and of various parities ( 0 10 ) were enlisted . fresh stool samples for helminth screening were collected from each of the 282 subjects in dry , clean , leak proof and sterilized sample containers . the samples were examined for consistency and presence of cysts , proglottids and adult worms . concentrated saturated sodium chloride floatation and formol - ether concentration techniques were used for fecal analysis . the total number of eggs was counted under x40 magnification of a compound microscope stool samples were processed within 8 hours of collection and examined microscopically within one hour of preparation to avoid over clearance of hookworm ova . based on the thresholds recommended by the world health organization ( who ) , helminth intensities were classified as light , moderate or severe ( 7 ) . using a sterile syringe , 3mls of venous blood was collected from each of the subjects and transferred into a capillary tube . the pcv of each specimen was determined using a hewkley microhematocrit reader and classified as follows : mild ( pcv 2729% ) , moderate ( pcv 1926% ) , and severe ( pcv below 19% ) . 4g / dl- very severe anemia , hb < 8g / dl- severe anemia , hb < data entry and validation was performed in excel , and statistical analysis was done using statistical package for social sciences ( spss ) version 17.0 . values were considered statistically significant when p - values were less than 0.05 ( p<0.05 ) . pearson chi - square , t - test and correlations were used to determine the association between hemoglobin concentrations and helminth infection as indicators of anemia . at the onset of the study , the community and household heads were well briefed on the objectives of the study . thereafter , they were given informed consent forms to sign for their communities and households after their contents were translated to them in local languages . the gastrointestinal helminth parasites observed in this study were hookworm ( 8.5% ) , ascaria lumbricoides ( 5.0% ) and trichuris trichiura ( 0.7% ) , while mixed infection accounted for 2.1% ( table 1 ) . of the 282 pregnant women examined , 46(16.3% ) were infected with at least one parasite species . age specific prevalence showed that subjects of 18 20 years age group had the highest rate of infection ( 27.0% ) while those of 4145 years had the least rate ( 0% ) . the difference in infection by age groups was statistically significant ( p<0.05 , = 28.759 , df=12 ) . within the trimester , pregnant women in their first trimester had the highest infection rate of 20.9% while those in their third trimester had the least ( 12.9% ) . the differences were however not statistically significant ( p>0.05 ; = 6.895 , df = 8) . the primigravidae had the highest prevalence ( 27.5% ) while the gravidae 7 group had the least rate ( 7.7% ) . differences in the prevalence of helminth infections by parity groups was statistically significant ( p<0.05 ; = 32.437 , df=12 ) . the intensity of infection among pregnant women ( table 2 ) shows that 24(80.0% ) of the pregnant women examined had single ( hookworm ) infection while 6 ( 20.0% ) had mixed ( hookworm and a. lumbricoides ) infection . fifteen ( 62.5% ) of the women with hookworm infection had light infection while 5(20.8% ) and 4(16.7% ) had moderate and heavy infections respectively . out of the pregnant women with mixed infection , 4 ( 66.7% ) had light infection while 2(33.3% ) had moderate infection . also , 14 ( 70.0% ) of infected women had a. lumbricoides infection , of which 8(57.1% ) had light , 4(28.6% ) moderate and 2(14.3% ) heavy infections , respectively . only two women were positive to t. trichiura infection , one of which is light while the other moderate . the differences in the intensities of infection was not statistically significant ( = 0.967 , df=2 , p>0.05 ) a total of 166(58.9% , meansd = 9.31.0 ) of the pregnant women were anaemic . out of these , 92(32.6% ) had mild anemia , 58(20.6% ) had moderate anemia while 16(5.7% ) had severe anemia ( table 3 ) . age specific prevalence shows that women between the ages of 31 40 years were most anemic with prevalence rate of 71.7% , meansd = 9.11.1 ) while those of 1820 years had the least ( 18(48.6% , meansd = 9.21.0 ) - table 3 . the differences in the hemoglobin levels of these age groups was statistically significant ( p<0.05 , = 17.197 , df=9 ) . table 3 also shows that the pregnant women in their second trimester ( 63.6% and meansd = 9.31.0 ) had the most severe anemia . the difference in the hemoglobin levels by trimester groups was not statistically significant ( p > 0.05 , = 2.794 , df=6 , meansd=9.31.0 ) . women in their secondigravidae had the most severe anemia ( 61.8% , meansd = 9.30.9 ) . the differences in hemoglobin levels by parity was not statistically significant ( p>0.05 , = 9.034 , df=6 , meansd = 9.31.0 ) table 3 . pregnant women who were infected with one helminth or the other were observed to have lower mean hemoglobin ( hb ) of 8.600.22g / dl than that of the uninfected ( 9.720.07g / dl ) . significant difference ( t - value = 5.660 , p<0.05 ) was observed between the hb of the infected and uninfected pregnant women . in addition , pregnant women infected with one helminth or the other had a mean pcv of 26.090.65% while the uninfected had 34.542.96% . the mean pcv of infected pregnant women was also significantly different ( t - value= 0.013 , p<0.05 ) from that of uninfected pregnant women . the correlation between hb , pcv and helminth infections hookworm infection was observed to have a moderate highly significant negative correlation with hb ( r= 0.389 , p<0.01 ) and pcv ( r= 0.277 , p<0.01 ) . mixed infections ( hookworm and ascaris lumbricoides ) were also observed to have a mild highly significant negative correlation with hb ( r=0.179 , p<0.01 ) and pcv ( r=0.192 , p<0.01 ) . furthermore , a. lumbricoides and t. trichiura infections were observed to have a negative correlation with hb and pcv respectively but were not statistically significant ( p>0.05 ) . the gastrointestinal helminth parasites observed in this study were hookworm ( 8.5% ) , ascaria lumbricoides ( 5.0% ) and trichuris trichiura ( 0.7% ) , while mixed infection accounted for 2.1% ( table 1 ) . of the 282 pregnant women examined , 46(16.3% ) were infected with at least one parasite species . age specific prevalence showed that subjects of 18 20 years age group had the highest rate of infection ( 27.0% ) while those of 4145 years had the least rate ( 0% ) . the difference in infection by age groups was statistically significant ( p<0.05 , = 28.759 , df=12 ) . within the trimester , pregnant women in their first trimester had the highest infection rate of 20.9% while those in their third trimester had the least ( 12.9% ) . the differences were however not statistically significant ( p>0.05 ; = 6.895 , df = 8) . the primigravidae had the highest prevalence ( 27.5% ) while the gravidae 7 group had the least rate ( 7.7% ) . differences in the prevalence of helminth infections by parity groups was statistically significant ( p<0.05 ; = 32.437 , df=12 ) . the intensity of infection among pregnant women ( table 2 ) shows that 24(80.0% ) of the pregnant women examined had single ( hookworm ) infection while 6 ( 20.0% ) had mixed ( hookworm and a. lumbricoides ) infection . fifteen ( 62.5% ) of the women with hookworm infection had light infection while 5(20.8% ) and 4(16.7% ) had moderate and heavy infections respectively . out of the pregnant women with mixed infection , 4 ( 66.7% ) had light infection while 2(33.3% ) had moderate infection . also , 14 ( 70.0% ) of infected women had a. lumbricoides infection , of which 8(57.1% ) had light , 4(28.6% ) moderate and 2(14.3% ) heavy infections , respectively . only two women were positive to t. trichiura infection , one of which is light while the other moderate . the differences in the intensities of infection was not statistically significant ( = 0.967 , df=2 , p>0.05 ) . out of these , 92(32.6% ) had mild anemia , 58(20.6% ) had moderate anemia while 16(5.7% ) had severe anemia ( table 3 ) . age specific prevalence shows that women between the ages of 31 40 years were most anemic with prevalence rate of 71.7% , meansd = 9.11.1 ) while those of 1820 years had the least ( 18(48.6% , meansd = 9.21.0 ) - table 3 . the differences in the hemoglobin levels of these age groups was statistically significant ( p<0.05 , = 17.197 , df=9 ) . table 3 also shows that the pregnant women in their second trimester ( 63.6% and meansd = 9.31.0 ) had the most severe anemia . the difference in the hemoglobin levels by trimester groups was not statistically significant ( p > 0.05 , = 2.794 , df=6 , meansd=9.31.0 ) . women in their secondigravidae had the most severe anemia ( 61.8% , meansd = 9.30.9 ) . the differences in hemoglobin levels by parity was not statistically significant ( p>0.05 , = 9.034 , df=6 , meansd = 9.31.0 ) table 3 . pregnant women who were infected with one helminth or the other were observed to have lower mean hemoglobin ( hb ) of 8.600.22g / dl than that of the uninfected ( 9.720.07g / dl ) . significant difference ( t - value = 5.660 , p<0.05 ) was observed between the hb of the infected and uninfected pregnant women . in addition , pregnant women infected with one helminth or the other had a mean pcv of 26.090.65% while the uninfected had 34.542.96% . the mean pcv of infected pregnant women was also significantly different ( t - value= 0.013 , p<0.05 ) from that of uninfected pregnant women . hookworm infection was observed to have a moderate highly significant negative correlation with hb ( r= 0.389 , p<0.01 ) and pcv ( r= 0.277 , p<0.01 ) . mixed infections ( hookworm and ascaris lumbricoides ) were also observed to have a mild highly significant negative correlation with hb ( r=0.179 , p<0.01 ) and pcv ( r=0.192 , p<0.01 ) . furthermore , a. lumbricoides and t. trichiura infections were observed to have a negative correlation with hb and pcv respectively but were not statistically significant ( p>0.05 ) . the prevalence of intestinal helminth infections among the study population ( 16.3% ) is epidemiologically significant considering the fact that this is an epidemiological survey involving asymptomatic subjects . it has been observed that any helminth ova or larvae present would be in very low level and possibly undetectable ( 9 ) . the high prevalence of hookworm infection compared to the a. lumbricoides and t. trichiura infections may be attributed to the cultural practices of the subjects especially agriculture and also high level of unhygienic practices . the prevalence of parasitic infections among pregnant women differed significantly ( p<0.05 ) within the age groups , indicating gestational - age dependence . findings in this study show that pregnant women in their first trimester were more infected than those in second and third trimesters . this can be attributed to the fact that treatment of helminthiases during ante natal visits is done after the first trimester . that is , pregnant women are given anthelminthic drugs after their first trimester ( 11 ) . when gestational age was related to anemia , women in their second pregnancy trimester were more anemic than their counterparts in their first and third trimesters . however , anemia in many areas of africa was described as usually most severe in the second trimester of gestation , especially following a period of acute infection , e.g. malaria , in the first trimester ( 12 , 13 ) . this study established an association between the intensity of helminth infections and lower hemoglobin ( hb ) . pregnant women with light infections were found to have low hemoglobin levels , but women with heavy infections had lower hemoglobin levels . the pathenogenicity of helminth infection shows that the disease manifests in three main phases , with the intestinal phase representing the most important period . a moderate hookworm infection according to studies will gradually produce anemia as the body reserves of iron are used up , with the severity depending on the worm load and the dietary intake of iron ( 12 ) . the burden of disease imposed on helminth - infected girls and women of childbearing age , especially when pregnant , may very well define the single most important contribution of intestinal parasitic infections to the calculation of their global disease burden . this study reveals a significant difference ( p<0.05 ) in the mean hb and pcv of the infected and uninfected pregnant women . pregnant women who were infected with at least one helminth parasite presented not just a higher frequency of anemia but also significant lower level of hemoglobin and pcv . ascaris lumbricoides and t. trichiura infections were also observed to have a negative correlation with hb and pcv among infected pregnant women but were not significant ( p>0.05 ) . public health importance where its prevalence is between 20% and 39.9% and severe if it occurs in 40% or more of the population . given these results , the importance and potential impacts of intestinal helminthiases during pregnancy , such as anemia , this indicates the need for periodical stool examinations during pregnancy as part of routine laboratory test in the prenatal control of helminthiases . a single course of anthelminthic therapy in addition to iron - folate supplementation would significantly increase hemoglobin concentrations and improve iron status in pregnant women . as has been stated in other studies , it is necessary to modify some preventive measures of information and education and to give specific treatment before the pregnancy in order to increase some of the pregnant women s health indicators . also , anthelmintic therapy which is inexpensive and safe during pregnancy after the first trimester should be part of the antenatal programme since malaria diagnosis and treatment is also part of the antenatal programme ( 14 ) . this study established an association between the intensity of helminth infections and lower hemoglobin ( hb ) . there is need for periodical stool examinations during pregnancy as part of routine laboratory test in the prenatal control of intestinal helminth infection . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .

backgroundthe incidence and hematological effects of helminth infection during pregnancy were investigated among pregnant women in isiala , mbano , southeast nigeria.methods:totally 282 pregnant women were enlisted for the study between october 2011 and september 2012 . stool samples were examined for intestinal helminths using formalin - ether sedimentation technique . hemoglobin ( hb ) and packed cell volume ( pcv ) levels were evaluated in venous blood samples using sahli s and microhaematocrit methods respectively.results:forty six ( 16.3% ) subjects were infected with at least one helminth parasite ; 24 ( 8.5% ) hookworm , 14(5.0% ) and 2(0.7% ) a. lumbricoides and trichuris trichiura infections respectively . intestinal helminthiases in pregnant women was significantly associated with age ( p<0.05 ) . the prevalence of intestinal helminthiases by parity was also significantly different ( p<0.05 ) with primigravidae having the highest infection rate ( 27.5% ) . hematological assessment showed that the prevalence of anemia among the women was 58.9% ( meansd = 9.31.0 ) . the differences in hemoglobin levels by age groups was statistically significant ( p < 0.05 ) . the contributory effect of gastrointestinal helminths in anemia showed that infected pregnant women had lower mean hemoglobin ( 8.600.22g / dl ) than the uninfected ( 9.720.07g / dl ) . significant difference ( t - value = 5.660 , p<0.05 ) was observed between the hb of the infected and uninfected pregnant women . in addition , infected pregnant women had mean pcv of 26.090.65% while the uninfected had 34.542.96% . the mean pcv of infected pregnant women was significantly different ( t - value= 0.013 , p<0.05 ) from that of the uninfected.conclusionanti-helminthic therapy after the first trimester should be part of the antenatal programme . intestinal helminth infection showed significant negative correlation with hb and pcv and contributed moderately to anemia .

Introduction Materials and Methods Study Population Determination of Helminth Infection Determination of Hemoglobin Concentration Data Analysis Permission and Ethical Approval Results Helminth species and levels of infections in relation to age, trimester and parity Intensity of Infection Hemoglobin (Hb) and packed cell volume (PCV) measurement Effect of Gastrointestinal Helminths on Anemia in Pregnancy Correlation between helminth infections and indicators of anemia in pregnant women Discussion Conclusion Ethical considerations

soft tissue sarcomas are very rare tumors ; however , there are many histologic subtypes . among those subtypes , furthermore , among sarcomas originating within the retroperitoneum , which constitute 1015% of all soft tissue sarcomas , liposarcomas are the most common histologic type , accounting for 41% of these tumors [ 2 , 3 ] . liposarcomas are generally located in the head , neck , trunk , mediastinum , upper and lower extremities , gastrointestinal tract , and retroperitoneum . they commonly occur in patients aged 4060 years , and men and women are equally affected . the dimensions and weight of liposarcomas are variable ; those over 20 kg are called herein , we report a giant retroperitoneal liposarcoma weighing 25.0 kg , encasing the entire left kidney and adherent to adjacent structures which was successfully removed with kidney and aorta preserving . the patient had not experienced any symptoms , such as abdominal pain , nausea , vomiting , constipation , dyspepsia , or dyspnea . the patient was admitted to the hospital and underwent contrast - enhanced computed tomography ( ct ) of the abdomen . the scan revealed a huge fatty mass originating from the retroperitoneum probably indicative of retroperitoneal liposarcoma . the spleen was pushed anteriorly and the small bowel was deviated to the right side of the intra - abdominal space by the mass ( fig . 1 ) . because the patient was old , we decided to attempt organ - preserving surgery for the removal of the tumor to minimize the morbidity . adherence of the mass to the diaphragm , stomach , spleen , pancreas , and aorta could be observed . the greatest difficulty was that the tumor was encasing the entire left kidney and adherent to the aorta . although the entire left kidney was encased with the huge tumor , neither the renal parenchyma nor the ureter was invaded . we successfully performed a salvage of the left kidney by wide excision and separated the tumor from the aorta by shaving it away , thus preserving both kidney and the aorta . the specimen measured 45.0 30.0 11.0 cm and weighted 25.0 kg ( fig . 2 ) . microscopic examination showed a combined type of liposarcoma ( tumor component : well - differentiated liposarcoma , more than 95% , myxoid liposarcoma , less than 5% ) . an average of 12 mitotic figures were noted per high - power field . according to the grading system of the french federation of cancer centers sarcoma group , she underwent regular follow - up examinations for 16 months after the operation . at 16 months , a follow - up ct scan revealed a newly defined low - density soft tissue mass in the aortocaval and preaortocaval area , measuring 3.5 1.8 4.3 cm , suggesting a locally recurrent tumor in the retroperitoneum . we performed positron emission tomography ( pet ) , which revealed tumor recurrence in the retroperitoneum . fluorescence in situ hybridization showed mdm2 amplification , which was consistent with a diagnosis of well - differentiated liposarcoma . after the second surgery , the patient underwent regular follow - up ct scans for approximately 12 months , and to date , there has been no evidence of tumor recurrence liposarcoma is one of the most common soft tissue sarcomas , constituting approximately 20% of cancers within that group . between 10 and 15% of soft tissue sarcomas originate within the retroperitoneal space , and the most common type among these is liposarcoma . however , liposarcoma is very rare overall , accounting for 0.20.3% of all malignancies . multiple factors , such as site and depth of origin , margin involvement after resection , and histologic grade affect survival rates for patients with liposarcoma . if the size of the tumor is less than 2.5 cm , the rate of metastasis at 5 years is approximately 3% . on the other hand , the rate of metastasis at 5 years is between 55 and 60% in cases of tumors larger than 20 cm . this is because the retroperitoneal space allows the tumor to grow to a large size before the appearance of clinical signs and symptoms . therefore , the tumor is often diagnosed at the advanced stage . resection margin involvement also affects prognosis . the five recognized histologic types are the well - differentiated , myxoid , round cell , pleomorphic , and dedifferentiated type . the well - differentiated type has good prognosis , with 5-year survival rates of approximately 90% . however , the toxic effects of radiation therapy limit this option by primary treatment modality . research has documented little benefit from adjuvant chemotherapy in well - differentiated low - grade tumors , and partial responses in high - grade diseases in up to 50% of patients , with increased overall survival . as a result , complete surgical resection is the gold standard treatment , which might be curative . in many cases , combined resection of involved organs and vasculatures therefore , the most commonly sacrificed organ is the kidney , followed by the colon , pancreas , major vasculature , and spleen . in this study , we reported on a giant retroperitoneal liposarcoma encasing the entire left kidney and adherent to adjacent structures . furthermore , we described successful organ - preserving surgical removal and discussed the prognosis . although there has been no evidence of recurrence to date , we will continue to observe our patient closely for recurrence , as in other previously published reports .

retroperitoneal liposarcoma is a rare tumor . the dimension and weight of liposarcoma are variable ; those over 20 kg are called giant liposarcoma. herein , we report giant retroperitoneal liposarcoma measuring 45 cm in diameter and 25 kg in weight encasing the entire left kidney and adherent to adjacent structures . a 71-year - old woman presented for a regular checkup . image study revealed a huge mass probably indicative of retroperitoneal liposarcoma encasing the entire left kidney and adherent to adjacent structures . we performed an organ - preserving surgical removal . the pathologic report was liposarcoma . at postoperative month 16 , a follow - up ct revealed a locally recurrent tumor . the patient underwent surgical removal of the newly discovered mass . after the second surgery , the patient underwent regular follow - up ct for approximately 12 months , and to date , there has been no evidence of tumor recurrence . high - grade liposarcoma shows sensitivity to radiation therapy . however , the toxic effect of radiation therapy limits this option by treatment modality . the use of chemotherapy is also controversial . as a result , complete resection is the gold standard treatment . here , we report a giant retroperitoneal liposarcoma encasing the entire left kidney and adherent to adjacent structures , describe successful organ - preserving surgical removal and discuss prognosis .

Introduction Case Report Discussion Statement of Ethics Disclosure Statement

eight members with schwannomatosis from four consecutive generations of a family included in this study were selected according to the following criteria : age : > 30 years ; two or more nonintradermal schwannomas , at least one with histological confirmation ; no evidence of vestibular tumor on high - quality magnetic resonance imaging scan ; and no known constitutional nf2 mutation . the ages at initial symptoms of body pains and numbness were ~3749 years for the disease - affected members . among five individuals with spinal imaging , the spinal schwannoma manifested as intradural , extramedullary nodules in areas of the lumbar , thoracic , and cervical spine . genomic dna ( 3 g ) from peripheral blood mononuclear cells was used for ( i ) the exon capture using the sureselect human all exon kit ( agilent technologies , santa clara , ca ) and ( ii ) sequencing and cluster generation using the illumina genome analyzer iix ( illumina , san diego , ca ) , as we previously reported . single - base substitutions were detected based on minimum total coverage of 10 and minimum variant coverage of 3 . small insertions / deletions and the log2 copy number variation were calculated for tumor versus normal tissue and were median centered , as we previously reported . the saccharomyces cerevisiae coq6-null mutant w303g63 ( mat ade2 - 1 , his 3 - 1,15 leu2 - 3,112 trp1 - 1 ura3 - 1 coq6:his3 ) , yeast coq6 gene expression plasmid , and a low - copy - number ( pqm ) or a high - copy - number ( prcm ) yeast expression plasmid containing the human coq6 open reading frame with an in - frame amino terminal yeast mitochondrial leader sequence ( as positive control for yeast rescuing studies ) were generous gifts of dr catherine f. clarke ( university of california , los angeles ) . the d208h mutation of human coq6 was introduced by site - directed mutagenesis ( stratagene , la jolla , ca ) . the s. cerevisiae coq6-null mutants were unable to survive in media containing a nonfermentable carbon source unless a functional coq6 gene was introduced into them , and the yeast complementation experiment was performed as previously reported . the coq10 level in cells was measured using a human coq10 elisa kit , and this level was converted to nanograms per microgram of total cellular protein . mitochondrial membrane potential ( m ) was measured using the standard mitochondrial - specific dual - fluorescence probe jc-1 ( 5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbocyanine iodide ) , as previously reported . rat coq6 gene specific small interfering rna and scrambled small interfering rna were transfected into rat schwann cells to decrease coq6 , and then production of intracellular reactive oxygen species ( ros ) in rat schwann cells was also monitored by the fluorescence emission of 2,7-dichlorofluorescein at 72 hours posttransfection . hemagglutinin - tagged human wild - type coq6 and d208h coq6 open reading frames were cloned into the pcdna3.1 ( + ) mammalian expression plasmid and introduced into human fibroblast imr90 cells to assess rescue of coq6 knockdown by small interfering rna . eight members with schwannomatosis from four consecutive generations of a family included in this study were selected according to the following criteria : age : > 30 years ; two or more nonintradermal schwannomas , at least one with histological confirmation ; no evidence of vestibular tumor on high - quality magnetic resonance imaging scan ; and no known constitutional nf2 mutation . the ages at initial symptoms of body pains and numbness were ~3749 years for the disease - affected members . among five individuals with spinal imaging , the spinal schwannoma manifested as intradural , extramedullary nodules in areas of the lumbar , thoracic , and cervical spine . genomic dna ( 3 g ) from peripheral blood mononuclear cells was used for ( i ) the exon capture using the sureselect human all exon kit ( agilent technologies , santa clara , ca ) and ( ii ) sequencing and cluster generation using the illumina genome analyzer iix ( illumina , san diego , ca ) , as we previously reported . single - base substitutions were detected based on minimum total coverage of 10 and minimum variant coverage of 3 . small insertions / deletions and the log2 copy number variation were calculated for tumor versus normal tissue and were median centered , as we previously reported . the saccharomyces cerevisiae coq6-null mutant w303g63 ( mat ade2 - 1 , his 3 - 1,15 leu2 - 3,112 trp1 - 1 ura3 - 1 coq6:his3 ) , yeast coq6 gene expression plasmid , and a low - copy - number ( pqm ) or a high - copy - number ( prcm ) yeast expression plasmid containing the human coq6 open reading frame with an in - frame amino terminal yeast mitochondrial leader sequence ( as positive control for yeast rescuing studies ) were generous gifts of dr catherine f. clarke ( university of california , los angeles ) . the d208h mutation of human coq6 was introduced by site - directed mutagenesis ( stratagene , la jolla , ca ) . the s. cerevisiae coq6-null mutants were unable to survive in media containing a nonfermentable carbon source unless a functional coq6 gene was introduced into them , and the yeast complementation experiment was performed as previously reported . the coq10 level in cells was measured using a human coq10 elisa kit , and this level was converted to nanograms per microgram of total cellular protein . mitochondrial membrane potential ( m ) was measured using the standard mitochondrial - specific dual - fluorescence probe jc-1 ( 5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbocyanine iodide ) , as previously reported . rat coq6 gene specific small interfering rna and scrambled small interfering rna were transfected into rat schwann cells to decrease coq6 , and then production of intracellular reactive oxygen species ( ros ) in rat schwann cells was also monitored by the fluorescence emission of 2,7-dichlorofluorescein at 72 hours posttransfection . hemagglutinin - tagged human wild - type coq6 and d208h coq6 open reading frames were cloned into the pcdna3.1 ( + ) mammalian expression plasmid and introduced into human fibroblast imr90 cells to assess rescue of coq6 knockdown by small interfering rna . the disease - affected members of the family were a father and his daughter in the first and second generations , respectively , and five of eight siblings in the third generation ( named as s1s8 ) ; in addition , one member of the fourth generation has been diagnosed with schwannomatosis thus far ( figure 1a ) . the schwannomatosis tissues of s2 and s7 displayed similar morphological features under hematoxylin - and - eosin staining ( upper panel in figure 1b ) and positive staining for s-100 protein , clearly indicating their schwann cell origin ( lower panel in figure 1b ) . constitutional mutations in smarcb1 , lztr1 , nf1 , and nf2 genes including point mutations , intragenic insertions / deletions , and gene duplication were not found in the family by whole - genome sequencing analysis . consistent with this observation , genetic abnormalities of smarcb1 , nf1 , and nf2 in the schwannomatosis tissues of s2 and s7 were not discovered by fluorescence in situ hybridization analysis ( supplementary figure s1a c online ) and sanger sequencing . immunohistochemical analysis further showed that smarcb1 ( supplementary figure s2a online ) , nf1 ( supplementary figure s2b online ) , and nf2 ( supplementary figure s2c online ) proteins were normally expressed in these tissues . the distribution of schwannomatosis - affected members in the family indicated an autosomal dominant trait . to explore the genetic differences between the affected and unaffected members , we performed whole - genome sequencing on the genomic dna samples of s4 ( schwannomatosis - affected ) and s5 ( normal ) . comparative analysis of whole - genome sequencing showed that there were no deleted / amplified dna regions in s4 compared with the dna of s5 ( supplementary figure s3 online ) . no genetic abnormalities in the smarcb1 , lztr1 , nf1 , and nf2 genes were further identified by whole - genome sequencing analysis ( supplementary table s2 online ) . we further performed whole - exome sequencing on the genomic dna samples of s2 , s3 , and s7 ( supplementary figure s4 online ) . twelve shared heterozygous variants , including nine missense variants ( supplementary table s3 online ) , were identified by these methods ( supplementary figure s4 online ) . variants of hrnr and gstt2 proteins were assessed as benign by polyphen-2 ( polymorphism phenotyping software , version 2 ) . the de novo heterozygous variants of mypn , coq6 , ckmt1a , cyp11a1 , duox1 , and triobp genes were commonly found in all affected members . on the basis of intensive literature review and mutation prediction of these genetic variants , we focused on a heterozygous mutation ( p.asp208his/d208h ; c.622g > c ) , reference sequence nm_182476.2 ) of the coq6 gene , whose function is essential but not redundant . sanger sequencing analysis showed that the d208h allele was found in the disease - affected but not in normal family members ( figure 1c ) . the messenger rna transcript of the d208h coq6 allele was found in the schwannomatosis tissues of s2 and s7 by reverse transcription polymerase chain reaction ( figure 1d ) . in addition to the heterozygous d208h mutation , molecular analysis did not discover other coq6 genetic variants in these schwannomatosis tissues . coq6 monooxygenase is evolutionarily conserved , and the d208 residue is located at the highly conserved flavin adenine dinucleotide ( fad)-binding domain . the missense mutation altered an amino acid residue that is uniformly conserved from escherichia coli to homo sapiens ( humans ) ( figure 1e , upper panel ) . structural modeling of the fad - binding domain of human coq6 using composer in sybyl ( tripos , st louis , mo ) indicated that the h208 residue would clash with the residues s212 and v214 in the fad - binding domain ( figure 1e , lower panel ) , indicating that h208 may negatively affect coq6 function by interfering with its binding to fad . as shown in figure 2a ( left panel ) , all the transformed coq6-null yeast mutants grew normally in sd - ura selective media ( synthetic defined media with uracil dropout , in which glucose acts as fermentable carbon source ) . the yeast coq6 gene ( prs1-yq6 , positive control ) and wild - type human coq6 ( hwt ) gene , but not the d208h coq6 mutant ( d208h - q6 ) , in both high - copy - number ( prcm ) and low - copy - number ( pqm ) plasmids ( the empty vectors were negative controls ) rescued the growth of coq6-null yeasts plated on ypg media ( yeast extract / peptone / glycerol media , in which glycerol acts as a nonfermentable carbon source ) , which indicated that the d208h coq6 mutant lacked complementation in coq6-deficient yeast mutants . furthermore , we also verified that knockdown of coq6 dramatically decreased coq10 production in human fetal lung fibroblast imr90 cells over a period of 72 hours ( figure 2b ) . knockdown of coq6 in imr90 cells dramatically decreased mitochondrial membrane potential , which may cause cell death by energy depletion , and concurrently increased ros levels over 48 hours ( supplementary figure s5a , b online ) . furthermore , we showed that only reconstitution of wild - type human coq6 , not the d208h coq6 mutant , rescued the imr90 cells after knockdown of coq6 ( figure 2c ) . moreover , we also modeled the haploinsufficiency of coq6 by knockdown of coq6 gene in rat schwann cells and found that ros production increased in a dosage - dependent manner ( figure 2d ) , which might suggest that haploinsufficiency of coq6 may cause chronic ros overproduction in schwann cells . the disease - affected members of the family were a father and his daughter in the first and second generations , respectively , and five of eight siblings in the third generation ( named as s1s8 ) ; in addition , one member of the fourth generation has been diagnosed with schwannomatosis thus far ( figure 1a ) . the schwannomatosis tissues of s2 and s7 displayed similar morphological features under hematoxylin - and - eosin staining ( upper panel in figure 1b ) and positive staining for s-100 protein , clearly indicating their schwann cell origin ( lower panel in figure 1b ) . constitutional mutations in smarcb1 , lztr1 , nf1 , and nf2 genes including point mutations , intragenic insertions / deletions , and gene duplication were not found in the family by whole - genome sequencing analysis . consistent with this observation , genetic abnormalities of smarcb1 , nf1 , and nf2 in the schwannomatosis tissues of s2 and s7 were not discovered by fluorescence in situ hybridization analysis ( supplementary figure s1a c online ) and sanger sequencing . immunohistochemical analysis further showed that smarcb1 ( supplementary figure s2a online ) , nf1 ( supplementary figure s2b online ) , and nf2 ( supplementary figure s2c online ) proteins were normally expressed in these tissues . the distribution of schwannomatosis - affected members in the family indicated an autosomal dominant trait . to explore the genetic differences between the affected and unaffected members , we performed whole - genome sequencing on the genomic dna samples of s4 ( schwannomatosis - affected ) and s5 ( normal ) . comparative analysis of whole - genome sequencing showed that there were no deleted / amplified dna regions in s4 compared with the dna of s5 ( supplementary figure s3 online ) . no genetic abnormalities in the smarcb1 , lztr1 , nf1 , and nf2 genes were further identified by whole - genome sequencing analysis ( supplementary table s2 online ) . we further performed whole - exome sequencing on the genomic dna samples of s2 , s3 , and s7 ( supplementary figure s4 online ) . twelve shared heterozygous variants , including nine missense variants ( supplementary table s3 online ) , were identified by these methods ( supplementary figure s4 online ) . variants of hrnr and gstt2 proteins were assessed as benign by polyphen-2 ( polymorphism phenotyping software , version 2 ) . the de novo heterozygous variants of mypn , coq6 , ckmt1a , cyp11a1 , duox1 , and triobp genes were commonly found in all affected members . on the basis of intensive literature review and mutation prediction of these genetic variants , we focused on a heterozygous mutation ( p.asp208his/d208h ; c.622g > c ) , reference sequence nm_182476.2 ) of the coq6 gene , whose function is essential but not redundant . sanger sequencing analysis showed that the d208h allele was found in the disease - affected but not in normal family members ( figure 1c ) . the messenger rna transcript of the d208h coq6 allele was found in the schwannomatosis tissues of s2 and s7 by reverse transcription polymerase chain reaction ( figure 1d ) . in addition to the heterozygous d208h mutation , molecular analysis did not discover other coq6 genetic variants in these schwannomatosis tissues . coq6 monooxygenase is evolutionarily conserved , and the d208 residue is located at the highly conserved flavin adenine dinucleotide ( fad)-binding domain . the missense mutation altered an amino acid residue that is uniformly conserved from escherichia coli to homo sapiens ( humans ) ( figure 1e , upper panel ) . structural modeling of the fad - binding domain of human coq6 using composer in sybyl ( tripos , st louis , mo ) indicated that the h208 residue would clash with the residues s212 and v214 in the fad - binding domain ( figure 1e , lower panel ) , indicating that h208 may negatively affect coq6 function by interfering with its binding to fad . as shown in figure 2a ( left panel ) , all the transformed coq6-null yeast mutants grew normally in sd - ura selective media ( synthetic defined media with uracil dropout , in which glucose acts as fermentable carbon source ) . the yeast coq6 gene ( prs1-yq6 , positive control ) and wild - type human coq6 ( hwt ) gene , but not the d208h coq6 mutant ( d208h - q6 ) , in both high - copy - number ( prcm ) and low - copy - number ( pqm ) plasmids ( the empty vectors were negative controls ) rescued the growth of coq6-null yeasts plated on ypg media ( yeast extract / peptone / glycerol media , in which glycerol acts as a nonfermentable carbon source ) , which indicated that the d208h coq6 mutant lacked complementation in coq6-deficient yeast mutants . furthermore , we also verified that knockdown of coq6 dramatically decreased coq10 production in human fetal lung fibroblast imr90 cells over a period of 72 hours ( figure 2b ) . knockdown of coq6 in imr90 cells dramatically decreased mitochondrial membrane potential , which may cause cell death by energy depletion , and concurrently increased ros levels over 48 hours ( supplementary figure s5a , b online ) . furthermore , we showed that only reconstitution of wild - type human coq6 , not the d208h coq6 mutant , rescued the imr90 cells after knockdown of coq6 ( figure 2c ) . moreover , we also modeled the haploinsufficiency of coq6 by knockdown of coq6 gene in rat schwann cells and found that ros production increased in a dosage - dependent manner ( figure 2d ) , which might suggest that haploinsufficiency of coq6 may cause chronic ros overproduction in schwann cells . coq10 is an electron carrier in the mitochondrial respiratory chain and is also a lipid - soluble antioxidant implicated in protecting cells from damage by ros . a previous study showed that severe coq10 deficiency ( < 30% ) caused a marked defect in bioenergetics , with decreased adenosine triphosphate production and sometimes decreased cell growth , but no increase in ros or oxidative stress induced death . by contrast , intermediate decreases in coq10 ( 3050% ) caused mild defects in bioenergetics , with significant increases in ros and oxidative stress induced cell death . our knockdown of coq6 in imr90 cells also resulted in a similar reduction of cellular coq10 and mitochondrial membrane potential . we also identified that knockdown of coq6 impaired mitochondrial function and increased ros overproduction in rat schwann cells , with a positive correlation between decreased coq6 protein and ros production . elevated levels of ros and decreased levels of ros scavengers and antioxidant enzymes are associated with various human diseases including cancers . for example , increased ros production caused by mitochondrial dna mutations has been linked to tumor progression in prostate cancer models . abnormally low plasma levels of coq10 have been found in a number of cancer types , including cervical cancer and melanoma . decreased levels of coq10 have been detected in human breast cancer tissues . however , whether deficiency of coq10 predisposes individuals to certain cancers is not known . similarly , the roles of coq10 biosynthesis gene mutations have not been appreciated in cancers . the association is only now becoming apparent with the identification of coq2 gene ( one of the coq10 biosynthesis enzymes ) mutations in human colon and rectal cancers , ovarian carcinoma , and glioblastoma multiforme by cancer genomic studies . in this study , we have identified a heterozygous loss - of - function coq6 missense mutation in familial schwannomatosis . a critical issue related to implication of the genetic alteration in the familial disease is whether the heterozygous loss - of - function coq6 displays haploinsufficiency . a large - scale screening study for genes in yeast displaying haploinsufficiency found that haploinsufficiency of coq6 resulted in a mild reduction of fitness in a medium containing glucose . a recent study demonstrated that both homozygous and compound heterozygous loss - of - function mutations in the human coq6 gene caused early - onset steroid - resistant nephritic syndrome with sensorineural deafness , which progressed to end - stage renal failure by a median age of < 2 years , and two single heterozygous nonsense mutations were also identified in two families with cyclosporin a therefore , it may be assumed that the coq6 haploinsufficiency may be conditional and tissue / cell specific . in the family under study , none of the members harboring the mutated allele had nephritic syndrome , but they did have schwannomatosis , indicating diversity and heterogeneity of clinical phenotypes caused by defects of the same gene . germline abnormalities associated with cancer may be detected in every cell in the body or only in the tumor cells . interestingly , despite the presence of a constitutional genetic abnormality that might affect growth regulatory pathways in all cells , people are generally predisposed to only certain tumor types . in this particular family , we consider that the d208h coq6 allele may lead to a chronic or conditional haploinsufficiency of coq6 in a cell / tissue - specific manner , causing chronic ros overproduction in schwann cells through an unknown mechanism , thus predisposing the family members to familial schwannomatosis . in summary , although the exact oncogenetic mechanism of the loss - of - function coq6 gene in the disease remains a challenging question to be elucidated , we have , for the first time , suggested an association of the defect in one of the coq10 biosynthesis genes , coq6 , with familial schwannomatosis . the mutated coq6 allele may lead to coq10 deficiency and chronic overproduction of ros in schwann cells , which may predispose individuals to the disease .

purpose : schwannomatosis , a subtype of neurofibromatosis , is characterized by multiple benign , nonvestibular , nonintradermal schwannomas . although the tumor suppressor smarcb1 gene has been frequently identified as the underlying genetic cause of half of familial and ~10% of sporadic schwannomatosis , for most other cases , further causative genes remain to be discovered . herein , we characterize the genome of a schwannomatosis family without constitutional inactivation of the smarcb1 gene to explore novel genomic alterations predisposing individuals to the familial disease.methods:we performed whole - genome / exome sequencing on genomic dna of both schwannomatosis - affected and normal members of the family.results:we identified a novel missense mutation ( p.asp208his ; c.622g > c ) in the coenzyme q10 ( coq10 ) biosynthesis monooxygenase 6 gene ( coq6 ) in schwannomatosis - affected members . the deleterious effects of the coq6 mutations were validated by their lack of complementation in a coq6-deficient yeast mutant . our study further indicated that the resultant haploinsufficiency of coq6 might lead to coq10 deficiency and chronic overproduction of reactive oxygen species in schwann cells.conclusion:although the exact oncogenetic mechanisms in this schwannomatosis family remain to be elucidated , our data strongly indicate a probable role of coq6 mutation and coq10 deficiency in the development of familial schwannomatosis .

Materials and Methods Familial schwannomatosis Whole-genome/exome sequencing, sequence alignment, variant calling, and annotation Complementation in Measurement of CoQ10 level, mitochondrial membrane potential, and ROS level Results Characterization of familial schwannomatosis without constitutional inactivation of Identification of constitutional Validation of loss-of-function D208H Discussion Disclosure Supplementary Material

emergence of bacterial resistance to many different antibiotics is considered as a great concern in human health . pseudomonas aeruginosa ( pa ) has been recognized as one of the significant pathogens of nosocomial infections ( 1 ) . key mechanism of antibiotic resistance in p. aeruginosa is the expulsion of antibiotics through multidrug resistance ( mdr ) efflux systems belonging to the resistance - nodulation - division ( rnd ) family ( 2 ) . mexab - oprm , mexcd - oprj , mexef - oprn , mexxy , mexjk and mexvw contribute the most significantly to antibiotic resistance ( 3 ) and play an important role in intrinsic and acquired multidrug resistance ( 2 ) . resistance of p. aeruginosa to multiple antibiotics is largely attributable to expression of the mexab - oprm efflux pump ( 4 ) . among all the rnd pumps of pa , mex - ab - oprm was the first efflux pump found to target multiple classes of antibiotics including -lactam ( carboxypenicillins , aztreonam , extended - spectrum cephalosporins , penems , the carbapenems such as meropenem and panipenem except imipenem and biapenem ) ; fluoroquinolones , tetracyclines , chloramphenicol , macrolides , novobiocin , trimethoprim and sulfonamides ( 5 , 6 ) . the mexab - oprm efflux pump belongs to the superfamily of ribonucleoproteins and consists of an inner membrane ( mexb ) , a periplasmic membrane fusion protein ( mexa ) and a channel - forming outer membrane protein , oprm ( 7 ) . in this study , we investigated the role of mex - ab - oprm efflux pump . transcription level of efflux pump genes mexa , mexb , oprm , mexr and ampc were analyzed using real - time pcr . p. aeruginosa strains were isolated from patients of children s hospital medical center during 6 months ( march and august 2012 ) . all bacterial isolates were identified at microbiology lab using standard biochemical identification methods ( 8) . a total of 45 samples were collected from various clinical specimens such as urine ( n=21 ) , exudates ( n=11 ) , eye ( n=2 ) , ear ( n=2 ) , csf ( n=2 ) , blood ( n=2 ) , trachea ( n=2 ) and lung secretions ( n=3 ) . p.aeruginosa pao1 strain which has entirely sequenced genome was used as the reference wild type strain throughout the study . antimicrobial susceptibility tests were performed using disk diffusion and minimum inhibitory concentration ( mic ) methods . antibiotics used in this study were chosen randomly from different antibiotic classes that were used mostly in this hospital . antibiotics used in the disk diffusion method were cephalothin ( 30 g ) , cefepime ( 30 g ) , ceftazidime ( 30 g ) , ciprofloxacin ( 5 g ) ( flouroquionolones ) , meropenem ( 10 g ) , imipenem ( 10 g ) ( carbapenems ) , piperacillin / tazobactam ( 10/100 g ) ( -lactams ) , gentamicin ( 10 g ) and amikacin ( 30 g ) ( aminoglycosides ) . antibiotics used in this study were cefuroxime , ceftazidim , cefazolin , ceftriaxone ( cephems ) , meropenem ( carbapenems ) , amikacin , tobramycin ( aminoglycosides ) , aztreonam ( monobactam ) , ampicillin , piperacillin ( penicillins ) , colistin ( lipopeptides ) , gatifloxacin , nalidixic acid ( flouroquionolones ) , piperacillin - tazobactam , tazobactam ( -lactams ) ( mast , uk ) . total rna was extracted using rna extraction kit ( fermentas , lithuania ) , and converted into cdna using the cdna synthesis kit ( fermentas , lithuania ) according to the manufacturer s instruction and the quality and purity of the rna obtained was evaluated using spectrophotometer . the final optimized pcr reaction consisted of 1 l of each primer ( 10pmol ) ( table 1 ) , 0.5 l dntp ( 10 mm ) , 0.5 l mgcl ( 100 mm ) , 0.2 l ( 1 unit ) taq dna polymerase ( metabion , germany ) , 2.5 l pcr buffer ( 10x ) , and 0.5 l of dna template ( 100g / ml ) in total volume of 25 l with double distilled water . the cycling program was adjusted as follows : initial denaturation at 94 c for 5 min followed by 30 cycles of 94 c for 45 sec , 5072 c ( 45 sec ) , 72 c ( 1 min ) and a final extension at 72 c for 10 min ( 9 ) . primers used in pcr and real - time pcr real - time quantification of cdna was carried out on an abi step one detection system ( applied biosystems , uk ) using the sybr green pcr master mix . real - time pcr was used to investigate the expression level of each gene in mexab - oprm efflux pump to expression each of these genes of separately measured by relative quantitation real - time pcr . the optimized reaction consisted of master mix ( 10x ) , 1 l of each primer ( 10 pmol ) , and 0.5 l of template dna ( 100 g / ml ) in a total volume of 20 l p. aeruginosa strain pao1 was used as a standard strain for normalization of relative mrna levels . ampc gene was considered as a housekeeping gene and all gene expressions were compared with ampc gene expression . the assay was performed three times for each sample and the mean of three obtained quantities was considered as quantity . cycle of threshold ( c t ) was considered as the average threshold cycle number from three independent experiments . the real - time pcr apparatus was programmed as follows : initial denaturation at 95 c ( 15 min ) followed by 40 cycles of 95 c ( 15 sec ) , 61 c ( 15 sec ) , 71 c ( 20 sec ) and melt curve at 61 c ( 1 min ) and 95 c for 15 sec . to obtain reproducibility of the reaction ampc gene was considered as a housekeeping gene and the results were compared with gene expression in a susceptible pa reference strain . primer dimers and other artifacts were evaluated by melting curve analysis . to confirm that specific amplification had occurred , melting curves of each amplicon were assessed p. aeruginosa strain pao1 was used as a standard strain for normalization of relative mrna levels . real - time pcr efficiencies were acquired by amplification of a standardized dilution series of the template cdna and were determined for each gene as the slope of a linear regression model . pcr efficiency was determined by measuring the ct ct to a specific threshold for a serial dilution of cdna . the corresponding real - time pcr efficiencies were then calculated according to the equation : e = ( 101 ) 100 ( 1012 ) . p. aeruginosa strains were isolated from patients of children s hospital medical center during 6 months ( march and august 2012 ) . all bacterial isolates were identified at microbiology lab using standard biochemical identification methods ( 8) . a total of 45 samples were collected from various clinical specimens such as urine ( n=21 ) , exudates ( n=11 ) , eye ( n=2 ) , ear ( n=2 ) , csf ( n=2 ) , blood ( n=2 ) , trachea ( n=2 ) and lung secretions ( n=3 ) . p.aeruginosa pao1 strain which has entirely sequenced genome was used as the reference wild type strain throughout the study . antimicrobial susceptibility tests were performed using disk diffusion and minimum inhibitory concentration ( mic ) methods . antibiotics used in this study were chosen randomly from different antibiotic classes that were used mostly in this hospital . antibiotics used in the disk diffusion method were cephalothin ( 30 g ) , cefepime ( 30 g ) , ceftazidime ( 30 g ) , ciprofloxacin ( 5 g ) ( flouroquionolones ) , meropenem ( 10 g ) , imipenem ( 10 g ) ( carbapenems ) , piperacillin / tazobactam ( 10/100 g ) ( -lactams ) , gentamicin ( 10 g ) and amikacin ( 30 g ) ( aminoglycosides ) . antibiotics used in this study were cefuroxime , ceftazidim , cefazolin , ceftriaxone ( cephems ) , meropenem ( carbapenems ) , amikacin , tobramycin ( aminoglycosides ) , aztreonam ( monobactam ) , ampicillin , piperacillin ( penicillins ) , colistin ( lipopeptides ) , gatifloxacin , nalidixic acid ( flouroquionolones ) , piperacillin - tazobactam , tazobactam ( -lactams ) ( mast , uk ) . total rna was extracted using rna extraction kit ( fermentas , lithuania ) , and converted into cdna using the cdna synthesis kit ( fermentas , lithuania ) according to the manufacturer s instruction and the quality and purity of the rna obtained was evaluated using spectrophotometer . the final optimized pcr reaction consisted of 1 l of each primer ( 10pmol ) ( table 1 ) , 0.5 l dntp ( 10 mm ) , 0.5 l mgcl ( 100 mm ) , 0.2 l ( 1 unit ) taq dna polymerase ( metabion , germany ) , 2.5 l pcr buffer ( 10x ) , and 0.5 l of dna template ( 100g / ml ) in total volume of 25 l with double distilled water . the cycling program was adjusted as follows : initial denaturation at 94 c for 5 min followed by 30 cycles of 94 c for 45 sec , 5072 c ( 45 sec ) , 72 c ( 1 min ) and a final extension at 72 c for 10 min ( 9 ) . real - time quantification of cdna was carried out on an abi step one detection system ( applied biosystems , uk ) using the sybr green pcr master mix . real - time pcr was used to investigate the expression level of each gene in mexab - oprm efflux pump to expression each of these genes of separately measured by relative quantitation real - time pcr . the optimized reaction consisted of master mix ( 10x ) , 1 l of each primer ( 10 pmol ) , and 0.5 l of template dna ( 100 g / ml ) in a total volume of 20 l p. aeruginosa strain pao1 was used as a standard strain for normalization of relative mrna levels . ampc gene was considered as a housekeeping gene and all gene expressions were compared with ampc gene expression . the assay was performed three times for each sample and the mean of three obtained quantities was considered as quantity . cycle of threshold ( c t ) was considered as the average threshold cycle number from three independent experiments . the real - time pcr apparatus was programmed as follows : initial denaturation at 95 c ( 15 min ) followed by 40 cycles of 95 c ( 15 sec ) , 61 c ( 15 sec ) , 71 c ( 20 sec ) and melt curve at 61 c ( 1 min ) and 95 c for 15 sec . to obtain reproducibility of the reaction ampc gene was considered as a housekeeping gene and the results were compared with gene expression in a susceptible pa reference strain . primer dimers and other artifacts were evaluated by melting curve analysis . to confirm that specific amplification had occurred , melting curves of each amplicon were assessed p. aeruginosa strain pao1 was used as a standard strain for normalization of relative mrna levels . real - time pcr efficiencies were acquired by amplification of a standardized dilution series of the template cdna and were determined for each gene as the slope of a linear regression model . pcr efficiency was determined by measuring the ct ct to a specific threshold for a serial dilution of cdna . the corresponding real - time pcr efficiencies were then calculated according to the equation : e = ( 101 ) 100 ( 1012 ) . totally , 45 strains of p. aeruginosa were isolated from patients aged 2 months to 12 years who were referred to children s medical center hospital , tehran , iran . the majority of isolates were collected from patients hospitalized in picu ( n=18 , 39% ) , nicu ( n=5 , 11% ) followed by emergency ward ( n=3 , 7% ) , nephrology ( n=3 , 7% ) , surgery ( n=5 , 11% ) , neurology ( n=3 , 7% ) , urology ( n=5 , 11% ) and infectious ward ( n=3 , 7% ) . the most antibiotic resistance based on clsi reference guidelines for disk diffusion method was detected for cephalothin ( n=41 , 92% ) whereas mics should the following frequencies for antibiotic resistance : cefuroxime ( n=41 , 91% ) , ceftazidime ( n=42 , 93% ) , amikacin ( n=38 , 84.5% ) , cefazolin ( n=40 , 89% ) , aztreonam ( n=42 , 93% ) , piperacillin ( n=39 , 86.5% ) , tazobactam ( n=41 , 91% ) and piperacillin - tazobactam ( n=42 , 93% ) . antibiotics such as colistin ( 15% ) , ceftriaxone ( 33% ) and tobramycin ( 22% ) showed the highest susceptibility rates against the isolates ( table 2 ) . pattern of determined antibiotic resistance among p. aeruginosa strains using disk diffusion and mic methods the best annealing temperature was obtained at 61 c . the results of real - time pcr for the genes of mexab - oprm efflux pump have been shown in table 3 . according to the results of antibiotic resistance via disk diffusion method , overexpression of mexab - oprm genes was associated to the resistance towards cephalosporin while via mic method overexpression of mexab - oprm was seen in those showing resistance towards special antibiotics especially fluoroquinolones , cephalosporin and beta lactams . the expression of mexab - oprm efflux pump genes in p. aeruginosa strains isolated from children the reproducibility of the expression levels of each gene was measured three times . p. aeruginosa clinical isolates demonstrated increased level of mexa ( 2 folds ) , mexb ( from 2.2 to 12.0 folds ) , oprm ( 2 folds ) and ampc ( 10 folds ) at transcriptional mrna level , respectively . confirmation of specific amplifications during real - time pcr on mexab - oprm genes of efflux pump among 45 resistant isolates , overexpression of mexa gene was observed in 25 isolates ( 55.5% ) , mexb in 24 isolates ( 53.3% ) and oprm in 16 isolates ( 35.5% ) . in 28 isolates ( 62% ) , overexpression was observed in one of the three genes of mexab - oprm efflux pump . the ratio values obtained for each of the four genes in samples showed that the expression levels of mexa gene ( n=25 , 89% ) was between 1.8 and 11.7 ( mean= 6.7 ) , mexb ( n=24 , 85% ) between 1.3 and 14 ( mean= 7.6 ) and oprm gene ( n=16 , 57% ) between 1 and 9 ( mean= 5 ) . primer dimers and other artifacts were evaluated by melting curve analysis . to confirm that specific amplification ( fig . totally , 45 strains of p. aeruginosa were isolated from patients aged 2 months to 12 years who were referred to children s medical center hospital , tehran , iran . the majority of isolates were collected from patients hospitalized in picu ( n=18 , 39% ) , nicu ( n=5 , 11% ) followed by emergency ward ( n=3 , 7% ) , nephrology ( n=3 , 7% ) , surgery ( n=5 , 11% ) , neurology ( n=3 , 7% ) , urology ( n=5 , 11% ) and infectious ward ( n=3 , 7% ) . the most antibiotic resistance based on clsi reference guidelines for disk diffusion method was detected for cephalothin ( n=41 , 92% ) whereas mics should the following frequencies for antibiotic resistance : cefuroxime ( n=41 , 91% ) , ceftazidime ( n=42 , 93% ) , amikacin ( n=38 , 84.5% ) , cefazolin ( n=40 , 89% ) , aztreonam ( n=42 , 93% ) , piperacillin ( n=39 , 86.5% ) , tazobactam ( n=41 , 91% ) and piperacillin - tazobactam ( n=42 , 93% ) . antibiotics such as colistin ( 15% ) , ceftriaxone ( 33% ) and tobramycin ( 22% ) showed the highest susceptibility rates against the isolates ( table 2 ) . pattern of determined antibiotic resistance among p. aeruginosa strains using disk diffusion and mic methods the results of real - time pcr for the genes of mexab - oprm efflux pump have been shown in table 3 . according to the results of antibiotic resistance via disk diffusion method , overexpression of mexab - oprm genes was associated to the resistance towards cephalosporin while via mic method overexpression of mexab - oprm was seen in those showing resistance towards special antibiotics especially fluoroquinolones , cephalosporin and beta lactams . the expression of mexab - oprm efflux pump genes in p. aeruginosa strains isolated from children the reproducibility of the expression levels of each gene was measured three times . p. aeruginosa clinical isolates demonstrated increased level of mexa ( 2 folds ) , mexb ( from 2.2 to 12.0 folds ) , oprm ( 2 folds ) and ampc ( 10 folds ) at transcriptional mrna level , respectively . confirmation of specific amplifications during real - time pcr on mexab - oprm genes of efflux pump among 45 resistant isolates , overexpression of mexa gene was observed in 25 isolates ( 55.5% ) , mexb in 24 isolates ( 53.3% ) and oprm in 16 isolates ( 35.5% ) . in 28 isolates ( 62% ) , overexpression was observed in one of the three genes of mexab - oprm efflux pump . the ratio values obtained for each of the four genes in samples showed that the expression levels of mexa gene ( n=25 , 89% ) was between 1.8 and 11.7 ( mean= 6.7 ) , mexb ( n=24 , 85% ) between 1.3 and 14 ( mean= 7.6 ) and oprm gene ( n=16 , 57% ) between 1 and 9 ( mean= 5 ) . primer dimers and other artifacts were evaluated by melting curve analysis . to confirm that specific amplification ( fig . p. aeruginosa is one of the most important causes of nosocomial infections due to the presence of various resistant elements ( 11 ) . during last decades , the emergency of multidrug resistant p. aeruginosa has been observed worldwide . in this study , 2835% of studied p. aeruginosa isolates were resistant to carbapenems which was in accordance with previous studies ( 13 , 14 ) . high frequency of cephalosporin resistance was also observed among p. aeruginosa isolates similar to the other reports ( 14 , 15 ) . among all isolates , resistance to piperacillin / tazobactam was low ( 2627% ) which was in agreement with our previous report ( 13 ) and was higher than ghazi et al . report ( 16 ) . in this study colistin showed 15% resistance which can be suggested as an effective antibiotic for treatment of pa infections . this finding is similar to the results of study performed by alekshun et al . in us ( 17 ) . at present , the efflux pump has been recognized as one of the significant complexes involved in resistance to most of the classes of antibiotics ( 11 , 18 , 19 ) . it has been reported that the prevalence of efflux pump overexpression in clinical p. aeruginosa strains of ranged from 1475% ( 20 , 21 ) . there are rare reports on prevalence of efflux pump overexpression in our country ( 22 , 23 ) and there is no investigation on pa strains isolated from children . in the present study the increased expression level of mexab - oprm genes of efflux pump simultaneously was 25% which was relatively more than dumas et al . ( 24 ) . in this study , 28 of 45 patients ( 62% ) showed an increased expression level of efflux pumps mex - ab - oprm genes that was similar to the studies reported more than 50% overexpression level of these genes ( 2427 ) . in arabestani study all the isolates ( n=31 ; 100% ) showed overexpression of efflux pump mexab - oprm genes ( 23 ) . according to aghazadeh et al . report , overexpression of mexa was 74% among the isolates ( 28 ) . since the concomitant overproduction of two mex pumps might have additive effects on being resistant to antibiotics ( 29 ) evaluating the co - expression of multi - component efflux pumps other than mexab - oprm is recommended . development of novel antibiotics that can bypass the effects of efflux pumps is still a challenging task . further studies on involved mechanisms and structure - function association of bacterial efflux systems as well as the interactions between the pumps and other resistance mechanisms are highly recommended .

background and objectives : pseudomonas aeruginosa ( pa ) is one of the most important causes of nosocomial infections and has an intrinsic resistance to many antibiotics . among all the resistance - nodulation - division ( rnd ) pumps of p. aeruginosa , mexab - oprm is the first efflux pump found to target multiple classes of antibiotics . this study was aimed to evaluate the expression level of genes expressing mexab - oprm in clinical isolates of p. aeruginosa.materials and methods : in this study , 45 p. aeruginosa strains were isolated from patients admitted to children s medical center hospital , an iranian referral hospital . disk diffusion and minimum inhibitory concentration ( mic ) methods were used for determination of the patterns of resistance to antibiotics . real - time pcr was used to investigate the expression level of genes of mexab - oprm efflux pump.results:among 45 resistant pa isolates , the frequency of genes overexpression was as follows : mexa ( n=25 , 55.5% ) , mexb ( n=24 , 53.3% ) and oprm ( n=16 , 35.5% ) . in addition , in 28 strains ( 62% ) overexpression was observed in one of the studied three genes of mexab - oprm efflux pump.conclusion:in our study 28 isolates ( 62% ) had increased expression level of efflux pumps genes , mexab - oprm . although the efflux pumps play important roles in increasing the resistance towards different antibiotics but the role of other agents and mechanisms in evolution of resistance should not be ignored . since the concomitant overproduction of other mex efflux systems might have additive effects on antibiotic resistance , the co - expressing of a multicomponent efflux pump is recommended . on the other hand , the concomitant overproduction of two mex pumps might have additive effects on resistance to antibiotic . therefore co - expressing of mex efflux systems is recommended .

INTRODUCTION MATERIALS AND METHODS Bacterial strains. Antimicrobial susceptibility tests. Isolation of total RNA and cDNA synthesis for RT-PCR. PCR reaction. Real-time PCR reaction. RESULTS Demographic data. Antibacterial susceptibility testing. PCR and Real-time PCR. DISCUSSION CONCLUSION

severe sepsis and septic shock are common causes of mortality and morbidity in an intensive care unit ( icu ) setting . the endotoxin ( lipopolysaccharide [ lps ] ) derived from the outer membranes of gram - negative bacteria is considered a major factor in the pathogenesis of sepsis . the toll - like receptor ( tlr ) family can be found in mammalian cells . endotoxins transduce their signal through the tlr4 transmembrane receptor , and innate immune cascades are initiated , which promote excessive cytokine release and tissue damage . the endotoxin level is associated with clinical outcome and higher activity correlates with greater icu mortality . therapeutic strategies aimed at minimizing or preventing the action of endotoxins are , therefore , attractive . however , the blockage of an endotoxin via binding with monoclonal antibodies has failed to improve outcome in clinical studies . the reduction of endotoxin levels or blockage of endotoxins can potentially interrupt the biological cascade of sepsis . polymyxin b ( pmx ) is an antibiotic agent that has strong gram - negative bactericidal activity and carries very high affinity for endotoxins . intravenous ( iv ) administration of pmx has significant nephrotoxicity and neurotoxicity , which has limited its clinical use . pmx can be immobilized covalently on polystyrene - based carrier fibers which preserve its endotoxin binding capacity without producing toxicity . a pmx immobilized fiber column was shown to improve blood pressure , oxygenation and mortality in patients with severe sepsis . the alteco endotoxin hemoadsorber ( alteco medical ab , lund , sweden ) is a similar device with strong endotoxin - binding capacity . during the treatment , we performed this randomized controlled trial ( rct ) in patients who suffered from septic shock due to intra - abdominal sepsis . we hypothesized that alteco endotoxin hemoadsorption may provide extraclinical benefit in terms of faster organ function improvement and hemodynamic stabilization when compared with conventional treatment . this prospective rct was approved by the institution 's ethics committee and registered with australian new zealand clinical trials registry ( anzctr , actrn12610000892011 ) . the study was conducted in the adult icu of pamela youde nethersole eastern hospital , which is a 2300-bed acute care tertiary hospital that provides comprehensive care , except for cardiothoracic surgery , transplant surgery , and burns . the icu is a 22-bed closed mixed medical - surgical unit with an average admission of 1400 patients / year . we enrolled patients who fulfilled the following inclusion criteria : ( 1 ) age 18 and 85 years old ; ( 2 ) presence of severe sepsis due to intra - abdominal infection where severe sepsis was defined using the american college of chest physicians / society of critical care medicine / european society of intensive care medicine criteria ; ( 3 ) presence of shock with mean arterial pressure ( map ) 65 mmhg ; ( 4 ) requirement of vasopressor support ( noradrenaline 0.2 g / kg / min or equivalent ) ; and ( 5 ) on hydrocortisone 200 - 300 mg iv / day or equivalent to cover potential relative adrenal insufficiency . exclusion criteria of the study were : pregnancy , terminally ill patients with life expectancy 3 months , hypersensitivity to heparin or low molecular heparin or any component of the formulation , known history of heparin - induced thrombocytopenia ; severe thrombocytopenia ( < 50,000/mm ) , uncontrolled active bleeding except when due to disseminated intravascular coagulation , and inclusion in other icu studies . informed consent was obtained from patients directly . for those with impaired consciousness due to underlying illness or the use of sedatives block randomization was performed using a computer generated scheme , and the allocation sequence was concealed in sealed envelopes which were available 24 h a day in the icu . the control group ( cg ) received conventional therapy for septic shock , namely : infective sources control , early appropriate antibiotics , fluid challenge and vasopressor infusion , and lung protected ventilatory strategy based on surviving sepsis campaign guidelines . continuous renal replacement therapy ( crrt ) in the form of citrate - based postdilution continuous venovenous hemofiltration using polysulfone high flux hemofilter ( f 80 , fresenius medical care , germany ) was provided in the presence of acute kidney injury categorized as injury or more based on risk , injury , failure , loss , and end - stage ( rifle ) criteria . treatment group ( tg ) ( endotoxin hemoadsorption group ) received endotoxin hemoadsorption in addition to conventional therapy . a double lumen 12-f hemodialysis catheter ( arrowguard blue plus antimicrobial catheter , arrow international inc . , usa ) was inserted into either the internal jugular or femoral vein for vascular access by the attending intensivists / physicians immediately after randomization . endotoxin hemoadsorption was performed with alteco endotoxin hemoadsorber using ak10 machine ( gambro - hospal , stockholm , sweden ) at a blood flow rate of 120 - 150 ml / h . each patient received two 2-hourly sessions of hemoadsorption 24 h apart . low molecular weight heparin ( lmwh ) was used for anticoagulation at the discretion of the treating physician , with tinzaparin 1000 iu iv as the default dosage . crrt was started in - between two sessions of hemoadsorption and afterwards based on the same starting criteria for cg if necessary . disease severity and prognosis were assessed with acute physiology and chronic health evaluation ( apache ) iv score . clinical parameters and laboratory data were recorded at 0 , 24 , 48 , and 72 h of randomization . dosage of vasopressor was expressed as vasopressor score ( vs ) using the formula : ( dopamine dose 1 ) + ( dobutamine dose 1 ) + ( adrenaline dose 100 ) + ( noradrenaline dose 100 ) + ( phenylephrine dose 100 ) , wherein all doses are expressed as g / kg / min . dose - response relationship between vasopressor and blood pressure was expressed as vasopressor dependency index ( vdi ) and was calculated using the formula : vs / map . primary end point was the change of the sofa score from 0 to 72 h of randomization . secondary end points included changes of vs , vdi , pao2/fio2 ratio , icu length of stay ( los ) , hospital los , and 28-day mortality . sample size was estimated based on previous study findings . with the power of 80% , type i error probability of 0.05 , mean sofa score difference of 2 , standard deviation of 1.5 , the estimated sample size was 20 . univariate analysis was performed using fisher 's exact test for categorical data or mann - whitney u - test for continuous data where appropriate . the analysis was performed by the statistical package for social sciences for windows , version 16.0 ( spss , chicago , il , united states ) . this prospective rct was approved by the institution 's ethics committee and registered with australian new zealand clinical trials registry ( anzctr , actrn12610000892011 ) . the study was conducted in the adult icu of pamela youde nethersole eastern hospital , which is a 2300-bed acute care tertiary hospital that provides comprehensive care , except for cardiothoracic surgery , transplant surgery , and burns . the icu is a 22-bed closed mixed medical - surgical unit with an average admission of 1400 patients / year . we enrolled patients who fulfilled the following inclusion criteria : ( 1 ) age 18 and 85 years old ; ( 2 ) presence of severe sepsis due to intra - abdominal infection where severe sepsis was defined using the american college of chest physicians / society of critical care medicine / european society of intensive care medicine criteria ; ( 3 ) presence of shock with mean arterial pressure ( map ) 65 mmhg ; ( 4 ) requirement of vasopressor support ( noradrenaline 0.2 g / kg / min or equivalent ) ; and ( 5 ) on hydrocortisone 200 - 300 mg iv / day or equivalent to cover potential relative adrenal insufficiency . exclusion criteria of the study were : pregnancy , terminally ill patients with life expectancy 3 months , hypersensitivity to heparin or low molecular heparin or any component of the formulation , known history of heparin - induced thrombocytopenia ; severe thrombocytopenia ( < 50,000/mm ) , uncontrolled active bleeding except when due to disseminated intravascular coagulation , and inclusion in other icu studies . informed consent was obtained from patients directly . for those with impaired consciousness due to underlying illness or the use of sedatives block randomization was performed using a computer generated scheme , and the allocation sequence was concealed in sealed envelopes which were available 24 h a day in the icu . the control group ( cg ) received conventional therapy for septic shock , namely : infective sources control , early appropriate antibiotics , fluid challenge and vasopressor infusion , and lung protected ventilatory strategy based on surviving sepsis campaign guidelines . continuous renal replacement therapy ( crrt ) in the form of citrate - based postdilution continuous venovenous hemofiltration using polysulfone high flux hemofilter ( f 80 , fresenius medical care , germany ) was provided in the presence of acute kidney injury categorized as injury or more based on risk , injury , failure , loss , and end - stage ( rifle ) criteria . treatment group ( tg ) ( endotoxin hemoadsorption group ) received endotoxin hemoadsorption in addition to conventional therapy . a double lumen 12-f hemodialysis catheter ( arrowguard blue plus antimicrobial catheter , arrow international inc . , usa ) was inserted into either the internal jugular or femoral vein for vascular access by the attending intensivists / physicians immediately after randomization . endotoxin hemoadsorption was performed with alteco endotoxin hemoadsorber using ak10 machine ( gambro - hospal , stockholm , sweden ) at a blood flow rate of 120 - 150 ml / h . each patient received two 2-hourly sessions of hemoadsorption 24 h apart . low molecular weight heparin ( lmwh ) was used for anticoagulation at the discretion of the treating physician , with tinzaparin 1000 iu iv as the default dosage . crrt was started in - between two sessions of hemoadsorption and afterwards based on the same starting criteria for cg if necessary . disease severity and prognosis were assessed with acute physiology and chronic health evaluation ( apache ) iv score . clinical parameters and laboratory data were recorded at 0 , 24 , 48 , and 72 h of randomization . dosage of vasopressor was expressed as vasopressor score ( vs ) using the formula : ( dopamine dose 1 ) + ( dobutamine dose 1 ) + ( adrenaline dose 100 ) + ( noradrenaline dose 100 ) + ( phenylephrine dose 100 ) , wherein all doses are expressed as g / kg / min . dose - response relationship between vasopressor and blood pressure was expressed as vasopressor dependency index ( vdi ) and was calculated using the formula : vs / map . primary end point was the change of the sofa score from 0 to 72 h of randomization . secondary end points included changes of vs , vdi , pao2/fio2 ratio , icu length of stay ( los ) , hospital los , and 28-day mortality . sample size was estimated based on previous study findings . with the power of 80% , type i error probability of 0.05 , mean sofa score difference of 2 , standard deviation of 1.5 , the estimated sample size was 20 . univariate analysis was performed using fisher 's exact test for categorical data or mann - whitney u - test for continuous data where appropriate . the analysis was performed by the statistical package for social sciences for windows , version 16.0 ( spss , chicago , il , united states ) . this prospective rct was approved by the institution 's ethics committee and registered with australian new zealand clinical trials registry ( anzctr , actrn12610000892011 ) . the study was conducted in the adult icu of pamela youde nethersole eastern hospital , which is a 2300-bed acute care tertiary hospital that provides comprehensive care , except for cardiothoracic surgery , transplant surgery , and burns . the icu is a 22-bed closed mixed medical - surgical unit with an average admission of 1400 patients / year . we enrolled patients who fulfilled the following inclusion criteria : ( 1 ) age 18 and 85 years old ; ( 2 ) presence of severe sepsis due to intra - abdominal infection where severe sepsis was defined using the american college of chest physicians / society of critical care medicine / european society of intensive care medicine criteria ; ( 3 ) presence of shock with mean arterial pressure ( map ) 65 mmhg ; ( 4 ) requirement of vasopressor support ( noradrenaline 0.2 g / kg / min or equivalent ) ; and ( 5 ) on hydrocortisone 200 - 300 mg iv / day or equivalent to cover potential relative adrenal insufficiency . exclusion criteria of the study were : pregnancy , terminally ill patients with life expectancy 3 months , hypersensitivity to heparin or low molecular heparin or any component of the formulation , known history of heparin - induced thrombocytopenia ; severe thrombocytopenia ( < 50,000/mm ) , uncontrolled active bleeding except when due to disseminated intravascular coagulation , and inclusion in other icu studies . informed consent was obtained from patients directly . for those with impaired consciousness due to underlying illness or the use of sedatives block randomization was performed using a computer generated scheme , and the allocation sequence was concealed in sealed envelopes which were available 24 h a day in the icu . the control group ( cg ) received conventional therapy for septic shock , namely : infective sources control , early appropriate antibiotics , fluid challenge and vasopressor infusion , and lung protected ventilatory strategy based on surviving sepsis campaign guidelines . continuous renal replacement therapy ( crrt ) in the form of citrate - based postdilution continuous venovenous hemofiltration using polysulfone high flux hemofilter ( f 80 , fresenius medical care , germany ) was provided in the presence of acute kidney injury categorized as injury or more based on risk , injury , failure , loss , and end - stage ( rifle ) criteria . treatment group ( tg ) ( endotoxin hemoadsorption group ) received endotoxin hemoadsorption in addition to conventional therapy . a double lumen 12-f hemodialysis catheter ( arrowguard blue plus antimicrobial catheter , arrow international inc . , usa ) was inserted into either the internal jugular or femoral vein for vascular access by the attending intensivists / physicians immediately after randomization . endotoxin hemoadsorption was performed with alteco endotoxin hemoadsorber using ak10 machine ( gambro - hospal , stockholm , sweden ) at a blood flow rate of 120 - 150 ml / h . each patient received two 2-hourly sessions of hemoadsorption 24 h apart . low molecular weight heparin ( lmwh ) was used for anticoagulation at the discretion of the treating physician , with tinzaparin 1000 iu iv as the default dosage . crrt was started in - between two sessions of hemoadsorption and afterwards based on the same starting criteria for cg if necessary . disease severity and prognosis were assessed with acute physiology and chronic health evaluation ( apache ) iv score . clinical parameters and laboratory data dosage of vasopressor was expressed as vasopressor score ( vs ) using the formula : ( dopamine dose 1 ) + ( dobutamine dose 1 ) + ( adrenaline dose 100 ) + ( noradrenaline dose 100 ) + ( phenylephrine dose 100 ) , wherein all doses are expressed as g / kg / min . dose - response relationship between vasopressor and blood pressure was expressed as vasopressor dependency index ( vdi ) and was calculated using the formula : vs / map . primary end point was the change of the sofa score from 0 to 72 h of randomization . secondary end points included changes of vs , vdi , pao2/fio2 ratio , icu length of stay ( los ) , hospital los , and 28-day mortality . sample size was estimated based on previous study findings . with the power of 80% , type i error probability of 0.05 , mean sofa score difference of 2 , standard deviation of 1.5 , the estimated sample size was 20 . univariate analysis was performed using fisher 's exact test for categorical data or mann - whitney u - test for continuous data where appropriate . the analysis was performed by the statistical package for social sciences for windows , version 16.0 ( spss , chicago , il , united states ) . this study was terminated early by the monitoring committee as an interim analysis could not identify any significant clinical benefit . from february 2010 to june 2012 , 15 patients were recruited ( seven in the lps hemoadsorption group and eight in the cg ) . all patients except one from cg yielded gram - negative bacteria from saved microbiological culture specimens . among them , klebsiella species were the most commonly isolated organisms ( total 40% , tg vs. cg = 29% vs. 50% ) , followed by escherichia coli ( total 33% , tg vs. cg = 29% vs. 38% ) . multiple bacteria were isolated from 27% of cases ( tg vs. cg = 29% vs. 25% ) . adequate , appropriate initial antibiotic coverage ( based on subsequent microbial sensitivity pattern ) were given to 93% of patients within 24 h of recruitment ( tg vs. cg = 86% vs. 100% ) . sofa score showed more obvious improvement among cg group at 48 h and 72 h , but this was not statistically significant [ table 2 ] . both groups showed decreased use of vasopressor over time , but the improvement did not differ between groups . improvement of oxygenation was more obvious among the tg group but did not reach statistical significance . continuous veno - venous hemofiltration was given in all tg patients and 63% of cg patients . for those icu survivors ( six from treatment and control arm respectively ) , no patient required dialysis support within 1 and 3 months after recruitment . concerning the adverse events during alteco endotoxin hemoadsorption , severe thrombocytopenia ( platelet count < 20 10 /mm ) occurred in one patient but no bleeding event was reported . transient hypotension ( map 60 mmhg ) occurred in one patient during the initiation of the first endotoxin hemoadsorption , who required increased vasopressor support . to our best knowledge , the current study is the first rct to investigate the therapeutic effect of this new endotoxin hemoadsorption device ( alteco endotoxin hemoadsorber , alteco medical ab , lund , sweden ) in gram - negative septic shock patients . unfortunately , the study was terminated early by the monitoring committee as an interim analysis showed a low probability of significant findings . extracorporeal blood purification as a treatment for sepsis consists of multiple treatment modalities ; these either targeted inflammatory mediators or bacterial toxins like endotoxins or both . crrt is commonly performed in icu settings for patient with septic acute kidney injury . however , the use of low or normal volume continuous venovenous hemodialysis or hemofiltration failed to demonstrate an improvement of patient outcomes in severe sepsis . high volume hemofiltration ( hvhf ) or pulse hvhf removed cytokines effectively , and initial study showed promising results . however , recently published ivoire study could not identify any significant mortality nor organ function benefit when compared with standard volume hemofiltration . moreover , hvhf incurred an increase of nursing workload ( especially without the use of online treatment modality ) , higher treatment cost due to the use of large volumes of replacement fluid and potential electrolytes / drug concentration disturbances . hemodialysis or hemodiafiltration using high cutoff membrane offers a good cytokine clearance , but significant albumin loss , together with albumin - bound drugs are the key problem which require particular attention . coupled plasma filtration adsorption is a relatively investigational tool , although initial experiences were impressive . hemoperfusion with cytokines and/or endotoxin hemoadsorption columns require simple set up and equipment , which is more feasible in an icu setting . nowadays , there are three different methods for endotoxin hemoadsorption in septic shock which have more clinical experience . pmx immobilized fiber column hemoperfusion ( toraymyxin , toray industries , tokyo , japan ) is the most commonly used device . this device has been used for the treatment of septic shock since 1994 in japan and since 2002 in europe . it has gained popularity worldwide in recent years , especially after the euphas ( early use of pmx b hemoperfusion in abdominal sepsis ) study . a recent meta - analysis by mitaka clearly showed that pmx hemoperfusion treatment had significant beneficial effects on patient hemodynamics , pulmonary oxygenation , and mortality . endotoxins may also be bound to an adsorber contained albumin ( matisse , fresenius medical care , bad homburg , germany ) . trends in the improvement of morbidity and organ dysfunction were found in initial nonrandomized studies . however , a subsequent multicenter rct could not identify any significant clinical benefit , which then limited its clinical use . endotoxin capture by specially designed synthetic peptides is another method ( alteco endotoxin hemoadsorber , alteco medical ab , lund , sweden ) . it is a class iia medical extracorporeal device consisting of a rigid porous matrix which can significantly increase its blood contact area . tailor - made synthetic peptides with a high affinity for endotoxins are connected to the surface of the polyethylene plates with a covalent bonding technique . the clinical experience for this device is scarce and is limited to case reports and case series . showed that the duration of noradrenaline infusion was significantly shorter in adsorber - treated patients compared to controls ( p = 0.03 ) . in our study , vasopressor use decreased nicely in adsorber - treated patients but this also occurred in control patients . compared with the study by ala - kokko et al . , our study cases were older ( 75 vs. 60 years old ) , had more significant organ failure as expressed by sofa score ( 13 vs. 9 ) , were on huge doses of vasopressor ( vs 50.5 vs. 11.1 ) and had much higher predicted mortality ( 65% vs. 27% ) . these findings also apply when compared with pmx hemoperfusion - treated patients in the euphas study . which indicated that our adsorber - treated cases were much sicker . by closely examining the difference between the adsorber - treated patients and the controls , we noted that the control cases had faster organ recovery as expressed by a more rapid drop in sofa score , less vasopressor use , better oxygenation improvement , and lower icu length of stay . although there was no statistically significant difference due to the small sample size , the apache iv score predicted mortality rate was much higher in adsorber - treated patients compared with controls , which may provide a good explanation on the discrepancy in clinical outcome parameters . it is possible that with such severe cases , the addition of endotoxin hemoadsorption offered no further clinical benefit when compared with standard intensive care , although suboptimal organ support or ineffective endotoxin removal could be other reasons for this . concerning the first alternative ( suboptimal organ support ) , the standardized mortality ratio by apache iv risk of death for the adsorber - treated patients was 0.7 which was fair ; this indicated that suboptimal care was less likely . for the second reason , due to great difficulty in sourcing a quantitative endotoxin assay and limited funding , no endotoxin assay was performed . therefore , we could not be sure that the patients had adequate endotoxin removal during hemoadsorption . concerning the side effects of alteco endotoxin hemoadsorption , ala - kokko et al . in fact , thrombocytopenia ( platelet count < 150 10 /mm ) occurred in all adsorber - treated patients but only one case suffered from severe thrombocytopenia ( platelet count < 20 10 /mm ) . no bleeding event was noted , and no platelet transfusion was given . in the case this may be related to the fact that we used lmwh for anticoagulation instead of unfractionated heparin ( ufh ) used in ala - kokko et al . the pharmacokinetics of lmwh are more predictable than ufh , which may be more obvious in septic patients . transient hypotension occurred once and required an increase in vasopressor support , but no arrhythmia was documented , as in the cases reported by ala - kokko et al . the sample size was estimated based on previous studies , but early termination of this study further limited its power . given that there are early reports on the effectiveness of hemoadsorption technique on treatment of septic shock , this negative study could offer readers information on patient 's clinical response and side effect profile of this novel device . for this single - center study , case recruitment proved to be quite difficult as the endotoxin hemoadsorption technique was a new treatment option in our locality . recruitment rate was slow and multiple center collaboration could be the only means to resolve this issue . an endotoxin activity assay ( eaa ) was not performed in our study , similar to the landmark euphas study , due to the unavailability of the point - of - care testing device in our locality . although endotoxin activity reflects the severity of illness in critically ill septic shock patients , its prognostic value is poor . we believed that the availability of eaa result should be a bonus but not a must for this study . however , in order to minimize potential error on cases recruitment , we targeted only those suffering from intra - abdominal sepsis with shock . so far , the microbiological findings have yielded gram - negative bacteria in almost all of the recruited cases . finally , blinding was not possible for this study and may have contributed to further bias . we could not identify any clinical benefit on the addition of alteco endotoxin hemoadsorption to conventional therapy in patients who suffered from intra - abdominal sepsis with shock . the side effect profile of this device was acceptable . given that there are early reports on the effectiveness of hemoadsorption technique on treatment of septic shock , larger multicenter study is indicated to further investigate the potential benefit or drawback of this novel device .

background and aims : severe sepsis and septic shock are common causes of mortality and morbidity in an intensive care unit setting . endotoxin , derived from the outer membranes of gram - negative bacteria , is considered a major factor in the pathogenesis of sepsis . this study investigated the effect of alteco endotoxin hemoadsorption device on gram - negative septic shock patients.materials and methods : an open , controlled , prospective , randomized , single - center trial was conducted between february 2010 and june 2012 . patients with septic shock due to intra - abdominal sepsis were randomized to either conventional therapy ( n = 8) or conventional therapy plus two 2-hourly sessions of alteco endotoxin hemoadsorption ( n = 7 ) . primary endpoint was the sequential organ failure assessment ( sofa ) score changes from 0 to 72 h. secondary end points included vasopressor requirement , pao2/fio2 ratio ( pfr ) , length of stay ( los ) , and 28-day mortality.results:this study was terminated early as interim analysis showed a low probability of significant findings . no significant difference was noted between the two groups with respect to change in sofa score , vasopressor score , pfr , los , and 28-day mortality . side - effect was minimal.conclusions:we could not identify any clinical benefit on the addition of alteco endotoxin hemoadsorption to conventional therapy in patients who suffered from intra - abdominal sepsis with shock . the side effect profile of this novel device was acceptable .

Introduction Materials and Methods None Patients Randomization and interventions Follow-up and data collection Statistical analysis Results Discussion Conclusion

a recent report published by the american association of colleges of nursing ( aacn ) noted that over 67,000 qualified applicants were not accepted into baccalaureate and graduate nursing programs in the usa in 2010 . the report also noted that almost two - thirds of the nursing schools participating in the survey noted that faculty shortage is the primary reason for not accepting all qualified applicants into baccalaureate programs . the consequence of a nursing shortage is nurses work longer hours under stressful conditions , which leads to nurses being more prone to making mistakes and medical errors . schools of nursing are increasingly using hospital - based nurses to precept students during clinical rotations . these nurse preceptors extend the faculty at a time when a shortage of nursing faculty limits nursing school enrollment . combined with initiatives already in place , such as using master 's prepared nurses at the hospital as loaned faculty , compressing students ' clinical rotations and assigning clinical rotations to off - shifts or , in less popular nursing units , using nurse preceptors as clinical faculty helps in two ways : it increases the number of available clinical nursing slots and it provides qualified clinical instructors . as little quantitative research on the effectiveness of using preceptors as clinical instructors early in a nursing program has been reported , this study looks at the question given baccalaureate students in their second medical - surgical class , do precepted students perform as academically well as traditionally prepared students ? clinical groups in texas traditionally have a ratio of one master 's prepared instructor to 10 students . the instructor 's role is to monitor students in the clinical setting and instruct them in meeting their educational learning objectives . when class size is extended to increase enrollment , procuring a sufficient number of qualified clinical instructors is often difficult . that nurses qualified for teaching can make higher salaries working as a nurse in a hospital than as faculty in a university exacerbates the faculty shortage problem additionally , as the number of clinical slots dedicated to nursing students is limited , schools in the region compete with each other . students often demand accessible and timely information , and they want flexibility to meet their needs of working , studying , and raising a family . the younger students rely heavily on technology for learning , entertainment , and life scheduling . students precepted one - on - one with registered nurses ( rn ) in hospital settings are more likely to find their needs met than is possible under a traditional group model , which permits less interaction between faculty and student , limits student opportunities for learning and skills practice , and provides an inaccurate view of the profession [ 4 , 5 ] . according to the texas board of nurse examiners , master 's prepared faculty can oversee the teaching activities of 12 rn preceptors , each of whom can supervise two undergraduate students . using preceptors as clinical faculty alternatives more than doubles the number of students ( n = 12 2 = 24 ) than can be placed in traditional clinical rotations ( n = 10 ) . the policy established by the texas board of nursing states that a precepted student must be visited by a faculty member at least once a month . faculty conducting the study rounded on precepted students at least twice a month since the students were early in their nursing program . hospital - based clinical preceptors , as alternatives to clinical faculty , expect adequate support to function within the educator role . according to yonge and myrick , preparation of preceptors includes teaching educational principles that help prepare the preceptors beyond their usual staff nurse orientation . wilkes et al . identified that continued support materials , beyond orientation , were essential to success . using hand - held computers allows preceptors to obtain support at the bedside when time is at a premium and desktop services are not available . the use of hand - held computers with internet access is an effective way for preceptors to obtain information , such as faculty contact information , school policies , and student clinical schedules , prepare anecdotal notes , and search for useful clinical information [ 12 , 13 ] . use of the precepting alternative also frees up additional nurses and hospital units for clinical training ; nurses on smaller units not able to support a traditional group of 10 students could precept one - on - one and nurses working off - shifts can serve as preceptors . students participating in precepted groups find that they have more scheduling flexibility , greater opportunities for learning and practicing skills , and more relevant learning experiences . to prepare the nurses for the preceptor role , the researchers developed a 14-module online preceptor education course . the module units , listed in table 1 , were designed to provide direction on teaching students as adult learners and to promote critical thinking in nursing students . the project team , including faculty and hospital educators , attended the preceptors ' presentations to offer technical training and support . upon completion of the preceptor training , nurses received 9.6 continuing education units . having blackboard access also gave the rn preceptors access to the students ' course materials , including syllabi and lecture notes , which permitted the rn preceptors to provide clinical experiences that met the learning objectives and to keep pace with the students learning progression . as nurses traditionally work with new hire graduates and not students in their second semester of nursing education , it was important that preceptors knew that these students would not perform at the same level as a new graduate nurse . technology assisted in permitting continuous availability of faculty and in forming a communication net for students , preceptors , and faculty . communication was via a dedicated web page , e - mail , cellular phones , traditional pagers , and handheld computers . preceptors working at the bedside could communicate with nursing faculty in the office . using the handheld computers , preceptors had a rapid means of access to relevant nursing and drug information while they were working with the students . in addition , the research faculty and project staff developed a project - specific website to provide quick access to contact information , school policies , performance issue information , tips and topics , and links for emergencies and needle sticks . the website was a resource for preceptors and students whether the students were precepted during school hours or on off - shifts . both preceptors and students could rapidly locate faculty contact information or receive technical support 24 hours a day . this was necessary as the precepted students worked the schedule their preceptor worked , whether this was a day , night , or weekend shift . e - mail group links permitted communication to the project staff and the control and experimental student groups . the availability of student performance information and school policies assisted preceptors to take appropriate action in addressing student attendance , dress and appearance , safety , and professionalism issues . using blackboard to deliver the education course online permitted the rn preceptors to complete the training at their convenience since the students worked all shifts , discussion boards were set up to support communication and submission of assignments . nursing faculty moderated the discussion postings and responded accordingly . additionally , faculty and hospital educators periodically made rounds when students were scheduled to be with their preceptors to stay in contact , answer questions , and provide support . the use of technology helped to decrease preceptor resistance in precepting students without the instructor being present and increased faculty assurance in the quality and relevance of the preceptors teaching . the students had to complete a total of 96 hours in the clinical setting and were permitted to work between 8 and 24 hours per week . for faculty to keep track of student schedule and hours , students posted their clinical schedule at least 48 hours prior to working with their preceptor . faculty held weekly post - clinical conferences with students at the school to answer questions and reinforce learning objectives . however , faculty were available to the students and preceptors by cellular phone twenty - four hours a day . the study used a quasi - experimental design where students ( n = 69 ) were randomly assigned to a control group ( traditional clinical group ) or experimental group ( precepted group ) . the subjects were in the second semester of their nursing education , and instruction that semester included pharmacology , gerontology , pathophysiology , and the second medical - surgical nursing course . both experimental and control students volunteering to participate in the study submitted an informed consent form in accordance with the university 's institutional review board policy . for experimental and control groups , the student 's accumulative numerical course grade in medical - surgical course 1 ( taken in the first semester ) was used as an independent variable . the dependent variables were students ' numerical grades on unit examinations given throughout the semester , comprehensive final examination grades , and accumulative numerical course grades in both the medical - surgical course 2 and the corequisite pharmacology course . both experimental and control students took a standardized medical - surgical exam . although scores earned on exams administered to measure what the student learned in the classroom does not have established reliability and validity for measuring clinical performance , issues surrounding clinical evaluation exist . some of the identified issues pertinent to this study include the subjectivity of the evaluation especially when using novice clinical faculty . novice faculty ( bedside nurses serving as preceptors ) may have limited formal education and experience in evaluation of students and often lack confidence in their ability to fairly evaluate students [ 16 , 17 ] . using a grading rubric , two faculty members on the research team reviewed the precepted student 's nursing process papers at weeks 4 , 8 , and 12 and recorded these grades . to increase interrater reliability , the two researchers critiqued one student 's paper prior to week 4 to standardize scoring . a clinical evaluation form was developed for preceptor use ( table 1 in supplementary material available online at doi:10.1155/2012/276506 ) . after each 12-hour shift , the preceptor evaluated the student 's clinical performance and faxed the form to the research team . if a student is consistently scoring 2 or less on the evaluation , the faculty meets with the preceptor to discuss the weaknesses of the student . faculty would meet with the student as well to discuss strategies for improving their clinical performance . the final clinical evaluation was completed by the faculty and was based on data from the preceptor evaluations , the nursing process paper grades , and the faculty 's impressions when rounding on the student in the hospital . the students were randomized into two groups , experimental or precepted group ( n = 37 ) and control or traditional group ( n = 32 ) . the precepted students were assigned clinical rotations at two tertiary - level hospitals , where they worked one - on - one with a baccalaureate - prepared registered nurse ( rn ) on a medical or surgical unit or a surgical intermediate care unit . as per the request of the two hospitals , precepted students could not work on the days other school of nursing held their traditional clinical . this meant that there was one day a week in which the precepted students could not schedule a clinical day . the control students were mixed within the traditional training groups of 10 students , and these groups were assigned to medical - surgical floors at various local hospitals . the criteria for eligibility were that the rns ( 1 ) have at least one year experience as a registered nurse ; ( 2 ) have a recent satisfactory annual evaluation by their nurse manager ; ( 3 ) have a current bcls and nursing license ; ( 4 ) completed the online preceptor education course ; ( 5 ) graduated from a baccalaureate nursing program . inclusion criteria for students were that they were in their second semester of nursing school and had not previously withdrawn from or failed a class . the students ' final numerical course grade from the first semester medical - surgical course was analyzed using an independent sample t - test to determine whether the first semester grade needed to be used as a co - variant . however , this test showed no significant difference between the experimental and control designated groups . student 2nd semester medical - surgical examination scores ( 4 units and 1 comprehensive final ) were analyzed using a mixed model approach for repeated measures anova . final numerical grades from their pharmacology course and a standardized specialty medical - surgical examination ( hesi ) were analyzed using independent sample t - tests . no significant differences between the experimental and control groups on any measurement were found . for discussion purposes , an implication is that precepted students did as academically well as students in the control group . likewise , this could be stated , as precepted students do no better than traditional students academically despite the one - on - one clinical treatment . given this , the study supports using hospital - based rn nurses as clinical preceptors . using rns as preceptors not only provides much needed clinical faculty but also frees up clinical slots that previously have not been available . the four unit examination grades and the final examination grade were analyzed using a mix model approach for repeated measures anova . there was no statistically significant difference between the precepted and control groups ( f = .936 , df = 63 , p = .449 ) . an independent sample t test was computed to determine if there was a significant difference between precepted and control groups in academic performance as demonstrated by the final course grade students received in their second semester medical - surgical course . students in the traditional clinical group had a mean of 83.7 ( sd = 5.9 ) , and the precepted students had a mean of 83.5 ( sd = 4.6 ) . there was no statistical difference between the two groups ( t = .118 , df = 67 , p = .906 ) . ( hesi , now owned by elsevier ) medical - surgical specialty exam at the end of the semester , this mean score was considered in the analysis . the mean standard score for the traditional students was 784.19 ( sd = 182.5 ) as compared to a mean standard score of 807.76 ( sd = 136.7 ) for the precepted students . however , there was no statistical difference between the two groups ( t = .612 , df = 67 , p = .543 ) . students in the traditional clinical groups usually prepared medication cards the day before each clinical session . as students in the precepted group did not know which patients their preceptor would have until report , they had to take a different approach . they reviewed each medication and presented the information to their preceptor before administering the medication . in analyzing pharmacology final course grades , there was no statistical difference between the two groups ( t = .786 , df = 67 , p = 434 ) . the students in the control group had a mean grade of 89.1 ( sd = 3.8 ) , and the precepted group had a mean of 88.3 ( sd = 4.8 ) . on average , the students in the precepted group received ratings of 35 for the clinical competencies listed on the clinical evaluation form . confident preceptors not only rated the clinical performance , but also provided anecdotal information to justify the given ratings . preceptors did note that the clinical evaluation process was an added responsibility to their busy clinical day . unlike students in the traditional group , precepted students arrived for their shift with no preparatory work in place . the student and their preceptor selected one patient as the student 's primary patient for that shift . although the precepted student was responsible for obtaining the same information as that of a traditional student , the precepted students did this on shift and completed the nursing process papers retrospectively . the faculty found that the quality of the nursing process papers were similar between the precepted and the traditional groups . students in both groups struggled with parts of the nursing diagnosis ( related to statement ) and setting measurable expected outcomes . the precepted students , instructed to turn in their paperwork within a week of completing the shift , tended to fall behind , allowing the paperwork to accumulate . the information technology ( it ) member of the research team worked closely with the two hospitals that participated in the study . the it personnel from the two hospitals and the university had to breech the firewall that existed between institutions . once the two systems were connected , the it member of the research team met with preceptors one - on - one to help them navigate the blackboard site within the university . the it member held mini tutorials to help the preceptors learn how to use their institution 's intranet , access the university 's blackboard site , and navigate the preceptor course . this challenge was not anticipated by the research team and did require additional time not planned in the original proposal . most preceptors had served in the role in the past , orienting new hires on their respective units . one occasion arose where a preceptor placed the student in a dangerous situation ( administering medications without being present ) . the student reported the incident , and working with the institution , the preceptor was replaced with another nurse . although many of the preceptors have mentored new nurses on their units , they had not participated in a formal evaluation process . some preceptors would circle all the same number on the likert scale clinical performance evaluation and would not provide any commentary . the members of the research team would meet with preceptors and ask for a verbal evaluation of the student 's performance . questions asked included an assessment of the student 's ability to perform a focused review of systems and physical exam , knowledge of medications and their administration , and the potential to use the nursing process to plan appropriate care for the patient , for example . reviewing the nursing process papers also provided insights as to how the student was performing in the clinical setting . in the last decade , we have seen an increase in the number of applicants to nursing programs , a decline in the number of nurses in the workforce , and a decline in the number of nurses who pursue a career in academia . with the nursing shortage , demands are made on schools to increase enrollment ; however , with the shortage of nursing faculty , this demand has been difficult to meet . as a barrier to increasing enrollment has been clinical availability , a solution is using nurse preceptors to extend faculty in the clinical setting . this project examined the use of preceptors , supported by training and technology , to facilitate the clinical experience of students in their second semester medical - surgical course . precepting students are not a new concept within nursing ; however , a preceptor support model for students early in their nursing education has not been fully studied . the purpose of the study was to determine whether students who were precepted performed as well as those in a traditional clinical group . as there was no significant difference in performance on grades and hesi scores , the results suggest that from an academic perspective , providing clinical education when using qualified and trained preceptors did not interfere with the student 's ability to master the course content . the quality of the nursing process papers produced by students was deemed to be equal between the two groups . students in both groups were provided feedback on their papers and were asked in equal proportion to resubmit work . as the main problem encountered was the timeliness of the submission of the paperwork , a solution would be to design a mechanism within the computer - scheduling program that locked out students from posting their schedule until all nursing process paperwork was completed .

the shortage of nursing faculty has contributed greatly to the nursing workforce shortage , with many schools turning away qualified applicants because there are not enough faculty to teach . despite the faculty shortage , schools are required to admit more students to alleviate the nursing shortage . clinical groups in which preceptors are responsible for student learning extend faculty resources . purpose . to determine the effectiveness of an alternative clinical experience ( preceptorship ) . methods . quasi - experimental , randomized , longitudinal design . students were randomized to either the traditional or precepted clinical group . the clinical experience was a total of 12 weeks . groups were compared according to several variables including second semester exam scores , hesi scores , and quality and timeliness of clinical paperwork . sample . over a two - year period , seventy - one undergraduate nursing students in the second semester medical - surgical nursing course participated . 36 were randomized to the experimental group . the preceptors were baccalaureate - prepared nurses who have been practicing for at least one year . setting . two hospitals located in the texas medical center . statistical analysis . descriptive statistics and independent t - test . results . there was no difference between the groups on the variables of interest . conclusion . students in the precepted clinical group perform as well as those in a traditional clinical group .

1. Introduction 2. Methodology 3. Results 4. Discussion

ameloblastoma is seen to have a benign appearance on histology , irrespective of its variable clinical behavior . microscopically various patterns have been described ( follicular , plexiform , acanthomatous , papilliferous - keratotic , granular cell type , desmoplastic , vascular , and dentinoameloblastoma).[13 ] majority of patients present in the fourth decade . men are affected slightly more often than female , with a particularly elevated incidence in eastern africa . more than 80% of ameloblastomas arise in the mandible ( mostly angle or ramus ) . they are either primary or secondary soft tissue tumors , the latter appearing after operations . radiologically , ameloblastomas present as unilocular or multilocular translucencies . malignancy in the ameloblastoma has been divided into two distant lesions . a malignant ( metastasizing ) ameloblastoma is diagnosed when a seemingly histologically benign ameloblastoma produces a metastasis resembling the original lesion . ameloblastic carcinoma is an odontogenic tumor having the overall microscopic architectural features of ameloblastoma but in addition having malignant cytological features such as marked nuclear atypia and numerous mitotic figures . in the year 1965 , tsukada et al . two years later , a case of granular cell ameloblastoma with metastasis to cervical vertebrae was reported . we reviewed the literature for any cases of granular cell ameloblastoma with metastasis , which might have been reported from year 1967 until now . to the best of our knowledge a 40-year - old female first reported to the surgery department of safdarjung hospital , new delhi , india . she presented with a disfiguring swelling on the right side of neck of approximately two years duration [ figure 1 ] . roentgenogram of the mandible showed swollen translucent cystic structures reaching from corpus to ramus of the right mandible . excision of zygomatic arch and surrounding soft tissue , masseter muscle , and temporalis muscle along with right parotid , was done . reconstruction was performed using right pectoralis major myofacial flap for buccal mucosal reconstruction and delto pectoral flap with split skin graft for skin defect . two years following surgery , patient 's follow up with x - rays , have not revealed any new lesions . patient with a large abnormal swelling on the right side of face gross examination of the excised specimen showed a well circumscribed large pink tan growth measuring 7.5 5 4 cm in the region of the mandible . tumor cells formed nests supported by fibrous connective tissue stroma [ figure 2 ] . at the periphery of the nests , the inner cell mass showed round to polygonal cells with abundant granular cytoplasm and small pyknotic nuclei [ figure 4 ] . one lymph node showed tumor metastasis characterized by the presence of granular cells [ figure 5 ] . ( h and e , 200 ) cells displaying cytoplasmic granularity with pyknotic nuclei , some of which are eccentric . ( h and e , 400 ) metastasis in lymph node showing tumor cells with granular cytoplasm . gross examination of the excised specimen showed a well circumscribed large pink tan growth measuring 7.5 5 4 cm in the region of the mandible . tumor cells formed nests supported by fibrous connective tissue stroma [ figure 2 ] . at the periphery of the nests , the inner cell mass showed round to polygonal cells with abundant granular cytoplasm and small pyknotic nuclei [ figure 4 ] . one lymph node showed tumor metastasis characterized by the presence of granular cells [ figure 5 ] . ( h and e , 200 ) cells displaying cytoplasmic granularity with pyknotic nuclei , some of which are eccentric . ( h and e , 400 ) metastasis in lymph node showing tumor cells with granular cytoplasm . the tumor is made up of proliferating odontogenic epithelium especially of enamel organ - type tissue that has not undergone differentiation to the point of hard tissue formation . it has been postulated that the epithelium of origin is derived from one of the following sources : ( 1 ) epithelial lining of odontogenic cyst , ( 2 ) dental lamina or enamel organ , ( 3 ) disturbances of developing enamel organ , ( 4 ) basal cells of surface epithelium , or ( 5 ) heterotopic epithelium of other parts of the body . our patient presented with a metastasis of granular cell ameloblastoma at the first instance , giving a brief history of 2 years . most common sites of metastasis are lung ( 76.7% ) , followed by regional lymphnodes ( 37.8% ) , pleura ( 16.2% ) , vertebrae ( 13.5% ) , skull ( 10.8% ) , diaphragm ( 8.1% ) , liver and parotid ( 5.4% ) and even more rarely , the spleen and kidney . granular cells of granular cell ameloblastoma are clearly of epithelial origin staining exclusively for cytokeratin . the term granular cell ameloblastic fibroma is a misnomer , as a number of these cases are probably central odontogenic fibromas exhibiting granular cell change . ultrastructurally it has been revealed that it is the lysosomal overload in these cells that imparts the characteristic granularity . whether granular cell change in ameloblastoma is a degenerative process or a harbinger of a more aggressive course is a matter of debate . all three cases of granular cell ameloblastoma ( our case included ) have eventually produced metastasis . add to this , our patient gave a short history of duration before tumor metastasis . although the exact implication of a granular cell change in ameloblastoma can not be ascertained due to paucity of cases documented , yet reported cases must be followed closely in anticipation of metastasis .

ameloblastoma is a slow growing odontogenic epithelial tumor of jaw . it accounts for 1% of all tumors and cysts arising in maxilla and mandible . although it is locally invasive and has a marked tendency to recur , metastasis is rare . of the various histological patterns of ameloblastoma , the granular cell type is extremely rare accounting for 4% of ameloblastomas . we report a case of granular cell ameloblastoma with metastasis to the cervical lymph node presenting in a 40-year - old indian female .

INTRODUCTION CASE REPORT Pathological findings DISCUSSION CONCLUSION

mesenteric and omental mesothelial cysts are responsible for only 1 in 100,000 of adult hospital admissions , and are thus left low on the list of differential diagnoses for abdominal pain . further evaluation of such masses is first directed at determining a tissue origin if possible . lymphangioma accounts for the most commonly reported of such lesions , followed by enteric cyst , enteric duplication cyst , non - pancreatic pseudocyst , and mesothelial cyst . gastrointestinal leiomyomas ( cystic spindle cell tumors ) in particular have been reported to undergo central liquefactive necrosis and hemorrhage , appearing as cystic mesenteric or omental lesions on imaging . the pathogenesis of a mesothelial cyst involves failed coalescence of mesothelial - lined surfaces , typically involving the small bowel , mesentery , or mesocolon . imaging usually demonstrates a fluid - filled cavity without a readily identifiable wall . unlike lymphangiomas , however , given the overlapping features of such cystic intra - abdominal masses on imaging , definitive diagnosis is made on thorough histopathologic analysis of the resected specimen . a 41 year - old male presented to our emergency department with periumbilical abdominal pain and associated intermittent nausea and vomiting of several days duration . medical history was significant only for hypertension , and he was noted to have had prior appendectomy and posterior spinal fusion . physical examination revealed an obese abdomen with localized tenderness to palpation over the mid - abdomen without peritoneal signs . initial emergency department laboratory workup included cbc and cmp , which revealed a hypokalemic hypochloremic metabolic alkalosis . this patient was admitted to the general surgery service and treated conservatively with iv rehydration and empiric antibiotics . accounting for his chronic diarrhea , chief differential diagnosis at that time included sclerosing mesenteritis , small bowel diverticulitis , and small bowel carcinoid tumor . 5-hiaa , octreotide scan , and chromogranin a were within normal limits , lowering suspicion for neuroendocrine tumor . with conservative management , he initially reported improvement in his abdominal pain ; however , his pain never completely resolved and he eventually reported postprandial exacerbation . on hospital day 13 , the decision was made to perform diagnostic laparoscopy with potential mass and/or small bowel resection . the mass present on ct was identified intraoperatively in the mid - jejunal mesentery after an adhesion between two adjacent loops of jejunum was separated ( fig . the mass was resected along with a 15 cm segment of the involved jejunum , followed by primary anastomosis . his postoperative course was uneventful , and he was discharged shortly thereafter with resolution of his pain . on clinic follow - up , he has remained without pain . h&e staining of the specimen demonstrated spindle cells and signs of coagulation necrosis with ghost cells showing prominent eosinophilic staining fig . cd117 and dog1 staining were negative ( not shown ) , excluding gastrointestinal stromal tumor . h&e staining of the specimen demonstrated spindle cells and signs of coagulation necrosis with ghost cells showing prominent eosinophilic staining fig . cd117 and dog1 staining were negative ( not shown ) , excluding gastrointestinal stromal tumor . mesenteric and omental cystic masses are uncommon , representing only 1 in 100,000 acute adult hospital admissions , although it is possible they occur with greater frequency but are missed or identified incidentally as most remain asymptomatic . further hindering their rapid diagnosis when symptomatic is their very nonspecific presentation including but not limited to abdominal pain which is often chronic in nature , mass , or distension . this patient presented with the additional complaint of nausea and vomiting , and it is likely that local mass effect was involved , as concluded by other authors reporting on similar intra - abdominal cystic masses . the exact etiology underlying the necrosis of this patient s mesothelial cyst and its contribution to his abdominal pain is unclear . it is likely that this patient s cyst simply outgrew its own perfusion , although a possible contribution by some physiologic stressor is worth consideration . the mainstay of treatment for symptomatic lesions is complete surgical excision , , as recurrence of incompletely excised cysts has been noted by other authors . fortunately for this patient , surgery seems to have been curative as he remains well on follow - up . rare etiologies of gastrointestinal upset and abdominal pain , while reasonably left low on the differential list , ought not to be excluded from it completely . unfortunately however , it appears that mesothelial cyst and other intraabdominal cystic masses often fail to reveal themselves on physical examination and leave no characteristic clues in recent patient history , only becoming apparent nonspecifically on advanced imaging . the routine practice of ct imaging and the low threshold employed at some institutions for its use is a matter of controversy outside the scope of this case report ; however in the case of our patient , it was diagnostically important , appropriately directed treatment towards surgical management , and led to a therapeutic outcome . routine histopathological examination of resected tissue specimens is also of value in excluding malignancy , arriving at a specific diagnosis and confirming total resection of lesions that are likely to recur if incompletely excised . walter beversdorf , ms-4 : writing of case report , editing , proofing , submitting . this research did not receive any specific grant from funding agencies in the public , commercial , or not - for - profit sectors . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

highlightsmesenteric cystic masses account for a very small fraction of abdominal pain cases.symptoms arise likely as a result of mass effect , even when these lesions are small.on detection of these lesions by imaging , it is important to exclude neuroendocrine tumors.complete surgical excision is curative of symptoms caused by local mass effect.histopathological examination of specimens is the definitive means to differentiate between such lesions , that appear similarly on imaging .

Introduction Presentation of case Histopathologic examination Discussion Conclusion Author contribution Ethical approval Conflicts of interest Consents Guarantor

in the past , a number of studies1,2 have given insight into the epidemiology of primary open - angle glaucoma . for caucasians , it is estimated that almost 2% of the population will suffer from the disease , and for afro - caribbeans this percentage goes to almost 8% . according to the world health organization , age - related cataract causes 48% of world blindness . in the united states , age - related lenticular changes have been reported in 42% of those between the ages of 52 and 64 years , 60% of those between the ages of 65 and 74 years , and 91% of those between the ages of 75 and 85 years.3,4 it is therefore almost inevitable that a glaucoma patient will sooner or later need to undergo cataract surgery independently from his chronic disease . the objective of the following systematic review is to examine whether there is strong evidence in order to draw safe conclusions on the long - term survival of a trabeculectomy performed before phacoemulsification.57 we looked for matched studies that compared in a prospective or retrospective way the adverse events after a trabeculectomy alone versus phacoemulsification after an uncomplicated previous trabeculectomy . no limits were applied for language , and we were prepared to translate foreign papers as needed . this search was applied to medline , scopus , embase , the web of science ( science citation index ) , and the cochrane database . in addition , we searched the online contents of the british library and abstracts presented at annual meetings of the association for research in vision and ophthalmology ( arvo ) . we used the following search terms to search all trial registers and databases : randomized controlled trial , controlled clinical trial , random allocation , double - blind method , matched study and trabeculectomy failure , glaucoma filtering operation failure , bleb failure and cataract surgery or phacoemulsification . disagreements were resolved by discussion between the two ; if no agreement could be reached , a third author would decide . in designing the study protocol nonetheless , no author was able to identify one , and therefore , the study design had to be changed . information was extracted from each included study on : ( 1 ) characteristics of the study participants and the inclusion and exclusion criteria ; ( 2 ) type of intervention ; ( 3 ) type of outcome measure ( including visual acuity , intraocular pressure [ iop ] , number of antiglaucoma drugs used , or need for a secondary antiglaucoma surgery ) . to ascertain the validity of eligible studies , a pair of authors working independently determined the adequacy of allocation . to explore variability in study results ( heterogeneity ) , we specified the following hypotheses before conducting the analysis . we hypothesized that effect size may differ according to the methodological quality of the study . the primary outcome measure was the statistical significance of the progressive iop modification before and after phacoemulsification in eyes with previous trabeculectomy . two abstracts from the arvo meetings did not provide full texts , which were necessary to assess the eligibility of the studies , and were not included . all of the studies finally selected for the review were nonrandomized matched studies published in english . the secondary and additional outcomes considered were the number of antiglaucoma medications used and the bleb morphology . the timing of outcome measures was variable and could include monthly investigations , evaluations every 3 months , or a single final evaluation . the first clinical study assessed was from wang et al.8 the main outcome measures for this study were the iop variation after the phacoemulsification in trabeculectomized eyes and the bleb morphology . the study included 27 eyes and concluded that cataract surgery adversely affects trabeculectomy , especially in cases where there is already an initial failure of the bleb . inal et al9 published a controlled study that prospectively assessed completed phacoemulsifications in trabeculectomized eyes as compared to isolated cases of trabeculectomy . the study and control group each comprised 30 patients with primary open - angle glaucoma . the study demonstrated that the success of filtering surgery gradually diminished , and the degree of iop control worsened progressively in a time - dependent manner . in 2005 , ehrnrooth et al10 conducted a retrospective study in order to evaluate risk indicators for cataract surgery and the effect of phacoemulsification on iop control in eyes that had undergone trabeculectomy . from a pool of 138 trabeculectomized patients , the conclusion of the study was that generally the iop is maintained stable after cataract surgery , even though there can be cases of late bleb failure . klink et al11 conducted a prospective study in 2005 with 30 cases and 36 controls . this prospective study concluded that cataract extraction using clear cornea phacoemulsification may be associated with partial loss of the previously functioning filter and with impairment of filtering bleb morphology . shingleton et al7 conducted a retrospective analysis of the surgical results in his private practice , evaluating the iop , best - corrected visual acuity ( bcva ) , and glaucoma medication requirements in patients who underwent phacoemulsification with preexisting glaucoma filters . the study included 58 patients , some of whom had had their cataracts removed through a scleral tunnel or temporal clear cornea . the conclusion was that temporal clear corneal or scleral tunnel phacoemulsification in the setting of a preexisting glaucoma filter was associated with improved bcva , a small but statistically significant increase in iop , and stability in the number of glaucoma medicines required for iop control . a prospective matched study was also conducted by casson et al.12 two groups comprising 28 patients each were tested for the same working hypothesis , comparing the mean iop 1 and 2 years after phacoemulsification , and the surgical success rate in each group was determined by kaplan meier survival analysis . the authors concluded that phacoemulsification may jeopardize long - term iop control in individual patients . rebolleda and muoz - negrete13 also contributed by designing and executing a prospective , nonrandomized comparative ( self - controlled ) study aiming to evaluate the effect of phacoemulsification on iop control in eyes with a previous functioning filtering bleb in patients who were not taking glaucoma medications . their conclusions were that phacoemulsification significantly increased the iop and the number of glaucoma medications necessary in eyes with preexisting functioning filtering blebs . eyes with higher iops before phacoemulsification exhibited worsened postoperative iop control and bleb failure . in their retrospective study , mietz et al14 concluded that cataract surgery had no markedly negative effect on iop . donoso and rodriguez15 conducted a retrospective study comparing two groups of patients treated with 5-fluorouracile ( 5-fu ) . the conclusion was that combined cataract and glaucoma surgery with intraoperative 5-fu was associated with good long - term iop control . this study focused on the effect of phacoemulsification on trabeculectomy survival and therefore the progression of glaucoma . this represents a good example of whether phacoemulsification adversely affects trabeculectomy over the long term . a study by caprioli et al16 assessed the safety of temporal clear corneal phacoemulsification in eyes with previous trabeculectomy . the authors concluded that cataract surgery by temporal clear corneal phacoemulsification in eyes with filtering blebs after trabeculectomy does not adversely affect long - term iop control . park et al17 conducted a retrospective case control study where they attempted to assess the effect of temporal clear corneal phacoemulsification on iop in eyes with a prior trabeculectomy . after a careful statistical analysis , the authors concluded that cataract surgery by temporal clear corneal phacoemulsification in eyes with filtering blebs does not adversely affect long - term iop control . another study that we assessed was published by swamynathan et al.18 in this retrospective case - control study , the main outcome measure was the iop before and after phacoemulsification , at various times postoperatively . this study showed that temporal corneal phacoemulsification can affect the long - term iop control after trabeculectomy with 5-fu or mitomycin c. halikiopoulos et al19 published a prospective case - control study where 68 trabeculectomized patients underwent extraction of their cataracts , either by phacoemulsification or by the extracapsular method . the conclusion of this study was that in the long term , the complication rate of the phacoemulsification was not statistically significant in respect to the extracapsular method with regard to the glaucoma progression . a review of the literature resulted in a large number of potentially eligible studies that needed to be assessed for inclusion against predetermined criteria ; only a small proportion of these were eventually included in the review ( tables 1 and 2 ) . the process for selecting the studies was explicit and conducted in such a way as to minimize the risk of errors and bias . the process by which decisions on the selection of studies were made was specified in a preliminary meeting of the authors that clarified these issues , including who would carry out each stage and how it would be performed . the aim of the selection process was to ensure that all relevant studies would be included in the review . as already known , the types of study used to assess the effects of interventions can be arranged into a hierarchy , based broadly on their susceptibility to bias . although the rcts are considered the best study design with which to evaluate the effect of an intervention , in cases where it is unworkable or unethical to randomize participants , a quasi - experimental or an observational design may instead have to be used . simply grading studies using this hierarchy does not provide an adequate assessment of study quality , because it does not take variations in quality among studies of the same design into account . even rcts can be implemented in such a way that findings are likely to be seriously biased and therefore of little value in decision - making . therefore , it is important to consider the individual aspects of the study design that may introduce bias rather than focusing on the descriptive label used . wang et al8 presented a prospective study where preoperative iop and two parameters of the ultrasound biomicroscopy images , including visibility of a route under the scleral flap and reflectivity inside the bleb , were evaluated for an association with postoperative success rate , using kaplan meier survival analysis . meier curve is that the method can take some types of censored data into account , particularly if a patient withdraws from a study , ie , is lost from the sample before the final outcome is observed . the same statistical method was also used by mietz et al.14 in the study by inal et al,9 the data were collected retrospectively , even though success rates were investigated by kaplan meier survival analysis , and the factors influencing final success were submitted to logistic regression analysis . this latter approach is used extensively in the medical sciences to predict a patient s propensity to a certain event . the study by ehrnrooth et al10 was a retrospective case - control investigation ; the paper from klink et al11 and the case - control study by halikiopoulos et al19 were prospective studies . their statistical analysis was based upon standard deviation calculation and extrapolation of the clinical statistical significance ( p - value ) , which limited the strength of the results . shingleton et al7 used the same statistical methods , but also introduced the best way to clinically assess bcva using the logmar scale . the prospective , matched study by casson et al,12 the prospective , nonrandomized comparative ( self - controlled ) study by rebolleda and muoz - negrete,13 and the retrospective case - control study by caprioli et al16 used the same statistical methods , with the limitations mentioned above . a very good impression comes from the study by donoso and rodriguez.15 they used the log - rank test ( sometimes called the mantel cox test ) , which is a hypothesis test to compare the survival distributions of two samples . it is widely used in clinical trials to establish the efficacy of a new treatment compared to a control treatment when the measurement is the time to event ( such as the time from initial treatment to iop spikes ) . lastly , another source of major bias in the finalization of the results is that during the execution of the trabeculectomy , some surgeons used different antimetabolites and some used none , such as in the studies of park et al17 and swamynathan et al.18 it is difficult to assess the influence of antifibrotic therapy on the long - term survival of a trabeculectomy when associated with phacoemulsification because statistical variables increase exponentially and add further to the scientific dilemma . in conclusion , our systematic review sought to gather all the available evidence in favor or against the question of whether phacoemulsification should be performed with or after a trabeculectomy .

the purpose of our systematic review is to document the adverse events that follow phacoemulsification in eyes with trabeculectomy due to glaucoma and to determine whether phacoemulsification jeopardizes the survival of the trabeculectomy . our research was based on english- and non - english - language articles obtained using the medline , embase , web of science and scopus databases . additional studies were identified by searching bibliographies in the british library and abstracts presented at the association for research in vision and ophthalmology annual meetings . search terms included randomized controlled trial , controlled clinical trial , random allocation , double - blind method , matched studies and trabeculectomy failure , glaucoma - filtering operation failure , bleb failure and cataract surgery or phacoemulsification . only prospective or retrospective matched studies testing the survival of a trabeculectomy alone versus clear corneal phacoemulsification after a trabeculectomy in patients with glaucoma were included . data were independently extracted by two authors using predefined data fields . pubmed yielded 152 results , scopus 235 , embase 222 , and web of science ( science citation index ) 216 . we read the abstracts of all the trials , and after reading the full text of 31 studies , we decided that 13 studies should be comprehensively evaluated . current evidence does not allow us to draw safe conclusions on the scientific question so far .

Introduction Methods Results Discussion

in the united states , 166 million dental restorations were placed in 2005,1 and clinical studies suggest that more than half were replacements for failed restorations.2 it is anticipated that the emphasis on replacement therapy will increase with the phasing out of dental amalgam . global concerns regarding mercury in the environment are the primary driver for the discontinuation of dental amalgam . identified as one of the top five mercury - added products , dental amalgam is ranked fifth behind batteries , measuring devices , electrical switches and relays , and mercury - containing light bulbs.3 resin composite is the most common alternative to dental amalgam,4 but numerous studies report that composite restorations have more recurrent caries , higher failure rates , and increased frequency of replacement.2,410 simecek et al reviewed the dental records of more than 3000 patients and concluded that there was a significantly higher risk of replacement for posterior composite restorations as compared to amalgam.4 in a study of posterior restorations placed by 243 norwegian dentists , failed amalgam restorations had a mean age of about 11 years , while the mean age of failed composite restorations was statistically significantly lower at 6 years.8 a study of composite and amalgam restorations in the pediatric population indicated that the need for additional treatment was 50% greater in children receiving composite restorations.11 depending on factors , including the size of the restoration , tooth location , and patient type , the lifetime of large to moderate posterior composite restorations is approximately one - half that of dental amalgam.12 the use of composite to restore form and function for posterior teeth damaged by disease , age , or trauma is gaining wide acceptance by the dental community . a myriad of factors can influence the clinical success of class ii composite restorations . clinical parameters , including patient characteristics , tooth preparation , matrix utilization , and composite composition the popularity and demand for resin - based posterior restorations has been increasing steadily since the introduction of these materials in the mid-1950s . the societal focus on aesthetics as well as the worldwide move toward eliminating amalgam restorative materials has contributed to this phenomenon.3 unfortunately the success and/or failure of resin - based composite restorations is dependent upon variables that may be difficult for the operator to control . for example , restorations placed in patients with high caries risk have restoration failure rates two times those of patients with low caries risk.13 these findings have been documented in the adult as well as the pediatric dental patient population.14 clinical data indicate that regardless of which preparation design is adopted or the type of posterior resin - based restoration that is utilized , the practitioner must give careful consideration to the caries status of the patient and adjust recommendations for restorative materials accordingly . posterior resin restorations have been indicated for various types of tooth preparations . in particular , resins are utilized to maximize aesthetics and minimize the loss of tooth structure during preparation . due to the location of the caries and thus the need to restore proximal surfaces in class ii restorations , a number of tooth preparation designs have been advocated . the underlying goal of all of these tooth preparation designs is a reduction in the loss of sound tooth structure . the tunnel technique , as reported by hunt15 and knight,16 has been used to remove proximal caries while leaving the marginal ridge intact . although potentially promising , the lack of long - term clinical studies limits wide adoption of this technique.17 the ability to access and restore a proximal carious lesion directly represents the most conservative proximal restorative technique available.17 this technique is relatively successful in preserving intact tooth structure ( figures 1 and 2 ) . minibox or slot preparations for the restoration of proximal lesions in posterior teeth have also been recommended by clinicians and researchers . these preparation designs have been described as minimally invasive and relatively successful with a reported 70% success rate over an average of 7 years.18 the aforementioned tooth preparation designs successfully limit the removal of sound tooth structure and take advantage of appropriate etching techniques in bonding to intact enamel and dentin . however , depending upon the location and extent of the caries , traditional preparation designs , which involve access through the carious marginal ridge and the removal of infected occlusal enamel and dentin , may be required . these more invasive preparations are indicated in this clinical situation ( figure 3 ) and are well documented in the literature.19 whenever possible , conservative structure - sparing preparation techniques should be used . when restoring proximal surfaces with resin - based composite . considerable attention has been devoted to the relationship between cavity type , cavity size , number of surfaces restored , and the risk of restoration failure . as the number of restored surfaces increases , the risk of restoration failure also increases.2022 for example , as reported in the 2012 review by demarco et al,23 single - surface and class i restorations are less likely to fail as compared to multisurface restorations , and class ii restorations . to minimize restoration failure and mitigate the effects of bonding multiple tooth surfaces , most clinical strategies have focused on methods to decrease the ratio between the bonded surface area to the nonbonded surface area , also described as the cavity configuration or c - factor . the higher the c - factor the less chance for relaxation of polymerization shrinkage . some studies have indicated that the increase in c - factor is also associated with decreased bond strength.24,25 however , recent investigations have suggested that this finding may not be valid for the newer low - shrink resin - based composites.26 along with preparation design and extent of tissue removal , the position of the tooth in the mouth directly influences the overall clinical performance and longevity of the restoration . studies suggest that restorations placed in premolars fail less often than similar restorations placed in molars.20,21 intuitively this finding makes sense in that the masticatory forces and stresses placed on restorations in molar teeth are higher than those placed in premolars . nonetheless , the findings in terms of tooth position and number of restored surfaces indicate that clinicians should utilize posterior resin composites in areas where aesthetics is deemed essential and should maintain as much tooth structure as possible . figures 4 and 5 illustrate the aesthetic results obtained when replacing a proximal amalgam restoration with a resin - based composite restoration . the techniques used to fill and cure resin - based composites , particularly in areas of high masticatory stresses , have received considerable attention . the debate among researchers as well as practitioners regarding bulk cure versus incremental cure continues . incremental filling techniques ( figure 6 ) have long been recommended due to the polymerization shrinkage associated with dental composites . reducing the volume of composite that is polymerized at each stage of the restorative procedure minimizes shrinkage and maximizes the conversion of monomers to polymer . this is achieved , in part , by decreasing the attenuation of the curing light.27 while incremental filling techniques have been taught and utilized for decades , some studies indicate that incremental filling of resin - based composites produces higher shrinkage stress.27,28 in direct contrast , more recent studies report that incremental filling produces lower shrinkage stress when compared to bulk filling techniques.29,30 these diverse and contradictory conclusions are likely due to different testing methods.31 currently , manufacturers are striving to produce resin - based composite systems that have less polymerization shrinkage ( < 2% ) and , more importantly , reduced polymerization shrinkage stress . strategies to improve shrinkage include utilizing new low - shrinking monomers or those with an increased molecular weight.26 as the low - shrinking composite resins improve , incremental filling and curing of posterior composites may no longer be recommended . however , until the long - term clinical success of the lower shrinking composite resin systems is confirmed , using an incremental filling technique in deep cavity preparations is recommended.26 the influence of matrix type on the quality of the proximal contact and the ease of placement of class ii resin restorations has also been evaluated . the ability to reproduce an appropriate , functional , proximal contact with a class ii resin restoration is important to minimize food impaction and thus maintain healthy periodontal tissues . open margin through which oral fluids , eg , saliva , enzymes , water , and cariogenic bacteria , may penetrate . this marginal leakage can lead to recurrent caries , which is the most often cited reason for composite restoration failure.2,410 manufacturers have introduced various types of matrices into the dental market with the goal of affecting or influencing the direction of composite shrinkage during polymerization.32 the literature no longer supports the concept of directional polymerization,33 but these matrices still exist . although there are a myriad of different shapes and sizes , the majority of matrices fall into one of two basic types : ( 1 ) metal matrices , which are straight or circumferential / precontoured and ( 2 ) transparent matrices which are either straight or circumferential / precontoured . despite the theory that transparent matrices will enhance polymerization at the gingival margin , the recent literature suggests that the choice of matrix does not influence the clinical success of class ii posterior resins.32 in addition to matrix type , there are numerous tooth separation ( wedging ) products and techniques . the literature suggests that the type of matrix material / wedge does not influence the clinical performance of class ii composite restorations.34 however , the literature does indicate that no matrix / wedge combination can accurately reproduce an intact proximal surface contact at the precise location of the natural intact tooth.35 researchers and industry continue their efforts to modify composite resin restorative materials in order to improve their handling characteristics , mechanical and physical properties , and clinical performance . the majority of the current resin composites have mechanical properties that make them suitable for use in all areas of the mouth . the functionality of these restorations , however , in areas of high masticatory stress is still a concern . resin restorations that are placed in areas of high function are more prone to exhibit excessive wear and/or marginal fracture despite the advances in the current materials . clinicians must exercise caution when placing large resin - based composite restorations in areas of high function . the longevity of posterior resin restorations placed in patients who have a history of clenching or grinding may be particularly limited.35 while resin composition , tooth preparation design , and matrix systems may influence the lifetime of posterior composite restorations , the primary factor in the clinical failure of moderate to large composite restorations is secondary caries at the margins of the restorations.8 as an example , in a study of radiographs from 459 adults , age 1819 years , the investigators reported that , among interproximal restorations , the failure rate as a result of secondary or recurrent caries was 43% for composite as compared to 8% for amalgam.7 in a separate study of amalgam and composite restorations placed in 812-year - old children , the primary reason for failure of both materials was secondary caries , but secondary caries was 3.5 times higher in composite restorations.5 an increase in secondary caries at the margins of composite restorations suggests that the seal at the composite tooth interface is not adequate to resist the physical , chemical , and mechanical stresses that are present in the mouth . the failure of moderate to large composite restorations has been linked to the degradation of the bond at the tooth surface composite material interface12,3641 and an increase in the concentration of the cariogenic bacterium streptococcus mutans at the perimeter of these materials.4246 degradation of the bond at the interface between the tooth and composite has been associated with the failure of adhesives to form an impervious seal with the dentin.2,4150 failure of the adhesive / dentin ( a / d ) bond leads to open pores at the composite tooth interface and bacterial enzymes , oral fluids , and even bacteria can penetrate these open pores.51 data from in vivo and in vitro studies indicate that the infiltration of these agents into the voids between the tooth and composite will lead to recurrent caries , hypersensitivity , and pulpal inflammation.41,47,52,53 results from clinical studies indicate loss of retention , poor marginal adaptation , and marginal discoloration when the a / d interface is exposed to the oral cavity.54 effective mechanical bonding between the composite restoration and treated enamel has been achieved using appropriate acid - etching protocols , but failure of the bond at the a / d interface threatens the long - term clinical survival of moderate to large posterior composite restorations.39,41,43,52,5557 bonding failures have been commonly tracked to the gingival margin of class ii composite restorations.58 a separation between the composite material and tooth surface has been noted at the gingival margin.55 in class ii composite restorations , there is generally little enamel available for bonding at the gingival margin ; therefore , the bond at this site depends on the integrity of the seal formed with dentin . gaps at the gingival margin have been attributed to unreliable dentin bonding.55,57 in a study comparing the microtensile a / d bond strength of gingival and proximal walls of class ii composite restorations , the adhesive bond to the gingival wall was significantly weaker.59 a complementary spectroscopic study reported a twofold difference in the extent of dentin demineralization at the proximal and gingival margins.50 the difference in demineralization suggests less mineralized dentin at the gingival margin . the cumulative effect of less mineral , increased density , and size of the tubules60 would mean faster and deeper etching at the gingival margin as compared to the proximal wall . although the etch was deeper at the gingival margin , there was considerably less adhesive infiltration of the demineralized dentin matrix at the gingival margin.50 the discrepancy between etching depth and adhesive infiltration led to a large area of exposed collagen at the gingival margin . yoshiyama et al suggested that the increased number of tubules per unit area at the gingival margin would promote efficient adhesive infiltration at this margin.61 however , other variables , including water content , interfere with efficient adhesive infiltration at the gingival margin . water content is higher in dentin at the gingival margin as compared to the proximal wall . water content is increased because of the water present within the demineralized dentin matrix and patent tubules that contain a great deal of dentinal fluid . the presence of this fluid contributes to the contamination of the prepared surface.62 the increased water leads to reduced adhesive infiltration and lower monomer / polymer conversion of the adhesive at the gingival margin as compared to the proximal wall.50 the impact of water upon the effectiveness of bonding is further supported by in vitro investigations that indicate that adhesive monomers or oligomers and unprotected collagen at the gingival margin of class ii composite restorations undergo hydrolytic degradation after 90 days of aqueous storage.49 wet bonding techniques were introduced in the early 1990s to counteract the problems noted with collagen collapse following drying of the demineralized dentin matrix.6366 wet bonding means that the demineralized dentin matrix is fully hydrated throughout the bonding protocol . using this procedure , the channels between the demineralized dentin collagen fibrils are filled with water , solvent , conditioner , and/or oral fluids.67,68 adhesive must diffuse into the fluid - filled spaces of the substrate and along the collagen fibrils . ideally , the solvent in combination with hydrophilic monomers , eg , hydroxyethyl methacrylate ( hema ) conditions the collagen to remain expanded during adhesive infiltration . however , hema , a primary component in many single - bottle , commercial , dentin adhesives , can dramatically reduce the evaporation of water.69 hydrophobic monomers , such as 2,2-bis[4(2-hydroxy-3-methacryloyloxy - propyloxy)-phenyl ] propane ( bisgma ) , would resist diffusing into these sites where there is residual water.7072 in the in vivo situation , there may be little control over the amount of water left on the tooth . thus , it is possible to leave the dentin surface so wet that the adhesive physically separates into hydrophobic- and hydrophilic - rich phases.71,73,74 indeed , results from laboratory investigations indicate that excess moisture prohibited the formation of an impervious structurally integrated a / d bond at the gingival margin of class ii composite restorations.49,50 under clinical conditions , dentists must routinely attempt to bond to naturally wet substrates , eg , caries - affected dentin75 or deep dentin.7679 the water content of caries - affected dentin is 2.7 times greater than that of normal dentin.75 exposed tubules account for 22% of the surface area in deep dentin . in contrast , exposed tubules account for 1% of the surface area of dentin close to the dentino - enamel junction.80 the large increase in exposed tubules in deep dentin means that pulpal fluid will contribute additional moisture to that already present within the demineralized dentin matrix . with the sensitivity of our current adhesives to excess moisture , it is obvious that bonding to these clinically relevant substrates is a formidable challenge.79,8183 this difficulty highlights the potential limitations in utilizing resin - based composites to restore large , deep , carious lesions . water blisters that form in adhesives placed on overly wet surfaces8486 and adhesive phase separation that leads to very limited infiltration of the critical but hydrophobic dimethacry - late component71,87,88 are two examples of the sensitivity of our current adhesives to excess moisture . the optimum amount of wetness varies as a function of the adhesive system.89 it is impossible to simultaneously achieve uniform wetness on all of the walls of the cavity preparation.90 in short , wet bonding is a very technique - sensitive procedure . optimum bonding with our current commercial dentin adhesives occurs over a very narrow range of conditions , eg , water content.78 strategies to promote bonding of the resinous materials to intrinsically wet dentin substrates include the incorporation of ionic and hydrophilic monomers into the adhesive.91 these adhesives etch and prime simultaneously , thus addressing the problems of collagen collapse and simplifying the bonding protocol . the hydrophilicity of these adhesives enhances water sorption , which can lead to hydrolytic breakdown in the mouth.85,90,92 with these systems , the bonded interface lacks a nonsolvated hydrophobic resin coating . the hybrid layers made with these adhesive systems behave as semi - permeable membranes ; water is transferred throughout the bonded interface even after adhesive polymerization.54 the increase in the concentration of hydrophilic monomers in these systems has been associated with decreased structural integrity at the a / d interface.54,93 deterioration of the a / d bond formed with these systems was noted after 1 year of in vivo aging.94 these results suggest that hydrophilicity and hydrolytic stability of resin monomers are generally antagonistic.90 when measured immediately , dentin - composite bonds are generally considered adequate to tolerate conditions in the mouth , but these bonds deteriorate with time . the two major mechanisms of deterioration are fatigue and hydrolysis.95 fatigue has been linked to stresses transmitted to the bond by occlusal forces , thermal expansion and contraction , and polymerization shrinkage of the composite . chronic deterioration of the dentin - composite bond is also related to hydrolysis and leaching of the adhesive that has infiltrated the tooth structure.70,79 fatigue investigations have indicated that the overall time - dependent behavior of the composite tooth interface is a complex function of the individual material phases . for example , microfinite element analyses have shown that each material phase at the a / d interface experiences different stress concentrations at functional loads.96,97 the overall failure behavior of the bond at the a / d interface is not determined by the weakest component but by the component whose stress concentration is closest to its failure strength . similarly , the overall fatigue life of the a / d interface is governed by the material component with the shortest fatigue life under a given loading condition.98 under masticatory function the material components at the composite tooth interface are subjected to both chemical and mechanical stresses . the interplay between these stresses can result in a deterioration of the properties of the material over time . the breaking of covalent bonds by addition of water to ester bonds is considered one of the primary reasons for deterioration of the adhesive at the interface between the composite and tooth.89,90 interestingly , degradation of methacrylate ester groups produces carboxylic acids the same functional group that is the culprit in lactic acid - induced dental caries . the change in mechanical properties of the materials can be contributed to a variety of mechanisms that include proliferation of surface and subsurface flaws.95,97,99101 these flaws in combination with the chemical and biochemical stresses that are present in the mouth can then lead to restoration failure . in conclusion , the a / d bond can be the first defense against substances that may penetrate and ultimately undermine the gingival margin in composite restorations in vivo . it has been hypothesized that the in vivo degradation of the bond at the a / d interface follows a cascade of events that begins when the dentin is acid etched102,103 disruption of the tooth structure by acid etching exposes and activates proteolytic enzymes , eg , matrix metalloproteinases ( mmps ) , that can degrade the exposed collagen component of the hybrid layer.104,105 the following factors inhibit the formation of a durable a / d bond : ( 1 ) water sorption and hydrolysis of the adhesive resin ; ( 2 ) inadequate monomer / polymer conversion of the infiltrating adhesive ; ( 3 ) incomplete resin infiltration of the demineralized dentin matrix ; ( 4 ) incomplete solvent evaporation ; and ( 5 ) enzymatic challenges within the cavity preparation through exposure to oral fluids.49,71,83,104115 although durable a / d bonds are critical for maintaining a seal at the tooth composite interface , the properties of the materials are only one part of an extremely complex problem.116 restoring posterior teeth with resin - based composite materials continues to gain popularity among clinicians , and the demand for such aesthetic restorations is increasing . manufacturers are working aggressively to improve resin composite materials by modifying components to decrease polymerization shrinkage , to improve mechanical and physical properties , and to enhance handling characteristics . the two main causes of posterior composite restoration failure are secondary caries and fracture ( restoration or tooth).35 a review and update of posterior resin composites in terms of preparation design , matrix choice , and resin systems demonstrate the limited extent to which these factors influence the overall clinical lifetime of resins placed in posterior teeth . clinical and patient factors , including caries risk , cavity size , cavity type , number of restored surfaces , and position of the tooth in the mouth must be given careful attention in the selection of any restorative material including composite resins . while clinicians tend to focus on tooth form and function when evaluating the success and failure of posterior resins , the emphasis must remain in advancing our understanding and knowledge of the intricate and complicated characteristics of the restoration tooth interface . this paper presents an update in existing technology and underscores the mechanisms that negatively impact the durability of posterior composites in permanent teeth .

restoring posterior teeth with resin - based composite materials continues to gain popularity among clinicians , and the demand for such aesthetic restorations is increasing . indeed , the most common aesthetic alternative to dental amalgam is resin composite . moderate to large posterior composite restorations , however , have higher failure rates , more recurrent caries , and increased frequency of replacement . investigators across the globe are researching new materials and techniques that will improve the clinical performance , handling characteristics , and mechanical and physical properties of composite resin restorative materials . despite such attention , large to moderate posterior composite restorations continue to have a clinical lifetime that is approximately one - half that of the dental amalgam . while there are numerous recommendations regarding preparation design , restoration placement , and polymerization technique , current research indicates that restoration longevity depends on several variables that may be difficult for the dentist to control . these variables include the patient s caries risk , tooth position , patient habits , number of restored surfaces , the quality of the tooth restoration bond , and the ability of the restorative material to produce a sealed tooth restoration interface . although clinicians tend to focus on tooth form when evaluating the success and failure of posterior composite restorations , the emphasis must remain on advancing our understanding of the clinical variables that impact the formation of a durable seal at the restoration tooth interface . this paper presents an update of existing technology and underscores the mechanisms that negatively impact the durability of posterior composite restorations in permanent teeth .

Clinical performance of composite versus dental amalgam restorations Patient selection Tooth preparation Polymerization and matrices Composite restoration failures Sensitivity of adhesive to wet bonding conditions Effects of function, fatigue, and degradation Summary

sarcoidosis is a rare condition with a prevalence of 4.46.3 patients per 100,000 personyears in australia , a figure similar to that of the united state 1 , 2 . it is a multisystem granulomatous disorder of unknown etiology predominantly affecting young and middleaged adults 3 , 4 . diagnostic criteria are based on a compatible clinical and radiological features supported by the histological evidence of noncaseating granulomas in the affected tissues , and the exclusion of other known causes of granulomatous inflammation 3 , 4 . pulmonary infiltration and hilar lymphadenopathy are the most common findings in more than 90% of cases , and transbronchial lung biopsy has been the recommended diagnostic procedure 3 , 4 . other organs involvement includes skin , eyes , liver , spleen , heart , musculoskeletal system , gastrointestinal tract , bone marrow , and the central nervous system . anemia has been reported in cases of sarcoidosis with the frequency ranging from 3.4% to 31% with a variety of explanations . these include hypersplenism , burden of chronic disease , autoimmunity , and bone marrow infiltration 5 . histological evaluation of extrapulmonary sarcoidosis depends on the site of involvement , but its diagnosis is rarely made via bone marrow biopsy 6 . features which may suggest bone marrow infiltration in sarcoidosis include extrapulmonary involvement and varying degree of cytopenia 7 . the characteristic granuloma in sarcoidosis is a noncaseating focal aggregation of macrophages or epithelioid cells , with or without multinucleated giant cells . its presence confirmed the diagnosis of a nonnecrotizing granuloma , in particular sarcoidosis 8 , 9 . a 40yearold caucasian woman presented with a threemonth history of polyuria , malaise , and weight loss . she had been receiving interferon ( ifn ) 1 for multiple sclerosis for the previous 12 years . investigations revealed moderate normocytic anemia , hypercalcemia , hyperglobulinemia , and acute kidney injury ( table 1 ) . her initial chest radiograph was normal , but further investigation with computed tomography showed diffuse lymphadenopathy in her chest and abdomen . a bone marrow trephine biopsy demonstrated noncaseating granulomas ( figs 1 and 2 ) and asteroid bodies ( black arrows in fig . her ifn treatment was discontinued , and she was commenced on prednisolone ( 60 mg daily ) with a slow tapering regimen over 6 months . her renal function and hypercalcemia recovered promptly , and her hemoglobin normalized at 12th week . summary of laboratory investigation results egfr , estimated glomerular filtration rate ; pth , parathyroid hormone ; k / l , kappa / lambda light chain ; ace , angiotensin converting enzyme ; si , systme international . histopathological section of a trephine bone marrow biopsy revealing a noncaseating granuloma composed of aggregation of multinucleated giant cells containing asteroid bodies ( arrowed ) . the noncaseating granuloma in the center ( black arrow ) is surrounded by pale pink amorphous material with scattered mononuclear cells interspersed throughout with some giant cells . there is also a surrounding cuff composed of reactive cells such as eosinophils and neutrophils . a second granuloma is visible in the periphery containing a langhans giant cell ( white arrow ) . a cardinal feature of sarcoidosis is the presence of cd+ t cells which display unregulated interaction with the antigenpresenting cells to initiate the formation and maintenance of noncaseating granulomas 10 . oligoclonal tcell repertoire observed in sarcoidosis suggests that the triggering antigens favor the progressive accumulation and activation of selective cd4 tcell clones 11 . this in turn leads to the preferential differentiation of the th1 helper cells which predominantly secretes interleukins ( il)2 and il12 12 . these ils have been found in higher quantity in the bronchoalveolar lavage fluid of patients with sarcoidosis and subsequently stimulate increased production of ifn and macrophage activation . it has a different structure and binds to a different receptor than the type i ifn ( and ) , and its gene is located on a different chromosome 12 . although endogenous ifn has been implicated in the pathogenesis of sarcoidosis , there is little evidence for other types of ifns 11 . the incidence of sarcoidosis is increasing with the use of type i ifn ( ifn , ifn ) for various conditions such as hepatitis b , hepatitis c , lymphoproliferative malignancy , and multiple sclerosis 13 , 14 , 15 . to date , 60 cases of sarcoidosis have been reported in the english literature in association with the use of ifn , in comparison with only six cases which were associated with the use of ifn 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 . the mean onset of development of sarcoidosis was 11.4 months after initiation of ifn therapy ( ranged 160 months ) , which is much earlier than our patient 13 . the pattern of system involvement is similar to that of the idiopathic form of sarcoidosis . only one case of the six is proven to have bone marrow involvement with a bone marrow biopsy 16 . ifninduced sarcoidosis exhibits a relatively mild disease course that usually resolves with cessation of ifn treatment . a small proportion of patients required systemic corticosteroid 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 . it is a diagnosis that should be considered in patients receiving ifn therapy of any type who present with anemia and multiorgan dysfunction . the overall pattern of organs involvement in sarcoidosis associated with ifn is similar to that of the idiopathic form .

key clinical messagesarcoidosis is a diagnosis that should be considered in patients receiving interferon therapy , who present with anemia and multiorgan dysfunction regardless of the duration of their treatment . when sarcoidosis is suspected , bone marrow biopsy should be considered especially for cases predominant by extrapulmonary features .

Introduction Case Presentation Discussion Conclusion Conflict of Interest

apratoxins are potent cytotoxins derived from marine cyanobacteria . because of their biological activity and intriguing structures , we recently established that apratoxins prevent cotranslational translocation and thereby downregulate various receptors , including receptor tyrosine kinases ( rtks ) , and inhibit trafficking of other secretory molecules , including growth factors that act on rtks . rtks such as epidermal growth factor receptors and corresponding ligands such as vascular endothelial growth factor a ( vegf - a ) individually are validated drug targets , which resulted in the approval of small molecules and antibodies against these proteins for colorectal cancer and other cancers . the combined indirect inhibition of both classes of molecules by apratoxins has proven very powerful and an alternative to the specific targeting of selected secretory proteins in cancers that rely on autocrine loops such as colorectal cancer . apratoxin a was rigorously profiled and shown to possess broad - spectrum yet differential in vitro activity ; however , it also showed irreversible toxicity in vivo and was not well tolerated . our initial investigation of the structure activity relationships indicated that the irreversible toxicity may be an off - target effect rather than mechanism - based and may be related to the presence of the michael acceptor in the molecule that might be prone to nonspecific addition of cellular nucleophiles . indeed , in vitro experiments showed that michael addition at c29 of apratoxin a can occur with thiol - containing compounds such as glutathione , cysteine , and n - acetylcysteine ( supporting information , scheme s1 ) . unfortunately , the only natural apratoxin without that ,-unsaturated carbonyl system has been apratoxin e , which , however , exerts much reduced activity , presumably due to the dehydration of the tertiary alcohol at c35 . therefore , we designed and synthesized apratoxin s4 ( 1a ) , which represents a hybrid of the natural products apratoxins a and e , containing the hydroxy group as in apratoxin a that is important for potent activity and lacking the michael acceptor as in apratoxin e ( figure 1 ) . compound 1a showed greater potency and efficacy in a colorectal tumor xenograft model than the parent compound ( apratoxin a ) and was much better tolerated in vivo , providing evidence that the apratoxin scaffold can serve as a new modality to treat cancer but also validating the mechanism of action as a new therapeutic strategy . natural apratoxins a and e and synthetic apratoxin s4 . in our previous work , some fragments of 1a were prepared with modified methods that paralleled those by other groups . to enable the large - scale synthesis of 1a for rigorous preclinical assessment , several steps needed to be improved or replaced due to their low efficiency or harsh operation . an improved synthesis would also provide easier access to additional apratoxin analogues , which we designed based on earlier observations with the goal of improving metabolic stability and reducing complexity of the molecule . in apratoxin a , the chiral center at c34 bears the risk of epimerization ; however , the c34 epimer has the same potency as apratoxin a and the same holds true for 1a and 34-epi-1a ( apratoxin s6 ) . it is also known that the hydroxy group at c35 in apratoxin a is sensitive toward acid - induced dehydration , leading to the double bond between c34 and c35 , and the product has greatly decreased activity , thus presenting a potential major deactivation pathway for 1a as well . on the basis of the above , it was necessary to explore and investigate analogues at c34 : ( 1 ) nonmethyl - c34 , to remove the chiral center , thereby simplifying the molecule ( apratoxin s7 , 1b ) , and ( 2 ) gem - dimethyl - c34 , to remove the chiral center to simplify the molecule and reduce the possibility to dehydrate to form a conjugated system with the thiazoline ( apratoxin s8 , 1c ) . both analogues were expected to retain potent activity based on our previous results with 34-epi-1a . to continue our systematic sar investigation in the nonpeptide portions , we also aimed to explore the synthesis and activity of 30-epi-1a ( apratoxin s9 , 1d ) . here we show the details of an improved synthesis of 1a and the synthesis of analogues with different c34 methylation status ( 1b , c ) and configuration of c30 ( 1d ) . during the development of this improved synthesis , several new reactions were applied , key reactions were modified to meet different substrate requirements , and many steps were optimized , resulting in an efficient synthesis that enables the generation of large - scale quantities of apratoxins for preclinical evaluation . we studied the sar by subjecting all new synthetic apratoxins to a multidimensional assay platform , measuring cell growth , receptor tyrosine kinase receptor ( rtk ) levels , and growth factor secretion . we also investigated the in vitro stability of these compounds and tested the compound with the least propensity to be deactivated via dehydration ( 1c ) for in vivo antitumor efficacy . the main strategies and procedures in the synthesis of all analogues we designed paralleled those of reported procedures but with notable modifications . on the basis of the retrosynthetic analysis depicted in scheme 1 , 1a and its analogues 1b d can be synthesized from two parts : tripeptide 6 and thiazole - containing long chain aliphatic acid 2 . the key step for the synthesis of each analogue is the formation of the thiazoline ring in 2 from the open - chain precursor 3 . experiments below showed that different degrees of methylation at c34 or different configuration of c30 affected the ring formation to different extents . compound 3 can be disconnected into modified cysteine 5 and proline ester based carboxylic acid 4 , which in turn can be synthesized from aldehyde 7 through a series of known reactions . scheme 2 details the steps which were improved from published procedures to meet practical large - scale production . -hydroxy ketone 8 was prepared via d - proline catalyzed aldol reaction of pivalaldehyde with acetone . after protection with tbs to 9 , reduction with nabh4 to 10 , and elimination through mesylate , 8 was transformed into allyl tbs ether 11 . the cleavage of the tbs from 11 afforded allyl alcohol 12 , which is the most critical step in the preparation of 12 due to its volatile property . the solvent ( et2o and thf ) in 12-containing fractions can be removed by distillation using a vigreux fractionation column for small - scale reactions under normal pressure ; however , for large - scale reactions , this was not feasible and we used the combination of cooling - concentration method under ambient reduced pressure ( see supporting information , figure s1 ) and vigreux fraction concentration . even though our reaction sequence consisted of more steps to prepare 12 than brown s method using ipc2bome , the latter caused purification problems which we did not encounter utilizing our optimized method . we found that this is indeed a practical route to the large - scale production of 12 , which we could easily achieve on 10 g scale . according to published procedures with minor modifications , aldehyde 7 was prepared starting from allyl alcohol 12 through formation of acryloyl ester 13 , grubbs catalyst - effected rcm reaction ( 14 ) , methylation with me2(cucn)li2 ( 15 ) , weinreb amide formation ( 16 ) , protection of hydroxy group with pmb ( 17 ) , and reduction with dibal - h ( 7 ) . the yield was low ( 1025% ) when we used p - methoxybenzyl bromide ( pmbbr ) to protect the hydroxy group of 16 in the presence of nah / tetra - n - butyl - ammonium iodide ( tbai ) in thf or nah in dmf . fortunately , we found that the pmboc(nh)ccl3/tfoh method was effective in smoothly converting 16 into pmb ether in moderate yield ( 56% ) . furthermore , unreacted starting material 16 was recovered quantitatively and could be used in the next cycle . it is noteworthy that , to shorten the synthetic route , we also tried to apply a grignard reaction to the syn - cyclic sulfate derivative of 8 to afford aldehyde 7 ( supporting information , scheme s2 ) . using this strategy , 8 should be stereoselectively reduced to the syn - diol . when we performed small - scale reactions ( < 2 g ) , we obtained adequate results ; however , for large - scale reactions ( > 4 g ) , both methods provided unsatisfactory results : low yields , low diastereoselectivity , and most of the product was obtained as an inseparable mixture . we speculate that an extremely slow rate of addition of reducing reagents is crucial for the success of this reaction . with aldehyde 7 in hand , we prepared proline ester - based aliphatic acid 4a c using modified published procedures ( scheme 3 ) . c34-methyl 4a and c34-nonmethyl 4b were synthesized utilizing a similar strategy ( scheme 3a ) . in our previous work , we constructed the c34(me)c35(oh ) chiral unit of 19a through roush s crotylation with roush s ( e)-crotylborate at 78 c in toluene following published procedures . roush s ( e)-crotylborate is not commercially available , it is laborious to purify crude roush s ( e)-crotylborate prepared in the lab by distillation and , if crude product was used without purification , the impurity reduced the yield to as low as 55% . here we now applied leighton s silanes 18a , b instead of roush s crotylborate to construct the c34c35 units in 19a , b . silanes 18a and 18b are commercially available and inexpensive ; they are solid and easy to handle . compound 19a and 19b were obtained smoothly in high yields when aldehyde 7 was treated with 18a and 18b along with sc(otf)3 in ch2cl2 at 0 c , respectively . compound 19a was converted into troc ester 20a with 2,2,2-trichloroethoxycarbonyl chloride ( troccl ) in the presence of pyridine and dmap . the troc ester of 19b was not stable and partly dehydrated to form a conjugate double bond , which led to low yield and caused problems with purification . therefore , we protected hydroxy group 19b with tbs and smoothly obtained the stable tbs ether 20b . the removal of the pmb group and subsequent esterification with fmoc - pro - oh by yamaguchi s method provided prolyl ester 21a and 21b . the combination of oxidants , oso4/oxone and naio4 , was effective to oxidize 21a to carboxylic acid 4a ; however , when 21b was exposed to the same conditions , the tbs group was cleaved simultaneously and gave carboxylic acid 4b with a free hydroxy group . the cleavage of the tbs group probably resulted from the acidic property of oxone which is a triple salt 2khso5khso4k2so4 . both 4a and the enantioselective chiral borane - mediated aldol reaction developed by kiyooka was used to construct the -hydroxy-,-dimethyl acid part of c34-gem - dimethyl acid 4c ( scheme 3b ) . treatment of aldehyde 7 with methyl trimethylsilyl dimethylketene acetal at 78 c in the presence of chiral oxazaborolidinone 22 ( derived from d - val ) provided ( s)--hydroxy ester 23 . with 23 in hand , we first tried to protect the hydroxy with the troc group and then hydrolyze the methyl ester with lioh . however , we found that troco-23 was not compatible to the lioh aq solution during hydrolysis in which a complex mixture including troc - cleaved acid was generated . we planned to couple 24 with modified cysteine ( mocys ) unit 5a first and then protect the hydroxy group with troc and finally remove pmb to form proline ester . however , we found the esterification from this reaction sequence provided a very low yield and caused difficulty in the purification . therefore , we adjusted the reaction sequence to esterify with fmoc - pro - oh first and then install the mocys unit . hydroxy acid 24 was converted into allyl ester 25 with allylbr in the presence of k2co3 in 93% yield . similarly to the preparation of 21a , b , hydroxy ester 25 was protected with troc and the pmb group was removed followed by esterification with fmoc - pro - oh to provide prolyl ester 27 , which was transformed into the carboxylic acid 4c by treatment with pd catalyst and n - methylaniline . the synthesis of modified cysteine unit 5a and its enantiomer 5b was achieved by following published procedures with minor modifications as depicted in scheme 4 . the weinreb amide 28 from s- ( or r- ) n - boc - cys(s - trt)-oh was reduced to amino aldehyde 29 , which was selectively converted into chain - extended modified cysteine ( e)-30 by wittig olefination . during this conversion , the choice of reductant was of importance because -amino aldehydes are easily racemized . the method using lithium aluminum hydride ( lialh4 ) in thf at 0 c decreased the racemization rate compared with that using dibal - h in toluene at 78 c in this preparation . subsequent reduction of the conjugated double bond in 30a and 30b using nabh4 in 95% ethanol afforded saturated compounds 31a and 31b , respectively , but only in 35% yield for both of them . to increase this yield , we also attempted hydrogenation with rhcl(pph3)3/h2 in toluene at 50 c . this reaction , however , gave a similar yield but also posed problems during the chromatographic purification of the product , which was considered a greater problem . fortunately , our apratoxin synthesis is convergent and this low yield is still not detrimental because it is not part of the longest linear sequence . finally , ethyl esters 31 were transformed into allyl ester 5 through hydrolysis and subsequent alkylation . using modified reported procedures,3a d and 2a d were synthesized as depicted in scheme 5 . the n - boc groups in 4a c were selectively removed with tmsotf in the presence of 2,6-lutidine and subsequent coupling of deprotected 4a c with 5a or 5b gave 3a d . first , we screened several coupling reagents for the preparation of 3a ( table 1 , entry 1 ) . even though hatu did not provide a good yield in the preparation of 3a , the yield was as high as 82% when it was used in the preparation of 3b . acknowledging that it may be difficult to prepare 3c due to the steric hindrance of -gem - dimethyl in acid 4c , we also screened coupling reagents for its preparation ( table 1 , entry 2 ) : pyaop gave the highest yield of 89% and surprisingly the bep coupling product gave a complex proton nmr as well as low yield while hatu gave an even lower yield of 20% . considering the similarity of 3d to 3a and the problem with bep to obtain 3c , we used bop as coupling reagent but only obtained product in moderate yield ( 62% ) ; however , pyaop provided a high yield of 91% ( table 1 , entry 3 ) . with 3a d in hand , we synthesized thiazoline - based acids 2a d ( scheme 5 ) . the formation of thiazoline ring is the key step in the preparation 2a d . replicating published procedures using kelly s method , ph3p = o / tf2o induced thiazoline ring formation smoothly for 3a , b to give 33a , b in ch2cl2 at 0 c within 30 min . however , for 3d , it took 3 h to consume all starting material and to finally form cyclized compound 33d . for gem - dimethyl 3c , it was surprising to us that ph3p = o / tf2o was unable to induce thiazoline formation effectively ( table 2 ) , despite extended reaction time or increased reaction temperature . solely the reaction at 60 c for 24 h gave 29% of 33c ( table 2 , entry 5 ) . under other conditions , we only detected trace amounts of product ( table 2 , entries 14 ) . then we turned to kelly s ticl4 method using conditions as shown in table 2 . for ticl4 mediated thiazoline formation , at 2540 c in 540 h , only 3034% yield was obtained ( entries 67 ) ; however , the yield improved to 72% when the reaction temperature was increased to 60 c ( table 2 , entry 8) . thiazoline - containing intermediates 33a d were immediately treated with zn - nh4oac to remove the troc group to avoid elimination of the o - troc group , providing 34a d in 5590% yield . in the preparation of 34a b , the percentage of their dehydration products was : dehyd-34b = 15.5% dehyd-34d trace > the removal of allyl esters of 34a d using pd(pph3)4/n - methylaniline provided acids 2a d . reactions were carried out using ph3p = o ( 8 equiv ) and tf2o ( 4 equiv ) for entries 15 . ticl4 ( 5 equiv ) for entries 68 ( 10 mg scale reactions ) or 2.53.0 equiv ticl4 used for > 30 mg scale reactions ) . this reaction first was carried out at 25 c for 24 h , when large amounts of starting material were still found by tlc and ms , and then this reaction was heated under reflux for another 16 h. reactions were monitored by ms , the bands of starting material and product on tlc were very close . products were isolated using preparative tlc plates . with 2a d in hand , we synthesized the final targets 1a d ( scheme 6 ) . fmoc - protected tripeptide 6(2a2c ) was treated with et2nh in mecn to liberate the corresponding amine and then coupled with acids 2a d to provide 36a d in yields of 7195% . pyaop was chosen as the coupling reagent in the preparation of 36a , c , d with acceptable results . however , for c34-nonmethyl - acid 2b ( table 3 ) , when pyaop or hatu were used as coupling reagents , product 36b was obtained in only low yield ( 1035% ) along with dedydration product ( dehyd-36b ) ( 520% isolated yield ) . one of the reasons for the low yield of 36b was that starting material 2b was consumed by intramolecular dehydration ( via elimination to form a double bond at c34c35 or intramolecular cyclization to form lactone between cooh and c35-oh of 2b ) . when we used depbt , a specific reagent for amine coupling , the desired product 36b was obtained in 72% yield and 13% of dehyd-36b was isolated , while only trace amount of intramolecular dehydration compound of 2b was detected . the cleavage of o - allyl ester by pd(pph3)4/n - methylaniline and the removal of fmoc by et2nh / mecn from linear precursors 36a d gave unmasked reactive precursors , which were then macrocyclized with pyaop or depbt in diluted solution . subsequent purification by semipreparative hplc afforded final targets 1a d in yields of 60% , 25% , 70% , and 45% , respectively . along with 1b and 1d , there were 10% and 5% dehydrated cyclized compounds isolated , respectively . the yields of cyclization and final total yields for the longest linear sequence from pivalaldehyde are summarized in table 4 . the most optimized yield ( 5.0% ) the lower yields of 1b and 1d resulted mainly from their dehydration propensity at c35 during the formation of the thiazoline ring and macrocyclization steps . however , the lower total yield of 1c is due to the lower efficiency of the thiazoline ring formation , presumably as a result of steric hindrance of gem - dimethyl at c34 . nevertheless , the prevention of dehydration of gem - dimethyl in the formation of the thiazoline ring ( 34c ) and the best yield ( 70% ) during macrocyclization ( 1c ) supported the utility and synthetic accessibility of the gem - dimethyl analogue at c34 . based on the reaction sequence : pivalaldehyde 7 4 3 2 1 . compounds 1b d retained potent activity compared with 1a in all biological assays . as hypothesized at the onset of this study and consistent with our previous data that the cytotoxic activity is independent of the configuration of methyl - c34 , we found that the nonmethylated compound ( 1b ) as well as the gem - dimethyl analogue ( 1c ) have similar antiproliferative activity between 1 and 2 nm ( table 5 ) . this indicates that the complexity of apratoxins by eliminating one chiral center ( c34 ) can be somewhat reduced . we have previously shown that apratoxins inhibit cotranslational translocation of secretory molecules , including receptors and growth factors , and therefore we measured representative key members of these protein classes . the low - nanomolar antiproliferative activity is paralleled by a similar potency in reducing levels of met proto - oncogene receptor ( met ) ( figure 2 ) , representative for receptor tyrosine kinases ( rtks ) overexpressed in cancers . we also measured secretion of the angiogenic vegf - a , which is potently inhibited even at subnanomolar concentrations by 1b and 1c with ic50 values of 300 and 470 we had been unable to predict the biological consequences of inverting the c30 configuration of the thiazoline ring . interestingly , the 30-epi-1a , compound 1d , showed superior , picomolar ( subnanomolar ) potency in all three assays , outperforming the other apratoxins by 23-fold ( table 5 , figure 2 ) . determined after 48 h ( n = 4 ) . sar for synthetic apratoxins by immunoblot analysis for rtk ( met ) levels . compounds 1a d were remarkably stable ( t1/2 > 24 h ) under aqueous conditions at physiological ( ph 7.4 ) and lysosomal ph ( 4.88 ) ( figures 3a , b ) and possessed excellent plasma and cellular stability ( figures 3c , d ) . under these conditions , the c34c35 dehydrated and hydrated compounds were probably also not interconverting because we also did not observe any hydration at c28c29 of the conjugated system in apratoxin a. we had been concerned about the tendency of apratoxins a , 1a , 1b , and 1d to dehydrate during synthesis as well as upon prolonged exposure to acidic organic solvents ( e.g. , chloroform ) , which could represent a major deactivation pathway for the apratoxins because the dehydrated compounds possess much reduced activity . while an issue during synthesis ( see above ) and in organic solvents , however , this appeared to not be a major concern in our biological in vitro systems . nevertheless , 1a and 1b were generally somewhat less stable than 1c , as expected ( figure 3 ) , especially under acidic conditions ( figure 3b ) . the stability of 1d was also slightly enhanced compared with that of 1a , suggesting that the configuration at c30 may affect the tendency to dehydrate ( possibly by changing the macrocycle conformation ) , assuming that dehydration is indeed the mode of primary apratoxin modification . in the synthesis , however , the dehydration propensity at c35 during the formation of the thiazoline ring and macrocyclization steps was slightly greater for 1d compared with 1a . microsomal metabolism of all apratoxins was strongly accelerated by nadph and stability was found to be low ( t1/2 < 5 min , table 6 ) , which may suggest that certain apratoxin biotransformation products could also retain activity , considering that 1a was extremely potent and active in vivo as well . in vitro stability of apratoxins under various conditions . apratoxins were incubated as indicated and extracted with ethyl acetate , subjected to lc - ms and monitored by using compound - specific mrm mode with harmine as internal standard . ( d ) cellular stability upon exposure to hct116 protein lysate ( 0.7 mg / ml ) . mean values are shown sd . even though 1c had slightly lower activity than our other synthetic apratoxins , it was still very potent in vitro and had the potential advantage that it can not dehydrate to form a conjugated system . therefore , we tested 1c for efficacy in the same hct116 xenograft mouse model as previously performed for 1a(2a ) and administered 1c at the previous efficacious dose for 1a ( 0.25 mg / kg , 5 g / mouse ) and a 2.5-fold lower dose ( 0.1 mg / kg , 2 g / mouse ) daily via intraperitoneal ( ip ) injection for 16 days . there was a clear dose - dependent tumor growth inhibition ( figure 4a ) . the higher dose strongly retarded the tumor growth , paralleling the effects of 1a . the lower dose showed a weaker yet pronounced effect ( figure 4a ) ; however , the tumor growth could only be inhibited by about 50% using 0.1 mg / kg . it is noteworthy that we did not observe signs of toxicity based on lack of both weight loss and abnormal behavior . although vegfr2 expression in hct116 xenografts was found to be low ( consistent with literature data ) , at the higher dose of 1c , there was a detectable reduction in vegfr2 expression levels , indicating target engagement in vivo ( figure 4b ) . dose - dependent in vivo activity of 1c using a hct116 xenograft mouse model . ( a ) subcutaneous tumor - bearing mice were injected daily ip with 1c ( n = 7 ) or vehicle ( n = 6 ) , and error bars indicate sem ( b ) at the end of the efficacy study , tumors were analyzed by immunoblot analysis for levels of an rtk . apratoxin s4 ( 1a ) along with its hitherto unknown c30 epimer ( 1d ) and two analogues with achiral c34 ( 1b , c ) were synthesized using improved procedures . the innovative points in the synthesis are : ( 1 ) preparation of homoallylic alcohol 12 from its tbs ether directly working up by cooling - concentration , which is critical to the scale up of aldehyde 7 , ( 2 ) leighton s silanes were introduced to efficiently prepare -hydroxy acid 4 , one key segment of composing apratoxins , ( 3 ) lialh4 was used instead of dibal - h to prepare amino aldehyde in the preparation of mocys part to greatly decrease the racemization , ( 4 ) kelly s thiazoline formation methods ( both ph3p = o / tf2o and ticl4 ) were developed to meet different substrate requirements , and ( 5 ) the optimized steps are efficient for the synthesis of 1a and viable to generate 1c and 1d . as hypothesized , sar studies demonstrated that 1b and 1c retain activity compared with 1a . unexpectedly , we identified 1d as the most potent apratoxin to date , exhibiting 23-fold improved in vitro activity , even though 1d still has the potential to be deactivated by dehydration . however , compound 1d was found to be stable during repurifications and stability tests . the propensity of apratoxins to dehydrate to form a c34c35 double bond is decreased with each methylation at c34 ; this is possibly a reason why the methylene - c34 has not been isolated from cyanobacteria but only the dehydrated form , apratoxin e ( figure 1 ) , which could have been formed enzymatically or nonenzymatically . while dehydration appears to not be a problem during in vitro incubations and stability studies , it may lead to apratoxin deactivation in vivo so that the corresponding gem - dimethyl compound 1c was further characterized and shown to possess in vivo antitumor efficacy . the low microsomal stability combined with the potent in vivo activity may suggest that apratoxin biotransformation products could play a role in the overall activity , and future experiments are aimed at characterizing the in vivo biotransformation products . overall , our study further corroborates that the development of this class of anticancer agents is warranted . tetrahydrofuran ( thf ) and diethyl ether ( et2o ) were distilled from sodium chips in the presence of a small amount of benzophenone ; ch2cl2 and toluene were distilled from cah2 ; mecn , n , n - dimethylformamide ( dmf ) were dried with 4 molecular sieves ( ms ) and meoh dried with 3 ms ; 4 m hydrochloric acid ( hcl ) solution in ethyl acetate was prepared by dissolving hcl gas ( yielding by dropping aqueous hydrochloric acid ( 34% ) to concentrated sulfuric acid ( 98% ) ) to ethyl acetate . all reactions were performed in heat - gun dried flasks ( 400 c under reduced pressure ) under an inert atmosphere of anhydrous ar unless otherwise noted . thin layer chromatography was performed on emd silica gel 60 f254 glass plates and preparative thin layer chromatography was performed on whatman silica gel 60 f254 glass plates ( layer thick 1000 m ) . nuclear magnetic resonance ( nmr ) spectra were recorded on a varian mercury 400 mhz , bruker avance ii 600 , bruker avance iii 600 mhz , or agilent vnmr 600 mhz spectrometer as indicated in the data list . chemical shifts for proton nuclear magnetic resonance ( h nmr ) spectra are reported in parts per million relative to the signal residual cdcl3 at 7.26 ppm . chemicals shifts for carbon nuclear magnetic resonance ( c nmr ) spectra are reported in parts per million relative to the center line of the cdcl3 triplet at 77.16 ppm . the abbreviations s , d , dd , ddd , dddd , t , q , br , and m stand for the resonance multiplicity singlet , doublet , doublet of doublets , doublet of doublet of doublets , doublet of doublet of doublet of doublets , triplet , quartet , broad and multiplet , respectively . optical rotation was measured on a perkin - elmer 341 polarimeter ( na d line ) using a microcell of 1 dm path length . high resolution mass spectra ( hrms ) data were obtained using an agilent - lc - tof mass spectrometer with an apci / esi multimode ion source detector . lr - ms data was obtained using a 3200 qtrap triple quadrupole mass spectrometer and detection by electrospray ionization - ms in the positive ion mode . the purity ( > 95% ) of all tested compounds was determined by hplc analysis ( shimadzu ) equipped with a phenomenex ultracarb ods column ( 250 mm 10 mm , 5 m ) and a shimadzu spd - m20a detector at 200/220 nm wavelength . the solution of tetra - n - butylammonium floride trihydrate ( tbaf ) ( 82.07 g , 260.116 mmol ) in thf ( 220 ml ) was added to the mixture of compound 11 ( 21.0 g , 86.705 mmol ) and 4 molecular sieves ( 22 g , predried at 450 c under reduced pressure 1 h ) in anhydrous thf ( 300 ml ) at 0 c . then the reaction mixture was stirred at room temperature overnight and filtered through a small pad of celite ( washed with diethyl ether ) . the filtrate was quenched with 200 ml of water , extracted with diethyl ether ( 300 ml 3 ) , washed with brine ( 200 ml 2 ) , dried over anhydrous mgso4 , concentrated with cooling / condensing fraction distillation system under moderate vacuum , and further concentrated by vigreux fraction distillation column . the concentrated mixture was purified by column chromatography eluted by 35% diethyl ether in pentane . the eluted product fractions were also concentrated by cooling / condensing fraction distillation system under moderate vacuum to give product 12 and further distilled by vigreux fraction distillation column to provide product 12 ( 10.5 g , 95% ) . h nmr ( 400 mhz , cdcl3 ) : 5.86 ( dddd , j = 14.4 , 10.4 , 8.8 , 6.0 hz , 1h ) , 5.14 ( m , 2h ) , 3.25 ( dd , j = 10.4 , 2.0 hz , 1h ) , 2.392.33 ( m , 1h ) , 1.98 ( ddd , j = 13.6 , 9.6 , 9.6 hz , 1h ) , 0.91 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 136.7 , 117.9 , 78.2 , 36.7 , 34.7 , 25.9 ppm . 4-methoxybenzyl-2,2,2-trichloroacetimidate ( 3.7 ml , 17.8 mmol ) and trifluoromethane sulfonic acid ( tfoh ) ( 7.9 l , 0.089 mmol ) was added sequentially to the solution of 16 ( 2.05 g , 8.9 mmol ) in thf ( 20 ml ) at 0 c . the resulting mixture was stirred at room temperature overnight and was then diluted with ethyl acetate ( 20 ml ) , quenched with saturated nahco3 ( 20 ml ) , extracted with ethyl acetate ( 20 ml 3 ) , dried with anhydrous mgso4 , and evaporated in vacuo . hexane ( 100 ml ) was added to the residue , which resulted in the precipitation of a white solid ( 2,2,2-trichloroacetimidate ) . the solid was filtered off , and the filtrate was concentrated and purified by column chromatography ( eluted by 2050% ethyl acetate in hexane ) to give product 17 ( 1.74 g , 56% , 100% brsm ) ( recovered starting material 1.08 g and used in next cycle ) . to the solution of 7 ( 234.1 mg , 0.801 mmol ) in ch2cl2 ( 8 ml ) was added ( s , s)-trans ez - crotylmix ( mixture of 18a and sc(otf)3 ) ( 943 mg , 1.602 mmol ) at room temperature . this mixture was stirred vigorously at the same temperature for 2.5 h , and then it was treated with 12 ml of et2o and 12 ml of 1n aq hcl . after this quenched mixture was stirred at room temperature for 30 min , it was filtered off to remove precipitated solid , extracted with et2o ( 15 ml 3 ) , washed with saturated nahco3 ( 20 ml 2 ) and brine ( 20 ml ) , dried with anhydrous mgso4 , evaporated in vacuo , and purified by chromatography column ( eluted by 3.54.5% ethyl acetate in hexane ) to give product 19a ( 245.7 mg , 88% ) as a colorless oil . to the solution of 7 ( 203.3 mg , 0.696 mmol ) in ch2cl2 ( 7 ml ) was added ( s , s)-18b ( 772.1 mg , 1.392 mmol ) and sc(otf)3 ( 28.5 mg , 0.058 mmol ) at 0 c . this mixture was stirred vigorously at the same temperature for 2.0 h , and then it was treated with 12 ml of et2o and 12 ml of 1n aq hcl . afterwards , the quenched mixture was stirred at room temperature for 30 min , filtered to remove the precipitate , extracted with et2o ( 15 ml 3 ) , washed with saturated nahco3 ( 20 ml 2 ) and brine ( 20 ml ) , dried with anhydrous mgso4 , evaporated in vacuo , and purified by column chromatography ( eluted by 4.2% ethyl acetate in hexane ) to give product 19b ( 197.6 mg , 85% ) as a colorless oil ; [ ]d 57.8 ( c 0.32 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.30 ( d , j = 8.4 hz , 2h ) , 6.86 ( d , j = 8.4 hz , 2h ) , 5.895.79 ( m , 1h ) , 5.175.13 ( m , 2h),4.63 ( d , j = 10.4 hz , 1h ) , 4.52 ( d , j = 10.4 , 1h ) , 3.79 ( s , 3h ) , 3.793.74 ( m , 1h ) , 3.11 ( dd , j = 9.2 , 2.4 hz , 1h ) , 2.302.24 ( m , 1h ) , 2.212.14 ( m , 1h ) , 2.001.90 ( br m , 1h ) , 1.65 ( ddd , j = 13.6 , 10.6 , 2.8 hz , 1h ) , 1.46 ( ddd , j = 14.0 , 8.8 , 4.0 hz , 1h ) , 1.35 ( ddd , j = 14.0 , 9.2 , 2.4 hz , 1h ) , 1.09 ( ddd , j = 13.6 , 10.4 , 2.0 hz , 1h ) , 0.97 ( d , j = 6.4 hz , 3h ) , 0.94 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 159.0 , 135.0 , 131.7 , 129.2 , 118.1 , 113.7 , 85.3 , 74.3 , 68.4 , 55.3 , 43.5 , 43.3 , 39.8 , 36.2 , 26.6 , 21.1 ppm . hrms ( esi ) m / z calcd for c21h34o3na ( m + na ) 357.2400 , found 357.2409 . to the solution of 19b ( 178.6 mg , 0.534 mmol ) in ch2cl2 ( 8 ml ) were added 2,6-lutidine ( 310 l , 2.672 mmol ) and tert - butyldimethylsilyl trifluoromethanesulfonate ( tbsotf ) ( 368.2 l , 1.603 mmol ) at 0 c under ar . after being stirred at the same temperature for 1.5 h , the reaction was quenched with meoh ( 5 ml ) and saturated aq nh4cl ( 7 ml ) , extracted with ethyl acetate ( 10 ml 4 ) , washed with brine ( 10 ml 2 ) , dried with anhydrous mgso4 , evaporated in vacuo , and purified by column chromatography ( eluted by 3.6% ethyl acetate in hexane ) to give product 20b ( 224.4 mg , 94% ) as a colorless oil ; [ ]d 49.0 ( c 0.31 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.28 ( d , j = 8.4 hz , 2h ) , 6.86 ( d , j = 8.8 hz , 2h ) , 5.865.76 ( m , 1h ) , 5.075.03 ( m , 2h ) , 4.65 ( d , j = 10.8 hz , 1h ) , 4.45 ( d , j = 10.8 hz , 1h ) , 3.863.80 ( m , 1h ) , 3.80 ( s , 3h ) , 3.08 ( dd , j = 7.2 , 3.6 hz , 1h ) , 2.312.20 ( m , 2h ) , 1.87 ( br m , 1h ) , 1.66 ( ddd , j = 13.2 , 9.2 , 2.8 hz , 1h),1.461.34 ( m , 2h ) , 1.06 ( d , j = 6.8 hz , 3h ) , 0.91 ( s , 9h ) , 0.86 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 159.0 , 135.2 , 131.9 , 128.9 , 117.0 , 113.7 , 85.6 , 73.9 , 69.8 , 55.4 , 43.9 , 43.4 , 40.5 , 36.2 , 26.8 , 26.6 , 26.1 , 21.0 , 18.2 , 4.1 , 4.3 ppm . hrms ( esi ) m / z calcd for c27h48o3sina ( m + na ) 471.3265 , found 471.3264 . to a solution of 20 ( 0.806 mmol ) in the mixture of ch2cl2 ( 5.0 ml ) and h2o ( 0.5 ml ) was added 2,3-dichloro-5,6-dibenzoquinone ( ddq ) ( 220 mg , 0.968 mmol ) at 0 c . the reaction mixture was stirred at the same temperature for 1 h , quenched with saturated aqueous nahco3 ( 10 ml ) , and filtered in vacuo . the organic layer was separated and the water layer was extracted with ch2cl2 ( 30 ml 3 ) . the organic phase was combined and washed with brine ( 20 ml 2 ) , dried with anhydrous mgso4 , filtered , and concentrated in vacuo . to the suspended solution of fmoc - pro - oh ( 549.5 mg , 1.629 mmol ) in toluene ( 5.0 ml ) were added n , n - diisopropylethylamine ( diea ) ( 435 l , 2.5 mmol ) and 2,4,6-trichlorobenzoyl chloride ( 390 l , 2.5 mmol ) at room temperature under argon , and the mixture was stirred at the same temperature for 30 min . then the crude alcohol in toluene ( 3.0 ml ) and dmap ( 350 mg , 2.862 mmol ) were added to the above mixture at 10 c . after being stirred at room temperature for 3 h , the reaction mixture was quenched and extracted with diethyl ether ( 10 ml 3 ) . the combined organic layer was washed with saturated nh4cl ( 15 ml 2 ) , saturated nahco3 ( 15 ml 2 ) , and brine ( 15 ml ) , dried over mgso4 , and concentrated in vacuo . the residue was purified by silica gel column chromatography ( eluted by 10% ethyl acetate in hexane ) to give ester 21 . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.787.75 ( m,2 h ) , 7.677.55 ( m , 2h ) , 7.427.38 ( m , 2h ) , 7.337.30 ( m , 2h ) , 5.855.71 ( m , 1h ) , 5.054.99 ( m , 2h ) , 4.80 ( dd , j = 8.4 , 2.0 hz , 1h ) , 4.534.40 ( m , 2h ) , 4.354.17 ( m , 2h ) , 3.813.71 ( m , 1h ) , 3.703.62 ( m , 1h ) , 3.603.50 ( m , 1h ) , 2.322.15 ( m , 3h ) , 2.141.93 ( m , 3h ) , 1.621.49 ( m , 3h ) , 1.391.30 ( m , 1h ) , 1.201.03 ( m , 1h ) , 0.95 ( d , j = 6.4 hz , 2h ) , 0.87 ( s , 9 h ) , 0.87 ( s , 9 h ) , 0.82 ( d , j = 6.4 hz , 1h ) , 0.050.02 ( m , 6h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.2 , 172.1 , 154.7 , 154.5 , 144.3 , 144.2 , 144.1 , 143.8 , 141.4 , 141.4 , 141.3 , 135.6 , 135.3 , 127.8 , 127.8 , 127.2 , 127.1 , 127.1 , 125.5 , 125.3 , 125.2 , 120.0 , 116.9 , 116.8 , 80.6 , 80.4 , 77.5 , 77.2 , 76.8 , 70.2 , 70.0 , 67.8 , 67.5 , 59.8 , 59.6 , 47.4 , 47.0 , 46.4 , 44.2 , 44.0 , 42.6 , 42.5 , 39.3 , 39.1 , 35.2 , 35.1 , 31.3 , 30.1 , 27.1 , 27.0 , 26.1 , 26.0 , 26.0 , 24.4 , 23.4 , 20.9 , 20.6 , 18.2 ppm . hrms ( esi ) m / z calcd for c39h57no5sina ( m + na ) 670.3898 , found 670.3920 . to the solution of 21 ( 0.646 mmol ) in dmf ( 6.0 ml ) were added oxone ( 1.588 g , 2.583 mmol ) , nahco3 ( 217.0 mg , 2.583 mmol ) , and oso4 ( 2.5% solution in tert - buoh ) ( 81 l , 6.5 mol ) at room temperature . after being stirred at the same temperature for 15 h , the reaction mixture was diluted with water ( 4 ml ) and tert - buoh ( 7.5 ml ) , and then naio4 ( 276.3 mg , 1.292 mmol ) was added . the reaction mixture was stirred at room temperature for an additional 5 h and poured into aqueous hcl ( 1 m for 4a , 0.5 m for 4b to ph 1 ; 25 ml ) and ch2cl2 ( 25 ml ) . the water layer was extracted with ch2cl2 ( 50 ml 3 ) . the combined ch2cl2 layer was washed with 10 wt % na2s2o3 ( 50 ml 3 ) and brine ( 50 ml 1 ) , dried over mgso4 , and concentrated in vacuo . the residue was purified by silica gel column chromatography to give product 4 as a white solid ( 4a eluted by 1725% ethyl acetate in hexane ; 4b eluted by 2.510% meoh in ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers , major ) : 7.75 ( d , j = 7.6 hz , 2h ) , 7.627.55 ( m , 2h ) , 7.39 ( dd , j = 7.6 , 7.4 hz , 2h ) , 7.337.29 ( m , 2h ) , 5.40 ( br , 1h ) , 4.91 ( d , j = 10.8 hz , 1h ) , 4.424.38 ( m , 1h ) , 4.344.29 ( m , 1h ) , 4.124.06 ( m , 1h ) , 3.683.62 ( m , 1h ) , 3.523.47 ( m , 1h ) , 2.442.43 ( m , 2h ) , 2.332.23 ( m , 1h ) , 2.081.91 ( m , 3h ) , 1.861.80 ( m , 1h ) , 1.75 ( dd , j = 13.6 , 2.4 hz , 1h ) , 1.66 ( dd , j = 14.4 , 2.0 hz , 1h ) , 1.331.26 ( m , 1h ) , 1.040.98 ( m , 1h ) , 0.98 ( d , j = 6.4 hz , 3h ) , 0.89 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers , major ) : 174.6 , 172.4,155.4 , 144.0 , 143.7 , 127.9 , 127.8 , 127.3 , 127.2 , 125.3 , 125.2 , 120.1 , 120.1 , 78.5 , 68.0 , 66.0 , 59.6 , 47.2 , 46.7 , 42.7 , 41.7 , 37.2 , 34.8 , 30.0 , 26.1 , 25.0 , 24.6 , 20.6 ppm . hrms ( esi ) m / z calcd for c32h41no7na ( m + na ) 574.2775 , found 574.2970 . to the solution of n - tosyl - d - val - oh ( 145.6 mg , 0.537 mmol ) in ch2cl2 ( 7 ml ) at 0 c under argon was added the solution of bh3 in thf ( 1 m , 537 l , 0.537 mmol ) dropwise . the resulting mixture was stirred at room temperature for 20 min and then cooled to 78 c . aldehyde 7 ( 157.0 mg , 0.537 mmol ) and methyl trimethylsilyl dimethylketene acetal ( 120.0 l , 0.591 mmol ) were added successively to the above mixture at 78 c . after being stirred at 78 c for 3 h , the reaction mixture was quenched with buffer ( ph 7 ; 8 ml ) and then it was warmed to room temperature and another 5 ml of buffer ( ph 7 ) was added . the quenched reaction mixture was extracted with et2o ( 25 ml 3 ) , washed with saturated nahco3 ( 15 ml 2 ) and brine ( 15 ml 2 ) , dried with anhydrous mgso4 , and purified by column chromatography ( eluted by 8.5% ethyl acetate in hexane ) to give product 23 as a colorless oil ( 171.5 mg , 81% ) ; [ ]d 55.8 ( c 0.12 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.29 ( d , j = 8.4 hz , 2h ) , 6.85 ( d , j = 8.4 hz , 2h ) , 4.63 ( d , j = 10.4 hz , 1h ) , 4.50 ( d , j = 10.4 hz , 1h ) , 3.77 ( s , 3h ) , 3.74 ( br m , 1h ) , 3.69 ( s , 3h ) , 3.09 ( dd , j = 9.2 , 2.4 hz , 1h ) , 2.47 ( br , 1h ) , 2.031.95 ( br m , 1h ) , 1.581.45 ( m , 2h ) , 1.371.30 ( m , 1h ) , 1.18 ( s , 6h ) , 1.031.00 ( m , 1h ) , 0.96 ( d , j = 6.4 hz , 3h ) , 0.93 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 178.3 , 159.0 , 131.6 , 129.2 , 113.7 , 85.2 , 74.4 , 74.2 , 55.3 , 51.9 , 47.3 , 39.7 , 38.2 , 36.2 , 26.8 , 26.6 , 22.1 , 20.9 , 20.6 ppm . hrms ( esi ) m / z calcd for c23h38o5na ( m + na ) 417.2611 , found 417.2628 . to the solution of 23 ( 223.8 mg , 0.568 mmol ) in the mixture of thf meoh h2o ( 7 ml3.5 ml0.7 ml ) was added aq lioh ( 119.1 mg in 2.8 ml h2o , 2.838 mmol ) . after being stirred at room temperature for 5 h , the reaction mixture was diluted with 10 ml of water , acidified by addition of aq hcl ( 2 m ) to ph 2 , extracted with ethyl acetate ( 10 ml 4 ) , washed with brine ( 10 ml 2 ) , dried with anhydrous mgso4 , and purified by column chromatography ( eluted by 8.517% acetone in hexane ) to give 24 ( 225 mg , 100% ) as a white solid ; [ ]d 52.3 ( c 0.26 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.30 ( d , j = 8.4 hz , 2h ) , 6.86 ( d , j = 8.4 hz , 2h ) , 4.63 ( d , j = 10.4 hz , 1h ) , 4.53 ( d , j = 10.4 hz , 1h ) , 3.80 ( d , j = 13.0 , 1h ) , 3.78 ( s , 3h),3.13 ( dd , j = 8.0 , 2.0 hz , 1h ) , 1.80 ( br m , 1h ) , 1.621.49 ( m , 2h ) , 1.401.34 ( m , 1h ) , 1.21 ( s , 3h ) , 1.19 ( s , 3h ) , 1.09 ( dd , j = 12.4 , 12.4 ) , 0.98 ( d , j = 6.4 hz , 3h ) , 0.95 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 182.9 , 159.0 , 131.4 , 129.3 , 113.7 , 85.2 , 74.3 , 74.3 , 55.3 , 47.1 , 39.4 , 37.9 , 36.2 , 26.8 , 26.6 , 22.3 , 20.8 , 20.2 ppm . hrms ( esi ) m / z calcd for c22h36o5na ( m + na ) 403.2455 , found 403.2472 . to the solution of compound 24 ( 222.4 mg , 0.585 mmol ) in dimethyl sulfoxide ( dmso ) ( 5.0 ml ) were added k2co3 ( 242.5 mg , 1.754 mmol ) and allyl bromide ( allylbr ) ( 99 l , 1.170 mmol ) at room temperature . after being stirred at the same temperature overnight , the reaction was quenched with water ( 10 ml ) and extracted with ethyl acetate ( 20 ml 4 ) . the combined organic layer was washed with brine ( 10 ml 5 ) , filtered , concentrated in vacuo , and purified by silica gel column chromatography ( eluted by 6.5% ethyl acetate in hexane ) to give product 25 ( 228.6 mg , 93% ) as a colorless oil ; [ ]d 56.0 ( c 0.175 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.30 ( d , j = 8.4 hz , 2h ) , 6.85 ( d , j = 8.4 hz , 2h ) , 5.965.86 ( m , 1h ) , 5.355.22 ( m , 2h ) , 4.64 ( d , j = 10.4 hz , 1h ) , 4.60 ( d , j = 5.6 hz , 2h ) , 4.50 ( d , j = 10.4 hz , 1h ) , 3.78 ( br m , 1h ) , 3.77 ( s , 3h ) , 3.10 ( dd , j = 8.0 , 2.0 hz , 1h ) , 2.54 ( br , 1h ) , 2.0 ( br m , 1h ) , 1.611.55 ( m , h ) , 1.49 ( ddd , j = 17.6 , 9.6 , 4.0 hz , 1h ) , 1.371.31 ( m , 1h ) , 1.21 ( s , 6h ) , 1.050.98 ( m , 1h ) , 0.97 ( d , j = 6.8 hz , 3h ) , 0.94 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 177.3 , 158.9 , 132.0 , 131.5 , 129.1 , 118.2 , 113.6 , 85.0 , 74.3 , 74.2 , 65.2 , 55.2 , 47.3 , 39.7 , 38.1 , 36.1 , 26.6 , 26.5 , 21.9 , 20.9 , 20.7 ppm . hrms ( esi ) m / z calcd for c25h40o5na ( m + na ) 443.2768 , found 443.2769 . to the solution of 25 ( 220.0 mg , 0.523 mmol ) in ch2cl2 ( 5.0 ml ) at 0 c under ar were added 4-dimethylaminopyridine ( dmap ) ( 1.3 mg , 10.5 mol ) , pyridine ( 423 l , 5.234 mmol ) , and 2,2,2-trichloroethoxylcarbonyl chloride ( troc - cl ) ( 554.5 mg/360.0 l , 2.617 mmol ) . after being stirred at 0 c for 10 min and room temperature for 1 h , the reaction was quenched with water ( 10 ml ) and extracted with ethyl acetate ( 15 ml 4 ) . the combined organic layer was washed with saturated nahco3 and brine , dried with mgso4 , concentrated in vacuo , and purified by silica gel column chromatography ( 2.51015% ethyl acetate in hexane ) to give 26 ( 295.1 mg , 95.0% ) ; [ ]d 7.6 ( c 0.37 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.27 ( d , j = 8.4 hz , 2h ) , 6.86 ( d , j = 8.4 hz , 2h ) , 5.965.86 ( m , 1h ) , 5.375.23 ( m , 3h ) , 4.78 ( d , j = 12.0 hz , 1h ) , 4.59 ( d , j = 5.6 hz , 2h ) , 4.55 ( d , j = 10.8 hz , 1h ) , 4.49 ( d , j = 10.8 hz , 1h ) , 4.30 ( d , j = 12.0 hz , 1h ) , 3.78 ( s , 3h ) , 3.05 ( dd , j = 9.6 , 2.0 hz , 1h),1.991.93 ( m , 1h ) , 1.75 ( br m , 1h ) , 1.50 ( ddd , j = 17.2 , 9.2 , 3.0 hz , 1h ) , 1.351.29 ( m , 1h ) , 1.27 ( s , 3h ) , 1.25 ( s , 3h ) , 1.081.01 ( m , 4h ) , 0.92 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 174.8 , 159.0 , 154.4 , 131.9 , 131.5 , 128.7 , 118.6 , 113.7 , 94.6 , 85.0 , 80.9,76.6 , 74.4 , 65.6 , 55.3 , 47.0 , 39.8 , 36.8 , 36.1 , 26.5 , 26.4 , 22.4 , 20.8 , 19.7 ppm . hrms ( esi ) m / z calcd for c28h41cl3o7na ( m + na ) 617.1810 , found 617.1832 . to a solution of 26 ( 291.5 mg , 0.491 mmol ) in a mixture of ch2cl2 ( 5.0 ml ) and h2o ( 0.5 ml ) was added 2,3-dichloro-5,6-dibenzoquinone ( ddq ) ( 133.6 mg , 0.589 mmol ) at 0 c . the reaction mixture was stirred at the same temperature for 1 h , quenched with saturated aqueous nahco3 ( 6 ml ) , and filtered in vacuo . the organic layer was separated , and the water layer was extracted with ch2cl2 ( 15 ml 4 ) . the organic phase was combined and washed with brine ( 3 15 ml ) , dried with anhydrous mgso4 , filtered , and concentrated in vacuo . this residue was used for the next reaction without further purification . to the suspended solution of fmoc - pro - oh ( 334.3 mg , 0.991 mmol ) in toluene ( 3.0 ml ) were added n , n - diisopropylethylamine ( diea ) ( 0.26 ml , 1.49 mmol ) and 2,4,6-trichlorobenzoyl chloride ( 233 l , 1.491 mmol ) at room temperature under argon , which was stirred at the same temperature for 10 min . then the crude alcohol in toluene ( 1.5 ml ) and dmap ( 212.8 mg , 1.742 mmol ) were added to the above mixture . after being stirred at room temperature overnight , the reaction mixture was quenched with water and extracted with diethyl ether ( 20 ml 4 ) . the combined organic layer was washed with saturated nh4cl ( 20 ml 2 ) , saturated nahco3 ( 20 ml 2 ) , and brine ( 20 ml ) , dried over mgso4 , and concentrated in vacuo . the residue was purified by silica gel column chromatography ( eluted by 10% ethyl acetate in hexane ) to give ester 27 ( 360.8 mg , 90.4% ) as a colorless oil ; [ ]d 58.9 ( c 0.124 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.777.75 ( m , 2h ) , 7.677.62 ( m , 2h ) , 7.40 ( dd , j = 7.4 , 7.2 hz , 2h ) , 7.347.29 ( m , 2h ) , 6.005.79 ( m , 1h ) , 5.345.12 ( m , 3h ) , 4.97 ( d , j = 12.0 hz , 0.6h ) , 4.87 ( d , j = 12.0 hz , 0.4h ) , 4.78 ( d , j = 10.0 hz , 1h ) , 4.69 ( d , j = 12.0 hz , 0.4h ) , 4.64 ( d , j = 12.0 hz , 0.6h ) , 4.594.16 ( m , 6h ) , 3.673.61 ( m , 1h ) , 3.593.48 ( m , 1h ) , 2.382.28 ( m , 0.6h ) , 2.242.16 ( m , 0.4h ) , 2.152.06 ( m , 1h ) , 2.041.93 ( m , 2h ) , 1.921.80 ( m , 1h ) , 1.551.48 ( m , 1h ) , 1.461.42 ( m , 1h ) , 1.381.29 ( m , 1h ) , 1.251.19 ( m , 6h ) , 1.151.07 ( m , 0.6h ) , 1.000.96 ( m , 1.6h ) , 0.89 ( s , 5.4h ) , 0.86 ( s , 3.6h ) , 0.67(d , j = 6.4 hz , 1.8h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 175.0,175.0 , 172.9 , 172.4 , 154.7 , 154.5 , 154.3 , 154.2 , 144.4 , 144.3 , 144.0 , 143.9 , 141.4 , 141.4 , 141.3 , 141.3 , 132.0 , 131.9 , 127.8 , 127.2 , 127.1 , 125.5 , 125.4 , 125.3 , 125.2 , 120.0 , 120.0 , 118.6 , 94.9 , 94.8 , 80.8 , 80.6 , 79.8 , 79.5 , 77.1 , 76.9 , 68.0 , 67.5 , 65.7 , 65.6 , 59.9 , 59.4 , 47.3 , 47.3 , 47.2 , 47.1 , 46.5 , 38.2 , 38.0 , 37.3 , 36.8 , 34.9 , 34.8 , 34.7 , 31.7 , 31.4 , 30.1 , 26.9 , 26.7 , 25.9 , 25.9 , 25.4 , 23.5 , 22.8 , 22.0 , 22.0 , 20.5 , 20.4 , 19.8 , 19.7 , 14.2 ppm . hrms ( esi ) m / z calcd for c40h50cl3no9na ( m + na ) 816.2443 , found 816.2420 . to a solution of 27 ( 349.3 mg , 0.440 mmol ) in thf ( 8 ml ) were added pd(pph3)4 ( 76.3 mg , 0.066 mmol ) and n - methyl aniline ( 144.3 l , 1.321 mmol ) at room temperature under argon . this reaction was protected with aluminum foil . after being stirred at room temperature for 1 h , the reaction mixture was concentrated in vacuo and purified by column chromatography ( eluted by acetone / hexane 1:3 ) to give acid 4c ( 354.1 mg , 95% ) as a pale - yellow solid ; [ ]d 51.1 ( c 0.131 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 9.90 ( br , 1h ) , 7.777.74 ( m , 2h ) , 7.687.63 ( m , 2h ) , 7.427.38 ( m , 2h ) , 7.347.29 ( m , 2h ) , 5.23 ( d , j = 10.4 hz , 0.4h ) , 5.13 ( d , j = 10.4 hz , 0.6h ) , 5.01 ( d , j = 12.0 hz , 0.6h ) , 4.90 ( d , j = 12.0 hz , 0.4h ) , 4.854.79 ( m , 1h ) , 4.70 ( d , j = 12.0 hz , 0.4h ) , 4.63 ( d , j = 12.0 hz , 0.6h ) , 4.524.17 ( m , 4h ) , 3.673.48 ( m , 1h ) , 2.372.27 ( m , 0.6h ) , 2.242.19 ( m , 0.4h ) , 2.162.10 ( m , 1h ) , 2.011.83 ( m , 3h ) , 1.781.69 ( m , 0.4h ) , 1.621.49 ( m , 1.6h ) , 1.431.35 ( m , 1h ) , 1.311.20 ( m , 6h ) , 1.091.00 ( m , 1h ) , 1.01 ( d , j = 6.4 hz , 1.2 h ) , 0.94 ( s , 5.4h ) , 0.87 ( s , 3.6h ) , 0.69 ( d , j = 6.4 hz , 1.8h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 181.1 , 180.7 , 172.8 , 172.3 , 154.8 , 154.4 , 154.2 , 144.3 , 144.1 , 143.9 , 143.7 , 141.3 , 141.3 , 141.2 , 141.2 , 135.1 , 135.0 , 135.0 , 130.6 , 128.1 , 128.1 , 128.0 , 127.7 , 127.1 , 127.1 , 127.0 , 125.5 , 125.3 , 125.2 , 125.1 , 120.0 , 119.9 , 94.9 , 94.8 , 80.5 , 80.3 , 79.8 , 79.4 , 77.0 , 76.8 , 68.0 , 67.6 , 59.8 , 59.3 , 47.2 , 47.1 , 46.9 , 46.4 , 38.1 , 37.5 , 37.1 , 36.7 , 34.9 , 34.7 , 34.6 , 34.5 , 31.6 , 31.3 , 30.0 , 29.1 , 29.1 , 26.7 , 26.5 , 25.9 , 25.3 , 24.3 , 23.5 , 22.7 , 22.2 , 21.9 , 20.8 , 20.4 , 19.9 , 19.6 , 19.4 , 18.8 , 14.2 , 11.5 ppm . hrms ( esi ) m / z calcd for c37h46cl3no9na ( m + na ) 776.2130 , found 776.2149 . to the solution of weinreb amide 28 ( 2.505 g , 4.945 mmol ) in thf ( 50 ml ) was added lialh4 ( 234.6 mg , 6.182 mmol ) in one portion at 0 c . after being stirred at 0 c for 30 min , the reaction mixture was quenched with 0.2n aq khso4 ( 30 ml ) and extracted with et2o ( 50 ml 3 ) . the combined organic layer was washed with 1n aq hcl ( 30 ml 3 ) and brine ( 30 ml 3 ) , dried with anhydrous mgso4 , and evaporated in vacuo to give the crude aldehyde 29 , which was used in the next step without further purification . to the crude aldehyde 28 in toluene ( 30 ml ) was added ph3p = chco2et ( 3.101 g , 8.901 mmol ) at 0 c under ar . after being stirred at room temperature for 3 h , the reaction mixture was concentrated in vacuo and purified by column chromatography ( eluted by 1217% ethyl acetate in hexane ) to give product(s ) 30 as a colorless oil . yield 88% , 2 steps ; [ ]d + 6.0 ( c 0.20 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.447.42 ( m , 6h ) , 7.317.27 ( m , 6h ) , 7.247.20 ( m , 3h ) , 6.72 ( dd , j = 15.6 , 4.4 hz , 1h ) , 5.84 ( d , j = 15.6 hz , 1h ) , 4.80 ( d , j = 8.4 hz , 1h ) , 4.29 ( br , 1h ) , 4.17 ( q , j = 7.2 hz , 2h ) , 2.532.41 ( m , 2h ) , 1.45 ( s , 9h ) , 1.27 ( t , j = 7.2 hz , 3h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 169.9 , 154.7 , 146.6 , 144.3 , 129.5 , 128.0 , 126.8 , 121.5 , 79.7 , 67.0 , 60.4 , 50.5 , 36.2 , 28.5 , 14.2 ppm . hrms ( esi ) m / z calcd for c31h35no4sna ( ( m + na ) 540.2210 , found 540.2223 . to the solution of compound 30 ( 3.379 g , 6.532 mmol ) in 95% etoh ( 35 ml ) was added nabh4 ( 247.1 mg , 6.532 mmol ) at room temperature . the resulting mixture was stirred at room temperature for 30 h and then quenched with water ( 50 ml ) and extracted with et2o ( 50 ml 4 ) . the combined organic layer was dried with anhydrous mgso4 , evaporated in vacuo , and purified by column chromatography ( eluted with the mixture of ch2cl2/hexane / acetone from 50:148:2 50:98:2 50:48:2 ) to give product 31 ( 1.187 g , 35% ) as a thick colorless oil . h nmr ( 400 mhz , cdcl3 ) : 7.427.40 ( m , 6h ) , 7.307.27 ( m , 6h ) , 7.237.19 ( m , 3h ) , 4.49 ( d , j = 9.2 hz , 1h ) , 4.10 ( q , j = 7.2 hz , 2h ) , 3.64 ( br , 1h ) , 2.34 ( br m , 2h ) , 2.21 ( t , j = 7.6 hz , 2h ) , 1.781.59 ( m , 2h ) , 1.43 ( s , 9h ) , 1.23 ( t , j = 7.2 hz , 3h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 173.3 , 155.3 , 144.7 , 129.7 , 128.0 , 126.8 , 79.4 , 66.7 , 60.5 , 49.6 , 37.2 , 31.1 , 29.7 , 28.5 , 14.3 ppm . hrms ( esi ) m / z calcd for c31h37no4sna ( m + na ) 542.2336 , found 542.2331 . to the solution of 31 ( 1.045 g , 2.013 mmol ) in 95% ethanol ( 7.5 ml ) was added aq naoh ( 1 m , 4.0 ml ) at room temperature . after being stirred at the same temperature for 2 h , the reaction mixture was diluted with water ( 10 ml ) , acidified with 10.5 m aq hcl to ph 45 , and extracted with diethyl ether ( 20 ml 3 ) . the combined organic layer was dried over mgso4 , filtered , and concentrated in vacuo to give crude acid 32 , which was used in the next step without further purification . to the above crude acid 32 solution in dmso ( 15 ml ) was added k2co3 ( 556.5 mg , 4.027 mmol ) and allyl bromide ( 255.5 l , 3.020 mmol ) at room temperature . after being stirred at room temperature 5 h , the reaction was quenched with water ( 30 ml ) and extracted with ethyl acetate ( 50 ml 3 ) . the combined organic layer was washed with brine , filtered , and concentrated in vacuo , and the residue was purified by column chromatography on silica gel ( eluted by 10% ethyl acetate in hexane ) to give product 5 as a colorless oil . yield 0.75 g , 70% : [ ]d + 10.0 ( c 0.16 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 ) : 7.427.41 ( m , 6h ) , 7.317.27 ( m , 6h ) , 7.237.20 ( m , 3h ) , 5.955.85 ( m , 1h ) , 5.325.21(m , 2h ) , 4.55 ( d , j = 5.6 hz , 2h ) , 4.49 ( d , j = 8.8 hz , 1h ) , 3.65 ( br m , 1h ) , 2.34 ( br m , 2h ) , 2.26 ( t , j = 7.6 hz , 2h ) , 1.801.62 ( m , 2h ) , 1.44 ( s , 9h ) ppm . c nmr ( 100 mhz , cdcl3 ) : 172.9 , 155.3 , 144.7 , 132.2 , 129.6 , 128.1 , 126.8 , 118.3 , 79.4 , 66.7,65.3 , 49.5 , 37.2 , 31.0 , 29.7 , 28.5 ppm . hrms ( esi ) m / z calcd for c32h37no4sna ( ( m + na ) 554.2336 , found 554.2341 . to the solution of 5 ( 169.6 mg , 0.319 mmol ) in ch2cl2 ( 4 ml ) were added 2,6-lutidine ( 556 l , 4.790 mmol ) and trimethylsilyl trifluoro - methanesulfonate ( tmsotf ) ( 694 l , 3.832 mmol ) dropwise at room temperature under argon . after being stirred at the same temperature for 1.5 h , the reaction mixture was quenched with meoh ( 6 ml ) and water ( 10 ml ) at 0 c and extracted with ch2cl2 ( 15 ml 4 ) . the combined organic layer was washed with brine , dried over anhydrous mgso4 , and evaporated in vacuo to give the crude free amine of 5 , which was used in next step without further purification . to the crude free amine of 5 ( 1.3 equiv ) in ch2cl2 ( 4 ml ) were added corresponding acid 4 ( based in scheme 5 ) ( 0.245 mmol , 1 equiv ) , coupling reagent ( cr , 0.368 mmol , 1.5 equiv ) , and diea ( 140 l , 0.735 mmol , 3.0 equiv ) at room temperature or 0 c . after being stirred at room temperature for 2.524 h , the resulting reaction mixture was evaporated in vacuo and purified by column chromatography , eluting with ethyl acetate in hexane to give product 3a , c , d or 34 as a colorless oil . from 4a , 5a ; cr bep added at 0 c ; reaction time 2.5 h ; yield 245.6 mg , 87% ) . from 4b , 5a ; cr hatu added at rt , reaction time 3.0 h ; yield 193.8 mg , 82% ; [ ]d 31.2 ( c 0.24 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.74 ( d , j = 7.6 hz , 2h ) , 7.637.54 ( m , 2h ) , 7.417.36 ( m , 8h ) , 7.307.15 ( m , 11h ) , 6.69 ( d , j = 8.8 hz , 0.84h ) , 6.06 ( d , j = 8.4 hz , 0.16h ) , 5.925.77 ( m , 1h ) , 5.305.15 ( m , 2h ) , 4.89 ( d , j = 11.2 hz , 0.84h ) , 4.79 ( d , j = 10.4 hz , 0.16h ) , 4.534.44 ( m , 2h ) , 4.394.29 ( m , 2h ) , 4.234.16 ( m , 1h ) , 4.01(br m , 1h ) , 3.953.85 ( m , 1h ) , 3.79 ( br , 1h ) , 3.663.61 ( m , 1h ) , 3.583.44 ( m , 1h ) , 2.402.15 ( m , 6h ) , 2.112.01 ( m , 3h ) , 1.981.88 ( m , 2h ) , 1.851.75 ( m , 2h ) , 1.711.60 ( m , 3h ) , 1.551.47 ( m , 1h ) , 1.401.30 ( m , 1h ) , 1.040.97 ( m , 1h ) , 0.96 ( d , j = 6.8 hz , 2.52h ) , 0.88 ( s , 9h ) , 0.77 ( d , j = 6.8 hz , 0.48h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.7 , 172.3 , 172.0 , 155.2 , 144.8 , 144.7 , 144.0,143.9 , 141.4 , 132.3 , 129.7 , 128.1 , 128.0 , 127.8 , 127.3 , 127.2 , 126.9 , 126.8 , 125.2 , 125.2 , 120.1 , 120.1 , 118.3 , 78.7 , 67.7 , 66.6 , 66.3 , 65.2 , 59.6 , 47.9 , 47.3 , 46.6 , 44.3 , 42.9 , 42.2 , 41.4 , 38.0 , 37.1 , 36.8 , 34.9 , 34.6 , 31.7 , 31.3 , 31.0 , 30.0 , 29.8 , 29.3 , 26.1 , 25.2 , 24.5 , 23.5 , 22.8 , 20.7 , 14.3 ppm . hrms ( esi ) m / z calcd for c59h68n2o8sna ( m + na ) 987.4589 , found 987.4628 . from 4c , 5a ; cr pyaop added at rt , reaction time 24 h ; yield 254.3 mg , 89% ; [ ]d 48.5 ( c 0.20 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.787.75 ( m , 2h ) , 7.67 ( d , j = 7.6 hz , 0.6h ) , 7.62 ( d , j = 7.2 hz , 1.4h ) , 7.417.38 ( m , 8h ) , 7.347.27 ( m , 8h ) , 7.227.20 ( m , 3h ) , 6.02 ( d , j = 8.0 hz , 0.4h ) , 5.96 ( d , j = 8.4 hz , 0.6 h ) , 5.925.80 ( m , 1h ) , 5.305.18 ( m , 2h ) , 5.13 ( d , j = 10.0 hz , 0.4h ) , 5.04 ( d , j = 10.0 hz , 0.6h ) , 4.95 ( d , j = 12.0 hz , 0.6h ) , 4.83 ( d , j = 12.0 hz , 0.4h ) , 4.794.75 ( m , 1h ) , 4.70 ( d , j = 12.0 hz , 0.4h ) , 4.66 ( d , j = 12.0 hz , 0.6h ) , 4.524.34 ( m , 4.4h ) , 4.284.23 ( m , 1h ) , 4.204.16 ( m , 0.6h ) , 3.993.87 ( m , 1h ) , 3.673.45 ( m , 2h ) , 2.362.27 ( m , 2.6h ) , 2.242.16 ( m , 2.4h ) , 2.12 ( br m , 1h ) , 2.011.90 ( m , 2h ) , 1.851.74 ( m , 3h ) , 1.531.44 ( m , 2h ) , 1.371.27 ( m , 1h ) , 1.191.16 ( m , 6h ) , 1.061.00 ( m , 1h ) , 0.97 ( d , j = 6.4 hz , 1.8h ) , 0.88 ( s , 5.4h ) , 0.85 ( s , 3.6h ) , 0.69 ( d , j = 6.4 hz , 1.2h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 174.2 , 172.7 , 172.6 , 172.2 , 154.6 , 154.3 , 154.2 , 154.1 , 144.5 , 144.5 , 144.3 , 144.1 , 143.9 , 143.7 , 141.3 , 141.2 , 132.1 , 132.0 , 129.5 , 128.0 , 127.7 , 127.1 , 127.0 , 126.8 , 125.4 , 125.3 , 125.1 , 125.1 , 120.0 , 119.9 , 118.3 , 94.8 , 94.8 , 81.6 , 81.4 , 79.6 , 79.4 , 79.3 , 76.7 , 67.8 , 67.4 , 66.5 , 65.2 , 59.8 , 59.3 , 48.3 , 47.2 , 47.0 , 46.8 , 46.3 , 38.1 , 37.8 , 36.8 , 36.3 , 36.3 , 34.8 , 34.7 , 34.5 , 31.6 , 31.3 , 30.8 , 30.0 , 26.8 , 26.5 , 25.8 , 25.8 , 25.3 , 24.4 , 23.4 , 23.1 , 22.7 , 20.4 , 20.3 , 20.1 , 14.2 ppm . hrms ( esi ) m / z calcd for c64h73cl3n2o10sna ( m + na ) 1189.3944 , found 1189.3964 . from 4a , 5b ; cr pyaop added at rt , reaction time 24 h ; yield 257.0 mg , 91% ; [ ]d 40.0 ( c 0.05 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.877.78 ( m , 2h ) , 7.717.67 ( dd , j = 8.4 , 8.0 hz , 2h),7.517.46 ( m , 8h ) , 7.407.28 ( m , 11h ) , 6.17 ( d , j = 8.4 hz , 0.6h ) , 6.025.92 ( m , 1h ) , 5.51 ( d , j = 8.4 hz , 0.4h ) , 5.405.30 ( m , 2h ) , 5.10 ( ddd , j = 7.6 , 7.4 , 7.2 hz , 1h ) , 4.974.80 ( m , 2.4h ) , 4.75 ( d , j = 12.0 hz , 0.6h ) , 4.624.30 ( m , 6h ) , 4.00 ( br m , 1h ) , 3.743.55 ( m , 2h ) , 2.602.57 ( m , 0.4h ) , 2.422.23 ( m , 6.6 h ) , 2.06 ( br m , 2h ) , 1.981.86 ( m , 1h ) , 1.821.70 ( m , 3h ) , 1.661.58 ( m , 2h ) , 1.551.30 ( m , 1h ) , 1.24 ( d , j = 6.8 hz , 1.8h ) , 1.20 ( d , j = 7.2 hz , 1.2 h ) , 1.07 ( d , j = 6.0 hz , 1.8h ) , 0.98 ( s , 3.6h ) , 0.96 ( s , 5.4h ) , 0.88 ( d , j = 6.4 hz , 1.2h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.8 , 172.8 , 172.6 , 172.5 , 172.4 , 172.3 , 154.9 , 154.5 , 153.7 , 153.7 , 144.6 , 144.5 , 144.2 , 144.0 , 143.8 , 141.4 , 141.2 , 132.2 , 129.8 , 129.6 , 128.1 , 128.0 , 127.8 , 127.3 , 127.2 , 127.1 , 126.9 , 126.9 , 125.7 , 125.5 , 125.2 , 120.0 , 118.6 , 118.5 , 79.5 , 79.2 , 79.0 , 78.7 , 76.7 , 68.0 , 67.5 , 66.8 , 66.7 , 65.4 , 65.4 , 59.8 , 59.5 , 48.1 , 47.3 , 47.3 , 47.1 , 46.4 , 45.7 , 45.4 , 38.3 , 37.6 , 37.1 , 36.6 , 36.5 , 35.1 , 34.8 , 34.8 , 31.7 , 31.4 , 29.9 , 30.1 , 29.8 , 29.2 , 29.2 , 26.2 , 26.1 , 26.0 , 25.9 , 25.4 , 24.4 , 23.5 , 22.8 , 20.6 , 20.2 , 14.3 , 14.0 , 13.8 ppm . hrms ( esi ) m / z calcd for c63h71cl3n2o10sna ( m + na ) 1175.3787 , found 1175.3805 . to the solution of compound 35 ( 166.3 mg , 0.172 mmol ) and pyridine ( 140 l , 1.742 mmol ) in ch2cl2 ( 5.0 ml ) were added 2,2,2-trichloroethoxylcarbonyl chloride ( troc - cl ) ( 182.6 mg/118.7 l , 0.862 mmol ) and 4-dimethylaminopyridine ( dmap)(0.36 mg , 2.93 mol ) at 0 c . after being stirred at the same temperature for 1 h the water layer was extracted with ethyl acetate ( 20 ml 4 ) . the combined organic layer was washed with 5% nahco3 ( 20 ml 2 ) and brine ( 20 ml ) , dried with mgso4 , and concentrated in vacuo . the residue was purified by chromatography column on silica gel ( 2030% ethyl acetate in hexane ) to give 3b ( 156.5 mg , 80% ) ; [ ]d 45.0 ( c 0.111 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.777.74 ( m , 2h ) , 7.67 ( d , j = 7.6 hz , 0.4h),7.60 ( d , j = 7.6 hz , 1.6h ) , 7.417.37 ( m , 8h ) , 7.337.17 ( m , 11h ) , 6.13 ( d , j = 8.4 hz , 0.6h ) , 5.925.80 ( m , 1h ) , 5.62 ( d , j = 8.4 hz , 0.4h ) , 5.305.18 ( m , 2.4h ) , 4.854.80 ( m , 1.2h ) , 4.77 ( d , j = 12.0 hz , 0.4h ) , 4.61 ( d , j = 12.0 hz , 0.4h ) , 4.54 ( d , j = 12.0 hz , 0.6h ) , 4.534.45 ( m , 3h ) , 4.404.30 ( m , 1.4h ) , 4.264.18 ( m , 1.6h ) , 3.933.82 ( m , 1h ) , 3.663.60 ( m , 1h ) , 3.583.45 ( m , 1h ) , 2.542.56 ( m , 4h ) , 2.222.10 ( m , 3h ) , 2.001.85 ( m , 3h ) , 1.751.60 ( m , 2h ) , 1.551.24 ( m , 3h ) , 0.99 ( d , j = 6.4 hz , 1.8h ) , 0.88 ( s , 3.6h ) , 0.87 ( s , 5.4h ) , 0.80 ( d , j = 6.4 hz , 1.2 h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.8 , 172.7 , 172.7 , 172.3 , 168.7 , 168.3 , 154.9 , 154.4 , 153.6 , 153.5 , 144.6 , 144.6 , 144.2 , 144.1 , 143.9 , 143.8 , 141.3 , 141.3 , 132.2 , 132.1 , 129.6 , 128.0 , 128.0 , 127.8 , 127.8 , 127.1 , 126.9 , 126.8 , 125.5 , 125.4 , 125.2 , 120.0 , 120.0 , 118.4 , 118.3 , 94.8 , 94.8 , 79.5 , 79.1 , 76.7 , 76.6 , 75.3 , 74.8 , 67.8 , 67.5 , 65.3 , 65.2 , 59.8 , 59.5 , 48.4 , 47.3 , 47.0 , 46.5 , 41.6 , 41.0 , 39.8 , 39.4 , 38.1 , 37.7 , 36.4 , 36.3 , 35.0 , 34.7 , 31.7 , 31.3 , 29.8 , 29.1 , 25.9 , 25.9 , 25.4 , 24.4 , 23.4 , 22.7 , 20.8 , 20.7 , 14.2 ppm . hrms ( esi ) m / z calcd for c62h69cl3n2o10sna ( m + na ) 1161.3631 , found 1161.3634 . to the solution of triphenylphosphine oxide ( 223.3 mg , 0.802 mmol ) in ch2cl2 ( 1 ml ) was added dropwise trifluoromethanesulfonic anhydride ( tf2o ) ( 68 l , 0.401 mmol ) at 0 c under argon . after being stirred at the same temperature for 10 min , compound 3 ( 0.100 mmol ) in ch2cl2 ( 0.5 ml ) the reaction mixture was stirred at the same temperature for 30 min for 3a/3b and 3 h for 3d . this reaction was monitored by mass spectrometry and was quenched with saturated nahco3 ( 6 ml ) at 0 c when starting material disappeared . the aqueous layer was extracted with ethyl acetate ( 10 ml 4 ) , washed with brine ( 10 ml ) , dried with mgso4 , filtered , and concentrated in vacuo to give troc protected thiazoline intermediate 33a , b , or d. the residue was used in the next step immediately without further purification . the above residue 33 was dissolved in thf ( 4 ml ) , and then aqueous nh4oac ( 1 m , 1.0 ml ) and zinc powder ( freshly activated with 1 m aqueous hcl ) ( 100 mg ) were added at room temperature . after being stirred at the same temperature for 30 min , ethyl acetate ( 5 ml ) and brine ( 5 ml ) and the aqueous layer was extracted with ethyl acetate ( 5 ml 4 ) . the combined organic layer was dried with mgso4 , filtered , concentrated in vacuo , and purified by column chromatography on silica gel ( eluted by ethyl acetate / hexane 1:3 , v / v ) to give thiazoline ring product 34a , b , or d as a colorless oil . yield 53.2 mg , 76% ; [ ]d 78.0 ( c 0.10 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.74 ( d , j = 7.6 hz , 2h ) , 7.63 ( dd , j = 5.6 , 6.0 hz , 1.6 h ) , 7.56 ( d , j = 7.6 hz , 0.4h ) , 7.37 ( dd , j = 7.2 , 7.2 hz , 2h ) , 7.327.27 ( m , 2h ) , 5.935.83 ( m , 1h ) , 5.305.19 ( m , 2h ) , 4.90 ( d , j = 10.8 hz , 0.8h ) , 4.83 ( d , j = 9.6 hz , 0.2h ) , 4.584.51 ( m , 2h ) , 4.464.34 ( m , 3.8h ) , 4.284.18 ( m , 1.2h ) , 3.97 ( br m , 1h ) , 3.683.61 ( m , 2h ) , 3.573.47 ( m , 1h ) , 3.33 ( dd , j = 10.4 , 8.8 hz , 0.2h ) , 3.24 ( dd , j = 10.4 , 8.8 hz , 0.8h ) , 2.88 ( dd , j = 10.0 , 8.4 hz , 0.2h ) , 2.81 ( dd , j = 10.4 , 8.4 hz , 0.8h ) , 2.552.48 ( m , 4h ) , 2.292.19 ( m , 1h ) , 2.081.80 ( m , 5h ) , 1.751.58 ( m , 2h ) , 1.481.25 ( m , 2h ) , 1.040.97 ( m , 1h ) , 0.96 ( d , j = 6.4 hz , 2.4h ) , 0.87 ( s , 9h ) , 0.79 ( d , j = 6.4 hz , 0.6h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.9 , 172.9 , 172.8 , 172.3 , 169.2 , 169.1 , 154.9 , 154.3 , 144.3 , 144.1 , 144.0 , 143.8 , 141.3 , 141.3 , 141.2 , 132.2 , 132.2 , 127.6 , 127.6 , 127.1 , 127.0 , 127.0 , 127.0 , 125.4 , 125.3 , 125.3 , 125.2 , 79.5 , 78.5 , 76.0 , 75.8 , 67.8 , 67.7 , 67.2 , 66.7 , 65.2 , 65.1 , 59.5 , 47.2 , 47.1 , 47.0 , 46.5 , 42.9 , 42.2 , 42.0 , 41.9 , 38.0 , 37.9 , 37.4 , 34.8 , 34.7 , 34.6 , 31.6 , 31.5 , 31.4 , 31.2 , 30.4 , 29.9 , 26.0 , 25.9 , 25.7 , 25.3 , 25.1 , 24.5 , 23.3 , 22.7 , 20.6 , 20.5 , 14.2 ppm . hrms ( esi ) m / z calcd for c40h52n2o7sna ( m + na ) 727.3387 , found 727.3399 . yield 57.0 mg , 79% ; [ ]d 22.5 ( c 0.12 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.76 ( d , j = 7.2 hz , 2h ) , 7.63 ( dd , j = 6.6 , 6.4 hz , 1.7 h ) , 7.57 ( d , j = 7.2 hz , 0.3h ) , 7.39 ( dd , j = 7.2 , 7.2 hz , 2h ) , 7.30 ( dd , j = 7.4 , 7.2 hz , 2h ) , 5.945.85 ( m , 1h ) , 5.315.20 ( m , 2h ) , 4.88 ( d , j = 10.0 hz , 0.7h ) , 4.81 ( d , j = 8.8 hz , 0.3h ) , 4.594.51 ( m , 2.3h ) , 4.454.33 ( m , 3h ) , 4.314.18 ( m , 1.7h ) , 3.823.72 ( m , 0.7h ) , 3.683.62 ( m , 1.3h ) , 3.583.49 ( m , 1.3h ) , 3.353.24 ( m , 1h ) , 2.902.85 ( m , 0.3h ) , 2.81 ( dd , j = 10.8 , 7.6 hz , 0.7h ) , 2.722.65 ( m , 0.7h ) , 2.612.44 ( m , 2.3h ) , 2.342.18 ( m , 1.7h ) , 2.101.89 ( m , 4.4h ) , 1.82 ( m , 0.7h ) , 1.701.57 ( m , 2h ) , 1.371.29 ( m , 1h ) , 1.19 ( d , j = 7.0 hz , 0.9h ) , 1.17 ( d , j = 7.0 hz , 2.1h ) , 1.061.00 ( m , 1h ) , 0.96 ( d , j = 6.4 hz , 2.1h ) , 0.87 ( s , 9h ) , 0.79 ( d , j = 6.4 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 174.2 , 173.1 , 173.0 , 172.8 , 172.5 , 155.0 , 154.5 , 144.4 , 144.3 , 144.1 , 143.9 , 141.4 , 141.4 , 141.3 , 132.3 , 132.3 , 128.0 , 127.7 , 127.4 , 127.2 , 127.1 , 125.6 , 125.4 , 125.3 , 125.3 , 121.0 , 120.0 , 118.4 , 118.3 , 79.6 , 78.6 , 77.4 , 76.2 , 75.7 , 71.5 , 71.5 , 70.7 , 67.9 , 67.8 , 65.3 , 65.3 , 59.7 , 59.7 , 47.3 , 47.2 , 47.1 , 46.6 , 46.0 , 45.3 , 40.4 , 39.3 , 38.2 , 37.8 , 37.4 , 37.3 , 34.8 , 34.7 , 31.7 , 31.5 , 31.3 , 30.3 , 30.2 , 30.1 , 29.8 , 26.1 , 26.1 , 25.9 , 25.5 , 25.3 , 24.6 , 23.4 , 20.7 , 20.6 , 16.3 , 15.8 ppm . hrms ( esi ) m / z calcd for c41h54n2o7sna ( m + na ) 741.3544 , found 741.3567 . to the solution of 3c ( 97.8 mg , 0.084 mmol ) in 1,2-dichloroethane ( 5 ml ) was added ticl4 ( 1 m in ch2cl2 , 0.294 ml , 0.293 mmol , 3.5 equiv ) at room temperature . the resulting solution was heated to 60 c and stirred at this temperature for 2.5 h. this reaction was monitored by mass spectrometry . when the starting material was consumed completely , the reaction was cooled to 0 c and quenched with saturated aq nahco3 ( 7 ml ) , stirred at room temperature for another 10 min , extracted with ethyl acetate ( 10 ml 4 ) , dried over anhydrous mgso4 , filtered , and evaporated in vacuo to give crude intermediate 33c , which was used in the next step without further purification . the above crude 33c was dissolved in thf ( 4 ml ) , and then aqueous nh4oac ( 1 m , 1.0 ml ) and zinc powder ( freshly activated with 1 m aqueous hcl ) ( 80 mg ) were added at room temperature . after being stirred at the same temperature for 30 min , to the reaction the aqueous layer was extracted with ethyl acetate ( 7 ml 4 ) . the combined organic layer was dried with mgso4 , filtered , concentrated in vacuo , and purified by column chromatography on silica gel ( eluted by ethyl acetate / hexane 1:3 , v / v ) to give thiazoline ring product 34c ( 101.3 mg , 55% ) as a colorless oil ; [ ]d 80.8 ( c 0.12 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.767.74 ( m , 2h ) , 7.667.61 ( m , 1.7h ) , 7.57 ( d , j = 7.2 hz , 0.3h ) , 7.39 ( dd , j = 7.4 , 7.2 hz , 2h ) , 7.317.28 ( m , 2h ) , 5.945.84 ( m , 1h ) , 5.315.19 ( m , 2h ) , 4.88 ( dd , j = 11.6 , 1.6 hz , 0.7h ) , 4.81 ( dd , j = 11.6 , 1.6 hz , 0.3h ) , 4.584.54 ( m , 2h ) , 4.524.38 ( m , 3h ) , 4.354.19 ( m , 2h ) , 3.663.59 ( m , 2h ) , 3.583.48 ( m , 2h ) , 3.303.23 ( m , 1h ) , 2.862.81 ( m , 1h ) , 2.592.46 ( m , 2h ) , 2.362.19 ( m , 1h ) , 2.121.91 ( m , 5h ) , 1.78 ( br m , 1h ) , 1.671.56 ( m , 2h ) , 1.371.27 ( m , 2h ) , 1.22 ( s , 0.9h ) , 1.191.18 ( m , 5.1h ) , 0.96 ( d , j = 6.4 hz , 2.1h ) , 0.87 ( s , 9h ) , 0.79 ( d , j = 6.8 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 178.8 , 178.3 , 173.1 , 173.0 , 172.9 , 172.5 , 154.9 , 154.4 , 144.4 , 144.3 , 144.0 , 143.9 , 141.4 , 141.3 , 141.2 , 132.3 , 127.7 , 127.7 , 127.1 , 127.1 , 125.5 , 125.4 , 125.3 , 125.2 , 120.0 , 118.3 , 118.3 , 79.4 , 78.6 , 76.0 , 75.8 , 75.0 , 74.9 , 67.9 , 67.7 , 65.2 , 65.2 , 59.7 , 59.7 , 47.3 , 47.2 , 47.0 , 46.5 , 45.9 , 45.6 , 38.0 , 37.8 , 37.0 , 37.0 , 36.9 , 36.6 , 34.8 , 34.6 , 31.6 , 31.4 , 31.3 , 30.3 , 30.2 , 30.0 , 29.8 , 26.1 , 25.8 , 25.3 , 24.5 , 24.3 , 23.7 , 23.4 , 23.1 , 20.6 , 20.5 ppm . hrms ( esi ) m / z calcd for c42h56n2o7sna ( m + na ) 755.3700 , found 755.3718 . to a solution of 34 ( 0.054 mmol ) in thf ( 1.5 ml ) were added pd(pph3)4 ( 7.1 mg , 0.005 mmol ) and n - methylaniline ( 0.015 ml , 0.136 mmol ) at room temperature under argon . this reaction was protected with aluminum foil . after being stirred at the same temperature for 1 h , the reaction mixture was concentrated in vacuo and purified by preparative tlc ( 20 cm 20 cm plate ) to give acid 2 . yield 31.8 mg , 89% ; [ ]d 90.0 ( c 0.04 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.74 ( d , j = 7.6 hz , 2h ) , 7.63(d , j = 7.2 hz , 1.8h ) , 7.57 ( d , j = 7.6 hz , 0.2h ) , 7.38 ( dd , j = 7.6 , 7.6 hz , 2h ) , 7.327.28 ( m , 2h ) , 6.22 ( br , 1h ) , 4.90 ( d , j = 10.0 hz , 0.8h ) , 4.84 ( d , j = 9.2 hz , 0.2h ) , 4.534.34 ( m , 3.8h ) , 4.294.17 ( m , 1.2h ) , 4.003.92 ( m , 1h ) , 3.683.61 ( m , 1h ) , 3.573.45 ( m , 1h ) , 3.35 ( dd , j = 10.8 , 8.8 hz , 0.2h ) , 3.23 ( dd , j = 10.8 , 8.4 hz , 0.8h ) , 2.91 ( dd , j = 10.8 , 8.4 hz , 0.2h ) , 2.80 ( dd , j = 10.8 , 8.4 hz , 0.8h ) , 2.602.43 ( m , 4h ) , 2.352.17 ( m , 1h ) , 2.081.82 ( m , 5h ) , 1.741.59 ( m , 2h ) , 1.481.25 ( m , 2h ) , 1.030.96 ( m , 1h ) , 0.96 ( d , j = 6.4 hz , 2.4h ) , 0.87 ( s , 9h ) , 0.77 ( d , j = 6.4 hz , 0.6h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 176.7 , 176.5 , 173.1 , 172.5 , 171.8 , 170.5 , 155.1 , 154.5 , 144.3 , 144.1 , 144.0 , 143.8 , 141.4 , 141.4 , 141.3 , 141.3 , 127.7 , 127.7 , 127.2 , 127.1 , 127.1 , 125.5 , 125.4 , 125.3 , 120.0 , 79.8 , 75.7 , 75.3 , 67.9 , 67.8 , 67.4 , 67.0 , 59.6 , 47.2 , 47.2 , 47.0 , 46.6 , 42.7 , 42.3 , 42.1 , 41.9 , 38.2 , 38.1 , 38.0 , 37.4 , 36.8 , 34.8 , 34.7 , 32.0 , 31.7 , 31.3 , 30.1 , 30.0 , 30.0 , 26.1 , 26.0 , 25.7 , 25.1 , 24.6 , 23.4 , 20.7 , 20.5 ppm . hrms ( esi ) m / z calcd for c37h48n2o7sna ( m + na ) 687.3074 , found 687.3070 . yield 31.2 mg , 84% ; [ ]d 57.7 ( c 0.052 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.76 ( d , j = 7.6 hz , 2h ) , 7.657.58 ( m , 2h ) , 7.39 ( dd , j = 7.4 , 7.2 hz , 2h ) , 7.327.28 ( m , 2h ) , 4.88 ( d , j = 12.0 , 0.7h ) , 4.80 ( d , j = 12.0 hz , 0.3h ) , 4.51 ( dd , j = 8.8 , 2.8 hz , 0.3h ) , 4.46 ( d , j = 7.2 hz , 0.3h ) , 4.43 ( d , j = 7.2 hz , 0.7h ) , 4.414.32 ( m , 2h ) , 4.304.25 ( m , 1.7h ) , 3.653.56 ( m , 2h ) , 3.533.45 ( m , 1h ) , 3.30 ( dd , j = 11.0 , 8.4 hz , 0.3h ) , 3.19 ( dd , j = 11.0 , 8.4 hz , 0.7h ) , 2.88 ( dd , j = 10.8 , 10.8 hz , 1h ) , 2.702.53 ( m , 2h ) , 2.372.14 ( m , 1h ) , 2.081.90 ( m , 5h ) , 1.79 ( br m , 1h ) , 1.681.60 ( m , 2h ) , 1.351.26 ( m , 2h ) , 1.26 ( s , 0.9h ) , 1.19 ( s , 2.1h ) , 1.18 ( s , 3h ) , 0.95 ( d , j = 6.6 hz , 2.1h ) , 0.87 ( s , 9h ) , 0.74 ( d , j = 6.6 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 182.4 , 180.5 , 175.7 , 175.5 , 173.2 , 172.7 , 155.1 , 154.7 , 144.5 , 144.2 , 144.1 , 143.8 , 141.5 , 141.4 , 141.3 , 127.8 , 127.8 , 127.2 , 127.1 , 127.1 , 125.5 , 125.4 , 125.4 , 125.3 , 120.0 , 79.7 , 78.6 , 76.0 , 75.8 , 75.4 , 75.1 , 68.1 , 67.9 , 59.7 , 59.6 , 47.3 , 47.2 , 47.1 , 46.6 , 46.5 , 45.8 , 38.0 , 37.8 , 37.5 , 37.4 , 37.1 , 36.3 , 34.8 , 34.6 , 33.4 , 32.7 , 32.7 , 31.7 , 31.3 , 30.2 , 30.0 , 29.8 , 29.7 26.1 , 25.6 , 25.1 , 24.9 , 24.7 , 23.8 , 23.7 , 23.5 , 22.8 , 20.7 , 20.4 , 14.3 ppm . hrms ( esi ) m / z calcd for c39h52n2o7sna ( m + na ) 715.3387 , found 715.3397 . yield 33.0 mg , 90% ; [ ]d 60.0 ( c 0.04 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.75 ( d , j = 7.6 hz , 2h ) , 7.677.57 ( m , 2h ) , 7.39 ( dd , j = 7.4 , 7.2 hz , 2h ) , 7.30 ( dd , j = 7.6 , 7.4 hz , 2h ) , 5.90 ( br , 1h ) , 4.91(dd , j = 12.8 , 12.4 hz , 0.7h ) , 4.864.82 ( m , 0.3h ) , 4.544.50 ( m , 0.3h ) , 4.454.40 ( m , 1h ) , 4.384.33 ( m , 1.7h ) , 4.304.27 ( m , 1.3h ) , 4.254.16 ( m , 0.7h ) , 3.823.80 ( m , 0.7h ) , 3.753.70 ( m , 0.3h ) , 3.64 ( br m , 1h ) , 3.513.49 ( m , 1h ) , 3.363.30 ( m , 0.3h ) , 3.263.15 ( m , 0.7h ) , 2.912.85 ( m , 0.3h ) , 2.842.72 ( m , 0.7h ) , 2.682.50 ( m , 3h ) , 2.352.21 ( m , 1h ) , 2.212.15 ( m , 0.3h ) , 2.051.89 ( m , 5h ) , 1.841.79 ( m , 0.7h ) , 1.751.70 ( m , 1h ) , 1.661.60 ( m , 1h ) , 1.541.45 ( m , 0.7h ) , 1.451.40 ( m , 0.3h ) , 1.191.16 ( m , 3h ) , 1.031.00 ( m , 1h ) , 0.96 ( d , j = 6.0 hz , 2.1h ) , 0.88 ( s , 9h ) , 0.74 ( d , j = 6.0 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 177.8 , 177.6 , 175.9 , 173.4 , 173.4 , 173.3 , 172.7 , 155.1 , 155.1 , 154.6 , 144.4 , 144.4 , 144.2 , 144.2 , 144.2 , 144.0 , 143.9 , 141.4 , 141.4 , 141.4 , 141.3 , 141.3 , 128.0 , 128.0 , 127.8 , 127.8 , 127.5 , 127.2 , 127.1 , 125.5 , 125.4 , 125.4 , 125.3 , 121.0 , 121.0 , 120.0 , 120.0 , 80.0 , 80.0 , 79.2 , 78.7 , 77.4 , 76.2 , 76.0 , 75.6 , 75.5 , 71.8 , 70.8 , 70.4 , 68.0 , 67.9 , 67.9 , 67.7 , 67.5 , 59.7 , 59.6 , 47.3 , 47.3 , 47.1 , 46.6 , 46.0 , 45.9 , 45.4 , 40.7 , 39.7 , 39.4 , 39.2 , 38.1 , 38.0 , 37.8 , 37.6 , 37.0 , 34.8 , 34.7 , 32.9 , 32.9 , 32.3 , 31.7 , 31.3 , 31.1 , 30.2 , 30.0 , 30.0 , 29.8 , 29.4 , 29.2 , 28.7 , 26.1 , 26.0 , 25.8 , 25.4 , 25.2 , 25.1 , 24.6 , 23.4 , 22.8 , 20.8 , 20.8 , 20.6 , 20.5 , 16.6 , 16.0 , 14.3 , 14.2 ppm . hrms ( esi ) m / z calcd for c38h50n2o7sna ( m + na ) 701.3231 , found 701.3253 . to a solution of fmoc protected tripeptide 6(2a2c ) ( 28.1 mg , 0.042 mmol ) in mecn ( 1.2 ml ) was added diethylamine ( 0.6 ml ) at room temperature . after being stirred at the same temperature for 30 min , the reaction mixture was evaporated in vacuo , then azeotroped with toluene and ch2cl2 two times , respectively , and dried under reduced pressure for 1 h to give the free amine tripeptide , which was used in the next coupling reaction without further purification . the above crude free amine tripeptide was dissolved in ch2cl2 ( thf for 2b ) ( 2 ml ) . to this solution were added acid 2 ( 0.028 mmol ) , corresponding coupling reagent ( 0.056 mmol ) ( pyaop for 2a , c , d and depbt for 2b ) , and diea ( 0.014 ml , 0.083 mmol ) at room temperature . after being stirred at the same temperature for 1524 h , the reaction mixture was concentrated in vacuo and purified by preparative tlc plate ( developed by acetone / hexane ( 2:3 , v / v ) ) to give the precursor 36a d as a colorless oil . yield 22.0 mg , 72% ; [ ]d 99.3 ( c 0.14 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.777.74 ( m , 2h ) , 7.647.62 ( m , 1.7h ) , 7.56 ( d , j = 7.6 hz , 0.3h ) , 7.39 ( dd , j = 7.6 , 7.4 hz , 2h ) , 7.327.26 ( m , 2h ) , 7.09 ( d , j = 8.0 hz , 2h ) , 6.76 ( d , j = 8.0 hz , 2h ) , 6.63 ( d , j = 8.0 hz , 0.3h ) , 6.49 ( br m , 0.3h ) , 6.346.27 ( m , 1h ) , 6.206.12 ( m , 0.3h ) , 5.925.83 ( m , 0.7h ) , 5.545.47 ( m , 0.3h ) , 5.425.35 ( m , 0.7h ) , 5.315.17 ( m , 2.7h ) , 5.115.06 ( m , 0.3h ) , 4.944.85 ( m , 1.7h ) , 4.624.50 ( m , 2h ) , 4.474.35 ( m , 2.3h ) , 4.27 ( t , j = 7.2 hz , 1h ) , 4.204.16 ( m , 1.4h ) , 3.74 ( s , 3h ) , 3.723.64 ( m , 1.3h ) , 3.603.54 ( m , 1h ) , 3.263.07 ( m , 1h ) , 3.022.90 ( m , 4h ) , 2.832.77 ( m , 2h ) , 2.772.60 ( m , 4h ) , 2.502.46 ( m , 0.7h ) , 2.392.19 ( m , 4h ) , 2.181.90 ( m , 6.3h ) , 1.871.78 ( m , 1h ) , 1.73 ( br m , 1h ) , 1.61 ( br m , 0.7h ) , 1.551.49 ( m , 1h ) , 1.421.38 ( m , 1h ) , 1.271.21 ( m , 3h ) , 1.000.84 ( m , 19.1h ) , 0.68 ( d , j = 6.4 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 172.7 , 172.1 , 172.0 , 171.9 , 171.6 , 171.6 , 170.8 , 158.7 , 154.8 , 154.4 , 144.3 , 144.2 , 144.1 , 143.9 , 141.4 , 141.3 , 131.8 , 131.4 , 130.5 , 130.4 , 128.2 , 128.2 , 127.8 , 127.8 , 127.2 , 127.1 , 127.1 , 126.4 , 125.5 , 125.4 , 125.3 , 120.1 , 118.8 , 114.0 , 79.6 , 79.1 , 77.4 , 75.9 , 75.7 , 67.9 , 67.7 , 66.1 , 65.5 , 60.6 , 59.6 , 59.4 , 55.3 , 50.4 , 49.8 , 49.2 , 47.3 , 47.1 , 46.6 , 38.7 , 38.2 , 37.9 , 37.2 , 37.1 , 36.8 , 34.8 , 34.5 , 33.7 , 33.4 , 32.1 , 31.7 , 31.5 , 31.1 , 31.0 , 30.7 , 30.2 , 29.8 , 29.6 , 29.5 , 28.8 , 26.1 , 25.1 , 24.6 , 23.5 , 22.8 , 21.1 , 20.7 , 16.2 , 15.9 , 14.5 , 14.4 , 14.3 , 11.8 , 10.7 ppm . hrms ( esi ) m / z calcd for c61h83n5o11sna ( m + na ) 1116.5702 , found 1116.5742 . yield 28.3 mg , 90% ; [ ]d 130.0 ( c 0.10 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.767.73 ( m , 2h ) , 7.657.59 ( m , 2h ) , 7.407.36 ( m , 2h ) , 7.317.26 ( m , 2h ) , 7.107.08 ( m , 2h ) , 6.85 ( d , j = 8.4 hz , 0.3h ) , 6.776.74 ( m , 2h ) , 6.65 ( d , j = 8.0 hz , 0.7h ) , 5.925.82 ( m , 1h ) , 5.37 ( dddd , j = 6.8 , 6.8 , 6.8 , 6.8 hz , 1h ) , 5.315.20 ( m , 2h ) , 5.205.14 ( m , 1h ) , 4.934.87 ( m , 1.7h ) , 4.81 ( d , j = 10.8 hz , 0.3h ) , 4.624.51 ( m , 3h ) , 4.464.41 ( m , 2h ) , 4.334.24 ( m , 3h ) , 3.74 ( s , 3h ) , 3.683.62 ( m , 1.3h ) , 3.603.48 ( m , 1.7h ) , 3.18 ( ddd , j = 18.8 , 10.8 , 8.8 hz , 1h ) , 3.032.95 ( m , 4h ) , 2.822.73 ( m , 2h ) , 2.68 ( s , 2.1h ) , 2.65 ( s , 0.9h ) , 2.432.17 ( m , 4h ) , 2.151.86 ( m , 5h ) , 1.851.75 ( m , 2h ) , 1.701.55 ( m , 2.3h ) , 1.501.45 ( m , 0.7h ) , 1.351.17 ( m , 13h ) , 0.970.91 ( m , 6h ) , 0.910.82 ( m , 14.1h ) , 0.76 ( d , j = 6.4 hz , 0.9h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 178.8 , 178.3 , 173.0 , 172.7 , 172.3 , 172.2 , 171.9 , 171.6 , 171.6 , 171.4 , 170.8 , 169.7 , 158.6 , 154.9 , 154.6 , 144.6 , 144.3 , 144.0 , 143.9 , 141.4 , 141.4 , 141.3 , 131.8 , 130.5 , 130.5 , 130.4 , 128.4 , 128.3 , 127.8 , 127.7 , 127.1 , 125.5 , 125.4 , 125.4 , 125.3 , 120.0 , 120.0 , 118.8 , 113.9 , 79.4 , 78.7 , 77.4 , 76.1 , 75.7 , 75.2 , 75.0 , 68.0 , 67.7 , 66.1 , 65.5 , 64.6 , 60.5 , 59.8 , 59.6 , 55.3 , 53.6 , 50.4 , 49.8 , 49.3 , 47.3 , 47.2 , 47.1 , 46.6 , 45.9 , 45.4 , 38.1 , 37.9 , 37.0 , 36.6 , 34.8 , 34.7 , 34.5 , 33.7 , 33.5 , 33.3 , 32.0 , 31.7 , 31.3 , 31.0 , 31.0 , 30.9 , 30.6 , 30.1 , 29.8 , 26.1 , 25.6 , 25.4 , 25.1 , 24.6 , 24.0 , 23.7 , 23.5 , 22.8 , 20.8 , 20.7 , 20.6 , 16.2 , 15.9 , 15.0 , 14.9 , 14.4 , 14.3 , 11.7 , 10.7 ppm . hrms ( esi ) m / z calcd for c63h87n5o11sna ( m + na ) 1144.6015 , found 1144.6041 . yield 22.0 mg , 71% ; [ ]d 66.0 ( c 0.05 , ch2cl2 ) . h nmr ( 400 mhz , cdcl3 , mixture of rotamers ) : 7.777.74 ( m , 2h ) , 7.657.60 ( m , 2h ) , 7.39 ( dd , j = 7.6 , 7.2 hz , 2h ) , 7.30 ( dd , j = 7.2 , 6.8 hz , 2h ) , 7.107.07 ( m , 2h ) , 6.786.75 ( m , 2h ) , 5.925.81 ( m , 1h ) , 5.395.35 ( m , 1h ) , 5.315.21 ( m , 2h ) , 5.185.11 ( m , 1h ) , 4.934.81 ( m , 2h ) , 4.624.53 ( m , 2h ) , 4.464.21 ( m , 5h ) , 3.813.69 ( m , 4h ) , 3.693.60 ( m , 1h ) , 3.583.49 ( m , 1h ) , 3.223.18 ( m , 1h ) , 3.032.88 ( m , 4h ) , 2.822.76 ( m , 3h ) , 2.712.57 ( m , 4h ) , 2.342.21 ( m , 4h ) , 2.111.79 ( m , 8h ) , 1.71 ( br m , 1h ) , 1.641.58 ( m , 1h ) , 1.341.18 ( m , 5h ) , 0.970.78 ( m , 21h ) ppm . c nmr ( 100 mhz , cdcl3 , mixture of rotamers ) : 175.1 , 174.6 , 173.2 , 172.9 , 172.7 , 172.6 , 172.3 , 172.2 , 172.0 , 172.0 , 171.9 , 171.9 , 171.8 , 171.6 , 171.5 , 171.4 , 170.8 , 169.7 , 158.7 , 158.6 , 155.1 , 155.0 , 154.5 , 144.5 , 144.4 , 144.3 , 144.2 , 144.1 , 144.0 , 143.9 , 141.4 , 141.4 , 141.3 , 131.8 , 130.5 , 128.5 , 128.3 , 128.0 , 127.8 , 127.1 , 125.5 , 125.4 , 125.4 , 125.3 , 120.0 , 118.8 , 114.0 , 113.9 , 79.7 , 78.8 , 77.4 , 76.2 , 75.9 , 75.6 , 71.8 , 70.9 , 70.3 , 67.9 , 67.8 , 67.6 , 66.1 , 65.5 , 60.5 , 59.8 , 59.7 , 59.7 , 55.3 , 50.4 , 49.9 , 47.3 , 47.3 , 47.2 , 47.1 , 46.6 , 45.8 , 45.2 , 45.0 , 40.8 , 39.8 , 39.6 , 38.1 , 37.8 , 37.7 , 37.3 , 37.3 , 34.8 , 34.7 , 33.5 , 33.4 , 32.1 , 31.7 , 31.4 , 31.0 , 31.0 , 30.7 , 30.6 , 30.1 , 30.1 , 29.8 , 26.1 , 25.7 , 25.4 , 25.2 , 25.1 , 24.6 , 23.4 , 22.8 , 20.7 , 20.6 , 16.8 , 16.4 , 15.9 , 14.4 , 14.4 , 14.3 , 13.9 , 11.8 , 11.6 , 10.7 ppm . hrms ( esi ) m / z calcd for c62h85n5o11sna ( m + na ) 1130.5859 , found 1130.5905 . to a solution of cyclic precursor 36 ( 11.6 mol ) in thf ( 1.0 ml ) were added pd(pph3)4 ( 2.7 mg , 2.32 mol ) and n - methylaniline ( 6.3 l , 58.0 mol ) at room temperature under argon . this reaction was protected with aluminum foil . after being stirred at the same temperature for 1 h , the reaction mixture was concentrated in vacuo and purified by preparative tlc plate ( developed with meoh / ch2cl2 1:9 , v / v ) to give the free acid cyclic precursor . to the solution of free acid cyclic precursor in mecn ( 1.5 ml ) was added n , n - diethylamine ( 0.75 ml ) . after being stirred at room temperature for 30 min , the reaction mixture was evaporated in vacuo , azeotroped with toluene ( three times ) and ch2cl2 ( two times ) , and then dried under reduced pressure for 1 h to give the unmasked precursor as a foam solid . then the unmasked precursor was dissolved in ch2cl2 ( dmf for 36b ) ( 20 ml ) . to this solution were added diea ( 20.0 l , 0.116 mmol ) and corresponding coupling reagent ( 34.8 mol ) at 0 c ( pyaop for 36a , c , d and depbt for 36b ) . after being stirred at 0 c for 30 min , the reaction was allowed to warm up to room temperature and stirred for additional 15 h. then the reaction was concentrated in vacuo and purified by semipreparative reversed - phase hplc ( phenomenex ultracarb , ods 250 mm 10 mm , 5 m , 3.0 ml / min , uv detection at 200/220 nm ) using an isocratic system of 80% aqueous mecn for 30 min , 80100% mecn for 3040 min , and 100% mecn for 4060 min to afford 1a d . yield 2.3 mg , 25% in 3 steps ; [ ]d 106.2 ( c 0.024 , ch2cl2 ) ; tr = 17.5 min . h nmr ( 600 mhz , cdcl3 , mixture of rotamers , major and minor ( 6/4 ) ) : 7.14 ( d , j = 8.4 hz , 1.2h ) , 7.10 ( d , j = 8.4 hz , 0.8h ) , 6.80 ( d , j = 8.4 hz , 0.8h ) , 6.79 ( d , j = 8.4 hz , 1.2h ) , 6.17 ( d , j = 9.0 hz , 0.4h ) , 5.78 ( d , j = 10.2 hz , 0.6h ) , 5.26 ( d , j = 11.4 hz , 0.6h ) , 5.205.16 ( m , 0.4h ) , 5.15 ( ddd , j = 15.0 , 10.2 , 4.8 hz , 0.6h ) , 4.96 ( dd , j = 12.6 , 2.4 hz , 0.6h ) , 4.89 ( d , j = 11.4 hz , 0.4h ) , 4.87 ( dd , j = 12.6 , 2.4 hz , 0.4h ) , 4.64 ( q , j = 6.6 hz , 0.4h ) , 4.60 ( d , j = 10.8 hz , 0.6h ) , 4.384.31 ( m , 1.2h ) , 4.244.19 ( m , 1h ) , 4.114.08 ( m , 0.4h ) , 4.05 ( br m , 0.4h ) , 4.003.95 ( m , 0.6h ) , 3.90 ( br m , 0.4h ) , 3.77 ( s , 1.8h ) , 3.77 ( s , 1.2h ) , 3.703.66 ( m , 0.6h ) , 3.653.61 ( m , 0.4h ) , 3.39 ( dd , j = 10.8 , 8.4 hz , 0.6h ) , 3.32 ( dd , j = 10.8 , 8.4 hz , 0.4h ) , 3.29 ( q , j = 6.6 hz , 0.6h ) , 3.09 ( dd , j = 12.0 , 11.4 hz , 1h ) , 3.053.01 ( m , 1h ) , 2.94 ( dd , j = 12.6 , 4.2 hz , 0.4h ) , 2.88 ( s , 1.2h ) , 2.80 ( s , 1.8h ) , 2.77 ( dd , j = 12.6 , 4.8 hz , 0.6h ) , 2.74 ( s , 1.8h ) , 2.642.58 ( m , 1.8h ) , 2.52 ( dd , j = 13.5 , 11.4 hz , 0.6h ) , 2.452.32 ( m , 1.6h ) , 2.312.23 ( m , 1.6h ) , 2.151.96 ( m , 2.4h ) , 1.961.83 ( m , 3.6h ) , 1.811.69 ( m , 4h ) , 1.62 ( ddd , j = 13.8 , 9.6 , 3.6 hz , 1h ) , 1.561.51 ( m , 1h ) , 1.311.25 ( m , 1h ) , 1.23 ( d , j = 7.2 hz , 1.8h ) , 1.211.17 ( m , 0.4h ) , 1.09 ( d , j = 6.6 hz , 1.2h ) , 1.03 ( t , j = 6.6 hz , 1.8h ) , 1.03 ( d , j = 6.6 hz , 1.8h ) , 1.00 ( d , j = 6.6 hz , 1.2h ) , 0.98 ( d , j = 6.6 hz , 1.2h ) , 0.980.92 ( m , 0.6h ) , 0.87 ( s , 9h ) , 0.84 ( t , j = 7.2 hz , 1.2h ) , 0.57 ( d , j = 6.6 hz , 1.2h ) ppm . c nmr ( 150 mhz , cdcl3 , mixture of rotamers , major and minor ) : 172.7 , 172.1 , 171.9 , 171.2 , 170.7 , 170.5 , 170.3 , 170.2 , 170.0 , 168.6 , 158.8 , 158.7 , 130.7 , 130.6 , 128.7 , 128.5 , 114.2 , 114.0 , 78.1 , 77.6 , 76.2 , 75.8 , 68.6 , 67.3 , 60.7 , 59.9 , 59.5 , 58.1 , 57.9 , 57.4 , 55.5 , 55.4 , 54.1 , 50.9 , 49.8 , 47.8 , 45.0 , 43.9 , 42.9 , 41.0 , 39.8 , 38.8 , 37.6 , 37.5 , 37.4 , 37.0 , 36.9 , 34.1 , 34.1 , 33.2 , 33.0 , 31.5 , 30.6 , 30.6 , 29.3 , 29.3 , 29.0 , 26.2 , 26.2 , 25.7 , 25.6 , 25.3 , 25.2 , 24.8 , 20.9 , 19.9 , 15.1 , 14.3 , 14.1 , 14.1 , 10.0 , 10.0 ppm . hrms ( esi ) m / z calcd for c43h67n5o8sna ( m + na ) 836.4603 , found 836.4607 . yield 6.8 mg , 70% in 3 steps ; [ ]d 59.5 ( c 0.037 , ch2cl2 ) ; tr = 26.2 min . h nmr ( 600 mhz , cdcl3 , mixture of rotamers , major and minor ( 7/3 ) ) : 7.14 ( d , j = 8.4 hz , 0.6h ) , 7.12 ( d , j = 8.4 hz , 1.4h ) , 6.80 ( d , j = 8.4 hz , 1.4h ) , 6.78 ( d , j = 8.4 hz , 0.6h ) , 6.18 ( d , j = 9.0 hz , 0.7h ) , 5.73 ( d , j = 10.2 hz , 0.3h ) , 5.27 ( d , j = 11.4 hz , 0.3h ) , 5.185.11 ( m , 1h ) , 4.96 ( d , j = 12.0 hz , 0.3h ) , 4.89 ( d , j = 10.8 hz , 1h ) , 4.60 ( q , j = 6.0 hz , 0.7h ) , 4.454.37 ( m , 1h ) , 4.354.31 ( m , 0.7h ) , 4.15 ( t , j = 8.4 hz , 0.3h ) , 4.104.06 ( m , 0.7h ) , 3.87 ( d , j = 10.8 hz , 0.7h ) , 3.76 ( s , 3h ) , 3.70 ( t , j = 10.8 hz , 0.7h ) , 3.633.59 ( m , 1h ) , 3.34 ( dd , j = 10.8 , 8.4 hz , 0.3h ) , 3.31 ( q , j = 6.6 hz , 0.3h ) , 3.24 ( dd , j = 10.8 , 8.4 hz , 0.7h ) , 3.12 ( dd , j = 12.6 , 11.4 hz , 0.3h ) , 3.093.04 ( m , 1.4h ) , 2.95 ( dd , j = 12.6 , 3.6 hz , 0.7h ) , 2.88 ( s , 2.1h ) , 2.87 ( s , 0.9h ) , 2.76 ( s , 0.9h ) , 2.752.73 ( m , 0.3h ) , 2.58 ( s , 2.1h ) , 2.41 ( ddd , j = 13.2 , 13.2 , 4.8 hz , 0.7h ) , 2.362.26 ( m , 2.3h ) , 2.232.18 ( m , 1h ) , 2.142.10 ( br m , 0.7h ) , 2.082.02 ( m , 1.3h ) , 1.981.91 ( m , 3.3h ) , 1.891.82 ( m , 2.3h ) , 1.781.73 ( m , 3.3h ) , 1.601.56 ( m , 0.7h ) , 1.51 ( m , 1h ) , 1.291.23 ( m , 2.8h ) , 1.17 ( s , 0.9h ) , 1.16 ( s , 2.1h ) , 1.071.06 ( m , 5.1h ) , 1.03 ( t , j = 7.2 hz , 0.9h ) , 0.98 ( d , j = 6.6 hz , 3h),0.87 ( s , 9h ) , 0.83 ( t , j = 7.2 hz , 2.1h ) , 0.49 ( d , j = 6.6 hz , 2.1h ) ppm . c nmr ( 150 mhz , cdcl3 , mixture of rotamers , major and minor ) : 179.6 , 178.4 , 172.2 , 172.0 , 172.0 , 171.8 , 170.9 , 170.4 , 170.3 , 170.2 , 170.1 , 169.8 , 158.9 , 158.6 , 130.7 , 130.6 , 128.7 , 128.5 , 114.2 , 113.9 , 77.7 , 75.8 , 75.3 , 74.8 , 73.9 , 60.8 , 60.0 , 59.3 , 57.8 , 57.4 , 55.5 , 55.4 , 54.2 , 50.9 , 49.8 , 47.8 , 46.7 , 46.5 , 40.0 , 38.2 , 38.0 , 37.6 , 37.3 , 37.0 , 36.0 , 35.2 , 35.1 , 34.9 , 34.6 , 34.1 , 33.7 , 31.7 , 31.4 , 30.8 , 30.8 , 30.7 , 29.8 , 29.5 , 29.3 , 28.9 , 26.3 , 26.3 , 25.8 , 25.6 , 25.6 , 25.5 , 25.3 , 25.0 , 24.2 , 22.8 , 20.7 , 20.3 , 18.7 , 18.3 , 14.9 , 14.6 , 14.3 , 14.1 , 14.1 , 10.7 , 10.0 ppm . hrms ( esi ) m / z calcd for c45h71n5o8sna ( m + na ) 864.4916 , found 864.4918 . yield 4.3 mg , 45% in 3 steps ; [ ]d 82.6 ( c 0.023 , ch2cl2 ) ; tr = 24.8 min . h nmr ( 600 mhz , cdcl3 , mixture of rotamers , major and minor ( 6/4 ) ) : 7.13 ( d , j = 9.0 hz , 1.2h ) , 7.13 ( d , j = 9.0 hz , 0.8h ) , 6.82 ( d , j = 9.0 hz , 0.8h ) , 6.79 ( d , j = 9.0 hz , 1.2h ) , 6.23 ( d , j = 8.4 hz , 0.4h ) , 5.86 ( d , j = 9.6 hz , 0.6h ) , 5.23 ( d , j = 11.4 hz , 0.6h ) , 5.19 ( ddd , j = 10.5 , 10.5 , 4.8 hz , 0.6h ) , 5.05 ( ddd , j = 10.8 , 8.4 , 4.2 hz , 0.4h ) , 4.95 ( dd , j = 13.2 , 3.0 hz , 0.6h ) , 4.88 ( dd , j = 12.6 , 3.6 hz , 0.4h ) , 4.82 ( d , j = 11.4 hz , 0.4h ) , 4.73 ( d , j = 11.4 hz , 0.6h ) , 4.59 ( q , j = 6.6 hz , 0.4h ) , 4.23 ( qd , j = 8.4 , 4.8 hz , 0.4h ) , 4.364.34 ( m , 0.4h ) , 4.314.23 ( m , 1h ) , 4.23 ( t , j = 7.8 hz , 0.6h ) , 4.19 ( d , j = 10.2 hz , 0.4h ) , 4.134.09 ( m , 0.4h ) , 3.77 ( s , 1.8h ) , 3.77 ( s , 1.2h ) , 3.693.64 ( m , 0.6h ) , 3.643.60 ( m , 0.4h ) , 3.553.51 ( m , 0.4h ) , 3.50 ( dd , j = 10.8 , 7.8 hz , 0.4h ) , 3.46 ( qd , j = 11.1 , 3.6 hz , 0.6h ) , 3.38 ( dd , j = 10.8 , 7.8 hz , 0.6h ) , 3.26 ( q , j = 6.6 hz , 0.6h ) , 3.092.98 ( m , 1.4h ) , 2.94 ( s , 1.2h ) , 2.802.76 ( m , 1.6h ) , 2.74 ( s , 1.8h ) , 2.74 ( s , 1.8h ) , 2.70 ( dd , j = 11.4 , 11.4 hz , 0.6h ) , 2.632.57 ( m , 2.2h ) , 2.44 ( ddd , j = 16.8 , 5.4 , 3.0 hz , 0.6h ) , 2.412.34 ( m , 1h ) , 2.302.22 ( m , 1.2h ) , 2.202.17 ( m , 0.4h ) , 2.162.10 ( m , 1h ) , 2.092.03 ( m , 1.4h ) , 1.981.84 ( m , 2.4h ) , 1.79 ( td , j = 13.2 , 3.6 hz , 0.6h ) , 1.751.61 ( m , 4.4h ) , 1.581.52 ( m , 0.6h ) , 1.49 ( td , j = 11.4 , 3.6 hz , 0.6h ) , 1.33 ( ddd , j = 13.8 , 11.1 , 3.0 hz , 0.4h ) , 1.291.26 ( m , 1.4h ) , 1.23 ( d , j = 7.2 hz , 1.8h ) , 1.121.09 ( m , 2.2h ) , 1.07 ( d , j = 6.6 h , 1.8h ) , 1.05 ( d , j = 7.2 hz , 1.8h ) , 1.01 ( t , j = 7.2 hz , 1.8h ) , 0.970.95 ( m , 3.6h ) , 0.92 ( m , 0.4h ) , 0.87 ( s , 5.4h ) , 0.87 ( s , 3.6h ) , 0.85 ( t , j = 7.2 hz , 1.2h ) , 0.43 ( d , j = 6.6 hz , 1.2h ) ppm . c nmr ( 150 mhz , cdcl3 , mixture of rotamers , major and minor ) : 175.3 , 174.9 , 172.6 , 172.2 , 171.9 , 171.4 , 171.1 , 170.7 , 170.5 , 170.5 , 170.3 , 170.0 , 158.9 , 158.7 , 130.7 , 130.5 , 128.7 , 128.4 , 114.3 , 114.0 , 78.0 , 77.6 , 75.5 , 74.9 , 72.5 , 72.1 , 60.7 , 59.8 , 59.3 , 58.3 , 56.9 , 55.5 , 55.4 , 53.8 , 51.6 , 49.6 , 49.0 , 47.8 , 47.5 , 40.0 , 39.4 , 38.3 , 38.0 , 37.8 , 37.6 , 37.5 , 37.1 , 36.8 , 35.2 , 35.2 , 34.2 , 34.0 , 33.2 , 32.5 , 31.6 , 31.1 , 30.8 , 30.5 , 29.3 , 29.2 , 28.8 , 26.2 , 25.8 , 25.7 , 25.3 , 25.2 , 24.8 , 24.7 , 20.6 , 20.1 , 16.5 , 16.4 , 14.6 , 14.3 , 14.0 , 14.0 , 10.1 , 9.9 ppm . hrms ( esi ) m / z calcd for c44h69n5o8sna ( m + na ) 850.4759 , found 850.4773 . human colon adenocarcinoma hct116 cells were purchased from atcc ( manassas , va ) and cultured in dulbecco s modified eagle s medium ( invitrogen , carlsbad , ca ) supplemented with 10% fetal bovine serum ( hyclone , logan , ut ) at 37 c humidified air and 5% co2 . hct116 cells were seeded at a density of 1 10 cells per well in 96-well plates . then 24 h later , the cells were treated with various concentrations of apratoxins or solvent control ( 1% etoh ) . after 48 h of incubation , cell viability was detected using mtt according to the manufacturer s instructions ( promega , madison , wi ) . hct116 cells ( 1 10 cells per well ) were seeded in 96-well plates and one day later treated with various concentrations of apratoxins or solvent control . after 12 h of incubation , culture supernatants were collected for detection of vegf - a by using an alphalisa kit ( perkinelmer , waltham , ma ) following the manufacturer s instructions . briefly , acceptor bead and anti - vegf antibody were incubated first with the supernatants for 60 min , donor beads were added later and incubated for another 30 min , and then vegf - a levels were detected using envision ( perkinelmer ) . hct116 cells were seeded in 6-well plates at a density of 4 10 cells and the next day treated with various concentrations of apratoxins or solvent control ( 1% etoh ) . then 24 h later , whole cell lysates were collected using phosphosafe buffer ( emd chemicals , inc . , gibbstown , nj ) . the protein concentration was measured with the bca protein assay kit ( thermo fisher scientific , rockford , il ) . lysates containing equal amounts of protein were separated by sds polyacrylamide gel electrophoresis ( 412% ) , transferred to polyvinylidene difluoride membranes , probed with primary and secondary antibodies , and detected with the supersignal west femto maximum sensitivity substrate ( thermo fisher scientific ) . anti - met , anti - vegfr2 , and secondary antimouse antibodies were from cell signaling technology , inc . three five week old female nude mice ( nu / nu ) were obtained from charles river laboratory ( wilmington , ma ) . one 10 hct116 cells in a volume of 100 l of sterile saline were injected subcutaneously on the left rear flank of a nude mouse to establish tumors . tumor dimensions were measured using calipers every day , and tumor volumes were calculated using the formula w l 0.5 , where width ( w ) length ( l ) . tumors with a starting volume bigger than 100 mm were excluded from the analysis . mice were injected intraperitoneally with the doses of 2 g / mouse ( 0.1 mg / kg ) , 5 g / mouse ( 0.25 mg / kg ) of 1c or solvent ( dmso ) control every day ( 25 l ) until the tumor size in one dimension reached 15 mm and tumor tissue was harvested on the following day . finally , 50 mg of tumor tissue was sonicated in phosphosafe lysis buffer ( emd chemicals , inc . ) and used for immunoblot analysis described as the above . all studies were carried out under the protocol approved by the institutional animal care and use committee at the university of florida . hplc - ms was done on a 3200 qtrap ( applied biosystems ) equipped with a shimadzu ( kyoto , japan ) uflc system . pooled cd1 mouse liver ( female ) microsomes were purchased from xenotech , lcc ( lenexa , ks ) with protein concentrations of 0.5 mg / ml . cell lysates were prepared with phosphosafe lysis buffer ( novagen , san diego , ca ) . stock solutions of 1a d were prepared by dissolving the compounds in ethanol to give a 1 mg / ml solution . aliquots of this stock solution were then obtained to afford a 40 g / ml solution in acetonitrile . serial dilution of the 40 g / ml solution in acetonitrile gave standard solutions with concentrations of 25 , 12.5 , 2.5 , 1.25 , 0.25 , 0.125 , 0.025 , and 0.0125 g / ml . a 1 mg / ml stock solution of the internal standard harmine was prepared in ethanol , which subsequently was used to prepare a 100 g / ml solution with ethanol . an aliquot of the 100 g / ml harmine solution was diluted to 35 ng / ml with ethyl acetate to serve as the working internal standard solution . in vitro plasma stability of 1a first , 10 l of apratoxins ( 25 g / ml ) were added to 100 l of mouse serum , and the solution was then vortex - mixed for 15 s and incubated for 0.25 min to 24 h. at the end of each incubation period , 400 l of ethyl acetate was added to each tube , followed by 200 l of harmine to quench the reaction and extract remaining apratoxin . samples were further incubated in a thermomixer at 27 c ( 750 rpm , 5 min ) and later centrifuged for 5 min at 1643 g . a volume of 10 l of the reconstituted solution was injected into the hplc - ms system . the stability of 1a d in the presence of mouse microsomes was determined by using an adaptation of a published procedure . in brief , microsomes were added to prewarmed phosphate buffer ( 100 mm , ph 7.4 ) at 37 c . apratoxins ( 3 l ) were added to the microsomal preparation followed by nadph cofactor solution ( 1.3 mm nadp , 3.3 mm glucose 6-phosphate , 0.4 u / ml glucose-6-phosphate dehydrogenase , 3.3 mm mgcl2 ) . the reaction was allowed to proceed for 3 min to 2 h at 37 c ( thermomixer , 1050 rpm ) . the reaction was quenched by addition of ethyl acetate and subsequently spiked with harmine . the zero time point was defined by denaturing the microsomes with ethyl acetate before the addition of apratoxins . incubation of apratoxins with microsomes alone was also performed following the same procedure to determine nadph - independent metabolism . the final concentration of the incubation mixture contained 0.5 mg / ml protein concentration and 1 m apratoxins . aliquots of hct116 cell lysates were diluted with 25 mm tris - hcl buffer , ph 8.0 , to give a final reaction volume of 100 l and protein concentration of 0.7 mg / ml . cell lysate solutions were incubated with 10 l of apratoxins ( 25 g / ml ) for 0.25 min to 24 h. remaining apratoxins were extracted from the reaction solution at the end of the incubation periods with ethyl acetate using the same procedure as described for the plasma stability assay . the stability of 1a d in aqueous solution was determined in 100 mm phosphate buffer , ph 4.88 , 100 mm phosphate buffer , ph 7.4 . portions of each solution ( 100 l ) were spiked with 10 l of apratoxin solution ( 25 g / ml ) and allowed to incubate for 0.25 min to 24 h. the reaction was quenched at the end of each time point , and the remaining apratoxins were extracted with ethyl acetate , as in the plasma stability study . analysis of 1a d was done by using hplc - ms [ column , onyx monolithic c18 ( 3.0 mm 100 mm ) , phenomenex ( torrance , ca ) ; solvent , water ( solvent a ) acetonitrile ( solvent b ) ; flow rate , 0.5 ml / min ; detection by electrospray ionization ms in positive ion mode ( mrm scan ) ] . a stepwise gradient elution was used starting at 60% b and 40% a , then increasing to 80% b at 5 min and maintained at this condition for 5 min . parameters were optimized before analysis by using direct syringe infusion . the retention times ( tr , min ; mrm ion pair ) of the analytes and internal standard are as follows : harmine ( 2.2 ; 213.1 169.9 ) , 1a ( 4.1 ; 828.5 432.2 ) , 1b ( 4.05 ; 814.5 418.2 ) , 1c ( 5.2 ; 842.5 446.2 ) , 1d ( 4.9 ; 828.5 432.2 ) . compound - dependent parameters used were as follows : apratoxins , declustering potential ( dp ) 51 , entrance potential ( ep ) 12 , collision energy ( ce ) 45 , collision cell exit potential ( cxp ) 6 , collision cell entrance potential ( cep ) 32 ; and harmine , dp 56.0 , ep 4.5 , ce 44.0 , cxp 5 , cep 16.0 . source gas parameters used were as follows : curtain gas , 15.0 ; collision gas low , ionspray voltage 5500 ; temperature , 600.0 ; ion source gas 1 50.0 ; ion source gas 2 60.0 . calibration curves for 1a d in the presence of mouse serum , hct116 cell lysates , and aqueous solutions were generated by least - squares linear regression analysis of the analyte peak area and internal standard peak area ratio against the nominal concentration of the standard solutions . a linear regression analysis was performed , and the concentration of remaining apratoxins at each time point was determined through interpolation for plasma , cellular , and aqueous stability experiments . the amount of remaining apratoxins with microsome incubation was determined from the peak area ratio of apratoxins at tx ( 3 min to 2 h ) and t0 . all calculations were done by using analyst 1.4.2 ( applied biosystems ) quantitate mode . human colon adenocarcinoma hct116 cells were purchased from atcc ( manassas , va ) and cultured in dulbecco s modified eagle s medium ( invitrogen , carlsbad , ca ) supplemented with 10% fetal bovine serum ( hyclone , logan , ut ) at 37 c humidified air and 5% co2 . hct116 cells were seeded at a density of 1 10 cells per well in 96-well plates . then 24 h later , the cells were treated with various concentrations of apratoxins or solvent control ( 1% etoh ) . after 48 h of incubation , cell viability was detected using mtt according to the manufacturer s instructions ( promega , madison , wi ) . hct116 cells ( 1 10 cells per well ) were seeded in 96-well plates and one day later treated with various concentrations of apratoxins or solvent control . after 12 h of incubation , culture supernatants were collected for detection of vegf - a by using an alphalisa kit ( perkinelmer , waltham , ma ) following the manufacturer s instructions . briefly , acceptor bead and anti - vegf antibody were incubated first with the supernatants for 60 min , donor beads were added later and incubated for another 30 min , and then vegf - a levels were detected using envision ( perkinelmer ) . hct116 cells were seeded in 6-well plates at a density of 4 10 cells and the next day treated with various concentrations of apratoxins or solvent control ( 1% etoh ) . then 24 h later , whole cell lysates were collected using phosphosafe buffer ( emd chemicals , inc . , gibbstown , nj ) . the protein concentration was measured with the bca protein assay kit ( thermo fisher scientific , rockford , il ) . lysates containing equal amounts of protein were separated by sds polyacrylamide gel electrophoresis ( 412% ) , transferred to polyvinylidene difluoride membranes , probed with primary and secondary antibodies , and detected with the supersignal west femto maximum sensitivity substrate ( thermo fisher scientific ) . anti - met , anti - vegfr2 , and secondary antimouse antibodies were from cell signaling technology , inc . three five week old female nude mice ( nu / nu ) were obtained from charles river laboratory ( wilmington , ma ) . one 10 hct116 cells in a volume of 100 l of sterile saline were injected subcutaneously on the left rear flank of a nude mouse to establish tumors . tumor dimensions were measured using calipers every day , and tumor volumes were calculated using the formula w l 0.5 , where width ( w ) length ( l ) . tumors with a starting volume bigger than 100 mm were excluded from the analysis . mice were injected intraperitoneally with the doses of 2 g / mouse ( 0.1 mg / kg ) , 5 g / mouse ( 0.25 mg / kg ) of 1c or solvent ( dmso ) control every day ( 25 l ) until the tumor size in one dimension reached 15 mm and tumor tissue was harvested on the following day . finally , 50 mg of tumor tissue was sonicated in phosphosafe lysis buffer ( emd chemicals , inc . ) and used for immunoblot analysis described as the above . all studies were carried out under the protocol approved by the institutional animal care and use committee at the university of florida . hplc - ms was done on a 3200 qtrap ( applied biosystems ) equipped with a shimadzu ( kyoto , japan ) uflc system . mouse serum and harmine pooled cd1 mouse liver ( female ) microsomes were purchased from xenotech , lcc ( lenexa , ks ) with protein concentrations of 0.5 mg / ml . hct116 cell lysates were prepared with phosphosafe lysis buffer ( novagen , san diego , ca ) . stock solutions of 1a d were prepared by dissolving the compounds in ethanol to give a 1 mg / ml solution . aliquots of this stock solution were then obtained to afford a 40 g / ml solution in acetonitrile . serial dilution of the 40 g / ml solution in acetonitrile gave standard solutions with concentrations of 25 , 12.5 , 2.5 , 1.25 , 0.25 , 0.125 , 0.025 , and 0.0125 g / ml . a 1 mg / ml stock solution of the internal standard harmine was prepared in ethanol , which subsequently was used to prepare a 100 g / ml solution with ethanol . an aliquot of the 100 g / ml harmine solution was diluted to 35 ng / ml with ethyl acetate to serve as the working internal standard solution . in vitro plasma stability of 1a first , 10 l of apratoxins ( 25 g / ml ) were added to 100 l of mouse serum , and the solution was then vortex - mixed for 15 s and incubated for 0.25 min to 24 h. at the end of each incubation period , 400 l of ethyl acetate was added to each tube , followed by 200 l of harmine to quench the reaction and extract remaining apratoxin . samples were further incubated in a thermomixer at 27 c ( 750 rpm , 5 min ) and later centrifuged for 5 min at 1643 g . a volume of 10 l of the reconstituted solution was injected into the hplc - ms system . the stability of 1a d in the presence of mouse microsomes was determined by using an adaptation of a published procedure . in brief , microsomes were added to prewarmed phosphate buffer ( 100 mm , ph 7.4 ) at 37 c . apratoxins ( 3 l ) were added to the microsomal preparation followed by nadph cofactor solution ( 1.3 mm nadp , 3.3 mm glucose 6-phosphate , 0.4 u / ml glucose-6-phosphate dehydrogenase , 3.3 mm mgcl2 ) . the reaction was allowed to proceed for 3 min to 2 h at 37 c ( thermomixer , 1050 rpm ) . the reaction was quenched by addition of ethyl acetate and subsequently spiked with harmine . the zero time point was defined by denaturing the microsomes with ethyl acetate before the addition of apratoxins . incubation of apratoxins with microsomes alone was also performed following the same procedure to determine nadph - independent metabolism . the final concentration of the incubation mixture contained 0.5 mg / ml protein concentration and 1 m apratoxins . aliquots of hct116 cell lysates were diluted with 25 mm tris - hcl buffer , ph 8.0 , to give a final reaction volume of 100 l and protein concentration of 0.7 mg / ml . cell lysate solutions were incubated with 10 l of apratoxins ( 25 g / ml ) for 0.25 min to 24 h. remaining apratoxins were extracted from the reaction solution at the end of the incubation periods with ethyl acetate using the same procedure as described for the plasma stability assay . the stability of 1a d in aqueous solution was determined in 100 mm phosphate buffer , ph 4.88 , 100 mm phosphate buffer , ph 7.4 . portions of each solution ( 100 l ) were spiked with 10 l of apratoxin solution ( 25 g / ml ) and allowed to incubate for 0.25 min to 24 h. the reaction was quenched at the end of each time point , and the remaining apratoxins were extracted with ethyl acetate , as in the plasma stability study . analysis of 1a d was done by using hplc - ms [ column , onyx monolithic c18 ( 3.0 mm 100 mm ) , phenomenex ( torrance , ca ) ; solvent , water ( solvent a ) acetonitrile ( solvent b ) ; flow rate , 0.5 ml / min ; detection by electrospray ionization ms in positive ion mode ( mrm scan ) ] . a stepwise gradient elution was used starting at 60% b and 40% a , then increasing to 80% b at 5 min and maintained at this condition for 5 min . the retention times ( tr , min ; mrm ion pair ) of the analytes and internal standard are as follows : harmine ( 2.2 ; 213.1 169.9 ) , 1a ( 4.1 ; 828.5 432.2 ) , 1b ( 4.05 ; 814.5 418.2 ) , 1c ( 5.2 ; 842.5 446.2 ) , 1d ( 4.9 ; 828.5 432.2 ) . compound - dependent parameters used were as follows : apratoxins , declustering potential ( dp ) 51 , entrance potential ( ep ) 12 , collision energy ( ce ) 45 , collision cell exit potential ( cxp ) 6 , collision cell entrance potential ( cep ) 32 ; and harmine , dp 56.0 , ep 4.5 , ce 44.0 , cxp 5 , cep 16.0 . source gas parameters used were as follows : curtain gas , 15.0 ; collision gas low , ionspray voltage 5500 ; temperature , 600.0 ; ion source gas 1 50.0 ; ion source gas 2 60.0 . calibration curves for 1a d in the presence of mouse serum , hct116 cell lysates , and aqueous solutions were generated by least - squares linear regression analysis of the analyte peak area and internal standard peak area ratio against the nominal concentration of the standard solutions . a linear regression analysis was performed , and the concentration of remaining apratoxins at each time point was determined through interpolation for plasma , cellular , and aqueous stability experiments . the amount of remaining apratoxins with microsome incubation was determined from the peak area ratio of apratoxins at tx ( 3 min to 2 h ) and t0 . all calculations were done by using analyst 1.4.2 ( applied biosystems ) quantitate mode .

apratoxins are cytotoxic natural products originally isolated from marine cyanobacteria that act by preventing cotranslational translocation early in the secretory pathway to downregulate receptor levels and inhibit growth factor secretion , leading to potent antiproliferative activity . through rational design and total synthesis of an apratoxin a / e hybrid , apratoxin s4 ( 1a ) , we have previously improved the antitumor activity and tolerability in vivo . compound 1a and newly designed analogues apratoxins s7s9 ( 1b d ) , with various degrees of methylation at c34 ( 1b , c ) or epimeric configuration at c30 ( 1d ) , were efficiently synthesized utilizing improved procedures . optimizations have been applied to the synthesis of key intermediate aldehyde 7 and further include the application of leighton s silanes and modifications of kelly s methods to induce thiazoline ring formation in other crucial steps of the apratoxin synthesis . apratoxin s9 ( 1d ) exhibited increased activity with subnanomolar potency . apratoxin s8 ( 1c ) lacks the propensity to be deactivated by dehydration and showed efficacy in a human hct116 xenograft mouse model .

Introduction Results and Discussion Conclusion Experimental Section Biological Material and Methods Metabolite Analyses

seizure in patients with systemic lupus erythematosus ( sle ) is considered to be one of the major manifestations of the disease . the prevalence of seizure has been documented as about 10 to 20% in the patients with sle ( 1 , 2 ) . this neuropsychiatric event is likely to be primary to the sle or secondary due to other concomitant conditions , including infection , hypertension , hyperlipidemia , metabolic derangement and the toxic effects of therapy ( 3 , 4 ) . hyperglycemic hyperosmolar syndrome ( hhs ) is a metabolic emergency , and it commonly occurs in elderly , disabled people with type 2 diabetes . the report of sament and schwartz in 1957 is widely credited as the original description of hhs . the proposed criteria for hhs are a plasma glucose concentration > 33.3 mm / l , a serum carbon dioxide concentration > 15 mm / l , no or mild ketonuria , absent to mild ketonemia , a serum osmolarity > 320 mm / kg and mental change ( 5 ) . however , hhs without other metabolic derangement and that occurs in a patient with lupus nephritis without diabetes and who received short term steroid therapy is a very rare complication . a 51-yr - old female was referred to our outpatient clinic for the evaluation of generalized edema on november 17 , 2009 . two years previously , she had been diagnosed with idiopathic thrombocytopenic purpura ( itp ) . she had taken no medicine . except for the itp , she had no history of systemic disease like diabetes or hypertension . on admission , her blood pressure was 140/80 mmhg with a pulse rate of 76 beats / min . the chest radiography revealed cardiomegaly ( the ct ratio was 0.54 ) and bilateral pleural effusions . both kidneys showed diffusely increased parenchymal echogenicity with partially obliteration of the corticomedullary differentiation and a normal range of size ( the right kidney was 10.3 cm by 4.5 cm in size , and the left kidney was 9.5 cm by 4.5 cm in size ) . the laboratory findings showed nephrotic syndrome with generalized edema ; the 24 hr urine protein was 5.3 g/24 hr , the total cholesterol was 7 mm / l ( normal : < 5.2 mm / l ) and the serum albumin was 22 the fasting blood glucose and hemoglobin a1c ( hba1c ) were 5.4 mm / l and 0.05 hb fraction , respectively . the blood urea nitrogen and serum creatinine were 20.6 mm / l ( normal : 2.6 - 7.3 mm / l ) and 0.23 mm / l ( normal : 0.05 - 0.11 in addition , the patient had a positive antinuclear antibody titer at 1:1,600 ( normal : negative ) , positive antibodies against double - stranded dna at 400 iu / ml ( normal : < 100 iu / ml ) and she was negative for antiphospholipid antibodies . she was diagnosed with systemic lupus erythematosus by the american college of rheumatology criteria ( 6 ) . at diagnosis , a renal biopsy was performed . that showed diffuse global glomerulonephritis with active lesion and iv - g(a ) by the isn / rps classification ( 7 ) . immunosuppressions consisting of high - dose steroid ( methylprednisolone 750 mg for 3 days followed by prednisolone 60 mg ) , cyclophosphamide pulses ( 500 mg at the 6th and 36th day of admission ) , as well as plasma exchange were all started . in addition , she had oliguria that was refractory to diuretics , and this led us to start hemodialysis . while maintaining a stable clinical course , a generalized myoclonic seizure occurred at the 47th day of admission . at that time , her body temperature was 36.1. the laboratory and neurology studies showed hyperglycemic hyperosmolar syndrome with a blood glucose level of > 44.4 mm / l , the serum osmolarity was 382 mm / kg ( normal : 275 - 300 mm / kg ) and the hemoglobin a1c was 0.082 hb fraction . the serum ph was 7.348 and the bicarbonate was 26.2 mm / l ( normal : 21 - 28 the c - reactive protein was normal at 3.9 mg / l ( normal : 0.1 - 4.7 mg / l ) . g / l ) , respectively . at shortly before seizure , the sledai score was 12 . the seizure stopped after the blood sugar and serum osmolarity declined below the upper normal limit mentioned above . the patient became asymptomatic and she was discharged 10 weeks after admission under maintenance therapy with prednisolone 10 mg , insulin glargine 12 unit and nateglinide 270 mg . on follow - up 1 , 2 , and 3 month after discharge , the hba1c was 0.051 , 0.049 , and 0.06 hb fraction , respectively . 1 , 2 . the patient remained asymptomatic under maintenance therapy with deflazacort 12 mg and without insulin or medication for blood sugar control . in patients with lupus nephritis , the causes of seizure are a multiplicity of different factors , such as cns involvement of sle , infections , hypertension and metabolic derangement . a large prospective study reported that infection was the most common cause of neurologic episodes and primary involvement of sle was the secondary cause ( 8) . the presence of seizure increases the risk of death in patients with sle by approximately 2-fold ( 2 , 9 ) . when seizure is noted in patients with lupus nephritis , identifying the cause and proper treatment are important to improve survival . most studies have revealed that reversible posterior leukoencephalopathy syndrome and cerebral vascular accident are other important causes of seizure in patients with lupus nephritis . by contrast , the neurologic episodes by purely metabolic derangement without infection or cns lupus are very rare , and especially hhs was a seldom cause of seizure ( 8) . steroid is associated with the risk of hyperglycemia in patients with or without diabetes ( 10 , 11 ) . this inhibit insulin signalling in skeletal muscle and liver , resulting in reduced glucose uptake and glycogen systhesis , increased breakdown of skeletal muscle mass , increased hepatic glucose production . in additions , steroid increase whole body lipolysis , resulting in increased nonesterified fatty acids ( nefa ) and triglyceride ( tg ) . augmented levels of nfea and tg may enhance the accumulation of intracellular lipids , which impair glucose metabolisms and induce hepatic steatosis , dyslpidemia . steroid most likely exert inhibitory effects in the beta - cell after exposure , resulting decreased beta - cell insulin production ( 12 - 14 ) . as an acute complication of diabetes , the overall mortality of hhs is in the range of 10%-50% . however , when therapy is promptly instituted , the mortality rate can be reduced . treatment is targeted towards 1 ) correcting the intravascular volume and electrolyte derangements ; 2 ) decreasing the hyperglycemia and hyperosmolarity by insulin ; and 3 ) identifying and managing the comorbidities triggering the hhs ( 5 , 16 ) . althought hyperglycemia due to steroid therapy is a common , but acute complication of diabetes , hhs as a first manifestation is a very rare event . our case showed that seizure developed due to hhs despite of the short - term steroid therapy . we should consider hhs as a cause of seizure in patient with lupus nephritis and who are treated with steroid . in conclusion , our case highlights the importance of regular blood glucose testing during or before high - dose steroid therapy .

a 51-yr - old female was referred to our outpatient clinic for the evaluation of generalized edema . she had been diagnosed with idiopathic thrombocytopenic purpura ( itp ) . she had taken no medicine . except for the itp , she had no history of systemic disease . she was diagnosed with systemic lupus erythematosus . immunosuppressions consisting of high - dose steroid were started . when preparing the patient for discharge , a generalized myoclonic seizure occurred at the 47th day of admission . at that time , the laboratory and neurology studies showed hyperglycemic hyperosmolar syndrome . brain mri and eeg showed brain atrophy without other lesion . the seizure stopped after the blood sugar and serum osmolarity declined below the upper normal limit . the patient became asymptomatic and she was discharged 10 weeks after admission under maintenance therapy with prednisolone , insulin glargine and nateglinide . the patient remained asymptomatic under maintenance therapy with deflazacort and without insulin or medication for blood sugar control .

INTRODUCTION CASE DESCRIPTION DISCUSSION

stress urinary incontinence ( sui ) , pelvic organ prolapse , and chronic pelvic pain are frequent complaints of women in perimenopause and menopause and result mainly from pelvic floor insufficiency . proper statics of the pelvic floor provides adequate support for the urethra and bladder , which determines the correct mechanism of continence . anatomical disorders such as loss of support for the bladder base and the proximal urethra are a direct cause of sui.13 women diagnosed with sui demonstrated changed configuration of these structures as well as disorders in their functioning . among the causes of these changes are the weakening of connective tissue structures and the loosening of connections within the pelvic floor.47 it is believed that the menopause plays the most significant role in this pathogenesis . symptoms related to the urogenital system may affect 50% of women in this period.3,813 many authors3,9,12,1417 indicate a decreased level of estrogens as the main cause of the symptoms . one of the key roles of estrogens , which may be impaired during menopause , is their influence on the synthesis and metabolism of collagen , eg , within the lower urinary tract , and on the increase in the number of muscle fibers of the detrusor muscle as well as other muscles comprising the pelvic floor.3,1416 during the menopause , a reduced number of estrogen receptors in the epithelia of the urethra , bladder triangle , or vaginal mucosa can be observed . this decrease is also seen in the structures supporting the pelvic organs , eg , uterosacral ligament , levator ani muscle , and pubocervical fascia.11,15,1821 the other cause of disorders in the statics of the pelvic floor is damage to the muscle and connective tissue structures due to vaginal deliveries.11,2224 botelho et al24 reported a significant loss of muscle contractility during electromyography ( emg ) evaluation in women who underwent vaginal delivery . in patients who had undergone cesarean section , a decrease in muscle function was not observed . it should be stated that despite many studies on the negative impact of episiotomy on the pelvic floor , in many countries , it is still a routine practice . a study conducted by blondel et al25 based on the euro - peristat project demonstrated that many european countries had episiotomy rates > 60% ( poland 67.5% , romania 68.2% , portugal 72.9% , and cyprus 75% ) . recent randomized clinical trials have shown that currently the most comprehensive therapeutic procedure in sui are properly chosen and properly executed pelvic floor muscle ( pfm ) exercises along with the use of objective , minimally invasive and safe diagnostic methods ( eg , emg).24,26,27 in physiotherapeutic practice , special attention is being given to the reciprocal anatomical , physiological , and biomechanical relationship of the pelvis and the structures connected to it . the lack of information about these relations from the practical aspect as well as the paucity of scientific papers31,3335 on the impact of posture changes on the pelvic floor and the function of the lower urinary tract prompted this study . the authors attempted to answer the question of whether the position of the lower limbs , affecting the different orientations of the pelvis , can influence pfm activity . the primary aim of this study was to compare the resting and functional bioelectrical activities of pfm depending on three different positions of the lower limbs ( position a , b , c ) in the supine position . the secondary goal was to compare the surface electromyography ( semg ) activity of selected synergists of the pfm , eg , adductor magnus ( am ) , rectus abdominis ( ra ) , and gluteus maximus ( gm ; two sides : left and right ) , in different positions of the lower limbs in the supine position as well as to determine the relationship between the myoelectric activity of the pfm and synergist muscles . this was a prospective , cross - sectional observational study evaluating resting and functional activities of the pfm depending on the position of the lower limbs in menopausal women . the presented study is a part of the research project funded by the national science centre in the preludium call on the basis of the decision number dec 2011/03/n / nz7/00505 . the study was approved by the bioethics committee of the wroclaw medical university on 5 july 2012 with the approval number kb 611/2012 . moreover , the study was registered at the australian new zealand clinical trials registry platform ( actrn1261300114470736 ) as a prospective observational study . the study was carried out at the department and clinic of urology of university hospital in wroclaw between december 2012 and december 2014 . all recruited women were subjected to evaluation by the inclusion and exclusion criteria in order to qualify for the appropriate study group . the inclusion criteria assumed in the study included written informed consent , doctor s and/or physiotherapist s permission to participate in the study , the overall well - being on the day of examination and no contraindications for the semg measurements . the exclusion criteria included age older than 75 years ; no history of menopause ; gynecological surgery surgery in the abdomen , pelvis , and lower extremities in the last 10 years ; injuries to the lower extremities , pelvis or , spine on the examination day ; contraindications for measurements infection , menstruation , and allergies to nickel ; the occurrence of pain during the examination and withdrawing during the examination . the visit protocol with the participants included an interview , instruction on the purpose of measurement and testing procedures and semg measurement of the pfms and their synergists in three positions of lower limbs . the measurements were performed with the lower limbs in three different positions ( figure 1 ) : position a ( position of lower limbs in 90 of flexion in hip and knee joints ; the limbs were placed freely on adequately profiled wedges decreased anterior pelvic tilt ) , position b ( position of lower limbs with a slight flexion of hip and knee joints ; intermediate pelvic position ) and position c ( supine position ; lower limbs without flexion in hip and knee joints and upper limbs resting freely on the couch increased anterior pelvic tilt ) . the order of the positions was established randomly for each participant by the random integer generator ( www.random.org ) . the participants , after setting the pelvis in a particular position , made five 5-second maximal contractions of the pfm ( functional semg activity ) with a 5-second rest between contractions ( resting semg activity ) . the resting and functional bioelectric activities were measured using the myosystem 1400l ( noraxon , scottsdale , az , usa ) with eight channels , along with the surface and endovaginal electrodes . the specification of the device fulfills the requirements set out in isek ( international society of electrophysiology and kinesiology ) and seniam ( surface electromyography for the non - invasive assessment of muscle ) publications . the equipment for recording bioelectric potentials includes main unit with a built - in analog to digital converter ( adc ) card ; signal amplifiers and preamplifiers ; a computer with myoresearch xp master edition software , version 1.04 ; compatible surface and vaginal electrodes . the measuring set was characterized with the semg recording frequency in the range of 10450 hz . the frequency range for the amplifier was 10 hz for high - pass cutoff , with the 500 hz filter for the low - pass cutoff . the level of common mode rejection amounted to a minimum of 100 db , and input impedance for emg channels was > 100 m. the system was characterized by the high sensitivity of the recorded emg signal 1 v . to record the semg signal from the pfm , a pear - shaped endovaginal electrode life - care vaginal probe pr-02 ( everyway medical instruments co. , ltd . the physical examination was conducted with the use of standardized assessment scales for menopause and the symptoms of urinary incontinence . tulsa , ok , usa ) under the license of the medical university in wroclaw . for the measurable variables , the arithmetic mean , all quantitative variables were tested with the shapiro wilk test to determine the type of distribution . comparisons of results between the values obtained in the a , b , and c positions were performed using a parametric test , one - way analysis of variance ( anova ) along with post hoc testing ( tukey s test ) or the nonparametric anova kruskal wallis analysis and multiple comparisons of mean ranks , depending on the fulfillment of the test assumptions . a multivariate linear regression analysis was used to assess relationships between the bioelectrical activity of pfm and bioelectrical activity of all tested synergists ( am , ra , gm for all comparisons , a level of = 0.05 was assumed , and the obtained p - values were rounded to four decimal places . a total of 55 women , aged between 50 and 75 years ( x=64.9 years ; sd = 5.3 years ) , participated in the study . all women underwent the menopause between 40 and 60 years of age ( x=50.7 years ; sd = 5.0 years ) . each participant in the mrs questionnaire reported symptoms typical for the menopause and postmenopause periods . the results of the mrs questionnaire ranged between 1 and 23 points ( x=10.9points ; sd = 5.7 points ) . in position a , the average resting semg activity of the pfm was 6.9 v ( min max : 3.315.3 v ; sd = 2.6 v ) ; in position b also , the result was 6.9 v ( min max : 3.014.8 v ; sd = 2.5 v ) ; and in position c , the resting semg activity was 5.7 v ( min max : 2.611.7 v ; sd = 1.8 v ) . the results of the functional bioelectrical activity of the pfm were as follows : position a 20.3 v ( min max : 4.555.1 v ; sd = 11.8 v ) , position b 19.9 v ( min max : 5.848.2 v ; sd = 10.6 v ) , and position c 25.3 v ( min max : 10.063.8 v ; sd = 10.9 v ) . the highest bioelectrical potential of am ( left and right sides ) , both during the resting and functional activities of the pfm , was obtained in position b. in the case of ra semg activity , there were no statistically significant differences between the results obtained in all positions . the highest semg of the gm ( on the right side ) during the resting and functional activities of the pfm was observed in positions a and b. on the left side , there were no statistically significant differences between positions . multivariate linear regression did not find any association between the resting bioelectrical activity of the pfm and the bioelectrical activity of all synergist muscles in each position ( table 5 ) . similar results were registered taking into account the functional bioelectrical activity of the pfm ( table 6 ) . a total of 55 women , aged between 50 and 75 years ( x=64.9 years ; sd = 5.3 years ) , participated in the study . all women underwent the menopause between 40 and 60 years of age ( x=50.7 years ; sd = 5.0 years ) . each participant in the mrs questionnaire reported symptoms typical for the menopause and postmenopause periods . the results of the mrs questionnaire ranged between 1 and 23 points ( x=10.9points ; sd = 5.7 points ) . in position a , the average resting semg activity of the pfm was 6.9 v ( min max : 3.315.3 v ; sd = 2.6 v ) ; in position b also , the result was 6.9 v ( min max : 3.014.8 v ; sd = 2.5 v ) ; and in position c , the resting semg activity was 5.7 v ( min max : 2.611.7 v ; sd = 1.8 v ) . the results of the functional bioelectrical activity of the pfm were as follows : position a 20.3 v ( min max : 4.555.1 v ; sd = 11.8 v ) , position b 19.9 v ( min max : 5.848.2 v ; sd = 10.6 v ) , and position c 25.3 v ( min max : 10.063.8 v ; sd = 10.9 v ) . the highest bioelectrical potential of am ( left and right sides ) , both during the resting and functional activities of the pfm , was obtained in position b. in the case of ra semg activity , there were no statistically significant differences between the results obtained in all positions . the highest semg of the gm ( on the right side ) during the resting and functional activities of the pfm was observed in positions a and b. on the left side , there were no statistically significant differences between positions . multivariate linear regression did not find any association between the resting bioelectrical activity of the pfm and the bioelectrical activity of all synergist muscles in each position ( table 5 ) . similar results were registered taking into account the functional bioelectrical activity of the pfm ( table 6 ) . the primary aim of the study was to compare the resting and functional bioelectrical activities of pfm in different positions . it was shown that in the supine position ( c ) , the resting semg activity of the pfm reached the lowest values ( 5.7 v ) . both in the position with lower limbs placed on wedges ( a ) and with lower limbs slightly bent ( b ) , the resting activity achieved the same values ( 6.9 v ) . the results confirm the use of the supine position as the most conducive to pfm relaxation . it would seem that this phenomenon may indirectly result from the relaxation of synergist muscles , especially the am and gm ( in the supine position , their insertions are relatively close , which contributes to lower resting potential ) , but the authors did not report any association between pfm and the synergists . the literature reveals only few research studies related to the relationship between posture and the pfm activity . they conducted the measurement of resting pressure , maximum squeeze pressure , and holding periods in seconds , both in supine and standing positions . although they noted significantly higher vaginal resting pressure in the standing position , there were no differences between these two positions in maximal strength and holding time . in the present study , therefore , it seems that this position is justifiably the most commonly used for both the diagnosis and treatment of sui.37 the relationship between the position and the pfm was also assessed by chen et al.35 they evaluated 39 incontinent women to determine the changes in pfm activity during various pelvic tilt angles created by horizontal , dorsiflexed , and plantar - flexed ankle positions . to change the pelvic tilt angle , an adjustable angle platform to set the ankles in a particular position was used . according to the authors , the horizontal position was the neutral position of the pelvis , the dorsiflexed ankle position facilitated the anterior pelvic tilt , and the plantar - flexed ankle position caused the posterior pelvic tilt . the results of this study showed that higher pfm emg activity occurred in the horizontal position and when standing with the ankles in the dorsiflexion position ( when the pelvis tilts anteriorly ) than when standing with the ankles in the plantar flexion position . the results of chen et al35 are similar to our observations as , in the supine position ( c ) , in which the participants achieved the highest functional pfm activity , the pelvis tends to roll forward the most . in the scientific literature,3235,38,39 some authors highlight a close correlation and cross - functional connections between the pelvis , the pfm , and other structures of the area . incorrect pelvis position can contribute to topographical changes in the position of the proximal part of the urethra and bladder neck with respect to the surrounding structures , including the urogenital diaphragm.7,40 the course of the urethra in healthy women is generally straightforward , and its curvature can be observed in the strong lift of the pelvic floor , with a large filling of the rectum , or lowering of the pelvic floor and bladder . when the pelvis orientation is correct , the urethra is directed obliquely downward and forward , almost vertically , which allows the free flow of urine during relaxation of the sphincter.4145 the more perpendicular the course of the urethra with respect to the pelvic floor , the greater the closing force of its lumen is generated by the pfm . however , according to capson et al,34 in the hypolordotic posture , the angle between the urethra and the pfm is greater than in a neutral or hyperlordotic posture , which does not explain , as discussed in this study , the higher semg activity achieved in an anterior pelvic tilt position . it is believed that muscles around the hip joint ( especially , the am and gm ) may increase the activity of the pfm,4651 while the abdominal muscles , by affecting the muscle corset of the trunk , can unweight the pfm . in the current study , the most visible differences of the activity of the synergist muscles were observed within the am . the lowest values of electrical potential ( resting and functional ) of these muscles were in the supine position . however , the highest semg values were observed in position b , in which the feet were supported . a and c , the feet did not have the support , which might result in lower semg activity of the am muscles . it can also be assumed that the am would therefore be strongly activated in the standing position . a significant relationship between the activation of the am and the pfm was shown by norton and baker.52 they conducted a cough stress test in a standing position , standing with the legs crossed , and standing with the body inclined . the authors showed less urine leakage while standing with the legs crossed than while standing in a normal position ( p<0.01 ) , which may show the strong effect of the am muscles on pfm performance . furthermore , b and stien41 observed that the contraction of , eg , the adductor muscles , leads to the activation of the pfm . sapsford et al53 noticed that during slump - supported sitting , the activity of the pfm was lower compared to unsupported sitting positions ( which require greater muscle involvement ) . the authors postulated that particular abdominal exercises would activate the pfm . similar to the am , the resting and functional activities of the gm in the supine position were the lowest . the highest values of these muscles were observed in position b. morin et al54 noticed that hip muscles , mainly the rotator and gluteal group , facilitate pfm activation . although the differences in pfm activity in different positions are still controversial , a supine position seems to be the most suitable for assessing the function and mechanism of pfm , especially in women with sui.37 in light of the abovementioned scientific reports and what is reported in this article , the relationship among pfm , synergist muscles and the pelvic tilt merits further investigation . the assessment of activity of only a certain synergistic muscles ( ra , am , gm ) is a limitation of this study . in the literature , it is noted that the transverse abdominal muscle as well as external and internal oblique muscles play an important accessory functions in pfm performance . the decision on the assessment of selected muscles came out of the limitations of research equipment , which was able to evaluate simultaneously pfm and three pairs of other muscles . the new projects will take into account the results presented in this study as well as additional aspects that may also affect the increase in the bioelectrical activity of pfm . however , the evaluation of selected muscles in the tested positions in patients with pelvic floor insufficiency will be a continuation of the research conducted by the authors . the assessment of activity of only a certain synergistic muscles ( ra , am , gm ) is a limitation of this study . the attempt to evaluate the other abdominal muscles would be very meaningful . in the literature , it is noted that the transverse abdominal muscle as well as external and internal oblique muscles play an important accessory functions in pfm performance . the decision on the assessment of selected muscles came out of the limitations of research equipment , which was able to evaluate simultaneously pfm and three pairs of other muscles . the new projects will take into account the results presented in this study as well as additional aspects that may also affect the increase in the bioelectrical activity of pfm . however , the evaluation of selected muscles in the tested positions in patients with pelvic floor insufficiency will be a continuation of the research conducted by the authors . in the study , we evaluated the relationship between the activity of pfm and various lower limb positions . the results showed that in the supine position , the pfm achieved the lowest resting activity and the highest functional activity . therefore , the supine position can be recommended for the diagnosis and therapy of weakened pfm and sui . in the assessed positions , we did not observe that the synergist muscles ( am , ra , gm ) influence pfm activity . thus , the obtained pfm activity may be treated as a result measured in isolated conditions . it seems , however , that other muscles , such as the transverse abdominal muscles and abdominal oblique muscles , play a great supporting role for the pfm , which will be investigated in further studies .

objectivesin physiotherapeutic practice , special attention is being given to the reciprocal anatomical , physiological , and biomechanical relationship of the pelvis and the structures connected to it . however , the scientific literature shows mainly the theoretical information about their mutual connections . the lack of information about these relations from a practical aspect coupled with the paucity of scientific papers on the impact of posture changes on the pelvic floor led the authors to conduct this study . the primary aim of this study was to compare the resting and functional bioelectrical activities of pelvic floor muscles ( pfms ) depending on three different positions of the lower limbs ( positions a , b , and c ) in the supine position.materials and methodsthis was a prospective observational study evaluating resting and functional activities of the pfm depending on the position of the lower limbs . the study was carried out at the department and clinic of urology , university hospital in wroclaw , poland and the target group were women in the menopausal period . bioelectrical activity of pfm was recorded using a surface electromyographic instrument in the supine position . results of the values obtained in a , b , and c positions were compared using a one - way analysis of variance.resultsin position a , the average resting surface electromyography ( semg ) activity of pfm was 6.92.6 v ; in position b , the result was 6.92.5 v and in position c , the resting semg activity was 5.71.8 v ( p=0.0102 ) . the results of the functional bioelectrical activity of pfm were as follows : position a 20.311.8 v , position b 19.910.6 v , and position c 25.310.9 v ( p=0.0104).conclusionthe results showed that in the supine position , the pfm achieved the lowest resting activity and the highest functional activity . therefore , the supine position can be recommended for the diagnosis and therapy of weakened pfm .

Introduction Aim Materials and methods Results Characteristics of the study group Primary result Secondary result Discussion Limitations Conclusion

thermal spring 's microbiomes have been in attention of the scientific community since past few decades . these springs , being hub of diverse microflora , increase the probability of vast gene pool of uncultured microbiota . metagenomics have helped the microbiologist to reveal the genome of the rest of the 99% of non - cultivable microbes which further helped to better understand the global microbial ecology and also helped in meeting the current demand for novel enzymes . thus , with the advances in metagenomics all the hidden facts of the microbial ecology have been faced off . odisha being rich in bio - diversity due to seasonal / climatic variations possesses a variety of hot - springs located in different geographical locations and vary both in physio - chemical and microbial ecology parameters . mainly four major hot - springs have been reported in odisha i.e. deulajhari hot spring in angul , taptapani hot spring in ganjam , atri hot spring in khurda and tarabalo in nayagarh . deulajhari hot spring is located at about 6 km from athamallik and between 203 north latitude and 8449 east longitude . in our study , sediment sample from deulajhari hot spring ( latitude 20.74199 n , longitude 84.49206 e ) was collected from the hot spring having 69 c temperature . the v3v4 region of the 16s rrna was amplified using primers 341f , 5-cctacgggaggcagcag-3 and 518r , 5-attaccgcggctgctgg-3 with 50 ng of metagenomic dna . the amplified pcr product was purified by gel elution using minelute column ( qiagen , india ) and further leads to 150 nucleotide paired end multiplex sequencing using illumina gaiix sequencer at genotypic technology pvt . krona tool was used for plotting krona graph as depicted in fig . 1 . 2,073,312 high quality reads obtained from the hot spring with temperature of 69 c were used for further analysis . out of the total , proteobacteria ( 88.12% ) , bacteriodetes ( 10.76% ) , firmicutes ( 0.35% ) , spirochetes ( 0.18% ) , thermi ( 0.13% ) and chloroflexi ( 0.11% ) were identified at the phylum level . of the total 216 genera in this deulajhari hot spring only 53.7% were identified and 46.29% were unidentified at the genus level . since all the phylotypes , retrieved through the sequencing , do not contribute to all the taxonomic groups known till date , it indicates the significance of the diversity of deulajhari hot spring explored .

insights about the distribution of the microbial community prove to be the major goal of understanding microbial ecology which remains to be fully deciphered . hot springs being hub for the thermophilic microbiota attract the attention of the microbiologists . deulajhari hot spring cluster is located in the angul district of odisha . covered within a wooded area , deulajhari hot spring is also fed by the plant litter resulting in a relatively high amount of total organic content ( toc ) . for the first time , illumina sequencing based biodiversity analysis of microbial composition is studied through amplicon metagenome sequencing of 16s rrna targeting v3v4 region using metagenomic dna from the hot spring sediment . over 28 phyla were detected through the amplicon metagenome sequencing of which the most dominating phyla at the existing physiochemical parameters like ; temperature 69 c , ph 8.09 , electroconductivity 0.025 dsm 1 and total organic carbon 0.356% , were proteobacteria ( 88.12% ) , bacteriodetes ( 10.76% ) , firmicutes ( 0.35% ) , spirochetes ( 0.18% ) and chloroflexi ( 0.11% ) . approximately 713 species were observed at the above physiochemical parameters . the analysis of the metagenome provides the quantitative insights into microbial populations based on the sequence data in deulajhari hot spring . metagenome sequence is deposited to sra database which is available at ncbi with accession no . srx1459736 .

Direct link to deposited data Experimental design, materials and methods

an article recently published demonstrated the efficacy of eculizumab in the treatment of children with severe hematopoietic stem cell transplantation - associated thrombotic micro - angiopathy ( hsct - tma ) . we report the case of an adult with hsct - tma successfully treated with eculizumab . hsct - tma is a rare but very serious complication of allogeneic hematopoietic progenitor stem cell transplantation . several factors have been implicated in the endothelial damage which leads to hsct - tma : calcineurin inhibitors , acute graft versus host disease ( gvhd ) and cytomegalovirus ( cmv ) infection ; however , in recent years another mechanism has been described in which complement deregulation plays an important role . therefore complement - modulating therapies are beginning to gain ground in the treatment of this complication . we report the case of a 30-year - old man , diagnosed with very serious acquired bone marrow aplasia in july 2014 . he underwent progenitor stem cell transplantation of bone marrow from his hla - identical sister in july 2014 . the conditioning regimen consisted of cyclophosphamide ( 30 mg / kg / day , 7 to 4 ) , fludarabine ( 30 mg / m2/day , 5 to 2 ) and antithymocyte globulin ( 2.5 mg / kg / day , 3 to 1 ) . , the patient developed acute cutaneous and liver gvhd ( grade ii ) which initially responded to treatment with corticosteroids and etanercept . the patient was readmitted on post - transplant day 116 with diarrhea and hyperbilirubinemia ( 1.7 mg / dl , normal values 0.3 - 1.1 mg / dl ) and colonoscopy confirmed the existence of acute intestinal gvhd . after the diagnosis of acute grade iii gvhd , which was refractory to steroids , he sequentially received various lines of treatment ( corticosteroids , mesenchymal stromal cells and sirolimus ) without any response . on post - transplant day 189 , the patient developed severe bloody diarrhea ( up to 3000 ml / day ) followed by persistent rectal bleeding that required intense transfusional support and treatment with activated factor vii ( 5 mg/2 h 6 doses ) . a new colonoscopy was performed and the colonic mucosa biopsy confirmed worsening of the intestinal gvhd without histological evidence of hsct - tma ( figure 1 ) . iu / l ) , total bilirubin 0.7 mg / dl ( normal values 0.3 - 1.1 mg / dl ) , hemoglobin 8.5 g / dl , platelets 4210/l and normal coagulation tests . treatment was then initiated with one dose of pentostatin ( 4 mg / m2 iv ) and alemtuzumab ( 20 mg sc 3 times / week for 2 weeks ) . one week after the administration of pentostatin , and with persistent gastrointestinal bleeding , biochemistry showed hyperbilirubinemia ( total bilirubin 6.4 mg / dl , direct bilirubin 5.5 mg / dl , normal values 0.0 - 0.5 mg / dl ) and elevated ldh ( 2700 the blood count revealed profound anemia ( up to 6.8 g hb / dl ) , reticulocytosis ( 0.310/l ) , thrombocytopenia 3910/l and the presence of numerous schistocytes in blood smear ( 6% ) . other laboratory findings were : negative direct coombs test , undetectable haptoglobin , proteinuria ( 30 mg / dl ) , normal adamst13 activity ( 94% ) and normal complement proteins ( c3 and c4 ) . that the patient was diagnosed with hsct - tma , treatment was initiated with eculizumab 900 mg iv weekly for 4 doses followed by a single maintenance dose of 1200 mg 2 weeks later . after the first dose of eculizumab , the patient ceased to require transfusions and a progressive improvement in analytical parameters for microangiopathy was observed until their complete normalization after 7 weeks ( hb 11.4 g / dl , platelets 16410/l , no schistocytes , bilirubin 0.8 mg / dl and 450 ldh iu / l ) . ch50 determinations showed complement activity inhibition after each dose had been administered . coinciding with the improved of hsct - tma , the patient presented a clear response to his acute gvhd with disappearance of the diarrhea and bilirubin normalization ( figure 2 ) , although it has not been documented histologically . he was discharged eight weeks after the start of treatment ( post - transplant day 257 ) . unfortunately , one month later , the patient was readmitted by diarrhea ; a new colonoscopy showed intestinal gvhd relapse . the patient died two weeks after admission because of acute respiratory distress syndrome of unknown cause , with diffuse bilateral infiltrates , cardiomegaly and right pleural effusion in chest ct . plasma exchange , defibrotide , rituximab and basiliximab have been used with variable response rates . we started eculizumab instead of plasma exchange for the poor results of this treatment in hsct - tma cases associated with acute gvhd . in our case , the rapid clinical and analytical response to early treatment with eculizumab ( a humanized monoclonal antibody against complement fraction 5 ) supports the implication of the complement in its pathophysiology . the rapid response of a severe , refractory gvhd is noteworthy and suggests that the drug has a beneficial effect when used as coadjuvant therapy in this situation .

a 30-year - old man with acquired aplastic anemia underwent an hla - identical bone marrow transplant . he developed a grade iii acute graft versus host disease ( gvhd ) refractory to various lines of treatment . on post - transplant day 196 , he was diagnosed with stem cell transplantation - associated thrombotic micro - angiopathy ( hsct - tma ) and he received treatment with eculizumab 900 mg iv weekly for 4 doses followed by a single dose of 1200 mg 2 weeks later . after the first dose of eculizumab , the patient ceased to require transfusions and a progressive improvement in analytical parameters for microangiopathy was observed until their complete normalization . coinciding with the improved of hsct - tma , the patient presented a clear response to his acute gvhd with disappearance of the diarrhea and bilirubin normalization . he was discharged eight weeks after the start of treatment . unfortunately , one month later , the patient was readmitted for a gvhd relapse and he died two weeks later by an acute respiratory distress syndrome . in our case , the rapid clinical and analytical response to early treatment with eculizumab supports the implication of the complement in hsct - tma and suggests that the drug has a beneficial effect when used as coadjuvant therapy in acute gvhd .

Introduction Case Report Discussion and Conclusions

numerous medical conditions are known to produce psychotic symptoms that resemble schizophrenia , including metabolic and neurological disorders ( cummings 1996 ) . we describe a young woman with schizophrenia - like psychotic symptoms and functional decline in the context of diagnosed aceruloplasminemia , a disorder which has not been previously associated with psychosis . bb was a 21-year - old woman referred for neuropsychiatric assessment on the background of a psychotic illness and a confirmed diagnosis of aceruloplasminemia . bb s family had noticed an initial 18-month period of functional and social deterioration , poor school performance , social withdrawal , and periods of verbal aggression . she was initially treated by her general practitioner with fluvoxamine , but later deteriorated with frank persecutory delusions , auditory hallucinations , aggression and poor self - care over the subsequent 6 months . the local mental health team began risperidone 3 mg / day , which treated the positive symptoms but did not arrest her functional decline . bb completely avoided all social contact , only watched television and was unable to manage her activities of daily living . she was referred for neuropsychiatric assessment to further elucidate the contribution of the aceruloplasminemia to her cognitive and functional abilities . she had mild learning difficulties as a child , but attended mainstream schooling . at age 15 she had seen a school psychologist after telling other students she was going to be reborn as a prince . bb had been diagnosed with aceruloplasminemia at age 20 , after detection of abnormal liver function and hyperferritinemia of 1700 g / l ( 15200 ) . liver biopsy confirmed significant iron overload without fibrosis , and desferrioxamine 20 g thrice weekly was initiated . the diagnosis of aceruloplasminemia was highly suspected because a paternal uncle had been diagnosed with the disorder . the patient and her maternal uncle share a common , unique mutation for this disorder . bb s uncle had been described by the family as suffering long - standing behavioral problems but had never been given a psychiatric diagnosis . she was a shy and clingy child at school who had verbal and social difficulties . she left school in year 11 and attended a technical college where she also struggled . there was no history of substance abuse . on mental state examination , she was cooperative but only established superficial rapport there were no psychotic or depressive symptoms and no insight into her previous symptoms or functional impairment . on bedside cognitive testing , she scored 25/30 on the mini - mental state examination ( folstein et al 1975 ) , and 75/100 on the neuropsychiatry unit cognitive screening tool ( nucog ) ( walterfang et al 2006 ) , each significantly below expected age norms . hence , the patient was referred for a neuropsychological review , and information from an earlier assessment was obtained as a baseline . g / l ( 115150 ) with normal platelet and white cell counts and b12 and folate levels . magnetic resonance imaging ( mri ) showed global atrophy , most marked over the frontal lobes . she had a greater - than - expected load of periventricular white matter hyperintensities , and a thin anterior callosum . iron deposition was evident in the dentate nucleus of the cerebellum and the thalamus , and to a lesser degree throughout the whole cerebral cortex , but not in the basal ganglia ( figure 1 ) . a screen for lysosomal and other storage disorders on peripheral blood lymphocytes and cultured fibroblasts was normal . neuropsychological assessment showed a woman of low - average to average premorbid intellect , but demonstrating borderline general intellectual ability suggesting a significant decline . she performed significantly better on non - verbal than verbal tasks , which were poor , in addition to poor verbal memory . working memory was very poor , and psychomotor speed and speed of information processing was slowed . she displayed good performances on frontal - based tasks tapping into generating new strategies , response monitoring , inhibition , planning and organization , and mental set - shifting , although she was at times significantly slower than her age - peers . these deficits were also borne out in an occupational therapy assessment , where her deficits of new learning were manifest in requiring frequent repetition to learn new tasks , and slow mental information processing impaired her ability to deal with everyday financial and logistical tasks . the patient s risperidone was increased to 5 mg per day , with some improvement in her degree of negative symptoms without re - emergence of positive symptoms . ceruloplasmin ( cp ) is a 132-kda glycoprotein that is predominantly synthesized in the liver but does not cross the blood brain barrier and is produced by astrocytes in the cns ( klomp and gitlin 1996 ) . copper atoms incorporated during the synthesis of cp allow it to shuttle electrons and act as a multicopper ferro - oxidase . in iron homeostasis cp oxidises fe ( ferrous iron ) to fe ( ferric iron ) so that the latter can bind to transferrin and be trafficked throughout the body . fe is required as a cofactor for many biological processes but is capable of generating toxic hydroxyl and superoxide free radicals , and hence must be tightly bound to proteins during transport and storage ( de silva et al 1996 ) . cp promotes the loading of iron onto transferrin , allowing fe efflux out of cells and preventing oxidative damage caused by fe ( qian and ke 2001 ; hellman and gitlin 2002 ) . in aceruloplasminemia , an autosomal recessive disorder occurring in 1 in 2 million non - consanguinous births ( miyajima et al 1999 ) , mutations in the cp gene result in absent ferroxidase activity of cp leading to the deposition of iron in the cns , retina , pancreatic cells , liver , spleen , and ovaries ( yoshida et al 1995 ; hellman and gitlin 2002 ) . the astrocyte - specific form of cp plays a key role in regulating iron levels in the cns and in preventing free radical injury ( patel et al 2002 ) . the major sites of cns iron deposition in aceruloplasminemia are the basal ganglia , cerebellar dentate nuclei , red nucleus , thalamus , and hippocampus ( miyajima 2003 ) . the pattern of deposition , which is greatest in the globus pallidus and putamen ( miyajima 2003 ) , occurs in regions where vulnerable perivascular astrocyte populations are distributed ( klomp and gitlin 1996 ) . the sites of greatest iron concentration in healthy individuals are the basal ganglia , red nucleus , and deep nuclei of the cerebellum ( yoshida et al . aceruloplasminemia presents with retinal degeneration , diabetes mellitus and neurological symptoms , usually extrapyramidal signs , dyskinesia , dystonia , and a subcortical dementia in the fifth or sixth decade ( nittis and gitlin 2002 ) . neurological signs may be preceded for many years by diabetes mellitus and anemia due to inefficient iron delivery . mri findings typically show marked t2 hypointensity in these regions of maximal iron deposition ( morita et al . 2005 ) , although may also show subtle posterior white matter tract hyperintensity and subtle superficial cerebral and cerebellar cortical hypointensity ( grisoli et al . 2005 ) . white matter tract changes may reflect a disconnection of projecting fibres from key relay nuclei such as the thalamic nuclei , with subsequent subtle cortical changes ( grisoli et al . 2005 ) . while the clinical presentation was predominantly one of schizophrenia with no classical neurological features of aceruloplasminemia , the imaging findings of thalamic and cerebellar involvement suggest that even at this early stage cns manifestations of aceruloplasminemia are present but neurologically silent . bb s imaging also revealed prominent frontal cortical atrophy , white matter hyperintensities and thinning of the corpus callosum which are not characteristic of cp ( miyajima 2003 ) and no other pathological cause was found for these changes . regional cortical and callosal atrophy of this nature , as opposed to subtle cortical and white matter intensity changes , have not previously been reported in aceruloplasminemia . the mri findings of significant iron deposition in the thalamus and the dentate nucleus of cerebellum may be relevant to her schizophrenia - like presentation . the repeated demonstration of subtle abnormalities in structure and function of the cerebellum in schizophrenia populations has also led to its implication in the development of schizophrenia , possibly due to disruptions to the cerebellothalamo - cortico - cerebellar loop ( andreasen et al . pathology in the thalamus may also disrupt this circuit , and given that the thalamus has similarly been implicated in the pathogenesis of schizophrenia ( clinton and meador - woodruff 2004 ) , it is feasible that iron deposition - related pathology in these regions may be , in a vulnerable brain , psychotogenic . the development of psychosis in bb , atypical for aceruloplasminemia , could be seen to represent an the effects of aceruloplasminemia through pathology in dentate and thalamic regions in bb may have interacted with an early frontal insult , such as perinatal hypoxia or other obstetric complications known risk factors for the later development of schizophrenia ( cannon et al . 2002a , 2002b ) or with other unknown biological vulnerabilities , to result in schizophrenia - like symptoms during the typical age of onset for the disorder . there is a strong relationship between anatomic abnormalities in the hippocampus , cerebellum and thalamus and schizophrenia ( harrison 1999 ; shenton et al . 2001 ) and iron deposition in these regions during adolescence may have triggered a vulnerability to schizophrenia - like psychosis in this patient .

schizophrenia - like illnesses occur in a variety of medical and neurological conditions but to date have not been described in association with aceruloplasminemia . aceruloplasminemia is an autosomal recessive disorder of iron metabolism which leads to iron deposition in the basal ganglia , thalamus , cerebellum and hippocampus and which usually presents in middle age with extrapyramidal symptoms and dementia . we describe a 21-year - old woman on treatment for aceruloplasminemia who presented with schizophrenia - like psychosis and declining function in the absence of neurological signs . neuropsychological testing showed significant dominant hemisphere deficits . magnetic resonance imaging showed bilateral iron deposition in the cerebellar dentate nuclei and thalami , frontal atrophy , and periventricular white matter hyperintensities . functional imaging suggested global hypoperfusion . the clinical , cognitive and imaging findings were not typical for either aceruloplasminemia or schizophrenia alone and the possible relationship between the two disorders is discussed with particular reference to implications for our understanding of schizophrenia .

Introduction Case history Discussion

we screened a collection of sponge- and marine fungi - derived extracts ( n = 2500 ) and pure compounds ( n = 400 ) using a primary cell - based in vitro model of hiv-1 latency that is re - engineered for optimal sensitivity and miniaturized for high - throughput screening . two hits were initially given high priority for further investigation : ( 1 ) the extract of a sponge putatively identified as pseudoceratina purpurea ( ucsc coll . 06135 ) , based on morphological similarity to previously identified sponges , and ( 2 ) the extract of a marine - derived fungus that was not taxonomically identified ( ucsc strain no . briefly , the known compounds psammaplin a and apicidin , shown in figure 1 , were isolated from the sponge and fungal extracts , respectively , and retested to show significant potencies ( ec50 = 0.2 m and ec50 = 0.3 m , respectively ) . a critical first step in these outcomes was the application of our recently published method for natural product peak library fractionation , whereby hplc coupled with ms and evaporative light scattering detection ( elsd ) maps the distribution of metabolites into biological screening wells as a function of retention time ( see experimental section and figure s1 , supporting information ) . subsequent operations involved scale - up isolation via peak libraries annotated with m / z ms data and bioassay hit information . apicidin has previously been shown to function as an hiv-1 reactivator via an hdaci mechanism . the successful workflow described above was employed to investigate the active extract of a marine - derived humicola fuscoatra ( ucsc strain no . 108111a ) , whose peak library elsd profile is shown in figure 2 , panel a. the major component ( tr = 2728 min ) showed a positive response in the latent hiv-1 reactivation assay . the mass spectrum ( esitof+ ) of this analyte displayed a chlorinated ion at m / z = 387.1:389.1 ( 3:1 intensity , figure 2 , panel b ) , which we duly assigned as the sodiated molecular ion [ m + na ] in conjunction with an ancillary [ m + h ] signal observed at m / z 365.1 . isolation of this active material ( ec50 = 9.1 m ) was accomplished by retrieving a pure sample from an archived library plate , and an accurate mass was measured ( esitof+ ) as 387.0637 ( [ m + na ] ) , consistent with the molecular formula of c18h17clo6 , un = 10 . conducting a literature search based upon taxonomy and this molecular formula yielded radicicol ( 1 ) , a well - known fungal metabolite and potent in vitro hsp90 inhibitor , as a solitary dereplication hit . indeed , the h nmr spectrum of the active extract ( figure 2 , panel c ) was dominated by the resonances of this metabolite . additionally , the specific rotation of + 203 for our sample from h. fuscoatra matched the literature value for 1 ( + 216 ) ; therefore , we assigned the absolute configuration of the three asymmetric carbon atoms in 1 as all r , based on a previously reported single - crystal xrd assignment . analytical data for the active extract of humicola fuscoatra ( ucsc strain no . annotations indicate the distribution of compounds 17 ( see experimental section for elution conditions ) . ( b ) esitof(+ ) m / z data collected during peak library fractionation . expansion of [ m + na ] ion for radicicol ( 1 ) , at tr = 27 min ( see panel a ) . ( c ) 600 mhz h nmr spectrum in acetone - d6 . the expanded region shows the aromatic singlet of the most abundant minor congener , compound 4 . we were inspired to further mine the extract for radicicol congeners by two pieces of information : ( 1 ) the h nmr spectrum shown in figure 2 , panel c , displayed a characteristic aromatic singlet of considerably less intensity than that of the major metabolite , and ( 2 ) the mass chromatogram generated during the peak library fractionation was rich with chlorinated ions in the region of 2026 min ( figure 2 , panel a ) . successive rounds of ms and nmr - guided hplc purification yielded minor quantities of several additional radicicol congeners : three known compounds , pochonins b ( 2 ) , c18h19clo7 , c ( 3 ) , c18h18cl2o6 , and n ( 4 ) , c18h21clo7 , and three new natural products , radicicols b d ( 57 ) . the molecular formulas and nmr properties of the known compounds radicicol b ( 5 , c18h19clo7 , un = 9 ) contains an additional molecule of h2o and one less degree of unsaturation relative to radicicol ( 1 ) . the h and c nmr data of 5 closely matched those of 1 with the following exceptions : ( i ) the h-4 and h-5 proton resonances of 1 were transposed downfield from h 3.05 and 3.32 to h 3.62 and 4.50 , respectively , and ( ii ) the c-4 and c-5 carbon resonances of 1 were transposed downfield from c 56.1 and 55.8 to c 71.9 and 69.4 , respectively . taken together with the gcosy and ghmbc correlations shown in figure 3 , the data suggest the epoxide of 1 is a 1,2-diol in 5 . the planar structure of 5 is identical to semisynthetic epoxide - opened diasteromers of natural radicicol described in both patent and peer - reviewed literature . the configuration of position c-2 is proposed to be analogous to that of radicicol ( 1 ) , and the anti relative configuration for the 1,2-diol of 5 is assigned based on a vicinal proton coupling constant of j4,5 = 5.4 hz , which matched the reported value of the synthetic anti diastereomer ( lit.j4,5 = 6.1 hz ) . the molecular formula of radicicol c ( 6 , c18h21clo8 , un = 8) contains two additional h2o molecules in comparison to 1 . the c nmr data ( table 1 ) matched those of 1 for all positions , apart from c-3 to c-10 , and suggested the two equivalents of h2o were positioned in the macrocyclic chain . with the aromatic ring functionality and macrocyclic ester linkage deemed intact , the two remaining degrees of unsaturation were assigned to resonances of a ketone ( c 204.1 ) and a trans double bond ( c 135.7 and 131.7 ; h 5.47 and 5.39 , jhh = 15.6 hz ) . additionally , three secondary alcohols were detected at h 3.60 , 3.93 , and 4.27 ( c 78.7 , 69.1 , and 70.2 ) . a single extended spin system in the gcosy spectrum was delineated from h3 - 1 to h2 - 9 , and long - range ghmbc correlations finalized the planar structure of 6 as shown in figure 3 . the stereochemistry of position c-2 is proposed to be analogous to that of radicicol ( 1 ) ; however due to a lack of both epoxide and ,,,-unsaturated ketone functionalities , radicicol c ( 6 ) is too flexible to assign the relative configurations of the three secondary alcohols by noesy correlation spectroscopy . radicicol d ( 7 ) was assigned the same molecular formula as 2 and 5 based on accurate mass measurement and required nine degrees of unsaturation . comparison of c chemical shifts to those of 1 indicated the aromatic ring functionality and macrocyclic ester linkage remained intact , and positions c-4 to c-10 were modified . two of the three remaining degrees of unsaturation were assigned to a ketone detected at c 203.7 and a cis double bond at c 129.9 and 131.6 ( h 5.98 and 6.09 , jhh = 6.2 hz ) . additionally , three oxygenated carbons were detected at c 72.3 , 84.1 , and 89.7 . the connectivity from positions 1 through 9 was established from the gcosy and ghmbc data ( figure 3 ) , and on the basis of the vicinal coupling constant of 6.2 hz between olefinic protons h-6 and h-7 , the final unit of unsaturation was assigned to a 2,5-disubstituted-2,5-dihydrofuran ring system . the stereochemistry of position c-2 in radicicol d ( 7 ) is proposed to be analogous to that of radicicol ( 1 ) ; the relative configuration of positions 4 , 5 , and 8 could not be assigned using data sets collected in this study . the possibility that radicicols b d ( 57 ) are artifacts produced during the isolation process was ruled out , as they were detected in the lcms analysis of the original etoac extract . furthermore , compounds 57 were not detected by lcms or h nmr after prolonged exposure of both natural ( 1 ) and commercial ( sigma ) radicicol samples to the isolation conditions . selected gcosy ( bold ) and ghmbc ( arrow ) correlations for radicicols b d ( 57 ) . reported values include % reactivation relative to saha and potency ( ec50 in m ) . the screening data obtained in this study are summarized in table 2 , and some of the patterns deserve additional discussion . radicicol ( 1 ) was isolated as the most abundant metabolite of h. fuscoatra and exhibited 98% reactivation efficiency of latent hiv-1 relative to the tool compound saha ( figure 4 ) and an ec50 of 9.1 m . radicicol activation of hiv-1 was confirmed by qpcr of hiv-1 rna in the same latency model ( see supplementary experimental procedures and figure s15 , supporting information ) . of the additional congeners 27 , isolated from the fungal extract , pochonins b ( 2 ) and c ( 3 ) and radicicol b ( 5 ) were reactivators ( figure 4 ) , while pochonin n ( 4 ) and radicicols c ( 6 ) and d ( 9 ) were found to be inactive . comparison of the structures of the active compounds suggests the epoxide functionality is not required for activation in our assay ; however , the active compounds all contain a michael acceptor functionality , something the inactive compounds 4 , 6 , and 7 do not possess . while the potencies in reactivating latent hiv-1 for the active radicicols and pochonins are lower than that of romidepsin , it appears that their mechanism of action is unique and remains to be elucidated . indeed , radicicol was previously reported to lack in vitro activity against histone deacetylase . although radicicol is a potent in vitro hsp90 inhibitor ( ic50 = 19 nm ) , a structurally unrelated hsp90 inhibitor , geldanamycin , is inactive in our assay , indicating that the mechanism of hiv-1 reactivation by 1 is unlikely to involve hsp90 inhibition . in addition , the most potent analogue , pochonin c ( 3 ) , is unlikely to act as an hsp90 inhibitor based on the conformational hypothesis advanced by winssinger : that hsp90 inhibition by radicicol - type resorcylides is closely tied to a specific bioactive molecular topology attenuated by modifications at the epoxide moiety . finally , radicicol did not induce detectable nfkb reporter gene activation in jurkat cells ( see supplementary experimental procedures and figure s15 , supporting information ) , indicating it reactivates latent hiv-1 by a pkc - independent mechanism . in vitro latent hiv-1 reactivation assay : dose response profiles of radicicol ( 1 ) , pochonin b ( 2 ) pochonin c ( 3 ) , and radicicol b ( 5 ) relative to the maximum activation of the positive control saha . . a screening paradigm has been created consisting of a sensitive and high - throughput primary cell - based hiv-1 latency assay that was well suited to investigate diverse marine natural product collections for novel reactivators of latent hiv-1 . the assay was robust with highly reproducible ec50 values for reference compound saha in all donors used in this screen . starting from an extract of the marine - derived fungus h. fuscoatra and followed by successive rounds of purification , dereplication , and bioassay , we isolated seven compounds in the radicicol / pochonin class , of which four display latent hiv-1 reactivation activity , providing a preliminary understanding of the structure activity relationship of these compounds . at this stage we believe that the new hiv-1 reactivators summarized in table 2 can be either the seeds for further scaffold modification or useful in combination with agents possessing a distinct mechanism of action , such as romidepsin , to achieve a higher magnitude of latent hiv-1 reactivation . standard pulse sequences were used for all nmr experiments , which were run on either a varian unity inova spectrometer ( 600 and 150 mhz for h and c , respectively ) equipped with a 5 mm triple resonance ( hcn ) cold probe or a varian spectrometer ( 500 and 125 mhz for h and c , respectively ) equipped with an inverse detection probe . residual solvent shifts for acetone - d6 were referenced to h 2.05 and c 29.84 , respectively . accurate mass measurements were obtained on a mariner esitof instrument for molecular formula determinations . all chromatographic work was done in reversed - phase and utilized hplc grade ch3cn ( solvent a ) and milli - q h2o ( solvent b ) , both adjusted to contain 0.1% formic acid . the analytical lcms system was composed of waters hplc components ( i.e. , solvent pumps and autosampler ) and controlled by empower software . a 150 4.60 mm 5 m luna c18 column ( phenomenex ) was utilized , and the system operated at a flow rate of 1 ml / min . the postcolumn flow of the eluent was first through a photodiode array ( waters ) and then split ( 1:1 ) between an evaporative light - scattering detector ( sedex model 55 ) and an esitof mass spectrometer ( applied biosystems mariner ) . the semipreparative hplc system was composed of waters hplc components ( i.e. , solvent pumps and gradient controller ) and equipped with a 250 10 mm 5 m luna c18 column ( phenomenex ) and tunable uv - absorbance detector ( waters ) . the humicola fuscoatra strain ( ucsc coll . 108111a ) was isolated from sediment collected at <33 m depth by scuba in tutuila , american samoa ( s 1416.600 , w 17036.719 ) , in 2010 . the strain was taxonomically identified by molecular ( 100% by its and d1/d2 regions of rdna ) and morphological methods at the university of texas fungus testing laboratory . the 125 ml and 5 l cultures of 108111a were grown in media that consisted of the following : cornmeal ( 4.5 g/150 ml ) and 5xasw ( 200 after autoclave sterilization , the cultures were inoculated and shaken at 75 rpm for 21 days at ambient temperature . at the time of harvest , the fungal cultures ( 5 1 l ) were homogenized , and the liquid was extracted three times with equal volumes of etoac . the combined organic extracts were concentrated in vacuo to yield 2 g of oil . a portion of the 108111a cma extract ( 194.9 mg ) was separated into 15 fractions ( fraction codes h1h15 , figure s2 ) using the semipreparative hplc system utilizing a flow rate of 3 ml / min , 310 nm detection , and the following elution conditions : 15 min isocratic 25:75 , 25 min gradient from 25:75 to 70:30 , 3 min gradient from 70:30 to 100:0 , 10 min isocratic 100:0 , and 3 min gradient from 100:0 to 25:75 . fraction h5 was pochonin n ( 4 , 5.0 mg ) , fraction h9 was pochonin b ( 2,1.8 mg ) , and fraction h9 was pochonin c ( 3 , 1.9 mg ) . fraction h12 was semipure radicicol , and an additional run under identical hplc conditions yielded pure radicicol ( 1 , 11.2 mg ) and three new analogues : radicicol b ( 5 , 1.2 mg ) , radicicol c ( 6 , 2.2 mg ) , and radicicol d ( 7 , 1.0 mg ) . the instrumentation setup for our natural product peak library generation has been recently published . the hplc stage utilized two waters 510 pumps and a waters 717plus autosampler , both controlled with empower 2 software . separation was performed on a 250 10 mm 5 m luna c18 column ( phenomenex ) . spectra from three detectors were acquired during peak library fractionation : waters 996 photo diode array , sedex 55 elsd , and mariner 5054 esi - tof - ms . the mobile phase parameters are ch3cn ( a ) and h2o ( b ) with a flow rate of 2 ml / min and the following elution conditions : 30 min gradient from 10:90 , 10 min isocratic 100:0 , 1 min gradient from 100:0 to 10:90 , 9 min isocratic 10:90 . sample collection was performed using a gilson 215 liquid handler controlled with gilson unipoint lc software . samples were collected into bd biosciences 96-deep - well plates , with a working volume of 2 ml ( part number : 353966 ) . after the lc - ms - uv - elsd library is collected , a duplicate archive plate is generated for analytical reference using a 12-channel pipet , creating an exact copy and counter balance for centrifugal drying . [ ]d + 216 ( c 1.00 , chloroform ) ; uv , h nmr , c nmr , and hresitofms data were in accordance with reported values . [ ]d + 20 ( c 1.0 , acetone ) ; uv , h nmr , c nmr , and hresitofms data were in accordance with reported values . ( )-2r,4s,5r [ ]d 68.3 ( c 0.06 , chloroform ) ; uv , h nmr , c nmr , and hresitofms data were in accordance with reported values . [ ]d 77.3 ( c 1.00 , methanol ) ; uv , h nmr , c nmr , and hresitofms data were in accordance with reported values . [ ]d + 32 ( c 0.8 , methanol ) ; uv ( lc eluent h2o / ch3cn / formic acid , 1:1:0.1 ) max ( au ) 219 ( 0.87 ) , 276 ( 0.60 ) nm ; h and c nmr data , see table 1 ; hresitofms m / z 405.0739 [ m + na ] ( calcd for c18h19clo7na , 405.0712 ) . [ ]d 69 ( c 1.0 , methanol ) ; uv ( lc eluent h2o / ch3cn / formic acid , 1:1:0.1 ) max ( au ) 219 ( 0.94 ) 262 ( 0.36 ) 309 ( 0.20 ) nm ; h and c nmr data , see table 1 ; hresitofms m / z 423.0826 [ m + na ] ( calcd for c18h21clo8na , 423.0817 ) . [ ]d 53 ( c 0.4 , methanol ) ; uv ( lc eluent h2o / ch3cn / formic acid , 1:1:0.1 ) max ( au ) 217 ( 0.48 ) 257 ( 0.12 ) 297 ( 0.08 ) nm ; h and c nmr data , see table 1 ; hresitofms m / z 405.0668 [ m + na ] ( calcd for c18h19clo7na , 405.0712 ) . an nl4 - 3-based vector with frame - shift mutations in vpr and env genes was engineered with a codon - optimized firefly luciferase gene in place of nef to generate the resulting construct pks13 . the nl4 - 3-luc virus was generated by co - transfection of hek-293 t cells with pks13 and a plasmid containing the hiv-1 env gene using lipofectamine 2000 ( life technologies ) . briefly , naive cd4 + t cells were purified by negative selection using pbmcs from healthy hiv-1 negative donors . purified naive cd4 + t cells were activated by incubation with anti - cd3/cd28 magnetic dynabeads ( 1 bead:2 cells ratio , life technologies ) , 1 mg / ml anti - il-4 ( r&d systems ) , 2 mg / ml anti - il-12p70 antibodies ( r&d systems ) , and 10 ng / ml tgf- ( r&d systems ) for 3 days . cells were maintained in 30 u / ml il-2 ( life technologies ) for 2 days followed by infection with nl4 - 3-luc . seven days postinfection , 20 l of latently infected cells at 10 000 cells / well was dispensed into 384-well plates containing 350 nl of compound solutions in 50 l of culture medium . after a 48 h incubation , 40 l / well briteglo ( promega ) was added , and luminescence measured using the envision plate reader ( perkin - elmer ) .

an extract of humicola fuscoatra ( ucsc strain no . 108111a ) was shown to reactivate latent hiv-1 expression in an in vitro model of central memory cd4 + t cells . we report the bioassay - guided isolation and structure determination of several resorcyclic acid lactones , including four known compounds , radicicol ( 1 , aka . monorden ) and pochonins b ( 2 ) , c ( 3 ) , and n ( 4 ) , and three new analogues , radicicols b d ( 57 ) . compounds 13 and 5 showed moderate activities in the memory t cell model of hiv-1 latency . radicicol ( 1 ) displayed lower potency in reactivating latent hiv-1 ( ec50 = 9.1 m ) relative to the hdac inhibitors apicidin ( ec50 = 0.3 m ) , romidepsin ( ec50 = 0.003 m ) , and saha ( ec50 = 0.6 m ) ; however , it achieved equivalent maximum efficacy relative to the positive control compounds ( 98% of saha and romidepsin ) .

Results and Discussion Experimental Section

warfarin is highly effective in reducing stroke risk in patients with atrial fibrillation ( af ) . however , using warfarin is not easy ; effort is needed to educate patients about drug and dietary interactions , and serial monitoring of the international normalization ratio ( inr ) is required . as a result , a recent population - based cohort study showed that 43% of patients stopped warfarin within 3 years and 61% within 5 years.1 in addition , warfarin has a narrow therapeutic threshold , and the quality of anticoagulation has a critical influence on its effect . in a uk cohort study , warfarin therapy with a time in therapeutic range ( ttr ) of inr of less than 60% did not significantly reduce stroke risk compared to no antithrombotic therapy.2 in a post hoc analysis of active w ( atrial fibrillation clopidogrel trial with irbesartan for prevention of vascular events ) , in order to ensure the superiority of warfarin over clopidogrel plus aspirin the minimum projected ttr threshold was 58%.3 while suboptimal doses lead to an increased risk of ischemic stroke , overdosing frequently results in hemorrhage that can be fatal . even in the setting of clinical trials , the reported ttrs were only about two thirds.4,5,6,7 it also has been shown that eight adverse bleeding events are estimated to occur annually for every 100 patients treated,8 and the underutilization of warfarin is in part due to concerns about hemorrhagic risk . lastly , the use of warfarin is particularly cumbersome in old subjects and in those with stroke . they are more vulnerable to bleeding complications that may be related with poor compliance , cognitive impairment , and the frequent presence of comorbid diseases that require polypharmacy and invasive procedures . in subjects undergoing invasive treatment , periprocedural management is difficult and carries a high risk for thromboembolism , partly because of the slow onset and offset of action ( long half - life ) of warfarin . therefore , more ideal anticoagulants are required that have a wide therapeutic range , a short half - life , and a predictable therapeutic effect with fixed or weight - based dosing , without significant food or drug interaction.9 several warfarin alternatives have been tested but failed to show benefits because of serious adverse effects , i.e. , excessive bleeding with idraparinux10 or hepatic dysfunction with ximelagatran.11 new oral anticoagulants ( noacs ) ( dabigatran , apixaban , rivaroxaban , and edoxaban ) were first introduced in 2005 , for prophylaxis against venous thromboembolism after total hip or knee replacement surgery , and are now used to prevent and treat deep vein thrombosis and pulmonary embolism ( table 1).12 more recently , four large phase iii randomized controlled trials of noacs ( re - ly , rocket - af , aristotle , and engage - af - timi 48 ) have been completed in patients with non - valvular af.4,5,6,7 overall , noacs were superior or non - inferior to warfarin in the prevention of ischemic stroke and systemic embolism , but superior to warfarin in reducing hemorrhagic stroke.4,5,6,7 noacs may be more beneficial among patients with af - related stroke or transient ischemic attack ( tia ) ; a recent meta - analysis showed that noacs significantly reduced stroke or systemic embolism , as well as hemorrhagic stroke or major bleeding , in patients with af and previous stroke or tia.13 the relative risk reduction and the number needed to treat with noacs vs. warfarin to reduce stroke / systemic embolism were estimated to be 14% and 134 patients ; for avoiding hemorrhagic stroke the respective values were 57.9% and 139 patients.13 evidence from these trials forms the basis for national and international guidelines for the management of patients with non - valvular af in clinical practice . although aspirin was preferred in patients with a low - risk of stroke , new and safer anticoagulants may lead to lowering of the threshold for anticoagulation.14 the selection of antithrombotic agent ( warfarin vs. noacs ) should be individualized on the basis of risk factors , cost , tolerability , patient preference , potential for drug interactions , and other clinical characteristics such as renal function and ttr.15 it would be unnecessary to switch from warfarin to noacs in patients who already achieve stable and good inr control with warfarin . good anticoagulation control ( ttr>70% ) is associated with the best efficacy and safety of warfarin,2 and the recent meta - analysis of the four phase iii noacs trials showed that there was a greater relative reduction in major bleeding with noacs when the ttr was less than 66% than when it was greater.16 first of all , it appears that asians more often have cerebral small vessel disease , which is prone to bleeding . it has been shown that hemorrhagic stroke ( intracerebral or subarachnoid hemorrhage ) , which accounts for 15% to 20% of strokes in whites,17 is more frequent among asians.18 death from hemorrhagic stroke is also much more common in asians.19 the prevalence of cerebral microbleeds , which increase the risk of intracerebral hemorrhage on anticoagulation , also appears to be higher in asian than in white population.20 the ethnic differences in bleeding - prone small artery disease are in part related with the high prevalence of uncontrolled hypertension or hypocholesterolemia in this region.21 ethnic differences in the salt sensitivity of intracranial hemorrhage ( ich ) have also been addressed.22 whatever the reason , these small artery diseases predispose patients to cerebral bleeding when they are given antithrombotics ; the presence of cerebral small artery diseases , such as lacunar infarcts , white matter ischemia or microbleeds , increases the risk of ich in patients receiving antiplatelet agents23 or anticoagulants.24,25 a recent study showed a high prevalence of warfarin - associated ich in asians , even if the inr levels were comparable ; the hazard ratio for ich was 4.06 for asians , and 2 for hispanics and blacks compared to whites.26 considering that noacs have a lower bleeding risk than warfarin , the benefit of noacs may be greater in asian patients . second , asians generally favor complementary treatment , such as herbal medication and healthy food . according to a study from korea , 40% of patients who were initially treated in a large tertiary hospital tried additional herbal treatment after discharge.27 this is in strong contrast to a report from canada , where patients with cerebrovascular diseases rarely used alternative medicine.28 a study from hong kong found that 26% of patients taking warfarin had ingested herbal remedies.29 this behavior probably results in significant warfarin - drug / food interaction , poor inr control , and may at least in part explain the lower ttr achievement in asian ( mean 54.5% ) than in non - asian ( 66.2% ) patients in the re - ly trial.30,31 as asians more often had a lower ( rather than higher ) inr level , another explanation would be that asian physicians tend to target a relatively low inr because of the fear of bleeding complications . indeed , japanese guidelines recommend a target inr of 1.6 - 2.6 for japanese people.32 whatever the reason , inr control is relatively poor in asia , which also supports the notion that noacs may be more suitable for asians . finally , there has been evidence that population frequencies of genetic polymorphisms related with warfarin metabolism and action ( e.g. , cyp2c9 and vkorc1 ) differ according to ethnicities.33,34,35 apart from being linked to ethnic variations in the required warfarin dose , these differences may also partly explain the poor inr control and the higher risk of ich among asians . recent studies report that noacs may be particularly valuable in asians compared to non - asians.31,36,37 the re - ly investigators reported that , among patients treated with warfarin , asians ( vs. non - asians ) had higher rates of ischemic stroke ( by 2.1-fold ) as well as hemorrhagic stroke ( by 2.4-fold ) , despite similar blood pressure , younger age , and relatively lower inr values . the magnitude of the benefit from dabigatran in the prevention of ischemic stroke and hemorrhagic was greater in asians than in non - asians.31 more recently , chiang and colleagues reported a post - hoc analysis of the asian population included in the re - ly and arisotle trials , which showed that , compared to non - asians , asians had a lower number needed to treat with noacs vs. warfarin to reduce stroke / systemic embolism , and a higher number needed to treat to avoid hemorrhagic complications , favoring their use in asians in terms of both efficacy and safety.38 cost - effectiveness analyses showed that noacs are cost - effective relative to warfarin for stroke prevention in patients with af and stroke / tia.39,40,41 cost - effectiveness is associated with the cost of the drug , care costs , the loss of productivity due to disability following recurrent disease , individual patient risk for thromboembolism and bleeding , and the quality of anticoagulation control ( i.e. , ttr ) which in turn is related to compliance , warfarin pharmacogenomics , and accessibility for regular inr tests . we suggest that noacs may be particularly cost - effective in asian stroke patients for the following reasons . first , the risk of both recurrent thromboembolism and bleeding is higher in stroke patients than in patients without stroke . moreover , as discussed above , asians are at higher risk of warfarin - related ich , a devastating condition , than caucasians . second , patients with af - related stroke have a poorer control of inr than those without stroke , probably because of more severe neurological disability and a lack of access to frequent inr monitoring . it has been shown that most ( > 70% ) af - related stroke patients have lobar or territorial infarcts,42 and poor anticoagulation control is associated with the size of brain infarcts ( figure 1).43 thus , asian stroke patients more often face problems in using warfarin : difficulty in maintaining inr and frequent bleeding complications . in this . however , noacs are expensive drugs and studies focusing on the cost - effectiveness of noacs in asian stroke patients are unavailable . nevertheless , given the considerations so far discussed , we propose that the reimbursement policy for the use of noacs should be more generous for asian stroke patients . the guidelines for the reimbursement of noacs are summarized in table 2 . in japan , taiwan , norway , switzerland , iceland , and the united arab emirates , there is no restriction as long as noacs are prescribed on - label . the reimbursement guidelines for noacs in some european countries , including the uk , france , and germany , are based only on the chads2 score ( 1 ) . other european countries and canada include both chads2 score and the quality of anticoagulation control . for example , the provincial reimbursement guideline for noacs in canada includes ( a ) unable to tolerate warfarin , ( b ) inrs not well controlled on warfarin , or ( c ) unable to have inrs tested regularly , in patients with a chads2 score of 2 . the guidelines for the reimbursement of noacs in korea are similar to those of canada , but the accessibility ( ability to have inr tested regularly ) is not considered . the criteria for ' inadequate anticoagulation ' appear to be too strict , especially during the maintenance period ( table 3 ) . as a result , it is difficult to prescribe noacs to stroke patients with severe disability , or those who live in remote areas ( e.g. , on an island ) and are thus unable to test inr regularly . the guideline also recommends a frequent change of warfarin dose ( at least 5 times during 6 months ) to monitor inr . this is in conflict with a randomized study comparing ttr between warfarin dose assessment every 4 weeks vs. every 12 weeks , which showed that frequent dose changes to monitor inr are unnecessary and result in temporary fluctuation of the inr.44 moreover , the guidelines state that reimbursement can be allowed if patients have a major bleeding complication during warfarin treatment . from the strokologist 's point of view this does not make sense , because warfarin - associated ich is frequently fatal . we understand that the strict guidelines can be attributed to the high cost of noacs , which may adversely affects the health budget , but we would suggest that the guidelines be more generous to asian stroke patients , who are particularly vulnerable to the adverse effects of warfarin . we suggest that this approach may be more cost - effective than not using noacs , because recurrent ischemic stroke or ich will be very costly in this rapidly aging society . as discussed above , cost - effectiveness studies on asian stroke patients are unavailable and should be performed in the future to answer this question . af is an emerging global epidemic in both high - income and low - income countries . recently , the use of noacs in af patients has been rapidly increasing , but the cost of noacs is unaffordable in low - income to middle - income countries . . however , the cost - effectiveness of noacs will depend on the characteristics of patients as well as therapy pricing . asian countries are facing population aging at a pace that is unprecedented and an increasing burden of stroke , particularly af - related stroke . af - related stroke is more disabling and more fatal than other stroke subtypes , and is expected to increase substantially in the decades to come ( figure 2 ) . compared to caucasians , asians more often develop hemorrhagic stroke and warfarin - related ich , as well as any stroke in the case of patients with af , and the benefit with noacs vs. warfarin for preventing stroke and reducing anticoagulation - related ich would be particularly high in asians . nevertheless , the current reimbursement guidelines are in general suboptimal . we suggest that guidelines for using noacs should be more generous for asian stroke patients . in addition , as noacs are expensive , continuous efforts should be made by healthcare providers and governors to find the ideal candidate for noacs ( most cost - effective group ) ; this includes research to find genetic or clinical factors that predict the quality of anticoagulation control.45,46 close communication is needed to arrive at a consensus decision regarding the coverage guideline for those patients who need noacs , and to reduce the ever - increasing burden of af - related stroke .

atrial fibrillation ( af ) is an emerging epidemic in both high - income and low - income countries , mainly because of global population aging . stroke is a major complication of af , and af - related ischemic stroke is more disabling and more fatal than other types of ischemic stroke . however , because of concerns about bleeding complications , particularly intracranial hemorrhage , and the limitations of a narrow therapeutic window , warfarin is underused . four large phase iii randomized controlled trials in patients with non - valvular af ( re - ly , rocket - af , aristotle , and engage - af - timi 48 ) demonstrated that new oral anticoagulants ( noacs ) are superior or non - inferior to warfarin as regards their efficacy in preventing ischemic stroke and systemic embolism , and superior to warfarin in terms of intracranial hemorrhage . among af patients receiving warfarin , asians compared to non - asians are at higher risk of stroke or systemic embolism and are also more prone to develop major bleeding complications , including intracranial hemorrhage . the extra benefit offered by noacs over warfarin appears to be greater in asians than in non - asians . in addition , asians are less compliant , partly because of the frequent use of herbal remedies . therefore , noacs compared to warfarin may be safer and more useful in asians than in non - asians , especially in stroke patients . although the use of noacs in af patients is rapidly increasing , guidelines for the insurance reimbursement of noacs have not been resolved , partly because of insufficient understanding of the benefit of noacs and partly because of cost concerns . the cost - effectiveness of noacs has been well demonstrated in the healthcare settings of developed countries , and its magnitude would vary depending on population characteristics as well as treatment cost . therefore , academic societies and regulatory authorities should work together to formulate a scientific healthcare policy that will effectively reduce the burden of af - related stroke in this rapidly aging society .

Unmet need for anticoagulation: Alternatives to warfarin? Results from major randomized clinical trials of new oral anticoagulants Viewing NOACs from Asian perspectives Using NOACs in Asian stroke patients may be cost-effective Viewing reimbursement guidelines for NOACs from strokologists' perspective Conclusions

the author has not received any funding or benefits from industry or elsewhere to conduct this study .

there remain tremendous opportunities to improve the stability and safety of american health care . within this context , residents and residency programs face two essential questions : how to reduce the risk to patients resulting from resident inexperience , and how to change our programs to create the safer physician of the future ? the spread of side - by - side teaching and non - teaching services creates a natural setting to study these questions and improve both services . when asked the question , would you admit your mother to the resident service ? , many of us respond , it depends . we are focusing this column on helping programs answer this question definitively in the positive , share potential best practices , and underscore community hospital 's contribution to our understanding of patient safety .

Conflict of interest and funding

attention to women 's health has evolved from a limited focus on reproductive and breast health to encompassing all aspects of health from birth through old age . in the era of individualized and precision medicine , innovative medical , surgical , pharmacological , regenerative , and genetic technologies are available to improve the health of women . application of these technologies increases the potential to better diagnose and treat conditions , both acute and chronic , that are specific to women , occur more frequently in women than men , or that present with different symptoms and outcomes for women compared to men . to address the evolving definition of women 's health , health care and academic research institutions have established women 's clinical and research centers that encompass holistic approaches to women 's health and include gynecological , reproductive , and obstetric services , as well as other medical subspecialties ( e.g. , cardiology , gastroenterology , immunology , hematology , endocrinology , nephrology , neurology , rehabilitation medicine , nutrition , and psychiatric services ) . many of these centers were developed as a result of government - funded initiatives promoted by the office on women 's health in the department of health and human services ( i.e. , the centers of excellence in women 's health ) and by the office of research on women 's health ( orwh ) at the national institutes of health ( i.e. , the specialized centers of research on sex differences ) , and the training program building interdisciplinary research careers in women 's health ( bircwh ) . critical to the future advances in women 's health is continued research into all aspects of female physiology and pathophysiology to provide the evidence base for practice guidelines and to educate the next generation of basic science investigators , clinical investigators , and healthcare providers . the national institutes of health 's ( nih ) commitment to improving health outcomes for women and men through rigorous science has been compromised by the lack of basic science evidence obtained from females animals . to correct this limitation , in june 2015 the nih announced expectations that sex , as a biological variable , be included into research design and analysis in studies of vertebrate animals and humans ( not - od-15 - 102 ) . however , caution is needed in how this directive is interpreted by scientists and study sections who review grant applications . there is a risk that their interpretation may restrict attention to studies involving the direct comparison between female / women and male / men ignoring the contribution of sex - specific conditions . understanding how sex influences all aspects of health and disease needs to take a programmatic approach that includes the study of sex - specific conditions . legislation reintroduced into the united states house of representatives in the form the research for all act 2101 ) codifies the nih support for the specialized centers of research on sex differences . first , the language of the final bill should not be restrictive , but rather flexible so that the centers can expand their research scope to follow scientific discoveries . second , in the need to increase understanding of the physiological processes that differ between women / females and men / males , it is possible to ignore those processes related to sex - specific conditions ( i.e. , those related to reproduction ) . the exclusion of the study of sex - specific conditions may actually slow progress in understanding women 's health across the life - span . said another way , because there are sex - specific conditions , there are sex differences in all physiological processes . women 's health , viewed through the lens of sex differences , incorporates research into reproductive health and the physiological processes directed by the xx chromosomal complement , including hormonal changes accompanying puberty , pregnancy , and menopause that have lifelong consequences . genomic analysis is a strategic part of the national precision medicine initiative ( www.nih.gov/precisionmedicine ) . implied but not stated in the publically available web material however , inclusion of the sex chromosomes in genome - wide association studies ( gwas ) analysis to date is sparse , and we hope this new precision medicine initiative will increase attention to the contribution of the sex chromosomes to health and disease . investigators in women 's health research are developing statistical packages that consider the sex chromosomes and x chromosome inactivation in gwas . including analysis of the x chromosome is critical to understand sex differences and to ensure the success of the national precision medicine initiative . the future of women 's health requires development of models to sustain basic and clinical research and educational initiatives in women 's health in the absence of , or in spite of , specific government directives . women 's health must become a natural part of the culture of clinical practice , discovery science , and medical / health education . mayo clinic has embraced individualized ( precision ) medicine as a strategic investment in the future of health care . the strategy is an evidence - based practice built on basic discoveries of the root causes of disease . by definition , a cornerstone of precision care is to recognize the contribution of biological sex ( as dictated by the complement of sex chromosomes ) and of gender ( that includes cultural and environmental influences that define feminine and masculine ) . some women 's health clinics and research centers focus on specific patient subsets and activities that reflect the clinical and research expertise of their faculties . the specialized centers of research on sex differences funded by the nih in association with orwh represent a model for the development of interdisciplinary teams . these centers act as catalysts to discovery and advancement of knowledge to improve the quality of care for women by incorporating both sex differences and sex - specific conditions . this approach also can be applied more broadly in other research and clinical areas not typically considered for example , ongoing research in women 's health and sex - based medicine at mayo clinic crosses multiple specialties . these programs include collaborations between engineers , primary care providers , and oncologists to develop imaging modalities that can better detect breast cancers in women with dense breasts that are not easily identified by conventional mammography . gynecological surgeons partner with oncologists and molecular scientists to develop non - invasive and sensitive tests to detect endometrial cancer . epidemiologists partner with gynecologists and internists to identify health disparities related to uterine fibroids in ethnic minorities , risks of overall mortality , and chronic diseases in women who have undergone oophorectomy , and conditions of pregnancy such as hypertension , preeclampsia , eclampsia , and gestational diabetes that affect lifelong risk for cardiovascular disease in women . however , in addition to these more typical women 's health arenas , cardiologists partner with basic scientists and surgeons to investigate sex differences in the etiology of valvular calcification and heart disease , and with neurologists to evaluate how the autonomic nervous system contributes to the etiology of postural orthostatic hypotension and fibromyalgia . with the aging of the population , investigation of sex - specific molecular pathways associated with age - related diseases such as sarcopenia are being pursued to understand how interventions may slow these processes . radiologists are working with neurologists to develop improved methods to detect sex - specific alterations in brain structures associated with cognitive decline . these initiatives are probably not unique to our organization but most likely reflect similar activities at other academic medical centers . these projects share an understanding that there are sex differences in the physiological processes under investigation and that these differences impact women 's health . thus , sex and hormonal status are key biological variables for organ and tissue transplantation , regenerative medicine , and pharmacogenomic programs . the support for sex - specific as well as sex - different initiatives will require dedicated medical services and patient - specific biorepositories . for example , sex - specific clinical databases can be developed within existing women 's health clinics such as the data registry on experiences of aging , menopause , and sexuality ( dreams ) developed by the mayo clinic women 's health clinic . the dreams project was designed to study , for example , the effects of caffeine intake on menopausal symptoms , women 's views of menopause and the symptoms experienced , and the association of recent physical and mental abuse with menopausal symptoms . similar clinical initiatives provide resources to junior investigators in women 's health to develop longitudinal studies of women as they age . discoveries from research related to women 's health and concepts of sex and gender differences in physiology and pathophysiology must become embedded into the material used to train future scientists and health care providers . programs such as the bircwh need to be sustained and expanded to create a critical mass of investigators leading and catalyzing research teams in women 's health . community , academic , national , and global partnerships are developing innovative educational materials and curricula to train the next generation of women 's health scientists and healthcare providers . opportunities are available to develop and test these curricular materials focusing on sex- and gender - based evidence in all phases of health care education through projects supported in part by the nih , the orwh , the american medical women 's association , the canadian institutes of health research , the european gender medicine program , the society for women 's health research , the organization for the study of sex differences , and the sex and gender women 's health collaborative . utilization of these educational materials will stimulate future research , facilitate translation of discoveries into patient care , and ultimately will reduce health disparities for women by improving their care . the patient through a sex and gender lens is a first step toward personalizing care . however , personalized healthcare must be based on evidence derived from research designed to study how sex and hormonal status influence health across the life - span . the mayo clinic approach to translation of women 's health research into clinical practice is embodied by innovative technologies driving discovery in regenerative medicine , organ and tissue transplantation , and pharmacogenomics . this approach may serve as a model by which other academic institutions can expand their women 's health research programs . ongoing initiatives in healthcare education are required to assure that future healthcare providers , researchers , and educators recognize that sex matters when making decisions about prevention , diagnosis , disease management , and patient outcomes . a plan to successfully integrate sex difference research and

abstractthe national institutes of health 's ( nih ) commitment to improving health outcomes for women and men through rigorous science has been compromised by the lack of basic science evidence obtained from female animals . to correct this limitation , in june 2015 the nih announced expectations that sex , as a biological variable , be included into research design and analysis in studies of vertebrate animals and humans ( not - od-15 - 102 ) . scientists must take the responsibility to implement this directive . however , in doing so , there is a risk that attention could be restricted to only studies of direct comparison between female / women and male / men . by contrast , understanding how sex influences health and disease needs to take a programmatic approach that includes the study of sex - specific conditions . a programmatic approach will assure the advancement of knowledge to improve women 's health .

Introduction An Integrated Approach to Women's Health: A Case Example It Doesn't Stop with Research Summary

thymic neuroendocrine ( ne ) tumors associated with multiple endocrine neoplasia type 1 ( men-1 ) are rare , variably documented in 1 - 8% cases . thymic ne tumors are usually detected about 7 - 29 years following surgical treatment of primary hyperparathyroidism ( phpt ) in men-1 . transcervical thymectomy ( tct ) at the time of parathyroid surgery for phpt usually prevents thymic ne tumors . the occurrence of thymic ne tumors is very rare after tct as part of the parathyroidectomy procedure for phpt . here we report a case of thymic ne carcinoma developing within a span of 8 months after subtotal parathyroidectomy and tct for phpt in a men-1 patient . a 56-year - old non - smoker male presented with generalized bodyaches , low back pain , and proximal myopathy of 1-year duration without any fragility fractures . examination revealed bony tenderness over the sternum and proximal muscle weakness of the lower limbs . laboratory evaluation revealed hypercalcemia ( serum total calcium 12.8 mg / dl , normal 8.5 - 10.5 mg / dl ) , hypophosphatemia ( serum phosphorus 2.1 mg / dl , normal 2.5 - 4.5 mg / dl ) , normal serum albumin ( 3.8 g / dl ) , normal serum alkaline phosphatase ( 136 iu / l , normal 50 - 150 iu / l ) , vitamin d sufficiency ( serum 25oh vitamin d 31 ng / ml ) , and normal renal function ( serum creatinine 1.2 mg / dl ) . hypercalcemia was pth dependent ( serum calcium 12.8 mg / dl with high serum intact pth 215 pg / ml , normal 15 - 70 pg / ml ) . his hemogram and esr were unremarkable ( hb 13.4 g / dl , tlc 6700/mm , platelet count 2.8 lakhs / mm , and peripheral smear showed normocytic , normochromic rbcs , esr 20 mm at end of the first hour ) . bone mineral density by dual energy x - ray absorptiometry showed osteoporosis ( t - score 2.7 at lumbar spine , 2.0 at total hip , and 3.4 at distal forearm ) . ultrasound neck revealed multiglandular parathyroid enlargement , while a tc tetrofosmin parathyroid scan showed a right inferior parathyroid tumor . the patient was advised surgery as he had serum calcium > 12 mg / dl and osteoporosis . the patient was subjected to bilateral neck exploration , where asymmetrical parathyroid hyperplasia was found . histopathology showed multiglandular parathyroid hyperplasia and a normal thymus . on follow - up , 8 months after parathyroidectomy , he presented with heaviness in the left side of the chest , dry cough , and exertional dyspnea of 3 months duration . chest radiograph revealed mediastinal widening with an oval well - circumscribed homogenous opacity ( figure 1b - dark arrow ) in left hemi - thorax . contrast - enhanced computed tomography ( ct ) of thorax showed a 10 6.7 cm inhomogenously enhancing anterior mediastinal soft tissue mass in the prevascular space on the left side , in close proximity to the ascending aorta and arch of aorta [ figure 2 ] . chest radiograph done 9 months earlier [ figure 1a ] did not show any mediastinal widening . chest radiographs done 9 months apart radio - opacity in the left hemi - thorax in july 2009 radiograph ( marked with arrow ) was not present in september 2008 radiograph contrast - enhanced computed tomogram of the thorax showing large solid anterior mediastinal mass ( marked with arrow ) to the left of mid - line tc methylene diphosphonate ( mdp ) whole - body skeletal scan showed increased tracer uptake at thoraco - lumbar vertebrae and multiple ribs suggestive of skeletal metastases . the anterior mediastinal mass was excised in toto via trans - sternal approach . on surgery , the tumor was not found to invade any of the adjacent structures . the excised tumor measured 12 7 5 cm and weighed 264 g [ figure 3 ] . on microscopy [ figure 4a and b ] , the tumor was partially encapsulated , and was composed of rosettes of tumor cells traversed by thin fibro - vascular septae . the tumor cells displayed round to oval nuclei , granular chromatin , occasional nucleoli , and moderate amount of granular to pale cytoplasm with areas of punctate necrosis and lympho - vascular emboli suggestive of thymic ne carcinoma . immuno - histochemical studies were suggestive of positive staining for chromogranin and synaptophysin , but absence of staining for nse and vimentin [ figure 4c and d ] , consistent with thymic ne carcinoma . lobulated solid tumor which was homogenous grayish white and fleshy on the cut surface histopathology and immuno - histochemistry . ( a ) tumor with adjacent thymus , h and e , 100 . ( b ) tumor cells displaying rosette formation and necrosis , h and e , 400 . ( c ) ( d ) cytokeratin immuno - positivity 200 with strong suspicion of sporadic men-1 , in view of coexistence of phpt with metastatic thymic ne carcinoma , work up for men-1 was done , which revealed raised fasting serum gastrin ( 18,000 pg / ml , normal < 200 ) suggestive of gastrinoma . his serum prolactin ( 12 ng / ml , normal 2.1 - 17.7 ng / ml ) and serum igf-1 ( 131 ng / ml ) were within normal range , thereby ruling out any functioning pituitary tumors . there was no family history of disorders suggestive of men-1 ( family pedigree chart , figure 5 ) . somatostatin - receptor scintigraphy with ga - dotanoc pet / ct revealed somatostatin receptor expressing tumors involving second part of duodenum , head , body , and tail of pancreas , suggestive of gastrinomas . there was no evidence of somatostatin receptor expression in the mediastinum or vertebrae , suggesting that the vertebral metastasis were from the thymic ne carcinoma and not from the gastrinomas . family pedigree chart showing index case of men-1 and unaffected family members the diagnosis of sporadic men-1 , with two major endocrine gland involvement ( phpt due to parathyroid hyperplasia and gastrinomas ) along with a rare occurrence of thymic ne carcinoma was apparent . the thymic ne carcinoma had evolved rapidly within a span of 8 months after parathyroidectomy and tct , and presented with bony metastases . with wide - spread metastatic disease , the patient was managed palliatively ( pantoprazole , zoledronic acid 4 mg intravenous infusion 4 weekly and lanreotide 20 mg intramuscular 4 weekly ) . the patient has been followed up with serum alkaline phosphatase , calcium , chromogranin and gastrin estimations ; and ga - dotanoc pet / ct and tc mdp bone scans at 6 monthly intervals , and other appropriate imaging such as abdomnal and thoracic ce - ct scans . he has been treated with external beam radiotherapy as well as sm samarium therapy for palliation of painful spinal lesions . sunitinib maleate- a multi - target tyrosine kinase inhibitor- 37.5 mg per orally , once daily was initiated in view of progressive metastatic disease , including liver , lungs and skeletal metastases , which he has received for 18 months with effective symptom palliation , and manageable toxicity . he suffered osteo - necrosis of the jaw- a known complication of long - term zoledronic acid usage , which has been managed by discontinuation of inj zoledronic acid and other supportive care . four years since being operated upon for the thymic n - e carcinoma , the patient is alive , ambulatory , is reasonably symptom free with good quality of life , and is normocalcemic , with no loco - regional recurrence of the thymic tumor . thymic ne tumors have been variably reported in men-1 from 1% to 8% of cases . in recent studies , thymic ne carcinoma has emerged as a major cause of mortality in men-1 along with gastro - entero pancreatic tumors . thymic ne tumors in men-1 are commoner in males and smokers and are almost always hormonally inactive and diagnosed incidentally . they are malignant , aggressive tumors and are widely invasive and metastatic at presentation ( usually to bone ) . thymic ne tumors are never the presenting feature of men-1 and almost always occur after phpt , providing an opportunity for prophylaxis for these tumors with tct at the time of parathyroid surgery . while operating a phpt patient with multigland parathyroid disease , routine tct is usually performed to take care of the supernumerary parathyroid glands that can be found within the thymus gland in 15 - 20% patients . the utility of tct in preventing the thymic ne tumors in men-1 patients is a matter of debate . our patient developed thymic ne carcinoma despite tct being performed as part of his first operation ( sub - total parathyroidectomy ) . tct could not prevent thymic ne carcinoma in our patient , as also reported by others . this may be because tct results in removal of only 40 - 50% of thymic tissue . in our patient , the thymic ne tumor was arising from thymic limb low down in the left pulmonary hilar region , which could not have been removed by tct . more radical thymectomy procedures like the trans - sternal thymectomy or video - assisted thoracoscopic surgical thymectomy have not been reported as a prophylactic procedure in men-1 patients . usually , phpt is the first component of men-1 manifesting in the third to fourth decade . in contrast , our patient had a rapid presentation of thymic ne carcinoma , which was not evident on the chest radiograph done about 9 months earlier during management of phpt . the rapid pace of development of thymic ne carcinoma with bone metastases in our patient underscores its aggressiveness and metastatic potential . current guidelines for surveillance of men-1 recommend screening for thymic ne tumors once every 1 to 2 years with ct or mri of thorax , although currently annual screening is advised by newer studies . as men-1 patients undergo parathyroid surgery almost universally , tct is recommended for prevention of thymic ne tumors . a complete surgical excision through a trans - sternal route is the only curative treatment for thymic ne tumors . our patient did not have any direct invasion of adjacent structures inspite of its large size and the histological margins were reported uninfiltrated . in view of the multiple bone metastases , we report a sporadic men-1 patient cured of phpt , presenting with gastrinoma and aggressive metastatic thymic ne tumor that developed within a year after subtotal parathyroidectomy along with tct . men-1 patients need to be screened for thymic ne tumors by routine annual ct or mri of the thorax even after tct at the time of parathyroid surgery .

thymic neuroendocrine ( ne ) tumors are a rare manifestation of multiple endocrine neoplasia syndrome type 1 ( men-1 ) . they are malignant and aggressive tumors and form a major cause of mortality in men-1 . transcervical thymectomy ( tct ) at the time of parathyroid surgery for primary hyperparathyroidism ( phpt ) in men-1 usually prevents thymic ne tumors . we report a 56-year - old nonsmoker male with sporadic men-1 who presented with thymic ne carcinoma developing rapidly within a span of 8 months after subtotal parathyroidectomy and tct for phpt . we present a brief review of literature on this rare ne malignancy , focusing on its occurrence despite tct . this case highlights the fact that thymic ne carcinoma may develop even after tct in men-1 . regular surveillance for these aggressive thymic ne tumors is mandatory even after tct in men-1 setting .

I C D C