Datasets:

ronitHF

/

pubmed-10k-8.1.1

like 0

there is evidence corroborating the relationship of vascular dysfunction during the first decade of life with risk factors such as familial hypercholesterolemia and hypertension . however , the question whether or not people exposed to cigarette smoke also develop these dysfunctions remains controversial . numerous studies have been conducted on adults exposed to passive smoking , particularly partners of smokers , and various aspects of cigarette smoke on these individuals have been evaluated[2 , 3 , 4 , 57 ] . however , only a few limited studies have addressed the issue of children exposed to passive smoke and the consequences on their blood pressure.[8 , 9 , 10 , 11 ] parental smoking affects children and neonates , and is associated with low birth weight , sudden infant death , asthma , bronchitis , pneumonia , otitis media , increased risk of contracting tuberculosis on exposure , crohn s disease , learning disorders , development retardation and dental caries . nevertheless , it is not yet clear whether children exposed to passive smoke develop vascular dysfunction or major changes in blood pressure . since the impact of cigarette smoke on children s blood pressure will provide yet another logical reason for parents to quit smoking or avoid smoking in the presence of their children , we have conducted this study to assess this relationship . according to reference 8 , standard deviation of blood pressure in exposed group was 4 mmhg and in not - exposed group was 3mmhg . therefore , with precision of 7mmhg ( = 0.01 and = 0.90 ) , sample size for our study was 8 in each grade and sex and total sample size in both sexes and five grades was calculated as 80 ( 825 = 80 ) in each group . 80 elementary school children exposed to cigarette smoke and 80 not exposed to smoke were studied in fall 2010 . range of age was7 to 12 years and average was 9.5 years in both groups . passive smoking was defined as breathing in a place where another person has been smoking over a period of at least 3 years with a daily consumption of 5 cigarettes or more[13 , 8 ] . after acquisition of necessary permissions from the department of education of the province and its triple regions , 8 elementary schools in kermanshah were selected through cluster sampling . in each school one class from each grade was randomly allocated . in each class , if we did not find enough cases of exposure in a grade , another school was substituted . finally , 80 cases of exposed and 80 cases of not - exposed children with same sex and age were enrolled from 12 elementary schools . subsequently , the principals and teachers were provided with enough information regarding the study , and questionnaires were submitted to parents to collect information regarding parental consent for participation in the study , as well as the health status of the children and their exposure to passive smoke . the questionnaires did not record the children s names and were only indentified with a code . we asked about parents and other families smoking habits who lived with the students and if the answer was positive continued questions about the location of smoking and how long and how many cigarettes do they smoke near their children ? once the questionnaires were collected , their data were matched with those in the children s health certificate . subsequently , the passive smokers of each class were identified and for each exposed child , one non - exposed counterpart of the same age and gender was randomly selected from the same class . the exclusion criteria included : chronic cardiac or renal diseases as expressed by parents or discovered in physical examination prior to measurement of blood pressure , any acute diseases , including respiratory and gastrointestinal infections and consumption of any medicine , and discrepancy between information recorded in parental questionnaires and those in the children s health certificate . during physical examination and measurement of blood pressure therefore , the examinations were performed in school laboratories which created an attractive ambience for the students and also entailed the smallest stress and greatest facilities . after explaining the situation to participants in a simplified language , the children were entertained with fruit snacks . the students did not have any activity for 15 minutes prior to blood pressure measurement and did not receive stimulant substances such as tea or coffee . the measurements were performed on the right arm in the level of the heart and supported on a desk while the child was in a sitting position and his / her feet were on the ground . appropriate cuff was defined as the width of cuff equal to 40% of arm circumference at the mid - arm . systolic and diastolic blood pressures were measured using a digital instrument ( e-7051-hem omron n3 intellisense , made in china ) and repeated under the same conditions by a resident of pediatrics in the morning shift . systolic blood pressure was defined as first korotkoff ( k1 ) and diastolic as fourth or fifth korotkoff ( k4 or k5 ) sound . values are expresses as meansd . a p - value < 0.05 was considered statistically significant . the values of blood pressure were compared for gender using one - way anova test , and compared for gender and school grade using 2-way anova test . in this study , we measured the blood pressure of 160 elementary school ( grades 1 to 5 ) children in kermanshah in fall 2010 . thirty - two students were selected from each grade ( consisting of 16 boys and 16 girls ) equally distributed over the case and control groups . the mean values of systolic and diastolic blood pressure of girls were 107.1610 mmhg and 63.098.7 mmhg , respectively . for boys , the mean values of systolic and diastolic blood pressures were 107.169.32 mmhg and 63.987.13 mmhg , respectively . in the exposure group , the mean values of systolic and diastolic blood pressures were 109.39.97 mmhg and 64.987.36 mmhg , respectively , while in the not - exposure group , the systolic and diastolic values were 105.478.98 mmhg and 62.157.01 mmhg , respectively . the mean systolic and diastolic blood pressures of the exposure group were higher than those of the non - exposure group , with a confidence interval of 0.95 and p values of 0.012 and 0.016 , respectively . girls exposed to cigarette smoke had a mean systolic blood pressure of 109.269.7 mmhg and a mean diastolic blood pressure of 64.6610 mmhg , whereas girls not exposed to smoke had a mean systolic blood pressure of 105.0610 mmhg and a mean diastolic blood pressure of 61.517.4 , indicating no significant difference between the two groups ( p=0.06 and 0.059 , respectively ) . boys exposed to cigarette smoke had a mean systolic blood pressure of 109.3410.3 mmhg and a mean diastolic blood pressure of 65.187.5 mmhg , whereas boys not exposed to smoke had a mean systolic blood pressure of 105.889.2 and a mean diastolic blood pressure of 62.796.61 , also indicating no significant difference between the two groups ( p=0.097 and 0.13 , respectively ) ( tables 1 ) . table 2 shows mean systolic and diastolic blood pressure in children exposed and not exposed to cigarette smoke according to their school grade . comparison of mean ( sd ) systolic and diastolic blood pressure in exposed and non - exposed children to cigarette smoke sd : standard deviation comparison of mean systolic and diastolic blood pressure in children exposed and not exposed to cigarette smoke according to their school grade cigarette smoke consists of two constituents : 15% of cigarette smoke is the main stream and 85% is the side stream distributed into the environment from the burning cigarette between puffs . while these two streams are similar in quality , their quantity differs as the amounts of carbonmonoxide , benzopyrene , ammonia and other carcinogenic substances are higher in the side stream than in the smoke inhaled by the smoker . passive smoking has been associated with endothelial damage in healthy children and young adults , suggesting early arterial damage . the impact of cigarette smoke is exerted on peripheral vasculature via the above mentioned substances to disrupt the function of vascular endothelial cells and jeopardize perfusion to vital organs , resulting in disorders of peripheral vasculature and increased risk of cardiovascular diseases . our findings indicate that systolic and diastolic blood pressures are higher in the exposure group compared to the non - exposure group ; however , after consideration of the gender variable , the difference between exposed and non - exposed girls and boys was not significant . previous studies conducted on the effects of cigarette smoke on children s blood pressure or studies on adults who were exposed to cigarette smoke in childhood have yielded different results . in the study of simonetti ( the mean sys bp in exposed children was + 1.2 mmhg higher than in not - exposed children , p<0.05 ) . in another study by feely and mahmood , acute changes of blood pressure before and after exposure to cigarette smoke were measured in 21 young adults and compared to 12 healthy controls . the findings indicated that exposure to cigarette smoke after 60 minutes only resulted in systolic hypertension in brachial artery and aorta in the male group . the diastolic blood pressure in aorta and brachial artery of the male and female groups did not alter considerably before and after exposure to cigarette smoke . in a turkish study by agirbasli et al family history of coronary artery disease and current smoking history of family members were not significantly associated with systolic and diastolic hypertension in their children ( hypertension was defined as having a systolic or diastolic blood pressure > 95% percentile for age and gender ) . geerts et al reported the exposure of pregnant mothers to cigarette smoke , whether as secondary exposure to smoke or smoking by the mother herself , to be associated with higher systolic blood pressure in their newborns . a study by hunk evaluated the impact of smoking parents on diabetes , hypertension and metabolic syndrome in their male adult children retrospectively . data regarding the smoking status of parents during the prenatal period and childhood were obtained with questionnaires . the findings indicated that after correction for age , gender , race , education and smoking status of the person , participants whose parents were both smokers had a 1.55 fold increase in their risk for adulthood hypertension . our study also indicates that systolic and diastolic blood pressures are higher in school children who are exposed to cigarette smoke . since signs of atherosclerosis begin to develop during the first decade of life , particularly in high - risk individuals such as those with hypertension , diabetes mellitus , and familial hypercholesterolemia , the exposure group is more likely to develop cardiovascular diseases in the future . after addition of the gender variables , both the girls and the boys groups did not indicate a significant difference between exposed and non - exposed individuals . however , in the girls group , the difference was close to the level of significance , and therefore larger sample sizes may yield significant differences . the greater impact of cigarette smoke on girls may be due to their longer presence at home and consequently greater exposure to smoke or it may reflect their intrinsic sensitivity to cigarette smoke . unlike the other factors of cardiovascular diseases , exposure to cigarette smoke is easily omissible ; therefore , the authors recommend that given the sensitivity of parents about their children s health , the results of this study and similar studies be used for encouraging parents to quit smoking or smoke in places isolated from their children . there are certain limitations in our study , the most important of which is the provision of inaccurate information by parents in questionnaires . nevertheless , we tried to circumvent this challenge by not mentioning the children s names on questionnaires and comparing the information with the data recorded in students health certificates ( which contain information regarding the smoking status of the parents ) to eliminate those questionnaires with discrepancy . another challenge was to control children s anxiety and activity , particularly those in the first and second grade , during blood pressure measurement . this study revealed that exposure to cigarette smoke can increase blood pressure in children with possible risk of cardiovascular diseases in future .

objectivemany diseases form their basis during childhood . one example is the changes in vascular structure and function , leading to atherosclerosis . in this study , we have assessed the impact of exposure to cigarette smoke on blood pressure of elementary school children in kermanshah.methods80 elementary school children exposed to cigarette smoke and 80 not exposed to smoke were studied in fall 2010 . information regarding the smoking status of parents and the children s health were obtained through questionnaires completed by parents . after physical examination and exclusion of those children with acute and chronic diseases as well as those consuming medicine , we measured and compared blood pressure in the exposure and non - exposure groups . data were analyzed using the anova statistical test . values are expresses as meansd.findingsthe mean systolic and diastolic blood pressures of the exposure group were higher than those of the non - exposure group ( 109.39.97/64.927.36 vs105.478.98/62.57.01 , respectively ; ci : 0.95 , p<0.05 ) . meanwhile , difference between two groups according to sex was not statistically significant.conclusionour study indicates that systolic and diastolic blood pressures are higher in those elementary school children exposed to cigarette smoke compared to those who are not .

Introduction Subjects and Methods Findings Discussion Conclusion Conflict of Interest

the present analysis was performed as part of the diabetes and informatics ( dai ) study , a multicenter cohort study conducted by the dai study group ( diainf ) together with the italian association of clinical diabetologists ( amd ) and the italian national institute of health ( iss ) since september 1998 . the aim of the dai study was to evaluate the prevalence and incidence of cvd ( myocardial infarction , ischemic heart disease [ ihd ] , percutaneous coronary intervention angioplasty [ ptca ] , coronary artery bypass graft [ cabg ] , stroke , and peripheral amputations ) among type 2 diabetic patients regularly attending hospital - based diabetes clinics . in italy , a public network of 700 diabetes clinics provides care for up to 80% of patients with known diabetes , delivering diagnostic confirmation , therapy , prevention , and early diagnosis of acute and chronic complications through close patient follow - up by a team of specialists and the scheduling of regular checkups . most patients are referred to these care units by their general practitioner , and care is free of charge . a detailed description of the dai study methodology has been presented elsewhere ( 5 ) . for the incidence study , 157 clinics participated , with a total of 14,432 patients : 11,644 patients free of cvd at enrollment and 2,788 patients who entered the study with a known prior cvd event . the recurrence of cvd events , described herein , was analyzed in the 2,788 patients with a prior cvd event ( cohort a ) and in the 844 of the 11,644 patients without events at enrollment who developed their first cvd event during the observation period ( cohort b ) . the data used in this analysis were collected in four waves of follow - up between 2000 and 2003 . during the enrollment and follow - up visits , a standard questionnaire was used to collect , in addition to anthropometric data , information on lifestyle habits , drug therapy , laboratory measures ( specified below ) , clinical history , microvascular complications ( retinopathy , blindness , and foot ulcers ) , and cardiovascular complications . for patients who did not appear for the scheduled visits , information , including death , was obtained through telephone interviews with the patient , a relative , or the primary care physician . a1c was measured at each clinic , not in a centralized laboratory ; for this reason , glycemic control was estimated as the percent increment of the individual patient 's a1c above the upper limit of the normal range of the local laboratory . urinary albumin excretion ( uae ) was obtained in a timed overnight collection ; microalbuminuria was defined as uae of 30300 mg / l in at least three successive measurements in the absence of other known causes of proteinuria . hypertension was defined as systolic blood pressure 140 mmhg and/or diastolic blood pressure 90 mmhg and/or antihypertensive treatment . retinopathy was assessed by a comprehensive dilated eye examination and by the acquisition of high - quality stereoscopic photographs assessed by an ophthalmologist . familial cvd was identified when the patient had a first - degree relative ( parent , sibling , or child ) who had had a major cardiovascular event at age < 55 years . alcohol consumption was calculated in equivalent milliliters of wine and transformed to grams per week ( 0 g / week , no consumption ; 1225 g / week , moderate consumption ; and 226 g / week , high consumption ) . study events were all major ihd events ( myocardial infarction , ptca , and cabg ) , minor ihd events ( angina and other forms of ihd ) , stroke , and limb amputations . patients were classified as having ihd if they had one of the following : 1 ) a history of hospital admission for either fatal or nonfatal myocardial infarction or an episode of angina ; 2 ) a 12-lead electrocardiogram with positive results for prior myocardial infarction or angina by the minnesota coding system ( criteria i 13 , iv 13 , v 12 , and vii 1 ) ; or 3 ) a history of cabg or ptca . all patients had had at least one electrocardiogram in the 12 months preceding enrollment to exclude prior myocardial infarction . stroke was defined according to world health organization criteria for confirmed and possible stroke ( i.e. , a clinical syndrome consisting of a rapidly developing neurological deficit persisting for > 24 h or leading to death , in the absence of other diseases that could explain the symptoms ) . a hospital discharge record or a specialist visit a cvd event was considered as recurrent if it occurred at least 28 days after the first event . a minor ihd event after another minor or a major ihd event was not counted as a bona fide recurrent event , i.e. , a new episode . similarly , a major ihd event after a minor ihd event was not considered as recurrent . such episodes were collectively indicated as events not classifiable as recurrent , in contrast with the truly recurrent cvd events . this choice was made on the grounds that , very often , angina and a subsequent myocardial infarction or revascularization are consequences of the same arterial lesion . the analysis was conducted separately in the two study cohorts ( a and b ) . the variables considered in the analyses were those collected at enrollment for cohort a and those collected at the follow - up visit at which the first cvd event was reported for cohort b. data for the continuous variables are expressed as means sd or median ( interquartile range ) for non - normal variables and as proportions for categorical variables . the incidence density of recurrent cvd events was standardized on the basis of the age distribution of the 1998 italian population . univariate and multivariate cox proportional hazards models were used to examine the risk factors for recurrent events . preliminary data analysis was performed with univariate cox models of all covariates : duration of diabetes , waist circumference , bmi , total cholesterol level , hdl cholesterol level , triglyceride level , a1c , blood pressure level , alcohol intake , smoke , familial cvd , microvascular complication , lipid - lowering treatment , antihypertensive treatment , and treatment of diabetes . the interaction between blood pressure level and antihypertensive treatment and between total cholesterol level and lipid - lowering therapy was evaluated . for cohort a , the overall model was also adjusted by the number of years from the first event to the enrollment to partially consider the patient 's history of cvd preceding the beginning of the study . all covariates with p 0.1 ( p 0.05 in cohort b , given the smaller sample size ) were entered into the final multivariate models . the data used in this analysis were collected in four waves of follow - up between 2000 and 2003 . during the enrollment and follow - up visits , a standard questionnaire was used to collect , in addition to anthropometric data , information on lifestyle habits , drug therapy , laboratory measures ( specified below ) , clinical history , microvascular complications ( retinopathy , blindness , and foot ulcers ) , and cardiovascular complications . for patients who did not appear for the scheduled visits , information , including death , was obtained through telephone interviews with the patient , a relative , or the primary care physician . a1c was measured at each clinic , not in a centralized laboratory ; for this reason , glycemic control was estimated as the percent increment of the individual patient 's a1c above the upper limit of the normal range of the local laboratory . urinary albumin excretion ( uae ) was obtained in a timed overnight collection ; microalbuminuria was defined as uae of 30300 mg / l in at least three successive measurements in the absence of other known causes of proteinuria . hypertension was defined as systolic blood pressure 140 mmhg and/or diastolic blood pressure 90 mmhg and/or antihypertensive treatment . retinopathy was assessed by a comprehensive dilated eye examination and by the acquisition of high - quality stereoscopic photographs assessed by an ophthalmologist . familial cvd was identified when the patient had a first - degree relative ( parent , sibling , or child ) who had had a major cardiovascular event at age < 55 years . alcohol consumption was calculated in equivalent milliliters of wine and transformed to grams per week ( 0 g / week , no consumption ; 1225 g / week , moderate consumption ; and 226 g / week , high consumption ) . study events were all major ihd events ( myocardial infarction , ptca , and cabg ) , minor ihd events ( angina and other forms of ihd ) , stroke , and limb amputations . patients were classified as having ihd if they had one of the following : 1 ) a history of hospital admission for either fatal or nonfatal myocardial infarction or an episode of angina ; 2 ) a 12-lead electrocardiogram with positive results for prior myocardial infarction or angina by the minnesota coding system ( criteria i 13 , iv 13 , v 12 , and vii 1 ) ; or 3 ) a history of cabg or ptca . all patients had had at least one electrocardiogram in the 12 months preceding enrollment to exclude prior myocardial infarction . stroke was defined according to world health organization criteria for confirmed and possible stroke ( i.e. , a clinical syndrome consisting of a rapidly developing neurological deficit persisting for > 24 h or leading to death , in the absence of other diseases that could explain the symptoms ) . a hospital discharge record or a specialist visit a cvd event was considered as recurrent if it occurred at least 28 days after the first event . a minor ihd event after another minor or a major ihd event was not counted as a bona fide recurrent event , i.e. , a new episode . similarly , a major ihd event after a minor ihd event was not considered as recurrent . such episodes were collectively indicated as events not classifiable as recurrent , in contrast with the truly recurrent cvd events . this choice was made on the grounds that , very often , angina and a subsequent myocardial infarction or revascularization are consequences of the same arterial lesion . the analysis was conducted separately in the two study cohorts ( a and b ) . the variables considered in the analyses were those collected at enrollment for cohort a and those collected at the follow - up visit at which the first cvd event was reported for cohort b. data for the continuous variables are expressed as means sd or median ( interquartile range ) for non - normal variables and as proportions for categorical variables . the incidence density of recurrent cvd events was standardized on the basis of the age distribution of the 1998 italian population . univariate and multivariate cox proportional hazards models were used to examine the risk factors for recurrent events . preliminary data analysis was performed with univariate cox models of all covariates : duration of diabetes , waist circumference , bmi , total cholesterol level , hdl cholesterol level , triglyceride level , a1c , blood pressure level , alcohol intake , smoke , familial cvd , microvascular complication , lipid - lowering treatment , antihypertensive treatment , and treatment of diabetes . the interaction between blood pressure level and antihypertensive treatment and between total cholesterol level and lipid - lowering therapy was evaluated . for cohort a , the overall model was also adjusted by the number of years from the first event to the enrollment to partially consider the patient 's history of cvd preceding the beginning of the study . all covariates with p 0.1 ( p 0.05 in cohort b , given the smaller sample size ) were entered into the final multivariate models . during the 4-year follow - up , in cohort a , 414 of 2,788 patients ( who had entered the study with a known previous cvd event ) developed at least an event that fulfilled the stipulated criteria of a recurrent event . in cohort b , 54 of 844 patients ( who had had their first event during the study ) had a recurrent event . with regard to multiple events , 38 patients in cohort a and 4 in cohort b had two recurrent events , and only 1 patient in cohort a had three recurrent events . events occurring in 386 patients of cohort a and 46 patients of cohort b were not included in the analysis because they did not meet the required criteria for recurrent events ( almost all ihd events ) . as summarized in table 1 , the study population consisted of a high proportion of elderly patients with rather good glycemic control . the most common cvd risk factor was hypertension , which was found in almost all patients . in cohort a , patients with recurrent events were older , were more often male with a previous history of microvascular complications , and had more use of insulin and lipid - lowering medications . in cohort b , patients with recurrent events had higher total cholesterol and triglyceride levels , more often had a previous history of microvascular complications , myocardial infarction , or amputation , and had more use of insulin . of note , the age - standardized incidence rate of recurrent cvd was 40% lower in cohort b than in cohort a ( table 2 ) . the average time between enrollment and the occurrence of the recurrent event in cohort a was 1.6 1.04 years , whereas in cohort b the average time between the first and recurrent event was 1.5 0.8 years . the average time between the first and the recurrent event in cohort a was 1.6 1.04 years , whereas the average time between the first and the recurrent event was 8.1 6.9 years in cohort a and 1.5 0.8 years in cohort b. in cohort a , the standardized incidence of recurrent episodes was 89.2 per 1,000 person - years ( 95% ci 71.3107.2 ) among patients with a major ihd event , 11.4 ( 3.619.2 ) among those with a minor ihd event , 49.2 ( 35.562.9 ) among those with a prior stroke , and 79.8 ( 36.0123.5 ) among those with amputation or combined events . a multivariate cox model for cohorts a and b a , age , male sex , and use of insulin , alone or in combination with oral agents , were independent predictors of recurrence . however , having had a major ihd event as the first event was the strongest factor of all , with stroke and combined events also being powerful predictors , whereas time between first and recurrent events did not make a significant independent contribution . in cohort b , the risk factor pattern was similar to that of cohort a , with prior events carrying the highest risk . in this model , the only metabolic factor with an independent risk prediction was a serum triglyceride level 1.69 no interaction between blood pressure level and antihypertensive treatment or between total cholesterol level and lipid - lowering therapy was found in either cohort . given the dominant role of the first event as a predictor , the multivariate models were also run after excluding this variable . in cohort a , some difference emerged : receiving lipid - lowering therapy ( hazard ratio [ hr ] 1.32 [ 95% ci 1.071.63 ] ) , number of years from first event ( 1.57 , [ 1.212.03 ] for > 6 years ) , and living in southern italy ( 0.77 [ 0.620.96 ] ) became significant . in cohort finally , given its value from the clinician point of view ( although not considered in our analysis of recurrent events ) , we report the standardized incidence of a minor ihd event : 39.5 per 1,000 person - years ( 95% ci 30.348.7 ) in men and 57.1 ( 36.777.5 ) in women in cohort a and 21.3 ( 5.736.8 ) in men and 8.3 ( 2.414.3 ) in women in cohort b. in our population of diabetic patients receiving usual care , we found that every year , 6.1% of the patients with a prior cvd event developed a new major atherosclerotic complication . this percentage compares very well with those ( 5.96.0% per year ) of the cohorts of diabetic patients in secondary prevention analyzed in the proactive ( 4 ) study and the scandinavian simvastatin survival study ( 4s ) ( 7 ) . a higher rate of 7.6% per year was reported in the drugs and evidence - based medicine in the elderly ( debate ) study ( 8) , but that study was performed in subjects with a higher mean age ( 80 years ) . the incidence rate of recurrent events in cohort b was almost half that of cohort a. likely explanations of this difference are that among cohort b patients , there were more women , age was somewhat younger , familial cvd was less prevalent , and prior myocardial infarction was less frequent relative to prior stroke . moreover , and more importantly , these patients had a shorter and more recent cvd history and were observed for only 1.7 year on average . survivors of a cvd event that preceded the recurrent event by a longer span of time ; in fact , there was a remarkable difference in terms of number of years from first and recurrent event , which could be the explanation for this different outcome . . this result may be due to the greater predisposition to necrotic events of men than of postmenopausal women , who are more prone to nonmyocardial infarction ihd ( angina ) and , probably , heart failure ( 911 ) . in the framingham study , after the onset of angina , men had a twofold greater risk than women for both myocardial infarction and coronary death after adjustment for age and ihd risk factors ( 1 ) . we described this sex effect previously in the prevalence ( 5 ) and incidence analyses of the first ihd event ( 12 ) and stroke ( 13 ) in the dai population . in the present study , on the other hand , the incidence of minor ihd in cohort a was higher in women than in men . second , in the search for risk factors specific to recurrent major cvd , we found that age played an important role , with a 10-year difference translating into a 26% risk increment . the impact of age as a cvd risk factor in the general population is well known ( 1418 ) , but the current findings document the fact that age is an independent risk factor for relapsing major cvd in a population of diabetic patients not selected for age . the fact that use of insulin , alone or in combination with oral agents , was an independent risk factor for recurrence in cohort a should not be overlooked . this finding was also reported in the proactive cohort of type 2 patients with prior myocardial infarction who developed a second fatal or nonfatal myocardial infarction ( 4 ) and in the cardiovascular health study ( 19 ) , in which insulin was found to be associated with greater cvd mortality compared with oral agents . the association was true also when serum insulin concentrations were measured ( 20 ) . in the dai study , insulin treatment was an independent risk factor for ihd ( 12 ) and stroke ( 13 ) in patients free of cvd at baseline as well . on the other hand , the adverse prognosis associated with insulin use may be regarded as the result of an indication bias : more severe , longer - standing diabetes is preferentially treated with insulin and has a worse cardiovascular prognosis ( 21,22 ) . in fact , in clinical trials such as the diabetes control and complications trial in type 1 diabetic patients and the uk prospective diabetes study ( ukpds ) in type 2 diabetic patients ( 23,24 ) , insulin treatment had a clear - cut antiatherogenic effect . therefore , the possibility that prolonged use of insulin in these type 2 diabetic patients resulted in less cardioprotection than control of glycemia by other pharmacological means can not be ruled out . dyslipidemia , as indicated by a higher frequency of lipid - lowering treatment in cohort a and higher serum triglyceride levels in cohort b , emerged as an independent risk predictor . this finding resonates with the previous observation in the dai study ( 12 ) that high triglyceride levels are a significant predictor of the first ihd event in women without prior cvd . the dominant observation in the dai study seemed to be the strong impact of the type of the first cvd events on relapses an observation that emerged from both study cohorts . having had a major ihd event , alone or combined with another cvd event , was associated with the highest relative risk , possibly leaving little room for other modifiable factors . a limitations of this study is the lack of centralized laboratory measurements . also , given the fact that the observation period was relatively short , there may not have been time for other potentially significant factors to emerge . finally , information on other potential risk predictors such as lipoprotein levels , postprandial glucose excursions , or genetic markers was lacking . the strength of this study , in addition to the large size , is that it provides a detailed description of the burden of secondary cvd prevention in diabetic patients under real - life conditions . because in italy the percentage of patients who seek care at the hospital - based diabetes clinics is very high ( up to 80% of patients with known diabetes ) , our results can be confidently extrapolated to the entire type 2 diabetic population in the country . in summary , this nationwide observational study outlines the natural history of recurrent events in type 2 diabetic patients managed by usual care . first , diabetic patients , especially elderly men , whose cvd onset is myocardial infarction or revascularization ( or combined events ) warrant close follow - up and intensive management . third , diabetic patients with high triglycerides levels may be targeted by aggressive treatment in secondary cvd prevention .

objective the purpose of this study was to assess incidence of and risk factors for recurrent cardiovascular disease ( cvd ) in type 2 diabetes.research design and methods we estimated the incidence of recurrent cardiovascular events in type 2 diabetic patients , aged 4097 years , followed by a network of diabetes clinics . the analysis was conducted separately for 2,788 patients with cvd at enrollment ( cohort a ) and for 844 patients developing the first episode during the observation period ( cohort b).results during 4 years of follow - up , in cohort a the age - adjusted incidence of a recurrent event ( per 1,000 person - years ) was 72.7 ( 95% ci 58.387.1 ) in men and 32.5 ( 21.243.7 ) in women , whereas in cohort b it was 40.1 ( 17.462.9 ) in men and 22.4 ( 12.932.0 ) in women . after controls were included for potential predictors ( familial cvd , obesity , smoking , diabetes duration , glycemic control , microvascular complications , geographic area , and antihypertensive and lipid - lowering treatment ) , male sex , older age , and insulin use were significant independent risk predictors ( cohort a ) and serum triglyceride levels 1.69 mmol / l emerged as the only metabolic ( negative ) prognostic factor ( cohort b ) . in both cohorts , a prior cvd episode , especially myocardial infarction , was by far the strongest predictor of recurrent cvd.conclusionsapproximately 6% of unselected diabetic patients in secondary prevention develop recurrent major cvd every year . those with long - standing previous cvd show a higher incidence of recurrence . male sex , age , high triglyceride levels , and insulin use are additional predictors of recurrence .

RESEARCH DESIGN AND METHODS Data collection and definitions CVD events Statistical analysis RESULTS CONCLUSIONS

electrophysiological brain signals are widely studied to get insights into the inner function of the brain . the electro - encephalogram ( eeg ) , as an example , has been analyzed for decades and is particularly popular because of its noninvasiveness , wide availability , relatively small cost and excellent temporal resolution which enables capturing the fast neural dynamics . because it is known that electrophysiological brain signals exhibit important spectral characteristics , frequency transforms are often applied . however , since in general brain signals do not possess the statistical property of stationarity , time - frequency transforms are of special interest . such methods are able to represent a given signal jointly in the time - frequency domain , called its time - frequency representation ( tfr ) . thereby the signal 's spectral components can be analyzed in relation to its temporal dynamics . in a wide sense an important feature of biological signals , and particularly brain signals , is their inter- and intraindividual variability . that is , under fixed experimental conditions , the obtained signals exhibit heterogeneousness not only between groups of subjects , but also between subjects within the same experimental group and even within the same subject between multiple experimental trials . existing signal analysis techniques either do not take this issue into account adequately or usually treat it by defining frequency bands of interest rather than single frequencies , and similarly time intervals instead of sharp instants . however , this strategy requires a priori knowledge about the variability to appropriately set the interval widths , and it is imprecise because it blindly includes all information contained in that time / frequency region . a good example is the time - frequency coherence analysis of two given input signals , for instance , by means of the cross short - time fourier transform , the cross wigner - ville distribution , or the wavelet coherence [ 1 , 3 ] . all of these methods relate both signals at fixed time / frequency ( or scale ) locations . thus , if signal a exhibits the same neural activation as signal b , but signal a 's pattern is shifted in frequency just a little , none of the abovementioned techniques will be able to find the strong similarity of a and b. although coherence estimation and other rigid strategies have been successfully applied for more than 30 years , this issue has inspired us to develop a general flexible method of pattern analysis and corresponding feature extraction in electrophysiological tfr data . by abstracting from the tfr images and working with the representation of a tfr pattern , tfr patterns reduce dimensionality by representing neural activity in a wide spectrotemporal region by comparably few quantities . pattern - based outlier detection has the potential to become a useful tool for data quality assurance . in ongoing studies we are employing the presented method , for instance , to estimate functional brain connectivity by means of a pattern - based approach . in the following , we present the developed neuroinspired interpretable model which is able to capture general time - frequency patterns . we use solely eeg data for demonstrations here , but our method is applicable to general electrophysiological signals or even to other signals showing similar behavior . algorithms for robustly fitting the novel model to time - frequency representations are presented . a strategy for finding an appropriate model order is given , and distance functions are defined which quantify ( dis-)similarity of two given models . these methods are tested in section 3 , where real as well as simulated data are used to demonstrate our technique 's functionality and robustness . while our technique is not restricted to specific time - frequency distributions , we employ the smoothed pseudo wigner - ville distribution in this work . this is a quadratic transform estimating signal power in the time - frequency domain , whereby all quantities in this work are real numbers . the transform generates quite smooth tfrs , which means that neighboring pixel values are correlated . although only positive values can be interpreted as signal power , the wigner - ville distribution introduces also negative values in general . we will refer to time - frequency representations as mappings y : t f which estimate signal power for each point in the time - frequency domain . of the numerous ways to quantify tfr patterns , we choose to fit a parametric surface to the data . because of the spatial correlation inherent in the data , traditional regression assumptions about independence of observations do not hold here . this absence of strong gradients in the tfr images also invalidates most image feature extraction techniques , which are often based on edges and texture . our model , however , is especially designed for spatially correlated data ; furthermore its parameters are interpretable . these quantities are useful features which embody important information about the underlying signal and thereby considerably reduce data dimensionality . using our method , we propose an extension of the well - known gaussian model for tfr analysis . the gaussian model for multivariate data x is defined by ( 1)y(g)(x)=c+a exp(12(x)t1(x ) ) with c being a constant additive offset , a the amplitude relative to the offset , the constant n - dimensional mean vector , and denoting a n n symmetric positive definite matrix . positive definiteness ensures that the argument to the exponential function is always negative ; additionally we know that e is bounded by zero and one for negative x. therefore , the exponential factor scales the final amplitude between 0 and a relative to the offset c. the term ( x)(x ) is also known as the squared mahalanobis distance of x with respect to and . because in our context this function represents arbitrary data in contrast to statistical distributions , will also be called the position vector , and is the spread matrix , its entries ij are denoted spread parameters . firstly , the model will be shaped like a peak for all possible parameter values by imposing the constraint that ( and thus also ) is symmetric positive definite . thereby , the model will never be able to completely degenerate . because the model is not flexible enough to fit small local variations of an expected pattern , the gaussian model is relatively insensitive to local data outliers and is also unsusceptible to overfitting . an additional aspect of robustness is that extreme peak deformations are directly reflected in extreme parameter values . thereby degenerated models can be easily detected or may even be prevented by imposing parameter constraints . the gaussian model is well - suited to extract bivariate peaks from brain signals ' tfr data , reflecting short intervals of neural excitement in a specific frequency range . an instance of the above described surface , in the bivariate case , is fully identified by its parameter vector ( 2)p=(c , a,1,2,11,12,22)t . the absolute peak height c + a , the peak position ( 1 , 2 ) , and the peak orientation can be derived from the parameter vector . further relevant quantities are the temporal peak onset , peak offset , and peak duration ( as the difference of the previous two ) . as already mentioned , the gaussian model 's robustness comes at the cost of inflexibility . while some local effects in tfr data can be appropriately explained by ( 1 ) , more general patterns of activation do not follow peak - like shapes , as will be shown later . thus a generalization of the gaussian model would be desirable , especially concerning the ability to represent patterns of activation rather than just independent events in the spectrotemporal domain . at the same time , a generalized method should maintain maximum robustness in order not to degenerate easily and to prevent overfitting . the so - called gaussian mixture modeling ( gmm ) is a straightforward extension , but this method still assumes ( multiple- ) peak - shaped data . in the following , the smooth natural gaussian extension ( snage ) model is presented as a flexible extension of the multivariate gaussian model . before giving a formal definition , we explain the idea in an intuitive way , guided by figure 1 . the n - variate gaussian model can be described by its ( n + 1)-dimensional peak point p = ( 1 , , n , a ) and its spread parameters controlling the exponential flattening relative to p along the independent variables ' dimensions . now the idea is to not use only one , but k peak points p , i = 1 k , interpolated by a smooth ( n + 1)-dimensional curve of peaks . a way to think of the surface in figure 1 modeled by snage is to shape it by sliding an n - variate gaussian model along the curve , its peak point being connected to the curve and thus varying in height ( a ) and position ( vector ) . thereby complex smoothly bent patterns of data with varying amplitude ( dependent variable ) can be captured . analogously to the gaussian model , an n n spread matrix determines the model 's shape , which is a surface for the tradeoff between robustness and flexibility can be controlled by choosing the number of peak points k. using many peak points will allow for good fits to complex patterns but will also increase the danger of overfitting . choosing a small k yields a robust model , but its ability to capture complex patterns will be limited . by setting k = 1 , snage reduces to the traditional gaussian model as a special case . regarding the standard gaussian model , each function value y(x ) is fully determined by the mahalanobis distance of the point x to the unique mean point . but since the snage model offers infinitely many mean points this issue will be addressed in the next section , where a formal definition is given . let the number of peak points be denoted by k , k 1 . let : [ 1 , k] denote a smooth n - dimensional curve of means , and let a : [ 1 , k] be a smooth one - dimensional curve of amplitudes along . let further the offset c , and let be a symmetric positive definite matrix . define ( 3)y~(snage):n[1,k]y~(snage)(x , u)c+a(u ) exp(12(x(u))t 1(x(u ) ) ) . note that y~(snage ) is a family of traditional gaussian models , parameterized by the curve parameter u. in order to construct a function which is independent of u , we define ( 4)u(x)argmaxu[1,k]|y~(snage)(x , u)c| . the snage model is then given by ( 5)y(snage):ny(snage)(x)y~(snage)(x , u(x ) ) . the function u*(x ) defines that traditional gaussian model which assigns to x the largest absolute amplitude relative to the offset c among all members of the gaussian family y~(snage ) . this is necessary to cope with positive as well as negative a(u ) . in tfr analysis , a(u ) can be restricted to only positive values ( see section 2.3.1 ) , in which case ( 5 ) in fact simplifies to ( 6)y(snage)+(x)maxu[1,k]y~(snage)(x , u ) . for y as well as y the max ( ) function curve , in the sense that ||(u1 ) (u2)|| is small , but |a(u1 ) a(u2)| is large . we assume that the diagonal entries of the spread matrix , that is , the spread along each dimension , are sufficient to control a tfr pattern 's width . therefore , we fix offdiagonal entries to zero for the sake of robustness . thereby , the mahalanobis distance in ( 3 ) reduces to the weighted euclidean distance . the two curves a(u ) and (u ) are yet to be defined in terms of discrete parameter values . for good parameter interpretability , we choose to form both curves by interpolating k points p , i = 1 k by b - splines of degree 3 , which yields the curve : ( 7)p:[1,k]n+1 , p(u)=(p1(u) pn(u)pn+1(u))=(1(u) , we obtain a sufficiently smooth model which inherits both the splines ' flexibility and the gaussian standard model 's robustness . our model further inherits the b - splines ' local control property ; that is , varying a p will affect the model only in the p 's vicinity . additionally , the degree of flexibility can be adapted to the data at hand by varying k from 1 ( single gaussian peak ) to arbitrary flexibility with k > 1 . an instance of the n - variate snage model with k points ( or of order k ) is fully represented by the parameter vector of length 1 + n + ( n + 1)k : ( 8)p=(c,11,22, ,nn , p1(1), while the offset c and the spread parameters are mainly responsible for the prediction of data values , the curve p(u ) interpolating the p is directly interpretable as it models the main path of peaks in the data . in the next section we show how to fit the model to data in a robust manner . given a time - frequency representation y(x ) , x t f , we aim to find a parameter vector p so that the respective model y fits the data best , in the sense that it minimizes a cost function . we use the sum of squared differences of the data and the modeled surface : ( 9)sse(p)=x=(t , f)ttt , ff(y(tfr)(x)y(snage)(x))2 . this quantity is also called the sum of squares due to error which is zero if the model perfectly fits the data . sse is a nonlinear function dependent on p. using squared differences pronounces outliers , but these are not expected to occur frequently in our smooth tfr data . in order to find a locally minimum solution of sse , a nonlinear least squares algorithm implemented in the matlab optimization toolbox , lsqnonlin , given an initial parameter vector and the cost function sse , this optimizer produces a sequence of models pi . the iteration hopefully converges to a p * with minimum cost , that is , best resemblance between model and data . we attempt to provide advantageous starting conditions for the optimizer by preprocessing the tfr and by obtaining an initial parameter vector p0 which is expected to be close to the optimum with respect to sse . moreover , an iterative refinement scheme is proposed to be able to robustly fit models of high order . tfr data are badly scaled , showing differences of several orders of magnitude in values of time , frequency , and signal power , which affects optimization performance . to address this problem , lsqnonlin offers a way to take into account typical values for each dimension for gradient estimation . also concerning this issue , any euclidean distance operating on tfr data in our algorithms is weighted appropriately . furthermore , smooth objective functions are desirable so that the low - order taylor approximations used during optimization resemble the cost function in a relatively large neighborhood around the current point . to this end , the tfr images are smoothed and subsampled , which has the additional benefit of faster cost function evaluations . finally , since negative values in the time - frequency domain are not interpretable , they are usually set to zero . since lsqnonlin performs local optimization , a start parameter vector should be chosen such that it already lies in the basin of the cost function 's ( unknown ) global minimum , that is , a vector whose cost is already low . to this end , the constant offset and the spread parameters are initialized to c = 0 , 11 = ( tmax tmin)/5 and 22 = ( fmax fmin)/5 if the underlying tfr 's time and frequency axes are bounded by tmin , tmax and fmin , fmax , respectively . one may choose any sensible values alike , but the spreads should not be initialized too small in order to obtain a generalizable model . yet , more thought has to be put in choosing the number and coordinates of the peak points p. in the following we propose a way to compute initial estimates of the time , and frequency coordinates of all p directly from the data . a reasonable approximation to the unknown optimal curve of peaks can be found by tracing a path through the tfr image y from left to right , which runs through areas of high pixel intensity . more precisely , the sum of all pixel intensities along this path should be as high as possible . this is an optimization problem in turn , yet its solution can be computed in quadratic time complexity ( provided that the path 's slope is bounded ) by a dynamic programming algorithm , see . because a global optimum is guaranteed to be found , this strategy is insensitive to local outliers and noise . to this end , a similar approach as described in is employed . following the notation therein , we define our energy function to be equal to the tfr values themselves , that is , e(i ) = i. a horizontal path s * ( called seam in ) which maximizes ( this is in contrast to , where minimum energy seams are computed ) this simple cost function is found by dynamic programming . see figure 3 for an example . additionally , the paths are constrained by imposing an upper bound k on their slopes . this value depends on the time - frequency resolution here and once more represents a compromise between robustness and flexibility . given the found path s * and the desired model order , k evenly spaced samples are subsequently drawn from a smooth approximating curve to obtain estimates of the first two coordinates of the p , i = 1 k. we choose to empirically set the ps ' last components , interpretable as amplitudes relative to the initial constant offset c = 0 , to max(y ) c = max(y ) . once a parametric representation of the data is available , its accuracy can be improved in a step - wise manner , as is presented in the following section . as already stated , the number of points p controls the model 's robustness which complements its ability to resemble complex patterns . therefore , the demand for a near - optimal initial parameter vector increases with the model order k. employing the optimal image path method described in the previous section yields a reasonable estimation , but sampling k equidistant points p , i = 1 k from the resulting curve is a simplification . in fact , it can be observed that the optimizer tends to concentrate the p in time - frequency regions of high signal variability . for low model order k , this shortcoming of our initial parameter estimation algorithm can be compensated easily by the optimization algorithm , but it may become a problem for increasingly flexible models . for this reason we propose an iterative scheme.find initial parameters p0 by means of an optimal path ( see section 2.3.2 ) for a first , robust model of low order k0 . let i0.fit the model to the data to obtain optimal parameters pi*.construct the optimal curve of peaks p(u ) by interpolation of the peak points ( see section 2.2.1).obtain the ki+1 = ki + 1 peak points for a refined model by uniformly sampling ( with respect to the spline 's sites uj ) the curve computed in the previous step.construct the parameter vector pi+1 of the refined model from pi by replacing the old ki peak points with the ki+1 new ones.if ki < kmax , let ii + 1 and continue with step 2 . find initial parameters p0 by means of an optimal path ( see section 2.3.2 ) for a first , robust model of low order k0 . fit the model to the data to obtain optimal parameters pi*. construct the optimal curve of peaks p(u ) by interpolation of the peak points ( see section 2.2.1 ) . obtain the ki+1 = ki + 1 peak points for a refined model by uniformly sampling ( with respect to the spline 's sites uj ) the curve computed in the previous step . construct the parameter vector pi+1 of the refined model from pi by replacing the old ki peak points with the ki+1 new ones . the curve found in steps 2 and 3 will exhibit smaller gradient magnitude , that is , traversal speed , in areas of high signal variability than in other regions . we aim at maintaining the curve - defining points ' optimum distribution found by the fitting algorithm and at enhancing the model 's flexibility mainly in these areas . it turns out that simply by uniformly sampling the fitted curve ( step 4 ) we obtain a new interpolated curve which retains these properties . an application of this algorithm is demonstrated in section 3.1 , where the resulting sequence of nested models is evaluated . in this section distance measures are necessary , for instance , to quantify how well the data exhibit an expected pattern . distance functions which are based solely on the curve of peaks p(u ) were found to be quite effective . other possibilities include parameter vector distances and pixel - wise differences of signal power of the models ' generated data . by comparison , curve - based distance functions have the advantage of being able to interrelate models of different orders . additionally , they are not influenced by the less informative parameters ( offset c and the entries of ) . a popular distance measure for parametric curves is the frchet distance . in the continuous case , the frchet distance of two parametric curves p1(u ) and p2(u ) is defined by ( 10)df_max(p1,p2)=inf, maxu d ( p1((u)),p2((u ) ) ) . here , (t ) and (t ) are monotone reparameterizations of the two curves , and d ( ) denotes ( weighted ) euclidean distance . in words , we search for those reparameterizations which make the curves the most similar with respect to maximum point - wise euclidean distance along the curves . this maximum for these reparameterizations is returned as the two curves ' continuous frchet distance . in practice , the discrete frchet distance is frequently applied , whose computation is based on dynamic programming once more . in the discrete case , an additional distance function df_sum(p1 , p2 ) can be obtained by replacing the max function with a sum over u. that way , df_sum represents an average distance , being less prone to outliers in the curves . we demonstrate the workflow to determine the appropriate model order k by fitting a tfr of real eeg data in this section . typically we determine the necessary model complexity by fitting data with good signal to noise ratio ( snr ) in order to prevent the overestimation of k. for example , one possibility to achieve sufficient data quality is to average several tfrs which are expected to show similar patterns . the averaged tfr of real eeg data shown in figure 5 will guide the following explanations . the depicted brain signals located in the lower frequency bands were recorded from the temporal brain region during a face recognition experiment . these data exhibit a pattern of activity which is too complex to be captured by a traditional gaussian model . the iterative scheme described in section 2.3.3 an optimal path ( see section 2.3.2 ) estimates the initial parameters for the first , least flexible model of order k0 . since the appropriate k is still unknown , a sufficiently large number kmax = 7 is chosen for the refinement . at each refinement stage the respective model is evaluated , and in the end the most suitable ( 11)k{k0, ,kmax } , k0kkmax is chosen as the model order for future fittings on lower - quality data . these are the cost function value ( sse , see section 2.3 ) , the coefficient of determination r and its adjusted version radj . although the use of quantities based on the coefficient of determination is discouraged for nonlinear models , they are applied here nonetheless for two reasons . they are found to perform well for our purposes , and the proposed alternatives ( aic and bic ) are not easily applicable here . this is because the assumption of normally distributed residuals often does not hold , which is supported by a highly significant shapiro - wilk test at = 5% yielding p < 10 for this experiment . the results show that for the data at hand a model of order k * = 4 is sufficient to capture the variability . having determined the maximum model complexity on high - quality data , such a model can now be fitted to the rest of the data . if the tfrs are not expected to vary substantially , like when fitting a model to signals from several nearby sensors , a previous fit may serve as the initial model . however , if , for instance , multiple data segments of the same sensor should be fitted , the tfrs ' patterns may vary strongly . in this case , initial parameters should be chosen depending on the data by using the method of optimal paths described in section 2.3.2 . since in this example k * = 4 is a quite moderate number , the iterative refinement may also be skipped . however , in general we would start with k0 = 3 or k0 = 4 and refine up to the determined k * , as proposed in section 2.3.3 . we want to assess our model 's robustness by simulating data and measuring how strongly the model is affected by additive gaussian noise . to this end , artificial data are created in the time domain , and their tfrs are computed to which our model will be fitted . we created a signal consisting of three consecutive oscillations , representing an alpha - theta - alpha eeg pattern at 10 hz/4 hz/10 hz respectively over a time span of 2.5 seconds . the simulated sample rate is 250 hz . a plot is shown in figure 9 . these data are quite challenging for our model because three distinct peaks emerge in the tfr which could be more appropriately modeled by a mixture of independent gaussian peaks . however , we want to demonstrate the flexibility of the snage model which should also be able to cope with patterns of this form . for the following experiments we chose to start the fitting with a model of order k = 5 to account for the pattern 's complexity and perform one refinement step . initial parameters are estimated by finding optimal paths , which means that no a - priori information about the known optimal model is passed to the fitting procedure other than the number of p to use . we define the optimal model by fitting the noise - free simulation in the same way . the distance measures from section 2.4 are used to determine how well the simulated pattern is found . in this experiment we added gaussian noise , which is appropriately filtered with respect to the sampling frequency , to the simulated data in the time domain . signals exhibiting signal to noise ratios of 15 db up to + 10 db were generated in steps of 2.5 db . at each snr , ten distinct noise realizations are created to obtain representative results . this independent noise in the time domain will produce correlated noise in the time - frequency domain due to smoothing . this experiment serves to assess how strongly our algorithm is affected by pattern variability , respectively , to investigate its robustness . small pattern distortions should ideally only slightly alter the optimal model , reflecting its robustness and avoidance of overfitting . we further want to find out to what degree our model is able to find the simulated pattern at all . we note here that adding noise increases the tfrs ' maximum amplitudes exponentially which strongly affects the comparability of different models . without normalization but this would merely reflect the decreasing data amplitudes and contain no information about the quality of fit . normalizing maximum data values are not an appropriate option either , because , for negative snrs , this would keep the noise constant while exponentially shrinking the pattern 's pixel intensities . even if the optimal model was perfectly recovered from the noisy simulation , high distances only if signal power is excluded from model distance estimation , the returned values are useful representatives of how well the pattern was found . the snage 's robustness to noise with respect to the pattern 's power is therefore not regarded here . this is done by setting the third dimension of the path of peaks p(u ) to zero during frchet distance computation . convergence to the optimal model seems to require high signal to noise ratios . at 7.5 db , the distance measures ' variances fall off , reflecting the point of reliable pattern extraction . apparently , the noise and interferences introduced in this experiment considerably impair the fitting process . in figure 11 , this issue is exemplarily investigated . at the positive snr of 5 db , where distance variances across the noise realizations are still high the pattern was in fact found , but only in a different way than was expected . nevertheless , this example shows that the impact different kinds of noise may have on the fitting process . to get a better feel for the average ability to fit the pattern under the influence of noise , see figure 12 . at each noise level , shown is a sequence of mean models which progressively look more similar to the true pattern . in fact , the average fitting capability concerning both the positioning of the peak points in the time - frequency domain and the estimation of surface values is better than expected after having studied figure 10 . apparently , although the mean distances are still decreasing at negative signal to noise ratios , they are already small enough for successful pattern extraction on average . an example is the subplot corresponding to snr = 0 db in figure 12 , which already clearly resembles the simulated pattern.this experiment shows that interferences between the desired signal and additive noise affect the fitting process quite strongly in the worst case . positive signal to noise ratios of at least 7.5 db are found to be necessary for reliable pattern extraction in this investigation . however , successful data modeling is also possible at lower snrs , as is seen in the average case . the snage model is especially suited for time - frequency representations of electrophysiological signals because of their ( expected ) nonnegativity , smoothness and their patterns following a path of peaks . however , our robust model is able to cope with data which do not exactly meet these requirements . in order to retain robustness , we imposed several restrictions on our model , like neglecting offdiagonal spread parameters and holding the spread matrix constant over the curve of peaks . an interesting question remains how the model 's flexibility and robustness would be affected if these constraints were dropped . little effort would be necessary to include the stated extensions . as is typical for nonlinear optimization problems , therefore , a - priori knowledge about the optimal model can be incorporated by starting the optimization with a model which was previously fitted to similar data . moreover , an algorithm based on an optimal path is developed to estimate initial model parameters directly from the data . however , this method is limited to positive peak polarity by trying to maximize the path 's average amplitude . additionally , the technique will not be able to find initial models which exhibit multiple contemporary components . in such a case , the nonlinear optimization algorithm , which was found to work well , must compensate . further strategies for the estimation of initial parameters would be desirable . in particular , the extraction of the curve interpolation points p from the optimal path possesses potential for improvement . an open question is how we should deal with the spatial correlation of both the dependent variable and the residuals in a statistical inferential context . further work is necessary to facilitate statistical testing , for instance , to assess the null hypothesis that an expected pattern is not contained in the data . concerning the presented measures of model distance , the frchet distances were found to be very useful to assess model similarity in our experiments involving simulated noise . their distinct advantage is their independence of model order and the disregard of the less interpretable parameters . on the other hand , spurious high distances this can be attributed to the fact that the simulated data exhibit three independent peaks , which is a violation of the snage 's assumption of a connected path of peaks . therefore , a combination of frchet values and a pixel - wise distance function based on the models ' generated data seems advantageous . when applied to noisy time signals , the snage model adapts too well to the corresponding smooth time - frequency representations . because the optimized cost function does not take into account information about the expected pattern , the model simply tries to capture the tfr data as accurately as possible . data preprocessing and tfr interference suppression are therefore extremely important . adding penalty terms to the cost function and/or providing explicit initial parameters are ways to point the optimizer in the right direction . however , even without specifying a - priori knowledge , the model was able to find the simulated pattern for low signal to noise ratios in the average case . the analysis of time - frequency representations of electrophysiological signals calls for flexible methods accounting for inter- and intraindividual data variability . we present the flexible , robust , and interpretable model snage , which extends the established gaussian model . its ability to extract 3d features from time - frequency representations of electrophysiological data is demonstrated . however , the model applies to general multivariate data which exhibit similar behavior . in this work , several techniques to improve the model fitting performance are described . we show how to estimate start parameters directly from the data . an iterative scheme to refine optimized models experiments with real as well as simulated data demonstrate the snage model 's robustness and flexibility . under the influence of severe noise , the developed technique is best suited for patterns which are too complex to be appropriately captured by a gaussian model , but still simple enough to facilitate robust fits . to summarize , due to its robustness and flexibility the snage model possesses the potential to become a beneficial tool for practical eeg / meg analysis , including functional brain connectivity analysis , outlier detection , time - frequency denoising , and feature extraction .

electrophysiological signals such as the eeg , meg , or lfps have been extensively studied over the last decades , and elaborate signal processing algorithms have been developed for their analysis . many of these methods are based on time - frequency decomposition to account for the signals ' spectral properties while maintaining their temporal dynamics . however , the data typically exhibit intra- and interindividual variability . existing algorithms often do not take into account this variability , for instance by using fixed frequency bands . this shortcoming has inspired us to develop a new robust and flexible method for time - frequency analysis and signal feature extraction using the novel smooth natural gaussian extension ( snage ) model . the model is nonlinear , and its parameters are interpretable . we propose an algorithm to derive initial parameters based on dynamic programming for nonlinear fitting and describe an iterative refinement scheme to robustly fit high - order models . we further present distance functions to be able to compare different instances of our model . the method 's functionality and robustness are demonstrated using simulated as well as real data . the snage model is a general tool allowing for a wide range of applications in biomedical data analysis .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusion

written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . lumbar hernias are rare and good history and general physical examination can rule out most of the differential diagnosis.ct scan should be done as routine prior to planning surgical approach unless patient is in life threatening emergency situation.even though the data available for us regarding the management of lumber hernias are limited current literature suggests laparoscopic approach is the best method of treatment.open surgery should be reserved for patients who have very large defects or failed laparoscopic approach.the operative technique should be decided on the size of the hernia , location , contents , etiology , recurrence and availability of facilities and expertise of the hospital . lumbar hernias are rare and good history and general physical examination can rule out most of the differential diagnosis . ct scan should be done as routine prior to planning surgical approach unless patient is in life threatening emergency situation . even though the data available for us regarding the management of lumber hernias are limited current literature open surgery should be reserved for patients who have very large defects or failed laparoscopic approach . the operative technique should be decided on the size of the hernia , location , contents , etiology , recurrence and availability of facilities and expertise of the hospital .

lumbar hernias are uncommon and about 300 cases have been reported till date . they commonly occur due to trauma , surgery and infection . they are increasingly being reported after motor vehicle collision injuries . however , spontaneous lumbar hernias are rare and are reported infrequently . it is treated with different surgical approaches and methods . we report a case of primary spontaneous lumbar hernia which was repaired by transperitonial laparoscopic approach using vypro ( polypropylene / polyglactin ) mesh and covered with a peritoneal flap .

Conflict of interest Funding Ethical approval Author contributions Key learning points

gastroesophageal reflux disease ( gerd ) is one of the most frequently occurring benign functional disorders in western industrial countries . the effectiveness of laparoscopic antireflux surgery for recalcitrant gerd has been clearly demonstrated in several series . these laparoscopic results , in combination with a shorter hospital stay and a more rapid return to normal activities , have promoted the emergence of minimally invasive antireflux surgery as the method of choice for the operative management of gerd . antireflux surgery has a higher failure rate in mo , which is in direct relation to high body mass index . the increased intraabdominal pressure and the morbid obesity - related comorbidities lead to a higher failure rate of the standard antireflux procedures in this group of patients . over the past 40 years , surgery has become the most effective long - term treatment for morbid obesity . the national institutes of health during their consensus development conference on gastrointestinal surgery for morbid obesity in 1991 recognized the role of bariatric surgery in the treatment of highly selected , well - informed , motivated patients who are acceptable operative risks and fail or are likely to fail a medical weight loss program . bariatric operations allow for substantial weight loss , extended weight maintenance , and control or reversal of obesity - related health problems . several series have now reported that lrygbp improves gerd symptoms , but few have included standardized quality of life tools . the objective of this study was to evaluate the efficacy of lrygbp as an antireflux procedure on gerd - related symptoms in morbidly obese patients by using a heart - burn - related quality of life score and other standardized outcomes tools . patients with recalcitrant gerd and a bmi greater than 35 were offered lrygbp or nissen fundoplication . patients who chose lrygbp an extensive preoperative evaluation , including history and physical examination , the usage of antacid medication and its efficacy , nutritional and psychiatric evaluation , and indicated specialty consultations , was performed before surgery . all the patients had an upper endoscopy or upper gastrointestinal imaging to document and evaluate their gerd severity and upper gi anatomy . laboratory evaluation included complete blood count , serum chemistries , and thyroid function testing ; 24-hour ph monitoring was done in select patients . patient preparation for surgery consisted of a detailed explanation in written and oral form of the developmental aspect of lrygbp and its benefits and risks , including short- and long - term complications , side effects , nutritional sequelae , and the possibility of conversion to the open procedure . prophylaxis against venous thrombosis and pulmonary embolus consisted of perioperative pneumatic compression devices and low - dose subcutaneous heparin . data were collected prospectively and verified retrospectively , then entered into a customized computer database . data sources included office charts , follow - up notes , hospital charts , and patient interview in the outpatient clinic and phone interviews . parameters included patient demographics , comorbidity , hospital stay , recovery , complications , weight loss , gerd symptoms , and the need for antacids . quality of life changes and patient satisfaction were evaluated using the heart burn related quality of life ( hrqol ) and sf-36 quality of life questionnaires . recovery was defined as the number of days after surgery when patients resumed common activities of daily living , such as driving , shopping , household activities , and employment . follow - up weights were obtained from the university of pittsburgh surgical weight loss clinic scale with a capacity of 400 kg . on occasion the patient was placed in a supine position with the surgeon on the right and the assistant on the left , and 2 monitors were above the patient 's shoulders . after creation of carbon dioxide pneumoperitoneum ( 15 mm hg ) using the open hasson technique , cannulas ( u.s . the operating table was placed in a steep reverse trendelenburg position . to expose the esophagus and stomach , a 5-mm liver retractor ( genzyme , tucker , ga ) was placed through the inferior right subcostal port , and the left lateral segment of the liver was elevated . gastric pouch creation was performed . to localize the esophagogastric junction and size the pouch , then , a window was created in the lesser omentum near the gastric wall at the lesser curvature . the endo gia stapler ( u.s . surgical ) , 60-mm length and 4.8-mm staples , was inserted and applied 3 or 4 times to staple and cut the gastric pouch with 3 rows of staples on each side . a smaller staple size ( 3.5 mm ) was later substituted to reduce staple line bleeds at the transected stomach . the greater omentum and transverse colon were passed to the upper abdomen to expose the ligament of treitz . to create the roux limb , the jejunum was transected with an endo gia ii stapler ( u.s surgical ) , 45-mm length and 3.5-mm staples , at approximately 50 cm from the ligament of treitz , where a comfortable length of mesentery exists . a smaller staple size ( 2.5 mm ) the jejunal mesentery was then divided with 2 applications of the endo gia ii stapler , using the vascular load ( 45-mm length , 2.0-mm staples ) . a 6-cm length of penrose drain a window was created in the meso - colon immediately anterior and lateral to the ligament of treitz to gain access to the lesser peritoneal sac . the roux limb was then passed in a retrocolic retrogastric fashion to lie next to the gastric pouch ( figure 2 ) . the gastrojejunostomy was then created using the endo gia ii stapler , and the gastrojejunostomy anastomosis was closed with interrupted 20 surgideck suture material ( u.s . the gastrojejunostomy and enterotomy site were endoscopically inspected and tested for leakage after insufflation and submerging them in irrigation fluid . the roux limb was then measured 150 to 180 cm distally , and a stapled side - to - side anastomosis was created with the proximal jejunal limb using 1 application of the endo gia stapler ii ( 60-mm length , 3.5-mm staples ) . the enterotomy sites were stapled closed , and the mesentery of the jejunojejunostomy was sutured closed ( figure 2 ) . the laparoscopic port placements and their use during the procedure . the completed gastric bypass : gastric pouch - jejunal anastamosis , the jejunojejunostomy , closure of the mesentery . pain management consisted of morphine patient - controlled analgesia ( pca ) intravenously as needed . an upper gastrointestinal series was performed on the morning of the first postoperative day using gastrografin followed by barium . a clear liquid diet was begun that day , and the patient was discharged from the hospital after demonstrating tolerance for the diet and return of bowel function , usually on the second postoperative day . patient follow - up was scheduled for every 2 months , with laboratory evaluation every 6 months , until weight loss stabilized ( usually 1 to 1.5 years after surgery ) , then twice per year . all the patients are routinely treated with a low dose of 150 mg / day ranitidine hydrochloride , to prevent anastomotic ulcers . the patient was placed in a supine position with the surgeon on the right and the assistant on the left , and 2 monitors were above the patient 's shoulders . after creation of carbon dioxide pneumoperitoneum ( 15 mm hg ) using the open hasson technique , cannulas ( u.s . the operating table was placed in a steep reverse trendelenburg position . to expose the esophagus and stomach , a 5-mm liver retractor ( genzyme , tucker , ga ) was placed through the inferior right subcostal port , and the left lateral segment of the liver was elevated . gastric pouch creation was performed . to localize the esophagogastric junction and size the pouch , then , a window was created in the lesser omentum near the gastric wall at the lesser curvature . the endo gia stapler ( u.s . surgical ) , 60-mm length and 4.8-mm staples , was inserted and applied 3 or 4 times to staple and cut the gastric pouch with 3 rows of staples on each side . a smaller staple size ( 3.5 mm ) was later substituted to reduce staple line bleeds at the transected stomach . the greater omentum and transverse colon were passed to the upper abdomen to expose the ligament of treitz . to create the roux limb , the jejunum was transected with an endo gia ii stapler ( u.s surgical ) , 45-mm length and 3.5-mm staples , at approximately 50 cm from the ligament of treitz , where a comfortable length of mesentery exists . a smaller staple size ( 2.5 mm ) the jejunal mesentery was then divided with 2 applications of the endo gia ii stapler , using the vascular load ( 45-mm length , 2.0-mm staples ) . a 6-cm length of penrose drain was sewn to the end of the roux limb using the endostitch ( u.s . a window was created in the meso - colon immediately anterior and lateral to the ligament of treitz to gain access to the lesser peritoneal sac . the roux limb was then passed in a retrocolic retrogastric fashion to lie next to the gastric pouch ( figure 2 ) . the gastrojejunostomy was then created using the endo gia ii stapler , and the gastrojejunostomy anastomosis was closed with interrupted 20 surgideck suture material ( u.s . the gastrojejunostomy and enterotomy site were endoscopically inspected and tested for leakage after insufflation and submerging them in irrigation fluid . the roux limb was then measured 150 to 180 cm distally , and a stapled side - to - side anastomosis was created with the proximal jejunal limb using 1 application of the endo gia stapler ii ( 60-mm length , 3.5-mm staples ) . the enterotomy sites were stapled closed , and the mesentery of the jejunojejunostomy was sutured closed ( figure 2 ) . the laparoscopic port placements and their use during the procedure . the completed gastric bypass : gastric pouch - jejunal anastamosis , the jejunojejunostomy , closure of the mesentery . pain management consisted of morphine patient - controlled analgesia ( pca ) intravenously as needed . an upper gastrointestinal series was performed on the morning of the first postoperative day using gastrografin followed by barium . a clear liquid diet was begun that day , and the patient was discharged from the hospital after demonstrating tolerance for the diet and return of bowel function , usually on the second postoperative day . patient follow - up was scheduled for every 2 months , with laboratory evaluation every 6 months , until weight loss stabilized ( usually 1 to 1.5 years after surgery ) , then twice per year . all the patients are routinely treated with a low dose of 150 mg / day ranitidine hydrochloride , to prevent anastomotic ulcers . from february 1999 to april 2001 , 57 patients with a median bmi of 43 underwent attempted lrygbp at the thoracic division of the university of pittsburgh medical center . patient demographics ( n=57 ) hiatal hernia or esophagitis , or both , were present in 48 patients ; barrett 's esophagus was documented in 2 . lrygb was possible in 52 patients ; 5 required open conversion , 3 due to multiple adhesions and 2 for poor exposure . complications included 1 leak , 1 pulmonary emboli , 2 reoperations for internal roux intestinal limb hernia , and 7 gastrojejunal strictures , which were treated with endoscopic dilatations , average of 1 postoperative dilatation ( range , 1 to 3 ) . no deaths occurred . at a mean follow - up of 18 months ( range , 3 to 30 ) , all patients report improvement or no symptoms of gerd and a mean weight loss of 40 kg ( range , 16 to 70 ) . previous and current antacid medication usage is summarized in table 2 . before and after surgery antacid medication usage quality of life scores ( sf-36 ) were above national norms for physical and mental components ( median=55 , mode=50 ) . the gerd - health related quality of life median score was < 1 ( scale , 0 to 45 , 0=asymptomatic , 45=worse ) ( table 3 ) . excessive body weight is a significant independent risk factor for a hiatal hernia and is significantly associated with esophagitis . fisher et al demonstrated a correlation between both weight and body mass index with gastroesophageal reflux . since the early 1990s , the status of laparoscopic antireflux surgery has moved from experimental to routine , with large experiences now reported by many centers . furthermore , the outcome in the majority of patients undergoing surgery is good , with relief of reflux symptoms in about 90% of the patients . laparoscopic surgery for the correction of gastroesophageal reflux has become common throughout the western world , partly because of better patient acceptance due to a perception that surgical procedures are now less invasive and also because of an apparently increasing incidence of reflux presenting as a clinical problem . our series of patients is the first description and evaluation of the lrygbp as an antireflux procedure . previously , it was reported that one of the major morbidities after ring vertical gastroplasty is severe acid reflux ; the roux - en - y gastric bypass suggests a solution to this complication although it has never been studied from the perspective of treating gastroesophageal reflux disease . all the patients in this study had symptomatic gerd , and they opted to be treated with lrygbp to address the initial gerd problem and the other comorbidities associated with their morbid obesity . they were all treated with low - dose ranitidine hydrochloride postoperatively to prevent anastomotic ulcers ; however , the dosage used is nontherapeutic for gerd symptoms . the use of antacid medications after the surgery was in less than 10% of the patients , and all of these were on a lower dosage than that prior to the surgery . all our patients were refractory to medical treatment before surgery , and 53% were on a high dosage and a conventional dosage of proton pump inhibitors . all the patients were interviewed , and the heartburn - related symptoms were recorded . according to our results , all were free of gerd symptoms after the operation , and it was not always correlated to their excess body weight lost . our result may suggest that the antireflux mechanism of this surgery is a combination of acid reflux reduction due to gastric stapling or gastroplasty and the reduction of increased intraabdominal pressure by reduction of excess body weight resulting in lower intraabdominal pressure . thoracic surgeons with laparoscopic expertise should consider lrygbp for treatment of gerd in the mo .

background and objectives : gastroesophageal reflux disease ( gerd ) is commonly associated with morbid obesity ( mo ) . antireflux surgery has a higher failure rate in mo and addresses only one of the comorbidities present . this paper reviews the results of laparoscopic rouxen - y gastric bypass ( lrygbp ) performed for recalcitrant gerd in mo.methods:patients with recalcitrant gerd and a body mass index ( bmi)>35 undergoing lrygbp were included . lrygb included crural repair , creation of a small gastric pouch ( 30 ml ) , and intestinal bypass ( 150 to 180 cm ) . all patients were followed in clinic and by telephone.results:from february 1999 to april 2001 , 57 patients ( 51 f , 6 m ) with a mean age of 43 ( range , 22 to 67 ) and a median bmi of 43 underwent lrygbp . hiatal hernia or esophagitis , or both , were present in 48 , barrett 's in 2 . lrygbp was possible in 52 patients ; 5 required open conversion . the median hospital stay was 3 days . complications included 1 leak , 1 pulmonary emboli , 2 reoperations for internal roux limb hernia , and 7 gastrojejunal strictures . at a mean follow - up of 18 months ( range , 3 to 30 ) , all patients report improvement or no symptoms of gerd and a mean weight loss of 40 kg ( range , 16 to 70 ) . quality of life scores ( sf-36 ) were above national norms for physical and mental components ( median 55 , norms=50 ) . gerd - health related quality of life median score was < 1 ( scale , 0 to 45 , 0=asymptomatic , 45=worse).conclusion : lrygbp was effective for recalcitrant gerd in mo . lrygbp also led to weight loss and improvement in other comorbidites . surgeons with minimally invasive expertise should consider lrygbp for treatment of gerd in the morbidly obese .

INTRODUCTION METHODS Surgical Technique RESULTS DISCUSSION CONCLUSION

acute epidural hematoma ( edh ) accounts for 2.7% to 11% of traumatic brain injuries ( tbis ) , and if the size is large , the disease leads to devastating results.1712 ) generally , a small edh does not cause neurological deficits , and it has a good prognosis . however , if an initially small edh suddenly expands , the patient 's condition may deteriorate quickly.2813 ) this may cause death or a serious neurological disorder in a patient , and thus , it always requires attention and quick action . so far , much of the literature has reported on the expansion of acute edh , and most types have been analyzed , including asymptomatic hematoma expansion found in the follow - up of computed tomography ( ct).5111719 ) the change of the hematoma in edh treatment - not only the change of radiologic imaging size but also the degree of expansion of the hematoma leading to operation - is important . thus , we investigated the early predictors and risk factors of hematoma expansion in patients who underwent delayed surgery when their neurological condition worsened due to the expansion of the hematoma during the conservative treatment of edh . this was a retrospective study of 151 patients who opted for conservative treatment during initial hospitalization among patients who presented with traumatic edh from january 2011 to january 2014 . of the 151 patients , 61 patients were excluded ; eight patients were excluded for surgery because of hematoma size increases without significant neurological symptoms or signs . four patients who underwent emergency surgery because of severe neurological deficits without follow - up ct were excluded . ten patients were excluded due to hemorrhagic diseases , such as hepatic cirrhosis , hematologic malignancy , and end - stage renal disease with hemodialysis . two patients with diffuse axonal injury and 19 patients with other severe accompanying tbis ( e.g. , subdural hematoma , intracerebral hemorrhage ) were excluded . eighteen patients with abbreviated injury scale ( ais)6 ) scores of more than 3 with traumatic multi - organ injury were excluded . accompanying head injuries included skull fracture , contusional hemorrhage of less than 5 ml , and traumatic subarachnoid hemorrhage of less than a fisher grade 3 . a total of 90 patients were enrolled in this study and divided into a delayed - surgery group ( dg ) and a non - surgical group ( ng ) . the dg was the group that received surgery due to changes in symptoms and hematoma growth in the course of the conservative treatment period . in other words , the dg was a group of patients , who were not indicated for operation initially , that underwent surgery later due to edh growth with neurological deterioration . members of this group had to have shown neurological change and hematoma increase in the follow - up ct and to have undergone surgery ( figure 1 ) . the follow - up ct of the ng was performed within 6 to 12 hours . the gender , age , initial glasgow coma scale ( gcs ) , presence of drinking at trauma attack , and medical history ( hypertension , diabetes , anticoagulant use ) of all patients were investigated . the laboratory studies - including platelet counts , prothrombin time ( pt ) , and partial thromboplastin time ( ptt)-were also investigated . in addition , the initial amounts and changes in edh amounts ( ml ) , changes in mean arterial pressure ( map , mm hg ) , accompanying head injury , and time interval between trauma and initial ct time ( hours ) were collected . the prognostic outcome of both groups was evaluated with the glasgow outcome scale . only in the dg , we also analyzed the relationship between the prognosis of patients and the gcs of both initial and later time points , where the same patients went through neurological aggravation . the abc/2 method was used to measure the amount of edh.9 ) the indications for edh surgery were defined as a volume of more than 30 ml , a thickness of more than 10 mm , or a mid - line shift of more than 15 mm . map change was defined as the difference between the first time map was measured in the emergency room and just before the follow - up ct . whether platelet counts were normal additionally , normal pt and ptt were determined based on 9.5 to 12.8 seconds and 27.9 to 37.8 seconds , respectively . each factor was examined with univariate analysis and multivariate analysis . the statistical package for the social sciences ( spss ) version 18.0 for windows ( spss inc . , chicago , il , usa ) was used as the analysis program . in the univariate analysis , an independent t - test was conducted for continuous variables , and a chi - square test was conducted for nominal variables . the average amounts of change in the hematomas of the dg and the ng were 33.0231.02 ml and 2.4156.272 ml , respectively ( p<0.001 ) ( figure 2 ) . independent variables of the dg and ng are shown in table 1 . in the univariate study , the presence of drinking , map change , and time interval between trauma and initial ct were statistically significant . in the ng , 20 patients with drinking ( 29.58% ) were reported to be higher than one patient ( 5.26% ) in the dg ( p=0.0345 ) . the map change of the ng showed a decrease of 0.428 mm hg , while the dg showed an increase of 9.684 mm hg ( p=0.031 ) . the time interval between trauma and initial ct time was 5.7076.963 hours for the ng and 1.8021.565 hours for the dg . initial brain ct was performed more quickly in the dg than the ng ( p=0.0001 ) . other factors - including age , anticoagulant use , medical history , and accompanying head injury - were not statistically significant . in the multivariate study , only the time interval between trauma and initial ct was statistically significant ( p=0.0135)(table 2 ) . according to the presence of surgery , the receiver operating characteristic ( roc ) curve for the time interval between trauma and initial ct time a specificity of 88.2% and sensitivity of 68.3% are shown in figure 3 ( area under the curve=0.854 ) . in comparison with the ng , the dg revealed a relatively poor outcome ; however , this difference between the two groups was not statistically significant ( p=0.0673 ) ( table 3 ) . on the other hand , the gcs checked at later time points , where the patients were neurologically aggravated , statistically significantly affected the prognosis ( p=0.020 ) . nonetheless , the initial gcs and the degree of change in gcs score were not statistically influential ( table 4 ) . this study examined the risk factors and predictors of expansion of edh for surgery from the clinical rather than radiologic perspective of initial edh , which is not indicated for surgery . anatomically , the surgical approach of edh is relatively easy and does not require proficiency . therefore , in a clinical situation , methods of surgical management alone can not be the problem . a problem in the clinical situation occurs when conservative treatment is determined to be sufficient for early acute edh , but it suddenly expands in size , leading to neurological disorders . in other words , due to the relatively small acute edh in the initial , clear state of consciousness , the patient can suddenly worsen . at that time , if surgery is required due to edh expansion on the ct , there is no rapid response in the process , and several problems can occur . several vectors associated with edh progression from existing reports have already been revealed . however , the majority involved asymptomatic radiologic change and did not focus on changes in the clinical status of patients that needed operations.5719 ) therefore , we evaluated risk factors for surgery , using only cases of expanded edh for which surgery was necessary . thus , the patients of this study were selected initially for conservative treatment , and the dg was defined as the group that received surgery due to changes in symptoms and hematoma growth in the follow - up ct during conservative treatment . in this study 's univariate analysis and multivariate analysis results , the most significant factor was the time interval between the trauma and the initial ct . we considered the main reason to be that ct was undergone during hematoma expansion.2417 ) based on the results of this study and a review of previous literature , the time interval between head trauma and ct was shorter . in that time , edh had a high probability of expansion . according to oertel et al.,15 ) the time between the initial injury and the first ct of the edh - enlarged group was 1.3 hours , while the time of the non - enlarged group was 2.3 hours . in the study by bezirciolu et al.,3 ) they recommended that ct be taken within 6 hours in the follow - up of edh . therefore , our research also considered time interval between trauma and initial ct time as a definite risk factor , and the roc curve was calculated . at the 2.08-hour cut - off value , specificity of 88.2% and sensitivity of 68.3% were confirmed . additionally , this result requires re - evaluation and reinforcement from large - scale studies , and we should note that it is more important to obtain a cut - off value of high sensitivity than that of specificity for the prediction of edh expansion and faster operation . ultimately , this study aimed to evaluate and analyze the variable factors that may serve as prognostic parameters in both groups of patients . the parameters with statistical significance were strongly considered for the risk factors of delayed operation in the aggravating of edh . of the factors discussed , the interval time between trauma onset and initial ct , which was statistically presented with time - dependent sensitivity and specificity , was found to have predictive potential in the diagnosis of disease progression . in addition to the time interval between trauma and initial ct , changes in map and the presence of drinking were also statistically significant . neurological change is a clinically important factor for predicting prognoses in tbis ; therefore , intracranial pressure changes during the expansion of the edh were also thought to be accompanied by map change , and map was set up as an independent variable . it was found that the average map change of the dg was increased by about 10 mm hg more than that of the ng . however , a 10 mm hg change of map is not clinically meaningful . the increase of map can be seen as a change in systolic map due to cushing 's reaction , pain , or external factors , and as variance due to the difference between observers . this means that map was measured before follow - up ct in the ng as a routine check - up , but in the dg , map was measured after neurological deterioration or severe headache . additionally , pain controllers , inotropes , or antihypertensive agents can be confounding factors for map . additionally , the authors excluded the patients who presented with ais values of 3 or over and injuries to other organs , as these factors can act as confounding variables . drinking alcohol was another aspect the authors considered an important , independent factor influencing the initial gcs and the severity of edh in the dg . drinking was reported in only one of 20 patients of the dg , which was thought to reflect a selection bias due to the small sample . this also means further study is required to reveal the correlation between drinking and the prognosis for edh expansion . this has been found to have meaning in the literature ; however , whether accompanied by brain injury , such as a fractured skull , or anticoagulants , no statistically significance correlation was found in the present study.710121618 ) however , this is also thought to be because it was conducted at a single institution . the relatively small sample size and different inclusion criteria compared with other studies could have caused conflicting results . additionally , in edh , factors of age are known to affect the dural adhesion to the skull.14 ) we subsequently carried out a statistical analysis on the effect of age ; however , it was not found to be statistically significant ( p=0.078 ) . we hypothesized that gender differences may also lead to variable states of dural adhesion and cause diverse types of trauma as well as affect the severity of the disease progression . however , these independent factors were concluded to be not statistically significant . in this study , the prognostic outcome of the patients in the dg were poor compared to those in the ng , but we were not able to prove this statistically . we understand that this may be due to the retrospective nature of the study and the small pool of patients . when focusing only on the patients in the dg , the mechanical damage made by the hematoma expansion itself was statistically more influential in determining the prognostic outcome than the degree of clinical changes in the patients . obviously , it is logical to assume that larger changes in gcs scores mean poorer prognostic outcomes for patients , and this was clinically witnessed in our patients . thus , the small number of patients and retrospective nature of the study are the greatest limitations of this study . , the patients who arrived at our emergency department during the process of hematoma expansion were included in our study . however , if the hematoma was already large enough to be considered an end - point of hematoma expansion , requiring an emergency operation , they were excluded from our study . in order to overcome this limitation , a well - organized time - matched study will be required in the future . in reality , the time interval between trauma and initial ct is a non - modifiable factor that can be applied in the clinical situation . the statistics have shown that the parameters - such as changes in map , presence of drinking , and time interval between trauma and initial ct - are statistically significant to support our hypothesis . nonetheless , they are unfortunately non - modifiable clinical factors , which can not be used in treatment guidelines . however , this particular study has proven that these factors have critical implications as predictive risk factors of progressive edh requiring surgery . in summary , our data revealed a sensitivity of 68.3% and a specificity of 88.2% at a 2.08-hour time interval between trauma and initial ct . this present finding indicated that if the time interval between trauma and initial ct was shorter in acute edh , the probability of the patient suffering subse quent neurological deterioration following a delayed operation increased . since the time interval between trauma and initial ct is a non - modifiable factor , if it is shorter , the neurosurgeons should be alerted to the possible neurological deterioration of the patients due to the growing hematoma and promptly respond with appropriate treatments .

objectivea small epidural hematoma ( edh ) that has been diagnosed to be nonsurgical by initial brain computed tomography ( ct ) can increase in size and need surgical removal , resulting in a poor prognosis . however , there have been few studies , which focused delayed operated edh . therefore , we analyzed the clinical factors to determine the predicting factors of delayed operated edh.methodsbetween january 2011 and january 2014 , 90 patients , who were admitted due to edh , were enrolled in this study . none of the patients were indicated for operation initially . based on the presence of surgery , we classified the patients into a delayed - surgery group ( dg ) and a non - surgical group ( ng ) . additionally , we analyzed them according to the following : time interval between the trauma and the initial ct , gender , age , medical history , drinking , change of mean arterial pressure ( map ) , volume of edh and other traumatic brain lesion.resultsamong the 90 patients , the dg was 19 patients . compared with ng , the dg revealed increased map , less presence of drinking , and a short time interval ( dg vs. ng : + 9.684 mm hg vs. -0.428 mm hg , 5.26% vs. 29.58% , 1.802 hours vs. 5.707 hours , respectively , p<0.05 ) . analyzing the time interval with receiver operating characteristic , there was 88.2% sensitivity and 68.3% specificity at the 2.05-hour cut - off value ( area under the curve=0.854).conclusionaccording to our results , the time interval between the trauma and the initial ct along with blood pressure change are potential predicting factors in the cases of delayed operation of edh .

Introduction Materials and Methods Results Discussion Conclusion

asbestos and silica are well - known fibrogenic dusts . however , there is no comprehensive understanding of the molecular and cellular events that lead to fibrosis as a consequence of asbestos or silica inhalation . previous studies have shown that asbestos stimulates superoxide anion production in alveolar macrophages through the phospholipase c / protein kinase c pathway . in contrast , silica does not appear to activate this pathway nor stimulate superoxide anion production , but silica does stimulate cytokine release by some undetermined pathway . therefore , using human alveolar macrophages isolated from normal healthy volunteers , we evaluated the potential involvement of intracellular calcium and tyrosine kinases as potential signal transduction pathways . in the absence of serum , crystalline silica , and to a lesser extent amorphous silica , caused a rapid and dose - dependent elevation of intracellular calcium coming from the extracellular space . however , in the presence of serum , which is required for silica - stimulated cytokine release , neither form of silica caused noticeable elevation of intracellular calcium . silica , however , did increase the extent of tyrosine phosphorylation , most notably of proteins at approximately 46 and 50 kda , suggesting activation of a tyrosine kinase pathway . preincubation of alveolar macrophages for 24 hr with silica - primed human alveolar macrophages for enhanced interleukin-1 beta ( il-1 beta ) release stimulated by endotoxin ( lps ) that was dose dependent . the enhanced lps - stimulated release of il-1 beta correlated with enhanced mitogen - activated protein kinase activity . taken together , these results indicate that a tyrosine kinase pathway is activated during silica stimulation of human alveolar macrophages.imagesfigure 4 . afigure 4 . b

Images

duodeno - duodenal intussusception , which involves the distal invagination of a segment of the duodenum , is a rare condition owing to the retroperitoneal fixation of the duodenum , which is sometime absent in cases of intestinal malrotation . the vast majority ( 8090% ) of cases of intestinal intussusception are secondary to pathological masses in the intestine , such as brunner s gland hamartomas , lipomas and adenomas . the presence of a duodenal membrane may cause retention of food resembling a pathologic mass , which may in turn facilitate intussusception . we describe the interesting case of a patient with intestinal malrotation who developed acute pancreatitis as a result of a duodenal intussusception involving the head of pancreas which was caused by a duodenal membrane . other symptoms include gastro - oesophageal reflux , weight loss , fatigue , anaemia due to iron deficiency ; pancreatitis due to obstruction of the outlet duct has also been described [ 36 ] . owing to the intermittent nature of the symptoms delay in diagnosis symptoms had started three days previously and consisted of intermittent peri - umbilical pain , nausea and vomiting . the initial physical examination indicated a healthy young man with mild epigastric tenderness . in infancy he had undergone surgery for a congenital heart malformation involving closure of atrial and ventricular septal defects . during childhood he had been treated with proton - pump inhibitors for symptoms of gastro - oesophageal reflux , and he had a history of intermittent post - prandial abdominal pain , but had never undergone endoscopic examination , or any abdominal surgery . presented with a normal height and weight for his age with a body mass index of 25 . routine blood analyses revealed elevated levels of s - amylase ( 408 u / l ; ref . subsequently the patient developed fever , ( core body temperature 38.6 c ) ; acute cholecystitis was suspected so he was treated with intravenous antibiotics . subsequent abdominal ultrasonography was inconclusive , although there were signs consistent with a tumour in the head of the pancreas . a ct - scan revealed a duodeno - duodenal intussusception involving the head of the pancreas and the common bile duct ( figs . 1 and 2 ) . these finding were confirmed at laparotomy and non - rotation of the duodenum was also noted ( fig . the intussusception was released , and a duodenotomy revealed a duodenal membrane with a narrow central opening ( fig . s - bilirubin and s - amylase levels were within the normal range at discharge . to our knowledge this is the first case report of pancreatitis resulting from duodenal invagination caused by a duodenal membrane . high peristaltic pressure proximal to the stenosis may have contributed to the development of the invagination , which may also have been facilitated by the mobile , non - rotated duodenum , which had a vertical straight course without retroperitoneal fixation . cases in which an intraluminal polypoid mass or tumour in the duodenum resulted in duodeno - jejunal intussusception have been reported . in a few cases the intussusception involved the head of the pancreas , resulting in acute pancreatitis . these patients were treated by surgical reduction of the intussusception and duodenal resection or polypectomy . membranous duodenal stenosis is often treated by duodenotomy and excision of the membrane followed by a duodenoplasty , or by duodeno - jejunal anastomosis , with good results . in our case the patient had persistent symptoms of gastro - oesophageal reflux , which should have triggered an upper gi endoscopy ; had this revealed the intestinal malformation the patient could have been treated in a timely fashion and which would have avoided this serious complication . the intussusception was not detected by ultrasonography but was revealed by a ct - scan . a previous study found that 27.1% of patients with intestinal malrotation had a history of congenital cardiovascular defects . this suggests that all children with intermittent upper gastrointestinal symptoms such as vomiting , abdominal pain and gastro - oesophageal reflux , particularly those with a history of congenital heart malformation , should undergo upper gi endoscopy and imaging of the gi - tract to exclude gi anomalies . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

highlightsintussusception is not always seen on ultrasonography but can revealed by a ct-scan.any child , and especially those with previous congenital disorders , must undergo upper gi- endoscopy at the presence of intermittent upper gastrointestinal symptoms as vomiting , abdominal pain and gastro - oesophageal reflux , to exclude upper gi anomaly .

Introduction Presentation of case Discussion Patient consent

it is characterized by autoantibodies that target against liver - specific and non - organ - specific antigens ( 1 ) . corticosteroids , especially prednisone or prednisolone ( pd ) , have been the key drugs of initial antiinflammatory and immuno - suppressive therapy of autoimmune hepatitis in children ( 2 ) . however , it is well known that long - term use of corticosteroid is associated with the risk of steroid - induced toxicities , and this requires newer immunosuppressive agents for the treatment of autoimmune hepatitis , especially in growing children . we report on the case of a 11-yr - old korean girl with type-1 autoimmune hepatitis who discontinued pd due to steroid - induced toxicities , but who remained in biochemical and clinical remission while undergoing deflazacort and ursodeoxycholic acid ( udca ) combination therapy . a 9-yr - old girl was admitted to eul - ji hospital because of jaundice and right upper quadrant pain . her height was 135 cm ( 75 - 90 percentile ) , and weight was 43 kg ( over 97 percentile ) . the sclera was icteric , and the liver edge descended 4 cm below the right costal margin . the results of laboratory studies were as follows : aspartate aminotransferanse ( ast ) 1,106 iu / l , alanine aminotransferase ( alt ) 1,888 iu / l , total bilirubin 25.7 mg / dl , direct bilirubin 18.2 mg / dl , total protein 6.9 g / dl , albumin 4.2 g / dl , serum alkaline phosphatase 1,160 iu / l , ggtp 71 iu / l , inr 2.4 , aptt > 120 sec , antinuclear antibody ( ana ) ( + ) speckled pattern , with 1:320 titer , anti - smooth muscle antibody ( ab ) ( - ) , anti - mitochondrial ( ama ab ) ( - ) , igg 1,397 mg / dl , anti - hav igm ( - ) , anti - hbc igm ( - ) , hbsag ( - ) , ebv - vca igg / m ( -/- ) , and ceruloplasmin 28 mg / dl . liver biopsy results showed piecemeal necrosis at the portal - lobular interface accompaning mild to moderate infiltration of lymphocytes , moderate centrilobular cholestasis , moderate lobular inflammation , and moderate fibrosis ( fig . 1 ) . according to the scoring system of international autoimmune hepatitis group ( 3 ) , she had definite autoimmune hepatitis ( score=16 ) . initially , on 40 mg of pd and 300 mg of udca daily , she gradually recovered both clinically and biochemically . pd was tapered gradually , and three months later , she was taking 15 mg of pd and 300 mg of udca daily . at eight months , her aminotransferase level had elevated to 400 iu / l , but reduced rapidly when pd was increased to 40 mg / day . at nine months , she was taking 15 mg / day of pd and 300 mg / day of udca , but she complained of hirsutism , striae , moon face , and buffalo hump , at ten months . the results of a second round of laboratory studies conducted at this time were ; ast 21 iu / l , alt 52 iu / l , total bilirubin 0.7 mg / dl , total protein 7.2 g / dl , albumin 4.7 g / dl , glucose 86 mg / dl , ana ( + ) speckled pattern , with 1:160 titer . accordingly , deflazacort ( calcort , handok pharm co. , ltd , eumseonggoon , chungcheongbuk - do , korea ) was administered at dose of 18 mg a day , instead of pd at dose of 18 mg a day , and udca was continued . her biochemical test remained within normal ranges on this regimen , and the pd - associated complications improved rapidly . fourteen months later , deflazacort was reduced at dose of 15 mg a day , and after 19 months of deflazacort treatment , a follow - up liver biopsy was performed . this showed no lobular activity , no portal activity , near - normal periportal inflammation , and fibrosis ( fig . . the girl has been in clinical and biochemical remission for two years now , without therapy . there are few diseases to be differentiated from autoimmune hepatitis , overlap syndrome , in which the features of autoimmune hepatitis is combined with those of primary biliary cirrhosis , or primary sclerosing cholangitis , and autoimmune cholangitis . in overlap with primary biliary cirrhosis , serologic test of ama is usually positive and histologic study shows findings of cholangitis . in overlap with primary sclerosing cholangitis , serologic test of ama is negative , and histologic evidence suggests various forms of cholangitis . in autoimmune cholangitis , serologic test of ama is negative , and histologic examination shows bile duct injury , suggestive of primary biliary cirrhosis . autoimmune cholangitis , also , is generally not steroid - responsive . in the present case , despite the cholestatic presentation , serum level of ggtp was not so high , histologic study showed no evidence of definite cholangitis , and response to steroid was excellent . according to the scoring system of international autoimmune hepatitis group , this case has definite autoimmune hepatitis ( pre - treatment score 16 , post - treatment score 18 ) . the long - term use of corticosteroid is known to be associated with the risk of steroid - induced toxicities . generally , there are several ways of reducing steroid - associated toxicities , i.e. , administering steroid on an alternate - day schedule , administering adjunctive agent to reduce the need for steroid , and finding a substitute agent . however , of these three options in case of autoimmune hepatitis , the risk of relapse is higher if steroids are administered on an alternate - day schedule ( 4 ) , and thus this method is not recommended . some authors add azathioprine to steroids if normalization of the liver function is not obtained by steroids alone or if too high a dose of steroids is required to maintain normal transaminase levels ( 4 ) . initial combination therapy with steroid and azathioprine , is considered by some authors as standard therapy of autoimmune hepatitis in children , as in adults ( 1 ) . however , there is concern about the oncogenecity associated with long - term azathioprine therapy ( 5 ) , and because of its hepatotoxicity , some authors do not recommend azathioprine as first line treatment , particularly in severely jaundiced patients ( 4 ) . thus , udca was prescribed as an adjuvant medication with pd or deflazacort . in a clinical study on japanese adults , udca improved aminotransferase levels and reduced inflammation in liver biopsy ( 6 ) ; however , a clinical study on caucasian adults showed no significant difference in the results of biochemical tests or in histologic indices between a udca group and a placebo group ( 7 ) . deflazacort is a synthetic steroid , an oxazoline derivative of pd , with potentially lower toxicities than prednisone or pd ( 8) , and has been widely used as an immunosuppressant in the field of pediatric nephrology ; nephrotic syndrome and renal transplantation ( 9 ) , and in duchenne dystrophy ( 10 ) . only one case of adult study has indicated that deflazacort might be a suitable substitute for pd in the treatment of autoimmune hepatitis ( 11 ) . in clinical trials in spain , deflazacort was administered to patients with type-1 autoimmnune hepatitis who were in remission on a stable dose of pd . only clinical and biochemical remission were maintained during the follow - up period without histologic examination . in the present case , deflazacort was substituted for pd as a therapeutic drug in a child who was in remission on pd and udca , but significant pd - associated toxicities occurred . after switching to deflazacort , these toxicities improved rapidly , and the patient remained in clinical and biochemical remission . after 19 months on deflazacort , a follow - up liver biopsy showed near - normalization of auto - immune hepatitis . this is the first known clinical report to show that deflazacort is a suitable substitute for pd in the treatment of autoimmune hepatitis . a recent study showed the measurement of organ- and non - organ - specific auto - antibodies and igg levels correlated with disease activity in autoimmune hepatitis ( 12 ) . the patient in the present case remained ana - positive with 1:160 titer , when on pd and udca , but became ana negative at about the time of the follow - up liver biopsy performed after 19 months on deflazacort and udca . this may provide additional evidence that deflazacort is a possible substitute for pd in the treatment of autoimmune hepatitis . this case poses the possibility that deflazacort can be a possible substitute for prednisone in type-1 autoimmune hepatitis in children , and demonstrates the need for further study .

prednisone or prednisolone are the mainstay drug treatments for autoimmune hepatitis in children . however , long - term use of corticosteroid is associated with the risk of steroid - induced toxicities , and this situation requires newer immuno - suppressive agents for the treatment of autoimmune hepatitis , especially in growing children . an 11-yr - old korean girl with type-1 autoimmune hepatitis discontinued prednisolone due to toxicities , i.e. , hirsutism , buffalo hump , and skin striae , and remained clinical and biochemical remission under replacement of deflazacort and ursodeoxycholic acid combination therapy . a follow - up liver biopsy after 19 months of deflazacort and ursodeoxycholic acid treatment showed histologic remission .

INTRODUCTION CASE REPORT DISCUSSION

congenital mitral valve anomalies are very rare clinical entities involving one or more components of the mitral valve apparatus . the majority of these abnormalities are causing mitral valve insufficiency and commonly presenting in the early part of life . common clinical presentations include left ventricular outflow tract obstruction , valvular insufficiency and heart failure . we report a rare and unique case of congenital mitral valve anomaly associated with anomalous coronary artery in a middle age man who presented with stroke . a 55-year - old male , smoker and previously healthy , presented to our emergency department for abrupt onset of difficulty reading and right sided weakness , signs and symptoms suggestive of a new onset stroke . stat computed tomography ( ct ) and computed tomography angiogram ( cta ) of the brain revealed no abnormality . magnetic resonance imaging of the brain showed acute infarction of the left posterior insular cortex and left parietal subcortical area . he underwent a routine transthoracic echocardiogram ( tte ) as to rule out any possible cardiac source of embolism . tte revealed an abnormally thickened anterior mitral leaflet associated with mild eccentric mitral regurgitation ( mr ) . tee revealed some form of redundant tissue along the anterior mitral leaflet and the base of the anterior leaflet in the left ventricular outflow tract ( lvot ) . it is thin and supple , the appearance was neither consistent with a fibroelastoma , nor a tumor , an abscess , a true aneurysm of the sinus of valsalva nor perimembranous septum . the anterior mitral leaflet is itself thickened and prolapses , which might represent myxomatous disease . a mild eccentric posteriorly directed mr jet was noted , likely originating from the mild prolapse of the anterior leaflet . at the very distal end of the anterior leaflet , there is an echo bright , independently mobile soft tissue entity , 2 - 3 mm in size . the left circumflex coronary artery ( lcx ) appears to have both an anomalous origin ( very low in the left sinus of valsalva immediately above the annulus , in closer association to the mitral valve than usual ) . the ostium of the right coronary artery appears larger than the left coronary artery ( fig . 1 , 2 , and 3 , supplementary movie 1 , 2 , and 3 ) . coronary cta revealed ; anomalous lcx originating from the proximal right coronary artery off the right sinus of valsalva with a retro - aortic benign course . the mitral valve was described as ; thickened anterior mitral valve leaflet with a band like attachment to the membranous inter - ventricular septum , the portion of the band closer to the anterior leaflet forms a thin curvilinear band ( fig . 4 and 5 ) . this abnormal appearance could represent a congenital anomaly , myxomatous changes are still probable although may not explain the atypical attachment site . the patient had no fever , blood cultures were negative and all other laboratory investigations were within normal limits . the patient remained in hospital for one week and discharged later with a minor neurological deficit . in the absence of obstruction of the lvot , the patient is being followed up without surgical intervention . most commonly , mitral valve prolapse due to myxomatous degenerative disease and connective tissue diseases , congenital mitral stenosis , accessory valvular tissue , isolated cleft mitral valve , double orifice and ebstein - like malformation were also reported . supra - mitral ring is one of the components of shone 's complex . in addition , there are also anomalies of the tensor apparatus i.e. , archade or hammock valve , straddling mitral valve with abnormal attachment of mitral valve chordae to both ventricles and parachute mitral valve characterized by unifocal attachment to a single or fused papillary muscle.1,2,3 ) blood cyst of the sub - valvular apparatus of the mitral valve are commonly reported as postmortem findings in infants and they regress spontaneously by age of 6 months , few cases in adults resulting in embolisation and valvular dysfunction have been reported.4 ) accessory mitral valve tissue is a rare congenital cardiac anomaly , commonly associated with other congenital heart diseases , such as ventricular septal defects and transposition of the great arteries . prifti et al.5 ) have classified accessory mitral valve tissue as type i - fixed type ( a : nodular , b : membranous ) , type ii - mobile type ( a : pedunculated , b : leaflet - like ) . type iib is divided into 1 ) rudimentary chordae and 2 ) developed chordae . in this case , the appearance might fit into type iib - mobile type ( leaflet like ) . however , they further described attachment of the mitral accessory tissue into six different locations in the left ventricle through the accessory tissue 's chordae . in our case , the accessory tissue was attached to the interventricular septum directly , not through a chordae , confirmed by echocardiogram and ct scan . in the majority of cases of accessory mitral valve tissue , presentations were left ventricular outflow tract obstruction , significant valvular insufficiency , palpitation and heart failure . the lvot obstruction is the result of systolic ballooning into the lvot producing a mass effect and the continuing turbulence producing this effect , results in a fibrous tissue reaction with permanent deposits of fibrous tissue and progressive lvot obstruction.6,7,8 ) in this case , there was no lvot obstruction and the presentation was stroke . however , infective endocarditis was excluded in this case on the basis of negative blood culture and absence of other criteria suggesting endocarditis . we reviewed all echocardiographic features of reported mitral valve anomalies , and none have shown similar appearance to the anomalous mitral valve presented in this case . proximal course of coronary arteries.9 ) the transesophageal echocardiogram revealed an anomalous course of the lcx , later confirmed by cta . pathological diagnosis of this uncommon mitral valve anomaly is unavailable , which might be considered as a limitation . however , given the clinical presentation of stroke , there is an ongoing debate , as to consider this anomaly being a definite cardiac source of embolism . in addition , there was no lvot obstruction and the final decision was to treat the patient conservatively with regular follow - up , which was also the patient 's preference . this case highlights an under - recognized anomaly of the mitral valve associated with anomalous coronary arteries . we advise regular clinical and echocardiographic evaluation in this situation to identify any progression . in future , such anomaly might be considered as potential source of embolism and surgical removal might be considered as a reasonable indication .

a 55-year - old male presented with stroke . transesophageal echocardiogram and cardiac computed tomography revealed an unrecognized congenital malformation of the anterior mitral leaflet associated with anomalous left coronary circumflex artery , arising from the right coronary artery , diagnosed first by echocardiogram . this case represents a unique unforeseen mitral valve anomaly that might be considered as potential cardiac source of embolism . this finding broadens the spectrum of known mitral valve anomalies .

Introduction Case Discussion Supplementary movie legends

nontraumatic spontaneous intracranial hemorrhage ( ich ) causes significant morbidity and mortality throughout the world . ten to 20% of strokes are caused by ich in western countries.6 ) over 45 years of age , ich is common,5)16)21 ) but rare before then . therefore , the goal of our study was to perform a descriptive analysis of ich etiology and prognostic factors in patients aged 40 years . we selected 39 consecutive patients who were 40 years of age diagnosed between january 2001 and june 2012 . all cases of ichs were confirmed using computed tomography ( ct ) or magnetic resonance imaging ( mri ) . traumatic ich , insufficient medical information , previously diagnosed intracranial tumors , arteriovenous malformation ( avm ) , and primary subarachnoid hemorrhage were exclusion factors for this study . for each patient , we analyzed the following prognostic factors : smoking history ( the consumption of 5 cigarettes at least 2 days per week over a period of 12 months ) , alcohol use ( the ingestion of 100 g / d or more every day for at least 20 days per month during the last 2 months or acute alcoholic intoxication during the 24 hours prior to the attack ) , previously diagnosed underlying disease such as hypertension or diabetes mellitus , the use of antihypertensive or antidiabetic agents , high serum cholesterol ( fasting cholesterol values 200 mg / dl at admission ) or low serum cholesterol ( < 150 mg / dl ) , and bleeding tendency ( prolongation of prothrombin time > 14.3 seconds or activated partial thromboplastin time > 43.5 seconds ) . the hematoma volume was estimated via the analysis of ct scans using the abc/2 method.12 ) the hematoma site was denoted by lobe ( frontal , parietal , temporal or occipital ) , thalamus , basal ganglia , cerebellum , or brain stem . hypertensive ich was defined as hemorrhage into the brain parenchyma in the absence of causal trauma or a structural disease process on a macroscopic level , such as a tumor , aneurysm , vascular malformation , or arteriovenous fistula , in patients treated for hypertension ( or who were previously diagnosed with hypertension ) , as well as the absence of another cause of ich . avm , venous angioma and other vascular malformations were confirmed using ct angiography , conventional cerebral angiography , or magnetic resonance angiography . if there was no explanatory underlying disease or abnormal structural lesion in the image workup , the ich was defined as cryptogenic ich . patients with an ich volume greater than 30 ml in the basal ganglia or thalamus received surgical treatment , with the exception of 4 patients . one patient was a high surgical risk because of disseminating intravascular coagulopathy associated with acute myelocytic leukemia , and the others showed no definite neurological deterioration and tolerated the event with conservative management . for the patients with an ich volume of less than 30 ml , conservative management was indicated . however , for the patients with an ich volume of less than 30 ml , if progressive acute hydrocephalus due to intraventricular hemorrhage and neurological deterioration was present , external ventricular drainage was performed . in cerebellar ich , regardless of the hemorrhage volume , a decompressive craniectomy with hematoma removal was performed if the patient showed progressive neurological deterioration . a good outcome was defined as a gos score 4 , and a poor outcome was defined as a gos score < 4 . fisher 's exact test was applied to assess statistical significance , and null hypotheses of no difference were rejected if p values were less than 0.05 . the mean age was 33.21 6.42 years ( range 15 - 40 years ) , and there were 11 females and 28 males . the characteristics of the study subjects by outcome at discharge and 6 months after discharge are described in table 1 . we assessed outcomes by reviewing the gos of medical record at discharge and 6 months after discharge . based on the outcomes at discharge and 6 months after discharge , smoking history was significantly associated with prognosis . alcohol use , previously diagnosed hypertension and bleeding tendency were not statistically significantly associated with outcome . all of the patients with cholesterol levels less than 200 mg / dl had good outcomes at 6 months after discharge ; this finding was statistically significant ( p = 0.047 ) . patients with an initial systolic blood pressure ( sbp ) < 160 mmhg had better outcomes ( good outcomes in 65.4% of patients ) , while those patients with an sbp 160 mmhg had poorer prognoses ( poor outcomes in 69.2% of patients ) ; this result was statistically significant ( p = 0.044 ) . the level of diastolic blood pressure ( dbp ) upon admission showed similar results ( < 90 mmhg : 66.7% experienced good outcomes ; 90 mmhg : 57.1% experienced poor outcomes ) although , these results were not significant . the ich location , as well as the presence or absence of intraventricular hemorrhage ( ivh ) , had no significant effect on outcome ( p = 0.451 ) . there were also no statistically significant findings associated with ich direction ( left or right ) . in particular , patients with gcs 8 had a higher proportion of poor outcomes , compared to patients with gcs > 8 ; this finding was statistically significant ( p = 0.02 via fisher 's exact test ) . variations in the volume of the hematoma showed no significant difference ( p = 0.051 ) in gcs score . lobar hemorrhage was the most common location of ich in young adults , and there were no statistically significant findings associated with hematoma location ( table 3 ) . in our institution , 280 patients were diagnosed with ich during the investigation period ; of these patients , 39 ( 13.9 % ) were aged 40 years . in western countries , only 3 - 5% of ich patients were younger than 45 years.14)24 ) the distribution of ich reflects the characteristics of the population ( ethnic / racial groups and the criteria of a young adult ) although these studies were not standardized.4 ) in this study , 11 ( 28.2% ) of the patients diagnosed with ich had also been diagnosed with hypertension . in young adults , hypertension is a primary cause of ich , and this hypertension / ich ratio varies from 11 to 15%.2)3)23 ) as with other published literature , our study showed that a poor prognosis is more likely in patients with hypercholesterolemia . many studies describe serum cholesterol level and smoking history as risk factors for ich.2)18)20)22)23 ) in our study , the serum cholesterol level and smoking history were also prognostic factors . according to ruiz - sandoval and coworkers,18 ) avm contributes to 33% of ich cases , cavernous angioma contributed to 16% of cases , and hypertension contributed to 11% of cases ( all under the age of 40 years ) , similar to our study results . however , among the elderly , hypertension was the most common cause of ich , and the putamen was the most common location.11)20 ) our results indicate that the most common causes of ich were cryptogenic cases ( n = 16 , 41.03% ) and the most common structural etiology of ich was avm . we found that an initial sbp greater than 160 mmhg indicated a poor prognosis , and patients with a sbp less than 160 mmhg were more likely to have a good prognosis . some authors reported a low ( < 130 mmhg ) or high ( 200 mmhg ) initial sbp as a prognostic factor that was independently associated with mortality.9 ) smoking , alcohol , and bleeding tendency in younger patients were determined to be prognostic factors of ich.13)18 ) regarding the serum cholesterol , the patients with levels < 200 mg / dl ( 63.3% ) showed a good prognosis , and patients with levels 200 mg / dl ( 77.8% ) showed a poor prognosis . six months after discharge , this difference was statistically significant and suggests that serum cholesterol levels can be a prognostic factor , as seen in the literature.1 ) ruiz - sandoval and coworkers19 ) reported that hypertension and hypercholesterolemia are 2 main risk factors for ich . some authors reported that hypocholesterolemia can cause ich and that the interaction between high diastolic blood pressure and low cholesterol levels weakens the endothelium of the intracerebral arteries , resulting in a hemorrhagic stroke in the presence of hypertension.10 ) however , in that study , the association between low cholesterol levels and the prognosis was not clearly presented . a study to investigate the association between serum low - density lipoprotein cholesterol ( ldl - c ) and mortality in ich found that lower ldl - c levels were associated with higher mortality rates.17 ) in our study , 7 patients ( 58.3% ) with ldl - c levels < 150 mg / dl had good outcomes and statistically significant improvements 6 months after discharge . however , the sample size was limited in our study , age was limited to 40 years , and cholesterol was the only factor used to assess the outcome via lipid profile . a statistically significant difference in outcomes ( p = 0.034 by the t - test ) by the initial gcs score was observed . a score of 8 or less predicted a higher risk of death within 2 days ( odds ratio , or = 3.9).7 ) among patients with a pre - hospital neurological decline , the gcs score was lower by an average of 6 points , and the mortality rate was 75%.15 ) the usefulness of surgical treatment of ich is still under debate.8 ) in this study , there was no statistically significant difference in prognosis between patients who did or did not receive surgical treatment ( p = 0.109 ) . ich is rare in young adults aged 40 years ; thus , the existing large - scale studies are not sufficient for studying either etiology or prognosis in this group of patients . due to the small number of patients and limited study period , more accurate and reliable outcome results could be obtained be comparative analysis of across several institutions and groups in the regional community . in this study , smoking , serum cholesterol , sbp on admission , and the initial gcs were significant prognostic factors . avm was the most common structural etiology of non - traumatic spontaneous ich in the patients aged 40 years . eight points or more on the initial gcs , sbp < 160 mmhg , serum cholesterol < 200 mg / dl , and low initial sbp indicated a good prognosis . a history of smoking was associated with a good prognosis in this study , although , the initial gcs score influenced this result . our study had some limitations , including its retrospective nature , its involvement of a single institution , the small number of cases , and the relatively short follow - up periods . thus , longer follow - up periods in prospective , multi - institutional studies that include large numbers of patients are necessary to better understand the prognosis of ich in young adults .

objectivespontaneous intracerebral hemorrhage ( ich ) in young adults is rare . the purpose of this study was to investigate causes , sites and other factors affecting the prognosis of ich in young adults aged 40 years.methodswe reviewed 39 consecutive patients diagnosed with spontaneous ich between january 2001 and june 2012 . patients with primary subarachnoid hemorrhage , previously diagnosed brain tumor bleeding , or vascular malformation were excluded . we analyzed the differences in prognostic factors such as hemorrhage location and vascular structural etiology . the outcome was measured using the glasgow outcome scale ( gos ) , and a good outcome was defined as a score of 4 or more.resultswe retrospectively evaluated 39 patients ( mean age , 33 years ; sd = 6.4 , range 17 to 40 years ) . the most common structural etiology was arteriovenous malformation . a statistically significantly higher proportion of patients with good outcomes had a lower initial systolic blood pressure ( sbp 160 mmhg , p = 0.036 ) , a higher initial glasgow coma scale ( gcs ) ( 9 or more , p = 0.034 ) , lower cholesterol levels ( < 200 mg / dl , p = 0.036 ) , and smoking history ( at discharge , p = 0.008 ; 6 months after discharge , p = 0.019).conclusionin this study , cryptogenic ich was the leading cause of spontaneous ich . a gcs score of 9 or more on admission , a lower serum cholesterol level ( < 200 mg / dl ) , and a lower sbp ( < 160 mmhg ) predicted a good outcome .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION

given that almost three quarters of older adults lack decision - making capacity when urgent choices about life - sustaining treatment need to be made , older adults have long been encouraged by nurses and other health care providers to express their wishes for health care while they are healthy enough to meaningfully participate in treatment decision - making . advance care planning has been recently promoted by the centers for disease control and prevention as a process contributing to overall public health through its focus on supporting the individuals ' health care choices and preventing unnecessary suffering . widespread social marketing of advance care planning has made many excellent online and print resources available to the public [ 24 ] . although advance care planning is now seen as an iterative process that includes the way in which people think about and communicate their values and preferences so that they may receive the health care they desire in the case of life - threatening illness , much of the extant research in this area has focused upon the completion of written advance care plans . using a population - based approach , this study addressed the research question how do community - dwelling adults aged 55 years and older plan for serious illness , either formally ( e.g. , by designating a substitute decision maker and preparing written advance care plans ) or informally ( e.g. , by discussing states of health considered to be unacceptable to continue living or desired medical care in the event of serious illness ) ? the overall objective of this study was to identify the associations between formal and informal planning for serious illness and key sociodemographic , health , and knowledge variables . based on a review of current literature on advance care planning , it was hypothesized that sociodemographic variables ( including age , gender , urban or rural location , education level , and income level ) , values ( importance of planning for future care ) , and self - reported knowledge of advance care planning would be statistically significant predictors of behaviors relating to planning for serious illness . it is estimated that between 18% and 36% of all american adults in the general public have completed an advance directive . rates of advance directive completion amongst distinct subpopulations , such as persons with terminal illnesses and older adults , have been reported to range from 15% to 84.9% [ 1 , 713 ] . completion of an advance directive is associated with a wide range of factors , including older age , greater disease burden , type and acuity of condition , white race , higher socioeconomic status , knowledge about advance directives or end - of - life treatment options , a positive attitude toward end - of - life discussions , a long - standing relationship with a primary care physician , and whether the patient 's primary care physician has an advance directive . while the clinical utility of advance directives has been rightfully questioned [ 1420 ] and the uptake by intended consumers less than hoped in spite of widely available resources , support for the overall process of people considering and sharing key values and preferences for health care in the face of serious illness remains strong . social marketing campaigns have increasingly focused public attention on promoting dialogue , rather than completing forms , as a means of supporting the preferences and autonomy of individuals who may not be able to communicate his or her wishes for care in the future . a number of studies have examined the extent to which discussions related to advance care planning are taking place , as well as the outcomes of these dialogues . between 75% and 91% of participants over age 65 in the canadian study of health and aging had considered who might make health decisions for them if they were unable to do this for themselves . the same study revealed that between 46% and 69% had discussed their preferences for end - of - life care with someone else . the benefits of having discussed preferences for future care were noted in a study of patients with advanced cancer by wright and colleagues and encompassed less aggressive medical care , including lower rates of ventilation ( adjusted or 0.26 ; 95% ci 0.080.83 ) , resuscitation ( adjusted or 0.16 95% ci 0.030.80 ) , icu admission ( adjusted or 0.35 ; 95% ci 0.140.90 ) , and earlier hospice admission ( adjusted or 3.37 95% ci 1.1210.13 ) , as well as better patient quality of life and improved bereavement adjustment . discussions early in the trajectory of cancer have also recently been demonstrated to be associated with less aggressive treatment and greater use of hospice care . despite these positive outcomes , many people remain skeptical about the benefits of advance care planning , fuelled in part by society 's denial of the inevitability of death [ 24 , 25 ] and death 's sequestration from mainstream society . the choice not to engage in advance care planning is complex and highly individual but may include any one or more of the following reasons : believing that one 's health is good and it is not necessary ; believing that advance care planning is only for the terminally ill , elderly , or infirm ; challenges discussing death ; not being ready ; lack of knowledge ; difficulty completing the form ; reluctance to broach the subject with the physician ; fear of being a burden ; incompatibility with cultural and spiritual traditions ; preference to delegate treatment decision - making to family or others ; lack of confidence that a written document would change the course of treatment received [ 15 , 23 , 2730 ] . this study was conducted in april , 2012 , within the province of saskatchewan , a province located in western canada with a population just over one million people . one third of the province 's population is considered rural , with the remainder divided between two urban centres . the sample of 238 community dwelling older adults over the age 55 years represents a subgroup of the entire sample of 827 individuals obtained for a larger project , who were stratified by age , region , and sex to be representative of the population of the province . the entire sample was randomly selected from a pool of volunteers who had agreed to participate in online commercial market surveys ( saskwatch research ) . participants provided consent for the data to be used in subsequent presentations and publications . the survey was comprised of structured , closed - ended items salient to planning for serious illness care . demographic data included age ; sex ; personal income ; education ; residence ( urban or rural ) . respondents were asked to identify the number and type of health conditions with which they lived from a list of common illnesses , as well as to respond to the following question : how important do you think it is to plan for medical care at the end - of - life ? ( not at all important , somewhat important , important , or very important ) . respondents were asked to indicate their level of knowledge about advance care planning and living wills on a three - point scale ( not at all familiar ; some basic understanding ; fairly or very good understanding ) . those who reported a written living will or advance directive were also asked to identify sources of help received with preparing this document ( consultation with lawyer ; consultation with lawyer and family ; consultation with family ; consultation with someone else ; prepared by myself ) . statistical analysis was completed using spss 19.0 . given that an age of 65 years has been recognized as the point at which many canadians retire from paid employment , respondents were divided into two groups : those 65 and younger and those older than 65 years . comparisons between the groups were completed using the kruskal - wallis test ( with multiple mann - whitney tests adjusted with bonferroni corrections for post hoc analysis ) and chi - square tests of proportion where appropriate . in order to determine the characteristics influencing outcome behaviors variables ( discussions of unacceptable states of health ; discussion of wishes for treatment , designation of a substitute decision maker ; preparation of a written directive ) , binary logistic regression was conducted . the strength of association was measured by the odds ratio ( or ) and 95% confidence interval ( ci ) . table 1 compares the demographic and health characteristics of the sample between respondents aged 5564 years ( younger group ) and those who were 65 years and older ( older group ) . respondents ranged in age from 55 to 88 years . the majority ( 82.1% ) of all respondents had education beyond completion of high school . a higher proportion of the older group reported incomes of less than $ 60,000 than the younger group , while the opposite was true for incomes above $ 60,000 . participants residing outside of primary urban centres ( populations > 250,000 ) comprised 58.6% of the total sample . a significantly higher ( p < 0.001 ) proportion of the older group reported four or more health conditions compared to the younger group , although the proportions were similar between the groups for those reporting one to three health conditions . table 2 compares the responses of the younger and older age groups in terms of values , knowledge , and behaviors related to planning for the end of life . the majority of respondents indicated they felt it was important or very important to plan for medical care in the event of serious illness ( 78.4% ) and to plan for one 's own funeral ( 62.2% ) . while 61.5% of respondents reported a good understanding of the term living will , substantially fewer indicated they had a good understanding of the term advance care plan . approximately half of all respondents had discussed states of health in which they would find it unacceptable to live with someone close to them in the past year . one - third of those aged 65 and older reported they had a written directive compared to 20.5% of adults below age 65 . respondents in the older group were significantly more likely ( p < 0.05 ) to have discussed wishes for treatment , designated a substitute decision maker , and to have prepared either an advance care plan or living will . respondents without a written advance care plan were asked to identify reasons for not preparing this document . the majority ( 60.0% ) indicated they had not considered this yet , while 21.2% suggested that their families would make decisions about future health care for them and 18.2% indicated that their families together with their physician would decide . for the 72 respondents who had prepared a written advance care plan , the most common source of assistance to prepare the document was a lawyer ( 50% ) . a third of respondents cited families as a source of assistance , while 22.2% indicated they had completed the plan by themselves . few ( 4.2% ) respondents had the assistance of a health care professional in writing the directive . table 3 displays the adjusted association between the outcome variables ( discussions about treatment wishes or unacceptable states of health ; designation of a substitute decision maker ; preparation of a written advance care plan ) and the hypothesized predictor variables . after adjustment for all the variables listed in table 3 , women were twice as likely as men ( o.r . = 2.05 , 95% ci 1.163.62 ) to have discussed treatment wishes but were similar to men in terms of reporting discussion regarding unacceptable conditions , designating a substitute decision maker , or completing a written advance care plan . those over 65 years of age were significantly more likely than those between the ages of 55 and 65 to have designated a substitute decision maker ( o.r . the older group was not more likely to have completed a written advance care plan , although this association approached significance ( p = 0.06 ) . education , income , and the number of self - reported health conditions were not associated with any of the four planning behaviors under consideration . = 0.47 , 95% ci 0.250.86 ) than those from urban centres to have completed a written advance care plan . those who believed it was important to plan for care were more than twice as likely to have designated a substitute decision maker ( o.r . = 2.32 , 95% ci 1.154.70 ) and more than four times as likely to have completed a written advance care plan ( o.r . respondents who reported a good understanding of advance care planning had a significantly greater likelihood of engaging in all planning behaviors : discussion of treatment wishes ( o.r . = 3.45 , 95% ci 1.876.34 ) ; discussion of states of health they would find unacceptable to live with ( o.r . = 5.62 , 95% ci 2.9210.92 ) ; designating a substitute decision maker ( o.r . = 2.49 , 95% ci 1.876.34 ) ; completing a written advance care plan ( o.r . the findings of this study demonstrate that neither formal nor informal planning for serious illness can yet be considered widespread amongst community - dwelling adults aged 55 and older . formal planning for serious illness , in the form of designating substitute decision makers and preparing advance care plans , was reported by fewer than half of the respondents in this study . these proportions are similar to those reported in other studies [ 1 , 713 ] . the proportion of respondents who engaged in informal planning for serious illness , such as conversations about treatment preferences and unacceptable health conditions , was only marginally higher , at 50% and 60% . in examining the demographic and health variables associated with planning behaviors , women were twice as likely as men to have discussed treatment wishes with someone close to them , but just as likely as men to have discussed unacceptable states of health , to have designated a substitute decision maker , or to have prepared a written advance care plan . similar findings were reported by garrett et al . , who reported women to be more likely to consider having a conversation about end - of - life wishes , but found no sex differences with respect to preparing an advance care plan . in the adjusted model , there were no associations between age and informal planning behaviors . older age proved significant only for the formal planning behavior of having designated a substitute decision maker , although the association between older age and having prepared an advance care plan approached significance ( p = 0.06 ) . given the formal nature of both these activities and the fact that half of the advance care plans were completed with the assistance of lawyers , it may be that older adults are more willing to consider planning for serious illness under the umbrella of estate planning than health . interestingly , the model found no associations between the number of health conditions reported by respondents and planning behaviors . it may be that an increasing number of health conditions are an expected sequela of the aging process and insufficient in and of themselves to trigger concern that planning for serious illness is warranted . the reason most frequently cited by respondents in this study for not preparing an advance care plan was that they those individuals may have been in the precontemplation phase , described in the transtheoretical model , and were not ready to engage in formal planning behaviors . the decision to participate in planning for serious illness activities would , according to this model , mean that the benefits must outweigh the the costs associated with the uncomfortable recognition and acceptance that one is personally vulnerable to poor health or death in the foreseeable future may have been such that respondents were not yet ready to engage in planning behaviors . if planning for serious illness is indeed a way to promote autonomy that is valued by older adults , it is worthwhile to further consider the factors that enhance readiness to participate in planning behaviors . a significant proportion ( 21.6% ) of respondents those who did not consider planning to be important were significantly less likely to have designated a substitute decision maker or have completed a written advance plan . while governments and health care providers continue to promulgate the benefits of planning for serious illness , it is important to bear in mind that a significant proportion of our patients may not share this value . nurses who seek to educate patients about strategies to plan for future medical care must first take the time to appraise whether , in fact , a given individual believes these activities to be of value . understanding the experiences that shape the individual 's perspective on advance care planning is critical to a truly patient - centred approach . knowledge about advance care planning was consistently and independently associated with all types of planning for serious illness behaviors ( discussions about treatment wishes or unacceptable states of health ; designation of a substitute decision maker ; preparation of a written advance care plan ) . the fact that respondents from rural areas , however , were only half as likely as those from urban areas to have an advance care plan suggests that access to information about planning for serious illness may , in fact , be a key driver for planning behavior . while the survey did not evaluate the access respondents had to education about advance care planning , access to health services is often limited in rural settings ( cihi ) . it is worthwhile to bear in mind , however , that the association between knowledge and behavior does not demonstrate causality , whereby more education about advance care planning leads directly to greater participation in planning . individuals who were already receptive to the importance of planning for serious illness may have availed themselves of opportunities to educate themselves about this process . teachable moments and providing support and education to those who demonstrate an interest and willingness to learn more about ways to best plan for future serious illness . tailoring interventions to the individual 's level of readiness is referred to as stage - matching within the transtheoretical model . while this survey was representative of the population of the province in terms of sex and region , the sample did not include the entire population of the province . stratification by socioeconomic status or additional variables was not possible , although level of education may reflect socioeconomic status to some extent . random selection occurred from the pool of those individuals who had agreed to participate in online surveys conducted by saskwatch research , and thus selection bias may have been present . education of the patients with respect to the process of advance care planning has been recognized as a public health issue in which nurses may make a significant contribution . as advocates for supporting the autonomy of older adults , however , nurses who engage in practice related to advance care planning must keep in mind that , for almost one quarter of respondents in this study , planning for serious illness was not considered important . that some individuals do not hold planning as a value is an important consideration when planning nursing interventions designed to educate and foster participation in advance care planning , highlighting the need to match interventions to levels of readiness .

older adults have long been encouraged to maintain their autonomy by expressing their wishes for health care before they become too ill to meaningfully participate in decision making . this study explored the manner in which community - dwelling adults aged 55 and older plan for serious illness . an online survey was conducted within the province of saskatchewan , canada , with 283 adults ranging in age from 55 to 88 years . planning for future medical care was important for the majority ( 78.4% ) of respondents , although only 25.4% possessed a written advance care plan and 41.5% had designated a substitute decision maker . sixty percent of respondents reported conversations about their treatment wishes ; nearly half had discussed unacceptable states of health . associations between key predictor variables and planning behaviors ( discussions about treatment wishes or unacceptable states of health ; designation of a substitute decision maker ; preparation of a written advance care plan ) were assessed using binary logistic regression . after controlling for all predictor variables , self - reported knowledge about advance care planning was the key variable significantly associated with all four planning behaviors . the efforts of nurses to educate older adults regarding the process of advance care planning can play an important role in enhancing autonomy .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Limitations 6. Nursing Implications

lung cancer is the leading cause of cancer death in most countries . although much effort has been made over the last few decades to improve the survival of lung cancer patients , overall five - year survival rates remain unsatisfactorily low ( 14% in the u.s.a . ) brain metastasis ( bm ) is a major cause of the low survival rate and poor quality of life of cancer patients . the prognosis for patients with bm who go untreated is extremely poor ( about one month following diagnosis ) ( 2 ) , whereas patients with non - small cell lung cancer ( nsclc ) who are treated with radiation therapy survive for about 8 months ( 3 ) . the incidence of bm in patients with locally advanced nsclc is 12 - 28% over the entire course of the disease . in most cases of nsclc , bm are diagnosed only after the development of symptoms , which is partly responsible for the poor prognosis of patients with nsclc . in patients with small cell lung cancer ( sclc ) , the incidence of detectable bm at the time of initial diagnosis is 10 - 14% ; the cumulative incidence at three years for patients that are in complete remission and that have few signs of disease is 59% ( 4 ) . for patients with nsclc , the incidence of bm at the time of initial diagnosis is about 6% according to a prospective study in which computerized axial tomography ( ct ) was used ( 5 ) . the prognoses of patients with symptomatic bm are substantially worse than those in which the metastases are asymptomatic ( 6 - 8 ) . clearly , improvements in systemic and local therapies can improve the long - term survival of cancer patients , which means that early and accurate diagnosis of bm has become crucial to improving the quality of life and poor survival rates of cancer patients . the use of imaging to detect extrathoracic metastasis , particularly bm , at the time of initial staging in asymptomatic patients is the subject of debate ( 8 - 10 ) . imaging is usually recommended in patients who form part of a population in which the overall incidence of bm is particularly high , such as in cases with adenocarcinomas ( 6 , 11 - 13 ) . of the different imaging methods , mri is more sensitive than ct and is the method of choice with which to screen for intracranial metastasis ( 12 , 14 - 17 ) . however , a major drawback to the routine use of brain mri is its high cost . therefore , we carried out the modified standard mri or limited mri procedure to detect bm at lower cost and without loss of sensitivity ( 18 ) . in our pilot study limited mri showed no difference with conventional mri for detecting bm ( sensitivity 97.67% , specificity 100% ) ( 18 ) . the cost of the modified mri was us$ 180 , which is substantially lower than the cost of conventional brain mri ( us$ 480 ) . based on these results , we conducted the present study to screen for bm at the time of initial staging and validated the clinical significance of the early detection of bm using limited brain mri . the results have implications for the quality of life and survival of patients with nsclc . between may , 2001 and april , 2002 , 183 patients were newly diagnosed with primary nsclc at chungnam national university hospital . all patients underwent the following initial staging procedures : clinical examination ; routine blood tests ; chest radiography ; chest ct ( including liver and adrenal glands ) ; whole - body bone scan ; and limited brain mri . the limited brain mri was modified from conventional mri by omitting t2-weighted axial , proton density axial , and contrast- enhanced t1-weighted images ( table 1 ) to decrease the cost from us$ 480 to us$ 180 without any decrease in sensitivity ( 18 ) . as a control group , we used 131 patients who were newly diagnosed with nsclc between may , 2000 and april , 2001 . control patients underwent the initial staging procedures described above , except that a brain mri was carried out only in cases that exhibited neurologic symptoms related to bm ( e.g. headaches , seizures , or unexplained weakness ) at the time of initial diagnosis . the incidence of bm in the initial staging of patients with primary nsclc and the incidence of metastases to other systemic sites were compared . we compared the clinically relevant characteristics of both groups ( age , sex , cell type , performance status , clinical stage , and incidence of brain metastasis ) . patients were followed up until the 30th of april , 2003 ( i.e. , a minimum period of one year ) and we analyzed the clinical significance of early detection of bm and the relationships among the various prognostic factors . differences between the two groups were evaluated for statistical significance using a chi - squared test . survival data were calculated using the kaplan - meier method and statistical differences were confirmed by means of the log - rank test . there were no statistically significant differences between the groups with respect to gender , age , performance status , tumor subtype , or clinical stage ( excluding brain metastasis ) ( table 2 ) . bm was detected in 38 of 183 ( 20.8% ) and 6 of 131 ( 4.6% ) patients in the study and control groups , respectively ( p<0.001 ) . twenty - three of 139 ( 16.5% ) males and 15 of 44 ( 34.1% ) females had bm . patients with non - squamous - type cells ( 32.6% ) had a higher frequency of bm than those with squamous - type cells ( 8.8% ) . during the follow - up period , subsequent bm developed in 3 of study group , and 9 of control group . in these patients , 1 of study group and 5 of control group had synchronous bm ( within 6 months after initial diagnosis ) ( table 3 ) . eighteen patients ( 47.4% ) had a single focus of metastasis within the brain , 17 patients ( 44.7% ) had multiple intracranial foci , and 3 patients ( 7.9% ) had a leptomeningeal pattern of metastasis ( table 4 ) . only 7 of 38 patients ( 18.4% ) in which bm was observed using limited mri also exhibited clinical symptoms related to bm ( table 4 ) . in 15 of 38 patients ( 39.5% ) in which bm was observed using limited mri , the brain was the only site of systemic metastasis , and these 15 patients were upstaged to stage iv based solely on the diagnosis of bm . this number included 11 of 68 patients ( 15.9% ) that were considered initially to be resectable surgically in the absence of bm . two stage i , three stage ii , six stage iiia , and four stage iiib patients were upstaged to stage iv ( table 5 ) . for the survival analysis , 10 of 183 patients in the study group were excluded due to insufficient follow - up data . the survival analysis was carried out on 173 patients . the overall median survival time and one - year survival rate of patients with bm were 43 weeks and 39.5% and 31 weeks and 16.7% for the study and control groups , respectively . the number of patients in the control group was too small to determine whether there were any statistically significant differences between the two groups . the one - year survival rate and median survival time of patients who had bm ( 46.7% and 49 weeks , respectively ) was greater only than patients who had multiple systemic metastases that included the brain ( 34.8% and 27 weeks , respectively ) . eighteen patients had between one and three metastatic nodules in the brain that could be accessed for stereotactic radiosurgery and 20 patients ( including three with leptomeningeal involvement ) had multiple ( > 3 nodules ) foci within the brain . the one - year survival rate and median survival time for the former and latter type of patient was 44.4% and 45 weeks and 35.0% and 24 weeks , respectively . of the 38 patients who had bm and were strongly recommended to receive radiation therapy to the brain with systemic chemotherapy , 14 were treated with whole brain irradiation only and 23 were treated with both radiation and chemotherapy . the one - year survival rate and median survival time of irradiation- treated patients was 21.4% and 21 weeks , respectively , and the one - year survival rate and median survival time of those treated with both radiation and chemotherapy was 52.2% and 49 weeks , respectively . the one - year survival rate and median survival time for symptomatic vs. asymptomatic patients was 42.9% and 45 weeks and 38.7% and 43 weeks , respectively ( table 6 ) . the one - year survival rate and median survival time overall for stage iv patients were 36.1% and 37 weeks , respectively . the median survival of 12 patients in whom bm was diagnosed during the follow - up treatment period was 8 weeks . even though locoregional control rates of 50% and higher have been achieved after neoadjuvant chemoradiotherapy and definitive resection ( multimodal therapy ) in patients with locally advanced nsclc , the brain is the most frequent site of initial treatment failure and is the site of approximately one third of all relapses that occur ( 11 , 13 , 19 , 20 ) . therefore , treatment strategies that reduce the risk of bm are needed to optimize the efficacy of multimodal therapy and to improve survival . between 25 and 30% of all patients with lung cancer develop bm at some stage , and this incidence is likely to increase if survival is prolonged by means of aggressive multi - modal treatment . the increasing frequency of treatment failure , the development of new imaging techniques and treatments , as well as the reports of prolonged survival of patients that have received aggressive treatment , suggest that approaches to treating patients who have bm should be reassessed . specifically , novel treatment paradigms should be developed to ensure that such patients receive optimal therapeutic intervention . to this end , prophylactic cranial irradiation in nsclc and sclc patients has been introduced and has led to several reports of positive outcomes , although a large - scale study is needed to confirm this ( 11 , 13 , 21 ) . an alternative means to the same end is the introduction of brain imaging when the initial workup is carried out . this approach would facilitate the early detection of bm and promote the timely application of appropriate treatments , which would improve the survival rates of cancer patients . however , such early imaging should be considered only if it is practicable and available at a reasonable cost . considering each of the aforementioned factors , we designed the present study to assess the clinical effectiveness of using limited brain imaging at the time of initial screening of lung cancer patients . the rate of bm in patients with locally advanced nsclc has been estimated previously to be between 17 and 32% ( median : 22% ) with a median time - to - brain recurrence of 7.5 - 9.3 months ( 8 , 11 , 13 ) . it has been shown previously that most recurrences of metastases within the central nervous system occur within 2 yr of the initial diagnosis ( 13 ) . furthermore , bm is a direct cause of death in between one third and one half of affected patients ( 12 ) . the incidence of bm in the initial screening of patients with primary lung cancer has been reported to be between 12 and 18% ( 22 , 23 ) . in the present study , we suspect that this slightly higher incidence was the result of using the limited brain mri procedure , which is more sensitive than brain ct ( 5 , 17 ) . there are several risk factors that are related to bm , including non - squamous histological characteristics ( particularly adenocarcinomas ) , bulky lymph nodes in the mediastinum , younger age , stage iiib , etc . our data supported the same trend and , in addition , suggested that the incidence of such risk factors is greater in females than in males . specifically , in the present study , the incidence of bm and non - squamous tumors in females was 30.6 and 26.2% , respectively , which was statistically higher than in males ( 15.5 and 8.8% , respectively ) . the incidence of bm in all patients with adenocarcinomas was 33.3% , whereas the incidence in females with adenocarcinomas was 50% . in clinical stage iv patients , the brain was the second most common site of metastasis ( 38/87 patients or 43.7% ) , following bone ( 39/87 , 44.8% ) , and was a more common site of metastasis than lung , liver , and the adrenal glands . although neurological symptoms have been reported to be associated with a poor prognosis ( 7 , 8 , 14 ) , the survival rates in the present study were unrelated to the presence of clinical symptoms . we found that patients who had a single focus of bm , and isolated bm , and who were treated with chemotherapy had better survival , as reported by others . the survival rate of patients who had bm was equivalent to those who did not have any clinical symptoms of bm ; this was due to early treatment using whole brain radiotherapy , stereotactic radiosurgery , and chemotherapy . reported that the use of chemotherapy to control not only bm but also extracranial lesions prolonged the survival of patients with bm due to nsclc ( 26 ) . in the present study , the survival rates of patients who had bm and who received both chemotherapy and radiotherapy were similar to those of patients in stage iiib ( data not shown ) , which would appear to support our hypothesis that early detection of bm and subsequent application of appropriate treatment may improve overall survival . in the present study , 15 patients ( 15/111 , 13.5% ) were upstaged from clinical stage i ( n=2 ) , ii ( n=3 ) , iiia ( n=6 ) , or iiib ( n=4 ) to stage iv , because of the presence of bm , including 11 patients ( 11/68 , 15.9% ) who had been considered initially to be suitable for surgical resection in the absence of evidence for the presence of bm . all of the aforementioned patients were treated with either radiotherapy alone ( n=7 ) or both radiotherapy and chemotherapy ( n=8 ) . the median survival time and one - year survival rate of the former and latter patients was 43 weeks and 28.6% and 72 weeks and 66.7% , respectively . that was greater than the survival rate of all patients with bm ( median survival time and one - year survival rate for radiotherapy only and radiotherapy plus chemotherapy for all patients with bm were 21 weeks and 21.4% , and 49 weeks and 52.2% , respectively ) ( table 6 ) . during a follow up period of at least one year , 12 patients ( 3 of study group and 5 of control group ) subsequently developed bm . all of these patients ( except one ) were treated with chemotherapy after the diagnosis of bm . initially , these patients responded to chemotherapy such that four exhibited partial responses , five exhibited a stable disease state , and three exhibited progression of the disease . the median time to relapse in treated patients ( n=11 ) was 38 weeks , which is similar to the time reported by ceresoli et al . these 11 patients were treated with radiation only without any further chemotherapy ; their median survival time after the diagnosis of bm was 8 weeks , which was shorter than that of patients in whom metastasis was detected during the initial screening and who were treated with radiation therapy alone ( 21 weeks ) . their overall median survival time and one - year survival rate ( after the diagnosis of lung cancer ) was 38 weeks and 27.3% , respectively , worse than the study group that had bm at the time of the initial screening ( 43 weeks and 39.5% ) and worse than patients who received whole - brain radiation and chemotherapy ( 49 weeks and 52.2% ) following the initial screening . nevertheless , these outcomes were slightly better than those of the control patients , who were diagnosed and treated for brain metastasis only upon the development of symptoms ( 31 weeks and 16.7% ) . in conclusion , limited brain mri appears to be a useful and cost - effective means by which to detect bm at the time of initial staging of lung cancer patients . such early detection of bm enabled patients to be treated immediately with radiotherapy and chemotherapy and led to improved rates of survival . consequently , we recommend that limited brain mri should be used as an initial screening procedure for the early detection of bm . this will allow lung cancer patients to receive the appropriate treatment in a timely manner , which should improve both the survival and quality of life of such patients .

the purpose of this prospective study was to determine whether using magnetic resonance imaging ( mri ) for early screening for brain metastases ( bm ) can improve quality of life , survival in patients with non - small cell lung cancer ( nsclc ) . the study group comprised 183 patients newly diagnosed with nsclc . all patients underwent limited brain mri and routine workups . the control group comprised 131 patients with nsclc who underwent limited brain mri only if they had neurologic symptoms . the incidence of bm was 20.8% ( 38/183 ) in the study group and 4.6% ( 6/131 ) in the control group . the rate of upstaging based on the mri data was 13.5% ( 15/111 ) overall and 15.9% ( 11/69 ) in patients that had been considered initially to be resectable surgically . there was no significant difference in survival outcome between the groups . patients who had bm alone had a greater overall survival time ( 49 weeks ) than those who had multiple systemic metastases ( 27 weeks ; p=0.0307 ) . in conclusions , limited brain mri appears to be a useful , cost - effective method to screen for bm at the time of initial staging . and it may facilitate timely treatment of patients with nsclc and improve their survival and quality of life .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION

hyponatraemia is the most commonly encountered electrolyte abnormality in hospitalised patients particularly in the intensive care unit ( icu ) . in a post - surgical icu , the syndrome of inappropriate secretion of antidiuretic hormone ( siadh ) is a frequent cause for hyponatraemia . vaptans , a new group of vasopressin receptor antagonists , are increasingly being used for the treatment of euvolaemic , hypervolaemic forms of hyponatraemia . conivaptan is now gradually becoming the most popular drug among the vaptans for correction of this condition in the icu . this is administered as an initial intravenous ( iv ) bolus followed by an infusion , which may be continued for days . in this study , we aimed to assess the effectiveness of a single dose iv conivaptan for correction of hyponatraemia in post - operative icu patients . this was a prospective , randomised trial conducted in 40 patients from april 2013 to december 2014 . based on the key article , and due to the availability of limited number of cases satisfying the inclusion criteria , the study was restricted to 40 patients , with 20 in each group ( a and b ) . post - operative icu patients who had undergone major head and neck surgeries for malignancies with a serum sodium level of 130 meq / l and were symptomatic ( headache , nausea , vomiting , lethargy , confusion , disorientation ) were included in the study . patients were randomly allocated to one of the two groups ( a and b ) using computer generated sequence of random numbers . pre - operative nutritional status and hydration of the patients in both groups were assessed with body mass index ( bmi ) , haemoglobin , serum albumin and sodium levels , pre - operative heart rate ( hr ) and mean arterial pressures . perioperative normovolaemia was assessed by comparing pre - operative and post - operative urea levels in addition to intraoperative urine output per hour . the 24 h fluid balance of the patients 2 days and 1-day prior to commencement of study was also documented . when symptomatic , for correction of hyponatraemia , group a patients received iv conivaptan 20 mg over 30 min , whereas in group b infusion of 3% hypertonic saline was started as an infusion at the rate of 2030 ml / h , the exact dose being calculated using the formula , the rate of correction in serum sodium was aimed to be 68 meq / l in 24 h , 1214 meq / l in 72 h. no diuretics were concurrently administered and there was no fluid restriction . hypotension was defined as a reduction of > 30% of systolic bp from baseline value . serum sodium was checked at beginning of treatment , 12 , 24 , 48 and 72 h after initiation of treatment . the daily fluid balance was recorded at 24 , 48 and 72 h following initiation of treatment . the statistical software ibm spss version 20.0 was used for data analysis . for comparing american society of anesthesiolgists ( asa ) physical status , gender and thrombophlebitis , mann - whitney test was used to compare the pre - operative nutritional status and hydration , post - operative serum sodium values , fluid balance and volume of hypertonic saline used at different time periods . mean age , weight , bmi , distributions of sex and asa physical status among patients in group a and b were comparable [ tables 1 and 2 ] . pre - operative haemoglobin , serum albumin , sodium , hr and mean arterial pressures of both groups were also comparable [ table 2 ] . comparison of pre - operative and post - operative urea levels , intraoperative urine output as well as the post - operative daily fluid balance 2 days and 1-day prior to commencement of study did nt show any significant difference between the groups [ p < 0.05 , table 3 ] . comparison of demographics and asa physical status comparison of pre - operative nutritional status and hydration comparison of perioperative fluid volume status the serum sodium level before initiating treatment for hyponatraemia was also comparable between the groups . however , the subsequent sodium level measured at 12 , 24 and 48 h showed significantly high values in group a ( p < 0.05 ) . at 72 h the mean sodium value was high in group a but the difference was not statistically significant [ p = 0.159 , table 4 and figure 1 ] ] . comparison of serum sodium levels and daily fluid balance during study changes in sodium levels group a showed a significantly high fluid loss ( negative fluid balance ) on day 1 , 2 and 3 following initiation of treatment as compared to group b. in addition , it was also observed that on day 3 , the fluid balance in group b had become positive [ table 4 ] . the mean volume of hypertonic saline used in group b showed a steady decline from day 1 to 3 [ 430 92.3211.5 65 ml , figure 2 ] and only 13 patients required hypertonic saline on the third day . this could probably explain the reason for a positive fluid balance observed in group b on the third day . hypertonic saline requirement in group b though less number of patients in group a developed thrombophlebitis compared to group b ( 10 vs. 50% ) , the difference was not statistically significant ( p = 0.014 ) . dysregulation of arginine vasopressin ( avp ) frequently occurs in hospitalised patients resulting in hyponatraemia and is associated with increased morbidity and mortality . non - osmotic secretion of avp is the main pathophysiology in patients with euvolaemic , hypervolaemic hyponatraemia . acute onset hyponatraemia ( duration of < 48 h ) requires prompt correction , whereas chronic hyponatraemia should be corrected cautiously as there is a higher risk of development of central pontine myelinolysis following rapid correction . although earlier recommendations supported a correction of < 1012 mmol / l of sodium during the first 24 h of treatment and a target < 18mmol at the end of 48 hrs , the occurrence of osmotic demyelination even at these values has led to caution in the rates of correction . meq / l in 24 h , 1214 meq / l in 48 h and 1416 however , in symptomatic patients regardless of chronicity , a rapid rise of 46 meq / l is adequate . conivaptan is a non - selective vasopressin receptor antagonist available in an iv form and is approved by the food and drug administration to treat euvolaemic , hypervolaemic hyponatraemia . though conivaptan has high affinity for both v1a ( vascular ) and v2 ( renal ) receptors , affinity for v2 is tenfold higher and the aquaretic effect is pre - dominantly v2-associated . v1 receptor antagonism in vascular smooth muscle cells results in vasodilatation whereas antagonism of v2 receptors present in the renal collecting duct results in aquaresis . side effects of conivaptan include minimal to clinically significant fall in bp , postural hypotension and hypokalaemia . though in most patients rate of increase in sodium level is moderate , there are reports of rapid correction as fast as 14 meq / l within 4 h when conivaptan 4080 mg / day was used . even though no serious neurological sequelae had been reported because of rapid correction , possible development of osmotic demyelination syndrome should be kept in mind . other possible side effects include rebound hyponatraemia and renal damage due to significant hypovolaemia leading to hypotension and acute tubular necrosis . increased frequency of adverse cardiac events , atrial dysrhythmias and sepsis in the presence of congestive cardiac failure however , v2 receptor antagonists ( v2ra ) are now indicated selectively for the treatment of hyponatraemia caused by congestive cardiac failure . tolvaptan or other v2ra may be of benefit in selected patients with severe congestive symptoms . recent research indicates that conivaptan and tolvaptan are safe and not associated with increased morbidity such as renal failure and arrhythmias . conivaptan is usually started at a dose of 20 mg iv over 30 min , followed by an infusion of up to 20 mg over the next 24 h , given to a maximum of 4 days , closely monitoring serum sodium levels , bp and volume status . though conivaptan treatment is costlier , it involves a significantly lower volume of medication and possibly reduces icu stay . data from the study by galton et al . suggest that in non - hyponatraemic patients with severe traumatic brain injury , the use of single dose conivaptan is safe and may reduce intracranial pressure . a single bolus dose of 20 or 40 mg was found to be effective for the correction of acute hyponatraemia in neurologically injured patients and the effect of intermittent bolus dosing lasts up to 72 h. similar results were obtained in our study also though the study population was different . while giving an iv infusion , to avoid the risk of an accidental administration of a bolus dose , it is always preferable to administer the drug using an infusion pump . the advantages of using single dose conivaptan are that only a lesser amount of the drug is required , which will reduce the cost of treatment by avoidance of an infusion , which requires careful monitoring or an infusion pump for safe administration . the superiority of 3% hypertonic saline in raising the serum sodium concentration in hyponatraemia patients is well proven . it is less expensive but carries a risk of volume overload in oliguric or anuric patients . a drawback of hypertonic saline is that it has to be given as an infusion and the duration of drug administration may extend over many hours . in the present study , the pre - operative nutritional and hydration status of patients in both the groups were comparable and well within normal limits [ table 2 ] . perioperative normovolaemia was ensured as reflected by adequate urine output and comparable pre - operative and post - operative blood urea levels [ table 3 ] . the positive daily fluid balance observed 2 days prior to patients becoming symptomatic indicated the gradual onset of development of hyponatraemia [ table 3 ] . the main limitations of our study were a low sample size and the fact that urine osmolarity was not analysed . we did not statistically analyse the haemodynamic parameters during the period of the study , but there were no alterations in hr or bp during the 72 h study period . none of the patients developed hypokalaemia during our study , but another limitation was that this was again not statistically analysed . based on the results of our study we suggest that a single dose of conivaptan can be considered for the initial correction of hyponatraemia , with serial serum sodium level monitoring , rather than prescribing a bolus dose followed by an infusion . a single dose of conivaptan was found to be effective in increasing the serum sodium levels up to 72 h , with a significantly negative fluid balance , in post - operative icu patients following major head and neck surgeries .

background and aims : conivaptan , a vasopressin receptor antagonist , is commonly used for the treatment of euvolaemic , hypervolaemic hyponatraemia . usually , an intravenous ( iv ) bolus followed by infusion is administered for many days . we decided to assess the effectiveness of single dose conivaptan for correction of hyponatraemia in post - operative patients.methods:this was a prospective , randomised trial conducted in 40 symptomatic post - operative intensive care unit ( icu ) patients with a serum sodium level of 130 meq / l . group a patients received iv conivaptan 20 mg over 30 min , whereas in group b infusion of 3% hypertonic saline was started as an infusion at the rate of 2030 ml / h . serum sodium levels were measured at 12 , 24 , 48 and 72 h and the daily fluid balance was measured for 3 days . the chi - square test , wilcoxon signed rank test and mann - whitney tests were used as applicable.results:the serum sodium levels before initiating treatment were comparable between groups . however , subsequent sodium levels at 12 , 24 and 48 h showed significantly high values in group a. though at 72 h the mean sodium value was high in group a , it was not statistically significant . group a showed a significantly high fluid loss on day 1 , 2 and 3 . the mean volume of hypertonic saline required in group b showed a steady decline from day 1 to 3 and only 13 patients required hypertonic saline on the 3rd day.conclusion:single dose conivaptan is effective in increasing serum sodium levels in post - operative icu patients up to 72 h associated with a significant negative fluid balance .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION

the introduction and subsequent sustained global spread in the human population of influenza a viruses with a novel hemagglutinin ( ha ) subtype leads to an influenza pandemic . the novel influenza pandemics that occurred during the last century resulted in considerable mortality and morbidity . genetic investigations revealed that these pandemic strains were partially or entirely derived from viruses of avian origin [ 14 ] and that most of them first appeared in southern china , a hypothetical influenza epicenter . the avian h5n1 influenza virus that infected poultry and humans in hong kong in 1997 caused the death of 6 of 18 persons that were confirmed infected with this virus [ 68 ] . this virus was proposed to be a naturally occurring avian virus produced by the reassortment of h5n1 and h9n2 or h6n1 viruses [ 6 , 7 ] . h9n2 influenza viruses have become panzootic during the last decade and have been isolated from different types of terrestrial poultry worldwide [ 911 ] . two distinct lineages of h9n2 viruses , represented by the prototype a / duck / hong kong / y280/97 ( h9n2 ) ( dk / hk / y280/97 ) and a / quail / hong kong / g1/97 ( h9n2 ) ( qa / hk / g1/97 ) viruses , have become established in terrestrial poultry : dk / hk / y280/97-like viruses are found predominantly in chickens whereas qa / hk / g1/97-like viruses are most often found in quail [ 10 , 12 ] . the qa / hk / g1/97-like viruses are thought to have been involved in the generation of the highly pathogenic h5n1 virus first isolated in 1997 . h9n2 viruses of each lineage have been isolated from humans [ 13 , 14 ] , and the dk / hk / y280/97-like lineage also has been isolated from pigs in southern china . during 1997 , an h6n1 influenza a virus , a / teal / hong kong / w312/97 was isolated from a green - winged teal . subsequent characterization of the virus showed that seven of its eight gene segments were closely related to those of the h5n1 influenza viruses isolated from humans in 1997 [ 68 , 17 ] . later studies showed that a / teal / hong kong / w312/97-like viruses continued to circulate in the hong kong live - bird markets and that all h6n1 viruses isolated up until 2000 belonged to this lineage . similarly , the host range of these h6n1 viruses remained stable , with most isolates originating from quail and minor " poultry species such as chukka , pheasant , and guinea fowl but rarely originating from chickens . beginning in 2001 , the host range appeared to be changing , with an increase in the number of h6n1 viruses isolated from chicken and silky chicken . to address whether this phenomenon was real and , if so , whether it was due to a change in the h6n1 viruses circulating in the markets , we investigated the antigenic , genetic , and biologic characteristics of various h6 influenza viruses isolated from the hong kong live - bird markets between 2001 and 2003 . this paper describes the results of these studies and demonstrates an abrupt increase in the genetic diversity of h6 viruses in these markets . the viruses isolated in the hong kong region and the abbreviations used in this study are listed in table 1 . viruses present in fecal and cloacal samples from various bird species were grown in 10- to 11-day - old embryonated chicken eggs . the h6 virus antigens were compared by using the hemagglutination inhibition ( hi ) test as previously described in . all sera were pretreated with the receptor - destroying enzyme from vibrio cholerae ( denka seiken , tokyo ) to abolish interference by nonspecific serum inhibitors . the viruses , which came directly from infected allantoic fluid , were diluted to doses equivalent to four ha units for use in the tests . viral rna was extracted from infected allantoic fluid by using rneasy kits ( qiagen , valencia , ca ) according to the manufacturer 's instructions . reverse transcription and pcr were performed under standard conditions by using primers specific for the various genes of influenza viruses . sequencing reactions were performed by the staff of the hartwell center for bioinformatics and biotechnology at st . template dna was sequenced by using drhodamine dye terminator cycle sequencing ready reaction kits with amplitaq dna polymerase fs ( perkin - elmer applied biosystems , inc . [ pe / abi ] , foster city , ca ) and synthetic oligonucleotides . samples were subjected to electrophoresis , detection , and analysis on pe / abi model 3700 dna sequencing instruments . dna sequences were compiled and edited by using the lasergene sequence analysis software package ( dnastar , madison , wi ) . multiple sequence alignments were made by using clustal w , and phylogenetic trees were generated by using the neighbor - joining algorithm in the treeview version 1.6.6 software package ( available at http://taxonomy.zoology.gla.ac.uk/rod/treeview.html ) . nucleotide and amino acid sequences of other influenza viruses were obtained from the influenza sequence database of the los alamos national laboratory . the ability of the h6 viruses to hemagglutinate chicken , horse , and guinea pig erythrocytes was determined as previously described in . briefly , 32 ha units of virus ( as determined by binding to chicken erythrocytes ) were used in a hemagglutination assay with 0.5% ( v / v ) horse or guinea pig red blood cells . chicken and guinea pig erythrocytes contain both 2 - 3- and 2 - 6-linked sialic acid whereas those from horse contain almost exclusively 2 - 3 linkages , thereby indirectly inferring receptor preferences of the agglutinating viruses . we used 5-to 6-week - old japanese quail and white leghorn chickens to determine the 50% infectious doses ( qid50 and cid50 ) of a selection of h6 viruses . infectious allantoic fluid 10-fold serially diluted ( 1 : 10 to 1 : 10 ) was intranasally administered to three quails ( 0.2 ml inoculum ) or chickens ( 0.5 ml inoculum ) of each group . birds were examined daily for disease signs , and cloacal and tracheal swabs were taken 3 and 5 days after inoculation . tracheal swabs were placed in 0.5 ml of sample medium ( 50% glycerol in phosphate - buffered saline ( pbs ) that contained 1000 u / ml penicillin , 200 g / ml streptomycin , 50 u / ml mycostatin , 100 u / ml polymyxin b , and 250 g gentamicin ) ; cloacal swabs were placed in 1 ml of sample medium . each of two embryonated chicken eggs were inoculated with 100 l of the sample medium containing tracheal or cloacal swabs and were incubated for 48 hours at 37c . ha assays using chicken red blood cells were performed to verify virus growth in the harvested allantoic fluid . briefly , uninfected birds were placed in direct contact with or in cages above and below the inoculated birds ( 10 pfu per bird ) 1 day after inoculation . intensive surveillance systems in the hong kong live - bird markets have been in place since 1997 . from 2001 through 2003 , these systems showed that 253 isolates of 42495 tested specimens were h6 influenza viruses ( 232 in 2001 , 12 in 2002 , and 9 in 2003 ) . we arbitrarily selected 18 h6 influenza viruses isolated from domestic poultry for further study ( table 1 ) . since 1997 , h5 viruses in hong kong have undergone antigenic and genetic change . to determine whether similar antigenic changes have occurred in h6 viruses in hong kong , we characterized the antigens of recent isolates by using hi tests . the h6 influenza viruses isolated in hong kong reacted with hyperimmune goat antisera raised against a / turkey / massachusetts/1/65 ( h6n2 ) ( ty / ma/1/65 ) , hyperimmune rabbit antisera raised against a / shearwater / australia/1/72 ( h6n5 ) ( sh / aus/1/72 ) , and postinfection chicken antisera against a / teal / hong kong / w312/97 ( h6n1 ) ( tl / hk / w312/97 ) , a / quail / hong kong / yu1654/00 ( h6n1 ) ( qa / hk / yu1654/00 ) , a / quail / hong kong / yu39/01 ( h6n1 ) ( qa / hk / yu39/01 ) , and a / duck / shantou/5540/01 ( h6n2 ) ( dk / st/5540/01 ) ( table 2 ) . the antisera against ty / ma/1/65 and sh / aus/1/72 were broadly reactive against all recent h6 viruses , as were antisera to qa / hk / yu39/01 and dk / st/5540/01 . all 2002 and 2003 isolates were antigenically indistinguishable from other viruses isolated during the same year whereas some heterogeneity existed among the 2001 isolates . although there were detectable differences in reactivity patterns to antiserum against qa / hk / yu39/01 between viruses of subsequent years , the h6 viruses of 2001 , 2002 , and 2003 represented a relatively antigenically homogeneous group of viruses . they had , however , changed in comparison to tl / hk / w312/97 , particularly in reactivity to antisera against ty / ma/1/65 and sh / aus/1/72 . the full - length ha sequences of the 18 h6 influenza viruses were determined to analyze their phylogenetic relationships ( figure 1 ) . the ha gene of contemporary h6 influenza viruses isolated from terrestrial poultry had an open reading frame of 1704 bp that encodes a precursor protein of 567 amino acids . the insertion of a conserved aspartic acid between positions 144 and 145 ( h3 numbering ) of the precursor polypeptides distinguishes the contemporary terrestrial poultry viruses from aquatic bird viruses . all h6 isolates possessed the typical nonpathogenic sequence pqietr / g at the ha cleavage site [ 2628 ] . the homology between the ha nucleotide sequences of the contemporary isolates and that of tl / hk / w312/97 ranged from 96% to 98% . the two strains isolated from chicken in 2001 ( ck / hk / sf3/01 and ck / hk / sf4/01 ) were typical of other h6 viruses within the terrestrial host clade . in addition to the ha genes , the na genes of all 18 h6 isolates were sequenced . the n1na genes from 14 virus isolates from domestic poultry , including the two isolates from chicken , belonged to the cluster represented by tl / hk / w312/97 . this cluster was distinguishable from that containing a / goose / guandong/1/96-like ( h5n1 ) n1na genes . the remaining two n1na genes , which were from two of the 2001 isolates ( qa / hk / fb611/01 and qa / hk / fb801/01 ) , were slightly different from those of the tl / hk / w312/97-like n1na cluster and instead were more similar to that of a / quail / hong kong/1721 - 20/99 . alignment analysis revealed a 19-amino acid deletion from the stalk region of the n1nas of all contemporary terrestrial isolates . unexpectedly , two of the contemporary h6 viruses isolated from domestic poultry contained n2 genes . the n2na gene of sc / hk / ap46/01 was similar to that of qa / hk / g1/97-like ( h9n2 ) viruses ( 98% identity to a / hk/1074/99 ) ; the high degree of similarity suggests that sc / hk / ap46/01 was a reassortant derived from cocirculating h6n1 and h9n2 viruses . the n2na gene of gf / hk / ssp99/02 did not belong to the qa / hk / g1/97-like ( h9n2 ) lineage but instead to a lineage represented by recent duck h9n2 isolates ; this finding suggests reassortment between h6n1 viruses and aquatic bird viruses . in 1998 and 1999 , the h6n1 viruses isolated from the hong kong markets were genetically stable and were of the same genetic lineage . to determine whether the stability of h6 viruses has continued since 1999 , we analyzed partial sequences for each of the remaining genes from the isolated h6 viruses . phylogenetic analysis of the pa polymerase ( pa ) gene revealed that , after 2001 , reassortment occurred not only with na genes but also with internal genes . pa genes from all nine viruses isolated in 2001 as well as those of qa / hk / yu404/02 , and qa / hk / yu421/02 were similar to tl / hk / w312/97-like viruses . the pa genes of ph / hk / ssp44/02 , gf / hk / ssp99/02 , and all of the 2003 isolates showed high homology to those of h5n1 viruses isolated from domestic poultry in 2000 and 2001 . also belonging to this lineage were the h5n1 viruses isolated from humans in hong kong in 2003 [ 29 , 30 ] . the np gene segments of ph / hk / ssp44/02 and all of the 2003 isolates were distinct from that of the tl / hk / w312/97-like lineage , as were the ns gene segments of ph / hk / ssp44/02 , gf / hk / ssp99/02 and all of the 2003 isolates . these np and ns gene segments were most similar to those of dk / hk / y280/97-like viruses ( h9n2 ) . the np and ns gene segments of a / pheasant / hk / fy294/00 ( h6n1 ) also clustered with those of dk / hk / y280/97-like viruses ; this clustering indicated that the reassortment events between h6 and h9 viruses had happened as early as 2000 . although there were minor differences , the remaining gene segments ( pb2 , pb1 , and m ) of the h6 viruses isolated from domestic poultry belonged to the tl / hk / w312/97-like lineage ( table 3 ) . the nucleotide sequences for 18 h6 strains presented in this paper have been submitted to dna data bank of japan ( ddbj ) under the accession numbers ab586744 to ab586887 . the receptor specificity of the ha is considered a likely determinant of host range for influenza viruses . additionally , studies have shown that h9n2 viruses circulating in the hong kong live - bird markets have human virus - like receptor specificity . to explore the receptor binding specificity of tl / hk / w312/97 and contemporary h6 isolates , the ability of these viruses to agglutinate erythrocytes from chicken , horse , and guinea pig was measured . tl / hk / w312/97 and recent h6 viruses from aquatic birds [ dk / st/5540/01 ( h6n2 ) and he / hk / lc10/03 ( h6n8 ) ] were uniform in their ability to agglutinate erythrocytes from all sources to similar levels ( table 4 ) . conversely , the recent h6 isolates from domestic poultry were able to agglutinate erythrocytes of chicken and guinea pig origin but not those from horse . the binding of the contemporary h6 isolates was similar to that of qa / hk / g1/97 , a virus with human virus - like receptor specificity . these results demonstrate that the receptor binding properties of the recent h6 isolates from poultry have evolved from those of tl / hk / w312/97 . an increase in the number of h6 viruses isolated from chickens in the hong kong live - bird markets raised the possibility that the host range of these viruses was expanding and that they were adapting to chickens . to test this hypothesis , we determined for chicken and quail the 50% infectious doses of selected h6 viruses isolated from different host species . tl / hk / w312/97 and the domestic poultry h6 isolates from 2001 , 2002 , and 2003 were able to infect quail and chickens ( table 5 ) , although in each case the id50 was lower for quail than for chicken . none of the tested strains showed a markedly increased infectivity for chicken ; the lack of an increase suggests that the contemporary h6 viruses , including those isolated from chickens , were not more adapted to chickens than was tl / hk / w312/97 . the ability of a virus to replicate within a host does not always correspond to its ability to be transmitted between individuals of that host . the ability of the domestic poultry h6 viruses to grow in chickens upon experimental infection conflicts with the low rates of isolation from this host in the markets . to determine the role of transmission in this apparent contradiction , we assessed the ability of the h6 viruses to be transmitted from chicken to chicken and from quail to chicken . although the h6 viruses we selected replicated in the inoculated animals , no virus was isolated from the animals in direct contact with infected birds ( table 6 ) ; this result shows that transmission of the h6 viruses to chickens is poor . in contrast , qa / hk / csw106/01 , ck / hk / sf4/01 , and ph / hk / ssp44/02 were efficiently transmitted from infected to contact quail ( data not shown ) . these infection and transmission results suggest that the h6 viruses circulating in southeastern china have not adapted to chicken populations and are unlikely to do so without further genetic change . the outbreak of h5n1 influenza in 1997 prompted researchers to hypothesize that chickens have the capacity to act as an intermediate host for influenza virus in humans . in light of this possibility , the observation that the host range of h6 viruses within the hong kong live - bird markets might be increasing to include chickens caused concern . h5n1 and h9n2 viruses that had been circulating in poultry in hong kong have caused human infection [ 7 , 8 , 13 , 14 , 17 ] . h6n1 viruses have been cocirculating with these h5n1 and h9n2 viruses in hong kong but have not been isolated from humans , and these viruses appear to have remained genetically stable with regard to antigenic drift and reassortment . the results of our study show that , although the 2003 h6 viruses are not more adapted to chicken than are earlier isolates , h6 viruses in hong kong are evolving and reassorting with other viruses . antigenic and genetic analyses of the h6 influenza viruses isolated from domestic poultry in southeastern china from 2001 through 2003 provide convincing evidence that the h6 influenza viruses are reassorting with h9n2 , h5n1 , and other viruses in the region . previous studies have suggested that h9n2 viruses have a two - way transmission between terrestrial and aquatic birds . this two - way transmission resulted in the generation of multiple genotypes of h9n2 viruses containing internal genes of aquatic avian origin . it is unclear whether the same type of transmission is occurring with h6n1 viruses or whether they are acquiring aquatic bird genes from h9n2 or similar viruses . this pattern parallels the re - emergence of h5n1 influenza viruses in hong kong in 2001 during which multiple new genotypes were identified . although all h6 ha genes appear to be of the tl / hk / w312/97 lineage , the result of hi assays indicate that despite a high level of genetic similarity , there has been a gradual decline in the reactivity of the recent isolates to serum raised against isolates collected in 2001 . the ability of the tl / hk / w312/97-like h6n1 or h6n2 viruses to replicate and transmit in quail but not in chickens suggested that the removal of quail from the hong kong markets ( accomplished in february 2002 ) would substantially affect the isolation rates of h6 viruses . in 2001 , 232 h6 viruses were isolated in the market but only 12 during 2002 and 9 in 2003 were isolated . this dramatic reduction in the isolation rate does indeed suggest that quail were playing an important role in maintaining h6 viruses within the markets . the comparatively small number of birds such as chukkas and pheasants in the markets corresponds with the small number of h6 viruses isolated since the removal of quail . the lack of efficient transmission of the h6 viruses to chicken under experimental conditions , however , conflicts with the isolation of these viruses from chicken in the markets . many market samples are fecal samples taken from cages beneath a given species of bird . although the isolates are likely from the species housed in the above cage , there is the possibility of environmental contamination . it is likely that the birds in the markets are under additional stresses exerted by temperature and other environmental factors in addition to the presence of other pathogens . such stresses which are impossible to mimic in laboratory settings may increase the susceptibility of the birds to influenza infection . regardless , our results showing the unlikely role of chicken as efficient hosts of h6 viruses in the hong kong market system suggest that h6 viruses are now maintained by species such as chukkas and pheasants but not by chickens . correspondingly , it should be expected that their incidence will remain low unless further adaptation to the chicken host is achieved . in addition to the reduction in isolation rates , the increase in the genetic diversity within the h6 viruses in the markets also corresponds with the removal of quail . exactly what role quail may have had in maintaining a stable tl / hk / w312/97-like lineage is uncertain . reassortants were present as early as 2000 , but tl / hk / w312/97-like viruses were the dominant genotype . it could be speculated that the tl / hk / w312/97-like viruses are more adapted for replication and transmission in quail than some of the reassortant viruses . hence , while quail remained in the market tl / hk / w312/97-like viruses predominated . the association of qa / hk / g1/97 ( h9n2)-like viruses , that share 6 gene segments in common with tl / hk / w312/97 , with quail would support this possibility . it is of course also possible that it is coincidence that links the removal of quail and the emergence of multiple genotypes . studies on h9n2 and h5n1 isolates in the region have also revealed an increasing degree of genetic diversity within these viruses . a more sinister scenario for the increase in h6 diversity is that there was an across - the - board enhancement in the amount of genetic reassortment occurring in the domestic poultry viruses throughout southeast asia . although we were unable to detect an increase in the chicken infectivity of recent h6 viruses , some biologic differences to tl / hk / w312/97 similar to what has been described for h9n2 viruses , the contemporary h6 viruses have erythrocyte binding properties more reminiscent of human viruses . human viruses , in contrast to avian viruses , are unable to bind to horse erythrocytes which contain primarily 2 - 3-linked sialic acids . unlike the contemporary h6 viruses , tl / hk / w312/97 has an avian virus - like binding pattern and retains the ability to bind to horse erythrocytes . interestingly , the contemporary h6 viruses do not contain any of the amino acid changes in the ha that matrosovich and colleagues associated with the human virus - like binding properties of the h9n2 viruses . similarly , no correlation between predicted carbohydrate moieties and binding preferences of the h6 viruses was seen . it is interesting that both h9 and h6 viruses have evolved towards a human - like virus binding preference . the fact that it has occurred in distinct subtypes of influenza virus would strongly support a selective advantage accompaning the change . exactly what environmental or host factor is driving the selective pressure is unclear . the hypothesis that the host range of h6 viruses underwent expansion in the hong kong markets appears to be incorrect in view of our findings . h6 viruses do have the capacity to be maintained in chicken populations as demonstrated by the emergence of multiple genotypes of h6n2 virus in chicken in the united states [ 3537 ] . what further molecular changes are required for establishment of the hong kong h6 viruses in chickens , if at all possible , is unknown . although the removal of quail has reduced the h6 virus burden in the hong kong bird markets , there has been an abrupt and corresponding increase in the genetic diversity of these viruses . it is unclear what effect this increase has on the continued presence and importance of these viruses for animal and human health .

until 2001 , h6n1 influenza viruses in the hong kong bird markets were represented by a single stable a / teal / hong kong / w312/97-like lineage . beginning in 2001 , despite a reduction in overall prevalence , an increase was observed in the number of h6 viruses isolated from chickens and other hosts . to assess any changes in h6 viruses , we characterized 18 h6 viruses isolated in the hong kong bird markets from 2001 to 2003 . experimental data showed that the 2003 h6 viruses had similar infectivity for chickens as did a / teal / hk / w312/97 , and they were unable to transmit . although all hemagglutinin genes were closely related to a / teal / hk / w312/97 , 7 isolates were reassortant viruses containing similar gene segments of co - circulating h9n2 or h5n1 viruses . the receptor specificity was different from that of a / teal / hong kong / w312/97 . interestingly , similar observations have been documented in h9n2 viruses in hong kong . this evolution strongly suggests that some change in the ecology of influenza in the region selected for these changes . taken together , these findings suggest that the h6 influenza viruses isolated in the hong kong markets are not well adapted to chickens and that the likely continued source of these viruses are other minor poultry species in which they are undergoing genetic and biologic evolution .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

using best evidence to inform healthcare decisions is widely recognized as a key competency for all healthcare professionals . academic institutions are implementing evidence - based healthcare ( ebhc ) as part of learning in the curriculum of healthcare professionals . these curricula usually cover critical enquiry and formulating clear questions when faced with a scenario of uncertainty , finding best research evidence applicable to the problem , critically appraising the evidence for validity , clinical relevance and applicability , interpreting and applying the findings in the clinical setting and evaluating the performance . clinically integrated teaching and learning , with a focus on learning linked to real - world problems in the clinical setting and learning by doing , as modelled by sackett are considered to be the more effective approaches for improving ebhc knowledge , skills and attitudes . successful teaching and learning depends on factors related to the learner , the educator / lecturer , and on having a supportive environment with teaching and learning opportunities . educators play a critical role in the delivery and facilitation of ebhc teaching and learning , in encouraging critical enquiry , in fostering reflective practices and in being role models for the practice of ebhc in the clinical setting . within the clinical setting , clinician lecturers / educators who have received ebhc training are more likely to teach the application of ebhc . a study in new zealand among clinical teachers found that those who received training in ebhc are more likely to teach its application in the clinical setting and are more comfortable to engage students on topics and issues related to ebhc , and this was more often seen among general practitioners than specialists . among nurse educators , melnyk et al . found significant relationships between educators knowledge of ebhc and their beliefs about the value of ebhc , the ability to practice ebhc and the relationship between teaching ebhc and advancing the profession and their comfort in teaching ebhc . the create framework , which provides an international consensus statement on ebhc assessment tools , defines self - efficacy as the individual 's judgments regarding their ability to perform a certain activity and notes that educators confidence in their ability may increase their likelihood to engage in practicing the various ebhc steps . internationally , training initiatives thus focus on training trainers in ebhc to enhance their capacity to integrate ebhc teaching and learning in the clinical setting . also on the increase are initiatives to build confidence in teaching and learning principles and theories . in south africa , the colleges of medicine of south africa includes critical appraisal skills in curricula for medical specialist training while the medical and dental professions board of the health professions council of south africa states in its regulations for registration of students , undergraduate curricula and professional examinations in medicine and dentistry that : the emphasis in teaching should be on fundamental principles and methods that promote understanding and problem - solving skills and not only on the purely factual knowledge which , in any event , becomes outdated . they should be taught at all times to be critical of old and new knowledge and to evaluate data , statistics , thinking and methods objectively . the emphasis in teaching should be on fundamental principles and methods that promote understanding and problem - solving skills and not only on the purely factual knowledge which , in any event , becomes outdated . they should be taught at all times to be critical of old and new knowledge and to evaluate data , statistics , thinking and methods objectively . the health professions council of south africa used the canmeds framework to define the desired graduate attributes of a newly qualified healthcare professional . this now serves as a guide to the essential abilities of a newly qualified health professional to optimize patient outcomes and defines the attributes of the graduate according to seven interdependent roles : medical expert , scholar ( which includes ebhc ) , professional , communicator , collaborator , manager and health advocate . at stellenbosch university an ongoing project aims to develop and implement undergraduate ebhc teaching and learning to medical undergraduates in an integrated manner . to inform curriculum development , an assessment of the medical curriculum was conducted , including a document review of the 2011 curriculum , a survey of recent graduates and interviews with faculty . this found that ebhc is covered to varying degrees with teaching in specific modules , which it was not explicitly integrated in a stepwise fashion and did not progress from foundational knowledge to the acquisition of skills and practical competencies throughout the curriculum . recent graduates felt that they lacked ebhc skills and proposed that ebhc teaching and learning be integrated into clinical rotations , making use of relevant examples in different disciplines . as educators play a key role in facilitating the teaching and learning of ebhc , especially within the clinical setting , the study reported here assessed educators confidence in practicing , and their attitude , to ebhc , as well as their confidence in teaching ebhc and the barriers they had experienced , or perceived , to practicing and teaching ebhc . the study population included all faculty members involved in teaching on the undergraduate medical curriculum across the 10 departments at the stellenbosch university faculty of medicine and health sciences . all those employed by the university , and those on joint appointments , whose role included teaching of undergraduate medical students were invited to participate by e - mail , and provided with a link to the online questionnaire . the structured questionnaire sought information regarding demographics and training received , experience in teaching and learning , and previous exposure to ebhc ( training received , research conducted , etc . ) . we used validated tools for assessing confidence in practicing , and attitude to , ebhc . confidence in practicing ebhc was assessed using the evidence - based practice confidence scale and questions were included to assess attitude . visual analogue scales measured attitudes to , and confidence in , teaching ebhc and open - ended questions explored barriers to practicing and teaching ebhc . the afrikaans version was back translated by a person independent of the research team , and the original english and the back - translated version compared to ensure that the meaning of the questions was not lost . stata 12 ( statacorp lp , college station , texas , usa ) was used for quantitative data analysis . categorical data were summarized using proportions . for questions on knowledge we assessed consistency and found high cronbach 's alphas ( 95% ) and therefore combined all 16 items into one knowledge score . the highest score was allocated to the best level of knowledge , giving a knowledge score with a maximum 80 . for questions on attitude to practicing ebhc we reversed the scores of the negatively phrased items , for example i rarely formulate questions about patients and then added all the items together to get an overall score between 10 and 50 ( cronbach 's alpha 57% ) . for confidence in practicing ebhc we grouped the scores into five categories aligned with the five steps in practicing ebhc namely ask clear questions , search for research evidence , appraise and interpret the evidence , apply the evidence and audit practices . scores for self - perceived confidence in teaching ebhc were also combined into an overall score ( maximum 55 ) . bivariate analysis of associations between factors such as demographics , education and exposure to ebhc , and outcomes such as attitude and confidence to practice and teach ebhc were assessed using correlation analysis , analysis of variance testing , pearson 's analysis and t tests as appropriate . responses to open - ended questions on barriers , and proposed strategies to overcome these , to practicing and teaching ebhc were coded and analysis and interpretation were done by the investigators , using thematic content analysis to identify key emerging themes . we linked these to the conceptual framework for integrated teaching and learning of ebhc , developed following semistructured interviews with 24 ebhc programme coordinators from around the world , which revolves around the engagement between the learner and the educator within the institutional context . the study proposal was approved by the stellenbosch university health research ethics committee ( s12/10/262(c ) ) . to enhance response rate , we had a lottery for respondents , with a sponsored conference registration , for a conference of their choice , to the value of r5000 as the prize . participants who wanted to enter the lottery had to provide their cell phone numbers , which were only be used to notify the winner . forty two ( 19% ) of 227 faculty members involved in teaching undergraduate medical students responded . they worked across various departments , were mainly senior lecturers and offered teaching to all years of medical students ( table 1 ) . about 75% had attended training on research methodology ( mainly epidemiology , research proposal writing , biostatistics , systematic reviews and qualitative research methods ) , and to a lesser extent training on knowledge translation and change management . most participants had conducted primary research , with only a few conducting systematic reviews . more than half ( 57% ) indicated that they had done some training in ebhc in the past 5 years by attending short courses , workshops / seminars , online courses , journal clubs or by reading articles on ebhc . these activities mainly addressed enabling competencies such as epidemiology , biostatistics , research methodology and the basic principles of ebhc . most ( 85% ) had attended teaching and learning training events that had content such as teaching and learning strategies , assessment , curriculum planning , teaching ebhc , supervision and promoting active learning . participants described ebhc as : supporting clinical decision - making by combining best available evidence with own experience , patient preference and local factors and healthcare practices ( of any nature e.g. prevention , diagnosis , treatment , prognosis etc . ) that are informed by evidence as far as possible ; and recognising where there is inadequate / insufficient evidence to inform these practices . it implies ongoing changes to healthcare practice when new evidence becomes available . supporting clinical decision - making by combining best available evidence with own experience , patient preference and local factors and healthcare practices ( of any nature e.g. prevention , diagnosis , treatment , prognosis etc . ) that are informed by evidence as far as possible ; and recognising where there is inadequate / insufficient evidence to inform these practices . profile of survey responders ebhc , evidence - based healthcare ; iqr , interquartile range . some emphasised use of research evidence and did not include reference to combining this with clinical experience and patient preferences . participants self - reported understanding of ebhc - related terms is described in table 2 . using the overall knowledge score for the 16 items , maximum score 80 , the median the knowledge scores were not significantly associated with training , highest qualification , years since qualifying , position , academic department or age . self - reported understanding of evidence - based healthcare - related terms often used in research articles figure 1 graphically depicts responses to the questions on attitude to practicing ebhc . the items were framed both positively , for example ebhc is useful on a daily basis and negatively , for example i rarely formulate questions about patients. most felt that ebhc is a realistic option in their practice and that lifelong learning is important . however , more than 50% felt that literature searches are too time - consuming to undertake in the clinic and that questions can be answered faster by referring to a textbook or a consultant . the overall mean score was 38 ( sd 5 ) ( maximum score 50 ) . data were normally distributed , so we compared the independent variables to attitude score using t tests and analysis of variance . training in ebhc and research methods , qualification , time since qualification , faculty position , age , conducting systematic reviews and years of teaching were not significantly associated with attitude . lecturers confidence in practicing ebhc is summarized in table 3 , highlighting levels of confidence that are high overall but with lower levels for interpreting statistics . they raised various barriers , relating to the individual or the context , to practicing ebhc . by far the most common were lack of time , clinical workload , limited access to internet and resources , knowledge and skills.no simple solution to increase time - clinicians responsibilities in the hospital , including patient and student load will only be addressed if more posts are made available . no simple solution to increase time - clinicians responsibilities in the hospital , including patient and student load will only be addressed if more posts are made available . educators self - perceived confidence in practicing evidence - based healthcare ( n = 42 ) they made suggestions on how this could be addressed , calling for more staff and dedicated time for research and for faculty development . they proposed capacity development opportunities to especially enhance their capacity to interpret and understand biostatistics , searching skills , how to read papers and on time management . support group to assist each other . to create an enabling environment , they suggested widely available and reliable internet access and wifi , access to relevant literature and having evidence informed clinical guidelines available at the point of care . furthermore , they suggested using auditing and feedback to enhance practices . this was done through lectures , small group tutorials , teaching at the bedside , online learning and including ebhc concepts in assessments . the content covered in these sessions focused on the enabling competencies ( epidemiology , biostatistics ) , basic ebhc principles and searching skills . the overall mean score for self - perceived confidence in teaching ebhc was 40 ( sd 11 ) of a maximum of 55 ( n = 42 ) . most ( 38 ) of the 42 respondents indicated that they were confident to help medical students find relevant articles in medline ( or other bibliographic databases ) , and to guide critical review of articles ( 60% or higher on the visual analogue scale ) . fewer ( 30 ) indicated that they were confident to assist students phrase a clear question following a clinical encounter with a patient , and to guide students in considering the application of the results of their critique of articles to the patient 's care . twenty seven selected 60% or higher on the visual analogue scale for confidence in evaluating students ebhc knowledge . 2 . confidence in teaching evidence - based healthcare ( ebhc ) per department . using total score ( maximum = 55 ) . educators raised a number of perceived barriers to teaching ebhc , which relate to the students , the context and the educators . they felt that the curriculum is full , that students are subjected to information overload , that there is no scaffolding of ebhc learning over the course of the degree and that ebhc is not integrated in practice . lack of internet access , especially at point - of - care , was commonly listed . with respect to students the size of student groups , immaturity and lack of interest of students were seen as barriers to ebhc learning while competing priorities and lack of time ( am involved with too many other activities ) , as well as limited ebhc knowledge and skills ( i need to upgrade and maintain my knowledge of ebhc ) and the tendency to stick to habits influence how educators facilitate ebhc learning . suggestions for addressing these challenges included improving departmental internet access , exploring wifi access for the whole faculty , and easy point - of - care access to databases and resources . respondents stressed the importance of increasing awareness of the value and utility of ebhc ( demonstrate to them the value of ebhc ) and thus the need for ebhc teaching . they also emphasized building capacity to both practice and facilitate learning of ebhc , and expressed the need for more time to devote to teaching students ( get somebody to take over my postgraduate activities . furthermore , they called for promotion of critical thinking among students , incorporating the teaching and learning of ebhc from the start of the curriculum , and making ebhc applicable and relevant to students. respondents felt that there needs to be dedicated time to apply ebhc principles especially within the clinical setting , and that it should be integrated in assessments . to support each other , educators requested help from others who are particularly proficient , for example a working group supporting educators , and highlighted the need for evaluation and ongoing refinement of teaching approaches and material . the items were framed both positively , for example ebhc is useful on a daily basis and negatively , for example i rarely formulate questions about patients. most felt that ebhc is a realistic option in their practice and that lifelong learning is important . however , more than 50% felt that literature searches are too time - consuming to undertake in the clinic and that questions can be answered faster by referring to a textbook or a consultant . the overall mean score was 38 ( sd 5 ) ( maximum score 50 ) . data were normally distributed , so we compared the independent variables to attitude score using t tests and analysis of variance . training in ebhc and research methods , qualification , time since qualification , faculty position , age , conducting systematic reviews and years of teaching were not significantly associated with attitude . lecturers confidence in practicing ebhc is summarized in table 3 , highlighting levels of confidence that are high overall but with lower levels for interpreting statistics . they raised various barriers , relating to the individual or the context , to practicing ebhc . by far the most common were lack of time , clinical workload , limited access to internet and resources , knowledge and skills.no simple solution to increase time - clinicians responsibilities in the hospital , including patient and student load will only be addressed if more posts are made available . no simple solution to increase time - clinicians responsibilities in the hospital , including patient and student load will only be addressed if more posts are made available . educators self - perceived confidence in practicing evidence - based healthcare ( n = 42 ) they made suggestions on how this could be addressed , calling for more staff and dedicated time for research and for faculty development . they proposed capacity development opportunities to especially enhance their capacity to interpret and understand biostatistics , searching skills , how to read papers and on time management . support group to assist each other . to create an enabling environment , they suggested widely available and reliable internet access and wifi , access to relevant literature and having evidence informed clinical guidelines available at the point of care . this was done through lectures , small group tutorials , teaching at the bedside , online learning and including ebhc concepts in assessments . the content covered in these sessions focused on the enabling competencies ( epidemiology , biostatistics ) , basic ebhc principles and searching skills . the overall mean score for self - perceived confidence in teaching ebhc was 40 ( sd 11 ) of a maximum of 55 ( n = 42 ) . most ( 38 ) of the 42 respondents indicated that they were confident to help medical students find relevant articles in medline ( or other bibliographic databases ) , and to guide critical review of articles ( 60% or higher on the visual analogue scale ) . fewer ( 30 ) indicated that they were confident to assist students phrase a clear question following a clinical encounter with a patient , and to guide students in considering the application of the results of their critique of articles to the patient 's care . twenty seven selected 60% or higher on the visual analogue scale for confidence in evaluating students ebhc knowledge . 2 . confidence in teaching evidence - based healthcare ( ebhc ) per department . educators raised a number of perceived barriers to teaching ebhc , which relate to the students , the context and the educators . they felt that the curriculum is full , that students are subjected to information overload , that there is no scaffolding of ebhc learning over the course of the degree and that ebhc is not integrated in practice . lack of internet access , especially at point - of - care , was commonly listed . with respect to students the size of student groups , immaturity and lack of interest of students were seen as barriers to ebhc learning while competing priorities and lack of time ( am involved with too many other activities ) , as well as limited ebhc knowledge and skills ( i need to upgrade and maintain my knowledge of ebhc ) and the tendency to stick to habits influence how educators facilitate ebhc learning . suggestions for addressing these challenges included improving departmental internet access , exploring wifi access for the whole faculty , and easy point - of - care access to databases and resources . respondents stressed the importance of increasing awareness of the value and utility of ebhc ( demonstrate to them the value of ebhc ) and thus the need for ebhc teaching . they also emphasized building capacity to both practice and facilitate learning of ebhc , and expressed the need for more time to devote to teaching students ( get somebody to take over my postgraduate activities . furthermore , they called for promotion of critical thinking among students , incorporating the teaching and learning of ebhc from the start of the curriculum , and making ebhc applicable and relevant to students. respondents felt that there needs to be dedicated time to apply ebhc principles especially within the clinical setting , and that it should be integrated in assessments . to support each other , educators requested help from others who are particularly proficient , for example a working group supporting educators , and highlighted the need for evaluation and ongoing refinement of teaching approaches and material . this is one of only a few studies conducted in south africa to assess one or more of the following : undergraduate educators confidence in practicing and teaching ebhc , attitudes to ebhc and to practicing and teaching ebhc . this study links to ongoing work at stellenbosch university supporting the implementation of graduate attributes , specifically linked to developing and implementing clinically integrated ebhc teaching and learning for medical undergraduates , a process within which educators play a critical role . despite respondents having a high self - reported level of knowledge and understanding of ebhc concepts attitudes towards ebhc varied ( fig . those who were teaching ebhc focused the curricula content on enabling competencies of ebhc , basic ebhc principles and searching skills , rather than on reading , interpreting and considering the application of different types of articles . as educators are faced with various competing priorities the need was expressed for dedicated faculty development and a community of practice to provide support in the implementation of ebhc teaching and learning . similar studies among south african psychiatrists and general practitioners with a special interest in mental health , general practitioner and specialist educators in new zealand and nurse educators in the united states found that those who had attended ebhc courses were more likely to teach ebhc . barriers to teaching ebhc , resonating with our survey , were centred around lack of time , lack of support , lack of evidence in some clinical areas and the need for more training in teaching ebhc . findings of this survey also resonate with a curriculum assessment , which found that there is no scaffolding of ebhc learning over the course of the degree and that ebhc is not integrated in practice . a supportive enabling institutional , and health sector , environment is important for advancing ebhc learning . educators need to be confident and competent to facilitate the learning and , to this end , require opportunities to enhance their capacity in ebhc and in how to facilitate learning . furthermore , through working together , building on each other 's strengths , sharing best practices and lessons learnt , in a supportive community of practice can build the critical mass of educators needed to facilitate learning across the various disciplines . our survey had limited the power to assess associations between confidence to practice and teach ebhc and variables such as attitude and training . the low response rate might also mean that those who took part are not representative of the target population . the nonresponders may have different levels of confidence to practice and teach ebhc , their attitude may vary and they could be experiencing different challenges . to assess this we conducted brief follow - up survey of nonresponders , to which 14 educators responded . they described ebhc in a similar way to responders and listed lack of time , length of the survey , limited involvement with undergraduate teaching and that ebhc is irrelevant to their practice as reasons for not participating . educators play a critical role in facilitating learning not just in the classroom , but also in practice . this survey , despite low response rate , shows that even for those with high levels of self - reported knowledge and understanding of ebhc ; adequate support , training and development and an enabling environment are important for educators to be the role models future healthcare professionals need .

abstractaim : medical student educators play critical roles in evidence - based healthcare ( ebhc ) teaching and learning and as role models practicing ebhc . this study assessed their confidence to practice and teach ebhc , their attitude to ebhc and barriers to practicing and teaching ebhc.methods:we conducted a cross - sectional online survey of educators of undergraduate medical students at a south african academic institution . stata 12 was used for quantitative data analysis . responses to open - ended questions were coded , and further interpretation done using thematic content analysis.results:forty two ( 19% ) educators from various departments responded to the invitation sent to everyone formally involved in teaching undergraduate medical students . they had high levels of knowledge and understanding of ebhc . many had received training in teaching and learning approaches , although ebhc training received was mainly on enabling competencies . limitations to practicing ebhc included lack of time , clinical workload , limited access to internet and resources , knowledge and skills . one quarter of the respondents indicated that they teach ebhc . perceived barriers to teaching ebhc reported related to students ( e.g. lack of interest ) , context ( e.g. access to databases ) and educators ( e.g. competing priorities ) . respondents suggestions for support included reliable internet access , easy point - of - care access to databases and resources , increasing awareness of ebhc , building capacity to practice and facilitate learning of ebhc and a supportive community of practice.conclusion:educators play a critical role in facilitating ebhc learning not just in the classroom , but also in practice . without adequate support , training and development , they are ill equipped to be the role models future healthcare professionals need .

Background Methods Results Attitude to evidence-based healthcare Practicing evidence-based healthcare Teaching evidence-based healthcare Discussion Conclusion

the regulated expression of different families of retrotransposons and dna transposons has been described in different tissues and species . however , a detailed analysis of the transcripts or their temporal and spatial expression patterns has been reported in only a few cases . during drosophila embryogenesis , spatial differential expression of the retrotransposon 412 has been described , specifically in the gonadal mesoderm . in mouse , retrotransposons make a high contribution to the pool of maternal mrnas in early embryos , and the expression of these elements is developmentally regulated . in xenopus , the 1a11 retrotransposon - like element is specifically expressed in the mesoderm and its expression is regulated by fgf . likewise , the expression of the retrotransposon family xretpos is restricted to ventro - posterior regions during development . we extended these observations by showing that a dna transposable element of the tc1/mariner family is differentially expressed during x. tropicalis development . transcripts for some tc1-like elements have been detected in other est databases , but no detailed analyses has been performed . our studies showed that the tc1-like element tc12_xt mrna ( named according to the repeatmasker nomenclature ) is specifically expressed at the gastrula stage in the spemann s organizer . this region is required for the proper dorso - ventral and anterior - posterior patterning of the embryo and the neuroectoderm , the tissue that will give rise to the nervous system ( fig . then as development progresses , tc12_xt mrna is found restricted to neural tissue regions . both tc12_xt sense and antisense strands present similar expression patterns . the length of the mrnas suggests that these transcripts are not included in other genes . pirnas are specifically derived from tc12_xt , and analysis of the expression of selected tc12_xt - derived pirnas suggests that these elements control its temporal expression . ( a ) the sequence analysis of the 116 copies of the tc12_xt transposable element in the x. tropicalis genome showed the typical structure of tc1-like elements . it is flanked by two inverted repeats ( ir ) containing two direct repeats ( white triangles ) for the binding of the transposase . the transposase orf ( green ) contains a putative dna binding domain ( blue ) and the catalytic triad ( red , aspartic - aspartic - glutamic residues ( dde ) ) . ( b ) schematic representation of the expression of tc12_xt during x. tropicalis early development . the expression of tc12_xt is shown in blue for early stages of x. tropicalis development . no expression is detected before the beggining of the zygotic transcription ( st.6 is shown as an example , lateral view ) . expression is clearly detected from gastrula stage ( st.10 ) in the spemann s organizer and then in anterior and neural tissues . figures were downloaded from http://www.xenbase.org/anatomy/static/nf/nf-all.jsp and modified according to the expression pattern obtained by in situ hybridization . in the x. tropicalis genome , 72% of transposable elements correspond to dna transposons with seven families of tc1-like elements characterized . our analyses for these elements , albeit not detailed , have shown that several of these families are transcribed during x. tropicalis development . interestingly , we could not find tc12_xt in x. laevis by using rt - pcr or in situ hybridization . whether this is explained because this element invaded the x. tropicalis genome after both species diverged , or to a high divergence in the sequence in the x. laevis genome is not known . the availability of the x. laevis genome could be very useful to study these alternatives . however , in x. laevis , two tc1-like elements have been described in the genome , txr and txz . our studies have demonstrated that txr and txz are also expressed during x. laevis development . importantly , the expression pattern of these elements is very similar to tc12_xt in x. tropicalis and both strands are also expressed . at present , we do not know how the expression of these elements is controlled and whether one or several loci are being transcribed . the presence of regulatory elements controlling gene expression in the sequences of these tc1-like elements has not been studied . however , in contrast to the expression of tc1 elements in c. elegans , which occurs by fortuitous read - through transcription , most tc12_xt rna is not included in other protein - coding transcripts , for which read - through transcription is unlikely to explain the bulk of tc12_xt rnas . another alternative is the presence of clusters of several copies of transposable elements under the control of a single promoter . the transcription of clusters of transposable elements to generate pirnas has been described in drosophila . it is possible that these clusters can also be regulated during development to produce specific expression patterns . another explanation is that transcription is ubiquitous , and that tc12_xt rnas are degraded in ventral and posterior regions by a pirna dependent - mechanism . in any case , the specific temporal and spatial expression of all these elements strongly suggests that they could play a role during nervous system development . in the x. tropicalis genome , 111 out of 116 tc12_xt copies contain frame - shifts and mutations rendering putative transposase - inactive copies of the element . consistently , the analysis of 20 tc12_xt cdnas from gastrula stage embryos indicates that none of them codes for an active transposase . these results suggest that tc12_xt could play a role as a non - coding rna . in mouse , the transcription of the retrotransposon sine b2 is necessary for gene activation in the growth hormone locus . in this case , the expression of this retrotransposon regulates the formation of a euchromatin / heterochromatin boundary , resulting in the expression of genes in proximal regions . it is still unknown whether this is the case for tc12_xt expression , but we can propose that some of the tc12_xt loci may be regulating chromatin architecture , allowing the expression of genes involved in the formation of the nervous system . considering that pirnas derived from tc12_xt were detected , another possible function is to generate pirnas . the expression of both strands is consistent with the ping - pong model of amplification of pirnas . if this is the case , it is worth noting that the tc12_xt rna is stable enough to be detected by rt - pct , rna gel blot and in situ hybridization , suggesting that the pirnas produced are most likely not enough to degrade all of the tc12_xt rna during early development . in addition , the expression of sense and antisense strands is specifically detected in neural tissues , and therefore , the amplification of pirnas could occur in these tissues . alternatively , pirnas derived from tc12_xt may not be involved in the degradation of tc12_xt itself . rather than that , they may regulate endogenous genes that contain sites complementary to pirnas . although our analysis for two tc12_xt - derived pirnas showed that all the pirna sequences in the genome are included only in tc12_xt sequences , the possibility that other tc12_xt - derived pirnas map to genes can not be ruled out . for example , pirnas derived from transposable elements regulate the expression of endogenous genes and allow the clearance of maternal mrnas during early drosophila development . finally , recently it has been published that pirnas derived from non - repetitive regions have a role in spine morphogenesis in the central nervous system in mice . although all the tc12_xt cdna copies we analyzed do not contain a functional transposase open reading frame , 5 out of 116 tc12_xt complete sequences in the genome could putatively code for an open reading frame containing the catalytic triad and perhaps an active transposase ( fig . we do nt know if these five copies contain all the other residues required for transposition , such us the binding to dna domains . however , the presence of active copies in the genome and its possible expression can not be ruled out . interestingly , work from the gage laboratory showed that endogenous line-1 retrotransposition can occur during mouse development . in addition , line-1 retrotransposition in the vicinity of neural genes can alter the expression of these genes in neural precursor cells . furthermore , the same group showed that line-1 retrotranspositions can also occur in neural progenitor cells isolated from human fetal brain , suggesting that de novo line-1 retrotransposition events may occur in the human brain . these events produce mosaicism in the neurons due to different genomic modifications on different neurons in the same individual . this has been suggested as a novel mechanism involved in the generation of the astonishing neuronal diversity required for nervous system formation . therefore , the specific expression of tc12_xt ( and txr and txz ) in dorsal and neural tissues allows speculation about a similar role in xenopus . as active elements for transposition , these transposons could be involved in the generation of heterogeneity during xenopus nervous system development . in this section we will briefly discuss possible experimental approaches to evaluate transposition of tc1 elements during nervous system development and determine its possible contribution to produce neuronal diversity . one of the first questions is to determine whether expression of an active dna transposase occurs during early development . after cloning the possible candidates , transposase activity must first be determined by in vitro assays . for this , a plasmid reporter for excision events needs to be prepared . based upon the white - peach allele studied in drosophila the egfp open reading frame contains an insertion of a random sequence ( same length as the transposase ) in between of the inverted repeats the putative transposase recognizes . therefore , when co - expressed with the transposase mrna in an exogenous system ( e.g. , cell culture ) , successful translation into an active transposase would render egfp+ cells . the reporter construct contains an egfp open reading frame with an insertion of a random sequence ( same length as the original transposase ) . when transposase mrna is present ( either exogenous , when working in vitro , or endogenous , when in vivo ) and an active transposase is being translated , transposition will occur , rendering egfp+ cells . the random sequence insertion sites can then be characterized using deep sequencing of reverse pcr amplicons . experiments to demonstrate in vivo transposition could be performed . for this purpose , transgenic xenopus embryos containing a tissue - specific promoter would allow us to follow transposition in the central nervous system . the presence of an endogenously active transposase would render egfp+ cells that we could observe in later developmental stages , such as stage 50 tadpoles . furthermore , it would be possible to characterize transposon insertion sites in neural tissues of individual tadpoles using deep sequencing of reverse pcr amplicons ( see fig . 2 ) . the comparison of insertion sites in neural tissues with non - neural tissues could be an indicator of in vivo transposition events . all of these approaches can be useful to determine whether transposition events occur during xenopus development . although host cells contain mechanisms to avoid the expression of transposable elements , they could also be using these elements for cellular functions . a proper balance must exist to control these positive and negative effects of transposable elements . our work has shown that the specific expression of tc1 elements in neural tissues and suggests that transposable elements may play a role during the formation of the nervous system in vertebrates .

transposable elements ( retrotransposons and dna transposons ) comprise a large proportion of animal genomes , for example 20% in d. melanogaster , 36% in x. tropicalis and 45% in humans . after invading a new genome , the transposable element increases its copy number and subsequently accumulates mutations . these may eventually result in inactive copies . until recent days transposons have been considered junk dna and no clear function have been assigned for this important amount of information on genomes .

Expression of Transposable Elements from the Possible Roles of Transposable Elements as Non-Coding RNAs Possible Roles of Transposable Elements as Active Copies Experimental Approaches to Study the Role of Transposable Elements during Development

we obtained formalin - fixed , paraffin - embedded tissue sections from 30 leiomyosarcoma patients at the university of texas md anderson cancer center ( mdacc ; houston , texas , usa ) . these included samples from the retroperitoneum ( n = 12 ) , gastrointestinal tract ( n = 9 ) , uterus ( n = 6 ) , and skin ( n = 3 ) . to validate the results obtained with the mdacc samples , another cohort of 45 formalin - fixed , paraffin - embedded tissues from patients with leiomyosarcoma were retrieved from tianjin medical university cancer institute & hospital ( tmucih ) for further study . the patients ' clinicopathologic characteristics , including sex , age , clinical stage , degree of cell differentiation , tumor location , tumor size , the presence or absence of hemorrhage / cyst , and histopathologic subtype , were also collected . the tissues had been acquired from 18 male and 27 female patients with a mean age of 55.8 years . histopathologic subtypes were assigned based on the 2002 world health organization classification of tumors of soft tissue and bone , . overall survival time was defined from the date of diagnosis or the first treatment to the date of death or last follow - up . overall survival ranged from 1 to 74 months , and the median survival was 19 months . the study protocol was approved by the institutional review boards of both hospitals , and consent was obtained from each patient . briefly , tissue sections ( 4 m ) were dewaxed with xylene , rehydrated with ethanol , soaked in citrate buffer solution ( 10 mmol / l , ph=6 ) , and boiled in a pressure cooker for 2.5 min to repair the antigen . the sections were then blocked for 20 min with normal serum ( vector laboratories , burlingame , ca ) and incubated overnight at 4c with rabbit polyclonal anti - prune2 antibody ( abcam company , abcam , cambridge , uk ; diluted 1:100 ) . secondary antibody was applied for 60 min ( one drop of biotinylated anti - rabbit with three drops of normal rabbit serum ) . dab ( dako corporation , carpinteria , ca ) staining was applied for 510 min and monitored by microscopy . two pathologists blinded to clinical information evaluated and scored prune2 staining based on staining extent and intensity . ten random high - power fields , each containing approximately 100 cells , were observed under the microscope ( 40 ) . first , staining extent was scored according to the proportion of positive tumor cells : 0% ( score 0 ) , 10% ( score 1 ) , 11% to 25% ( score 2 ) , 26% to 50% ( score 3 ) , 51% to 75% ( score 4 ) , and > 75% ( score 5 ) . second , staining intensity was scored based on the color observed : no color ( score 0 ) , yellow ( score 1 ) , tan ( score 2 ) , and brown ( score 3 ) . final scores were calculated by adding the extent and intensity scores , and the results were used to divide patients into two groups : low expression group , for final scores of 04 , and high expression group , for final scores > 4 . kaplan - meier survival analysis ( log - rank test ) and multivariate cox regression analysis were used to examine the relationship between overall survival and prune2 protein expression . we obtained formalin - fixed , paraffin - embedded tissue sections from 30 leiomyosarcoma patients at the university of texas md anderson cancer center ( mdacc ; houston , texas , usa ) . these included samples from the retroperitoneum ( n = 12 ) , gastrointestinal tract ( n = 9 ) , uterus ( n = 6 ) , and skin ( n = 3 ) . to validate the results obtained with the mdacc samples , another cohort of 45 formalin - fixed , paraffin - embedded tissues from patients with leiomyosarcoma were retrieved from tianjin medical university cancer institute & hospital ( tmucih ) for further study . the patients ' clinicopathologic characteristics , including sex , age , clinical stage , degree of cell differentiation , tumor location , tumor size , the presence or absence of hemorrhage / cyst , and histopathologic subtype , were also collected . the tissues had been acquired from 18 male and 27 female patients with a mean age of 55.8 years . histopathologic subtypes were assigned based on the 2002 world health organization classification of tumors of soft tissue and bone , . overall survival time was defined from the date of diagnosis or the first treatment to the date of death or last follow - up . overall survival ranged from 1 to 74 months , and the median survival was 19 months . the study protocol was approved by the institutional review boards of both hospitals , and consent was obtained from each patient . , tissue sections ( 4 m ) were dewaxed with xylene , rehydrated with ethanol , soaked in citrate buffer solution ( 10 mmol / l , ph=6 ) , and boiled in a pressure cooker for 2.5 min to repair the antigen . the sections were then blocked for 20 min with normal serum ( vector laboratories , burlingame , ca ) and incubated overnight at 4c with rabbit polyclonal anti - prune2 antibody ( abcam company , abcam , cambridge , uk ; diluted 1:100 ) . secondary antibody was applied for 60 min ( one drop of biotinylated anti - rabbit with three drops of normal rabbit serum ) . dab ( dako corporation , carpinteria , ca ) staining was applied for 510 min and monitored by microscopy . two pathologists blinded to clinical information evaluated and scored prune2 staining based on staining extent and intensity . ten random high - power fields , each containing approximately 100 cells , were observed under the microscope ( 40 ) . first , staining extent was scored according to the proportion of positive tumor cells : 0% ( score 0 ) , 10% ( score 1 ) , 11% to 25% ( score 2 ) , 26% to 50% ( score 3 ) , 51% to 75% ( score 4 ) , and > second , staining intensity was scored based on the color observed : no color ( score 0 ) , yellow ( score 1 ) , tan ( score 2 ) , and brown ( score 3 ) . final scores were calculated by adding the extent and intensity scores , and the results were used to divide patients into two groups : low expression group , for final scores of 04 , and high expression group , for final scores > 4 . kaplan - meier survival analysis ( log - rank test ) and multivariate cox regression analysis were used to examine the relationship between overall survival and prune2 protein expression . in the 30 leiomyosarcoma tissues from mdacc , prune2 protein staining was predominantly in the cytoplasm of cells ( figure 1 ) . low expression was discovered in 63.3% ( 19/30 ) of the samples ( figure 1a ) , while high expression was observed in 36.7% ( 11/30 ) ( figure 1b ) . to investigate the prognostic role of prune2 , we analyzed the association between prune2 protein expression and overall survival . univariate analysis showed that prune2 protein expression had no significant association with overall survival ( = 0.246 , p = 0.62 ) ( figure 2a ) . a , low expression of prune2 protein ; b , high expression of prune2 protein . to validate these results and further evaluate the prognostic role of prune2 in leiomyosarcoma , we used a larger cohort of leiomyosarcoma tissue samples from tmucih . in this set of 45 samples , prune2 was also predominantly detected in the cytoplasm ; and 62.2% ( 28/45 ) had low expression , while 37.8% ( 17/45 ) had high expression . we also analyzed the association between prune2 protein expression and clinicopathologic factors , and found that prune2 protein expression was significantly associated with tumor size ( p = 0.03 ) and the absence of hemorrhage / cyst ( p = 0.014 ) ( table 1 ) . in addition , univariate analysis showed that there was a significant association between prune2 protein expression and overall survival ( = 5.399 , p = 0.02 ) ( figure 2b ) , with longer survival noted among patients with high levels of the protein . furthermore , multivariate analysis revealed that high prune2 protein expression was an independent , favorable prognostic factor for overall survival ( hr = 0.373 , p = 0.025 ) . a , prune2 protein expression is not significantly associated with overall survival in patients from md anderson cancer center ; b , prune2 protein expression is significantly associated with overall survival in patients from tianjin medical university cancer institute & hospital . in the 30 leiomyosarcoma tissues from mdacc , prune2 protein staining was predominantly in the cytoplasm of cells ( figure 1 ) . low expression was discovered in 63.3% ( 19/30 ) of the samples ( figure 1a ) , while high expression was observed in 36.7% ( 11/30 ) ( figure 1b ) . to investigate the prognostic role of prune2 , we analyzed the association between prune2 protein expression and overall survival . univariate analysis showed that prune2 protein expression had no significant association with overall survival ( = 0.246 , p = 0.62 ) ( figure 2a ) . a , low expression of prune2 protein ; b , high expression of prune2 protein . to validate these results and further evaluate the prognostic role of prune2 in leiomyosarcoma , we used a larger cohort of leiomyosarcoma tissue samples from tmucih . in this set of 45 samples , prune2 was also predominantly detected in the cytoplasm ; and 62.2% ( 28/45 ) had low expression , while 37.8% ( 17/45 ) had high expression . we also analyzed the association between prune2 protein expression and clinicopathologic factors , and found that prune2 protein expression was significantly associated with tumor size ( p = 0.03 ) and the absence of hemorrhage / cyst ( p = 0.014 ) ( table 1 ) . in addition , univariate analysis showed that there was a significant association between prune2 protein expression and overall survival ( = 5.399 , p = 0.02 ) ( figure 2b ) , with longer survival noted among patients with high levels of the protein . furthermore , multivariate analysis revealed that high prune2 protein expression was an independent , favorable prognostic factor for overall survival ( hr = 0.373 , p = 0.025 ) . a , prune2 protein expression is not significantly associated with overall survival in patients from md anderson cancer center ; b , prune2 protein expression is significantly associated with overall survival in patients from tianjin medical university cancer institute & hospital . the most important contribution of this study is that we found a significant association between prune2 protein expression and overall survival , and that prune2 protein expression was an independent prognostic factor for leiomyosarcoma . more specifically , leiomyosarcoma patients with higher prune2 protein expression exhibited a better survival trend , suggesting that increased levels of the protein might be a favorable prognostic factor for leiomyosarcoma . similarly , in neuroblastoma and prostate cancer , prune2 protein is highly expressed and also plays a prognostic role , . on the other hand , we found no statistically significant association between prune2 mrna expression and survival time in tissue samples from patients at mdacc in our previous study . here , kaplan - meier survival analysis revealed no significant relationship between overall survival time and prune2 protein expression in samples from mdacc , which is consistent with our previous result . nevertheless , in the larger cohort of samples from tmucih , prune2 protein expression showed a significant association with overall survival and was an independent prognostic factor . possible causes are the differences in race among the patients from each center and in the number of cases . we also found that prune2 protein expression was significantly associated with tumor size and hemorrhage / cyst . specifically , prune2 protein expression was higher in the smaller tumor size group ( < 10 cm ) . because prune2 plays an important role in regulating cell differentiation and apoptosis , this result suggests that patients with larger tumors may have worse survival . leiomyosarcoma is a rare soft tissue tumor that can occur anywhere in the human body . several factors have been reported to predict poor outcomes in patients with leiomyosarcoma , including advanced age , vascular invasion , dna aneuploidy , and c - myc expression , , . in particular , c - myc expression was reported to be a marker for poor prognosis in leiomyosarcoma . in this study , we have identified that prune2 protein expression level can serve as a prognostic factor for leiomyosarcoma . in conclusion , we report the association between prune2 protein expression and prognosis in human leiomyosarcoma . survival time was longer in tmucih leiomyosarcoma patients with higher expression of prune2 protein . this suggests that prune2 may be involved in the process of leiomyosarcoma development and can be regarded as a biomarker for favorable prognosis . further study is necessary to better understand the role that racial factors play for the relationship between prune2 protein expression and prognosis in patients with leiomyosarcoma , and discover new therapeutic strategies against aggressive leiomyosarcoma .

prune2 plays an important role in regulating tumor cell differentiation , proliferation , and invasiveness in neuroblastoma . our previous study revealed that prune2/obscn two - gene relative expression classifer accurately differentiated leiomyosarcoma from gastrointestinal stromal tumor . however , the association between prune2 expression and prognosis in leiomyosarcoma is poorly understood . in this study , we evaluated the prognostic role of prune2 in leiomyosarcoma . prune2 expression was detected using immunohistochemistry in 30 formalin - fixed , paraffin - embedded leiomyosarcoma tissues from md anderson cancer center , and high expression was detected in 36.7% ( 11/30 ) of the samples . to validate these results , immunohistochemistry was performed on another cohort of 45 formalin - fixed , paraffin - embedded leiomyosarcoma tissues from tianjin medical university cancer institute & hospital , and high prune2 protein expression was detected in 37.8% ( 17/45 ) of the samples . moreover , elevated prune2 expression was significantly associated with tumor size ( p = 0.03 ) and hemorrhage / cyst ( p = 0.014 ) , and was an independent favorable prognostic factor for overall survival in leiomyosarcoma patients from tianjin medical university cancer institute & hospital ( p < 0.05 ) . these data suggest that increased prune2 protein expression may serve as a favorable prognostic marker in human leiomyosarcoma .

Materials and Methods Patients and clinical information Immunohistochemical (IHC) analysis Statistical analysis Results The protein expression and prognostic role of PRUNE2 in leiomyosarcoma samples from MDACC The protein expression and prognostic role of PRUNE2 in leiomyosarcoma samples from TMUCIH Discussion

child abuse is defined as any physical or emotional injury which causes harm or substantive risk of harm to the child 's health or welfare . it includes sexual abuse , neglect , or being physically dependent upon an addictive drug at birth . types of child abuse , include physical abuse , emotional abuse and neglect , healthcare neglect ( medical and dental ) , physical neglect , sexual abuse , failure to thrive , safety neglect , intentional poisoning , and munchausen syndrome by proxy ( fabricated or induced illness by parent ) . factors contributing to abuse include stress[35 ] ( e.g. life crises such as unemployment or homelessness ) , lack of a support network , substance / alcohol abuse , learned behavior ( many abusers were previously victims ) , and other forms of family violence in the home such as spousal or elderly abuse.[69 ] craniofacial , head , face , and neck injuries happen in more than half of the cases of child abuse . although the oral cavity is a frequent point of sexual abuse in children , obvious oral injuries or infections are rare . the american academy of pediatric dentistry defined dental neglect as the willful failure of a parent or guardian to seek and follow through with treatment necessary to ensure a level of oral health essential for adequate function and freedom from pain and infection . indeed , many dentists who regularly treat children assert that management of dental neglect is part of daily practice . however , based on the literature , dentists feel unprepared to play a child protection role and are unsure what to do if they suspect that a child has been maltreated.[1215 ] the aim of this study was to provide data on prevalence and factors of orofacial lesions relating child abuse in iran to lend evidence to support preventing child abuse . the overall approach was a case - note review of children with child abuse history recording by personnel of social services . the social emergency services are legally eligible to separate the victims of child abuse from their families as well as interview the children and their families in order to solve their problems . research ethical approval was sought from the central social service organization as well as ethics committee of isfahan university of medical sciences . this study was conducted in isfahan , iran . for study inclusion , participating children had to have identifiable records of abuse during 2007 - 2011 . inclusion criteria for children dictated that they had been exposed to at least one child abuse event during this period . the data collected retrospectively for each child , from their existing records , were as follows : type of abuse : physical , sexualpatient characteristics : age , gender type of abuse : physical , sexual patient characteristics : age , gender descriptive statistics were used to describe child - related sociodemographic and clinical data . type of child abuse , gender , age , and the type of abuser was described using appropriate measures of spread . exploratory analyses including bivariate analyses and correlation were used to analyze the relationship of different variables such as child gender , age , abuse experience , abuse type as well as abuser type . all statistical tests were repeated using these data and found the same relationships between variables as identified for the original data set . for study inclusion , participating children had to have identifiable records of abuse during 2007 - 2011 . inclusion criteria for children dictated that they had been exposed to at least one child abuse event during this period . the data collected retrospectively for each child , from their existing records , were as follows : type of abuse : physical , sexualpatient characteristics : age , gender type of abuse : physical , sexual patient characteristics : age , gender type of child abuse , gender , age , and the type of abuser was described using appropriate measures of spread . exploratory analyses including bivariate analyses and correlation were used to analyze the relationship of different variables such as child gender , age , abuse experience , abuse type as well as abuser type . all statistical tests were repeated using these data and found the same relationships between variables as identified for the original data set . data were obtained for 301 children from social services records . there was an equal gender distribution amongst children gender . the mean age of children when abuse had been occurred was 8 years ( sd = 1.68 ) which was categorized to seven age groups [ table 1 ] , and there were approximately an equal number of boys and girls [ table 2 ] . children had a high physical experience ( 66.1% ) ; of these children , at least 69% sustained trauma to the face and mouth . emotional abuse was 77.1% , neglect was 64.1% , and lower experience of sexual abuse which was 4.1% . age of children having child abuse records categorized to seven age groups the gender distribution of children having child abuse records during 2007 - 2011 exploratory bivariate analyses revealed a significant relationship between the frequency of abuse with gender and age , p = 0.008 and 0.015 , respectively . having problem such as being a mental retired and hyperactive child shows significant relationship with gender , p = 0.03 and 0.02 , respectively , which was in the favor of males . there was a strong relationship between gender and abuser which shows girls have been affected by stepfathers , p = 0.001 . there was also strong relationship between age of child and age of abuser , p = 0.001 . however , there were no significant differences regarding age of abuser and gender of the child . the mean age of children when abuse had been occurred was 8 years ( sd = 1.68 ) which was categorized to seven age groups [ table 1 ] , and there were approximately an equal number of boys and girls [ table 2 ] . children had a high physical experience ( 66.1% ) ; of these children , at least 69% sustained trauma to the face and mouth . emotional abuse was 77.1% , neglect was 64.1% , and lower experience of sexual abuse which was 4.1% . age of children having child abuse records categorized to seven age groups the gender distribution of children having child abuse records during 2007 - 2011 exploratory bivariate analyses revealed a significant relationship between the frequency of abuse with gender and age , p = 0.008 and 0.015 , respectively . having problem such as being a mental retired and hyperactive child shows significant relationship with gender , p = 0.03 and 0.02 , respectively , which was in the favor of males . there was a strong relationship between gender and abuser which shows girls have been affected by stepfathers , p = 0.001 . there was also strong relationship between age of child and age of abuser , p = 0.001 . however , there were no significant differences regarding age of abuser and gender of the child . the main purpose of this study was to obtain preliminary data to provide data on child abuse - related orofacial lesions in order to lend evidence to prevent child abuse . this was considered important as there is a paucity of current data on the incidence of child abuse in all over the world and there is recognized need to evaluate the evidence to support dentists in different aspects of service provision . results of previous studies show that trauma to the head and associated areas occurs in approximately 50% of the cases of physically abused children and soft tissue injuries most frequently bruises are the most common injury to head and face . these findings make it obvious that dentists are in a position to detect child abuse . the british study by skinner and castle ( 1967 ) documented the injuries to 78 abused children requiring medical attention ; of these children , at least 34 ( 43.5% ) sustained trauma to the face and mouth . this may be an underestimate since some of the bruises were reported without noting the region . the majority of the injuries were bruises , but they also included lacerations , bites , and abrasions which support the results of our study . however , in our study , 60% of children had trauma to the face and head which was a higher prevalence . national figures in usa indicate that as many as 1 million children are abused and/or neglected annually and of these about 1000 die each year . if we assume that half of these cases involve trauma to the head , as is indicated in the literature , our profession is definitely in a position to detect and assist substantial numbers of victim - abused children . in this way , we can help to refer them to social security agencies and prevent further continuing trauma to the children by bringing help to these troubled families . the majority of victim - abused cases in our study were lower than ten years old . stress and trauma of them permanently impacted any aspects of their future life , especially in girls . the cost of orofacial trauma makes heavy burden on social security agencies and their families . the main purpose of this study was to obtain preliminary data to provide data on child abuse - related orofacial lesions in order to lend evidence to prevent child abuse . this was considered important as there is a paucity of current data on the incidence of child abuse in all over the world and there is recognized need to evaluate the evidence to support dentists in different aspects of service provision . results of previous studies show that trauma to the head and associated areas occurs in approximately 50% of the cases of physically abused children and soft tissue injuries most frequently bruises are the most common injury to head and face . these findings make it obvious that dentists are in a position to detect child abuse . the british study by skinner and castle ( 1967 ) documented the injuries to 78 abused children requiring medical attention ; of these children , at least 34 ( 43.5% ) sustained trauma to the face and mouth . this may be an underestimate since some of the bruises were reported without noting the region . the majority of the injuries were bruises , but they also included lacerations , bites , and abrasions which support the results of our study . however , in our study , 60% of children had trauma to the face and head which was a higher prevalence . national figures in usa indicate that as many as 1 million children are abused and/or neglected annually and of these about 1000 die each year . if we assume that half of these cases involve trauma to the head , as is indicated in the literature , our profession is definitely in a position to detect and assist substantial numbers of victim - abused children . in this way , we can help to refer them to social security agencies and prevent further continuing trauma to the children by bringing help to these troubled families . the majority of victim - abused cases in our study were lower than ten years old . stress and trauma of them permanently impacted any aspects of their future life , especially in girls . the cost of orofacial trauma makes heavy burden on social security agencies and their families . this is the first study in iran to provide data for the evaluation of orofacial lesions relating child abuse . preliminary data suggest that there are strong evidence regarding the incidence of child abuse relating orofacial lesions which dentists should be aware of them . future trials may draw based on these useful baseline data to help their study design .

background : family violence , including child abuse , neglect , and domestic violence , is a public health problem . the aim of this study was to provide data on prevalence and factors of orofacial lesions relating child abuse in iran to lend evidence to support preventing child abuse.materials and methods : the overall approach was a case - note review of children having child abuse note , recording by personnel of social services . research ethical approval was sought from the central social service organization . this study was conducted in isfahan , iran ( 2011).result : the mean age of children , when abuse had been occurred was 8 years ( sd = 1.68 ) , and there were approximately an equal number of boys and girls . children had a high physical experience ( 66.1%).of these children , at least 60% sustained trauma to the face and mouth . emotional abuse was 77.1% , neglect was 64.1% , and lower experience of sexual abuse which was 4.1% . there was a strong relationship between gender and abuser which shows girls have been affected by stepfathers ( p = 0.001).conclusion : preliminary data suggest that there are strong evidence regarding the incidence of child abuse relating orofacial lesions which dentists should be aware of them . future trials may draw on these useful baseline data to help their study design .

INTRODUCTION MATERIALS AND METHODS Participants Data analysis RESULTS Patient details Outcomes DISCUSSION Key findings CONCLUSION

oncocytes are observed in lesions of several organs such as the thyroid , kidney , pancreas , ovary , liver , and salivary gland . in the salivary glands , oncocytes are known to arise in warthin tumor , oncocytoma , oncocytic carcinoma , and oncocytosis . oncocytosis is a rare non - neoplastic lesion that is classified as diffuse oncocytosis and multifocal adenomatous oncocytic hyperplasia ( maoh ) ; it comprises approximately 0.1% of salivary gland lesions [ 3 , 4 ] . the correct cytological diagnosis of oncocytosis can be difficult because oncocytes are seen in a variety of other salivary gland lesions , and it is usually diagnosed by histological examination [ 5 , 6 , 7 , 8 ] . here she consulted an otolaryngology clinic because of discomfort at the left side of her neck . at the clinic , a mass was noted in the left side of her neck and she was referred to our hospital . a 1.5-cm mass with no lymph node swelling was identified using magnetic resonance imaging . from the above clinical findings , warthin tumor or a malignant parotid tumor was suspected . five slides were prepared for cytological evaluation , including 3 fixed smears for papanicolaou staining , 1 air - dried smear for may - grnwald giemsa ( mgg ) staining , and 1 smear examined by liquid - based cytology ( lbc ) based on the lbc technique . papanicolaou staining of direct smears revealed a loose sheet - like cluster formed of round to polygonal cells with granular cytoplasm against a hemorrhagic background . the cells had round to oval , centrally located nuclei with granular chromatin and without distinct nucleoli . in the lbc preparation , the cytoplasm showed microvacuoles in contrast to the direct smear ( fig . there were only a few lymphocytes , and basophils were not detected in any of the smears . the cut surface of the resected lesion revealed a milky - white lobular mass with an unclear border ( fig . microscopically , the lesion was formed of many variable - sized nodules that comprised oncocyte - like cells with small round nuclei and eosinophilic granular cytoplasm . a definite capsule was not seen around the nodules and the surrounding adipose tissue and acinus . the oncocyte - like cells were diffusely positive for cytokeratin antibodies and strongly positive for mitochondrial antibodies ( fig . basophils were not detected in the lesion , using immunohistological staining based on anti - cd117 ( c - kit ) antibodies . typical findings for low - grade cancer of the salivary glands were not observed . from the above findings it has been reported that maoh develops in women in their 60s and is localized unilaterally in the parotid glands . histologically , maoh is thought to arise from the ductal epithelium and the remnants of the original salivary gland . the lesion was observed unilaterally in the left parotid gland in a 71-year - old woman . the remnants of the existing salivary ducts were observed by p63 and ck34e12 staining , and a strong response to mitochondrial antibodies was found in the cytoplasm . from the above findings described the cytological findings of maoh in a case report : ( 1 ) a low n / c ratio ; ( 2 ) central round nuclei ; ( 3 ) anisonucleosis ; ( 4 ) prominent nucleoli ( in part of the cells ) , and ( 5 ) abundant eosinophilic cytoplasm . in the present case , however , we could not make a diagnosis of maoh cytologically because of the high n / c ratio and because the nucleoli were unclear . cytologically , the major lesions in which oncocytes are observed include warthin tumor , oncocytoma , and oncocytic carcinoma . typical cytological findings of warthin tumor reveal oncocytes and lymphocytes with an inflammatory or necrotic background . have reported that mast cells are present with oncocytes in fine - needle aspiration preparations . kobayashi et al . have investigated the frequency of mast cells in cytological samples , as compared with immunocytochemical identification using human mast cell tryptase antibodies in warthin tumor , and have indicated that mast cells are frequent in the epithelial cell component . in contrast , there are no reports to suggest any association with mast cells of other lesions . we also searched for mast cells by cytological mgg staining and immunohistochemical staining using the cd117 ( c - kit ) antibody . . the identification of basophils seems to be a diagnostic checkpoint when differentiation from warthin tumor is necessary . however , the typical cytological findings such as a lymphocyte and/or basophil appearance were not observed in any of the cases , which may thus be mistakenly diagnosed as oncocytoma or maoh . cytological features of oncocytoma comprise large , round to polygonal cells with abundant granular cytoplasm , centrally located nuclei , prominent nucleoli , binucleation , sheet - like clustering , and an often necrotic background . in oncocytic carcinoma , although the neoplastic cells are pleomorphic , with nuclear atypia and hyperchromatism , other findings overlap with oncocytoma [ 7 , 8 , 13 ] . thus , it can be difficult to differentiate between maoh , warthin tumor , and oncocytoma . in addition , a case of oncocytoma arising from maoh has been reported . however , the distinction between maoh and oncocytoma is possible by capsular interpretation . therefore , it should be noted that neoplastic identification can not be achieved from partial samples microscopically . furthermore , oncocytic metaplasia has recently been shown in other salivary gland lesions ( e.g. , pleomorphic adenoma , myoepithelioma , and mucoepithelial carcinoma ) , except for maoh , warthin tumor , and oncocytic tumor . therefore , it is necessary to carefully carry out the assessment of oncocytes . when oncocytes are observed , it is necessary to perform a surgical resection . the authors have no potential conflicts of interest with respect to the authorship and/or publication of this article .

multifocal adenomatous oncocytic hyperplasia ( maoh ) is a non - neoplastic lesion that is classified as oncocytosis . maoh is a rare entity of the parotid gland and accounts for approximately 0.1% of salivary gland lesions . here , we report a case of maoh of the parotid gland . the patient was a 71-year - old woman who presented with discomfort at the left side of her neck . fine - needle aspiration cytology of the parotid gland revealed a loose sheet - like cluster of round to polygonal cells with granular cytoplasm against a hemorrhagic background . the cells had round to oval , centrally located nuclei with granular chromatin and without distinct nucleoli . histologically , the lesion was formed of many variable - sized nodules , comprising oncocyte - like cells with small round nuclei and eosinophilic granular cytoplasm that was positive for mitochondrial antibodies . the diagnosis of maoh is difficult to make by cytology alone , because the findings overlap with those of other oncocytic lesions . in particular , the cytological findings of maoh have not been sufficiently reported to date . a correlation of cytology and histology was expected .

Introduction Case Presentation Cytological Findings Histological Findings Discussion Disclosure Statement

a 59 year - old female with a family history of mcd presented to our clinic with progressive loss of vision over a 40-year period . there were multiple irregular grayish - white , dense , poorly delineated spots in the stroma . because her parents died at an early age , her family history was unclear . of note , her only son complained of foggy vision and was 37 years old . his slit lamp examination revealed a similar , but less severe appearing corneal exam compared to that of his mother ( fig . one year post - operatively , that patient had a best - corrected visual acuity of 20 / 100 od and a clear cornea graft . informed consent for both the clinical examinations and dna analyses was obtained from the patient and her son in accordance with the declaration of helsinki . the study was approved by the institutional review board at the catholic university of korea , st . hematoxylin and eosin ( he ) , alcian blue , periodic acid - schiff ( pas ) , colloidal iron , and masson 's trichrome stains were performed on the specimen using standard techniques . for transmission electron microscopy , the corneal specimen was immersed immediately in a fixative solution containing 3% glutaraldehyde with 0.2 m sodium cacodylate at a ph of 7.4 . after overnight fixation , the fixative solution was removed and replaced with a phosphate buffer , followed by 1% osmium tetroxide buffered with sodium cacodylate . after one hour , the osmium was replaced with increasing concentrations of ethanol through propylene oxide , and the tissue was embedded in the epoxy . the embedded tissue was then sectioned with an ultra - microtome into 1 m - thick sections , and stained with toluidine blue . the area to be observed was placed under a light microscope , ultra - sectioned from 60 to 100 nm in thickness , double stained with uranyl acetate and lead citrate , and examined via transmission electron microscope ( jem 1010 ; jeol , tokyo , japan ) . the unique exon involving the coding region , exon 3 , was amplified via polymerase chain reaction ( pcr ) with the previously described primers . the cycling program began with an initial denaturing step of 5 minutes at 95 followed by 33 cycles of 94 for 30 seconds , 53 to 57 for 30 seconds , and 72 for 45 seconds with a final extension step at 72 for 10 minutes . the pcr products were purified and sequenced directly on both strands using an automatic dna sequencer ( abiprism 377xl ; applied biosystems , foster city , ca , usa ) . the nucleotide sequences were compared with the published cdna sequence of chst6 ( nm_021615 ) . he staining revealed faintly basophilic deposits between the stromal lamellae , and within keratocytes and endothelial cells . these deposits were positive to alcian blue , pas , and colloidal iron stain , but negative to masson 's trichrome stain ( fig . electron microscopy revealed keratocytes distended by membrane - bound intracytoplasmic vacuoles containing electron - dense fibrillogranular material . one missense mutation was identified in a homozygous state ( p.arg205trp [ c.613c > t ] ) , which had not been previously reported . samples from the patient 's son also showed the same missense mutation ( p.arg205trp [ c.613c > t ] ) ( fig . hematoxylin and eosin ( he ) , alcian blue , periodic acid - schiff ( pas ) , colloidal iron , and masson 's trichrome stains were performed on the specimen using standard techniques . for transmission electron microscopy , the corneal specimen was immersed immediately in a fixative solution containing 3% glutaraldehyde with 0.2 m sodium cacodylate at a ph of 7.4 . after overnight fixation , the fixative solution was removed and replaced with a phosphate buffer , followed by 1% osmium tetroxide buffered with sodium cacodylate . after one hour , the osmium was replaced with increasing concentrations of ethanol through propylene oxide , and the tissue was embedded in the epoxy . the embedded tissue was then sectioned with an ultra - microtome into 1 m - thick sections , and stained with toluidine blue . the area to be observed was placed under a light microscope , ultra - sectioned from 60 to 100 nm in thickness , double stained with uranyl acetate and lead citrate , and examined via transmission electron microscope ( jem 1010 ; jeol , tokyo , japan ) . the unique exon involving the coding region , exon 3 , was amplified via polymerase chain reaction ( pcr ) with the previously described primers . the cycling program began with an initial denaturing step of 5 minutes at 95 followed by 33 cycles of 94 for 30 seconds , 53 to 57 for 30 seconds , and 72 for 45 seconds with a final extension step at 72 for 10 minutes . the pcr products were purified and sequenced directly on both strands using an automatic dna sequencer ( abiprism 377xl ; applied biosystems , foster city , ca , usa ) . the nucleotide sequences were compared with the published cdna sequence of chst6 ( nm_021615 ) . he staining revealed faintly basophilic deposits between the stromal lamellae , and within keratocytes and endothelial cells . these deposits were positive to alcian blue , pas , and colloidal iron stain , but negative to masson 's trichrome stain ( fig . electron microscopy revealed keratocytes distended by membrane - bound intracytoplasmic vacuoles containing electron - dense fibrillogranular material . one missense mutation was identified in a homozygous state ( p.arg205trp [ c.613c > t ] ) , which had not been previously reported . samples from the patient 's son also showed the same missense mutation ( p.arg205trp [ c.613c > t ] ) ( fig . in this study , we describe histopathological findings and a novel mutation in the chst6 gene ( p.arg205trp [ c.613c > t ] ) in a case of mcd . light microscopy revealed abnormal deposits of glycosaminoglycans in bowman 's histiocytes and keratocytes , as well as between the stromal lamellae , descemet 's membrane , and endothelium . electron microscopy revealed that these deposits corresponded to electron - lucent fibrillogranular material visible within membrane - bound intracytoplasmic vacuoles . such abnormalities have been identified as sequelae of an error in glycosaminoglycans metabolism within the cornea . in particular , errors in proteoglycan keratan sulfate ( ks ) metabolism the product of the chst6 gene , corneal n - acetylglucosamine-6-sulfotransferase ( c - glcnac6st ) , has been demonstrated to catalyze the sulfation of glcnac in ks . in normal corneal tissue chst6 can transfer a sulfuric acid group from the 3'-adenosine 5'-phosphate acid to ks via competition with an endogenous or exogenous substrate . the variations in the coding region of chst6 may reduce enzyme activity or cause it to be lost , resulting in a low sulfated form or non - sulfated form of ks . due to the loss of its soluble properties , non - sulfated ks can not be completely metabolized , inducing the deposition of sediment in the corneal stroma . the mutation identified in this korean patient is different from those reported previously in asians ( japanese and chinese ) or whites ( american , british , and icelandic ) . although the p.arg205gln mutation has been reported in a southern indian patient , the p.arg205trp mutation has not been reported previously . the immunophenotype of mcd was not performed in our study since we could not test ks serum levels . regardless of the type of macular corneal dystrophy , the patient showed indistinguishable clinical characteristics linked to the same responsible gene . in summary , we identified a novel homozygous missense mutation in chst6 in a korean patient with macular corneal dystrophy . this novel gene mutation expands the mutation spectrum of the chst6 gene and contributes to the study of molecular pathogenesis of corneal dystrophy . further studies on these mutations would be helpful in further understanding the molecular mechanisms underlying macular corneal dystrophy .

to report a novel mutation within the chst6 gene , as well as describe light and electron microscopic features of a case of macular corneal dystrophy . a 59-year old woman with macular corneal dystrophy in both eyes who had decreased visual acuity underwent penetrating keratoplasty . further studies including light and electron microscopy , as well as dna analysis were performed . light microscopy of the cornea revealed glycosaminoglycan deposits in the keratocytes and endothelial cells , as well as extracellularly within the stroma . all samples stained positively with alcian blue , colloidal iron , and periodic acid - schiff . electron microscopy showed keratocytes distended by membrane - bound intracytoplasmic vacuoles containing electron - dense fibrillogranular material . these vacuoles were present in the endothelial cells and between stromal lamellae . some of the vacuoles contained dense osmophilic whorls . a novel homozygous mutation ( c.613 c > t [ p.arg205trp ] ) was identified within the whole coding region of chst6 . a novel chst6 mutation was detected in a korean macular corneal dystrophy patient .

Case Report Histopathologic examination DNA analysis Results Discussion

various methods including chemical , electro - chemical , and physical deposition techniques have been employed to synthesize 1d zno nanostructures [ 3 - 5 ] . on the other hand , the wet - chemical methods [ 6 - 8 ] have been used for producing varied zno one - dimensional ( 1d ) nanostructures , such as nanotube , nanopencil , nanoneedle , and nanoscrew . recent experiments have shown that the zno 1d nanostructures have excellent field emission properties , far better than other semiconductors . an important advantage of using aligned nanorods , nanowires , nanobelts , and nanotubes for field emission is their high aspect ratio . the field enhancement factor is a key parameter which is determined by turn - on field , threshold field , and work function . also , the value of relates to the structure , shape , size , alignment , crystalline , aspect ratio , etc . . many effects , such as morphological effects , surface states , and densities of nanorods have been studied . the result showed that the zno nanoneedle arrays exhibit excellent properties due to their small emitter radius and high nanorod density remarkably reduces the local field at the emitters owing to the screening effect . wang et al . investigated the density effects on the field emission of zno nanorods and pointed out that the mezzo density of zno nanorods had the best field emission properties . but there is no report about the aspect ratio effects on the field emission properties of zno nanorod arrays . in this work , zno nanrod arrays with different aspect ratios and densities are synthesized by controlling the reaction times and concentrations of solution . the field emission properties of zno nanorod arrays with different aspect ratios and densities have been investigated for showing the enhancement factor was enhanced with increasing the aspect ratio of zno nanorods and the enhancement factor was decreased with reducing the density of nanorods . an optimum density and aspect ratio of zno nanorod arrays ( sample c ) the zno nanorod arrays were prepared on a silicon wafer ( 4 5 cm ) through a multi - step hydrothermal process . firstly zno nanocrystals colloid ( 4 10 m ) is spin - coated 15 times on the silicon wafer at the speed of 3000 r / s to form a thick film of zno nanocrystals and zno nanocrystlas film annealed at 400 c for 2 h under atmosphere . then the silicon wafer is immersed into the aqueous solution ( 250 ml ) of 0.04 m zinc nitrate hexahydrate / hexamethylenetetramine at 75 c . after keeping it for 10 h in this solution , the surface of silicon wafer is coated for forming a layer of white film , which is washed by deionized water three times , and dried in air at room temperature . a piece of the silicon wafer ( 1 4 cm ) is cut as sample a. the remnant wafer ( 4 4 cm ) is reinserted into the aqueous solution ( 250 ml ) of 0.04 m zinc nitrate hexahydrate / hexamethylenetetramine at 75 c for 10 h and the sample b is obtained by cutting a piece from the above mentioned silicon wafer ( 1 4 cm ) . the nanorods are able to form bundles if the sample b is immersed into 0.04 m aqueous solution of zinc nitrate hexahydrate / hexamethylenetetramine at 75 c for 10 h. the concentration of reaction solution is reduced to 0.03 m and a remnant wafer ( 3 4 cm ) is kept into the aqueous solution ( 250 ml ) of 0.03 m of zinc nitrate hexahydrate / hexamethylenetetramine at 75 c for 10 h and the sample c ( 1 4 cm ) is obtained from the above method the arrays of zno nanorods are characterized and analyzed by field emission scanning electron microscopy ( fesem ) and x - ray diffraction ( xrd ) . the sem images are obtained with a jeol jsm 6700f field emission scanning electron microscope . the xrd patterns are recorded with a japan rigaku d / max-2500 rotation anode x - ray diffractometer equipped with graphite - monochromatized cu k radiation ( = 1.54178 ) , employing a scanning rate of 0.05sin the 2 range from 20 to 60. the field emission properties of zno nanorod arrays are measured using a two - parallel - plate configuration in a homemade vacuum chamber at a base pressure of ~1.0 10 pa at room temperature . the sample is attached to one of the stainless - steel plates which is cathode with the other plate as anode . a direct current voltage sweeping from 0 to 5000 v was applied to the sample at a step of 50 v. the emission current is monitored using a keithley 6485 picoammeter . 1 . the diffraction peaks are identified to match the hexagonal zno crystalline with wurtzite structure and preferentially aligned in the c - axis direction . as shown in fig . 2 , for the samples a , b , c , d , and e , the zno nanorod arrays aligned on the silicon wafers . the average radiuses of samples a , b , c , d , and e are 90 2 nm , 125 5 nm , 136 5 nm , 150 5 nm , and 168 5 nm , respectively . the average lengths of samples a , b , c , d , and e are 2.5 0.05 m , 4.2 0.05 m , 5.3 0.05 m , 6.3 0.1 m , and 7.4 0.1 m , respectively . from sample a to sample b the average radiuses and lengths of zno nanorods obviously increased about to 35 nm and 1.7 m when the reaction times are increased . from sample b to sample e , the average radiuses and lengths of zno nanorods equably increased by ~15 nm and ~1 m . the radiuses and lengths of zno are able to be accurately controlled by adjusting the concentration of reactants and reaction times . the average spacing of nanorods of samples a , b , c , d , and e are 195 10 nm , 183 10 nm , 167 10 nm , 143 10 nm , and 126 10 nm , respectively . the average radiuses , lengths , and spacing of the nanorods are listed in table 1 . the aspect ratios of the samples a , b , c , d , and e are 28 , 34 , 39 , 42 , and 44 , respectively . xrd patterns of those zno nanorod arrays the sem images of samples a , b , c , d , and e. the inset images are the section view of samples the morphological characteristic and field emission property of zno nanorod arrays . ( r : the average radius;l : the length of nanorod; : the field enhance factor;s : the spacing of nanorods ) the current density electric field ( j e ) curves and the corresponding fowler - nordheim ( f - n ) plots of zno nanorod arrays are illustrated in fig . the important field emission parameters extracted from these current density electric field ( j we define the turn - on field ( eto ) and the threshold field ( eth ) as the applied electric fields required to produce a current of 10 a / cmand 1 ma / cm , respectively . the etoof samples a , b , c , d , and e are 6.33 v/m , 5.16 v/m , 3.83 v/m , 4.16 v/m and 4.65 v/m , respectively . the ethof sample a , b , c , d and e are 8.58 v/m , 7.43 v/m , 5.65 v/m , 6.57 v/m , and 6.97 v/m , respectively . the sample c has the lowest turn - on field ( 3.83 v/m ) and threshold field ( 5.65 v/m ) , which indicates that the sample c has the best field emission properties in these samples . the field emission properties of zno nanorod arrays : ( a ) j e plots . ( b ) the corresponding f - n plots to further analyze the field emission properties of the zno nanorod arrays , the class fowler - nordheim ( f - n ) law , which was induced on the basis of the electron emission properties from a semi - infinite flat metallic surface , was used to describe the relationship between the j and the local field nearby the emitter . is usually related to the average applied field e as follows : where d is the inter - electrode spacing , v is the applied voltage , and is the enhance factor . the f - n law is expressed as where , , and is the work function , which is estimated as 5.2 ev for zno . the enhance factor can be determined by fitting the slope value and taking a reasonable value . for those zno nanorod arrays , the f - n plots ( fig . 3b ) show a rough linear relationship , implying that a quantum - tunneling mechanism is responsible for the emission . the obtained field enhancement factors from the f - n plots are summarized in table 1 . the field enhancement factors of samples a , b , c , d , and e are 1103 , 1772 , 2612 , 2382 , and 1760 , respectively . the apparent reasons might be due to the screening effect [ 20 - 25 ] . an empirical model can be used to explain this phenomenon.(1)(2 ) l and r are the length and the radius of zno nanorods . 0 is the intrinsic field enhancement factor for a single emitter which is determined by the aspect ratio . is the field enhancement factor of the emitter array , which can be determined by the aspect ratio and the interspacing of nanorods ( density effect ) . s is the interspacing of nanorods . when the aspect ratio increases gradually , 0 will keep up with it . when the interspacing s decreasing , there exists a negative effect on the increment of . when s l , eq . the alterable parameter h is chosen 26 to fit the data of samples a and b. then using the formula ( 3 ) , the stimulant relationship of and l / r can be shown in fig . 4b which shows the sample c ( = 2885 ) has the highest field enhancement factor . , is not only related to aspect ratio but also dependent on s. for the low - density , the interspacing is large , and the screening effect is weak resulting in the field enhancement factor increasing with the increase of aspect ratio . for the small interspacing , the screening effect is able to be domain factor leading to decrease in the field enhancement factor . these two opposite effects take place simultaneously ; the enhancement factor shows a maximum value at balance point ( aspect ratio : 38.9 , interspacing : 178 nm ) , which is consistent with the sample c ( aspect ratio : 39 , interspacing : 167 10 nm ) , for producing an optimization of field emission properties . the arrays of zno nanorod with different aspect ratios and densities are constructed using a multi - step hydrothermal process by controlling the reaction times and concentrations . the results show that the aspect ratio and the density of nanorod arrays play key roles in the field emission . the field enhancement factorenhances with increasing the aspect ratio of the nanorod . for the small interspacing ( s ) , the screening effect may become the domain factor which will decrease the field enhancement factor. when the interspacing ( s ) is larger than 167 nm , the enhancement factorincreases with aspect ratio , linearly , while the screening effect can be negligible . but when thesis smaller than 167 nm , the screening effect becomes the domain factor . there exists a balance point ( aspect ratio : 38.9 , interspacing : 178 nm ) , in which the optimization field emission can be obtained . this work was supported by the national nature science foundation of china ( 20531060 , 20473102 , and 20571078 ) and the national basic research 973 program of china ( grant no .

zno nanorod arrays are prepared on a silicon wafer through a multi - step hydrothermal process . the aspect ratios and densities of the zno nanorod arrays are controlled by adjusting the reaction times and concentrations of solution . the investigation of field emission properties of zno nanorod arrays revealed a strong dependency on the aspect ratio and their density . the aspect ratio and spacing of zno nanorod arrays are 39 and 167 nm ( sample c ) , respectively , to exhibit the best field emission properties . the turn - on field and threshold field of the nanorod arrays are 3.83 v/m and 5.65 v/m , respectively . importantly , the sample c shows a highest enhancement of factor , which is 2612 . the result shows that an optimum density and aspect ratio of zno nanorod arrays have high efficiency of field emission .

Introduction Experimental Details Results and Discussion Conclusions Acknowledgment

the adverse consequences of the acquired immune deficiency syndrome ( aids ) or t cell immunodeficiency provide evidence of the vital role of cytotoxic t - lymphocytes ( ctl ) in the immune response . indeed , ctl are well - known elements of the immune response to virus - infected , tumour and allogeneic cells [ 13 ] . more recently , the role of ctl was expanded significantly when the ability to mediate direct killing of microbial pathogens was identified . research defining the precise mechanisms underlying ctl killing of microbes , however , is still in its infancy . remarkably , granulysin ( in contrast to granzymes ) has emerged as a fundamental mediator of microbial killing . the mode of action of granulysin appears to be through the disruption of membrane permeability . it follows that granulysin has been found to insert into the microbial membrane through ionic interactions between the positively charged amino acid residues and negatively charged phospholipids . insertion of granulysin in turn disrupts membrane permeability resulting in the influx of fluid into the cytoplasm and death by osmotic lysis . other mechanisms identified in the killing of tumor cells may also play a role , including ca influx and k efflux , and activation of a sphingomyelinase associated with the cell membrane to generate ceramide . ctl killing of extracellular pathogens involves direct microbial recognition by the ctl ( figure 1(a ) ) . in contrast to tumour and virus - infected cells , recognition of extracellular pathogens occurs through an apparent mhc - independent mechanism ( as microbes have not been found to express mhc ) . successful recognition induces the release of granulysin which may directly bind and kill the microbe . in the case of intracellular microbes these interactions , like recognition of tumor and virus - infected cells , are often mhc - restricted and antigen - specific . binding triggers the release of granulysin , which must enter the infected host cell for microbial killing to occur ( figure 1(b ) ) . this is thought to be mediated through perforin - generated pores in the host cell membrane . these pores facilitate the influx of extracellular ca which triggers the target cell to endocytose the damaged region of the membrane and internalize nearby granulysin [ 79 ] . alternatively , ctl may mediate lysis of the infected host cells releasing microbes which may then be recognized and killed by nearby ctl ( figure 1(c ) ) . to acquire microbicidal activity , this priming event can occur in response to cytokines such as t cell growth factors , stimulation by a mitogen , or antigen - specific responses . the receptors and signalling pathways involved in priming may be the same , but also might be quite distinct from the receptors and signalling that lead to immediate killing . following the priming event , the microbicidal ctl is then ready to receive the signal that triggers them to kill the pathogen . t cells from mice immunized with p. aeruginosa polysaccharide were stimulated with macrophages from nonimmune mice with or without the addition of heat - killed bacteria . macrophages had to be present during the priming , but surprisingly , heat - killed bacteria did not . this suggested that the bactericidal activity of these t cells was dependent on their interaction with macrophages but did not require presentation of p. aeruginosa antigens . supernatants collected from immune t cells exposed to macrophages and p. aeruginosa were found to kill p. aeruginosa in addition to staphylococcus aureus and escherichia coli suggesting that these t cells were producing a soluble bactericidal product . ctl have also been found to mediate killing of mycobacterium tuberculosis through the release of bactericidal products [ 1113 ] . m. tuberculosis growth was reduced as much as 74% in the presence of cd4 ctl and 84% in the presence of cd8 ctl . when cd8 ctl were pretreated with strontium chloride ( which depletes granule contents ) , it caused a clear reduction in the ability to kill m. tuberculosis that correlated with a marked decrease in granulysin content . in vitro , purified granulysin was able to kill extracellular m. tuberculosis in a dose - dependent fashion . however , killing of intracellular m. tuberculosis required the addition of perforin , which was not directly bactericidal , but was able to lyse m. tuberculosis - infected macrophages . together this data suggests that perforin facilitates entry of granulysin into m. tuberculosis - infected cells where granulysin can access and kill the intracellular pathogen . in vivo studies have provided additional support for the conclusion that perforin is required for cd8-mediated clearance of m. tuberculosis . in these studies , irradiated mice infected with m. tuberculosis were found to have a significantly greater bacterial load after receiving adoptively transferred perforin - deficient cd8 t cells compared to wild - type cd8 t cells . studies conducted with listeria innocua support a perforin - independent mechanism in which granulysin is actively taken up by the infected cell . both healthy and l. innocua - infected dendritic cells ( dc ) were found to take up recombinant granulysin in a temperature - sensitive manner , indicative of active internalization . furthermore , cholesterol depletion abrogated granulysin uptake and killing of infected dc , suggesting lipid raft involvement . this was further supported by data showing colocalization of granulysin and cholera toxin ( used as a marker of lipid rafts ) during and shortly following uptake . ninety minutes after uptake , granulysin was found to colocalize with phagosomes containing l. innocua dna . indeed , granulysin was found to kill both extracellular l. innocua and l. innocua - infected dc in a dose - dependent manner . while granulysin may function independently , another study found that perforin treatment ( whether simultaneous or sequential to granulysin treatment ) augmented granulysin - dependent killing of intracellular l. innocua which was not due to the formation of stable pores in the dc membrane . rather , perforin treatment was found to stimulate a transient change in the plasma membrane permeability ( assessed by ca influx ) that enhanced fusion of granulysin - containing endosomes with phagosomes containing l. innocua . the highest level of expression of granulysin occurred in patients afflicted with the localized tuberculoid form , rather than the disseminated lepromatous form of the disease . this correlation suggests that granulysin release by ctl may limit the spread and severity of m. leprae infection . cd4 t cell lines derived from tuberculoid leprosy lesions were found to lyse m. leprae infected macrophages and kill intracellular mycobacteria . strontium treatment abrogated both the cytolytic and bactericidal activity of these cd4 t cells , which suggested that killing was mediated through the granule - exocytosis pathway . blocking fas using anti - fas antibody also partially inhibited the cytolytic activity of two of four cd4 t cell lines suggesting that the fas - fasl pathway may also play a minor role in the lysis of m. leprae - infected cells . it follows that the extent of fas - fasl mediated lysis may depend on the nature of the ctl or the infected target cell . t cells stimulated with phytohemagglutinin ( pha ) , a mitogenic lectin , as well as various oxidative mitogens , antigens , and alloantigens were found to kill schistosomula . killing was found to correlate with increased binding to schistosomula suggesting a contact - dependent mechanism . in support of this , supernatants from pha - stimulated t cells were ineffective at killing , although the concentration of parasiticidal products in the supernatants may not have been high enough to mediate an appreciable response . moreover , it remains unclear how pha induces ctl parasiticidal activity . removal of pha prior to incubation of t cells with schistosomula was found to impair killing suggesting that pha may have an ulterior function in addition to stimulating t cell activation and proliferation . ctl killing of entameoba histolytica closely resembled that of schistosoma mansoni in many respects . first , nonspecific activation of t cells with pha was found to significantly enhance killing of e. histolytica trophozoites compared to unstimulated t cells . pha - stimulated t cells killed as many as 92% of trophozoites whereas amoebic viability in the presence of unstimulated t cells remained relatively unchanged . third , and surprisingly , killing required the continuous presence of pha , again alluding to direct participation . however , bridging the t cells and entameoba can not be the only mechanism by which pha participates in killing because at least 18 hours of preincubation was required to elicit killing . similarly , in studies with s. mansoni , pretreatment of schistosomula with pha was not sufficient to induce parasiticidal activity of unstimulated t cells . thus , pha appears to act both by activating the t cells as well as possibly functioning as a bridge for binding . specific activation of t cells isolated from patients with an amoebic liver abscess with an e. histolytica lysate also induced killing . in contrast to prior studies with pha [ 20 , 21 ] , stimulation with antigens from e. histolytica was found to augment binding intensity of t cells to the trophozoites rather than the binding frequency . thus , the more important determinants in killing amoeba may be the binding characteristics of the ctl rather than the number of ctl bound . anti - tnf- antibody blocked killing of immune t cells from mice immunized against e. histolytica , although large doses of tnf- did not directly kill the amoeba . these results demonstrate the complexity of the system and the possible role of additional mediators . t cells from mice immunized with p30 ( a t. gondii membrane protein ) and subsequently restimulated in vitro with p30 were found to kill extracellular t. gondii . unlike studies conducted with s. mansoni and e. histolytica [ 20 , 21 ] , killing of t. gondii appeared to be antigen specific . p30-antigen - specific splenocytes killed significantly more t. gondii than splenocytes stimulated with the mitogenic lectin , concanavalin a ( cona ) , despite greater t cell proliferation in response to cona . although antigen stimulation resulting in microbicidal priming was likely to have been mhc - restricted , killing was direct . since there is no evidence for expression of mhc or mhc - like molecules by t. gondii , this suggests that direct cytotoxicity was mhc - independent . mhc - unrestricted t cell killing of extracellular t. gondii has also been reported by others . however , the mechanism by which antigen - specificity is accomplished in the absence of mhc is not yet defined . ctl responses against intracellular t. gondii , on the other hand , have been found to proceed through an mhc - restricted mechanism . splenocytes from mice immunized against t. gondii mediated killing of both infected macrophages and intracellular t. gondii [ 26 , 27 ] . concanamycin , an inhibitor of the vacuolar atpase that is required to maintain perforin in lytic granules , significantly impaired killing , implicating perforin in the response against t. gondii . perforin - deficient mice chronically infected with t. gondii were found to have a higher rate of mortality and a greater number of brain cysts compared to wild - type mice , although other studies came to disparate conclusions . moreover , the ability of cd8 t cells to kill intracellular t. gondii is controversial . in one study , cd8 t cells failed to kill t. gondii - infected b cells as assessed by quantitative pcr of the sag-1 gene . t cells were found to kill blood - stage p. falciparum through a contact - dependent mechanism [ 3133 ] . killing appeared to be stage - dependent with extracellular merozoites being the suggested targets [ 31 , 32 ] . in vitro studies revealed a correlation between the parasiticidal activity of the t cells and expression of granulysin . together , this data indicates that parasiticidal ctl mediate killing of p. falciparum via the release of granulysin . several studies have reported the ability of ctl to kill the opportunistic fungus candida albicans . il-2 stimulation of murine splenocytes was found to induce fungicidal activity against c. albicans as well as several other candida species . anti - candida activity required at least 3 days of priming with il-2 and peaked at 7 days . the induction of fungicidal activity correlated with enhanced killing of an nk cell - resistant tumor cell line . supernatants taken from il-2 stimulated splenocytes had no effect on the growth of c. albicans suggesting a contact - dependent fungicidal mechanism . moreover , another study found that the cd8 t cells , and not nk1.1 cells ( nk cells ) , mediated fungicidal activity against c. albicans in response to il-2 . the ctl response against the yeast - like pathogen cryptococcus neoformans has been described extensively . in one of the earlier studies , lymphoid cells were isolated after mice had been immunized with heat - killed c. neoformans in complete freund 's adjuvant . the anticryptococcal activity of these cells was measured by assessing colony forming units , and delayed - type hypersensitivity was assessed by footpad swelling following administration of c. neoformans antigen . only lymphoid cells from immunized mice furthermore , the magnitude of the anticryptococcal activity correlated with the intensity of the delayed - type hypersensitivity response . t cells within the peripheral lymphoid compartment were found to be the mediators of the anticryptococcal activity . in another study , t cells were observed to interact directly with c. neoformans in vitro suggesting a contact - dependent mechanism of killing ( figure 2 ) . however , between 11 and 35% of t cells were found to bind to c. neoformans suggesting recognition by a receptor other than the t cell receptor . other studies reported similar killing with human peripheral blood mononuclear cells ( pbmc ) stimulated with dead c. neoformans or cultured for 7 days with il-2 and gm - csf ( but not with tnf , ifn- , or vitamin d3 ) . in agreement with prior studies [ 36 , 37 ] , t cells ( as well as nk cells ) isolated from the pbmc were found to directly bind to , and possess fungicidal activity against c. neoformans after priming with il-2 . another study found that freshly isolated t cells could mediate killing of c. neoformans without the need for il-2 stimulation . however , t cells cultured without il-2 soon lost their ability to kill , suggesting that il-2 is required for t cells to maintain their fungicidal activity . treatment of t cells with the proteases trypsin and bromelain , which have been found to cleave several receptors on t cells , also impaired killing of c. neoformans suggesting that receptor - ligand interactions were involved in anticryptococcal activity . investigators have asked whether ctl kill cryptococcus or exert their anticryptococcal activity by inhibiting the growth of the organism . studies using the viability dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) showed that c. neoformans failed to demonstrate metabolic activity after incubation with t cells . c. neoformans also becomes permeable and labels with propidium iodide after incubation with ctl providing further evidence for killing ( unpublished observations , anowara islam ) . furthermore , ctl can reduce the burden of organisms below the starting innocula [ 41 , 44 ] , and consistent with previous studies that suggested a contact - dependent mechanism of killing , separation of t cells and c. neoformans with a porous membrane during incubation was found to abrogate anticryptococcal activity . early studies investigating the mechanism of ctl anticryptococcal activity examined possible receptors and effector mechanisms . antibody - mediated blockade of various t cell surface molecules such as lfa-1 and cd3 did not significantly inhibit killing . together this data suggests that ctl killing of c. neoformans may proceed through a novel receptor that is yet to be identified . these early studies also examined the role of reactive hydroxyl radicals , which have been suggested to play a role in eosinophil - mediated killing . additionally , cyclooxygenase inhibitors and prostaglandin e2 , which have been found to inhibit nk cell cytotoxicity [ 47 , 48 ] and nf-b activation , were assessed . among the 3 hydroxyl radical scavengers used similarly , only 1 ( salicylic acid ) of the 3 cycloxygenase inhibitors abrogated killing , while prostaglandin e2 failed to have any appreciable effect . one study , however , described an effector mechanism by which il-15 stimulated cd8 ctl kill c. neoformans . in vitro studies have previously shown that il-15 from c. neoformans - stimulated monocytes induced t cells to become anticryptococcal . this led to studies showing that the anticryptococcal activity of il-15-stimulated cd8 t cells correlated with the level of granulysin expression . furthermore , both strontium treatment and sirna knockdown of granulysin abrogated anticryptococcal activity , directly implicating granulysin in the ctl response against c. neoformans . perforin was not required , as neither concanamycin a nor egta treatment impaired anticryptococcal activity . these results are in contrast to nk cells , which depend on perforin , but not granulysin for killing . these results were extended using cd8 t cells purified from pbmc that had been stimulated with c. neoformans mitogen ( cnm ) , a protein mitogen within the cryptococcal cell wall and membrane [ 52 , 53 ] . priming of anticryptococcal activity and granulysin expression by stimulation with cnm was dependent on cd4 t cells . stimulation of pbmc with cnm in the presence of anti - il-15 abrogated anticryptococcal activity and granulysin expression suggesting that the dependence on cd4 t cells was mediated through il-15 . however , in the absence of accessory cells , cd4 t cells were not sufficient to induce cd8 t cell anticryptococcal activity and granulysin expression . together this data suggests that the proliferating cd4 t cells provide a retrograde stimulus to accessory cells that results in production of il-15 , which then primes cd8 t cell for granulysin expression and anticryptococcal activity ( figure 3 ) . indeed , both cd4 and cd8 t cells in vivo have been found to be indispensable for an effective response to c. neoformans [ 5458 ] . aside from their role in licensing accessory cells to prime cd8 ctl anticryptococcal activity , cd4 t cells have also been demonstrated to directly kill c. neoformans . upon stimulation with il-2 , cd4 t cells increased the expression of granulysin ( but not perforin ) which correlated with increased fungicidal activity . both strontium treatment and granulysin sirna knockdown abrogated cd4 t cell killing of c. neoformans . perforin involvement was excluded as neither concanamycin a nor perforin knockdown could interfere with anticryptococcal activity of cd4 t cells stimulated with both il-2 and anti - cd3 antibody ( which stimulated both perforin and granulysin expression ) . together this data suggests that cd4ctl ( like cd8 ) directly kill c. neoformans through a granulysin - mediated mechanism . the high prevalence of serious cryptococcal infection in hiv - infected patients [ 60 , 61 ] may be at least partially due to a defect in this fungicidal activity . indeed , cd4 t cells from these patients were found to exhibit defective killing of c. neoformans . neither il-2 nor il-2 plus anti - cd3 stimulation could induce granulysin expression in these patients ' cells . these results suggest that profound dysregulation of perforin and granulysin expression may account for the failure of cd4 t cells from hiv - infected patients to kill c. neoformans . the signalling pathways regulating granulysin expression in cd8 and cd4 ctl are relatively unknown . in preparation for killing of fungi , expression of granulysin correlated with short - term ( 060 min ) and long - term ( 15 days ) phosphorylation of extracellular signal - regulated kinases ( erk)1/2 , p38 mitogen - activated protein ( map ) kinase , and p54 c - jun n - terminal kinases ( jnk ) as well as the transcription factor signal transducers and activators of transcription ( stat)5 . meanwhile , no phosphorylation of the human oncogene akt ( signifying phosphoinositide 3-kinase ( pi3k ) activation ) could be detected following continuous il-2 stimulation . akt phosphorylation could only be detected when cd4 t cells were stimulated with il-2 for 35 days , rested ( 24 hours ) and restimulated with il-2 for 5 min , indicating that pi3k undergoes a transient activation after initial stimulation with il-2 . continuous stimulation of cd4 t cells with il-2 was also found to increase expression of the il-2r and il-2r subunits of the il-2 receptor ( by day 3 ) followed by expression of granulysin ( on day 5 ) . pharmacological inhibition of janus kinase ( jak)3/stat5 or pi3k abrogated both granulysin expression and anticryptococcal activity of il-2 stimulated cd4 t cells , which correlated with decreased expression of the il-2r subunits . together this data suggests that granulysin expression requires acquisition of one or more of the il-2r subunits . indeed , blockade of il-2r expression using anti - il-2r antibodies or sirna knockdown abrogated granulysin expression in il-2 stimulated cd4 t cells . thus , il-2 ( and perhaps other t cell growth factors ) signals t cells to increase expression of il-2r , which is then available for signalling that is necessary for granulysin expression . previous studies have shown that cd4 t cells from hiv - infected patients exhibit dysregulated expression of perforin and granulysin . comparison of il-2 signalling in cd4 t cells from healthy donors and patients infected with hiv revealed the underlying cause to be defective stat5 and pi3k signalling . il-2 stimulation of cd4 t cells from hiv - infected patients failed to induce phosphorylation of stat5 and failed to increase expression of il-2r. furthermore , in contrast to cd4 t cells from healthy donors , il-2 failed to induce phosphorylation of akt . together these results demonstrate a critical role for jak / stat and pi3k signalling in granulysin - mediated killing of c. neoformans by cd4 t cells . / stat signalling was also found to be required for granulysin expression in cd8 t cells in response to il-15 and il-21 . cd8 t cells stimulated with either il-15 or il-21 were found to increase granulysin expression , which correlated with increased phosphorylation of stat3 and stat5 . il-15 was found to induce phosphorylation of both stat3 and stat5 , while il-21 only induced phosphorylation of stat3 . pharmacological inhibition and sirna knockdown of jak / stat signalling was found to abrogate granulysin expression by cd8 t cells in response to il-15 and il-21 . together this data indicates that jak / stat signalling regulates granulysin expression by cd8 t cells in response to il-15 and il-21 . consistent with previous studies conducted with cd4 t cells [ 59 , 62 ] , hiv - infected cd8 t cells exhibited reduced phosphorylation of stat3 , stat5 , and granulysin expression in response to il-15 and il-21 as compared to mock - infected cells . it is clear that both cd4 and cd8ctl mediate direct killing of a wide range of bacterial , parasitic , and fungal pathogens . several studies reported a correlation between the frequency [ 20 , 21 ] or intensity of binding and killing . moreover , microscopy [ 37 , 40 , 41 ] revealed direct ctl - microbe interactions . finally , t cells separated from c. neoformans by a porous membrane were unable to mediate killing . contact may induce release of cytotoxic products by the ctl or provide a microenvironment or concentration at which the cytotoxic product can be efficacious . the latter may explain why supernatants from activated t cells were often unable to mediate killing [ 20 , 34 , 40 , 41 ] . second , killing is mediated primarily through the granule - exocytosis pathway . in many experimental systems , pretreatment of ctl with strontium ( which depletes granule contents ) was found to abrogate killing [ 13 , 17 , 44 , 59 ] . furthermore , granulysin , a granule constituent , has been implicated in the killing of several microbes [ 13 , 1517 , 33 , 44 , 59 ] . third , killing ( at least of extracellular microbes ) is neither antigen - specific nor mhc - dependent . nonspecific stimulation with t cell growth factors [ 34 , 35 , 39 , 40 , 44 , 59 ] or mitogenic lectins [ 20 , 21 ] was often sufficient to prime the effector cells for killing . while granulysin appears to be highly involved in killing , the role of perforin and other effector molecules is not as clear . in the case of extracellular pathogens , perforin has not been found to play a role in killing [ 54 , 59 ] , although it plays a role in direct killing by nk cells [ 51 , 64 , 65 ] . by contrast , killing of intracellular microbes requires perforin [ 13 , 27 ] , although some investigations have suggested a perforin - independent mechanism . to be sure , this topic demands the attention of future studies . jak / stat and pi3k signalling have been found to be essential in ctl killing of c. neoformans . defective jak / stat and pi3k signalling in ctl from hiv - infected patients [ 62 , 63 ] may explain why these patients experience such a high incidence of severe cryptococcal infection . during the process of evolution , ctl have developed the ability to specifically recognize altered self through complex tcr - mhc interactions . as a consequence , they have become the epitome of specific cell - mediated immunity . it is fascinating to now discover that during this process , ctl have , at the same time , preserved one of the most rudimentary immune functions of all , namely , the ability to directly recognize a microbe , bind , and without the help of antigen presenting cells or other effector cells kill the invading pathogen with competence and precision .

cytotoxic t - lymphocytes ( ctl ) are famous for their ability to kill tumor , allogeneic and virus - infected cells . however , an emerging literature has now demonstrated that ctl also possess the ability to directly recognize and kill bacteria , parasites , and fungi . here , we review past and recent findings demonstrating the direct microbicidal activity of both cd4 + and cd8 + ctl against various microbial pathogens . further , this review will outline what is known regarding the mechanisms of direct killing and their underlying signalling pathways .

1. Introduction 2. Direct Killing of Bacteria by CTL 3. Direct Killing of Parasites by CTL 4. Direct Killing of Fungi by CTL 5. Summary

skin tissue integrity is a crucial factor to maintain the homeostasis generated through physical barriers , separating the organism from the environment . every disruption of dermal integrity triggers a complicated cascade of events , including rapid blood clot formation , inflammatory response , and wound healing , leading to the restoration of the integrity and formation of new tissue . however , repaired structures , known as scars , are nonfunctioning , tight , and tense masses of fibrotic tissue that maintain 7080% of normal strength , with even less flexibility . inflammatory responses are necessary for wound healing , preventing multiple infection and contamination and stimulating the proliferation , revascularization , and remodeling of the extracellular matrix [ 2 , 3 ] . nevertheless , wound healing might become uncontrolled and , combined with the inflammatory response , results in massive fibrotic tissue formation called fibrosis . in this review , we will focus on the molecular mechanisms underlying skin fibrosis as a post - wound - healing pathological disorder and the impact of bone marrow - derived cells and inflammation on the formation of scars . fibrosis is a pathological process that occurs in many different organs ( organ specific fibrosis ) , such as skin , kidney , heart , lung , and liver , which might also take the form of systemic sclerosis ( ssc ) , a global , progressive , and autoimmune disorder , characterized by an extremely poor prognosis and high mortality [ 5 , 6 ] . according to the united states government , every year , in the usa although the etiology and triggering cascade might differ , fibrosis is characterized by the increased production and deposition of extracellular matrix ( ecm ) components , including collagen type i , fibronectin , hyaluronan , and elastin , and the accumulation of activated , sma - positive , and collagen - secreting fibroblasts , called myofibroblasts [ 4 , 8 , 9 ] . many authors refer to fibrosis in the context of uncontrolled or exceeded wound healing , as an effect of long - term inflammation or mechanical irritation . this process can be divided into four overlapping phases : coagulation , inflammation , proliferation , and remodeling . skin injury results , inter alia , in the disruption of endothelial and epithelial cells integrity . damaged cells release inflammatory mediators that trigger the coagulation cascade , platelet recruitment , and blood clot formation . degranulated and activated platelets present in the blood clot release multiple chemokines and growth factors ( tgf-1 , pdgf ) , which recruit inflammatory cells . platelets also participate in the chemotaxis and recruitment of fibroblasts and endothelial cells [ 1113 ] . the first two phases are often treated as one phase , representing the inflammatory stage . the blood clot comprises cross - linked fibrin and extracellular matrix proteins , such as fibronectin , vitronectin , and thrombospondin . this structure serves as a physical barrier that closes the blood vessel , a reservoir of growth factors , and a matrix on which regenerated tissue is formed [ 12 , 14 ] . the next phase , proliferation , results from hypoxic conditions and reactive nitrogen species ( rns ) production from macrophages [ 15 , 16 ] . during this phase , angiogenesis occurs , forming new capillaries and facilitating the delivery of nutrients to the wound . in addition to nutrients , collagen - secreting myofibroblasts are recruited to the wound microenvironment . as previously described , myofibroblasts are activated , sma - positive , and collagen - secreting fibroblasts that deposit new ecm components , primarily fibronectin and collagen type i , to replace the clot - formed matrix , often forming a scar [ 10 , 18 ] . in physiological wound healing , remodeling is the final phase . during this phase , myofibroblasts and some vascular cells moreover , the synthesis of ecm components is reduced but not fully terminated , and remodeling is primarily regulated through different matrix metalloproteinases ( mmps ) and their inhibitors ( tissue inhibitor of metalloproteinases , timps ) . after the degradation of the overexpressed ecm components , scarring is reduced and an equilibrium between synthesis and catabolism is reached [ 13 , 20 ] . in fibrosis , . the increased deposition of collagen type i and fibronectin stiffens and damages the surrounding tissue . in addition , connective tissue cells replace the original cells , creating a scar that in some cases might take an extremely severe form [ 13 , 21 , 22 ] . the wound healing process is shown in figure 1 . activated fibroblasts / myofibroblasts accumulate in the fibrotic tissue environment by three different , simultaneous mechanisms . first , these cells are derived from preexisting fibroblasts in the affected tissue through activation due to specific , profibrotic , and proproliferative mediators released from infiltrating inflammatory cells , such as t cells [ 2325 ] . second , myofibroblasts are recruited through bone marrow - derived fibroblast resembling cells , such as fibrocytes , cd45 and cd34 positive cells . fibrocytes transmigrate to the fibrotic environment , and in a tgf-1-controlled process , these cells undergo transdifferentiation into myofibroblasts . finally , fibroblasts / myofibroblasts accumulate through the transition from endothelial or epithelial cells to mesenchymal fibroblast - like cells [ 5 , 11 ] . during the endothelial and/or epithelial to mesenchymal transition ( endmt and emt , resp . ) , cells lose their origin markers , polarity , and cell - cell connections and gain promigratory phenotypes and mesenchymal markers [ 2830 ] . both endmt and emt are physiological processes that occur during embryonic organogenesis and wound healing . epithelial and endothelial cells establish close cell - cell contacts with a certain cell polarity , forming a solid barrier that maintains homeostasis . this barrier is formed through desmosomes and tight and adherent junctions [ 28 , 31 ] . in contrast , mesenchymal cells are spindle - shaped solitary cells , possessing migratory and ecm remodeling abilities . these cells produce and secrete ecm components , such as collagen type i and fibronectin [ 13 , 32 ] . during tissue development or regeneration therefore , after undergoing endmt / emt , these cells gain the migratory abilities of fibroblasts , facilitating the recruitment of these cells to certain locations . cells do not typically undergo full transitions , often terminating in intermediate phenotypes between endothelial or epithelial and mesenchymal , and maintaining some cell - cell contacts to perform group migration rather than single cell migration [ 28 , 33 ] . the endothelial to mesenchymal transition was first observed and described as the leaking and proliferation of endothelial cells during the development of chick and rat endocardial cushions ( cardiac mesenchyme ) . endmt is closely associated with dermal , renal , cardiac , pulmonary , intestinal , and cystic fibrosis through the establishment of fibroblasts and myofibroblasts [ 35 , 36 ] . emt is reversible , and fibroblasts might regain epithelial phenotypes ( mesenchymal to epithelial transition , met ) , whereas endmt reversibility is not well understood . the reversal of endmt ( mesenchymal to endothelial transition ) has been recently observed in cardiac fibroblasts that rapidly adopt an endothelial - cell - like phenotype after acute ischemic cardiac injury . however , more additional evidence suggests that endmt is irreversible , and transformed cells can not regain endothelial phenotypes , even after the removal of endmt inducing factors . therefore , endmt , which is not terminated at a certain time , could lead to the accumulation of collagen type i secreted from myofibroblasts and the irreversible transformation into fibrotic tissue . both endmt and emt are regulated through the zinc finger transcription factor snail family ( snail1 , snail2 , and snail3 ) . after activation , on the molecular level , snail1 stabilizes the quantity of twist1 transcription factor , and in cooperation , both of these proteins upregulate zeb1 gene expression [ 40 , 41 ] . as a repressor , snail proteins downregulate the expression of genes encoding junction proteins , such as claudin , occludin , e - cadherin ( in epithelial cells ) , ve - cadherin , and pecam1 ( in endothelial cells ) . it is not clear whether snail upregulates the genes encoding mesenchymal markers , as observed in the upregulation of myosin va in some highly metastatic cancer cell lines , such as human lung carcinoma cell lines ( a549 , pg , and calu6 ) , human colon cancer cell lines ( lovo and sw480 ) , human breast cancer cell lines ( bicr - h1 and mcf7 ) , and prostate cancer cell lines with the same genetic background ( pg3m-1e8 and pg3m-2b4 ) , or represses epithelial / endothelial genes and therefore indirectly upregulates mesenchymal markers . nevertheless , mesenchymal cell proteins , such as vimentin , fibronectin , collagen type i , sma , sm22 ( transgelin ) , n - cadherin , calponin , and fsp-1 ( fibroblast specific protein 1 ) , are expressed during and after the transition [ 4346 ] . the microrna profile also changes during mesenchymal transition , revealing the significant upregulation of mir-125 , let-7c , let7 g , mir21 , mir30b , and mir195 and downregulation of mir122a , mir127 , mir196 , and mir375 . a previous study reported that the accumulation of snail in colorectal cancer cells and in mice utricle sensory epithelia cells , after blocking the degradation of this protein through the glycogen synthase kinase-3 ( gsk-3 ) , via lithium chloride treatment or the overexpression of snail , might trigger the transition into mesenchymal - like cells [ 43 , 48 , 49 ] . however , this transition is typically induced through a variety of proinflammatory cytokines and growth factors secreted from leukocytes , which act synergistically . the most important proinflammatory / profibrotic molecules are transforming growth factors -1 and -2 ( tgf-1 and tgf-2 ) , tumor necrosis factor- ( tnf- ) , interleukins il-1 , il-6 , il-8 , and il-11 , and fibroblast growth factor-2 ( fgf-2 ) [ 38 , 39 , 5054 ] . it has been suggested that tgf- receptor is essential for mesenchymal transition signal transduction , and the overexpression of snail might be an insufficient factor . the inhibition of tgf- receptor accompanied by simultaneous upregulation of snail does not lead to endmt in mouse embryonic stem cell - derived endothelial cells ( mesecs ) . however , the upregulation of the transcription factor snail directly upregulates profibrotic and proinflammatory cytokines , such as il-8 . the secretion of tgf- into the fibrotic microenvironment during inflammation is the most important snail inducer . however , studies on skin cancer formation have shown that smad2 inhibits endmt , whereas smad3 acts as an activator . the binding of tgf- to tgf- receptor type ii ( trii ) triggers heterodimerization through the activation of the tgf- receptor type i kinase ( tri ) , which activates activin - like kinase 5 ( alk5 ) and transduces a signal through the smad2/3 complex with smad4 , which activates the expression of snail . the inhibition of either alk5 or alk2 results in the inhibition of endmt [ 29 , 57 ] . tgf- also activates snail in a non - smad pathway , involving wnt and noch , via the sequestration of gsk-3 and akt2 , through the transcriptional repression of the mir-200 superfamily and the activation of the inflammatory transcription factor nfb [ 30 , 46 , 50 , 58 ] . as previously discussed , chronic inflammation is one of the main factors triggering fibrosis , particularly endmt - based fibrosis , as endmt is an irreversible process . constant inflammation leads to the production of a variety of proinflammatory cytokines and growth factors secreted from different leukocytes present in the fibrotic microenvironment . however , fibrosis formation is a multidimensional and multistage process that not only involves endmt . leukocyte recruitment triggers many different mechanisms and pathways that might lead to disordered wound healing , myofibroblasts and collagen type 1 accumulation , scarring , and fibrosis . the recruitment of these cells is initiated immediately after activated platelets degranulate and release tgf-1 and pdgf . tnf- , il-1 , and il-8 released from endothelial cells also stimulate neutrophil recruitment , leading to selectin - mediated rolling adhesion towards the chemoattractant gradient . in the next phase , tight adhesion to endothelial cells occurs via integrin 2 , followed by transmigration through the endothelial tissue . when necessary , neutrophils cross the ecm barrier along fibroblasts and transmigrate through epithelial cells to enter the wound . neutrophils begin phagocytosing invading bacteria and damaged necrotic cells to clear the wound , preparing it for the regeneration of homeostasis through scar formation . however , fetal wounds heal without scar formation , and fetal neutrophils are physiologically distinct from adult neutrophils , as these cells are less adept than adult cells , producing less cytokines and presenting lower contributions to the inflammatory response [ 60 , 61 ] . neutrophil serine protease , elastase , is secreted into the microenvironment , increasing il-8 expression in the surrounding cells . il-8 not only is responsible for leukocyte recruitment but also might trigger endmt and increase the survival and proliferation of endothelial - derived fibroblasts / myofibroblasts , leading to fibrosis [ 6 , 63 ] . additionally , elastase is also believed to cleave the il-8 receptor cxcr1 , interfering with neutrophil functions and antibacterial abilities , thereby prolonging inflammation , which in turn increases additional fibrosis - based changes . prolonged inflammation might also occur through the elastase - mediated degradation of complement , releasing the strong neutrophil chemoattractant , c5a . moreover , neutrophil derived oxidative burst , leading to the formation of hocl from h2o2 catalyzed through myeloperoxidase , induces injury to epithelial cells , thereby implicating the switch to fibrotic tissue deposition [ 66 , 67 ] . two different populations of neutrophils have been observed to enter the wound in mice after the induction of acute inflammation : one population has a proinflammatory function , and the second population is responsible for anti - inflammatory responses . these cells differ in size , granularity , and the expression of cd11b and ly6 g . respectively , the anti - inflammatory neutrophil response is strongly associated with the secretion of the anti - inflammatory cytokine il-10 . moreover , a certain population of mature neutrophils , characterized as cd11c / cd62l / cd11b / cd16 , have been reported to suppress t cell proliferation via the expression of the integrin mac-1 ( m2 ) . the impact of neutrophils on fibrosis has been observed in pulmonary fibrotic disorders , as these cells transmigrate to pulmonary fluids ( such as bronchoalveolar lavage fluid ) and recruit other leukocytes [ 71 , 72 ] . however , only a few clinical studies have successfully established anti - inflammatory strategies in patients with pulmonary fibrosis . inhibition of neutrophil derived elastase as strategy of downregulation of self - destructive process of neutrophil derived protease activity as well as elastase derived il-8 expression is currently being elucidated and brings more questions than answers . clinically useful concepts have only just started to evolve and bring promising , but not yet convincing , answers [ 59 , 73 ] . macrophages appear as the second type of bone marrow - derived cells invading the wound site , and three to five days after injury , they become the dominant leukocyte type . similar to neutrophils , different populations of macrophages have been reported , depending on the activation path through different chemokines and growth factors , as shown in figure 2 . classical macrophage activation , or m1 , is obtained , in particular , through the combination of interferon gamma ( ifn- ) and tumor necrosis factor- ( tnf- ) signaling pathways . alternative activation , or m2 , is far more complex , leading to the formation of regulatory and wound - healing macrophages . regulatory macrophages release anti - inflammatory cytokines il-10 and tgf- , which downregulate inflammation , and also lead to the endothelial to mesenchymal transition and increase the fibroblast number at the wound site . its abilities might shift , depending on other cytokines availability and cell type [ 76 , 77 ] . it was shown that tgf- administered to animals with infection or inflammation reduces severity of disease and production of proinflammatory il-1 and tnf . a second group of m2 macrophages , wound - healing macrophages , are derived through il-4 induction . these cells secrete cc chemokine ligands , including ccl2 , ccl17 , ccl18 , and ccl22 . wound - healing macrophages are extremely profibrotic , as these cells produce high levels of fibronectin and through ccl18 activation promote collagen production from fibroblasts / myofibroblasts . moreover , arginase activation in m2 macrophages , stimulated through il-4 , leads to the conversion of arginine to ornithine , a precursor of collagen [ 74 , 80 ] . blocking il-4 with specific antibodies significantly decreases wound - healing , macrophage accumulation , and fibrosis formation . recent studies showed that overexpression of mmp9 in macrophage might attenuate bleomycin induced pulmonary fibrosis . respectively , production of mmp13 by kuppfer cells was shown to be sufficient in preventing pig serum - induced rat liver fibrosis . these data suggest that high level of mmps might play key role in fibrosis reversibility . macrophages are the main sources of mmps that facilitate ecm degradation during remodeling phase in wound healing process ; they also phagocytose apoptotic myofibroblasts and cellular debris preventing advance in the fibrotic process . however , some authors suggest strong profibrotic role of macrophage derived mmp13 , as they observed that liver fibrosis was suppressed , along with fibrotic markers and inflammatory mediator expression , in mmp13-deficient mice during cholestasis - induced liver fibrosis . surpassingly , prolonging inflammation and recruitment of activated macrophages might be involved in fibrosis reversing process , as accumulating evidence strongly correlates macrophages and the macrophages derived mmps ( mmp1 , mmp2 , mmp8 , mmp9 , and mmp13 ) with this process . after arrival to the wound site , these cells produce lymphokines , which in turn activate other inflammatory cells , such as macrophages . among all lymphocyte subpopulations , th1 and th2 are most relevant for tissue fibrosis . th1 and th2 lymphocytes contribute different responses to wounded tissue . th1 acts as an antifibrotic , releasing il-10 , and th2 acts as a profibrotic . studies using mouse models have shown that the polarized th2 response leads to massive collagen deposition and increased fibrosis formation . however , the th1 response activates the genes responsible for apoptosis and acute - phase reactions [ 86 , 87 ] . among all cytokines released from th2 , the two most important and most profibrotic cytokines are il-4 and il-13 . both il-4 and il-13 share functional similarities , as these molecules transduce signal via the il-4r / stat6 pathway [ 8890 ] . as previously described , il-4 activates m2 wound - healing macrophages , resulting in collagen production and deposition . moreover , il-4 stimulates in the dose - dependent manner collagen synthesis in fibroblasts and is two times more effective than tgf- . the scleroderma mouse model ( tight - skin mutant mouse tsk/+ ) presented treatment with an anti - il-4 antibody resulted in collagen downregulation and provided less fibrosis - based pathological changes . the th2-mediated secretion of il-4 and il-13 enhanced fibrocyte differentiation from cd14-positive precursors , thereby leading to increased fibroblast recruitment and potential fibrosis . the impact of th2-derived il-5 on fibrosis is strongly associated with the recruitment and activation of eosinophils . activated eosinophils secrete inflammatory factors , such as il-13 and tgf-1 , into wounded tissue , resulting in fibrosis development , as shown for dermal fibrosis in a mouse model of skin allograft rejection . both il-13 and tgf-1 might induce collagen secretion from fibroblasts present in the wound ; however , tgf-1 is strongly associated with endmt- and emt - based fibrosis [ 95 , 96 ] . as discussed above , th1 and th2 lymphocytes affect differently fibrotic tissue . recently , it was shown that patients with cystic fibrosis and p. aeruginosa infection present an age - dependent dysregulation of lymphocyte t response that shifts towards th2 lymphocyte , resulting in enhanced fibrotic tissue deposition . as previously described , these cells are both cd45- and cd34-positive cells that transdifferentiate into myofibroblasts . the name fibrocyte represents a combination of shared features of these cells : fibroblast and monocyte . circulating fibrocytes subsequently , tgf-1 triggers the transdifferentiation of these cells into sma - positive myofibroblasts that express collagen type i , fibronectin , and vimentin and increase the amount and deposition of ecm components [ 98 , 99 ] . normally , circulating fibrocytes comprise less than 1% of all leukocyte populations , but during fibrotic changes derived from inflammation , the amount of these cells systematically increases . fibrocytes can be distinguished in at least 4-day - old skin wounds , and the quantity of these cells raises with time and increasing wound age . for the differentiation of fibrocyte precursors , the induction of fibrosis through fibrocytes is primarily based on the deposition of ecm components , as discussed above . nevertheless , we can not omit a variety of proinflammatory cytokines secreted from fibrocytes into the wound , namely , tnf- , il-6 , il-8 , il-10 , and macrophage inflammatory protein 1/ ( mip 1/ ) . moreover , it has been demonstrated that the fibrocytes in burned patients secrete tgf-1 , which activates myofibroblasts from existing fibroblasts or triggers differentiation toward fibroblasts - like cells from surrounding endothelial or epithelial tissues through endmt or emt . however , due to dynamic nature of fibrocytes and constantly changing phenotype and functions of these cells , during their migration , some serious inconsistency appeared on the exact definition and identification of fibrocytes . these discrepancies are related to different methodology used to investigate fibrocytes involvement in variety of fibrotic disorders on variable stages . it has been suggested that one must categorize fibrocytes as functionally different depending on the isolation condition . what is more , it is still unclear whether fibrocytes contribute only to worsening or improving tissue repair , as they possibly represent the wrong cells in the wrong time . fibrosis is a complicated and composed process , leading to severe pathological disorders . the scarce formation of fibrotic tissue , comprising excess amounts of collagen type i , fibronectin , and other ecm components , deregulates normal tissue functions . inflammation and inflammation - associated bone marrow leukocyte recruitment in wounded tissue trigger a cascade of events , leading to wound enclosure , scar formation , and , in case of prolonged inflammation , massive fibrosis . the impact of leukocytes on fibrosis formation might be generally divided into direct and indirect effects as shown in figure 3 . the direct impact is strongly associated with the production and excess deposition of ecm components . this effect is primarily observed with fibrocytes and alternatively activated , wound - healing macrophages . the indirect impact is far more complicated , as this effect is multistaged and associated with the activation and recruitment ( including cells transdifferentiation and emt / endmt fibroblasts formation ) of collagen - secreting cells , such as macrophages and myofibroblasts , and increased myofibroblast survivability through the downregulation of proapoptotic signals and increased inflammatory response times . the most common , and likely , best - known indirect impact is correlated with tgf- family proteins , as these molecules trigger both the endothelial and epithelial to mesenchymal transition and activate myofibroblasts from fibroblasts and fibrocytes , thereby increasing the production of ecm components . however , although this mechanism is well known , no antifibrotic therapy , based on tgf- deactivation , has been implicated without disruption of the physiological function of this molecule . several drugs for the downregulation of tgf- transcription or signal transduction have been examined in the last stages of clinical trials . nevertheless , the impact of il-6 , il-8 , il-4 , il-13 , or tnf- can not be neglected . th2-derived il-4 and il-13 are primarily responsible for macrophage collagen deposition and fibrocyte generation , whereas tnf- , il-6 , and il-8 are strongly associated with emt and endmt and myofibroblast survival and stimulation of collagen production . thus , leukocyte interactions with wounded tissue cells and other leukocytes are extremely complicated and complex , bringing more questions than answers .

skin tissue scar formation and fibrosis are often characterized by the increased production and deposition of extracellular matrix components , accompanied by the accumulation of a vast number of myofibroblasts . scaring is strongly associated with inflammation and wound healing to regain tissue integrity in response to skin tissue injury . however , increased and uncontrolled inflammation , repetitive injury , and individual predisposition might lead to fibrosis , a severe disorder resulting in the formation of dense and stiff tissue that loses the physical properties and physiological functions of normal tissue . fibrosis is an extremely complicated and multistage process in which bone marrow - derived leukocytes act as both pro- and antifibrotic agents , and therefore , few , if any , effective therapies are available for the most severe and lethal forms of fibrosis . herein , we discuss the current knowledge on the multidimensional impact of leukocytes on the induction of fibrosis , focusing on skin fibrosis .

1. Introduction 2. Fibrosis and Wound Healing: Two Faces of the Same Story 3. The Endothelial and Epithelial to Mesenchymal Transition as a Key Factor in Fibrosis 4. Leukocytes in Fibrosis: Unanswered Questions 5. Concluding Remarks

acinetobacter baumannii is an opportunistic pathogen that is frequently involved in outbreaks of infection occurring mostly in intensive care units.1 members of genus acinetobacter is gram negative , nonmotile nonspore forming encapsulated coccobacilli belonging to family neisseriaceae.2 it is an opportunistic pathogen found to be associated with wide spectrum of infection including nosocomial pneumonia , meningitis , endocarditis , skin and soft tissue infections , urinary tract infection , conjunctivitis , burn wound infection and bacteremia posing risk for high mortality.34 acinetobacter pneumonia generally occurs in patients with diminished host defenses ( e.g. alcoholism , tobacco use , diabetes mellitus , and renal failure , underlying pulmonary disease).57 outbreak of acinetobacter infections is linked to contaminated respiratory equipments , intravascular access devices , bedding materials and transmission via hands of hospital personal.8 it typically colonizes skin and indwelling plastic devices of the hospitalized patients.9 mdr strains of acinetobacter isolates are a growing problem and have been widely reported.10 most a. baumannnii are now resistant to ampicillin , carbenicillin , cefotaxime , and chloramphenicol , with some centers reporting up to 91% of nosocomial acinetobacter resistant to resistance to tobramycin and amikacin is increasing . fluoroquinolones , colistin , imipenem , and meropenem may retain activity against nosocomial acinetobacter.11 ertapenem , the newest of the carbapenems , has little intrinsic activity against acinetobacter and should not be used.12 however , the rapid development of significant quinolone resistance in france , aminoglycoside resistance in germany , and carbapenem resistance in selected regions worldwide raises an important therapeutic problem.1314 a total 4180 specimens like blood sample , pus , csf , and other body fluids were subjected to simplified phenotypic identification scheme [ table 1 ] . presumptive identification of acinetobacter was made by inoculation on macconkey agar medium incubated at 37c . all nonlactose fermenting members subjected to gram staining , oxidase , catalase , and hanging drop preparation . acinetobactor are gram - negative bacilli or coccobacilli , oxidase negative , nonmotile , catalase positive . speciation was done on the basis of glucose oxidation , gelatine liquefaction , haemolysis , growth at 35 and 42c . bauer disk diffusion method with imipenem , meropenem , piperacillin - tazobactum , netilmicin , amikacin , ceftazidime , gentamicin , ofloxacin , chloramphenicol disks . the screening test for detection of inducible beta lactamases ( ibl ) , extended spectrum beta lactamases ( esbl ) , and mbl was done by the disk approximation method and double disk synergy respectively . during the period of study from january 2010 to december 2011 a total of 4180 samples were examined from of different age group admitted in various medical wards , surgical wards and icu . nonfermenter isolates account for 12% and acinetobacter isolates account for 4.5% of total organism isolated during the study period . most of these patients had respiratory problems like copd , bronchial asthma , respiratory failure . infection in neonates was common in preterm babies . in 87.5% sample growth was monomicrobial . in 12.5% sample growth was polymicrobial . escherichia coli was the most common associated organism with acinetobacter in the case of uti . staphylococcus aureus was the associated organism in the case of wound infection , cellulitis , and abcess . acinetobacter was isolated most commonly from surgical ward , medical ward , burn unit , and two isolates were isolated from humidifier ventilator and two isolates from the ot table . the present study shows more strains belonging to acinetobacter baumanii complex 114 ( 74.02% ) of total acinetobacter isolates [ table 2 ] . other species includes a.lowfii 22 isolates ( 14.2% ) , a. haemolyticus 12 ( 7.79% ) isolates , a junni 06 ( 3.8% ) isolates . different spices of acinetobacter isolated from clinical samples one of the striking features of genus acinetobacter is the ability to develop antibiotic resistant extremely rapid in response to challenge with new antibiotics . in the present study , strains were resistant to imipenem ( 5.2% ) , meropenem ( 9.75% ) , piperacilin - tazobactum ( 18.2% ) , netilmicin ( 16.24% ) , amikacin ( 14.29% ) , ceftazidime ( 74.1% ) , gentamicin ( 70.13% ) , ofloxacin ( ( 42.21% ) , chloramphenicol ( 92.20% ) [ table 3 ] . the difference in susceptibility pattern was due to environmental factors and different pattern of antimicrobial usage . acinetobacter species has emerged as an important pathogen causing life - threatening infections both in community and hospital . rapid emergence of multidrug - resistant acinetobacter has further made the situation critical.15 acinetobacter is found ubiquitously in nature , soil and also in skin as commensal . prior use of broad spectrum antibiotics , cross infection by hand of hospital staff , ventilator machine are all potential risk factors for development of multidrug - resistant acinetobacter infection in hospital.16 in one study at jipmer hospital respiratory infections due to acinetobacter in mechanically ventilated patients in icu were 44.7% . was responsible for 35% of ventilator associated pneumonia ( vap ) , making it the most conspicuous and dominant pathogen among all other bacteria encountered in that study.17 in our study , a total of 4180 samples were studied , out of which 504 ( 12.05% , n=4180 ) nonfermenters were isolated [ table 4 ] . acinetobacter species accounted for ( 30.55% , n=504 ) of total nonfermenter and 4.5% of total positive culture . most of the isolated acinetobacter species were sensitive to imipenem , meropenem . however , 10% of them were ibl producers and 8% were esbl producers . in conclusion , multidrug - resistant a. baumannii was responsible for majority of the acinetobacter infections at our hospital . injudicious use of antibiotics , mechanical ventilation , cross infection was found to be potential risk factors for development of acinetobacter infection . during routine microbiological work nonfermenter gnb other than pseudomonas aeruginosa but the rate of isolation of acinetobacter in various studies indicates its role as nosocomial pathogen and also as an agent of community acquired infection . traditional typing methods like phenotyping and antibiogram typing have advantage over genotyping as they are readily available and cost effective .

background : antibiotic - resistant acinetobacter nosocomial infection is a leading problem . it acts as an opportunistic pathogen to cause a wide spectrum of infection including nosocomial pneumonia , meningitis , endocarditis , skin and soft tissue infections , urinary tract infection , conjunctivitis , burn wound infection and bacteremia . multidrug - resistant acinetobacter infection creates a great problem in hospital setting.materials and methods : the clinical specimens obtained from icu and different surgical and medical wards were investigated using standard microbiological techniques to know the distribution of and their resistant profile . antimicrobial resistance was studied using the modified kirby bauer disk diffusion technique following the clsi protocol.results:major infections found in different medical wards , surgical wards and icu were due to acinetobacter baumannii ( 74.02% ) , a. lowfii ( 14.2% ) , a. haemolyticus ( 7.79% ) , a. junii ( 3.8% ) among acinetobacter spices . acinetobacter showed increased resistant against majority of commercially available drugs imipenem ( 5.2% ) , meropenem ( 9.75% ) , piperacillin - tazobactum ( 18.2% ) , netilmicin ( 16.24% ) , amikacin ( 14.29% ) , ceftazidime ( 74.1% ) , gentamicin ( 70.13% ) , ofloxacin ( 42.21%).conclusion : a . baumannii was found to be associated with uti , rti , septicemia , bacteremia , and meningitis and wound infection . a. baumannii displayed higher resistance to more number of antibiotics than other nosocomial pathogens from icu .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

bone grafting is common in neurosurgery for spinal fusion and in orthopedic reconstruction surgery for revision hip replacement , repairing skeletal defects after a trauma , and for support when removing a tumor . three types of bone graft are used : autograft ( autologous graft ) , allograft , and alloplastic graft . an alloplastic graft is a synthetic substitute , usually created from ceramics ( calcium phosphate , calcium sulfate , or bioactive glass ) , polymer ( derivative from acrylate ) , or growth factors ( the family of bone morphogenetic proteins ) . intraoperative complications might occur and affect subsequent tissue healing , motor function recovery , and the surgical outcome . approximately 500,000 surgical site infections caused by bacteria and viruses occur every year in the united states . postoperative transmission of an infection can be devastating to the graft and the patient : it may lead to serious illness and even death . patients with a preexisting illness are at a higher risk for an infection than are those who are otherwise healthy . delayed union and nonunion fracture are two of the most common complications after orthopedic surgery , and both require additional reconstruction using bone grafts . moreover , after bone surgery , patients with an immunocompromised disease , like diabetes mellitus ( dm ) , have a greater risk of infection . two other increasing chronic infectious diseases in asia , tuberculosis ( tb ) and acquired immunodeficiency syndrome ( aids ) , may compromise the immunity of patients and relate to the incidence of bone infection . treating deep infection alternatively , a skin graft or flap might be required to improve the outcome after infection . for most patients , removing the graft might be the only way to fix the problem , because the fresh tissue may be the source or a nidus for infection recurrence . nevertheless , there is no prior study that examines the risk factors of infection after bone - grafting surgery . we examined the risk factors of infection in patients that underwent bone grafting in taiwan . data were collected from the taiwan national health insurance research database ( nhird ) ( http://nhird.nhri.org.tw/en/background.html ) and analyzed for all patients who were admitted to hospitals from 1997 through 2012 for primary bone - grafting treatment . the incidence of recipient graft site infection in patients who underwent bone grafting , and the risk factors associated with postoperative infection , were evaluated . this is the first large national database study of the factors associated with bone - grafting surgery . approximately 98% of taiwan 's population ( ca . 23 million ) participate in the national health insurance program ( http://www.nhi.gov.tw/english/index.aspx?menu=13&menu_id=486&wd_id=486 ) . the taiwan nhird , which uses the international classification of disease , ninth revision , clinical modification ( icd-9-cm ) diagnosis and procedure codes , covers all inpatient medical claims data for enrolled residents . the established categories of expenditure were provided in inpatient expenditure by admission ( dd files ) ( http://nhird.nhri.org.tw/date_01.html ) . the personal information of all patients was encrypted with a double scrambling protocol for research purposes to protect patient privacy . this study was approved by the institutional review board of jianan psychiatric center , and the protocol was evaluated by the national health research institutes ( nhri ) , which consented to this planned analysis of the nhird ( agreement number : nhird-103161 ) . the participant demographic characteristics , including age , gender , hospital stay , and low - income households , were identified at the index date . the risk factors included in this study were those that have been found to be associated with or possibly related to the development of bone infection . a diagnosis of bone infection was defined on the basis of deep infection after surgery ( excluding superficial infection ) as prescribed by the national health insurance system ( icd 9 codes 996.4 , 996.66 , 996.67 , 996.69 , and 730.10730.19 ; table 1 ) . data regarding deep infection - related surgeries ( icd 9 codes 77.177.9 , 79.3 , and 86.22 ) were collected . they were identified from data of the nhird based mainly on icd-9-cm diagnostic codes ( table 1 ) . the diagnosis in this study were judged and determined by related specialists and physicians according to the standard criteria . the minimum living expense standard was defined as 60% of the average monthly disposable income for each region . low - income households were defined as those with a monthly average per - member gross income of less than the monthly minimum living expense standard in the household 's residence region . the icd-9-cm procedure code used for alloplasts and allografts were the same ( 79.3 ) ; thus , grafts were grouped into three categories : alloplast / allograft , autograft , and combined ( autograft plus alloplast / allograft ) . the criterion for a nonunion fracture was an unhealed broken bone 9-month postfracture that had shown no healing progression between the affected ends of the bone for 3 months after any specific treatment . a fracture that failed to heal within the normal time for that fracture type and location was defined as a delayed union fracture . according to the chapter ii , laws of medical care act , ministry of health and welfare in taiwan ( http://law.moj.gov.tw/eng/lawclass/lawcontent.aspx?pcode=l0020021 ) , medical care institutions with wards for the inpatient care of patients shall be referred to as hospitals ; those with only out - patient facilities shall be referred to as clinics . clinics referred may set up no more than 9 beds for observation . in taiwan , local clinics are set up with different specificities . therefore , the data regarding to patients with bone infection can be collected from those local clinics specialized in orthopedics , general trauma , rehabilitation , infectious disease , etc . descriptive statistics were analyzed for all variables using frequency , percentage , mean , and standard deviation ( sd ) . the effects of outcome variables were measured using the adjusted odds ratio ( aor ) with a 95% confidence interval ( ci ) . approximately 98% of taiwan 's population ( ca . 23 million ) participate in the national health insurance program ( http://www.nhi.gov.tw/english/index.aspx?menu=13&menu_id=486&wd_id=486 ) . the taiwan nhird , which uses the international classification of disease , ninth revision , clinical modification ( icd-9-cm ) diagnosis and procedure codes , covers all inpatient medical claims data for enrolled residents . the established categories of expenditure were provided in inpatient expenditure by admission ( dd files ) ( http://nhird.nhri.org.tw/date_01.html ) . the personal information of all patients was encrypted with a double scrambling protocol for research purposes to protect patient privacy . this study was approved by the institutional review board of jianan psychiatric center , and the protocol was evaluated by the national health research institutes ( nhri ) , which consented to this planned analysis of the nhird ( agreement number : nhird-103161 ) . the participant demographic characteristics , including age , gender , hospital stay , and low - income households , were identified at the index date . the risk factors included in this study were those that have been found to be associated with or possibly related to the development of bone infection . a diagnosis of bone infection was defined on the basis of deep infection after surgery ( excluding superficial infection ) as prescribed by the national health insurance system ( icd 9 codes 996.4 , 996.66 , 996.67 , 996.69 , and 730.10730.19 ; table 1 ) . data regarding deep infection - related surgeries ( icd 9 codes 77.177.9 , 79.3 , and 86.22 ) were collected . they were identified from data of the nhird based mainly on icd-9-cm diagnostic codes ( table 1 ) . the diagnosis in this study were judged and determined by related specialists and physicians according to the standard criteria . the minimum living expense standard was defined as 60% of the average monthly disposable income for each region . low - income households were defined as those with a monthly average per - member gross income of less than the monthly minimum living expense standard in the household 's residence region . the icd-9-cm procedure code used for alloplasts and allografts were the same ( 79.3 ) ; thus , grafts were grouped into three categories : alloplast / allograft , autograft , and combined ( autograft plus alloplast / allograft ) . the criterion for a nonunion fracture was an unhealed broken bone 9-month postfracture that had shown no healing progression between the affected ends of the bone for 3 months after any specific treatment . a fracture that failed to heal within the normal time for that fracture type and location was defined as a delayed union fracture . according to the chapter ii , laws of medical care act , ministry of health and welfare in taiwan ( http://law.moj.gov.tw/eng/lawclass/lawcontent.aspx?pcode=l0020021 ) , medical care institutions with wards for the inpatient care of patients shall be referred to as hospitals ; those with only out - patient facilities shall be referred to as clinics . clinics referred may set up no more than 9 beds for observation . in taiwan , therefore , the data regarding to patients with bone infection can be collected from those local clinics specialized in orthopedics , general trauma , rehabilitation , infectious disease , etc . descriptive statistics were analyzed for all variables using frequency , percentage , mean , and standard deviation ( sd ) . only variables that were significantly associated with bone infection ( p < 0.05 ) were entered simultaneously into multivariate logistic regression models . the effects of outcome variables were measured using the adjusted odds ratio ( aor ) with a 95% confidence interval ( ci ) . we enrolled 1,303,347 cases ( mean age : 46.57 22.16 years old ; mean length of hospital stay : 8.04 7.73 days ; male : 58.4% ; low income : 1.3% ) ( table 2 ) . comorbid diseases included dm ( 83,416 ) , tb ( 1,353 ) , and aids ( 19 ) . the infection rate of bone - grafting cases with dm , tb , and aids was 4.6 , 6.6 , and 31.6% , respectively . more patients went to district hospitals ( 485,171 ) and regional hospitals ( 453,723 ) for surgery ( table 2 ) . all variables but previous bone graft surgery were significantly correlated with surgical site infection after bone grafting ( table 3 ) . characteristics of patients who underwent a bone graft bivariate associations between variables and bone infection univariate and multivariate analyses both showed that the likelihood of postoperative infection was significantly positively dependent upon the patient - related factors of age , gender , income , and comorbid diseases ( table 4 ) . patients more easily developed surgical site infections if they were older , were male , had a lower income , and had comorbid diseases . patients with comorbid aids had the highest odds of infection ( aor = 6.945 , 95% ci = 2.40520.054 , p < 0.001 ) . univariate and multivariate analyses also showed that the likelihood of postoperative infection was significantly dependent upon the surgery - related factors of hospital stay length and fracture , graft , and hospital type . patients with a history of nonunion have relatively high odds of developing a surgical site infection ( aor = 7.005 , 95% ci = 6.7747.245 , p < 0.001 ) ; our data also indicated that patients who underwent an autograft were the least likely to develop a postoperative infection . the aor of patients who had their bone grafts done in medical centers was 0.928 compared with those who had them done in local clinics ( 95% ci = 0.9040.953 , p < 0.001 ) . the aor of patients who had their bone grafts done in regional hospitals was 0.764 compared with those who had them done in local clinics ( 95% ci = 0.7430.785 , p < 0.001 ) . the aor of patients who had their bone grafts done in district hospitals was 0.544 compared with those who had them done in local clinics ( 95% ci = 0.3360.881 , p = 0.013 ) . the relative risk factor of surgical site infection was the highest for bone grafts done in local clinics , followed by those done in medical centers , regional hospitals , and district hospitals . to our surprise , the odds of infection in the medical centers were the second highest . in this study , we evaluated various risk factors of surgical site infection in patients who undergo bone grafting . among the 1,303,347 cases that had undergone a bone - grafting operation , 39,816 cases developed a postoperative infection . the infection rate was 3.05% , lower than the 5.4% allograft infection rate in 128 patients reported by delloye et al . our infection rate was also lower than the 7.8% rate in 140 patients after cranioplasty . our infection rate might be lower because our patients were recruited from the general population and because we did not restrict enrollment based on the surgery site or the graft materials used . surprisingly , except for local clinics , the smallest units where the aor was highest , the second highest one was in the medical centers , the largest units , followed by the regional hospitals and district hospitals . the commonsense and intuitive order should have been local , district , and regional hospitals , and then medical centers , that is , the smallest rate of infection should have been at the largest unit . this paradoxical finding might be explained by a national study of nosocomial infection , which found that the infection rate was highest in medical centers ( 0.42% ) followed by regional hospitals ( 0.34% ) . it may also explain why staying 1 extra day in a hospitals increased by 1.054 times the odds of developing a surgical site infection . patients given an autograft were less likely to develop an infection than those who were given a combined graft or an alloplast / allograft . similar results were reported in a study on anterior cruciate ligament reconstruction : bone - tendon - bone autografts were associated with a lower risk of postoperative infection than were allografts and combined grafts . the principles involved in successful bone grafts include osteoconduction ( guiding the reparative growth of the natural bone ) , osteoinduction ( encouraging undifferentiated cells to become active osteoblasts ) , and osteogenesis ( living bone cells in the graft material contribute to bone remodeling ) . however , an autograft might lead to complications such as pain , infection , scarring , and blood loss , as well as a variable quantity of bone to harvest from each patient . the alternative is an allograft , but that lacks osteoactive capacity and risks carrying infectious agents or leading to an immune rejection . other approaches have used alloplasts , which are various types of organic and synthetic substitutes for bone , and they have focused on improving the efficacy of bone grafts or other scaffolds by incorporating bone progenitor cells and growth factors to stimulate cell proliferation . based on our study , in addition to using an autograft alone , the combined use of an alloplast with an autograft might help reduce infection . we collected data without exclusion of prior infection history . although the bone grafting was performed when no sign of infection or the infection was totally under control in surgical sites , an exclusion of these patients with prior infection would underestimate the infection rate . the debridement of wound infection would not be considered to use bone grafts . however , in rare cases , when repetitively deep infection occurred , a vascular bone graft might be applied from the donor site of patients for bone grafting . in that case , this type of bone graft belonged to autograft that was the least likely to develop a postoperative infection compared to the other two groups in our study . nevertheless , preexisting complications can increase the risk of infection ; for example , a nonunion increases it 7.005 times and a delayed union increases it 2.781 times after bone grafting . careful attention is required when doing a bone graft , particularly in patients with these histories . our study indicated that patients 1 year older were 1.009 times more likely to develop a postoperative infection than patients 1 year younger . moreover , patients with comorbid chronic or infectious diseases were more likely to develop an infection . oxidative stress in the tissue of patients with dm reduces the phagocytic and antibacterial activity of neutrophils and macrophages and provides an intracellular niche for the pathogen to replicate . it should not , therefore , be surprising that patients with comorbid aids are 6.945 times more likely to become infected after bone - grafting surgery . notably , patients with comorbid tb , another infectious disease with a rapidly rising incidence worldwide , are 1.780 times more likely to become infected than those without tb . cd4 t cells are protective against mycobacterium tuberculosis : cd4 t cell depletion is responsible for the increased susceptibility to develop active m tuberculosis in hiv - infected patients . although the role of cd8 t cells in tb is less clear than the role of cd4 t cells , they are generally considered to contribute to optimal immunity and protection . these results suggested that compromised immunity because of aging and comorbid disease are determining risk factors of bone - graft infection . how other noninfectious comorbid diseases were involved in bone - graft infection required for further investigation . we also found that low - income earners were 1.634 times more likely compared with higher income earners to develop an infection . consistent with this risk factor for other bone surgery , economic stress might physically and psychologically make patients less aware of the state of their individual health . the national health insurance bureau has established a uniform system to control the quality of medical services , and the quality of the coded data in the present study was reliable . compared with self - reported surveys , the methodology used in this study reduced the patients recall bias and thereby increased its accuracy . nevertheless , the nhird provides only insurance - related data ; information such as education level and marital status are not provided . second , the limited data acquired made it difficult to explain the different infection rate between males and females . identified that several risk factors were associated with infection after total knee arthroplasty surgery , including previous history of open reduction internal fixation , remnants of prior internal fixation material , and male gender . this is probably why the mortality rate was higher for male patients orthopedic and trauma admissions . compliance with the doctor 's prescribed medication regimen may be different between men and women . in conclusion , we surveyed the epidemiology of surgical site infection in patients who had undergone bone grafting in taiwan between 1997 and 2012 . they consists of the patient - related factors like age , income , gender , and chronic diseases , and the surgery - related factors like the length of hospital stay , disease complications , type of graft used , and type of hospital in which the surgery was done . as the frequency of using different types of bone grafts for orthopedic reconstructive surgery increase , our findings should provide an understanding of the risk factors associated with infection and should be a valuable reference for orthopedic surgeons .

abstractbone grafting is a commonly used orthopedic surgical procedure that will provide bone formation in bone defects or regions of defective bone healing . a major complication following bone grafting is a postoperative recipient graft site infection that is associated with substantial mortality and increased use of medical resources . the purpose of the study was to identify the risk factors associated with infection after bone - grafting surgery.data from 1,303,347 patients listed in the taiwan national health insurance research database ( nhird ) and admitted to hospitals from 1997 through 2012 who underwent primary bone grafting ( mean age : 46.57 years old ; mean length of hospital stay : 8.04 days ) were analyzed . the incidence of infection by age , hospital stay , gender , income , chronic disease ( tuberculosis [ tb ] ; diabetes mellitus [ dm ] ; acquired immunodeficiency syndrome [ aids ] ) , fracture complications ( nonunion ; delayed union fracture ) , types of graft and hospital was evaluated.three percent of the patients developed a postoperative recipient graft site infection . multivariable analysis revealed that patients were more likely to develop a post bone - grafting surgery infection if they were older , had a longer hospital stay , were male , had a lower income , or had comorbid tb , dm , or aids . patients were more likely to develop an infection if they had a nonunion , an alloplast graft , or treated in a local clinic.our findings should provide a clinically relevant reference for surgeons who perform bone grafting . patients should be informed of the potential risks .

INTRODUCTION METHODS Data Source Study Design Statistical Analysis RESULTS DISCUSSION

globally , mother - to - child transmission of hiv-1 results in approximately 370 000 infant infections each year . hiv-1 early infant diagnosis ( eid ) programs aims to detect hiv infection as early as possible in hiv - exposed infant and to link them to care and treatment . eid of hiv confers substantial benefits to infants and families , both for hiv - infected and uninfected infants , as well as to programs providing prevention of parent - to - child transmission ( pptct ) services , including hiv counselling and testing , family centric approach , provision of care , support and lifelong treatment for hiv positive women , provision of arv and cotrimoxazole prophylaxis and early infant diagnosis services for hiv - exposed children , guidance on feeding and nutrition practices , and immunization services . maharashtra is one of the high prevalent states in the country with hiv prevalence of 0.4% among antenatal women and 0.42% in adults and ante natal case prevalence 0.40% . early infant diagnosis was launched in the country in april 2010 , which entails follow - up of babies born to hiv positive women for hiv dna polymerase chain reaction ( pcr ) test and subsequently final hiv test at the age of 18 months of age . a major priority for pptct services is ensuring pregnant women pursue their care and treatment , including testing of babies at regular intervals for eid . the common barriers reported in qualitative studies regarding low uptake of pptct - eid services for mother and baby both include confidentiality , stigma , availability of testing facility , financial issues , behavior of health staff , fear of baby 's hiv test result , cultural barriers , long waiting time . in addition , health workers are unable to monitor pregnant women because of inadequate data management system across the service continuum . who estimates that only 615% of hiv - exposed infants under 1 year of age accessed eid programs in 20082009 , highlighting that the implementation of effective eid programs has been challenging in resource - limited settings and demands careful attention . although there are many reasons for the lack of continuity of care , there is a need to improve the adherence and retention in care and this may be improved by maintaining better communication between program officers and field staff . mobile phone technology has the potential to serve as a strategic intervention medium to improve patient management . owing to the widespread use and low cost of this technology , it pervades all age groups and many cultures and socioeconomic backgrounds . but there is also a need for interactive program management by reacting promptly and effectively to deviations from program plans . this may include operational decisions for short - term management of patient retention at individual care centers , tactical decisions such as reconfiguring the messaging based on performance , and strategic decisions such as data collection or preservation . hence , an integrated mobile phone text messaging system was designed , developed , and implemented to follow the babies under eid in maharashtra ( excluding mumbai ) in june 2012 . this study was conducted to assess the utility of web - based mobile technology monitoring tool , for ensuring linkages , and tracking of hiv - exposed child until 18 months of age . maharashtra state aids control society developed a web - based system that provides support to eid program . a broad set of usability requirements was identified during brainstorming design sessions between the researchers , program officers , and developer . the program officers in maharashtra state aids control society , with strong program backgrounds and substantial experience in healthcare and understanding of the field problems , outlined the requirements that they anticipated the system should offer . these requirements were then documented and elaborated in more detail as new ideas were exchanged within the design team ( two program officers and one computer experts ) and final design principles of the system were derived . the development team and the program officers assessed the responses from field staff in the current system , which were stored in a microsoft structured query language server , to identify patterns that could be used to define relevant answers . the output was a list of possible automatic sms text message replies through symbian supported mobile . eid follow - up system was designed as a web - based tool using java swing framework which generates automated sms and e - mails for reminding the field level staff for follow - up of hiv - exposed babies 7 days prior to the follow - up date . the information was collected through field tested excel - based hiv positive pregnant women line - list format incorporating the major key indicators of pptct program . this line list is generated at the hiv testing facilities where the pregnant woman is detected hiv positive . format is then shared through e - mail with hiv treatment facilities to update the treatment details of the pregnant women . the line list is further updated on periodic basis whenever the pregnant women is accessing the pptct services at hiv facilities . the individual records in the line list are monitored and crossverified by district and state level officials during the supervisory visits to these centers on periodic basis . the data collected through line list from different districts is then compiled by the state . for the software , we used the variables like name of mother and child , date of birth of baby , mobile number of counsellor and district supervisor , email of district official , and name of the hiv testing facility . database of hiv positive mother and her exposed child with date of birth was updated on monthly basis . deliberation with various stakeholders on development of tracking system led to use of mobile technology in follow - up mechanism . the software developed sends required information ( name of mother / child , facility name , and follow - up date ) to the counsellor of the respective facility and district supervisor as mobile text message alerts on daily basis and simultaneously , system generated e - mail is send to district officials for monitoring and following the baby for eid . we used brainstorming techniques to solicit usability requirements , focus group meetings to discuss and define system architecture , and prototyping to test in real environments and to improve the system ( fig . eid follow up system : development process and work flow . in this kind of system , there are telecommunication costs involved . it is imperative to be able to make favorable bulk mobile text messaging contracts on the part of the healthcare provider , but also to be efficient in messaging so as to reduce the traffic . on a pilot basis , we have purchased sim card at state for sending mobile text message from the same number to counsellors and district supervisors . the connection between the server and the client mobile is made using a web service . a set of text messages was developed based on discussion involving the design team and the program officers . suggestions for message formulations were reviewed and amended during team meetings , resulting in a final set of three messages , which were approved by all involved . in both sets , messages for testing of baby for eid were divided into four categories : 6-week follow - up reminders , 6-month follow - up reminders , 12-month follow - up , and 18-month follow - up reminders . the messages did not include general information about the health status of the patient because such status information may be difficult to communicate in an unambiguous way . as the mobile networks in maharashtra are often unreliable , especially in rural areas , we designed a mechanism of e - mail to district aids prevention and control unit ( dapcu ) and dapcu will follow - up at field level . this way , we were able to , in most cases , get daily updates , although not necessarily at a predefined time every day . to accommodate the requirements , architecture the main elements of this architecture include the following : the sms server , as shown in fig . 3 , interacts with feild staff that uses their mobile phone set and the sms messaging service to send messages to the system . at the lowest level , the sms server interfaces with a global system for mobile ( gsm ) modem that sends field staff sms text messages through an sms service provider ( mobile operator ) . once the data are imported in software from excel sheet , the sms server performs checks on its content and responds to the field staff accordingly ( automatic reply feature ) . safeguarding the privacy , confidentiality , and security of any public health information is an important undertaking . the system only collects data necessary for the server to process and send text messages . the system comprises an application layer for the capture and delivery of patient information , including date of next appointment and next date of testing , to a remote server by means of a gsm modem . six sets of system requirements that need to be addressed for success are data collection , telecommunication costs , privacy and data security , text message content , connectivity , and system scalability . a text messaging system was designed and implemented in 578 hiv testing facilities and district supervisors in 33 districts in maharashtra . these sites feed data into a central data repository , which was used for analysis of operations and decision support . based on the follow - up schedule , the system automatically generates appointment reminders as mobile text message to counsellors and as emails to dapcu officers . healthcare professionals , technical experts , and an interdisciplinary group of researchers were involved in the design , development , and implementation processes to enhance the utility and functionality of the system . it is imperative to be able to make favorable bulk mobile text messaging contracts on the part of the healthcare provider , but also to be efficient in messaging so as to reduce the traffic . on a pilot basis , we have purchased sim card at state for sending mobile text message from the same number to counsellors and district supervisors . the connection between the server and the client mobile is made using a web service . a set of text messages was developed based on discussion involving the design team and the program officers . suggestions for message formulations were reviewed and amended during team meetings , resulting in a final set of three messages , which were approved by all involved . in both sets , messages for testing of baby for eid were divided into four categories : 6-week follow - up reminders , 6-month follow - up reminders , 12-month follow - up , and 18-month follow - up reminders . the messages did not include general information about the health status of the patient because such status information may be difficult to communicate in an unambiguous way . as the mobile networks in maharashtra are often unreliable , especially in rural areas , we designed a mechanism of e - mail to district aids prevention and control unit ( dapcu ) and dapcu will follow - up at field level . this way , we were able to , in most cases , get daily updates , although not necessarily at a predefined time every day . to accommodate the requirements , architecture the main elements of this architecture include the following : the sms server , as shown in fig . 3 , interacts with feild staff that uses their mobile phone set and the sms messaging service to send messages to the system . at the lowest level , the sms server interfaces with a global system for mobile ( gsm ) modem that sends field staff sms text messages through an sms service provider ( mobile operator ) . once the data are imported in software from excel sheet , the sms server performs checks on its content and responds to the field staff accordingly ( automatic reply feature ) . safeguarding the privacy , confidentiality , and security of any public health information is an important undertaking . the system only collects data necessary for the server to process and send text messages . the system comprises an application layer for the capture and delivery of patient information , including date of next appointment and next date of testing , to a remote server by means of a gsm modem . six sets of system requirements that need to be addressed for success are data collection , telecommunication costs , privacy and data security , text message content , connectivity , and system scalability . a text messaging system was designed and implemented in 578 hiv testing facilities and district supervisors in 33 districts in maharashtra . these sites feed data into a central data repository , which was used for analysis of operations and decision support . based on the follow - up schedule , the system automatically generates appointment reminders as mobile text message to counsellors and as emails to dapcu officers . healthcare professionals , technical experts , and an interdisciplinary group of researchers were involved in the design , development , and implementation processes to enhance the utility and functionality of the system . before the introduction of eid follow - up system , only 55.9% ( 637/1139 ) of the hiv - exposed babies born were tested at 6 weeks for dna - pcr during april 2011march 2012 . however , after its introduction , 68.4% ( 1117/1631 ) of them were tested during april 2012march 2013 . correspondingly , the 18 months confirmatory hiv testing in eligible babies increased from 45.6% ( 934/2044 ) to 54.7% ( 1118/2044 ) . this study summarizes the processes of design , development , and implementation of a remote management system using mobile technologies to help field staff and supervisors to track mother and children for hiv testing . our study endeavors to design , develop , and implement a tool to empower health staff in tracking hiv - exposed children . mobile phones are available and are practical , low - cost tools that may facilitate and support health staff in follow - up of babies . our study showed that mobile phone text messaging provides an effective communication mechanism between healthcare providers and supervisors , provided it is implemented well . it has been shown that regular follow - up is possible through mobile technology intervention . design of a system for follow - up of specific diseases like hiv / aids , based on mobile phone text message and e - mail technology , includes careful attention to not only the theoretical underpinning of the strategic intervention and associated content , but also the requirements for optimal design , including how each part of the system has to be placed together . crucial parts of a successful text messaging intervention include how messages are tailored , how participants may be directed to different content based on their situation , and the intensity of the communication . the system must also include cost - effective mechanisms so as to minimize costs of both technologies involved ( including costs for gsm network communication and gsm modems with its data plan ) and of sending messages to patients . trust , usefulness , and usability are crucial issues for both health staff and professional users , and it is important that features installed also work properly and meet privacy standards . therefore , it is better to move slowly in making the system more advanced and , at the same time , making sure to have users on board . the basic input information required for system to generate the follow - up is being manually compiled through excel - based format on monthly basis leading to delay in updating the base data in the system . this study demonstrated that it is possible to design , develop , and implement an integrated remote patient management system using the mobile phone 's text message feature to communicate with field staff regarding alerts on follow - up of children . the study shows that it is necessary to address the following six different requirements : data collection , telecommunication costs , privacy and data security , the content of text messages , connectivity , and system scalability . state may plan for an evaluation of the system , including a satisfaction survey of the health professionals and field staff that used it . additionally , plan to perform a cost - benefit analysis and to implement the system permanently with advanced technology using android - based smart phone . we thank all the ictc , dapcu , art and sacs staff of maharashtra state aids control society for their sincerity and hard work in facilitating this study .

objectivethe purpose of this study is to assess the utility of web - based mobile technology monitoring tool , for ensuring linkages , and tracking of hiv - exposed child until 18 months of age.methodsthe early infant diagnosis ( eid ) follow - up system was designed as a tool for reminding the field level staff for follow - up of hiv - exposed babies . using java swing framework , software was developed which generates automatic advance sms alerts regarding patient information to the counsellor of the respective integrated counselling and testing center and district supervisor , 7 days prior to due dates . simultaneously , system generated e - mail is sent to district program officer for monitoring and updating the line-list.resultsbefore the introduction of eid follow - up system in june 2013 , only 55.9% ( 637/1139 ) of the hiv - exposed babies born were tested at 6 weeks for dna - polymerase chain reaction during april 2011march 2012 . however , after its introduction , 68.4% ( 1117/1631 ) of them were tested during april 2012march 2013 . correspondingly , the 18 months confirmatory hiv testing in eligible babies increased from 45.6% ( 934/2044 ) to 54.7%(1118/2044 ) during the same period.conclusionthe replicable technology driven initiative would help in strengthening the follow - up mechanisms and reach every hiv - exposed child for eid .

INTRODUCTION METHODS Telecommunication costs Privacy and data security Text message content RESULTS DISCUSSIONS LIMITATION OF STUDY CONCLUSION RECOMMENDATIONS Acknowledgements Financial support and sponsorship Conflicts of interest

regulation of gene expression is fundamental for the coordinate synthesis , assembly and localization of the macromolecular structures of cells . this is achieved by a multi - step program that is highly interconnected and regulated at diverse levels ( fig . it starts in the nucleus , where transcription factors bind to specific dna sequences proximal to the genes they regulate and recruit rna polymerases for rna synthesis . as soon as rna precursors are formed , they get covered by a host of proteins forming ribonucleoprotein complexes [ 3 , 4 ] . messenger rna - binding proteins ( mrbps ) associate with nascent mrna precursors and mediate diverse rna processing reactions including 5-end capping , splicing , editing , 3-end cleavage and polyadenylation [ 24 ] . the transcripts are subsequently exported through nuclear pores to the cytoplasm where they may undergo localization to subcellular regions by complexes consisting of motor proteins and rbps or by the signal recognition particle . the transcripts assemble with translation factors and ribosomes for protein synthesis , which is controlled by global or transcript - specific mechanisms . the fate and location of proteins can be further controlled through modification of specific amino acids , cleavage by site - specific proteases and degradation through the proteasome . see text for details . besides many classical biochemical and genetic studies that revealed factors involved in and regulating these diverse steps in the gene expression program , the recent development of genome - wide analysis tools like dna microarrays allowed fundamental new insights into the systems architecture of gene regulatory programs . for instance , dna microarrays have been extensively used to study transcriptional programs by comparing steady - state rna levels between diverse cell types and stages , and by the mapping of binding sites for dna - associated proteins through chromatin immunoprecipitation ( so - called chip - chip assays [ 9 , 10 ] ) . integration of these data allowed the description of complex transcriptional regulatory networks , involving large sets of genes that control coherent global responses in physiological and developmental programs [ 1113 ] . in contrast , less is known about the systems architecture that underlies the post - transcriptional steps in the gene expression program ( although many rna regulatory processes also occur co - transcriptionally , we further classify them as post - transcriptional for simplicity ) . considering the large number of mrna molecules in the cell ranging from 15 000 to 150 000 mrna molecules in yeast and mammals , respectively it is rational to assume that the location , activity , and fates of these rnas is not left to chance but is highly coordinated and regulated by an elaborate system . such a post - transcriptional regulatory system may be controlled by the hundreds of rbps and non - coding rnas ( e.g. micrornas ) that are encoded in eukaryotic genomes , possibly defining specific fates of each rna by the combinatorial binding of distinct groups of rbps [ 1416 ] . here , we summarize recent work that applied genomic tools to decipher the principles and logic of post - transcriptional regulatory systems . we focus on studies considering the localization , translation and decay of mrnas in eukaryotes . nodes of these programs , which involves the characterization of rbps and the systematic identification of their rna targets ( fig . ( a ) determining the translation status of each mrna for the mapping of translational programs . cell - extracts are fractionated through a sucrose - density gradient and the absorbance at 254 nm is monitored . free rna and ribosomal subunits , monosomes ( 80s ) and polysomes , and analyzed with dna microarrays . the relative position of a message in this profile is an indicator for its translational activity . ( b ) systematic identification of rnas associated with specific rna - binding proteins . in this ribonomics approach , rbps are immunoprecipitated or affinity - purified via a tag from cellular extracts . rnas associated with rbps are isolated , cdna copies are fluorescently labeled and hybridized to dna microarrays . the cy5/cy3 fluorescence ratio for each locus reflects its enrichment by affinity for the cognate protein . ( a ) determining the translation status of each mrna for the mapping of translational programs . cell - extracts are fractionated through a sucrose - density gradient and the absorbance at 254 nm is monitored . free rna and ribosomal subunits , monosomes ( 80s ) and polysomes , and analyzed with dna microarrays . the relative position of a message in this profile is an indicator for its translational activity . ribonomics approach , rbps are immunoprecipitated or affinity - purified via a tag from cellular extracts . rnas associated with rbps are isolated , cdna copies are fluorescently labeled and hybridized to dna microarrays . the cy5/cy3 fluorescence ratio for each locus reflects its enrichment by affinity for the cognate protein . rna localization generally refers to the transport or enrichment of subsets of mrnas to specific subcellular regions . rna localization can be achieved passively by local protection from degradation or through the trapping / anchoring at specific cellular locations . moreover , asymmetric distribution of rna can also be established by the active transport of rnas via rbp - motor protein complexes [ 5 , 17 ] . here , we discuss studies that systematically mapped rna distribution to subcellular structures or organelles , and then refer to investigations aimed at globally identifying localized mrnas mediated through active mrna transport by rbps . in a pioneering study by pat brown and colleagues , cytosolic ribosomes by equilibrium density centrifugation in a sucrose gradient , and the distribution of transcripts in the fractions were quantified by comparative dna microarray analysis . as expected , transcripts known to encode secreted or membrane - associated proteins were enriched in the membrane - bound fraction , whereas those known to encode cytoplasmic or nuclear proteins were preferentially enriched in the fractions containing mrnas associated with cytoplasmic ribosomes . however , transcripts for more than 300 genes in the yeast saccharomyces cerevisiae were found in the membrane - fraction coding for previously unrecognized membrane or secreted proteins . rather unexpected , among these was also the message for ash1 coding for a well - known transcriptional repressor , suggesting alternative signals for membrane association . similarly , application of this method to map mrna distributions in the plant arabidopsis thaliana allowed the classification of 300 previously unknown transcripts as secreted or membrane - associated proteins . a recent extension of this approach to eleven different human cell lines provided a detailed catalog containing more than 5000 previously uncharacterized membrane - associated and 6000 cytoplasmic / nuclear proteins at high confidence levels . strikingly , this analysis predicts that 44% of all human genes encode membrane - associated or secreted proteins exceeding previous estimates ranging from 15% to 30% . in addition , the comparison of this catalog to data obtained from hundreds of dna microarray profiles from tumors and normal tissues allowed the identification of candidate genes that are highly overexpressed in tumors and , hence , could be particularly good candidates for diagnostic tests or molecular therapies . claude jacq s lab applied a subcellular fractionation approach to determine transcripts associated with free and mitochondrion - associated ribosomes in the yeast s. cerevisiae . besides the mrna for atp14 , which was previously known to localize in the vicinity of mitochondria , nuclear transcripts for diverse mitochondrial proteins were enriched in the mitochondrial fraction . interestingly , two characteristics correlated with this mrna localization : the phylogenetic origin and the length of the genes . mrnas enriched in the mitochondrial fraction were preferentially longer ( as deduced from average length of the encoded proteins ) and originate from genes with bacterial homologues , whereas mrnas in free cytosolic polysomes were shorter and of eukaryotic origin [ 22 , 23 ] . possibly , such coordinate localization of groups of mrnas could allow oriented access for controlling their fates . for instance , a low - density array study revealed that 22 out of 649 analyzed transcripts were enriched in the cytoskeleton fraction relative to the cytosolic fraction most of these encoding ribosomal proteins or structural proteins that interact with the cytoskeleton [ 24 , 25 ] . in polarized cells like neurons , mrna localization has major physiological implications . in dendrites , rna transport and subsequent local protein synthesis is thought to influence experience - based synaptic plasticity and long - term memory formation ; in axons , local translation modifies axon guidance and synapse formation [ 26 , 27 ] . however , to date there are only a handful of well - characterized examples of localized neuronal mrnas , among them the messages coding for microtubule - associated protein 2 ( map2 ) , the -subunit of a calmodulin - dependent protein kinase ( camkii ) , brain - derived neurotrophic factor ( bdnf ) , and activity - regulated cytoskeletal - related ( arc ) [ 5 , 26 ] . therefore , several genomics - based approaches have been undertaken to identify novel localized transcripts . for example , matsumoto et al . fractionated brain tissue and isolated rna from the heavy portion of polysomes and synaptosomes to provide a list of potentially dendritic mrnas that undergo localized translation . interestingly , the induction of neural activity by an electroconvulsive shock triggered a redistribution of the population of dendritic transcriptome , which may trigger changes in the translatability of this transcriptome , suggesting complex mechanisms of local translation in response to synaptic inputs ( fig . the hundreds of potentially localized mrna in neurons now await confirmation by in situ hybridization and exploration as to whether and how these may be regulated through activating stimuli , such as neurotransmitter release . to date , more than 100 mrnas are known to undergo active mrna transport in diverse organisms [ 17 , 29 ] . in neurons , mrnas are transported over long distances in a microtubule - dependent manner in the form of large granules consisting of rna - binding proteins , ribosomes and translation factors [ 27 , 30 ] . several rbps associated with neuronal rna transport have been identified , such as zipcode - binding proteins ( zbp1,2 ; named after their ability to bind to a conserved 54-nucleotide element in the 3-utr of the -actin mrna known as the zipcode ) , staufen , hnrnpa2 , cytoplasmic polyadenylation protein ( cpeb ) and members of the familial mental retardation proteins ( fmrps ) . at least for one of these rbps , fmrp , a systematic gene array - based screen was undertaken to identify the mrnas that are transported and possibly regulated by this protein . using a ribonomics approach , which involved the immunoprecipitation or affinity isolation of rbps followed by the identification of bound rnas with dna microarrays ( fig . 2b ) , the authors immunopurified the protein from mouse brain tissues and found 4% of all mrnas ( 435 messages ) associated with fmrp . in addition , they compared the mrna profiles of polyribosomes between normal human cells and cells derived from fragile x syndrome patients identifying over 200 messages with altered association and hence , these are potentially subject to translational regulation ( fig . notably , nearly 70% of the homologous messages found in both studies had a g - quartet structure , which was demonstrated as an in vitro fmrp target . these data provided a good starting point for further investigations on the most critical targets involved in fragile x pathophysiology and , possibly , on other related cognitive diseases . probably the best - studied example for actin - dependent rna transport concerns ash1 mrna localization to the bud tip of yeast cells during cell division . mrna is bound by she2p , an rbp tethered to the myosin motor protein myo4p via the adaptor protein she3p . this rna - protein complex travels along actin cables to the emerging bud for local protein synthesis . to identify other localized mrnas , affinity purification of components of the she complex followed by the analysis of bound mrna with microarrays was combined with a robust reporter system for in vivo visualization as a secondary screen [ 33 , 34 ] . this analysis revealed 23 additional transcripts that are localized to the bud - tip and encode a wide variety of proteins , several involved in stress responses and cell wall maintenance . these results reveal an unanticipated widespread use of rna transport in budding yeast possibly providing the daughter cells with a favorable start - up package. in conclusion , the few studies that investigated spatial distribution of mrnas in the cell on a global level challenge the long - standing assumption of a rather unorganized pool of mrnas that randomly diffuse in the cytoplasm to be eventually translated . possibly , many mrnas may be spatially organized even in non - polarized cells for local translation or decay in processing ( p ) bodies . further applications of both subcellular fraction techniques and ribonomics approaches will certainly reveal a more comprehensive picture of the spatial arrangement of rnas in cells . translational regulation has essential roles in development , oncogenesis and synaptic plasticity [ 3537 ] . it concerns the differential recruitment of mrna species to the ribosome for protein synthesis , which results in a lack of correlation between the relative amounts of mrna and the amount of the encoded protein . in an innovative study , the relative contribution of transcriptional and translational regulation in yeast was measured using large - scale absolute protein expression measurement called apex ( absolute protein expression index ) , which relies upon observed peptide counts from mass spectrometry . most ( 73% ) of the variance in protein abundance can be explained by mrna abundance , which is lognormal distributed around an average of 5600 proteins per mrna molecule . this indicates that the abundance of most proteins is set per mrna molecule ; however , one third of the mrnas must be regulated at additional levels including translation and/or protein turnover . in mammalian cells , the fraction of differentially expressed messages may be considerably higher ranging from 60% to 80% , indicating that gene expression of most messages is heavily controlled at diverse levels . translation can be divided into three steps : initiation , elongation and termination . during translation initiation , the primary target for translational control , translation initiation factors ( eifs ) recruit the mrna to the small ribosomal subunit ( 40s subunit ) . thereby , eif4e binds to the cap structure at the 5-end of the mrna and interacts with eif4 g , which binds to the poly(a)-binding protein ( pabp ) . the initiation complex then scans the mrna in 5 to 3 direction until the initiation codon is reached where the large ribosomal subunit ( 60s ) joins the complex leading to the formation of active ribosomes . notably , ribosomes can also be recruited cap - independently to some viral and cellular mrnas by direct binding of the small ribosomal subunit to internal rna structures , termed ires . the assembled ribosomes traverse the coding region with help of elongation factors ( eefs ) and synthesize the encoded polypeptide with multiple ribosomes covering them rna to form polysomes . at the termination codon , peptide chain - releasing factors ( erfs ) two basic modes of translation regulation have been described . during global regulation , translation of most mrnas for instance , phosphorylation of eif2 reduces the amount of active initiation complexes and hence leads to a rapid reduction of translation of most messages . the availability of eif4e is controlled by 4e - binding proteins ( 4e - bp ) that displace eif4 g from eif4e , and thus inhibit association of the small ribosomal subunit with them rna[6 , 41 ] . the second mode of translational regulation concerns mrna - specific control , where translation of defined groups of mrnas is modulated without affecting general protein biosynthesis . this can be carried out by specific rna - binding proteins , which often bind to sequence or structural elements in untranslated regions ( utrs ) of protein - coding transcripts and , hence , repress translation via interactions with eifs [ 6 , 42 ] . a prime example for such regulation represents cytoplasmic aconitase , an enzyme that regulates iron - dependent translation initiation through binding to a stem - loop structure in the 5-utr of messages involved in iron metabolism ( e.g. , ferritin mrna coding for an iron regulatory protein ) . specific control can also be exerted by micrornas ( mirnas ) small rnas of 22 nucleotides in length that have recently been shown to repress translation via base pairing to sequences located in 3-utrs of target mrnas . interestingly , it has recently become apparent that mirna- and rbp - mediated translational regulation may collaborate or compete on specific mrna substrates , suggesting interconnections between these different modes of translational regulation . genome - wide analysis of translational regulation . a reliable measure for translation of cellular mrna is the degree of its association with ribosomes . since the rate of initiation usually limits translation , most translational responses will alter the ribosome density on a given mrna . actively translated mrnas are typically bound by several ribosomes ( polysomes ) and can be separated from the small ( 40s ) and the large ( 60s ) ribosomal subunits and the 80s monosomes by sucrose gradient centrifugation ( fig . in classical experiments , total rna was isolated from fractions of the polysomal gradient and assayed for the mrna of interest by northern blot analysis . several laboratories have further extended this technique using dna microarray technology to perform genome - wide analysis of mrnas in polysomes in yeast , drosophila and mammals . the laboratories of pat brown and daniel herschlag performed a high resolution translation state analysis in rapidly growing yeast cells , providing profiles for mrna - ribosome association for thousands of genes . based on these data , they calculated the ribosome occupancy ( fraction of a specific mrna associated with ribosomes ) , the ribosome density and the translation rate for each expressed mrna . the average occupancy was calculated at 71% , indicating that most mrnas are likely engaged in active translation . however , about 100 mrnas showed only weak association with ribosomes and may therefore be considered as potential candidates for translation on demand. the average ribosome density was found to be 156 nucleotides per ribosome , which is about one fifth of the maximal packing density , supporting the premise that translation initiation is the rate - limiting step for protein synthesis . surprisingly , the orf length appears to be a major factor determining the ribosome density , which is expressed through an inverse correlation between the orf length and the ribosome density in diverse species [ 4749 ] . since poly(a ) tail length affects translational efficiencies and mrna stability , two recent studies systematically addressed its length in yeast [ 48 , 50 ] . in a procedure called polyadenylation state array analysis ( pasta ) , mrnas were captured with poly(u ) sepharose columns and differentially eluted by increasing temperature . rnas fractions were analyzed with dna microarrays to identify groups of mrnas with similar poly(a ) tail lengths . in the yeast s. cerevisiae , mrna coding for functionally or cytotopically related mrnas long poly(a ) tails were found among mrna coding for cytoplasmic ribosomal proteins , whereas short tails were enriched for dna / ty elements and among mrnas coding for nucleolar proteins involved in ribosome synthesis , and proteins with cell cycle - related functions . the comparison of the data with other genome - wide analysis revealed that poly(a ) tail length positively correlates with ribosome density and to some extend with mrna abundance , and it negatively correlates with orf and utr length . the poly(a ) tail length , and hence ribosome occupancy of messages correlate with the degree of association with poly(a)-binding protein ( pab1p ) global support for the concept that long poly(a ) tails stimulate translation via pab1p and eif4 g . therefore , it appears that translation rates are not directly coupled to mrna decay control , although poly(a ) shortening is a prerequisite for mrna decay . possibly , processes acting on oligo(a)-tailed intermediates may limit the decay rates of large number of yeast mrnas . a congruent study performed in fission yeast s. pombe monitored translational status , poly(a ) tail length , mrna abundance , mrna decay rates and rna polymerase ii association under identical conditions . functional groupings of mrna in respect to their translational efficiencies , length and abundance were identified with shorter and abundant mrnas having longer poly(a ) tails . notably , orf length correlated best with ribosome density and mrna abundance with ribosome occupancy . in conclusion , both studies revealed similar principles that may organize translation and therefore , these may be evolutionarily conserved . further studies in other organisms will reveal whether these principles are universally conserved and possibly affected in disease . several studies were aimed at the systematic identification of translationally regulated messages after subjecting cells to stress and other environmental stimuli . low - resolution profile analysis , where the mrna contents of high sucrose gradient fractions ( polysomes ) were compared with fractions from the low sucrose gradient ( the pool of non - translated mrnas ) ( fig . , changes in the levels of total rna were measured to study the relation between transcription / decay and translationally regulated messages . in yeast , global effects on translation were first studied for the rapid transfer of cells from a fermentable to a non - fermentable carbon source mimicking glucose starvation , followed by heat - shock response and rapamycin treatment , amino acid starvation , butanol addition ( an end product of amino acid breakdown ) , and application of hydrogen peroxide to induce oxidative stress . first , it should be noted that these relatively harsh treatments induced global translation inhibition that goes along with a decrease in cell growth . although this global translation inhibition is triggered by similar signaling pathways like phosphorylation of eif2 , the various forms of stress affected quite different sets of mrnas . amino acid and glucose starvation differentially regulated the translation of up to 20% of all mrnas , whereas more mild treatments , such as butanol and peroxides , affected less than 4% of transcripts . treatment of cells with heat / rapamycin or nutrient removal ( amino acid and glucose starvation ) co - activated similar translational and transcriptional programs . here , regulation at the translational level often reflects a magnification of the transcriptional activity an effect that has been termed potentiation . in contrast , the addition of butanol or peroxide provoked no potentiation , but instead changed the abundance and translation rates of different sets of mrnas . this could , at least in part , be explained by the recruitment of stored mrna for translation on demand. nevertheless , in all cases , the specific sets of mrnas that undergo treatment - specific regulation appear to share functional themes that can be attributed to logic response of the cell s altered physiological circumstances . for instance , mrnas coding for proteins related to sugar metabolism and transport , such as hexose transporters , remain associated with polysomes during glucose starvation ; rapamycin treatment , which blocks the target of rapamycin ( tor ) pathway controlling cell growth , led to a decrease of nearly all yeast mrnas coding for cytoplasmic ribosomal proteins , whereas mrnas for proteins acting in the nitrogen discrimination pathway were increased ; amino acid starvation strongly coregulated or potentiated transcripts encoding permeases , proteases and proteins involved in degradation pathways , which may reflect an early amino acid scavenging response to starvation . another interesting aspect of these studies is that the concentration of an applied compound may significantly matter for the outcome . . showed that low concentrations of peroxide ( 0.2 mm h2o2 ) induced the translation of mrnas coding for antioxidants , cellular transporters and proteins involved in diverse intermediary metabolism and may reflect the need for metabolic reconfiguration . a tenfold higher concentration of peroxide ( 2 mm ) resulted in the up - regulation of genes involved in ribosome biogenesis and ribosomal rna processing , possibly reflecting the need to repair factors for efficient protein synthesis . on the other hand , many translationally repressed mrnas showed increased steady - state ( total rna ) levels . again it was postulated that this group of messages may represent an mrna store that could become rapidly activated following relief of the stress condition . mild treatments with pharmacological compounds activate dose - dependent non - linear effects via distinct regulatory programs . if so , this may become of great medical relevance as diverse drugs are known to act differentially depending on their dose . finally , there are recurring and intriguing observations that mrnas coding for cytoplasmic ribosomes generally appear to undergo outstanding and strong coregulation . amino acid and glucose starvation coordinately repress these transcript s abundances and ribosome association very rapidly , whereas the addition of butanol or oxidative stress even lead to the opposite effect translational activation that possibly reflects the requirement of cells to replace ribosomal proteins and rrna that became damaged by free radicals or other toxic products . therefore , besides tight transcriptional control of these messages , they also undergo decent post - transcriptional control at diverse levels and hence , may represent the most tightly controlled genes in eukaryotic cells . first studies to investigate global aspects of translational regulation in mammalian cells focused on ires - dependent translation in poliovirus - infected cells , and the reaction of mitogenically activated fibroblasts , providing early proof - of - principle for the methodology introduced above that involves polysomal fractionation followed by dna microarray analysis of rna contents ( fig . 2a ) . a further landmark study by holland and colleagues analyzed polysomal profiles of murine cell lines after blocking oncogenic ras and akt signaling apparently , these pathways regulate the recruitment of specific mrnas to ribosomes to a far greater extent than de novo synthesis of mrnas by transcription and thus , ras and akt signaling pathways seem to have a more pronounced effect on translational versus transcriptional regulation . the authors postulated that the immediate and direct inductive oncogenic effect of these signaling pathways could be largely achieved through translational activation . the differences seen in rna abundances during chronic signaling alterations may be secondary to translational effects caused by mrnas encoding transcription factors . similar studies on different cancer types may lead to the identification of potential markers and possibly reveal novel drug targets [ 37 , 61 ] . moreover , a recent study identified specific subsets of mrnas regulated by eif4e overexpression , which is known to lead to tumor transformation . the authors postulated that down - regulation of eif4e and its downstream targets may represent a potential therapeutic option for the development of novel anti - cancer drug . as seen for ras / akt activation , it is intriguing that changes at translation can even outperform changes at the steady - state mrna level . this has also been noticed in a study analyzing radiation - induced changes in gene expression of human brain tumor cells or normal astrocytes . ten times more genes ( 15% ) were altered at the level of translation compared to the number of genes regulated at the level of transcription ( 1.5% of 7800 analyzed human genes ) . only a few transcripts were commonly affected at both the transcriptional and translational levels , suggesting that the radiation - induced changes in transcription and translation are not coordinated . those transcripts that were affected at translation fell into functional groups such as cell cycle , dna replication and anti - apoptotic functions . this indicates that dna damage affects post - transcriptional gene regulation of previously synthesized mrnas , possibly enabling cells to repair dna instead of being transcriptionally active . functional relations among messages were also recognized in a recent study performing translational profiling of mouse pancreatic -cells in response to an acute increase in glucose concentration . more than 300 transcripts ( 2% of the analyzed genes ) changed their association with polysomes more than 1.5-fold ; most of them encoding proteins acting in metabolism or transcription . notably , this set of messages is related to the group of genes translationally altered during glucose starvation in the yeast s. cerevisiae . therefore , in mammals and yeast , it appears that mrnas for functionally related messages may be coordinately regulated at the translational level . it is possible that a comparative analysis in different species may allow evolutionarily conserved translational regulatory programs to be deciphered , which are at the moment still rather speculative . whereas concomitant changes in rna abundance and translational rates were rarely detected during radiation response , a recent study identifying mrnas that remain associated with polysomes during hypoxia in transformed prostate cancer cells ( a condition that tumors prevent through the induction of angiogenesis ) found both homodirectionally / potentiated mrnas and distinctively regulated messages . after prolonged exposure of pc-3 cells to low oxygen levels , global translation was reduced by half ; however , 104 mrnas , representing about 0.5% of all analyzed features , became more associated with hypoxic polysomes compared to normoxic ones . among these , 71 mrnas were similarly increased in hypoxic polysomes compared with total rna levels representing homodirectional changes ; 33 mrnas were translationally enriched , some of them potentiated ( 11 of those coding for ribosomal proteins ) . in summary , the common principles of translational regulation that emerge from genome - scale studies in diverse eukaryotes suggest a complex but coordinate system of regulation . it must be triggered by a variety of factors that go well beyond the described pathways that influence global translation . in future , there will certainly be an increasing number of studies to decipher translational regulatory programs in cancer , neurogenesis and development . intriguingly , despite the impact of translational regulation during development , only one recent study systematically investigated translational programs during early embryogenesis in the fruit fly drosophila melanogaster . the mapping of translational programs in diverse species will likely reveal key regulatory networks and how these are affected in disease . steady - state mrna levels are a result of both rna synthesis and degradation that are dynamically controlled and can vary up to 100-fold during the cell cycle or cellular differentiation . in eubacteria like escherichia coli , mrnas are generally degraded by endonucleolytic cleavage , followed by 3-to-5 exonucleolytic rna decay through the so - called rna degradasome consisting of ribonuclease e ( rnasee ) , 3-exoribonuclease polynucleotide phosphorylase ( pnpase ) , rna helicase ( rhlb ) and enolase . in eukaryotes , most cytoplasmic mrna degradation begins with shortening of the poly(a ) tail by deadenylases followed by removal of the 5 cap structure by the decapping enzymes , dcp1 and dcp2 . the decapped intermediates are then degraded either by an exonuclease ( xrn1p ) in the 5 to 3 direction , or by the cytoplasmic exosome in the 3 to 5 direction . in addition , eukaryotes own specialized pathways that target mrnas containing premature termination codons ( nonsense - mediated decay pathway , nmd ) that lack translational termination codons ( non - stop decay pathway , nsd ) or that bear stalled ribosomes ( no - go decay ) . degradation of specific mrnas can also be initiated by endonucleolytic cleavage through sequence - specific endonucleases , or in response to mirnas or sirnas . numerous cis - acting elements located in the 5-utr , the coding sequence ( cds ) or in the 3-utr of mrnas can function as binding sites for rna - binding proteins that regulate decay . for instance , au - rich elements ( ares ) , conserved sequences found in the 3-utr of nearly 5% of all human genes , interact with specific are - binding proteins that stabilize the rna or promote mrna degradation by recruiting the rna decay machinery . global analysis of mrna decay rates following arrest of transcription has been performed in all three kingdoms of life : bacteria [ 6870 ] , archea and eukaryotes including yeast [ 52 , 72 ] , plants , and human cells . in eubacteria and archea , two main characteristics seem to be evolutionarily conserved : adjusted decay rates for functionally related groups of messages , and the inverse correlation between the half - lives and the relative abundances of transcripts . as seen in the archaebacterium sulfolobus , transcripts encoding proteins involved in growth - related processes , such as transcription , trna synthesis , translation and energy production , generally decay rapidly ( t1/24 min ) , whereas those encoding products necessary for maintaining cellular homeostasis are relatively stable ( t1/2>9 min ) . short half - lives of highly abundant mrnas imply high - turnover rates and thus , enable cells to rapidly reprogram gene expression upon changes in environmental conditions [ 68 , 71 ] . interestingly , the half - life and abundance of distinct classes of transcripts appear to depend on particular rna degradosome components . this finding suggests the existence of structural features or biochemical factors that distinguish different classes of mrna targeted for degradation . this may also apply to specific growth phases , as seen in streptococcus where certain mrnas become sensitive to stationary - phase - induced pnpase . evidence for the existence of coordinated rna decay regulons in eukaryotes was obtained from global investigation of mrna decay profiles in yeast and human cells . here , transcription was shut - off using cells that bear a temperature - sensitive allele of rna polymerase ii or through chemical inactivation , and the decay of thousands of genes was monitored with dna microarrays over a time course [ 52 , 72 , 74 ] . strikingly , mrna half - lives among components of macromolecular complexes in yeast were significantly correlated . for instance , the transcripts for the four histone mrnas were among the least stable with closely matched , rapid decay rates ( t1/2=72 min ) ; the 131 mrnas coding for ribosomal proteins had average decay rates ( t1/2=226 min ) , and the four components of the trehalose phosphate synthetase complex were amongst the longest lived messages ( t1/2=10515 min ) . the examination of decay rates in human cells revealed similar mrna - turnover patterns among orthologous genes , indicating the presence of evolutionary conserved programs of rna stability control . transcripts encoding metabolic proteins have a tendency for longer half - lives , whereas transcripts encoding transcription factors or ribosome biogenesis factors are relatively short lived [ 52 , 72 ] . interestingly , it appears to be a universal feature that average transcript half - lives are roughly proportional to the length of the cell cycle : cell - cycle lengths of 20 , 90 , and 600 min correspond to median mrna half - lives of 5 , 21 and 600 min for e. coli , s. cerevisiae and human cells , respectively . dna microarrays have also been applied to investigate specialized decay pathways , such as nmd and nuclear exosome - mediated decay . mutants for nmd factors upf1 , nmd2 and upf3 alter the mrna levels of an overlapping set of 600 messages ( 10% of the transcriptome ) in yeast [ 77 , 78 ] . however , mrna levels in nmd strains may also be the result of indirect effects because transcription factors are also targeted through nmd and therefore , guan et al . dissected direct from indirect targets of nmd by profiling global rna decay rates in nmd strains . about half ( 300 transcripts ) are likely to be direct nmd targets decayed through 5 to 3 degradation by xrn1p . nmd - sensitive transcripts tend to be both non - abundant and short - lived , with one third of them coding for proteins that are connected to two central themes : first , replication and maintenance of telomeres , chromatin - mediated silencing and post - replication events related to the transmission of chromosomes during the cell division cycle ; and , second , synthesis and breakdown of plasma membrane components , including transport of macromolecules and nutrients , and cell wall proteins . several genes , located downstream of independently transcribed snorna genes , were overexpressed in exosome mutants . such read - through transcripts into downstream orfs are normally rapidly degraded by the exosome and , hence , could explain their enrichment in exosome mutants . global mrna turnover in mutant cells was monitored through gene expression analysis expecting adverse effects on subsets of messages . examined the effects of deletions of genes encoding deadenylase components ccr4p and pan2p and putative rna - binding proteins pub1p and puf4p after inhibition of transcription by chemicals and/or heat stress . this examination showed that ccr4p , the major yeast mrna deadenylase , contributes to the degradation of transcripts encoding both ribosomal proteins / rrna synthesis and ribosome assembly factors largely mediating the transcriptional response to heat stress . pan2p and puf4p also participate in degradation of these mrnas , while pub1p preferentially stabilized transcripts encoding ribosomal proteins . a second study focused on pub1p , a yeast rna - binding protein thought to destabilize mrnas through binding to au - rich sequences in 3-utrs . global decay profiles in pub1 mutants revealed a significant destabilization of proteins involved in ribosomal biogenesis and cellular metabolism , whereas genes involved in transporter activity demonstrated association with the protein , but displayed no measurable changes in transcript stability . therefore , in this case , the direct targets only partially related to the functional outcome under specific physiological conditions . this could be mediated through additional rna protein interactions forming a network through combinatorial binding . finally , foat et al . combined a computational and experimental approach to identify transcripts that are destabilized under specific environmental conditions ( sugar sources ) by yeast mrna stability regulators . for puf3p , which was known to primarily associate with mrnas coding for mitochondrial proteins , they computationally inferred and experimentally verified target destabilization in the presence of glucose , as some of these mrnas were up - regulated in puf3 mutants grown in a non - repressing carbon source , but down - regulated in a repressing carbon source . mammalian cells have evolved a variety of specific mrna decay programs that play important roles in medically relevant processes such as inflammation , hypoxia and cancer pathogenesis . for example , the expression of diverse cytokines is differentially regulated after t cell activation , and glucocorticoids inhibit inflammation through destabilization of proinflammatory transcripts like cyclooxygenase-2 . for instance , in resting t lymphocytes , the majority of transcripts are stable with half - lives of more than 6 h , but a small proportion ( 3% ) of expressed transcripts exhibits rapid decay with half - lives of less than 45 min . these short - lived transcripts encode a variety of regulatory proteins such as cell surface receptors , transcription factors and regulators of cell growth and apoptosis . focused on the massive degradation of transcripts occurring during meiotic arrest at the germinal - vesicle ( gv ) stage , and found that degradation is apparently not promiscuous but preferentially affects specific groups of messages . in particular , transcripts involved in processes associated with meiotic arrest at the gv stage and the progression of oocyte maturation , such oxidative phosphorylation , energy production , and protein synthesis , were rapidly degraded , whereas those encoding participants in signaling pathways maintaining the oocyte in the mii - arrested state were among the most stable . in conclusion , these studies exemplify that stimulus - dependent transcript destabilization is an important mechanisms for controlling gene expression in a coordinated manner . the presence of these motifs in mrnas often correlates with shifts in the distribution of decay rates ; however , their sole presence can not reliably predict turnover behavior . are - binding proteins may therefore differentially determine the fate of mrna depending on the cellular and environmental context . tristetraprolin ( ttp ) , a well - known are - binding protein , has several characterized physiological target mrnas including tumor necrosis factor ( tnf)- , granulocyte - macrophage colony - stimulating factor , and interleukin-2. micro - array analysis of rna obtained from wild - type and ttp - deficient fibroblast cell lines identified 250 transcripts with altered decay rates , some of them containing conserved ttp binding sites . the rna - binding protein t - cell intracellular antigen 1 ( tia-1 ) functions as a post - transcriptional regulator of gene expression and aggregates to form stress granules following cellular damage . tia-1 regulates mrnas for proteins involved in inflammatory responses such as tnf- and cyclooxygenase 2 . immunoprecipitation ( ip ) of tia-1-rna complexes , followed by microarray - based identification and computational analysis of bound transcripts revealed at least 300 potential targets , many of them bearing an u - rich motif . in conclusion , global analysis of mrna turnover underlines the importance of rna decay in the control of mrna levels and strongly suggests the presence of specific rna turnover programs . mrna decay certainly involves combinatorial interactions of rbp enabling stimulus - dependent decay programs through the integration of diverse signals . besides temporal control , rna decay may also occur spatially restricted , as seen with drosophila ire1 , a protein activated during the unfolded protein response in the endoplasmic reticulum directing the decay of specific subset of mrnas , many of which encode plasma - membrane proteins . moreover , still rather unexplored is the role of p - bodies and stress granules as storage place for untranslated mrna and site for mrna degradation at least the recent observation that are containing mrnas are localized to specific cytoplasmic granular structures containing exosome subunits that are distinct from p - bodies or stress granules , support the idea of specialized structures for storage or degradation of distinct groups of mrnas . putative rna - binding proteins comprise 3 11% of the proteomes in bacteria , archea and eukaryotes . the large number of rbps in all kingdoms of life may merely reflect the ancient origin of rna regulation , which is possibly the most evolutionary conserved part of cell physiology . rbps often contain distinct rna - binding domains that specifically interact with sequences or structural elements in the rna . approximately one hundred protein domains associated with rna metabolism have been described to date , half of them believed to have originated at early stages in evolution , whereas others , such as the rna recognition motif ( rrm ) , are exclusively present in eukaryotes and therefore may have been acquired later in evolution . a successful approach to globally identify the in vivo rna targets of rbps involves immunoprecipitation or affinity purification of epitope - tagged proteins followed by the analysis of associated rnas with dna microarrays or by sequencing ( fig . although low - density arrays were used to identify the bound mrnas , each rbp was associated with a distinct subset of the mrnas present in total cell lysate . moreover these results led to the proposal that groups of mrnas encoding functionally related proteins are organized as so - called post - transcriptional operons . in analogy to prokaryotic operons , this model predicts that specific rbps may coordinate groups of mrnas coding for functionally related proteins in eukaryotes . cis - acting elements in the mrna may provide the means to mimic the coordinated regulatory advantages of clustering genes into polycistronic operons [ 16 , 92 ] . a prime example for the coordination of functional related transcripts by specific rbps is represented by the pumilio - fem-3 binding ( puf ) proteins [ 80 , 93 ] . puf proteins comprise a conserved family of structurally related rbps that negatively regulate gene expression of specific mrnas . applying dna microarrays to identify their rna targets revealed that each of the five yeast puf proteins associated with distinct groups of 40 to 220 different mrnas with striking common themes in the functions and subcellular localization of the proteins they encode : puf3p binds nearly exclusively to cytoplasmic mrnas that encode mitochondrial proteins ; puf1p and puf2p interact preferentially with mrnas encoding membrane - associated proteins ; puf4p preferentially binds mrnas encoding nucleolar ribosomal rna - processing factors ; and puf5p is associated with mrnas encoding chromatin modifiers and components of the spindle pole body . the results were further corroborated by the identification of distinct sequence motifs in the 3-untranslated regions of the mrnas bound by puf3 , puf4 , and puf5 proteins . a physiological relation between puf3p and its mrna targets has also been observed as suggested from its association with mrna - encoding mitochondrial proteins , puf3 mutant cells showed a slow - growth phenotype on non - fermentable carbon sources indicative of a functional connection to mitochondrial physiology . genome - wide identification of rnas associated with the orthologous puf protein from drosophila melanogaster , called pumilio , revealed distinct clusters of mrnas in embryos and in ovaries of adult flies . subgroups of these pum - associated mrnas had commonalities , such as function in the anterior - posterior patterning system , and the subunits of the vacuolar h - atpase . moreover , a characteristic sequence motif was present in 3-utrs of pumilio - bound mrnas resembling the one previously identified for the yeast puf3 protein . . hence , the data obtained from the yeast and drosophila studies provided an additional source for considering their evolution . for instance , conservation of amino acid residues in the rna - binding domain ( the pum - homology domain ) between homologous puf proteins correlated with identified core motifs in 3-utr of mrna targets . however , the proteins encoded by the mrna targets appeared not to be particularly conserved . this discordance suggested that acquisition or loss of rbp binding motifs in utrs of genes may provide a surprisingly fluid evolutionary mechanism to modify post - transcriptional regulatory connections . ribonomic studies have now been conducted for more than 30 specific rbps ( table 1 ) . each of the analyzed rbps has a unique rna binding spectrum comprised of 201000 distinct transcripts that often share functionally related themes . occasionally , sequence or structural elements could be identified among mrna targets using bioinformatics tools , and novel physiological consequences were discovered ( e.g. , ) . the ribonomics approach has recently been implemented on the argonaute ( ago ) protein family to discover novel mrnas that potentially undergo mirna dependent regulation [ 96 , 97 ] . although the number of detectable ago - associated mrnas was low ( 90 messages ) compared to the thousands of genes expected to undergo mirna dependent regulation , the comparison of ago - associated mrnas in wild - type and mirna mutants may provide a tool to decipher mirna - specific targets . besides specific rbps general rna - binding proteins for the identification of messages expressed in particular tissues or cell - types . affinity - tagged poly(a ) binding protein ( pabp ) was expressed with tissue - specific promoters to identify muscle- or ciliated sensory neuron - specific transcripts in the worm caenorhabditis elegans [ 98 , 99 ] , and mrnas in photoreceptor cells of flies . the method was also used to measure gene expression of endothelial cells that were co - cultured with breast tumor cells . a similar approach with tagged ribosomal proteins may become another tool to determine gene expression in specific cells [ 102 , 103 ] . table 1global identification of rna targets for specific rna - binding proteins ( rbps).organismrbpprocesstargetsfunctional relation among proteins encoded by targetsrna motifreferenceyeastmex67rna export1142cell wall components , translation factors , membrane proteinsno(saccharomyces cerevisiae)yra1rna export1002cell cycle - regulated , cell wall , carbohydrate metabolismnoshe2 , she3 , myo4rna localization22cell cycle , membraneorf/3-utr[33 , 34]scp160translational regulation?>50membrane - associated factors?nolhp1rna biogenesis1000noncoding rna , ribosomal proteins and biogenesis , unfolded protein responsenopuf1mrna decay / translation40membrane - associated , plasma membranenopuf2mrna decay / translation146membrane - associated , plasma membranenopuf3mrna decay / translation220mitochondrion ( ribosome)3-utrpuf4mrna decay / translation205nucleolar factors ( rrna/ trna processing)3-utrpuf5mrna decay / translation224nuclear factors ( chromatin modifiers , spindle - pole body)3-utrpub1mrna decay384ribosome biogenesis , transporter3-utrcth2mrna decayiron metabolism3-utrnpl3mrna exportribosomal subunits3-utrnab2mrna exporttranscription3-utrnab4/hrp1mrna export , polyadenylationmetabolism ( amino acid , alcohol , ergosterol ) , energy pathways3-utrmammalselav/ humrna stability / translation60cell cycle regulators , transcription factors3-utr[119 global identification of rna targets for specific rna - binding proteins ( rbps ) . the application of genomic tools to study post - transcriptional gene regulation suggests additional levels of coordination and regulation that are beyond the traditional view of equally treated cellular mrnas that are similar processed , exported , and eventually translated in the cytoplasm [ 1416 ] . the decay , localization and translation of mrna seem to undergo coordinate control by regulatory programs , which may be embedded in a multifaceted post - transcriptional regulatory system . the properties of this system are controlled by rna - binding proteins or non - coding rnas ( e.g. , micrornas ) that coordinate functionally related sets of mrnas through binding to sequence elements in the rna . considering the hundreds of rbps encoded in eukaryotic genomes , post - transcriptional control may be comparable in its richness and complexity to transcriptional regulatory systems . this provides a means to link rna regulation to other cellular regulons such as signal transduction pathways allowing rapid and efficient reprogramming of gene expression in response to changing physiological conditions . further analysis of rbps and their target rnas may finally lead to a map of the proposed post - transcriptional regulatory system . however , besides the architecture , it will also be important to study the plasticity and dynamics of this regulation by measuring how it reacts in response to environmental or developmental changes , and how it is perturbed in certain diseases [ 35 , 105 ] . finally , a major challenge will be to connect the different levels of gene expression systems though large - scale data integration .

abstract.post-transcriptional regulation of gene expression plays important roles in diverse cellular processes such as development , metabolism and cancer progression . whereas many classical studies explored the mechanistics and physiological impact on specific mrna substrates , the recent development of genome - wide analysis tools enables the study of post - transcriptional gene regulation on a global scale . importantly , these studies revealed distinct programs of rna regulation , suggesting a complex and versatile post - transcriptional regulatory network . this network is controlled by specific rna - binding proteins and/or non - coding rnas , which bind to specific sequence or structural elements in the rnas and thereby regulate subsets of mrnas that partly encode functionally related proteins . it will be a future challenge to link the spectra of targets for rna - binding proteins to post - transcriptional regulatory programs and to reveal its physiological implications .

Gene expression goes global RNA localization Regulation of translation Regulation of mRNA decay Identification of specific RNA-protein interactions Final conclusions

fetus in fetu ( fif ) was first described by meckel in the early 19th century , and it was defined as a mass containing a vertebral axis often associated with other organs or limbs around this central axis in 19351 ) . since then , this disease entity has been rarely reported . with advance in prenatal diagnosis techniques , more than half of the cases have been detected prenatally . in this report fif differentiating a fif from other cause of meconium peritonitis is discussed with review of literature . a 31-year - old primi pregnant woman with minimal prenatal care and no history of fertility medications or in vitro fertilization came to our institution at 33 weeks ' gestation . obstetric sonography at 26 weeks ' gestation revealed a single fetus of appropriate size for gestational age , but bowel wall edema and small bowel obstruction were suspected . sonography at 29 weeks ' gestation showed a large amount of amniotic fluid and the aforementioned findings were not changed . sonography at 33 weeks ' gestation which was performed at our institution showed that a markedly dilated bowel and the bowel obstruction were still suspicious . the amount of amniotic fluid was increased , and a 6.86.4 cm pseudocyst and a 4.393.22 cm calcified heteroechgenic mass were found ( fig . our clinical diagnosis was a giant cystic type of meconium obstruction associated with peritonitis induced by perforation and atresia of the small bowel . the weekly ultrasonographic follow - ups showed no significant interval changes . at 38-weeks ' gestation , a female newborn weighing 4,120 g was delivered by an elective cesarean section , with apgar scores of 2 , 4 and 9 at 1 , 5 and 10 minutes . the baby had a grossly distended abdomen and did not present any evidence of dysmorphic features . the patient had respiratory distress after birth which was probably induced by elevated abdominal pressure due to the abdominal mass and ascites and necessitated assisted ventilation . laboratory tests showed no abnormalities except for a slightly decreased albumin level of 3.1 g / dl and an alpha - fetoprotein level of 5,845 ng / ml . abdominal radiographs showed a large abdominal mass containing multiple calcifications in the lower abdomen ( fig . abdominal ultrasonography showed a huge solitary and cystic mass which filled most of the abdomen . abdominal computed tomography ( ct ) showed a well - demarcated intraabdominal mass measuring 15.610.2 cm , with a heterogeneous enhancing solid portion , fatty component and a cystic portion containing multiple calcification or ossification lesions . a teratoma arising from both ovaries was the most likely diagnosis , and she underwent an elective laparotomy at 5 days of age . during surgery , we observed a small amount of ascites with a mass attached to the colon and mesocolon which was thought to be a splenic flexure ( fig . 3 ) . the mass did not have a cystic sac and had a buttock - like lesion with skin and hair follicles , fatty tissue , a finger and a coccyx . a tubular structure was also identified along the mesenteric border of the sigmoid colon , which was suspected of an intestinal duplication cyst . the mass measuring 1595 cm had a smooth surface partially covered with skin or thin membrane and 2 finger - like lesions ( fig . 4 ) . on section , most of the mass consisted of yellowish fat tissue , and the middle portion of the mass had a tubular structure which looked like an intestine . microscopic examination showed a well developed gastrointestinal tract , liver , pancreas and finger as well as 3 germinative layers , but the vertebral axis was not identified . meckel first coined the term " fetus in fetu " in the late 18th century to describe an encapsulated fetoid tumor within a fetus . after then , willis1 ) stated in 1935 that the presence of an axial skeleton distinguishes between fif and a teratoma , which remains a clinical definition . gonzalez - crussi4 ) defined fif in a narrower sense as " highly organotypic development and presence of a vertebral axis with arrangement of tissue around this axis " . thirty - one cases of fif were reported before 1900 , and thereafter only 11 cases were reported between 1900 and 19563 ) . its incidence is very low and is estimated to be 1 per 500,000 birth2 ) . the incidence of fif has increased and the incidence seems to be higher than in previous reports . with advances in prenatal diagnosis techniques , more than half of the cases have been detected prenatally . our case was also detected prenatally , but it was misdiagnosed as cystic meconium peritonitis . meconium peritonitis represents aseptic peritonitis caused by the spreading of meconium into the fetal peritoneal cavity . cyst occurs when the site of perforation is not sealed and a thick - wall cyst is formed within the intestinal loops . the cystic type of meconium peritonitis is thought to be a life - threatening condition . therefore , rapid deterioration of fetal status can be possible in this type . in this regard meconium pseudocyst must be antenatally differentiated from other intra - abdominal cystic images such as urinary bladder distention , ovarian cyst , intestinal duplication , hematoma , teratoma and fetal infection5 ) . fif can be presented prenatally as an abdominal cystic mass with diffuse calcification or ossification by ultrasonography . ct or mri has sometimes been used as a confirmatory diagnostic tool to differentiate between these diseases . however , if the vertebral axis - like structure is seen within a mass on prenatal imaging , it is also helpful in differential diagnosis . it is still controversial whether the presence of the vertebral axis should be included in the diagnostic criteria for fif . some previously reported cases without the vertebral axis were diagnosed as fif as in our case . it is thought to occur at the very early stage of embryo development before the ventral fusion of the lateral body walls . the spectrum is diverse from conjoined symmetric twins to a form of organized teratoma , but fif is thought to be a different category from teratoma based on its organo - level development , rarity of malignant potential and the possession of the same karyotype with the host . chromosome analysis was performed on 29 cases , which showed the same chromosomes as the host 's . miura et al.6 ) reported that in 2 cases undergoing dna methylation assay , 46.7% and 66.7% of clones from the mass had an unmethylated paternal allele . they suggested that 2 isolated blastocysts originated from one zygote , and one of the two was implanted into the other blastocyst during the process of methylation . in this regard , presence of vertebral axis to diagnosis of fif may not be a prerequisite factor . pathological confirmation is essential for a final diagnosis , and genetic testing can provide unambiguous evidence for a fetus in fetu . several cases have been reported in older children with a delay in diagnosis and 1 case in a 39-year - old man , was and they showed no malignant potential7 ) . the prognosis of intracranial fif is not good . only 1 case survived , and 2 cases were stillborn , 2 cases were terminated fatally due to intracranial hypertension , and 2 cases were terminated with their parents order . hopkins et al.8 ) reported a retroperitoneal fif presenting as a right abdominal mass which proved to be a teratoma with malignant components requiring chemotherapy8 ) . there are 2 other cases with local recurrence as a teratoma without malignant potential in the literature ; they were located in the retropenitoneum and recurred at 1 and 2 years of age , respectively9 , 10 ) . for this reason , it is necessary to regularly follow up patients with fif for the surveillance of recurrence . we report a case of fif which was misdiagnosed as cystic meconium peritonitis prenatally . abdominal cystic mass should be differentiated from various conditions . although fif is considered as a rare disease , it has been increasingly reported in the literature . thus , fif should also be included in the differential diagnosis of cystic masses in fetus .

fetus - in - fetu ( fif ) is a rare congenital condition in which a fetiform mass is detected in the host abdomen and also in other sites such as the intracranium , thorax , head , and neck . this condition has been rarely reported in the literature . herein , we report the case of a fetus presenting with abdominal cystic mass and ascites and prenatally diagnosed as meconium pseudocyst . explorative laparotomy revealed an irregular fetiform mass in the retroperitoneum within a fluid - filled cyst . the mass contained intestinal tract , liver , pancreas , and finger . fetal abdominal cystic mass has been identified in a broad spectrum of diseases . however , as in our case , fif is often overlooked during differential diagnosis . fif should also be differentiated from other conditions associated with fetal abdominal masses .

Introduction Case report Discussion Conclusion

during october 1 , 2010july 31 , 2011 , the centers for disease control and prevention ( cdc ; atlanta , georgia , usa ) asked all state public health laboratories to submit pandemic ( h1n1 ) 2009 virus positive respiratory specimens and virus isolates for antiviral susceptibility testing . laboratories were asked to provide the first 5 specimens of any type / subtype collected during each 2-week period for virus isolation . comprehensive antiviral testing , including neuraminidase inhibition ( ni ) assay , was performed on all isolates , and sequencing was performed on all isolates with elevated 50% inhibitory concentration values . cdc also requested that laboratories provide 5 additional specimens every 2 weeks for pyrosequencing to identify the h275y substitution in the neuraminidase , a change associated with oseltamivir resistance ( 3 ) . in addition to ( or instead of ) participating in the national surveillance , state laboratories in california , maine , maryland , minnesota , new york , texas , and washington performed pyrosequencing on state surveillance specimens to detect the h275y substitution . we included those state - specific data in the national surveillance data for this report . state health departments used a standard case form to collect demographic and clinical information for patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infection and their ill close contacts . oseltamivir resistance was determined by use of an ni assay or pyrosequencing for the h275y substitution . for ni testing on isolates , we used the na - fluor kit ( applied biosystems , foster city , ca , usa ) as described ( 4 ) . we performed pyrosequencing , as described ( 5 ) , on all oseltamivir - resistant pandemic ( h1n1 ) 2009 isolates identified by ni assay to confirm the presence of the h275y substitution . we performed pyrosequencing for h275y , without the ni assay , to screen pandemic ( h1n1 ) 2009 clinical specimens ( 5 ) . for the national surveillance , ni testing was performed at cdc and pyrosequencing was performed at cdc and at state laboratories in wisconsin , new york , and california . state laboratories followed pyrosequencing protocols provided by cdc ; when possible , cdc confirmed results for resistant viruses by use of pyrosequencing and ni assay . most oseltamivir - resistant viruses in this report were included in the weekly fluview report prepared by cdc ( 6 ) . we tested a total of 3,652 pandemic ( h1n1 ) 2009 virus isolates and specimens from every state and the district of columbia ; 35 ( 1.0% ) isolates / specimens from a total of 18 states were oseltamivir - resistant ( figure ) . overall , 8 ( 1.3% ) of 609 isolates tested by ni assay and 27 ( 1.0% ) of 3,043 specimens tested by pyrosequencing were resistant to oseltamivir . the state - specific prevalence of oseltamivir - resistant pandemic ( h1n1 ) 2009 viruses varied ; however , the number of viruses and specimens tested also varied markedly between states , and several states submitted only a few specimens . forty - four states submitted > 20 specimens for antiviral resistance surveillance . the prevalence of oseltamivir resistance among these specimens ranged from 0% to 5.6% . none of the 609 pandemic ( h1n1 ) 2009 isolates tested by ni assay were resistant to zanamivir . the ranges of 50% inhibitory concentration values for oseltamivir - resistant and -susceptible isolates were 166.17230.37 nmol / l and 0.100.80 geographic distribution of oseltamivir - resistant pandemic ( h1n1 ) 2009 viruses in the united states , october 1 , 2010july 31 , 2011 . numerators are number of oseltamivir - resistant viruses identified by state public health laboratories ; denominators are number of pandemic ( h1n1 ) 2009positive specimens submitted by each state for susceptibility testing . the median age of the 35 patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infections was 33 years . of 34 patients with available information , 26% reported receiving oseltamivir before providing a specimen for antiviral susceptibility testing ( table 1 ) . among 33 patients with a completed case form , 67% had at least 1 preexisting chronic medical condition , 24% had an immunocompromising medical condition , 42% required hospitalization , and 9% died . most patients with oseltamivir - resistant virus infection for whom housing information was available lived in a single - family household . two siblings from 1 household had oseltamivir - resistant virus infection ; neither child had received oseltamivir . * the median age of patients was 33 y ( range 1 mo78 y ) . nine patients began oseltamivir treatment prior to specimen collection ; none received oseltamivir chemoprophylaxis . includes hiv / aids , malignancy , autoimmune disorder , solid organ transplant , stem cell transplant , and history of taking immunosuppressive therapy in the past year . includes morbid obesity , obstructive sleep apnea , chronic liver disease , and neurologic or developmental disorders . all oseltamivir - resistant pandemic ( h1n1 ) 2009 viruses were identified from specimens collected during december 2010april 2011 ; the prevalence of resistance did not change significantly over time ( test for trend , p = 0.18 ) ( table 2 ) . in addition , the proportion of patients with oseltamivir - resistant virus infections who did not have exposure to oseltamivir before specimen collection did not change significantly over time ( test for trend , p = 0.48 ) ; however , the number of specimens tested each month was small . the number of oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infected patients was small during the 200910 ( april 2009september 2010 ) and 201011 influenza seasons . however , the prevalence of oseltamivir - resistant virus infected patients was slightly higher during 201011 compared with 200910 ( 35/3,652 [ 1.0% ] vs. 37/6,740 [ 0.5% ] , respectively , p = 0.02 by test ) ( 2 ) . also , during 201011 , compared with 200910 , more patients with oseltamivir - resistant virus infection had no history of oseltamivir exposure before specimen collection ( 25/34 [ 73.5% ] vs. 4/35 [ 11.4% ] , respectively ; p<0.0001 by test ) . during the 201011 us influenza season , the prevalence of oseltamivir - resistant pandemic ( h1n1 ) 2009 viruses remained low , and most persons with oseltamivir - resistant virus infection had no prior oseltamivir exposure . this is a notable difference from surveillance findings both globally and in the united states during the 200910 season , when most patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infection had a history of oseltamivir exposure , and many were severely immunocompromised , a condition that may increase the risk for resistance developing during oseltamivir therapy ( 2,7 ) . these data suggest a low level of community transmission of oseltamivir - resistant pandemic ( h1n1 ) 2009 virus in the united states during the 201011 influenza season . the united kingdom also reported that the proportion of oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infected patients without prior oseltamivir exposure was higher during 201011 than 200910 ( 8) . the increase during the 2010 - 11 influenza season in the proportion of patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infections without prior oseltamivir exposure causes concern in light of the recent history of oseltamivir resistance among seasonal influenza a ( h1n1 ) viruses that circulated before pandemic ( h1n1 ) 2009 virus emerged . in the united states before the 200708 influenza season , the prevalence of oseltamivir resistance among seasonal influenza a ( h1n1 ) viruses was < 1% ( 9,10 ) . however , during the 200708 season , the prevalence of oseltamivir resistance among seasonal influenza a ( h1n1 ) viruses increased to 12% , and by the 200809 season , resistance dramatically increased to > 99% ( 9,11,12 ) . no association was found between this increase in oseltamivir resistance and prior oseltamivir use ( 11,13 ) . oseltamivir resistance in pandemic ( h1n1 ) 2009 and seasonal influenza a ( h1n1 ) viruses was conferred by the h275y substitution in the neuraminidase . however , unlike seasonal influenza a ( h1n1 ) viruses , which retained susceptibility to the m2-blocking adamantanes ( amantadine and rimantadine ) , > 99% of circulating pandemic ( h1n1 ) 2009 viruses are inherently resistant to adamantanes ( 14 ) . thus , inhaled zanamivir or investigational drugs , such as intravenous zanamivir , are the only treatment options for patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infection . our conclusions are limited by the small number of patients with oseltamivir - resistant pandemic ( h1n1 ) 2009 virus infection . variability in state surveillance and the number of specimens tested from each state may also have limited the representativeness of our data . despite these shortcomings , our findings emphasize the importance of ongoing surveillance for oseltamivir - resistant pandemic ( h1n1 ) 2009 viruses in the united states and globally and of close monitoring for changes in the epidemiology of oseltamivir resistance among pandemic ( h1n1 ) 2009 viruses . updated information about antiviral resistance in influenza viruses in the united states is available at www.cdc.gov / flu / professionals/.

during october 2010july 2011 , 1.0% of pandemic ( h1n1 ) 2009 viruses in the united states were oseltamivir resistant , compared with 0.5% during the 200910 influenza season . of resistant viruses from 201011 and 200910 , 26% and 89% , respectively , were from persons exposed to oseltamivir before specimen collection . findings suggest limited community transmission of oseltamivir - resistant virus .

The Study Conclusions

the incidence of cutaneous melanoma ( cm ) is rapidly increasing in europe , especially in the caucasian population . incidences are known to vary amongst white populations , reaching 15 cases per 100,000 inhabitants per year in scandinavia and 57 cases per 100,000 inhabitants per year in mediterranean countries [ 24 ] . fortunately , these data are matched by active research directed toward a greater identification of risk factors linked with the onset of melanoma . in this regard , the presence of naevi assumes particular importance as an independent and very high risk factor for the development of melanoma . clinically dysplastic naevi and an excess number of melanocytic naevi are among the most serious known risk factors for cutaneous melanoma . in the last decade , a plethora of investigations aimed at identifying risk factors for the development of melanoma have been conducted . more recently , working on 200 patients affected by melanoma and 200 healthy control patients , nikolaou et al . confirmed that the presence of atypical naevi is an important risk factor for the development of cm , tripling the odds ratio ( or ) . according to carli et al . , the greatest difference between subjects with or without atypical naevi is related to their number of common naevi : the authors demonstrated that more than 30 naevi are encountered in 41.5% of melanoma cases , but in only 9% of healthy control subjects ( or 8.0 ; confidence interval ( ci ) 6.310.3 ) . even if atypical clinical features of naevi constitute a very high risk factor for cm , their partial correspondence with histologic dysplasia indicates that the total number of naevi remains the most important factor in the development of cm . these data confirm the major risk of dysplasia or the development of cm when the total number of naevi exceeds 100 , and the presence of an elevated number of naevi needs to be carefully evaluated in the panorama of risk factors for the development of melanoma [ 13 , 14 ] . as a result , numerous studies have been undertaken in order to establish a classification of naevi and to define their physiological and pathological evolution , the majority of which have aimed to correlate the macroscopic appearance of these structures with their histopathological characteristics [ 15 , 16 ] , dividing them into dermal , composed , and junctional . kincannon and boutzale further divided acquired naevi into five categories according to their rough macroscopic appearance and their relationship to the skin surface , noticing that the papillomatous variant is most commonly associated with such phenotypes as blue or green eye colour and fair , light brown , or red hair . these authors underlined the importance of any possible correlations between naevi and phenotype characters and also drew up a more accurate and detailed classification of naevi , even though it was restricted almost exclusively to dermal naevi . gallagher and kwan showed that naevi have a preferred body distribution in the two genders which is already evident in the pediatric age : in males naevi are more numerous on the head , neck , and trunk , whereas females show a greater distribution on their limbs . naevi are much more numerous in children intermittently exposed to the sun , highlighting the importance of sun exposure during childhood in the genesis of benign acquired naevi . however , the same distribution pattern in photoprotected locations raises the possibility that hormonal differences play a consistent role in the development of melanocytic naevi [ 19 , 20 ] . the most famous and widely accepted classification of acquired melanocytic naevi was published by ackermann and magana - garcia who classify naevi into four types , of which clark naevi constitute the predominant type among commonly acquired melanocytic naevi . when their diameter exceeds 5 mm and at least two other signs of clinical activity are present , such as irregular or poorly defined edges , uneven colouring , or erythematous patch variations in skin pattern , they are defined as atypical , whereas when histology shows the presence of specific architectural features they are diagnosed as dysplastic naevi . however , although ackerman 's classification continues to be a reference , all pigmented melanocytic naevi are grouped under the single denomination of clark naevi which does not enable the analytical investigation of naevi in the field of melanoma prevention : further steps in this direction have only led to the conviction that the presence of a small number of clark naevi has weak meaning in young patients with no melanoma familiarity . on the other hand , when clark naevi arise in older subjects , between the ages of 40 and 50 with no familiarity , their meaning is less clear but it is considered as an anomaly of the normal formation and growth process of melanocytes . several variants , whose denominations can be found in the literature , are mentioned and defined by means of clinical criteria in saurat 's book . this publication includes the most common naevi present in the population ; sutton or halo naevus is also mentioned and congenital pigmented naevi are divided into small ( < 1.5 cm ) , medium ( 1.520 cm ) , and large ( > 20 cm ) . further progress in this direction can be achieved by making a precise systematic table of the various subspecies of naevus , free of any excess or overlapping . we have conducted this case - control study with the aim of observing different numbers of moles and different mole typology associations between patients affected by melanoma and control volunteers . the analysis of naevus variants is not only of commercial value but can be of considerable practical value in the self - analysis of naevi , which is of great importance in the prevention of cm . this analysis makes it easier for patient and physician to know the number and distribution of the naevi , thus enabling the timely observation of any anomalous cellular activity in progress , of any lesions at risk or of a still undetected early clinical melanoma . in addition , this study may provide a further contribution to the determination of a naevic map in the patient undergoing a routine dermatological checkup without suspect lesions , evaluating the possibility of identifying one or more categories of naevus variants for every individual in order to identify further guide lines for the study of melanoma risk factors . naevus variants can improve the interaction between doctors and their patients , who will be able to furnish more accurate information on the naevi and their evolution , thus providing doctors with better guidelines for diagnosis and therapy . in this way , they will be able to better orient themselves in the identification of risk naevus / naevi , examining mole variant associations and their numerosity , according to the total number of naevi and the phenotypic features of the people concerned . one of the aims our study is to try to identify the phenotypic features of individual naevus variants with a view to establishing different risk patterns for mc , which may in turn suggest different follow - up procedures . 64 cases and 183 controls were selected amongst patients at the dermatology department of federico ii university , naples between october 2009 and february 2011 . the cases and the controls ( 102 males and 145 females ) had an average age of 34.8 years ( minimum 2 and maximum 82 ) . the 64 cases were equally distributed between the two sexes ; of the 183 controls 70 were males and 113 females . the cases enrolled were patients affected with nodular or superficial melanoma , the thickness of the lesion had been determined in each case ( staging model ajcc 1988 ) , and the time elapsed from the excision was calculated as between 0 and 10 years . patients with melanoma that had developed on a malignant freckle were excluded , as these melanomas rarely break out in association with a preexisting naevus . the controls were first - degree relatives of cases living in the same household for the same period . all patients were caucasian and homogeneous in respect of socioeconomic indicators and occupation ( table 2 ) . before the naevus count , a trained interviewer compiled a form for each case and control . the interview lasted about 15 minutes and included the following data : residence , phenotype characteristics such as eye colour ( brown , hazel , green , and blue ) , hair colour ( black , brown , fair , and red ) ; phototypes for groups and subgroups from i to iv , ( since v and vi are practically absent in our area for ethnic reasons ) , melanoma familiarity , sunburn history subdivided by age ( juvenile 015 years old , and adult over 15 years old ) , and use of sun beds . the naevi were evaluated after being classified into one of three major groups : the common acquired melanocytic naevi ( nmac ) ( > 2 mm ) , congenital naevi , and atypical naevi . the location of each one was reported : head or neck , arm , upper arm , hands , chest , abdomen , upper back , lower back , thigh , and feet . sun freckles or ephelides were recorded by a number code ( l = none , 2 = from 1 to 5 , and 3 = more than 5 ) . those naevi which were identifiable as atypical were reported separately from the total count . in order to minimise possible errors in the naevus count and according to data reported in the literature , a series of clinical criteria identifying the variants was established ( table 1 ) , based on clinical morphological criteria , that considered the following : relationship to the skin surface , this was used by the dermatologists to identify every naevus lesion . for each variant , the presence of naevic elements and their number was reported , as well as the total number of variants present and the total number of naevi > 2 mm , regardless of their variant group membership . univariate analysis was carried out , followed by a chi - square test to evaluate the degree of association between several variables . finally , the or and the 95% confidence limit were adjusted for age , gender , number of naevi , and some known risk factors for cm , such as phototype i - ii , melanoma familiarity , and past sunburn history . more than 70% of the sample had homogeneous phenotypes : phototype ii or iii ; dark hair ; dark eyes ( 9% of the subjects phototype i , 40% phototype ii ; 35% phototype iii ; 14% phototype iv ) . the sample was also homogeneous in relation to the total number of naevi : 42% of cases and 45% of controls , thus nearly half the sample reported a total number of naevi ranging between 10 and 50 elements . 67% of cases and 80% of controls were negative for childhood sunburn : more than 75% of the sample did not present a childhood sunburn risk factor . with regard to our first aim , that is , the distribution of the single types in the sample , our study showed that the small brown naevus was present in more than 70% of controls and of cases . the raised brown naevus , on the other hand , was found in 93% of control subjects and in only 7% of cases . the target naevus was identified in 7.8% of the cases and in 16.1% of the controls . the association small brown + small black is equally distributed between the two groups : 27% of the cases and the controls . the presence of the target naevus varies in the two groups when it is the only type present and , when in association with others , more predominantly in cases ( target : 16% of cases and 8% of controls ; target + small brown : 16% of cases and 7% of controls ; target + small brown + small black : 10% of cases and 3% of controls ; target + small brown + small black + large brown : 8% of cases and 2% of controls ) . the presence of the small brown does not seem to be associated with cm ( small brown or 2.05 ; ci 1.04.42 ) . the risk increases when there is also the target variant ( target or 3.65 ; ci 1.49.7 ) . the raised brown naevus , on the other hand can be considered as protective for the development of cm ( raised nevus or 0.2 ; ci 0.030.8 ) . it can be seen that among subjects with an equal number of naevi , a greater number of variants corresponds to a greater cutaneous melanoma risk . the results were relative to the variants indicated in table 3 . with an equal number of naevi , the combination of only two variants was found to be of slight significance : ( small black + large brown or 3.5 ; ci 1.39.2 ) ; ( target + large brown or 3.6 ; ci 1.111.2 ) ; ( small black + large brown + large black or 5.5 ; ci 1.421.7 ) ; ( target + small brown + small black or 5.9 ; ci 1.523.2 ) indicating that apart from the number of naevi , naevus variants might influence the degree of risk . on the other hand the or does not change when the small brown variant is added to the association of small black and small brown ( small brown + large brown + small black ( or 3.5 ; ic 1.39.5 ) , small black + large brown ( or 3.5 ; ic 1.39.2 ) ) . analysing these data , it can be seen that a further significant element is provided by the specific impact of the different variants : the data indicate that the presence of the very common small brown naevus , does not modify the or , whereas the target naevus requires more careful evaluation ( or 3.65 ; ci 1.49.7 ) . moreover , the association of the target naevus with other variants , increases the degree of risk [ target + small brown or 5.25 ; ci 1.815.4 ] ; [ target + small brown + small black or 5.9 ; ic 1.523.2 ] ; [ target + small brown + small black + large brown or 5.0 ; ic 1.122.4 ] . our study indicates that some variants and/or variant combinations , do not significantly increase risk . ( fried egg or 0.4 ; ci 0.081.86 ; p = 0.23 ) ; ( unna or 0.94 ; ci 0.461.90 ; p = 0.8 ) ; ( meischer or 1.26 ; ci 0.52.9 ; p = 0.6 ) . the self - assessment of pigmented lesions remains an important step in the prevention of skin melanoma . in an australian study , carried out to determine the correspondence between the patient 's and the dermatologist 's naevus check , it was shown that the number of pigmented lesions is always underestimated by the patient , but agreement increases for atypical melanocytic naevi ; however , the role of the atypical naevus has been the subject of much debate in the literature and elsewhere , and , of course , it is not so easy to diagnose clinically . our study aims to introduce the differentiation of naevus variants among the monitoring criteria of risk factors for cutaneous melanoma . the results show that even if the total number of naevi represents a risk factor for the development of cutaneous melanoma , orientation in the naevus panorama of a specific subject requires the identification of several naevus variants . the most common naevus variants , such as dermal naevi and homogeneously pigmented naevi ( small and large brown or small and large black naevi ) can not alone represent a risk marker ; however the combination of two or more variants becomes a significant risk marker , and their combination in a person thus enables the identification of groups of subjects as reference targets potentially at risk of developing cutaneous melanoma . on the other hand , people presenting the target naevus in association with other naevus variants , have a major rearrangement and activity of pigmented lesions , and therefore require a more rigorous follow - up procedure . the greater variability of this variant is perhaps also expressed through its greater clinical inhomogeneity . this introduces a further aspect of our results : it is important to consider carefully not only the non - uniformity of a single type but also the general non - uniformity of the whole naevus panorama . the data actually available in the literature indicate that when the total number of naevi present in a subject increases , the risk of developing cutaneous melanoma also increases . a further datum emerges from our study : when two subjects present a similar number of naevi , the greater risk for cutaneous melanoma is linked to the greater number of naevus variants . subjects having a moderate number of lesions but presenting clinical inhomogeneous pigmentation are included in the group of subjects at risk . conversely , subjects with an elevated number of naevi but with a homogeneous panorama and low variability , can be observed with greater tranquillity , without however neglecting other risk factors . the classification of naevus in variants can be an indicator of clinical predictivity particularly in subjects who present naevi and especially an elevated number of naevi . furthermore , some variants considered singularly can play a key role in determining the clinical picture of the subject and are to be evaluated with great attention . consider , for example , naevi such as the small brown naevus whose presence or absence appears to be totally uninfluential , whereas the presence of others , such as the bullseye naevus , can greatly modify the dermatologist 's attitude toward the patient .

background . the incidence of cutaneous melanoma is rapidly increasing in europe . active research is directed toward the identification of naevi as a risk factor . objective . the aim of our case - control study was to observe different numbers of moles and different mole typology associations in order to evaluate clinical predictivity and to establish a new classification for some naevus variants . methods . a case - control study was carried out , enrolling 64 cases affected by melanoma and 183 controls , between october 2009 and february 2011 . each patient was interviewed and subjected to clinical examination . the resulting data were analysed using the statistical elaboration program spss 16.0 . results . the association of target naevus with other variants increases the degree of risk ( target + small brown odds ratio 5.25 ; confidence interval 1.815.4 ) ; ( target + small brown + small black + large brown odds ratio 5.0 ; confidence interval 1.122.4 ) . therefore , other variants and/or other variant combinations do not significantly increase risk . conclusion . people presenting two naevus variants in association with other naevus variants seem to run a major risk . the general nonuniformity of the whole naevus panorama should be carefully considered .

1. Introductions 2. Aims 3. Material and Methods 4. Results 5. Conclusion

head and neck squamous cell carcinoma ( hnscc ) is one of the most prevalent and lethal cancers worldwide ( argiris et al . , 2008 ) . despite recent advances in early detection , surgical techniques , radiation and chemotherapeutic regimes ( temam et al . 2009 ) , the survival rate and quality of life for patients with hnscc has only marginally improved over the past few decades ( haddad and shin , 2008 ; masuda et al . , 2011 ) . there is a desperate need for better biomarkers , to identify patients at high - risk for treatment failure , as well as novel concepts for a more effective and less toxic therapy for patients with advanced tumors ( hunter et al . head and neck squamous cell carcinoma has a strong epidemiologic background ( rodriguez et al . , 2004 ; dsouza et al . , 2007 ; furniss et al . , 2009 ) including environmental and lifestyle factors . the major risk factors for hnscc are tobacco and alcohol abuse ; however , the escalating incidence of oropharyngeal carcinoma ( oropharyngeal squamous cell carcinoma , opscc ) are not explained by increases in either smoking and alcohol consumption suggesting that atypical behavioral and environmental factors are also involved ( ernster et al . , 2007 ) . importantly , a subgroup of opsccs has causally been linked to infection with high - risk types of human papillomavirus ( hpv ) , especially hpv16 ( gillison et al . , 2008 ; pai and westra , 2009 ) . hpv infection has been established as a causative agent for almost 70% of opsccs and 2025% of all hnsccs ( gillison et al . , 2000 ; , 2005 ; kreimer et al . , 2005 ; reimers et al . , 2007 ; hoffmann et al . , , hpv - related tumors have been shown to be a new tumor entity in itself , with distinct clinical and histopathological features , including younger median age , oropharyngeal primary anatomical site , small tumor size , high lymph node involvement , as well as a lack of typical risk factors , and increasing incidence over the last decades at variance with decreasing total hnscc incidence . furthermore , hpv - related tumors do not show significant keratinization and they have a prominent basaloid morphology . the differences between hpv - related and hpv - negative tumors have been reviewed in several excellent recent reviews ( argiris et al . , 2008 ; psyrri and dimaio , 2008 ; leemans et al . , 2011 ) . intriguingly , patients with a hpv - positive tumor have improved performance status and a better prognosis compared to hpv - negative patients , even though the former patients were more likely to present with regional lymph node metastasis at the time of diagnosis ( curado and hashibe , 2009 ; pai and westra , 2009 ) . in general , hpv - positive patients are highly curable with ionizing radiation with or without chemotherapy , and have better overall and disease - free survival compared to patients diagnosed with hpv - negative tumors ( figure 1 ) ( fakhry et al . , 2008 ; ang et al . , 2010 ) . however , in several studies hpv dna - positive opsccs were heterogeneous in both biological and clinical behavior , possibly due to differences in viral load and/or viral oncogene expression ( paz et al . , 1997 ; andl et al . , 1998 ; , 2001 ; van houten et al . , 2001 ; mellin et al . , 2002 ; braakhuis et al . , 2004 ; lindquist et al . , 2007 ; reimers et al . hpv - related tumors are distinct from non - hpv - related tumors in biological and clinical features , including response to radio- and chemotherapy and clinical outcome . functional genome and transcriptome studies strongly suggest that hpv - related hnsccs comprise a disease entity that differs from hpv - negative tumors in regard to distinct molecular characteristics . in the past , several groups used comparative genomic hybridization ( cgh ) to identify genomic imbalance in the pathogenesis of hnsccs , focusing on hpv - related and hpv - negative tumors ( dahlgren et al . , 2003 ; smeets et al . , 2006 ; klussmann et al . , 2009 ; wilting et al . , 2009 ) . despite tumor - associated genomic alterations , which are common in both groups , these studies highlighted that per tumor , the total amount of chromosomal alterations , as well as amplifications was significantly lower in the hpv - related than in the hpv - unrelated tumors ( table 1 ) . this finding is consistent with the assumption that due to the inactivation of the tumor suppressor proteins p53 and prb by the viral e6 and e7 oncoproteins , respectively , the number of required genetic alterations for a malignant phenotype is lower in hpv - related carcinogenesis . consequently , a better clinical outcome of patients with hpv - related tumors could simply be a reflection of less genetic aberrations at the time of treatment . however , specific hpv - related genetic alterations have also been identified ( table 1 ) some of which were connected with improved survival . for example , 16q loss , which was predominantly identified in hpv - related opscc , was a strong indicator of favorable outcome and none of these patients had a tumor recurrence ( klussmann et al . , 2009 ) . additionally , hpv - negative tumors demonstrate a loss at 18q12.123 , in contrast to a gain in hpv - positive tumors ( smeets et al . , 2006 ) . it will be a major challenge in the future to identify candidate genes at the affected genomic sites , and to investigate their contribution to treatment resistance and tumor cell survival in both patient cohorts as well as preclinical model systems . alteration in the genome of hnsccs : genomic aberrations characteristic for hpv - related opscc . to uncover the genetic origin and the mutational landscape of hnscc , two recent studies applied gene copy number and whole exome sequence analysis on specimens of tumor normal pairs , including samples from patients with hpv - related tumors ( agrawal et al . , 2011 ; stransky et al . , 2011 ) . in both studies , the majority of tumors exhibited a mutational profile consistent with tobacco exposure , and there were obvious differences in the genetic landscapes of hpv - related and hpv - negative hnsccs . for instance , tumors that were negative for hpv had more mutations than hpv - positive tumors , independently of the smoking status . this finding is in line with the data derived by cgh analysis and further confirms major differences in the pathogenesis of hpv - related and hpv - negative tumors . furthermore , both studies observed an inverse correlation between the hpv status and tp53 mutations , as already shown previously ( wiest et al . , 2002 ; westra et al . , in addition to genomic alteration and gene mutation , aberrant dna methylation is widely recognized as a mechanism in the progression of hnscc ( hasegawa et al . , 2002 ; schmezer and plass , 2008 ) , but our knowledge on virus - induced changes in dna methylation of the host genome as well as other modes of epigenetic alterations , as part of the divergent carcinogenic pathway , is limited . nevertheless , the identification of distinct epigenetic profiles in hpv - related and hpv - negative tumors should provide clues to novel drug targets for development of individualized therapeutic strategies . currently , there is a limited number of studies which address the differences in epigenetic alteration between hpv - related and hpv - negative tumors . furthermore , the published data has largely evaluated changes in promoter methylation of a limited number of candidate genes , most of which were selected based on functional relevance in several human malignancies ( table 2 ) . a more recent study by sartor et al . ( 2011 ) applied an integrative approach combining genome - wide methylation and gene expression profiling to characterize the molecular differences between hpv - related and hpv - negative tumor cell lines . they found a higher overall dna methylation in hpv - positive compared to hpv - negative cell lines . this hpv - dependent difference was consistent with findings in primary tumor samples and in line with data from richards et al . moreover , an inverse correlation between gene promoter methylation and expression of affected genes was found in hpv - positive cells ( sartor et al . , 2011 ) . although differentially methylated loci found in tumor cell lines were significantly correlated with primary tumor dna methylation levels , a recent study demonstrated major changes in the dna methylation pattern between cultured cells and primary tumors ( hennessey et al . , 2011 ) . although these findings may direct alterations in the epigenome to different disease pathways involved in hpv - related versus hpv - negative tumors , critical validation in larger hnscc tumor sample sets is required . genes / proteins , specific gene(s ) or protein(s ; or total number ) of genes investigated in each study ; t , total number of tumors / patients included in the study ; cl , number of different cell lines included in the study ; hpv , consideration of hpv status in the study . global gene expression profiling comparing hpv - related and hpv - negative tumors revealed distinct transcriptome signatures , reflecting underlying heterogeneous somatic , genetic , and epigenetic alterations . as it would have been expected , all published studies identified differentially expressed genes that regulate dna replication and cell cycle progression ( slebos et al . , 2006 ; 2009 ) , while some also describe aberrant regulation of genes involved in viral defense and immune response ( schlecht et al . it is worth to mention that some differentially expressed genes are already known to modulate resistance to radiation and chemotherapeutic drugs , but experimental evidence of their impact on the favorable outcome of patients with hpv - related tumors are still missing . moreover , dysregulation of genes associated with processes of natural killer cell - mediated cytotoxicity , activation of the toll - like receptor , jak stat signaling pathways ( jung et al . , 2010 ) , as well as immune response and inflammation ( schlecht et al . , 2007 ) , are of particular interest , assumpting that the mechanisms underlying the clinical differences of hpv - related and hpv - negative tumors may involve the combined effects of immune surveillance to viral - specific tumor antigens , an intact apoptotic response to radiation , and the absence of widespread genetic alterations ( pai and westra , 2009 ) . yet , the correlation between altered cytokine and interferon signaling and the hpv status further supports the conclusion that improved survival of patients with hpv - related tumors may not only depend on tumor cell intrinsic features , but also could be due to different activation of stromal cells within the tumor microenvironment ( figure 2 ) . intrinsic and extrinsic features of hpv - related hnscc tumors potentially involved in the molecular mechanisms underlying improved disease course . hpv - related tumors have a better survival likely due to the combined effects of phenomena occurring in epigenome , genome , and transcriptome . these events drive alternations in intracellular signaling networks and along with complex interactions of malignant cells with components of tumor microenvironment including immune cells , they orchestrate the improved response to treatment and the favorable outcome . micrornas ( mirnas ) are small non - coding rnas , which represent another mode of gene regulation by influencing mrna translation or decay . several studies reported altered expression of distinct mirnas in the pathogenesis of hnscc ( babu et al . , 2011 ) . two recent studies characterized the influence of hpv on global mirna expression in hnscc cell lines ( wald et al . , 2011 ) , and tumor biopsies of hnscc patients ( lajer et al . , 2011 although , the overlap on common deregulated mirnas is only minor ( which may be due to the use of cell lines versus tumor biopsies ) increasing our understanding of the virus - targeted mirnas may provide further insight into molecular mechanisms for the distinct clinical behavior of hpv - related tumors . several intrinsic hallmarks of tumor cells have been described , including : ( i ) sustaining proliferative signaling , ( ii ) evading growth suppressors , ( iii ) resisting apoptosis , ( iv ) enabling unlimited replication , ( v ) inducing angiogenesis , and ( vi ) activating invasion and metastasis ( hanahan and weinberg , 2000 , 2011 ) . however , which of these capabilities differ between hpv - related and hpv - positive tumor cells and their likely contribution to the differential clinical outcome , is still a matter of debate . for instance , while patients with hpv - related hnscc respond better to radiotherapy , there is controversial data concerning whether hpv - related tumor cells are indeed inherently more radiosensitive than hpv - negative cells ( pai and westra , 2009 ) . infection by hpv results in over - expression of the viral oncoproteins and thereby affects many cellular pathways as well as genome stability . the oncogenic potential of hpv involves the expression of the viral e6 and e7 oncoproteins , which disrupts the tumor suppressive p53 and prb signaling pathways , respectively , and thereby modulate cell cycle progression and survival of infected keratinocytes ( zur hausen , 2002 ) . continued expression of viral oncogenes is necessary for neoplastic progression and the malignant phenotype of an hpv - associated tumor . transcriptionally active viral dna has been shown to be biologically and clinically relevant ( figure 1 ) ( wiest et al . , 2002 ; hpv - related hnsccs have less frequent p53 or prb mutations , which often occur in hpv - negative tumors ( marur et al . , 2010 ) . the tumor suppressor p53 acts as a central mediator of the cellular stress response , including dna damage induced apoptosis and cellular senescence by chemotherapy and ionizing radiation . therefore , the presence of wild - type p53 in hpv - related tumors could , at least in part , confer accelerated chemo- and radiosensitivity compared to hpv - negative tumors with p53 mutations . ( 2006 ) found that the clinical behavior of hnscc patients critically depends on the hpv and the p53 status . they provided clinical evidence that only patients with hpv - related tumors and wild - type p53 exhibit an improved survival , while patients with hpv - related tumors and mutant p53 have an unfavorable outcome , similar to hpv - negative hnscc patients . however , in a more recent publication pang et al . ( 2011 ) showed that expression of the viral e6 oncogene sensitizes tumor cells to radiation - induced apoptosis , and that the e6i , and not the e6ii isoform , is sufficient to mediate this effect . interestingly , e6i was shown to be a weak inhibitor of p53 transactivator activity , and the study supports a role for e6i in the enhanced responsiveness of hpv - positive opsccs to p53-independent radiation - induced cell death . the finding that nuclear survivin is associated with hpv - negative compared to hpv - related opscc and correlated with a poor clinical outcome further suggests a fundamental role in cell death regulation ( preuss et al . , 2008 ) . survivin is an inhibitor of apoptosis ( iap ) and nuclear survivin is believed to control cell division , whereas cytoplasmic survivin is considered cytoprotective ( stauber et al . , 2007 ) . hnscc cases with nuclear survivin and aurora - b expression exhibited marked malignant behaviors whereas both survivin and aurora - b knockdown inhibited cell growth and tumor formation ( qi et al . , 2010 ) . furthermore , survivin also plays a critical role in mediating resistance to radiation in part through suppression of apoptosis . more recently , gubanova et al . investigated whether the mechanism underlying increased sensitivity of hpv - positive tumors to radiation may be connected to the impaired ability of the cancer cells to respond to dna damage . they found that expression of smg-1 ( suppressor with morphogenetic effect on genitalia ) is diminished in hpv - positive tumors due to gene promoter hypermethylation ( gubanova et al . , 2012 ) . smg-1 belongs to a family of phosphoinositide 3-kinase ( pi3-kinase)-related kinases ( pikks ) involved in the maintenance of genome integrity via genotoxic stress response pathways and plays an important role in the dna damage response network ( shiloh , 2003 ; brumbaugh et al . , 2004 ; gewandter et al . , low smg expression correlated with positive hpv status and improved patient survival , whereas depletion of smg-1 in hnscc cells resulted in their increased sensitivity to radiation ( gubanova et al . , the impact of hpv e6 and e7 oncoproteins in in vitro cell sensitization to radiation remains controversial , since other studies have suggested that hpv16-positive cervical cancer cells ( padilla et al . , 2002 ) and hnscc cells ( hoffmann et al . , 2008 ) as well as hpv - negative cells with ectopic e6 and e7 expression ( hampson et al . , 2001 ) are resistant to treatment with cytotoxic drugs and radiation . it is worth noting that increased expression of another iap molecule , namely ciap2 , was reported to be significantly associated with hpv16-related hnsccs ( mansour et al . , 2012 ) . viral e6 oncoprotein has been shown to induce ciap2 expression through either the nf-b or egfr / pi3k / akt signaling pathways . ciap2 confers less sensitivity to apoptosis in hpv16 e6-immortalized human oral keratinocytes ( yuan et al . , 2005 ; james et al . , 2006 ) , and resistance to cisplatin in hpv - infected lung cancer ( wu et al . , 2010 ) , or 5-fu treatment of hnscc cell lines ( nagata et al . , 2011 ) . furthermore , high ciap2 expression was associated with poor clinical outcome , at least in patients with oral squamous cell carcinoma ( nagata et al . , 2011 ) . although there is a growing body of in vivo and in vitro data supporting the assumption that hpv - related tumors have a better survival due to a higher sensitivity to radiation and chemotherapy , it is difficult to conclusively attribute the improved clinical outcome only to the intrinsic features of the hpv - infected cells . it is more likely that a complex paracrine interaction among intrinsically mediated key pathways and the tumor microenvironment , including cells of the immune system , may determine the accelerated sensitivity to either radiation or chemotherapy ( figure 2 ) . accordingly , hpv - positive tumors have been postulated to be more susceptible to immune surveillance of tumor - specific antigens ( argiris et al . , 2008 ) , but so far only a few studies have explored endogenous host immunity to viral proteins in hnscc patients , in order to elucidate pathogenetic and treatment response mechanisms , and to gain insights into novel immunotherapeutic strategies . cytotoxic therapies including radiation induce potentially immunogenic cell death , releasing tumor - associated antigens , as a danger signal to the immune system ( shinohara and maity , 2009 ) . the efficacy of radiotherapy is determined not only by tumor cell properties , but also endothelial cells and infiltrating immune cells within the tumor environment ( shinohara and maity , 2009 ) . high levels of tumor - infiltrating lymphocytes ( tils ) have been identified as a favorable prognostic biomarker in various cancers ( pages et al . , 2010 ) , including hnscc ( brandwein - gensler et al . , 2006 ; uppaluri et al . , 2008 ) . however , their exact role on hnscc , especially in the context of hpv - related tumors remains to be elucidated . in this context , hoffmann et al . found that the frequency of hpv16-e7-specific t cells in the serum did not differ between hnscc patients and healthy controls . however , higher frequencies of t cells specific for hpv16-e7 epitopes were observed in hnscc patients with hpv - related tumors ( hoffmann et al . , 2006 ) , which is in line with previous findings ( albers et al . , 2005 ) the fact that hpv16-e7 epitopes are apparently immunogenic raises the question as to why antigen - specific t cells in hnscc patients are unable to eliminate hpv - related tumors without treatment . one possible explanation was provided by the finding that e7-specific cytotoxic t cells obtained by in vitro stimulation only recognize human leukocyte antigen hla - a201 positive and hpv16-transformed hnscc cells after pretreatment with ifn - gamma ( albers et al . , 2005 ) . further analysis demonstrated that this cell line had little or no expression of critical components of the hla class i antigen - processing machinery , which were subsequently up - regulated upon ifn - gamma treatment . in addition , the antigen - processing machinery components were also found to be downregulated in hpv - related tumors compared to adjacent normal epithelium . it currently remains uncertain as to whether impaired antigen presentation in hpv - related tumors may be reversed by radiation or chemotherapy and thereby induces an antitumor immune response . in a retrospective study , rajjoub et al . ( 2007 ) reported a positive correlation between large numbers of tils ( cd3 ) and lower incidence of metastasis at presentation , regardless of hpv status . however , when the hpv status was taken into account , the correlation between a cd3 count and a lower rate of metastasis was maintained in hpv - positive but not in hpv - negative patients ( rajjoub et al . , 2007 ) , further supporting the crucial role of the adaptive immunity in the favorable clinical outcome of hpv - related tumors . in line with this assumption , the percentage of circulating cd8-positive t cells was significantly higher in patients with hpv - related tumors as compared to hpv - negative hnscc patients ( wansom et al . , 2010 ) . furthermore this prospective study revealed a positive correlation between a higher percentage of cd8-positive t cells and the response to induction chemotherapy and complete tumor response after chemotherapy . ( 2012 ) reported that the degree of t cell infiltration in tumor tissue is associated with improved survival but is independent of the hpv status , similar to previous findings ( rajjoub et al . they concluded that more comprehensive studies with larger numbers of patients combined with functional analysis of individual subsets may be necessary to detect significant differences in local immunity in hpv - related hnscc . there is increasing evidence that radiotherapy modulates immune response and that the underlying mechanism behind the better prognosis of hpv - positive tumors may be enhanced immune response following radiotherapy ( vu et al . , 2010 ) . ( 2009 ) found that both hpv - positive human and murine transformed cell lines cells were even more resistant to radiation and cisplatin treatment in vitro compared with hpv - negative counterparts . however , hpv - positive cells were more sensitive to radiation in a syngeneic mouse tumor model , and complete clearance was found at 20 gy , in contrast to hpv - negative cells , which showed persistent growth ( spanos et al . , 2009 ) . intriguingly , neither radiation nor cisplatin therapy cured hpv - positive tumors in immune - incompetent mice , strongly supporting a crucial role of the immune system in the therapeutic sensitivity of hpv - positive tumors . in line with this assumption , williams et al . ( 2009 ) showed in a syngeneic mouse tumor model that only hpv - positive tumor cells induce an antigen - specific antitumor response , which was mediated by cd4- and cd8-positive t lymphocytes . innate immune cells may also contribute to the favorable clinical outcome of patients with hpv - related opsccs . as basal keratinocytes are the primary target of hpv infection ( feller et al . , 2009 ) , innate immunity represents the first line of defense against invading viruses . keratinocytes express several pathogen recognition receptors ( prrs ; pries et al . , 2008 ) , and their engagement by pathogen - associated or danger - associated molecular patterns leads to direct activation of the pro - inflammatory transcription factors , and/or activation of an anti - viral type i interferon ( ifn ) response ( rincon - orozco et al . several reports highlighted a major impact of viral oncoproteins on the regulation of pro - inflammatory mediators and anti - viral responses , suggesting that hpv has developed strategies to evade the innate host immunity ( schlecht et al . s100a9 were downregulated in hpv - immortalized cells ( delloste et al . , 2008 ) . vice versa , the s100a8/s100a9 protein complex has been shown to inhibit phosphorylation of the viral e7 oncoprotein by the casein kinase ii and may play an important role in hpv - infected epithelial cells to counteract the oncogenic activity of e7 ( tugizov et al . , 2005 ) . s100a8 ( mrp8 ) and s100a9 ( mrp14 ) belong to the large family of s100 proteins , which are low molecular weight proteins sharing conserved structural motifs that consist of two ef - hand ca - binding domains . s100a8 and s100a9 form a functional heterodimer ( also known as calprotectin ) and have been identified as important endogenous damage - associated molecular pattern proteins that critically contribute to pathological conditions of acute and chronic inflammation , and may therefore represent a key player in the setting of inflammation - associated carcinogenesis ( gebhardt et al . , 2006 ; it is worth mentioning , that inflammatory signals and the establishment of a pro - inflammatory environment are increasingly linked to the induction and promotion of tumorigenesis ( balkwill and mantovani , 2001 ; coussens and werb , 2002 ; grivennikov et al . , 2010 ) . one of the most extensively studied signaling network in inflammation - associated cancer is the nf-b pathway ( ben - neriah and karin , 2011 ) , and there is increasing evidence for its crucial role in the pathogenesis of hnscc including hpv - related tumors ( molinolo et al . , 2009 ) . analysis of hpv16-transformed cell lines revealed that functional components of the nf-b signaling pathway were sequestered in the cytoplasm , or became inactivated by viral e6 and e7 expression , accompanied by reduced expression of cytokines and chemokines ( guess and mccance , 2005 ; havard et al . , 2005 ) . however , it will be a challenge for the future to address the question of whether changes in pro - inflammatory signaling pathways , such as nf-b , and the establishment of an activated pro - tumorigenic environment are causally linked to the increased sensitivity to therapy of patients with hpv - related tumors and their improved survival . currently , hpv - positive opscc dominates the head and neck oncology landscape , and its escalating incidence has a strong impact on clinical and translational research . although it is well accepted that hpv - related tumors represent a distinct histopathological and biological entity with a favorable clinical outcome , we have just now begun to establish the molecular principles underlying improved survival . as a consequence of modern genome - wide approaches , our understanding of the fundamental mechanisms and biological processes involved in the pathogenesis of hpv - related and hpv - negative hnsccs has rapidly increased . however , most of the functional genomics data was derived from primary tumor samples largely devoid of the important information on differences in response to current treatment options . furthermore , the use of several cell culture and mouse tumor models have produced conflicting results which neither mimic the complex interaction between the tumor and its activated tumor microenvironment nor the etiology of hpv - related tumors . hence , there is an urgent need for an appropriate and more sophisticated preclinical model system(s ) . the mechanisms underlying the clinical differences between hpv - related and hpv - negative tumors may involve the combined effects of tumor cell intrinsic features and paracrine interactions between tumor cells and stromal cells of the activated tumor microenvironment , especially cells of the adaptive and innate immunity . unraveling the molecular nature of improved clinical outcome of hpv - related hnscc will not only support personalized risk assessment but will also unravel new concepts for a targeted therapy for hnscc patients with hpv - negative tumors . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

human papillomavirus ( hpv ) infection is well established as an etiological agent responsible for a number of pathologies affecting the stratified epithelia of skin and anogenital sites . more recently , the infection by ( mucosal ) high - risk hpv types has also been found to be causally associated with squamous cell carcinoma in the head and neck region ( hnscc ) , especially in the oropharynx . intriguingly , hpv - related oropharyngeal squamous cell carcinomas ( opscc ) represent a distinct clinical entity compared to hpv - negative tumors with particular regard to treatment response and survival outcome . the association between hpv infection and opscc may therefore have important implications for the prevention and/or treatment of opscc . the improved survival of patients with hpv - related tumors also raises the question , as to whether a better understanding of the underlying differences may help to identify new therapeutic concepts that could be used in targeted therapy for hpv - negative and improved therapy for hpv - positive cancers . this review summarizes the most recent advances in our understanding of the molecular principles of hpv - related opscc , mainly based on functional genomic approaches , but also emphasizes the significant role played by the tumor microenvironment , especially the immune system , for improved clinical outcome and differential sensitivity of hpv - related tumors to current treatment options .

HPV Infection in the Pathogenesis and Prognosis of HNSCC Alterations in the Genome, Epigenome, and Transcriptome of HPV-Related Tumors Cell Intrinsic Features of HPV-Positive Tumor Cells Impact of the Immune System Conclusion and Perspectives Conflict of Interest Statement

crohn 's disease ( cd ) is a form of inflammatory bowel disease ( ibd ) affecting the entire gastrointestinal ( gi ) tract [ 14 ] . cd is characterized by transmural inflammation of gi wall in a noncontiguous pattern anywhere from the mouth to the anus [ 5 , 6 ] . it is believed that , in genetically predisposed individuals , interaction between local microbiota and the intestinal mucosa can cause chronic inflammation and ulceration [ 79 ] . a key pathological feature of cd is a granulomatous inflammatory response , characterized by the presence of epithelioid and multinucleated giant cells as well as macrophage infiltration [ 10 , 11 ] . it is believed that the onset and development of the inflammatory reaction depend on persistence of an inciting agent , resulting in a chronic inflammatory milieu and perpetuating a complex immune reaction subsequent to the local granulomatous response . persistent inflammation and immune activation are believed to be the leading causes of tissue necrosis and fibrosis . newly diagnosed cd usually presents with diarrhea , abdominal pain , fever , fatigue , stomatitis , and weight loss . in more advanced cases , strictures and fistulas may develop , changing the clinical presentation to include severe abdominal pain , distension , bloating , vomiting , perianal fistulae , and abscesses . cd can be diagnosed at any age ; however disease progression and clinical presentation frequently differ in young and adult patients . cd in children and adolescents tends to have a more severe clinical manifestation often with development of strictures or fistulae [ 1 , 3 , 14 ] . in contrast , later onset of cd is often characterized by a milder course with a lower frequency of complications [ 13 , 14 ] . furthermore , it has been shown that the childhood - onset cd is more likely to require immunosuppressive therapy and has a higher frequency of surgery as compared to cd diagnosed in adulthood [ 4 , 13 ] . additionally , juvenile and adolescent onset cd has more frequent involvement of the small bowel , while adult cd is generally more likely to be colon - associated [ 1519 ] . an altered immune response , together with genetic and environmental factors , may govern the timing of cd onset . there is a higher frequency of cd family history in patients diagnosed before the age of 20 relative to those diagnosed later in life , suggesting that genetic predisposition plays a role in early onset [ 13 , 20 ] . for example , it has been shown in adult cd that higher levels of serum antibody reactivity towards increasing amount of microbiota in small intestine correlate with a greater frequency of complications [ 21 , 22 ] . a similar observation has been made in a pediatric cohort [ 23 , 24 ] . furthermore , cd patients have been shown to have increased numbers of circulating th17 lymphocytes and upregulation of il17 transcriptional activity in intestinal mucosa . this indicates that the progression of cd is characterized by an exacerbated th17 response , which may explain the continuing nature of the disease . immune mechanisms are believed to play a role in the pathogenesis of adult and juvenile cd , with cytokines being essential to establish and maintain the immune response . however , little is known about differences in serum cytokine profiles between juvenile and adult cd cases . we have found that all cd patients have upregulated serum cxcl10 levels , regardless of the age of diagnosis and the stage of the disease . also , we have demonstrated upregulation of il-1b and il-6 in juvenile cd , with no changes detected in levels of gm - csf and ifn-. in contrast , the adult cd serum profile was characterized by upregulation of gm - csf and ifn- , as well as il-6 and il-1b , when compared to controls . it has been shown that gm - csf and ifn- promote a th1 immune response , while il-6 is essential for activation of th17 lymphocytes [ 2628 ] . therefore , this suggests that the mechanisms of pathogenesis differ in adult and juvenile cd patients . clinical surplus serum samples from 64 patients diagnosed with cd were utilized in this study ; 12 juvenile patients ( 6 male , 6 female ; average age 14.0 2.1 ) hospitalized in the volga region federal medical research center of the ministry of public health ( nizhny novgorod , russia ) and 52 adult patients ( 26 male , 26 female , average age 35.1 13 ) hospitalized in the department of gastroenterology of republican clinical hospital ( kazan , russia ) . diagnosis of cd was established in all patients based on clinical presentation and was verified by upper gi endoscopy . additionally , a small number of samples ( 6 ) were collected from juvenile patients during their period of clinical improvement . age and gender matched control samples were collected from 10 juvenile ( 5 male , 5 female ) as well as from 23 adult ( 13 male , 10 female ) controls . all serum samples were stored at 80c until use . the study was approved by the ethics committee of kazan state medical university ( protocol 23 ) and the ethics committee of volga region federal medical research center of the ministry of public health nizhny novgorod ( protocol 4 ) . serum cytokine levels were analyzed using single - plex sets for il-1b , il-2 , il-5 , il-4 , il-6 , il-8 , il-10 , il-12p40 , gm - csf , ifn- , cxcl10 , and tnf- ( bio - rad , hercules , ca , usa ) following the manufacturer 's instructions . serum aliquots ( 50 l ) were used for analysis , with a minimum of 50 beads acquired per analyte . data collected was analyzed with masterplex ct control software and masterplex qt analysis software ( hitachi software , san bruno , ca , usa ) . statistical analysis was performed using the statistica 7.0 software package ( statsoft , tulsa , ok , usa ) . levels of 12 cytokines were analyzed in juvenile cd serum collected during both the acute stage and remission . acute serum was characterized by upregulation of il-1b , il-6 , cxcl10 , and tnf- levels compared to controls ( table 1 ) . in contrast , no changes in il-2 , il-5 , il-4 , il-10 , il-12p40 , gm - csf , and ifn- were found in acute juvenile patients compared to controls . median values of il-8 in acute serum were upregulated ( 1415.30 [ 997.12654.4 ] versus 2777.00 [ 611.07382.5 ] ) ; however , differences were not statistically significant from controls . during remission , serum levels of cxcl10 ( p < 0.05 ) and il-1b ( p < 0.05 ) remained significantly upregulated in juvenile cd patients compared to controls ( table 1 ) . the median value of il-1b during remission was higher than that in acute patients ( 832.75 [ 481.91016.0 ] versus 550.00 [ 192.0784.3 ] ) , suggesting an upward trend in cytokine production ( p = 0.067 ) . il-6 and tnf- serum levels were significantly higher during the acute stage but then declined in remission and remained comparable to controls . similarly , in acute stage patients , median values of il-8 were upregulated during remission ( 1415.30 [ 997.12654.4 ] versus 4 194.0 [ 411.97 220.9 ] ) ; however , differences were not statistically significant from controls . several leukocyte surface markers were examined including cd3 ( lymphocytes ) , cd4 ( t - helper ( th ) lymphocytes ) , cd8 ( cytotoxic t lymphocytes ( ctl ) ) , cd16 ( natural killer ( nk ) cells ) , cd19 ( b lymphocytes ) , and cd56 ( nk cells ) ( table 2 ) . increased numbers of cd16+cd56 + leukocytes were characteristic for acute stage juvenile cd compared to remission ( 0.26 0.08 versus 0.14 0.02 10/l ; p < 0.02 ) ( table 2 ) . when the cd4/cd8 ratio was analyzed , two groups of acute stage patients could be identified having a ratio higher or lower than 2.0 . since cytokines play a central role in differentiation and proliferation of leukocyte cd4 and cd8 subsets , we analyzed serum cytokines in the cd4/cd8 subgroups of juvenile cd patients ( table 3 ) . acute stage patients with a cd4/cd8 ratio above 2.0 were characterized by upregulated serum levels of il-1b , cxcl10 , tnf- , and il-10 . additionally , high cd4/cd8 ratio patients had a greater il-8 median value compared to those with a cd4/cd8 ratio below 2.0 ( 4161.50 [ 2956.08372.8 ] versus 1760.00 [ 257.46014.1 ] ) ; however , these differences were not significant . interestingly , cxcl10 levels were significantly higher in juvenile cd patients with a cd4/cd8 ratio below 2.0 than those with a cd4/cd8 ratio above 2.0 . serum cytokine profiles in adult cd patients depended on the stage ( acute or remission ) of the disease . for example , a subset of serum cytokines , including il-1b , il-6 , gm - csf , ifn- , and cxcl10 , were upregulated in the acute stage of cd relative to controls ( table 4 ) and remained upregulated as in remission . however , serum levels of tnf- and il-10 , unchanged in acute stage the disease , were downregulated during remission ( table 4 ) . it should be noted that the il-12 median value was 20-fold higher in adult cd patients in either acute stage or remission than controls , though not statistically significant . although these differences were not significant , there was a strong trend towards upregulation in adult serum , both during the acute stage and the remission . interestingly , in contrast , the serum level of il-12 in juveniles in both the acute stage and the remission did not differ from controls . further , in serum of acute stage , adults with cd both gm - csf and ifn- were upregulated , whereas these cytokines remained unchanged in acute juvenile cd patients . this strongly suggests that several cytokines , including gm - csf , ifn- , and il-12 , play a role in the pathogenesis of cd in adult patients . cd is a chronic inflammatory bowel disease affecting the integrity and function of the gi tract . the disease has a bimodal age distribution , with 2025% of cases diagnosed early in life ( childhood and adolescence ) , while 70% of cases are diagnosed in adulthood . clinical symptoms of cd include abdominal pain , diarrhea , weight loss , and fever . in addition to the common gi symptoms , juvenile cd is often associated with failure to thrive that can include retarded growth , malnutrition , pubertal delay , and bone demineralization [ 31 , 32 ] . studies using animal models have shown that cd pathogenesis is closely associated with a th1 cytokine profile , while activation of the th2 cytokines is more prevalent in the pathogenesis of ulcerative colitis [ 33 , 34 ] . activation of t cell - mediated immunity is linked to the development of epithelioid granulomas , which are pathognomonic to cd . the serum cytokine profile of cd patients is also indicative of activation of a th1 and a th17 type immune response . for example , upregulation of il-17a , il-17f , il-21 , il-22 , il-26 , and ccl20 has been demonstrated in cd cases pointing to activation of th17 type immunity . increased serum levels of tnf- are a hallmark of cd suggesting a fundamental role for this cytokine in disease pathogenesis [ 3739 ] . the role of cytokines in cd was supported by prehn et al . who demonstrated enhanced production of ifn- , the key cytokine for activation of a th1 type immune response , by mucosal t lymphocytes upon stimulation with tnf- . therefore , these data suggest that cytokines play an important role in activating and maintaining the th1 and th17 type immune response , which is indicative of cd . although the role of cytokines in cd pathogenesis is well established , little is known about age differences in cytokine activation in cd patients . juvenile cd is usually characterized by severe clinical manifestations , often including development of strictures or fistulae requiring surgical intervention , whereas adults frequently have a milder clinical presentation with a lower likelihood of developing complications [ 4 , 13 ] . therefore , we sought to determine whether the cytokine profiles in juvenile and adult cd differed . serum levels of 12 cytokines were evaluated during both the acute stage and the remission in juvenile and adult cd patients . an interesting observation was that there was upregulation of cxcl10 cytokine in all patients regardless of age and stage of the disease . although increased cxcl10 serum levels and enhanced expression of cxcl10 in inflammatory bowel tissue has previously been shown in adult cd , here we present the first evidence for upregulation of this chemokine in the serum from juvenile cd cases . cxcl10 is a chemokine known to exclusively recruit activated t lymphocytes and nk cells [ 4143 ] . additionally , it has been demonstrated that cxcl10 targets th1 lymphocytes [ 42 , 43 ] . the essential role of cxcl10 in the gut lymphocyte infiltration and inflammation has been established by grip and janciauskiene . these authors demonstrated that reduced plasma levels of cxcl10 correlate with decreased level of the prominent inflammation marker , c reactive protein . in another study , hyun et al . demonstrated that a reduction in cxcl10 serum levels impairs activation and reduces recruitment of th1 lymphocytes into the gut mucosa and lymphoid tissue therefore , our data support the notion that upregulation of cxcl10 can facilitate th1 lymphocyte infiltration and perpetuate epithelial inflammation in the gut . furthermore , increased serum levels of cxcl10 were found in all patients regardless of the stage of the disease , suggesting chronic th1 lymphocyte activation , which is ongoing even during clinical remission . an interesting observation regarding serum il-8 levels in juvenile and adult cd patients was that , although not significant , the serum level of il-8 was higher ( 1.9 and 2.9 times ) in acute and remission juvenile cd compared to controls . in contrast , serum il8 levels in adult cd remained similar to age - matched controls . il-8 is a pleotropic cytokine , known as the prototype neutrophil attractant , which also activates neutrophils by upregulating phagocytosis and respiratory burst . since inflamed tissue is often infiltrated by activated neutrophils , this suggests a contribution of il-8 to both local and systemic inflammation . although high circulating il-8 is characteristic of inflammation , a lack of change in serum il-8 in some cases of gastroduodenitis has been documented . further investigation demonstrated that although il-8 levels in serum were unchanged , there were increased levels of il-8 transcripts within intestinal tissue [ 50 , 51 ] , suggesting local production of il-8 . therefore , this suggests that lack of changes in il-8 in serum may not always reflect ongoing in situ inflammation . therefore , we propose that in juvenile cd that high serum il-8 may reflect systemic inflammation , whereas , in adult cd , the lack of changes in circulating il-8 level indicates that inflammation could be restricted to bowel tissue . another finding was that the serum level of tnf- was significantly upregulated in juvenile cd compared to controls , while it remained unchanged in adult cases . these data suggest that juvenile cd , relative to adult , is characterized by a stronger inflammatory milieu in the gut . additionally , increased serum il-6 was detected all cd cases , regardless of patient 's age , relative to controls . il-6 is a b cell differentiating factor that , when combined with tgf , promotes the differentiation of th17 lymphocytes . moreover , il-6 is considered an essential cytokine for th17 differentiation of naive t cells . th17 lymphocytes are believed to be pathogenic and are often associated with the severe tissue damage and development of autoimmunity . the mechanisms of th17-associated tissue damage are linked to a breach in the integrity of the intestinal epithelium due to increased production of inflammatory cytokines and matrix metalloproteinases , as well as inhibition of proliferation of human gut epithelial cells [ 56 , 57 ] . interestingly , juvenile cd is characterized by upregulation of the il-6 , while levels of ifn- were unaffected . however , the opposite pattern of cytokine activation was found in adult cd , where only ifn- levels were significantly upregulated . ifn- is secreted by ctl and often used as a marker of the th1 type immune response . the th1 ( il12-ifn- ) and th17 ( il-6-il-17 ) pathways seem to be mutually exclusive , with ifn- and il-17 acting as reciprocal inhibitory cytokines . however , a subpopulation of th17 lymphocytes producing il-17 and ifn- was identified in cd gut tissue by annunziato et al . . the authors suggested that il-17/ifn- positive th17 are important for cd pathogenesis , as these cells were able to support b cell proliferation , had low cytotoxic activity , and were poorly responsive to autologous regulatory t cells . therefore , we hypothesize that the th17 response is characteristic for juvenile and adult cd . however , upregulation of il-17 and ifn- in adult cd suggests that there are more complex mechanisms of pathogenesis relative to juvenile cd . we propose that the th17 ( il-17/ifn- ) , or a combination of th17 and th1 immune responses , play a leading role in pathogenesis of adult cd . studies using tissue biopsies from juvenile and adult cd will help to better understand the role of these th subsets in cd pathogenesis . it has been suggested that gm - csf can alter the course of intestinal inflammation . have shown that gm - csf activated macrophages protect mice from t cell - induced colitis . these authors suggested that gm - csf - activated macrophages facilitate differentiation of th2 lymphocytes by upregulating production of il-4 , il-10 , and il-13 in lamina propria resident leukocytes , which may decrease local inflammation , improve bacterial clearance , and promote healing . in another study , have shown that the presence of anti - gm - csf antibody can serve as marker for the severity of cd . further , these authors demonstrated that elevated anti - gm - csf antibody levels were associated with intestinal stricture , penetration , and resection in cd patients . a similar observation was published by gathungu et al . , where cd patients with elevated anti - gm - csf antibody exhibited increased bowel permeability as compared to those with lower levels of this antibody . it has been suggested that gm - csf neutralization promotes ileac disease by modulating expression of ccl25 by intestinal epithelium and ccr9 by t lymphocytes via nod2-dependent and -independent pathways . therefore , increased gm - csf levels in adult cd may contribute to inhibition of bowel inflammation and prevention of tissue damage . adult cd was characterized by upregulation of serum gm - csf and ifn- , a combination with strong anti - inflammatory potential . for example , it has been shown that treatment of an lps challenge with gm - csf and ifn- inhibited an inflammatory response by lowering neutrophil counts and increasing the number of suppressive neutrophils ( cd16 ( bright)/cd62l ( dim ) ) in healthy volunteers . the gm - csf / ifn- combination may have a profound effect on leukocyte polarization . both cytokines play a key role in developing m1 type macrophages , which are associated with th1 type immune response . . therefore , increased serum gm - csf and ifn- may reflect activation of th1 type immune response in adult cd . our data suggest that juvenile and adult cd are characterized by unique serum cytokine profiles , which may reflect age - dependent difference in disease pathogenesis .

crohn 's disease ( cd ) is a chronic inflammatory bowel disease that can be diagnosed at any age . there are two major patient groups based on diagnosis of this disease , before or after the age of 20 ( juvenile / adolescent or adult ) , with disease progression in adults usually milder than in juvenile cd patients . immune mechanisms have been suggested to play an important role in cd pathogenesis , with cytokines governing the development of the immune response . upregulation of inflammatory cytokines in serum of juvenile and adult cd patients has been documented ; still little is known about age - dependent differences in serum cytokine profiles of cd patients . we applied multiplex technology to analyze serum levels of 12 cytokines in juveniles and adults . we show that during the acute stage of the disease all cd patients have high serum levels of cxcl10 , which remains upregulated during remission . increased serum levels of tnf- and il-6 during the acute stage was characteristic of juvenile cd patients , whereas adult cd patients had upregulated levels of gm - csf and ifn-. taken together , these results demonstrate age - dependent differences in cytokine profiles , which may affect the pathogenesis of cd in patients at different ages of disease onset .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

contaminated sites are extensively present in europe where approximately 250,000 sites require cleanup interventions , as listed by the european environment agency . several thousands of these sites are located in italy , and a total of 57 sites , defined in 2009 as national priority contaminated sites ( npcss ) , qualify for remediation because of contamination documented in qualitative and/or quantitative terms , and because of a potential health impact . the site of taranto , located in apulia region ( southern italy ) , includes two municipalities and 216,618 inhabitants at 2001 census . this site is of interest because of several polluting sources , such as a large steel plant , a refinery , the harbor , and both controlled and illegal waste dumps . previous environmental and epidemiological investigations in the area have provided evidence of environmental contamination [ 29 ] . these studies have documented severe air pollution originating mainly from the steel industry , that is , particulate matter , heavy metals , polycyclic aromatic hydrocarbons , and organ - halogenated compounds . epidemiological studies showed an increased mortality / morbidity from respiratory , cardiovascular diseases and several cancer sites [ 1013 ] . npcss ) funded by the italian ministry of health studied mortality for 63 causes among residents of 44 npcss included in the national environmental remediation programme . the distinguishing feature of sentieri project is that the epidemiological evidence evaluation has been carried out before the study to minimize the risk for researchers to be data - driven when performing and interpreting the specific epidemiologic investigation . sentieri dealt with the complexity of the relation between area contamination and health effects by examining , for each combination of causes of death / environmental exposures , the epidemiological evidence ( 19982009 ) and then building a matrix of the a priori evaluation of the strength of the causal association . the environmental exposures were classified as chemicals , petrochemicals and refineries , steel plants , power plants , mines and/or quarries , harbour areas , asbestos or other mineral fibers , landfills , and incinerators labelled on the basis of the legislative decrees defining the sites ' boundaries . a standardized procedure was set up to collect the available epidemiological literature , which was reviewed on the basis of explicit criteria and led to classify each cause of death / environmental exposures combination in terms of strength of causal association . the evaluation was categorized as sufficient to infer the presence of a causal association ( s ) , limited to infer the presence of a causal association ( l ) , and inadequate to infer the presence or the absence of a causal association ( i ) . the rationale , scope , methods , and details of the a priori evidence evaluation can be found in , and the procedures and results of the evidence evaluation have been published in italian . with specific reference to the environmental exposures in taranto npcs , this procedure led to classify the presence of a steel industry , a refinery , a harbour area , and a number of landfills and waste dump sites as associated , with limited evidence , with an increased risk of lung cancer , pleural mesothelioma , nonmalignant respiratory diseases , congenital malformations , and perinatal conditions . in this context , residence near steel industry was evaluated as specifically associated with the occurrence of both acute and chronic respiratory diseases in adults and children , based on studies by [ 1723 ] . it should be underlined , however , that air pollution from particulate matter has been causally linked by who with several health effects , including all - cause mortality and cardiovascular and respiratory morbidity . sentieri analyzed mortality at municipality level in the period 19952002 , computing standardized mortality ratios ( smr ) both crude and adjusted for a deprivation index . while sentieri strengths are the a priori epidemiological evidence evaluation and the mortality analysis of all npcss adopting the same analytical approach and adjusting for deprivation , there are several limitations that should be noted , such as its ecological design and the use of mortality data at municipal level for a short period of time . with the aim of overcoming the above limitations , this paper presents an epidemiological profile of taranto npcs residents analyzing different health indicators available at municipality level , that is , cause - specific mortality ( 20032009 ) , mortality time trend ( 19802008 ) , and cancer incidence ( 2006 - 2007 ) . a cohort study of the resident population examined mortality ( 19982008 ) and morbidity ( 19982010 ) in the districts close to the steel plant . details on the codes used during the study period for the 9th and 10th revisions of the international classification of diseases ( icd-9 and icd-10 ) and on the demographic data of the two municipalities included in taranto npcs are presented in appendix a. mortality in taranto npcs residents was initially studied for the period 19952002 and then updated for the years 20032009 ( note that the period 2004 - 2005 was not available from istat ) . the analysis considered 63 single or grouped causes ( all ages , both genders ) ; 0 - 1 and 014 age classes were also analyzed for a selection of causes ( both genders combined ) . standardized mortality ratios both crude ( smrs ) and adjusted for deprivation together with 90% confidence intervals ( 90% cis ) were computed using regional rates for comparison . in sentieri project the deprivation index ( di ) was constructed using the 2001 national census variables representing the following socioeconomic domains : education , unemployment , dwelling ownership , and overcrowding . the strengths and weaknesses of sentieri i d , its correlation with 2001 national deprivation index , its efficacy in representing deprivation in different categories of demographic dimensions , together with suggestions about the use of socioeconomic indices in small area studies of environment and health are discussed in pasetto et al . the analysis was performed for the population 099 years separately for men and women ; directly standardized death rates ( sdrs ) per 100,000 were calculated ( standard : italian population at 2001 census ) together with their 90% ci . the population size of taranto npcs is relatively small ; therefore the study period was divided into three - year periods to obtain stable values of the indicators . the overall mortality was analyzed together with specific diseases , selected on the basis of the a priori evidence evaluation of their link with environmental exposures in taranto npcs . the selected diseases were all cancers ( in particular lung cancer ) , circulatory diseases ( in particular ischemic heart disease ) , and respiratory diseases ( in particular , the acute , and chronic ones ) . we also analyzed the overall infant mortality ( i.e. mortality from all causes during the first year of life ) without gender distinction , as not informative in this age group . for cancer incidence ( 2006 - 2007 ) , standardized incidence ratio ( sir ) and 90% ci were calculated for both genders ; the incidence rates of italian south and islands cancer registries macroarea ( 20052007 ) and of taranto province , excluding npcss municipalities ( 2006 - 2007 ) , were used for comparison . a cohort study design was applied to evaluate cause - specific mortality and hospitalization in relation to residence in specific districts close to the industrial sites . a cohort of residents ( all subjects living in taranto , massafra , and statte as january 1 , 1998 , and subsequently entered in these municipalities up to 2010 ) was enrolled from the municipal register . individual follow - up for vital status assessment at 31.01.2010 was performed using municipality data . this cohort population is different from the base population analyzed for mortality in 20032009 ( see previous paragraph for details ) . the socioeconomic position level ( sep ) of the census block of residence and the district of residence were assigned to each participant ( five categories from low to high sep ) , on the basis of the addresses geocoded at the beginning of the follow - up . occupational history for all cohort members was traced through the national insurance company ( inps ) database ( people employed in 1974 and subsequently ) , and the subcohort of individuals employed in industries located in the area was identified . mortality / morbidity information was retrieved from regional health databases ( 19982008 for mortality , 19982010 for hospital admissions ) . the associations of district of residence with mortality / morbidity were estimated by calculating mortality and morbidity hazard ratios ( hr , ci 95% ) using the proportional cox models . all models considered age ( temporal axis ) , calendar period , and area - based socioeconomic status , and they were calculated separately for men and women . tables 13 show mortality results in the periods 19952002 and 20032009 . in table 1 , mortality , from the main causes of death , is displayed for descriptive purposes ; tables 2 and 3 present the results for the causes selected on the basis of the a priori evidence evaluation , the distinguishing feature of sentieri project . table 1 shows that in both periods , for both genders , for all causes and all neoplasms , there was an excess of mortality ranging between 7% and 15% ; adjustment for deprivation did not substantially change smrs values . in both periods , among males and females , the observed mortality was above expected for circulatory , respiratory , and digestive systems diseases ; also in these cases , accounting for socioeconomic factors did not essentially change the study results . for diseases of the genitourinary system , table 2 presents the results for the causes of death for which sentieri classified the epidemiological evidence of causal association with the environmental exposures in taranto npcs as limited . from now on lung cancer showed a 20% excess in the first period , confirmed in the second one ; among females the excesses were , respectively , about 30% ( 19952002 ) and 20% . correspondingly , in the two periods excesses for pleural tumors were 193% and 167% among males , 90% and 103% among females . excesses for acute respiratory diseases among males were 49% ( 19952002 ) and 37% ( 20032009 ) , and for females 38% and 14% , respectively . the observed mortality for chronic respiratory diseases in 19952002 was as expected in both genders , while in 20032009 a 10% excess was present for males . asthma mortality was not increased , but the observed number of death is small . table 3 displays the results combined for males and females , again for causes with limited epidemiological evidence of causal association with the environmental exposures in taranto npcs . the mortality from congenital anomalies showed a 17% excess in 19952002 , while in 20032009 it was below expectation . for mortality from perinatal conditions , an heterogeneous group of diseases affecting fetus or newborn spanning from pregnancy and delivery complications to digestive or hematological disorders , the excess was 21% and 47% , in the first and second periods , respectively . in the age class 014 less than 3 deaths from acute respiratory diseases and asthma were observed . some noteworthy results should be considered ( results not shown in tables ) . among males , the observed deaths were above expected in 19952002 and 20032009 for dementia ( resp . , 105 and 102 deaths ) , hypertensive diseases ( resp . , 307 and 287 deaths ) , ischemic heart diseases ( resp . , 1032 and 679 deaths ) , and cirrhosis ( resp . , 266 and 156 deaths ) . in 20032009 excesses were reported for melanoma ( 50% , 26 deaths ) , non - hodgkin lymphoma ( 34% , 45 deaths ) , and myeloid leukemia ( 35% , 37 deaths ) . time trends for mortality from all causes and selected causes among adults and overall infant mortality are presented in figures 117 and in appendix b ( see tables s2 , s3 , and s4 in supplementary material available online at http://dx.doi.org/10.1155/2013/753719 ) . since many decades , overall mortality in italy and in apulia has been declining ( resp . , 44% and 45% ) . this favorable trend was also observed in taranto npcs , where the regular fall showed a slackening in the last three - year period . since the early 90s , the sdrs observed in taranto npcs were higher than those observed in apulia , which in turn were lower than the italian ones ; in the most recent three - year period the sdr observed in taranto site was higher than that in apulia and italy ( figure 1 ) . in italy , mortality from all neoplasms has been falling throughout the study period , while in taranto npcs and in apulia , the trend has been moderately increasing for the same study period . in taranto npcs sdrs tend to be higher than in apulia , which in turn are lower than in italy ( figure 2 ) . mortality from lung cancer has been declining in italy , apulia , and taranto npcs throughout the years 19802008 ; sdrs in the study site are higher than in italy and apulia , since 19951997 , this differential shows a reduction ( figure 3 ) . mortality from circulatory diseases in italy , apulia , and taranto site decreased , and the mortality rates almost halved during the study period ; yet , in the most recent time , taranto 's mortality rates are higher than in italy ( figure 4 ) . mortality trends from ischemic heart disease have been declining in italy , apulia , and taranto site ; yet , since the end of the 1980s , taranto 's sdrs are higher than in apulia ( figure 5 ) . mortality trends from respiratory diseases ( overall , acute , and chronic ) showed a decrease in italy , apulia , and taranto . the rates in taranto site are higher than those in the italian ones over the whole study period , the exception being the last decade , when only mortality due to acute respiratory was higher in taranto ( figures 6 , 7 , and 8) . overall mortality among women in italy , apulia , and taranto site showed a long - term decreasing trend : from 1980 to 2008 the decrease was respectively 45% , 46% , and 38% ; yet , since the beginning of the 2000s , mortality rates in taranto are higher compared to those in apulia and italy ( figure 9 ) . mortality from cancer ( all sites ) has been decreasing in italy , remaining stable in apulia , and increasing in taranto site ( figure 10 ) . in contrast with the overall cancer mortality , lung cancer mortality has been rising steadily ; in the study period the increase was 59% in italy , 44% in apulia , and 78% in taranto npcs , where sdrs were higher than in apulia ( figure 11 ) . mortality from circulatory diseases showed a declining trend in italy , apulia , and taranto site ( figure 12 ) . mortality from ischemic heart disease declined as well , but the rates observed in taranto npcs were higher than in apulia and italy throughout the study period ( figure 13 ) . finally , mortality from respiratory diseases ( overall , acute , and chronic ) showed a decline in italy , apulia , and taranto site , but the rates in taranto are higher than in italy ( figures 14 , 15 , and 16 ) . the results indicate that some differential between taranto and other areas are emerging in recent years ; it may be attributed to the presence for many years of pollutants in the environment , given that no remediation has been performed in the taranto area . infant mortality showed a steady decline both in italy and apulia ; sdrs in taranto were decreasing , but they stayed higher in taranto than in apulia and italy ( table s4 and figure 17 ) . in taranto npcs ( table 4 ) excesses were observed among both males and females when using for comparison both the rates of south and islands macroarea and of the province ( taranto and statte excluded ) for all tumors and a number of tumor sites ( stomach , colon - rectum , liver , pancreas , lung , mesothelioma , skin melanoma , kidney and other unspecified genitourinary organs , and leukemia ) . among males an increase was present for prostate cancer and among females for breast cancer . for most sites , the excesses were confirmed when province rates ( taranto and statte excluded ) were used for reference , thus supporting a major health impact among residents in taranto npcs . the study area was divided into 9 districts in taranto city and 2 municipalities ( massafra and statte ) . we considered that the districts located close to the industrial zone were the most areas affected by environmental pollution , especially considering the prevailing winds from northwest . the exposed districts were ( 1 ) tamburi ( we also included in this category the small districts of isola , porta napoli , and lido azzurro ) , ( 2 ) borgo , ( 3 ) paolo vi , and ( 4 ) statte . all the other districts were considered the reference zone ( italia - montegragnano , san vito - lama - carelli , salinella , solito , corvisea , talsano , tre carrare - battisti , and massafra ) . a total of 321,356 people ( 157,031 males and 164,325 females ) were enrolled in the cohort . at the time of the enrolment ( january 1 , 1998 ) , 84.9% of the subjects were already resident in the study area , and 39.1% of them had been residing at the same address for more than 20 years . as far as socioeconomic status is concerned , 35% of the cohort members were in the low sep category and 21.4% in the high sep category . the social distribution in the different districts was heterogeneous , with elevated proportion of high social level ( 62.2% ) in some districts in the reference area ( san vito , lama , carelli ) and low social level in tamburi ( 69.4% ) and paolo vi ( 64.3% ) . in the tamburi and paolo vi districts there was a higher proportion of subjects with previous employment at the steel industry than in other areas . a total of 3,384,302 person years were accumulated for the cohort . at the end of follow - up ( december 31 , 2010 ) , 76.6% of the cohort members were alive and resident in the study area , 14.6% had moved , and 28,171 individuals ( 8.8% ) had died . only 2.3% of the study subjects were born abroad , and most of the cohort members were born in taranto ( 81.6% ) and in southern italy ( 93.5% ) . an analysis of the mortality differences by socioeconomic status ( low versus high category ) shows ( data not in tables ) in both genders a higher mortality for all causes ( hazard ratio hr 1.25 , 95% ci 1.191.31 among males and hr 1.18 , 95% ci 1.131.24 among females ) , cardiovascular diseases ( hr 1.14 , 95% ci 1.041.25 among males and hr 1.21 , 95% ci 1.111.32 among females ) , respiratory diseases ( hr 1.89 , 95% ci 1.552.29 among males and hr 1.38 , 95% ci 1.111.72 among females ) , and digestive diseases ( hr 1.46 , 95% ci 1.191.79 among males and hr 1.56 , 95% ci 1.241.95 among females ) . socioeconomic differences in mortality were observed among males for all neoplasms ( hr 1.26 , 95% ci 1.151.37 ) and cancer of the stomach ( hr 1.69 , 95% ci 1.102.59 ) , larynx ( hr 3.32 , 95% ci 1.557.09 ) , lung ( hr 1.40 , 95% ci 1.201.64 ) , and bladder ( hr 1.55 , 95% ci 1.082.23 ) . the results for hospitalizations confirm the increased risks among subjects in the low socioeconomic category when compared with those in the highest socioeconomic group . tables 5 and 6 show , respectively , for males and females , cause - specific mortality in the exposed subareas , that is , tamburi , borgo , paolo vi , and statte , compared with mortality observed in the reference ones . after adjusting for socioeconomic status , the exposed subareas ( tamburi , borgo , paolo vi , and statte ) have a higher mortality for all causes in comparison with the reference in males ( in particular , paolo vi and tamburi ) . the most notable increases in mortality among males were in paolo vi , with 42% excess for all malignant neoplasms ( especially lung cancer , + 76% ) , diseases of the cardiovascular ( + 28% ) , respiratory ( + 64% ) and digestive ( + 47% ) systems . in tamburi , an excess was observed among males for all malignant neoplasms ( + 11% ) and cardiovascular diseases ( + 10% ) , specifically ischemic heart diseases ( + 20% ) . among females , in paolo vi , excesses are present for all cancers ( + 23% ) , in particular lung , pleural and liver cancer , cardiovascular diseases ( + 18% ) , chronic obstructive pulmonary disease ( copd ) , and digestive system diseases . in tamburi , excesses were present among females for cardiovascular diseases ( + 15% ) , in particular ischemic heart diseases , copd ( + 39% ) , and renal diseases ( + 57% ) . the hospitalization analysis confirms the mortality results , documenting the major health impact on residents in tamburi and paolo vi areas , where excesses were observed among males for a number of causes such as lung cancer ( 29% and 61% in tamburi and paolo vi , resp . ) , neurological ( 26% and 43% in tamburi and paolo vi , resp . ) , cardiovascular ( 18% and 32% in tamburi and paolo vi , resp . ) , respiratory ( 36% and 52% in tamburi and paolo vi , resp . ) , and renal diseases ( 35% both in tamburi and paolo vi ) . among females , similar excesses were observed for cardiovascular diseases ( 15 and 31% in tamburi and paolo vi , resp . ) , respiratory diseases ( 28% and 39% in tamburi and paolo vi , resp . ) , digestive diseases ( 18% and 25% in tamburi and paolo vi , resp . ) , and renal diseases ( 47% and 35% among males in tamburi and paolo vi , resp . ) . in paolo vi , pleural ( 235% ) and breast cancer ( 33% ) the health impact of residence in taranto npcs was investigated using different epidemiological approaches : geographical ( mortality and cancer incidence at municipality level ) , historical ( mortality time trends at municipality level ) , and residential cohort studies ( mortality and hospital discharge records at individual level ) . we adopted an analysis at small - area scale which includes a mix of small area and individual based data . the design issues relevant to this type of investigation have been thoroughly examined by elliott and savitz , some of them are briefly examined in the following paragraphs . in environmental epidemiology , exposure ascertainment is a key phase because the exposure / s affecting the study population should ideally be described in detail , while in most instances the available exposure information is indirect and qualitative . in ecological investigations , the exposure / s can be a single event from a point emission source of some contaminants ; more often the contaminants are heterogeneous mixture progressively polluting different matrices in the area . for example , in sentieri project the sources of environmental exposures were abstracted from the legislative decrees defining sites ' boundaries and fixed on the basis of the possible sources of contamination ( e.g. , chemical industry , steel plants , and landfills ) . a further limitation lies in the implicit assumption that all residents in the area under investigation experience the same exposures , while exposure variability is likely to be substantial , due to many factors ( e.g. , concentration of contaminants and their diffusion to soil and water , distance of residence from polluting sources ) . the possible consequences of such nondifferential exposure misclassification are complex , and the direction of the resulting bias is not predictable . in addition , information exposure source / s with possible health impact , such as concurrent air pollution from road traffic and exposures in the occupational setting , are often not available . finally , vital statistics are accessible for a given administrative area whose boundaries hardly correspond to the distribution of environmental pollutants , so that the misclassification of exposure ( and loss of statistical power ) is common . a more detailed description of these limitations of ecological study design is available [ 15 , 28 , 29 ] . exposure ascertainment is a critical issue in ecological investigations as well as in studies based on individuals , as cohort of residents are . in this case residential history , overtime information on exposure / s in different residences and different environmental matrices , daily variability , and seasonal variability should be available to classify subjects in different exposure categories . obtaining individual - based measures of exposure as described above is clearly infeasible , and modeling of exposures , ranging from simple measures such as distance from a point source or distance to nearest road to more complex estimation , for example , dispersion modeling around a point source , is used . the possible exposure misclassification in such approaches has been discussed in . as far as outcome measures are concerned , many studies of environmental healthin polluted areas consider mortality , based on death records . however , the analysis of hospital discharge records , ad hoc registry data of specific pathologies ( e.g. , cancer , congenital malformations ) can give a better picture of the health profile of residents in npcss . the key issue is that , whatever the outcome under investigation , databases need to be validated for use in epidemiological studies . reporting the event of death is usually exhaustive ; therefore the overall mortality can be analyzed with confidence . in italy , validity of cause of death certification has been documented for specific diseases [ 3134 ] . the validity of hospital discharge records ( hdrs ) , indicators of hospital activity , has not been systematically evaluated , although in italy some critical aspects of this novel utilization of hdrs have been examined . another crucial aspect in environmental health studies is that factors such as socioeconomic status , occupational exposures / s , and individual lifestyles can have an etiologic role on the health effects under study thus possibly confounding the exposure - disease relationships . for a review of adjustment for socioeconomic status using census data in ecological studies of environment and health refer to pasetto et al , 2010 . to account for deprivation in sentieri project , mortality data both crude and adjusted were analyzed using an ad hoc built deprivation index . also in individual - based studies , the analyses can be adjusted for socioeconomic factors , usually with an aggregate indicator based on residence address . in the present cohort of residents in taranto npcs sep was assigned to each participant on the basis of the geocoded addresses at the beginning of the follow - up . . the ecological components of the present investigation are affected by this limitation , while for the cohort study individual occupational history was traced through the national insurance company ( inps ) database , and the subcohort of individuals employed in industries located in the area was identified indicating a high proportion of past employment at the steel plant among residents in tamburi and paolo vi . again on this topic , with specific reference to pleural mesothelioma , it should be noted that the italian national mesothelioma registry analysis of residential asbestos exposure showed that steel mills and iron foundries were the second most frequent sources of asbestos in the neighborhood ( after asbestos - cement factories ) , ranking equal to asbestos textiles production . furthermore a case - control study in the area of taranto ( hdr , 19982002 ) adjusted for occupational exposures , showed an increase in malignant pleural neoplasms among residents close to the steel mill ( or 1.62 , 95% ci 0.377.10 , 11 cases ) and the coke plant ( or 2.18 , 95% ci 0.3115.31 , 9 cases ) . another aspect to consider in environmental epidemiology is that large populations are needed to study many of the health concerns of greatest interest . in ecological investigations , the reference populations should be selected balancing the need for comparability of study and reference populations for factors other than the environmental exposure / s with possible health impact ( socioeconomic status and lifestyle factors as diet and tobacco use ) and the requirement of sufficiently numerous populations to have stable reference rates also for rare diseases . these needs are satisfied in the present investigation where national , macroregional , and regional populations were used for comparison in the mortality , time trend , and cancer incidence analysis . in the cohort study an internal comparison was carried out , and the reference population was composed of residents in districts distant from the industrial area . for chronic diseases including most cancers , latency effects are important , such that exposures experienced many years previously , or accumulated exposures , may be crucial . in taranto npcs , the mortality ( 19952009 ) and the time trends analyses ( 19802008 ) show consistent results and cover a time span which should encompass latency effects . analogously in the cohort of residents , most subjects were present at enrolment in 1998 ( 85% ) , and half of them had a residence duration of 10 or more years . a brief comment on the use of 90% ci in our analyses is needed . in this respect we refer to sterne and smith , who affirm that confidence intervals for the main results should always be included , but 90% rather than 95% levels should be used . ci should not be used as a surrogate means of examining significance at the conventional 5% level . interpretation of ci should focus on the implications ( clinical importance ) of the range of values in the interval . in taranto npcs , mortality data at municipality level analyzed , in the context of sentieri project , time trend analysis and cancer incidence results coherently showed , in both genders , excess risks for a number of causes of death , among them : all causes , all cancers , lung cancer , cardiovascular , and respiratory diseases , both acute and chronic . for these causes , an etiologic role of environmental exposure present in taranto npcs can be supported on the basis of a priori evaluation of the epidemiological evidence completed in sentieri . in the cohort study among residents in the districts nearer to the industrial area , excess mortality / morbidity risks were shown for natural cause , cancers , cardiovascular , and respiratory diseases . these excesses were also observed in low socioeconomic position groups compared to high ones , some of them could be explained on the basis of previous employment of residents in industries active in the study area . as discussed above the present results for taranto npcs are based on sound study design and valid data , which make a low potential for bias and help to strengthen etiologic inference . it should not be disregarded the fact that most diseases showing an increased risk have multifactorial etiology , therefore interventions of proven efficacy , such as smoking cessation , food education , measures for cardiovascular risk reduction , and breast cancer screening programs , should be planned . to build a climate of confidence and trust between citizens and public institutions , study results and public health actions are to be communicated objectively and transparently .

the national environmental remediation programme in italy includes sites with documented contamination and associated potential health impacts ( national priority contaminated sites npcss ) . sentieri project , an extensive investigation of mortality in 44 npcss , considered the area of taranto , a npcs where a number of polluting sources are present . health indicators available at municipality level were analyzed , that is , mortality ( 20032009 ) , mortality time trend ( 19802008 ) , and cancer incidence ( 2006 - 2007 ) . in addition , the cohort of individuals living in the area was followed up to evaluate mortality ( 19982008 ) and morbidity ( 19982010 ) by district of residence . the results of the study consistently showed excess risks for a number of causes of death in both genders , among them : all causes , all cancers , lung cancer , and cardiovascular and respiratory diseases , both acute and chronic . an increased infant mortality was also observed from the time trends analysis . mortality / morbidity excesses were detected in residents living in districts near the industrial area , for several disorders including cancer , cardiovascular , and respiratory diseases . these coherent findings from different epidemiological approaches corroborate the need to promptly proceed with environmental cleanup interventions . most diseases showing an increase in taranto npcs have a multifactorial etiology , and preventive measures of proven efficacy ( e.g. , smoking cessation and cardiovascular risk reduction programs , breast cancer screening ) should be planned . the study results and public health actions are to be communicated objectively and transparently so that a climate of confidence and trust between citizens and public institutions is maintained .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

simultaneous bipolar dislocation of the clavicle is uncommon and unusual , although it has been documented as panclavicular dislocation , floating clavicle , and complete dislocation of the clavicle . a review of the recent literature indicated that most bipolar clavicular dislocations have been treated non - operatively . we report the case of a 23 year polytrauma patient with bipolar dislocation of the right clavicle . patient presented to us 2 weeks post injury and had an unstable corao - clavicular joint . on radiographic assessment a simultaneous dislocation of the coraco - clavicular and sterno - clavicular joints of right side was diagnosed . in view of the unstable condition of the right clavicle , young age of the patient , requirement of high physical activity a decision for operative treatment for clavicle dislocation although bipolar dislocation of the clavicle are rare a high index of suspicion will avoid missed diagnosis . open reduction and internal fixation is a good option in young patients and gives good short term result . simultaneous bipolar dislocation of the clavicle is uncommon and unusual , although it has been documented as panclavicular dislocation , floating clavicle , and complete dislocation of the clavicle [ 1 - 13 ] . porral reported the first case of a dislocation of both ends of the clavicle in 1831 . a review of the recent literature indicated that most bipolar clavicular dislocations have been treated non - operatively . we report the case of a 23 year old polytrauma patient with bipolar dislocation of the right clavicle treated surgically . he sustained contusion of both lungs , multiple fractures of the 1st to 6th ribs left hand , and of the 3rd to 6th ribs right hand , fracture of the transverse processus of the 1st and of the 8th to 10th dorsal vertebrae , a fracture of the sacrum left hand , and a bipolar dislocation of the right clavicle . first aid was performed at a primary center and patient was transferred to our hospital after 2 weeks . the anteriorly dislocated sternoclavicular joint could be reduced passively , but was unstable , and the protruding anterior deformity quickly recurred . on physical examination the lateral end of the clavicle was tender and was palpable in a posteriorly displaced position . on the radiograph of the right shoulder and of the thorax a type four dislocation of the right acromioclavicular joint according to rockwood and an anterior dislocation of the right sternoclavicular joint fractures of the spine and the sacrum were treaded conservatively , the patient was mobilized using analgesics and physiotherapy . in view of the unstable condition of the right clavicle , young age of the patient , requirement of high physical activity a decision for operative treatment for clavicle dislocation was taken . at 3 weeks after the accident , open reduction of both the acromioclavicular and the sternoclavicular joint and internal fixation by cerclage wires was performed ( fig.2 ) . 18 months after injury , the patient was referred to the senior one of us ( t.s . ) for evaluation . the patient had no complaints of pain or discomfort and both shoulders had a full range of motion . the patient could perform all activities of daily living and had returned to his former work . a - anteroposterior view of the right shoulder shows a dislocation of the acromioclavicular joint . b- anteroposterior view of both sternoclvicular joints shows a widening of the joint space of the right sternoclavicular joint . c - ct scan of the thorax and both sternoclavicular joints confirms widening of the joint space of the right sternoclavicular joint . simultaneous bipolar dislocation of the clavicle is uncommon and unusual [ 1 - 13 ] . the predominant mechanism of injury causing acromioclavicular separation is a downward blow to the acromion , which tears the coracoclavicular and acromioclavicular ligaments and leads to a superior displacement of the distal pole of the clavicle . the least common mechanism is a direct blow on the anterior aspect of the medial end of the clavicle , causing it to dislocate posterior to the manubrium . a medially directed force on the lateral aspect of the shoulder can result in the more common anterior or superior dislocation of the medial end of the clavicle . however , the treatment of an isolated dislocation of the acromioclavicubar or sternoclavicular joint is still controversial . slings , braces , shoulder spicas , and ligament repair or reconstruction , as well as internal fixation . because of the rarity of simultaneous dislocation of both poles of the clavicle , little is known about the treatment of this injury . a review of the recent literature indicated that most bipolar clavicular dislocations have been treated non - operatively . gearen et al . treated bipolar clavicular dislocation in a young patient with a shoulder - spica cast in order to maintain the reduction of the clavicle at the acromioclavicular joint that had been obtained by manipulation . cook and horowitz reported the case of a patient who had a bipolar clavicular dislocation with a grade ii acromioclavicular separation whom they treated non - operatively with closed reduction . several days after treatment , the clavicle redislocated , but this went unreported . at follow - up beckman reviewed 16 cases of patients who had biterminal dislocation of the clavicle that was treated by closed manipulation . ten patient 's obtained a good functional result . in one shoulder that could not be manipulated because of the patient s poor general condition , symptoms involving the brachial plexus developed ; a total claviculectomy provided a good functional result . the reasons for the remaining poor results were not stated . the acromioclavicular joint has been well described . the conoid ligament medially and the trapezoid laterally connect the clavicle to the coracoid process and are strong stabilizers of the acromioclavicuhar joint . a posterior dislocation of the acromioclavicular joint can be detected clinically by palpation of the end of the clavicle posterior to the acromion and within the substance of the trapezius . the displacement ( that is , the widening of the acromioclavicular joint space ) may be seen on an anteroposterior radiograph like in our case . an axillary lateral radiograph or a computed ct scan can confirm the diagnosis by showing the posterior displacement of the clavicle from the acromion . the sternoclavicular joint connects the large medial end of the clavicle with a small sternal site of articulation . the joint is stabilized by a dense fibrocartilaginous disc , as well as by the rhomboid ligament between the clavicle and the first rib , the capsular ligaments anteriorly and posteriorly between the clavicle and the manubrium , and the interclavicuhar ligament superiorly . the injuries may be classified as type i- sprain with ligaments intact and no instability , type ii - persistent subluxation , and type iii- dislocation with gross disruption of the ligament [ 12 , 15 ) . in the current case a 23 year old polytrauma patient suffered biterminal dislocation of the right clavicle . the sternoclavicular joint showed an anterior dislocation , the acromioclavicular joint showed a grade iv dislocation according to rockwood . in our case there were several additional injuries especially serial fractures of the ribs . in respect to the young age of the patient with high physical demands and the polytrauama condition we performed open reduction of both joints with internal stabilization . review of the literature did not show satisfying results with conservative treatment of this rare injury and we believe conservative treatment should be reserved for elderly and multimorbid patients . a - postoperative radiograph of the right coraco - clavicular joint shows stabilization with a k - wire and cerclage wire . bipolar clavicular dislocations are rare and a high index of suspicion should be excercised in polytrauma patients with unipolar clavicle dislocations to avoid missed diagnosis . although a conservative treatment is reported we believe operative treatment should be offered to young patients especially in cases with high physical demands .

introduction : simultaneous bipolar dislocation of the clavicle is uncommon and unusual , although it has been documented as panclavicular dislocation , floating clavicle , and complete dislocation of the clavicle . a review of the recent literature indicated that most bipolar clavicular dislocations have been treated non-operatively.case report : we report the case of a 23 year polytrauma patient with bipolar dislocation of the right clavicle . patient presented to us 2 weeks post injury and had an unstable corao - clavicular joint . on radiographic assessment a simultaneous dislocation of the coraco - clavicular and sterno - clavicular joints of right side was diagnosed . in view of the unstable condition of the right clavicle , young age of the patient , requirement of high physical activity a decision for operative treatment for clavicle dislocation was taken . patient was treated surgically with open reduction and tension band wiring with good result.conclusion:although bipolar dislocation of the clavicle are rare a high index of suspicion will avoid missed diagnosis . open reduction and internal fixation is a good option in young patients and gives good short term result .

Introduction: Case Report: Conclusion: Introduction Case Report Discussion Conclusion

neural stem cells ( nscs ) are multipotent cells that can give rise to various cell types in the central nervous system ( cns ) , including neurons , astrocytes , and oligodendrocytes ( alvarez - buylla et al . , 2002 ) . in adult mammals , neurogenesis is limited to two brain regions ; the subventricular zone ( svz ) by the lateral ventricles and the subgranular zone ( sgz ) of the dentate gyrus in the hippocampus ( reviewed in zhao et al . , 2008 ) . nscs in the svz , so called type - b cells , are of astrocytic lineage and generate transient amplifying type - c cells . neuroblasts then migrate along a defined pathway , the rostral migratory stream , to mature and form interneurons in the olfactory bulb ( doetsch et al . , 1999 ) . they generate type 2 intermediate proliferating progenitors that subsequently give rise to type 3 neuroblasts migrating into the subgranular layer , to become mature functional glutamatergic granule neurons ( kempermann et al . , 2004 ) . although the functional role of adult neurogenesis still is debated , it is undoubtedly a complex and highly regulated process . recently , micrornas ( mirnas ) have been suggested as players of neurogenesis , controlling expression of key regulatory genes ( gao , 2010 ; shi et al . , 2010 ; luikart et al . , 2011 ) . mirnas are one of the central determinants of mrna abundance , functioning as standby mediators of mrna regulation . they are small ( 2123 nucleotides long ) , non - coding endogenously expressed rna that bind to complementary mrna targets , resulting in a decrease in target mrna activity ( bartel , 2009 ) . since the discovery of the first mirna in 1993 , they have been identified in animals , plants , and viruses and more than 1000 mirna sequences have so far been found in humans ( www.mirbase.org ) . many are conserved across species . some have a general expression pattern , others are specifically expressed in certain tissues or cell types and expression can be spatially and temporally restricted . several labs have utilized conditional deletion of dicer , a key enzyme in mirna biogenesis , as a tool to study the role of mirnas in neurogenesis . disruption of the function of dicer during brain development results in gross anatomical changes and in some cases it is embryonic lethal ( giraldez et al . , 2005 ; davis et al . , 2008 ; de pietri tonelli et al . , nscs can be cultured in the absence of dicer but are unable to generate neurons or astrocytes upon differentiation ( andersson et al . , 2010 ) . although , dicer knockout ( ko ) studies indicate that mirnas are important regulators of neurogenesis and nsc self - renewal , they are difficult to interpret . not only because the simultaneous deficiency of all mirnas , but the long half - life of mature mirna makes conditional dicer ko experiments difficult to control from a temporal aspect , moreover there are concerns that non - mirna related functions of dicer contribute to the observed phenotypes ( konopka et al . . for example , when dicer was conditionally deleted in the retinal pigmented epithelium , cell death occurred via a mechanism that is independent on mirna , rather depending on the accumulation of retrotransposon transcripts ( kaneko et al . , 2011 ) . with this in mind , studies of the functional role of individual mirnas are a necessity . in 2007 there were four simultaneous reports of mirna ko mice ( rodriguez et al . , 2007 ; thai et al . , 2007 ; van rooij et al . , 2007 ; zhao et al . , 2007 ) , which enabled loss - of - function studies of specific mirnas . however , for several mirna , including many of those involved in neurogenesis , a classic ko strategy is complicated to apply due to single mirna species being located in multiple copies in separate regions of the genome , in clusters or located within other genes . one example of such a mirna family is mir-124 , which is transcribed as three different primary transcripts from three independent loci . mir-124 - 1 , mir-124 - 2 , and mir-124 - 3 all produce the same mature mirna ( griffiths - jones , 2006 ) . another example is mir-9 which is expressed from three independent loci , mir-9 - 1 , mir-9 - 2 , and mir-9 - 3 . the mature sequence is identical , and conserved in vertebrates and mammals . with let-7 the situation is even more complex with 12 human let-7 genes encoding for nine distinct , but closely related , mature forms of the mirna ( griffiths - jones , 2006 ) . recently , a ko mouse for mir-124 - 1 was described showing that reduction of mir-124 has severe consequences for neuronal survival and axonal outgrowth ( sanuki et al . , 2011 ) . while this study demonstrates the importance of mir-124 , it also highlights the problems of using a classic ko strategy . ( 2011 ) that compensation of mir-124 - 2 and mir-124 - 3 influence the phenotype of the mir-124 - 1 ko mouse . likewise , a ko mice that have two of the three copies of mir-9 deleted has been reported ( shibata et al . , these two reports suggest that conditional deletion of all three copies of either mir-9 or mir-124 is necessary in order to fully understand the role of these mirnas in adult neurogenesis . although challenging and time consuming , such a strategy may be feasible for mir-9 and mir-124 . however , for let-7 such a strategy appears unlikely to be successful given the large size of the let-7-family . adding to this , in situ analysis of the expression profile of individual mirna is difficult due to the small size of the mature mirna , which leads to poor resolution obtained in the brain with current histological techniques . as such , the study of the functional role of individual mirnas in vivo is complicated and makes interpretation and comparison between different studies challenging . we describe the current status of the field , existing attempts to study loss of mirna function , and point out technical limitations that need to be circumvented in order to move the field forward . it is fairly straightforward to profile mirna - expression patterns from bulk rna samples , either at single species resolution using for example northern blot or pcr - techniques , or at a global level using mirna arrays , pcr - array , deep sequencing of small rnas or other more specialized platforms . these methods all have their innate differences and parallel analysis of the same samples using different techniques may give significantly different results ( see , e.g. , hebert and nelson , 2011 for a discussion on this matter ) . since there is currently no gold standard for transcriptional profiling of mirna , the use of independent techniques to verify results is therefore necessary . nevertheless , these approaches have revealed the complexity of mirna - expression patterns among different cell types and have allowed identification of a number of candidate mirnas that appear to be enriched in cultured nscs . however , the technical difficulties of purifying populations of nscs and progenitors from in vivo material , using for example fluorescence activated cell sorting , make these approaches problematic to transfer to the in vivo setting ( see table 1 ) . histological approaches to study mirna expression in brain tissue have to a great extent relied on in situ hybridization ( ish ) techniques . due to the small size of the mirna it is not possible to use standard ish protocols ; an additional fixation step of the mirna is needed and probe hybridization must be optimal ( pena et al . , 2009 ) . locked nucleic acid ( lna ) modified oligonucleotides is preferable to use , since the melting temperature of the lna probe / mirna duplex is increased , resulting in stringent hybridization conditions , which in turn increases specificity and sensitivity ( reviewed in obernosterer et al . , 2007 ; wheeler et al . , 2007 ) . to do so , additional probes that target all the various precursor transcripts need to be used ( obernosterer et al . , however , this can be technically challenging when analyzing mirnas with multiple precursor transcripts ( such as mir-9 or mir-124 ) . furthermore , the results from this method are of limited resolution , thereby making it difficult to distinguish between two adjacent cells . in addition , ish is also problematic to use in combination with other labeling techniques that are routinely used in nsc - research . we have in our lab not been able to adopt protocols that allow the use of mirna ish in combination with , for example brdu - labeling , which is widely used in this field . this is primarily due to the stringent treatment of the tissue that is necessary for ish , which is incompatible with the tissue treatments for brdu - labeling . the problem of in situ mirna - expression analysis is a major concern for the study of mirna in the nervous system where it is essential to understand the cellular localization with regards to functionality . more recently , mirna reporter or sensor vectors have been used to visualize the expression pattern of endogenous mirna in cells . these are gene transfer vectors that contain a reporter gene ( i.e. , gfp ) along with binding sites for specific mirna ( mansfield et al . . in the case that a cell is actively expressing the specific mirna , the expression of the reporter gene will be suppressed by the binding of the mirna to the complimentary binding sites . thus , this system reports the absence of the target mirna , and cells that do not express it will be gfp - positive . this technique is highly specific , simple , and robust and makes it possible to study mirna expression as cells differentiate . injection of a mir-124 reporter vector into the brain will separate reporter gene expression between different cell types such as neurons and astrocytes ( colin et al . , 2009 ) . the system has been used to segregate differentiated neural cells in pluripotent cell cultures , based on the expression of mir-292 that is expressed in embryonic stem cells but not in nscs ( sachdeva et al . , 2010 ) , as well as the opposite where a mirna let-7a reporter was used to select undifferentiated cells from more differentiated cells ( di stefano et al . , 2011 ) . in nscs in vivo , sensor vectors have been used to track the expression of mir-132 in the dg ( luikart et al . the use of sensor vectors has the advantage that they measure the activity of the mirna rather than expression per se allowing easy determination if the mature mirna is present . also , the use of a fluorescent reporter gene allows excellent morphological analysis of cells in vivo . still , the technique is time - consuming including the generation of viral vectors followed by experimentation in cell culture or in vivo models . however , the versatility of the technique opens up the possibility of generating transgenic reporter animals , making it possible to visualize the expression pattern of a specific mirna throughout an organism over time ( see , e.g. , gentner et al . , 2010 ) . although this approach remains to be tested in the cns , it may be an attractive alternative in order to achieve sensitive , high - quality expression analysis of mirnas in vivo . as mentioned above , generation of ko mice for individual mirnas is often complicated since many mirnas are present in several copies or in clusters while some are present within introns of genes . to circumvent this issue several knockdown or inhibition approaches an early approach to analyze specific mirnas was by using anti - mirna oligonucleotide ( amo ) which are nucleic acids that are antisense to the mirna , thus hindering the interaction between the mirna and target mrna . this technique was first used to inactivate mir-2 and mir-13 in drosophila , in the search for mirna - target genes ( boutla et al . , 2003 ) . it was soon found that unmodified oligonucleotides are ineffective since the cellular machinery degrades them . 2-o - methyl amo is a simple chemical modification where the methyl group reduces the chances of endonucleolytic cleavage , and improves binding affinity to the mirna ( weiler et al . , 2006 ) . another variant is 2-o - methoxyethyl amo , which are fully modified oligonucleotides , with higher affinity and specificity than 2-o - methyl amo variants ( davis et al . , 2006 ; esau et al . , recently , lna ( locked nucleic acid ) modified oligonucleotides allow for even further stabilization of the mirna / target duplex structure improving silencing and also making it possible to the use small oligonucleotides that enables targeting of entire mirna - families ( vester and wengel , 2004 ; obad et al . , 2011 ) . anti - mirna oligonucleotide targets single mirnas with high specificity , as they are completely complementary to the mature sequence of the mirna ( boutla et al . , 2003 ) . despite the successful knockdown of mirna in vitro and in vivo using this method , it has several limitations . first , a direct measurement of the down regulation of mirna is difficult , because amo binds to the mirna and sequesters it from its target rather than inducing its degradation ( krutzfeldt et al . , 2005 ; davis et al . , 2009 ) . therefore the only possible way to confirm the decrease of mirna is to use indirect methods , whereby one can measure the level of expression of a reporter gene containing a target sequence of the mirna or analyzing upregulation of endogenous target genes . secondly it is not possible to identify the cells in which the amos are active as they do not carry a reporter . on top of that , the level of amo should preferably be kept constant to allow a continuous sequestration of the mirna . oligonucleotide antagomirs are chemically modified ; cholesterol conjugated single stranded rna analogs complementary to a target mirna ( krutzfeldt et al . , 2005 ) . the modification includes a partial phosphorothioate backbone in addition to 2-o - methoxyethyl to inhibit ago-2-mediated cleavage . in vivo , antagomirs have been given through intravenous injection where they appear to efficiently target mirna in various tissues . however , antagomirs do not cross the blood brain barrier , which means that in the brain , antagomirs have the same limitations as amos have . microrna sponges are transcripts expressed from strong promoters , containing multiple , tandem binding sites to a selected member of the mirna seed family of interest ( ebert et al . , 2007 ) . the binding site is imperfect , containing a bulge , for preventing rna interference cleavage and degradation of the sponge rna through endonucleolytic cleavage by ago-2 . the main advantage of mirna sponges is the possibility to achieve stable expression from integrated transgenes in vivo ( gentner et al . , 2009 ) . this can be used for studying long - term effects of mirna loss - of - function and also allows for stably expressing cell lines to be generated . the use of vector - mediated delivery also enables the incorporation of a reporter gene in order to identify the modified cells . another advantage is that sponges complementarily bind to the seed sequence of the mirna , which means that one sponge can target an entire family of mirnas . in summary , these features make sponge vectors an attractive approach to study mirna function in vivo in nscs . recently ; this technology was employed to demonstrate that mir-132 affects the integration of new - born neurons in the adult hippocampus ( luikart et al . , 2011 ) . a previous report used a retrovirus expressing the cre - recombinase to delete a floxed mir-132 gene allowing a side - by - side comparison of sponge vs. conditional ko ( magill et al . , 2010 ; luikart et al . , 2011 ) . the sponge recapitulates some , but not all , defects detected following a complete deletion of mir-132 suggesting that the use of a sponge reduces rather than eliminates levels of mir-132 ( magill et al . , 2010 ; luikart et al . , 2011 ) . as with the use of amos , the sponge vectors also have other limitations , including the difficulty of validating the down regulation of a specific mirna and the only possible way to confirm the decrease of mirna is to use indirect methods as described above . taken together , it is evident that is technically challenging to perform loss - of - function studies of mirnas in vivo in nscs . the problem of validating the inhibition , the use of transient systems together with the appearance of potential off - target effects makes the interpretation of several studies challenging . an example of this are two studies performed in the developing chick , one report suggested that mir-124 plays no role in neurogenesis while another found that mir-124 modestly promotes neurogenesis ( cao et al . , 2007 ; visvanathan et al . , 2007 ) . direct delivery of mirna - duplexes or the use of various plasmid based approaches and viral vectors have been effectively used to overexpress mirna . there are several relatively simple designs of vectors enabling stable expression that all appear to work efficiently ( krutzfeldt et al . , 2006 ; the statement that gain of function studies are easier to perform than loss of function studies is reflected in the literature and a great extent of the insight gained in the mirna field is from overexpression studies . in the last part of this review we discuss in detail three mirnas that have been functionally implicated in neurogenesis ; mir-9 , mir-124 , and the let-7 family . we give an overview of the current understanding of how these mirnas influence neurogenesis and also highlight the technical shortcomings that still prevent a full understanding of the role of these mirnas in vivo . in addition to the three above - mentioned mirna , there is a growing literature of other mirnas , including for example mir-125b , mir-132 , mir-137 , and mir-184 that influence neurogenesis ( le et al . , 2009 ; liu et al . , 2010 ; magill et al . , 2010 ; szulwach et al . , 2010 ; luikart et al . , 2011 ; sun et al . , 2011 ) . several of the technical problems that limit our understanding of mir-9 , mir-124 , and the let-7 family also hold true for other mirnas . mir-124 is perhaps the best characterized brain - specific mirna , and accounts for 2548% of all brain mirna ( lagos - quintana et al . , 2002 ) . mir-124 is expressed in neurons and have been proposed to suppress non - neural transcripts to promote neural identity ( visvanathan et al . , 2007 ; de pietri tonelli et al . , 2008 ; maiorano and mallamaci , 2009 ; farrell et al . , 2011 ; liu et al . , 2011a ; yoo et al . , 2011 ) several studies suggest that mir-124 is not expressed in other cells of the cns such as astrocytes ( see , e.g. , smirnova et al . , 2005 ) while ponomarev et al . ( 2010 ) also found it to be expressed in microglia and downregulated in activated microglia , being a key regulator of microglia quiescence . mir-124 is not expressed in nscs but is suggested to regulate the temporal progression of neurogenesis in svz . it is upregulated in the transition between type - c and type - a cells and further upregulated as the neuroblasts exit the cell cycle ( cheng et al . , 2009 ) . delivery of mir-124 to mouse or human cells in vitro causes the global expression profile of mrna to shift toward that of the brain . ( 2008 ) used a dna plasmid with primary mir-124 transcript whereas yoo et al . ( 2011 ) delivered mir-124 with a lentiviral vector harboring a mir-124 precursor , all resulting in promoting a neural phenotype . in addition , transfection of mir-124 duplexes into glioblastoma cells inhibits proliferation and induces differentiation ( silber et al . , 2008 ) . in vitro loss of function , by using antisense 2-o - methyl amo , results in delayed neurite outgrowth ( yu et al . , 2008 ) and upregulation of non - neural transcripts ( conaco et al . , 2006 ) . blocking mir-124 in svz cell populations in vivo by delivering antisense 2-o - methyl amo by a micro - osmotic pump into the ventricle , maintains neural progenitors as dividing precursors ( cheng et al . , 2009 ) . on the contrary , injecting a retrovirus overexpressing mir-124 into the svz promotes precocious neural maturation ( cheng et al . , 2009 ) . although mir-124 has been reported to be an important regulator of neurogenesis both in the developing and the adult brain , contradictory findings have been published suggesting mir-124 to be less important for neurogenesis in the developing spinal cord ( cao et al . based on in vitro mir-124 suppression or overexpression experiments , numerous mir-124 target genes have been found and validated . mir-124 has been shown to suppress several components of the re1 silencing transcription factor ( rest ) pathway ( conaco et al . , 2006 ; rest is a master regulator of neuronal phenotype ( lunyak and rosenfeld , 2005 ) and together with co - repressors it recruits histone deacetylases to suppress non - neural genes . mir-124 and rest act reciprocally ; mir-124 represses rest in neurons to promote expression of neural genes , whereas rest downregulates mir-124 in non - neural cells to inhibit expression of neural genes ( conaco et al . , 2006 ) . another mir-124 target is ptbp1 ( makeyev et al . , 2007 ) , a repressor of alternative splicing in non - neural cells demonstrating that mir-124 promotes a neuronal transcriptome by altering splicing . these targets suggest that mir-124 expression maintains a neuronal transcriptome by repressing non - neuronal genes at several levels . other targets include jagged1 in the notch signaling pathway ( cheng et al . , 2009 ; liu et al . , these targets suggest that mir-124 also plays a role in regulating the exit of a self - renewing state of nsc . however , these are only a few examples since computational algorithms suggest more than 1000 mir-124 targets ( griffiths - jones , 2006 ) . the large number of mir-124 target genes together with the observation that overexpression of mir-124 can induce a neuronal gene program suggest that mir-124 plays a crucial role in establishing and maintaining a neuronal transcription network . in light of this , it is surprising that the in vivo phenotypes found when blocking mir-124 using antisense technology is subtle , characterized mainly by a delay in differentiation or without detectable malformations ( cao et al . , 2007 ; however , a recent report using a classic ko strategy shows that deletion of mir-124 - 1 leads to major developmental phenotypes including small brain size , defective axonal outgrowth , and cell death confirming a crucial role for mir-124 in neurogenesis ( sanuki et al . , 2011 ) . as mentioned above , it is clear that compensation of mir-124 - 2 and mir-124 - 3 influence the phenotype of the mir-124-ko mouse , which highlights the need for generation of a conditional triple - mir-124-ko mouse . although this will be challenging and time consuming , such a strategy is necessary in order to understand the role of mir-124 during brain development and will assist the understanding of mir-124 in adult neurogenesis . however , since the use of retroviral or lentiviral vectors allow targeting of nscs in vivo , the application of stable inhibition vectors using for example mirna sponges to reassess the role of mir-124 in adult nscs is an interesting alternative . another well - studied brain - specific mirna involved in neurogenesis is mir-9 that is expressed in nscs and upregulated upon neural differentiation ( krichevsky et al . , 2006 ; de pietri tonelli et al . , 2008 ; zhao et al . , 2008 ; laneve et al . , 2010 ; bonev et al . , 2011 ; shibata et al . , 2011 ; initial studies , done in zebrafish , showed that mir-9 directs late organizer activity of the midbrain hindbrain boundary ( mhb ; leucht et al . , 2008 ) . the mhb is an organizing center in the vertebrate neural tube essential for proper development of the midbrain and anterior hindbrain ( wurst and bally - cuif , 2001 ) . in human cells , mir-9 was found to have an important role in migration and proliferation of nscs . knockdown experiments in neurospheres , using an lna antisense probe , led to reduced proliferation , and an increased migration ( delaloy et al . , 2010 ) . in contrast , zhao et al . found reduced proliferation accompanied with increased differentiation of mouse nscs when overexpressing mir-9 by rna duplexes . when they knocked down mir-9 with 2-o - methyl amo , proliferation increased ( zhao et al . , 2009 ) . in mouse , mir-9 has been shown to have a regional diversity along the anterior / posterior - axis ; knockdown in hindbrain leads to a failure of cell cycle , promoting proliferation of neural progenitor cells , whereas cells lacking mir-9 in the forebrain undergo p53-dependent apoptosis ( bonev et al . , , mir-9 has reciprocal actions with rest ; rest inhibits mir-9 - 2 in undifferentiated neuroblastoma cells , rest and creb inactivation triggers mir-9 - 2 activation ( laneve et al . , 2010 ) . other mir-9 targets include stathmin that increases microtubule instability ( delaloy et al . , 2010 ) and tlx that regulate stem cell fate ( zhao et al . , 2009 ) . tlx is suppressed by mir-9 to negatively regulate stem cell proliferation and accelerate neural differentiation ( zhao et al . , 2009 ) . hairy1 has also been suggested to mediate the effects of mir-9 on proliferation ( bonev et al . , 2011 ) . mir-9 expression pattern during mouse development has been investigated by ish ; it is expressed in the developing medial pallium although it is most abundant in cortex . when a mir-9 amo was electroporated into e11.5 cerebral cortex , deficiencies in differentiation of cajal retzius cells and early born neurons were seen , suggested to be due to the increased expression of the target gene foxg1 ( shibata et al . , 2008 ) . generation of a mir-9 - 2 and mir-9 - 3 double ko mouse , that is the two most abundant forms during telencephalon development , resulted in major phenotypic brain defects . cortical layers and vz were reduced , lateral ventricles expanded , the proliferative zones hyperplasic and differentiated structures reduced . in addition , mice suffered from growth retardation and died within 1 week , demonstrating the importance for mir-9 in neurogenesis ( shibata et al . , 2011 ) . these reports clearly demonstrate that mir-9 influence nscs , perhaps by regulating self - renewal and migration . still , much remains unclear regarding the functional role of mir-9 in nscs in vivo . as with mir-124 , it will be interesting to follow the generation of a conditional triple - mir-9-ko mouse or the application of stable mirna sponges to study the functional role of mir-9 . let-7 is one of the first mirna discovered in c. elegans , the first known human mirna and it is conserved over species . there are 12 human let-7 genes encoding for nine distinct mature forms of the mirna , let-7a through to let-7i . increased let-7 expression is seen in early neurogenesis and neural differentiation while it is decreased in the adult brain . ish shows induction of let-7 already at e9.5 in the developing cns ( wulczyn et al . , 2007 ) . let-7 expression closely resembles the expression of other brain - enriched mirnas ( wulczyn et al . , 2007 ) . in utero electroporation of let-7b duplexes injected into the lateral ventricles of e13.5 mice causes a reduction in cell cycle progression in nscs ( zhao et al . , overexpression of let-7b in nscs causes reduced proliferation and an increase in neural differentiation ( zhao et al . , 2010 ) . suppression of let-7 , using a mirna - sponge , causes an increase in levels of lin28 protein ( rybak et al . , 2008 ) . lin28 is a protein that specifically binds and blocks processing of let-7 , thereby inducing pluripotency ( rybak et al . , 2008 ; balzer et al . , 2010 ) lin28 is expressed broadly throughout the neural tube early during development where neural differentiation has not begun ( balzer et al . , 2010 ) , at this stage it co - localizes with sox2 , a maker for nscs . it has also been shown that let-7b suppresses the expression of tlx ( zhao et al . , 2010 ) . these reports suggest that the let-7-family serves as key regulators of nsc proliferation and accelerated neural differentiation ( wulczyn et al . , 2007 ; . however , the large size of the let-7 family posses a technical hurdle for the generation of loss - of - function mutants , which limits our understanding of the role of let-7 . in the future it appears likely that the use of sponge - vectors allowing stable inhibition of the entire family may be the most feasible choice to study the functional role of let-7 in nscs in vivo . it is likely that we have so far only begun to realize the complexity of mirna - mediated regulation of nscs . the multitude of mirna complimentary targets in the genome implicates the complexity of mirna gene regulation . therefore studies of mirna - target regulation in specific cell types at various developmental time points are essential . other questions that need to be answered are ; can several mirnas act to suppress the same mrna simultaneously and do they have compensatory , collaborative or competitive effects ? the development of new biotechnological tools such as mirna sponges and transgenic reporter systems will enable new types of studies that will clarify the functional properties of individual mirnas . in the coming years it will be extremely interesting to follow this field as it matures and unravels the full role of mirnas in nscs . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

in adult mammals , neural stem cells ( nscs ) are found in two niches of the brain ; the subventricular zone by the lateral ventricles and the subgranular zone of the dentate gyrus in the hippocampus . neurogenesis is a complex process that is tightly controlled on a molecular level . recently , micrornas ( mirnas ) have been implicated to play a central role in the regulation of ncss . mirnas are small , endogenously expressed rnas that regulate gene expression at the post - transcriptional level . however , functional studies of mirnas are complicated due to current technical limitations . in this review we describe recent findings about mirnas in nscs looking closely at mir-124 , mir-9 , and let-7 . in addition , we highlight technical strategies used to investigate mirna function , accentuating limitations , and potentials .

Introduction Expression Profiling of miRNA in Neural Stem Cells Loss of Function Studies of miRNAs miR-124 miR-9 The Let-7-Family Conclusion Conflict of Interest Statement

torus hyperplasia is a very rare condition also known as focal pyloric hypertrophy ( 1 ) . this lesion is caused by a circular muscle hypertrophy affecting the lesser curvature near the pylorus . pathogenesis of the lesion is unclear , some considering it as a persistence of infantile pyloric hypertrophy to adulthood , others noting that it develops within a few weeks in adult ( 1 , 2 ) . some have speculated that the lesion results from chronic gastritis or from repeated spastic contractions of the area secondary to visceral - visceral reflexes that could be established as a result of local irritation stimulating afferent fibers and starting a reflex arc involving efferents that locally innervate the circular pyloric musculature ( 1 , 3 ) . in summary , focal hypertrophic stenosis of the pyloric antrum in adult is classified as primary or secondary types ; 1 ) primary type being an idiopathic torus hyperplasia uncertain of origin , and 2 ) secondary type from a result of muscular thickening due to inflammation , ulceration , or carcinoma ( 4 ) . after the first report on 1946 , torus hyperplasia has been reported as a rare disease ( 5 ) . although there are some typical findings ( i.e. , recognizable radiologically by narrowing and enlongation of the pyloric cancal and endoscopically by appearances resembling those of the cervix so called characteristic pyloric " cervix sign " ) in this benign disease ( 6 , 7 ) , it is difficult to confirm without resection . moreover , it is hard to predict the prevalence of the disease because of its ' rarity ( 3 ) . herein , we report a 56-yr - old man who was diagnosed as torus hyperplasia with appendiceal mucocele after visiting our hospital because of abdominal discomfort . to the best of our knowledge , this is the first case of torus hyperplasia with appendiceal mucocele which is found incidentally . a 56-yr - old man with a history of hypertension presented with abdominal discomfort for one month . he reported no bowel habit change , nausea , vomiting , or fever , but complained of anal pain . he had a family history since his father died of advanced gastric cancer . on arrival , his blood pressure was 128/87 mmhg , heart rate 80 beats / min , respiratory rate was 20/min , and body temperature was 36.0. the physical examination revealed no abnormalities except rectal examination . his abdomen was soft and non - tender with normal bowel sound . on rectal examination , upper gastrointestinal endoscopy showed a 1.0 cm sized irregular submucosal lesion proximal to the pylorus to the distal antrum on the lesser curvature . central erosion was noticed on the surface of the lesion due to previous biopsy ( fig . 1 ) . cushion sign revealed negative finding , and biopsy revealed no significant abnormality . on colonoscopy examination which was performed on the same day with upper gastrointestinal endoscopy , histological section revealed marked hypertrophy of the distal circular pyloric musculature without an evidence of neoplasia ( fig . the present case revealed marked hypertrophy of the distal circular pyloric musculature on histological finding , and was diagnosed as torus hyperplasia after the resection . it was consistent with adult idiopathic hypertrophic pyloric stenosis , a benign disease resulting from hypertrophy of the circular fibers of the pyloric canal of unknown etiology . since the patient had no predisposing factors for the development of secondary pyloric stenosis , we considered this lesion as congenital in origin . although the endoscopic finding revealed typical cervix sign , we were not able to differentiate from true neoplastic lesion before the resection . despite the recent progress in radiology and endoscopy , it is very hard to define hypertrophic stenosis in adults ( 8) . on endoscopic finding , torus hyperplasia reveals as submucosal tumor since it arise from circular muscle consisting the pyloric canal which makes it hard to diagnose through endoscopic biopsy ( 6 , 8) . in addition , it is usually misdiagnosed as carcinoma of the antrum ( 6 ) . although recent progress of endoscopic ultrasonography and endoscopic resection had been made , it is hard to diagnose only with the aid of endoscopic procedures . most of these lesions are found incidentally like our case because it cause minimal clinical signs or is asymptomatic . in the absence of the symptoms , no clinical treatment is required , and resection is advocated only when stenosis gives rise to symptoms or when a malignancy is suspicious ( 6 , 8) . although endoscopic dilatation or laparascopic hypertrophy have been reported as alternative treatments ( 9 , 10 ) , distal gastrectomy with gastroduodenostomy is still the main therapy for final diagnosis and treatment . second , the patient had a fear of gastric cancer since his father died of this malignancy . third , elective operation for appendiceal mucocele was planned for suspicious malignant potential . in summary , we have experienced a rare disease , tours hyperplasia which was difficult to differentiate from gastric cancer mimicking submucosal tumor . our experience including typical cervix sign on endoscopic finding would help other endoscopists for their diagnosis .

primary or idiopathic hypertrophy of the pyloric muscle in adult , so called torus hyperplasia , is an infrequent but an established entity . it is caused by a circular muscle hypertrophy affecting the lesser curvature near the pylorus . since most of the lesions are difficult to differentiate from tumor , distal gastrectomy is usually preformed to rule out most causes of pyloric lesions including neoplastic ones through a pathological study . a 56-yr - old man with a family history of gastric cancer presented with abdominal discomfort of 1 month duration . upper gastrointestinal endoscopy showed a 1.0 cm sized irregular submucosal lesion proximal to the pylorus to the distal antrum on the lesser curvature . on colonoscopy examination , a 1.5 cm sized protruding mass was noticed on the appendiceal orifice . gastrectomy and cecectomy were done , and histological section revealed marked hypertrophy of the distal circular pyloric musculature and an appendiceal mucocele . to the best of our knowledge , this is the first case of torus hyperplasia with appendiceal mucocele which is found incidentally .

INTRODUCTION CASE REPORT DISCUSSION

the incidence of non - hodgkin lymphoma ( nhl ) is rising worldwide and is higher in developed countries than in africa and asia . b cell non - hodgkin lymphoma is a typical extrahepatic manifestation frequently associated with hepatitis c virus ( hcv ) infection . the prevalence of hcv infection in patients with b cell non - hodgkin lymphoma is approximately 15% . the hcv envelope protein e2 binds human cd81 , a tetraspanin expressed on various types of cells , including lymphocytes , and activates b cell proliferation . infection and replication of hcv were observed in b cells [ 6 , 7 ] although the direct effects , particularly in vivo , have not been clarified . to determine the direct effect of hcv infection on b cells in vivo , we crossed transgenic mice with an integrated full - length hcv genome ( rz ) under the conditional cre / loxp expression system , with mice expressing the cre enzyme under transcriptional control of the b lineage - restricted gene cd19 . to investigate the mechanism of development of lymphoproliferation or b cell non - hodgkin lymphoma in hcv patients , we also developed a transgenic mouse model that conditionally expressed hcv cdna ( nucleotides 2943435 ) , including the viral genes that encode the core , e1 , e2 , and ns2 proteins , by using the cre / loxp system ( in core - ns2 [ cn2 ] mice ) [ 10 , 11 ] . conditional transgene activation of the hcv cdna ( core , e1 , e2 , and ns2 ) protects mice from fas - mediated lethal acute liver failure , by inhibiting cytochrome c release from mitochondria . persistent hcv protein expression is established by targeted disruption of interferon regulatory factor-1 ( irf-1 ) , and high incidences of lymphoproliferative disorders are noted in irf-1 cn2 mice . previously , transgenic mice that expressed the hcv core protein were established using a promoter derived from hepatitis b virus , whereas mice that expressed structural or complete viral proteins were established using promoters derived from the albumin gene . these mice were immunotolerant to the transgene and did not develop hepatic inflammation . however , they developed age - related hepatic steatosis and hepatocellular carcinomas . in contrast , the cn2 mice used in the present study were not immunotolerant to the hcv gene and developed hepatitis after the onset of hcv gene expression . however , the expression of hcv in these mice was usually lost after 21 days . therefore , an animal model of persistent hcv protein expression is required for examining the effects of chronic hcv infection in vivo . ifn signaling mediates tumor - suppressor effects and antiviral responses and is regulated by key transcription factors of the interferon - regulatory factor ( irf ) protein family , including irf1 , irf2 , irf3 , irf7 , and irf9 . targeted disruption of irf-1 results in aberrant lymphocyte development and a marked reduction in the number of cd8 t cells in the peripheral blood , spleen , and lymph nodes . the mechanisms by which hcv infection induces ifn resistance and influences the development of lymphomas are poorly understood . therefore , we established an irf-1 cn2 mouse model of persistent hcv expression , which allowed us to investigate the effects of hcv on lymphatic tissue tumor development . the full - genome hcv expression was induced by the cre / loxp system with cd19cre ( figure 1(a ) ) . the incidence of b cell lymphomas in rzcd19cre mice was 25.0% ( 22.2% in male and 29.6% in female mice ) and was significantly higher than the incidence in the hcv - negative groups . most were cd45r positive and located in the mesenteric lymph nodes ( figure 1(c ) ) . indeed , the expression of the hcv or hcv proteins induces the spontaneous development of b cell lymphomas , irrespective of the integrated site in the mouse genome . serum concentrations of il-1 , il-1 , il-2 , il-3 , il-4 , il-5 , il-6 , il-9 , il-10 , il-12(p40 ) , il-12(p70 ) , il-13 , il-17 , eotaxin , g - csf , gm - csf , ifn- , kc , mcp-1 , mip-1 , mip-1 , rantes , tnf- , il-15 , fgf - basic , lif , m - csf , mig , mip-2 , pdgf , vegf , alanine aminotransferase ( alt ) , and aspartate aminotransferase ( ast ) were not significantly different in the presence or absence of b cell lymphomas . interestingly , the average sil-2r level was significantly higher in the sera from rzcd19cre mice with b cell lymphomas ( 830.3 533.0 pg / ml ) than in that from tumor - free control groups , including the rzcd19cre , rz , cd19cre , and wild - type ( wt ) mice ( 499.9 110.2 pg / ml ; p < 0.0057 ) ( figure 1(d ) ) . the difference in the average sil-2r levels between the sera from groups with tumors other than b cell lymphomas ( 430.46 141.15 pg / ml ) and that from tumor - free control groups was insignificant ( p > 0.05 ) . moreover , all rzcd19cre mice with a relatively high level of sil-2r ( > 1000 pg / ml ) presented with b cell lymphomas . a significant increase in sil-2r was also observed in mxcre / cn2 - 29 mice that expressed the hcv cn2 gene and had b cell lymphomas , compared with tumor - free control ( cn2 - 29 ) mice . to examine whether sil-2r was derived from lymphoma tissues , we quantified il-2r concentrations in splenocytes , peripheral blood lymphocytes ( pbls ) , and b cell lymphoma tissues . the concentration of il-2r was significantly higher in splenocytes from rzcd19cre mice than in splenocytes from cd19cre mice . moreover , the concentration of il-2r in b cell lymphoma tissues from rzcd19cre mice was higher than that in splenocytes . these results strongly suggest that b cell lymphomas directly contribute to the elevated serum concentrations of sil-2r in rzcd19cre mice . they also strongly support the possibility that persistent expression of hcv could directly induce transformation of b cells . rzcd19cre mice are immunotolerant to hcv , because hcv is expressed in b cells before birth . in contrast , cn2 mice express hcv after they are administered the recombinant adenovirus that expresses the cre enzyme ( figures 2(a ) and 2(b ) ) . the expression of hcv in these mice is usually lost after 21 days ( figure 2(b ) ) through removal of hcv - expressing hepatocytes by the immune response . to establish persistent hcv expression , we disrupted irf-1 by crossing of rzcd19cre mice with irf-1 mice . irf-1 plays a significant role in the th1-type immune response and its absence is expected to decrease the elimination of hcv - expressing cells . as expected , hcv expression in irf-1 cn2 mice persisted for more than 500 days ( figure 2(c ) ) . a significant percentage of the mice that expressed the hcv core protein ( irf-1 cn2 mice ) showed polyclonal lymphoid growth disturbances , including splenomegaly , expanded lymph nodes , adenocarcinoma in the abdomen or leg , and lymphoma of the liver or peyer 's patches ( figures 2(d ) and 2(e ) ) . in contrast , hepatocytes with abundant expression of hcv proteins rarely developed into hepatocellular carcinomas . hematoxylin and eosin ( h&e ) staining of splenomegalic tissue showed extensive hyperplasia of the white pulp zones , in which the cortical zones contained lymphoid follicles and scattered germinal centers although mitotic figures were rarely observed . these results indicate that persistent expression of hcv proteins frequently induces lymphoproliferative disorders in addition to liver hyperplasia , which is consistent with the phenotype of patients with hepatocellular carcinoma . the average ratio of t cells to b cells in the lymph nodes and spleens of cn2 mice was significantly higher than that in wt mice . the majority of cd3 lymphocytes and a few cd8 lymphocytes expressed cd4 on their surfaces . these results confirm that hcv protein expression induces lymphoproliferative disorders that involve excessive expansion of both t cells and b cells . the cell population that showed negative results for t cell receptor ( , , , and isoforms ) staining was smaller in irf-1 cn2 mice than that in the other mice . the disruption of irf-1 inhibited fas - induced apoptosis , presumably by decreasing the levels of caspase-6 and caspase-7 messenger rna . these results suggest that the reduced expression of effector caspases delays fas - mediated apoptosis in irf-1 mice and prevents the elimination of hcv - expressing cells in vivo . the cn2 mice showed significantly increased levels of serum il-2 , il-10 , and il-12 ( figure 3(a ) ) . notably , the cn2 mice with proliferative disturbances in the lymph nodes and spleen had dramatically elevated levels of these cytokines , suggesting that altered cytokine production is involved in aberrant lymphocyte proliferation or differentiation . in contrast , the irf-1 cn2 mice did not show elevated levels of serum il-12 , but had significantly higher levels of serum il-2 and il-10 than did irf-1 mice ( figure 3(b ) ) . thus , the disruption of irf-1 negated the increase in the il-12 level , but augmented the increases in the levels of il-2 and il-10 in cn2 mice . these results indicate that il-2 and il-10 play key roles in the induction of the lymphoproliferative phenotype in irf-1 cn2 mice . a significantly positive correlation was found between the cytokine levels and spleen weights of cn2 gene - expressing mice with the irf-1 background ( r = 0.43 , p < 0.05 , and r = 0.53 , p < 0.05 , resp . ) . these results indicate that il-2 and il-10 are involved in lymphoproliferation in viral protein - expressing mice . bcl-2 is an integral inner mitochondrial membrane protein , overexpression of which blocks the apoptotic death of pro - b - lymphocyte death . bcl-2 transgene expression increases the oncogenic potential and is linked with b cell neoplasm and t(14;18 ) translocation . we therefore examined the level of bcl-2 protein and found that it was upregulated in the lymph nodes of irf-1 cn2 mice after 400 days ( figure 3(c ) ) . il-10 treatment in the presence of il-2 greatly inhibited fas - induced apoptosis in irf-1 cn2 mice compared with other groups ( table 1 ) . furthermore , irf-1 disruption accelerated the resistance of splenocytes to fas - induced apoptosis in the presence of il-2 , il-10 , and/or il-12 . in particular , il-2 plus il-10 treatment produced the strongest upregulation of the bcl-2 mrna levels in splenocytes of irf-1 cn2 mice . this indicates that il-2 , il-10 , and/or il-12 contribute to upregulation of bcl-2 expression , which subsequently inhibits fas - induced apoptosis . these results indicate that aberrant cytokine expression and disruption of ifn signaling affect bcl-2 expression synergizing with hcv proteins , which is associated with the inhibition of caspase expression . these results indicate that the hcv core and e2 proteins are responsible for il-2 , il-10 , and il-12 expression . core protein expression and il-10 stimulation most strongly induced bcl-2 expression ( table 2 ) . from these results , core protein contributes significantly to the induction of bcl-2 in the presence of cytokines . our results show that the conditional expression of hcv proteins induces inflammation and lymphoproliferative disorders . furthermore , established animal models will probably provide critical information for the elucidation of the molecular mechanism(s ) underlying the spontaneous development of b cell non - hodgkin lymphoma after hcv infection . therefore , irf-1-inducible genes probably play essential roles in suppressing hcv - induced lymphoma and in eliminating hcv protein - expressing cells . the overexpression of apoptosis - related proteins ( including bcl-2 ) and/or aberrant cytokine production are the primary events in hcv - induced lymphoproliferation . the hcv gene has the potential to induce b cell lymphomas in rzcd19cre mice , without inducing host immune responses against hcv gene product . this is in agreement with the results of a previous study , which indicate that viral elimination reduces the incidence of malignant lymphoma in patients infected with hcv . the incidence of b cell lymphoma in the hcv transgenic mouse strain ( mxcre / cn2 - 29 ) is high , and this strongly suggests that development of b cell lymphomas occurs via expression of the hcv transgene . the level of il-2r was higher in splenocytes of rzcd19cre mice than in those of cd19cre mice ; however , the differences in the serum concentrations of sil-2r between rzcd19cre mice without b cell lymphomas and other control groups ( rz , cd19cre , and wt ) were insignificant . these results indicate that hcv increases il-2r expression in b cells ; proteolytic cleavage of il-2r increased after b cell lymphoma development in the rzcd19cre mice . the detailed mechanism by which hcv expression induces il-2r remains unclear , but hcv core protein induces il-10 expression in mouse splenocytes . il-10 upregulates the expression of il-2r ( tac / cd25 ) in normal and leukemic b lymphocytes . therefore , through il-10 , the hcv core protein might induce il-2r in b cells of the rzcd19cre mouse . this leads to lymphoproliferative diseases resulting from reduced apoptosis ( i.e. , lower levels of caspase-1 , caspase-6 , and caspase-7 expression ) . hcv cn2 transgenic ( tg+ ) mice are resistant to fas - induced apoptosis because of the inhibition of cytochrome c release from mitochondria . mice with disruption of irf-1 have several defects in their innate and adaptive immunities , including lineage - specific defects in thymocyte development , and the development of immature t cells into mature cd4 cells but not cd8 t cells [ 16 , 23 ] . irf-1 controls the positive and negative selection of cd8 thymocytes and is required for the development of the th1-type immune response . the absence of irf-1 induces th2-type immune response [ 16 , 25 ] . the number of natural killer cells is dramatically reduced in irf-1 mice . this defect may markedly increase viral protein expression and inhibit tumor surveillance mechanisms , leading to the development of non - hodgkin lymphoma . hypermutation of the immunoglobulin genes in b cells induced by hcv infection is the cause of the lymphomagenesis observed in hcv infection [ 16 , 26 ] . this finding may provide a more direct insight into lymphoma production , because hcv - induced hypermutation causes genetic instability and chromosomal aberrations , possibly resulting in neoplastic transformation . in addition , the antiapoptotic phenotype resulting from sustained viral protein expression may enhance the survival of lymphocytes and inhibit activation - induced cell death to turn off the activated lymphocytes . the dysregulated cytokine profiles and sustained lymphocyte survival may alter the fates of regulatory t cells and dendritic cells . in summary , the mouse model of b cell lymphoma and lymphoproliferative disorder represents a powerful tool to address the molecular mechanism of lymphoma development by hcv .

b cell non - hodgkin lymphoma is a typical extrahepatic manifestation frequently associated with hepatitis c virus ( hcv ) infection . the mechanism by which hcv infection leads to lymphoproliferative disorder remains unclear . our group established hcv transgenic mice that expressed the full hcv genome in b cells ( rzcd19cre mice ) . we observed a 25.0% incidence of diffuse large b cell non - hodgkin lymphomas ( 22.2% in male and 29.6% in female mice ) within 600 days of birth . interestingly , rzcd19cre mice with substantially elevated serum - soluble interleukin-2 receptor -subunit ( sil-2r ) levels ( > 1000 pg / ml ) developed b cell lymphomas . another mouse model of lymphoproliferative disorder was established by persistent expression of hcv structural proteins through disruption of interferon regulatory factor-1 ( irf-1_/_/cn2 mice ) . irf-1_/_/cn2 mice showed extremely high incidences of lymphomas and lymphoproliferative disorders . moreover , these mice showed increased levels of interleukin ( il)-2 , il-10 , and bcl-2 as well as increased bcl-2 expression , which promoted oncogenic transformation of lymphocytes .

1. Introduction 2. Spontaneous Development of B Cell Lymphomas in the RzCD19Cre Mouse 3. Persistent HCV Expression and Lymphoproliferative Disorder 4. Conclusion Conflict of Interests

we studied 22 samples , from dogs , cattle , wildlife , and humans in cear , obtained from 1997 to 2003 ( table ) . samples were antigenically characterized by using a monoclonal antibody ( mab ) panel against the viral nucleoprotein ( 35 ) . isolates were injected into the brains of suckling mice , and brain impressions were made for mab typing ( 3,5 ) . antigenic variant-2 ( agv2 ) , maintained by dogs , was found in all c. thous , p. crancrivourous , and human cases and in all dog isolates with the exception of brdg5360 , which was positive with all the mabs . antigenic variant-3 ( agv3 ) , epidemiologically associated with vampire bats , desmodus rotundus , was identified in 3 bovine samples . a previously reported profile , representing an agv that circulates in marmosets in cear ( 5 ) , was detected in sample brsg5696 . * the cear viruses were analyzed genetically through a comparative phylogenetic study based on a 320-bp fragment of the nucleoprotein gene , from position 1157 to 1476 , as compared with sadb19 ( 58 ) . these isolates were also compared with rabies virus variants circulating among domestic animals and wildlife from the americas . the viral rna was extracted from infected tissues , and the cdna was obtained by reverse transcription pcr techniques , using primers 21 g and 304 , and was sequenced with primer 304 ( 7,9 ) . the phylogenetic analyses were made by using the pileup program of the wisconsin package version 10.1 ( 10 ) and the programs dnadist , neighbor , seqboot , and consense of the phylip package ( 11 ) . rabies virus isolates by geographic localization and neighbor - joining tree showing a comparison of the groups formed by cear state , brazil , samples isolated from 1997 to 2003 . bootstrap values of > 50% obtained from 100 resamplings of the data using distance matrix methods are shown in the nods . lineage a was represented by a sample from a dog from maranguape , which was obtained in 2001 . lineage b was formed by all the c. thous isolates , a sample from a human bitten by a p. cancrivorous raccoon in fortaleza in 1997 , and a virus from a p. crancrivorous raccoon collected in maranguape during 2001 ( intrinsic identity 96.5%100% ) . this lineage showed its highest percentage of identity with lineage c ( intrinsic identity 90.6%92.8% ) . lineage c consisted of 9 human samples collected in 5 different counties from 2000 to 2003 and an isolate obtained from a dog in 2000 . lineage d included 3 bovines collected in 3 geographically distant counties during 2000 and 2001 ( intrinsic identity 97.5%98.4% ) . lineage e was represented by the only sample collected from a c. j jacchus marmoset , these last 2 lineages were related distantly to all the others . when compared with representatives of rabies variants maintained by terrestrial and bat species in the americas ( figure 2 ) , lineages a , b , and c continue to segregate as independent lineages with high statistical support . cear bovine samples representing lineage d clustered with d. rotundus and d. rotundus related cases from latin america ( intrinsic identity 94%97.8% ) . neighbor - joining tree showing a comparison of cear samples ( groups a , b , c , d , e ) with isolates obtained from the americas . bootstrap values of > 50% obtained from 100 resamplings of the data using distance matrix methods are shown in the nods . the sequences from latin america used in the comparison were identified as as follows : group i , dogs and terrestrial wildlife from mexico , venezuela , colombia , dominican republic , and peru ( mxsk , skunk from mexico ; mxdg and mxmx , dog from mexico ; vedg , dog from venezuela ; codg , dog from colombia ; drmg , mongoose from dominican republic ; mxgm , bobcat from mexico ; pefx , fox from peru ) and terrestrial wildlife from the united states ( caussk , skunk from california ; txuscy , coyote from texas ; wiussk , striped skunk from wisconsin ; arussk , striped skunk from arkansas ; azusfox , gray fox from arizona ; txusfx , gray fox from texas ) ; and group ii , terrestrial wildlife from the united states ( flrac , raccoon from florida ; parac , raccoon from philadelphia ; ksussk , striped skunk from kansas ; arussk , striped skunk from arkansas ) . the antigenic variant and endemic cycle to which it belongs are shown in the tree . the only sample representative of lineage e segregated with 2 isolates from humans bitten by c. j. jacchus and a sample collected from a marmoset kept as a pet ( 5 ) . a thorough description of rabies epidemiology depends on a comprehensive surveillance program and application of accurate molecular methods to discriminate among different variants and the emergence of new foci . antigenic and limited sequencing analyses were used to better understand the emergent epidemiologic events in wildlife in cear , brazil . these analyses allowed identification of 5 potential cycles in this region , despite antigenic homogeneity . lack of antigenic and genetic relationships of sample brdg5693 , representing lineage a , with the rest of the isolates from cear and the known terrestrial rabies vectors from the americas shows that this virus is a variant not previously described . this virus was geographically and temporarily associated with samples brpcr5698 and brcth5692 , obtained in maranguape during 2001 . these circumstances demonstrated the existence of at least 2 overlapping endemic cycles in this area . lineage b was formed mainly by isolates from c. thous , which indicates the existence of an emerging rabies cycle in this species . the epidemiologic situation in cear was complicated because of overlapping distributions of dog and c. thous rabies cases ( figure 1 ) . tree topology and genetic relationships between dog and c. thous variants suggested that the canine virus was introduced in c. thous populations because of spillover events , which gave rise to an emergent cycle . a similar event was described between domestic dogs and canis adustus ( jackal ) in zimbawe . in this case , the variant circulating in dogs was introduced into the c. adustus population by spillover events , with the consequent emergence of an independent cycle ( 13 ) . recently , the hoary fox has been identified as a rabies reservoir in brazil ( 14 ) . cancrivorous raccoon and another sample collected from this species suggested the risk of establishing c. thous variant in p. cancrivorous . epidemiologic data which indicates that humans had been exposed to dog bites , results of molecular characterization , and inclusion of a dog isolate in the c lineage strongly incriminate the dog as the reservoir of this variant . identification of the source of infection by using classic surveillance alone is complicated by the presence of multiple cycles of transmission . genetic comparison of samples from lineage d with viruses representing bats viruses from the americas helped to identify d. rotundus as the source of livestock infection . the close genetic relationship of sample brsg5696 with rabies isolates obtained from c. j. jacchus and human cases bitten by marmosets further supported c. j. jaccuss as the most important vector of this variant . this finding indicates that this species plays an important role for disease maintenance in nature . methods for antigenic and genetic identification of rabies samples isolated in the americas have contributed effectively to the development of health programs , as well as recognition of possible wild reservoirs of urban rabies . the emergence of new cycles in latin american wildlife indicates the need to strengthen surveillance programs in these species and research development for the evaluation of the feasibility of oral vaccination interventions .

rabies viruses circulating in cear , brazil , were identified by molecular analysis to be related to variants maintained by dogs , bats , and other wildlife . most of these viruses are associated with human rabies cases . we document the emergence of a rabies virus variant responsible for an independent epidemic cycle in the crab - eating fox ( cerdocyon thous ) .

The Study Conclusions

toxoplasma gondii ( t. gondii ) is an obligate intracellular protozoan parasite that causes toxoplasmosis , a usually asymptomatic disease in most immune - competent individuals but potentially severe in immune - compromised hosts . successful control of this pathogen depends on the early production of the proinflammatory cytokines il-12 and ifn- , required for the development of a protective cell - mediated immune response against the parasite [ 25 ] . although neutrophils and macrophages produce il-12 in response to t. gondii infection or its soluble antigens ( stag ) [ 69 ] , in vivo studies indicate that cd8 and cd11b dendritic cell ( dc ) populations may be the most important sources of this proinflammatory cytokine during acute infection [ 1012 ] . the strong il-12-driven response against t. gondii results in the systemic production of ifn- by natural killer ( nk ) cd4 and cd8 t cells , which promotes the effector mechanisms to control both acute and chronic infections [ 2 , 1318 ] . mif is a pleiotropic inflammatory cytokine that plays a role in the outcome of a variety of protozoan infectious diseases [ 1923 ] . we have previously demonstrated that balb / c mif mice were more susceptible to t. gondii infection , with the virulent rh strain and the avirulent me49 strain . the increased susceptibility in mif mice was associated with deficient serum levels of inflammatory cytokines ( il-12 and ifn- ) , as well as impaired il-12 production and reduced expression of costimulatory molecules in cd11c cells from spleen or mesenteric lymph nodes . these data indicated a deficient innate immune response on infected mif mice presumably due to a deficient dc maturation . however , as macrophages are able to express cd11c and different dcs subsets share the expression of this marker , it is difficult to discern whether mif has a role in the maturation of dc subsets involved in the resistance to t. gondii . therefore , the present study aimed to assess the role of mif in the maturation of conventional cd8 and cd11b dcs during the acute infection with avirulent t. gondii me49 strain . we demonstrate that serum mif increased rapidly during the acute infection with t. gondii and promoted maturation of cd11b but not cd8 dcs . adoptive transfer of bone marrow ly6c monocytes suggested that systemic mif levels are required for conversion of this monocyte subset into tipdcs . mif mice displayed reduced ifn- natural killer ( nk ) cells compared to infected wt mice , suggesting that mif promotes the recruitment of ifn--producing nk cells . finally , administration of rmif to t. gondii - infected mif mice restored the numbers of tipdcs and inflammatory cytokines along with the resistance to the parasite . our results uncover a new role for mif in the development of cell - mediated immunity to t. gondii by favoring tipdc differentiation during acute toxoplasmosis . all experiments in this study were performed strictly according to the guidelines for the care and use of laboratory animals adopted by the us national institutes of health and the mexican regulation of animal care ( nom-062-zoo-1999 , 2001 ) . protocols were also approved by the institutional animal care and use committee ( iacuc ) , the research institute at nationwide children 's hospital . adult 6- to 8-week - old female mice ( balb / c background ) were purchased from harlan laboratory ( mxico or usa ) . mif mice were developed as previously described and backcrossed for more than 10 generations to a balb / c genetic background . all animals were maintained in a pathogen - free environment and established as breeding colonies in the animal facility at fes - iztacala , universidad nacional autnoma de mxico ( unam ) , or in the transgenic mouse facility at the research institute at nationwide children 's hospital animal facility . cysts of the avirulent t. gondii me49 strain were harvested from brains of c57bl/6 mice that had been inoculated i.p . with 40 cysts 2 months earlier . for experimental infections , mif or wt mice received via intraperitoneal ( i.p . ) 100 cysts or pbs as a control . control inoculations with uninfected brains failed to elicit detectable inflammatory responses or significant increases in cytokine levels . to assess acute disease progression , mice were killed by co2 and the peritoneal fluids were recovered under sterile condition using 3 ml of warm pbs and gentle massage at days 5 and 7 after toxoplasma infection of mif and wt mice . tachyzoites were counted by trypan blue exclusion with a neubauer hemocytometer under olympus bx51 microscope ( 100 ; olympus american , melville , ny ) equipped with a digital video camera . serum was obtained from infected or uninfected mif and wt mice during the acute phase of infection with t. gondii ( 1 , 2 , 3 , 5 , and 7 days after infection ) . the whole blood was centrifuged for 10 min at 2000 g at 4c . mif levels were determined by elisa according to the manufacturer 's guidelines ( neobiolab ) . serum ifn- , il-6 , il-12p70 , il-4 , and il-10 were measured using a bio - plex pro assay ( bio - rad ) or cytometric bead array ( cba th1/th2 , bd biosciences ) according to the manufacturer 's protocols . single - cell suspensions were obtained from peritoneal exudate cells ( pecs ) by peritoneal wash with 5 ml ice - cold pbs . pecs pellets were washed twice with complete rpmi 1640 media and filtered with 70 m nylon mesh ( fisher scientific ) . two milliliters of ack lysing buffer ( gibco , life technologies ) was added to lyse red blood cells . harvested cells were incubated in saturated doses of anti - mouse fc receptor in 100 l of ice - cold facs buffer ( 1% bovine serum albumin/0.01% nan3 in pbs ) for 15 min . after washing , 3 10 cells were stained with various combinations of antibodies in ice - cold facs buffer for 15 min and further collected on a lsr ii cytofluorometer ( becton dickinson , bd ) . cells were gated according to size ( ssc - a ) and forward scatter ( fsc - a ) . blue - fluorescent reactive dye l23105 ( life technologies ) was used to discard dead cells . absolute cell numbers were calculated with the total cell count multiplied successively by the percentages for the appropriate gates obtained through flow cytometry . peritoneal cells free of red blood cells were washed with complete rpmi 1640 media and adjusted 3 10 cells / ml . two ml per well of the cell suspension was incubated in 24-well plate , stimulated with 5 ng / ml of phorbol 12-myristate 13-acetate ( pma ) ( sigma ) plus 500 ng / ml of ionomycin ( sigma ) and 10 g / ml of brefeldin - a ( biolegend ) at 37c , 5% co2 for 4 hours . cells were recovered and placed into facs tubes containing 1 ml of ice - cold facs buffer and centrifuged at 1500 rpm for 5 min . after surface staining , cells were washed and fixed using 2% paraformaldehyde in pbs for 10 min , rt , darkness . cells were washed with intracellular staining buffer ( pbs , 1% fcs , and 0.025% saponin ) and resuspended with 100 l of the same buffer containing the indicated mabs for cytokines for 10 mins , rt , darkness . cells were washed , resuspended in 500 l of buffer facs , and analyzed in facsaria fusion cytometer ( becton dickinson , bd ) . the following mabs were used : anti - cd11c alexa fluor 700 ( n418 ) or anti - dec-205 pe - cy7 ( 205yekta ) , anti - mhcii efluor 450 ( m5/114.15.2 ) , anti - cd40 pe ( 1c10 ) , anti - cd86 fitc ( ct - cd8b ) , anti - cd86 brilliant violet 605 ( gl1 ) , anti - cd11b alexa fluor 647 ( m1/70 ) , anti - ly6c alexa fluor 488 ( hk1.4 ) , anti - f480 alexa fluor 488 ( bm8 ) , anti - ly6c efluor 450 ( hk1.4 ) , and anti - inos pe ( cxnft ) from ebioscience ; anti - cd8 alexa fluor 700 or percp ( 53 - 6.7 ) , anti - cd11b alexa fluor 700 ( m1/70 ) , anti - f4/80 brilliant violet 605 ( bm8 ) , anti - ly6 g percp ( 1a8 ) , anti - cxcr4 brilliant violet 421 ( 1276f12 ) , anti - cxcr2 pe / cy7 ( 5e8/cxcr2 ) , anti - tnf- brilliant violet 650 ( mp6-xt22 ) , anti - cd3 fitc ( 145 - 2c11 ) , anti - cd49 apc ( dx5 ) , and anti - ifn- pecy7 ( xmg1.2 ) from biolegend ; and anti - mhc - ii pe ( af6 - 120.1 ) , anti - cd8 percp ( 53 - 6 ) , anti - cd11c apc ( n418 ) , anti - cd74 fitc ( in-1 ) , anti - il-12p40/70 v450 ( c15.6 ) , and anti - il-12p40/70 apc ( c15.6 ) from bd bioscience . , bone marrow cell suspensions were isolated by flushing femurs and tibias from 6- to 8-week - old mif or wt balb / c mice with complete rpmi 1640 supplemented with 10% fetal calf serum ( fcs ) , 100 units of penicillin / streptomycin , 2 mm glutamine , 25 mm hepes buffer , and 1% nonessential amino acids ( all from gibco , brl grand island , ny , usa ) . bone marrow monocyte cells ( bm - mncs ) were isolated using a density - gradient centrifugation method . bm - mncs were incubated with a mixture of antibody microbeads according to the manufacturer 's protocol ( miltenyi biotec , auburn , ca ) . the negative fraction was collected ( putative monocytes ) and stained for cell sorting with a bd influx sorter . isolated populations of ly6c monocytes were obtained and stained with the cell trace proliferation dye efluor 450 ( cat . number 65 - 0842 - 85 ; ebioscience ) and transferred ( 2 10 cells ) intravenously ( i.v . ) to t. gondii - infected or uninfected mif or wt balb / c mice . a group of 13 mif and 13 wt mice were infected via i.p . with 100 cysts of t. gondii . mice received ( via i.p . ) 0.5 g per mouse of rmif ( biolegend # 599504 ) daily during the first 5 days after t. gondii infection . three mice of this group were selected randomly and sacrificed on days 3 and 5 after infection to analyze the presence of tipdcs and production of serum ifn- ( as previously described ) . uninfected mice that did not receive rmif were used as a control . the rest of the group , 7 mif and 7 wt mice , were monitored until day 25 to register the mortality and number of cysts per brain . the total number of cysts was determined by counting cysts under olympus bx51 microscope ( 100 ; olympus american , melville , ny ) equipped with a digital video camera ( 40x ) in a 10 l aliquot and multiplied by 200 . statistical comparisons were performed by either student 's t - test or one - way anova followed by tukey 's multiple comparisons for data that had a normal distribution . although mif plays a critical role in the resistance to t. gondii infection , it is not known whether this protective role starts during the acute phase of infection with the parasite . therefore , we first evaluated the systemic levels of inflammatory cytokines from acutely infected wt and mif mice with the avirulent me49 strain from t. gondii . as shown in figure 1(a ) , serum mif from infected wt mice increased as early as 1 day after infection , peaked at 3 and 5 days , and decreased at day 7 . the absence of mif led to deficient levels of il-12p70 , ifn- , il-6 , and tnf- in sera ( figures 1(b)1(e ) ) , but the anti - inflammatory cytokine il-10 was similar between groups ( figure 1(f ) ) . these data suggest that the early upregulation of mif favors the prompt inflammatory immune response to acute toxoplasmosis . under conditions of infection , dcs mature by exposure to microbial agents or inflammatory mediators and increase their antigen processing capacity as well as their expression of costimulatory molecules and cytokine production . recent studies in our laboratory suggest a role for mif in inducing dc maturation from spleen or mesenteric lymph nodes during experimental toxoplasmosis . because dcs are essential for resistance to acute toxoplasmosis [ 1012 , 31 ] , we evaluated the role of mif in the maturation of conventional cd8 and cd11b dc subsets in peritoneal exudate cells as the early primary response in the i.p . t. gondii infection . in figure 2(a ) , we show the gating strategy used for identification of cd11b ( cd11c mhcii cd11b ) and cd8 dcs ( cd11c mhcii dec205 cd8 ) subsets . the absolute numbers of both cd11b ( figure 2(b ) ) and cd8 ( figure 2(c ) ) dcs increased at the site of infection ( peritoneal cavity ) until reaching a peak by day 5 after infection . comparable numbers of these cell populations were observed between wt and mif mice . nevertheless , mif mice displayed fewer il-12p70 cd11b dcs ( figure 2(d ) ) , compared to wt mice at 3 ( p = 0.0028 ) and 5 ( p = 0.0006 ) days after infection . similar numbers of il-12p70 cd8 dcs were observed between mif and wt infected mice ( figure 2(e ) ) . in addition , mif cd11b dcs displayed reduced cd86 expression ( figures 3(a ) and 3(b ) ) at 3 ( p = 0.0498 ) and 5 ( p = 0.0194 ) days after infection , but no differences were observed in their expression of cd40 ( figure 3(d ) ) . on the other hand , the expression of costimulatory molecules in cd8 dcs was unaltered in the absence of mif ( figures 3(a ) , 3(c ) , and 3(e ) ) . similar results were observed on dcs from the spleen ( figure s-1 in supplementary material available online at http://dx.doi.org/10.1155/2016/9101762 ) . these findings suggest a role for mif in selectively inducing maturation of cd11b dcs , a population that has proven to be crucial in the control of parasite replication and induction of the adaptive immune response against t. gondii . previous studies have demonstrated that both inos and tnf- are essential factors in the control of t. gondii infection . inos - deficient mice succumb during the chronic stage of infection with t. gondii , due to uncontrolled parasite replication , while tnf-r - deficient mice are susceptible to both acute and chronic toxoplasmic encephalitis [ 4 , 3235 ] . monocyte - derived tnf-/inos - producing cd11b dcs ( tipdcs ) can be induced during parasitic or microbial infections , and they exert potent antimicrobial functions required to control the infection [ 3639 ] . however , the role of mif in inducing tipdcs during acute t. gondii infection has not been addressed . therefore , using the same strategy for identification of cd11b ( cd11c mhcii cd11b ) and cd8 ( cd11c mhcii dec205 cd8 ) dcs described above , we determined tnf- and inos production on cd11b and cd8 dcs from infected wt and mif mice . our data revealed a population of tipdcs that gradually increased in both wt and mif mice during the acute phase of infection ( figure 4(a ) ) . however , infected mif mice displayed reduced numbers of tipdcs ( p = 0.0049 ; figures 4(a ) and 4(b ) ) and tnf- inos cd11b ( p = 0.0090 , figures 4(a ) and 4(c ) ) dcs at 5 days after infection . no differences were observed in inos tnf- cd11b dcs ( figures 4(a ) and 4(d ) ) . cd8 dcs showed a gradual increase in tnf- ( figures 4(e)4(h ) ) , but not inos ( figures 4(f ) and 4(h ) ) , production during acute t. gondii infection . comparable numbers of tnf--producing cd8 dcs were observed between wt and mif mice ( figure 4(g ) ) . these findings demonstrate a novel role for mif in inducing tipdcs during acute toxoplasmosis and the ability of cd11b but not cd8 dcs to mature into tipdcs . the chemokine - like inflammatory mediator mif is a ligand for the single - pass type ii membrane protein cd74 and a noncognate ligand for the chemokine receptors cxcr2 , cxcr4 , and cxcr7 . because the role of mif in promoting dc maturation was only observed on cd11b dcs , we determined whether this phenomenon was associated with a differential expression of mif receptors on cd11b and cd8 dcs from infected wt mice . in basal conditions , wt cd11b and cd8 dcs show similar expression of cd74 , cxcr4 , and cxcr2 ( figures 5(a ) , 5(b ) , and 5(c ) ; day 0 ) . however , during the course of t. gondii infection , wt cd11b dcs express more intensively the receptors cd74 ( 3 days , p = 0.0013 ; 5 days , p = 0.0014 ; figure 5(b ) ) , cxcr4 ( 5 days , p = 0.0014 ; figure 5(c ) ) , and cxcr2 ( 3 days , p = 0.0241 ; 5 days , p = 0.0341 ; figure 5(d ) ) , compared to wt cd8 dcs ( figures 5(a)5(d ) ) . these results suggest that the selective role of mif in the maturation of cd11b dcs may be related to the high expression of mif receptors on this dc subset . two major subsets of circulating monocytes have been characterized in mice based on their phenotypical and functional characteristics . one subset expresses a high level of ly6c and is referred to as inflammatory monocytes due to its early response and selective migration into inflamed tissues [ 42 , 43 ] . the second subset , termed resident or patrolling monocytes , expresses a low level of ly6c and is primarily distributed in blood vessels and tissues under the steady state , where it provides surveillance functions [ 4245 ] . because inflammatory ly6c monocytes are able to differentiate into tipdcs [ 36 , 39 ] and newly recruited ly6c monocytes infection with t. gondii [ 4650 ] , we analyzed the activation of ly6c and ly6c monocytes in acutely infected mif and wt mice . we found that resident ly6c monocytes and f4/80 macrophages ( ms ) patrolled the peritoneal cavity in basal conditions ( figure s-2b , day 0 ) . however , upon infection with t. gondii , newly recruited monocytes ( ly6c and ly6c ) populated the peritoneal cavity at 3 and 5 days after infection , and few or no resident ms remained ( figure s-2b , 3 and 5 days after infection ) . no significant differences were observed in the absolute numbers of monocytes or resident ms between infected mif and wt mice ( figure s2c - e ) . figure 6 shows that mif ly6c monocytes had reduced numbers of both tnf- inos ( p = 0.0330 ; figures 6(a ) and 6(b ) ) and inos tnf- ( p = 0.0473 ; figures 6(a ) and 6(c ) ) cells , when compared to wt ly6c monocytes . no differences were observed in ly6c tnf- inos monocytes between mif and wt infected mice ( figures 6(a ) and 6(d ) ) . interestingly , the ly6c subset ( figure 6(e ) ) showed no differences between mif and wt infected mice in tnf- inos ( figure 6(f ) ) , inos tnf- ( figure 6(g ) ) , and tnf- inos monocytes . these data suggest that mif promotes the activation of inflammatory ly6c monocytes and possibly their differentiation into tipdcs during acute t. gondii infection . to address whether mif influences differentiation of inflammatory ly6c monocytes into tipdcs during the acute t. gondii infection , we determined the fate of adoptively transferred bone marrow ly6c monocytes from mif or wt mice ( donors ) into t. gondii - infected ( recipients ) mif or wt mice ( figure s3 ) . we first analyzed the numbers of transferred ly6c monocytes differentiated into cd11b dcs ( cd11c mhcii cd11b cell trace , figure 7(a ) ) in the peritoneal cavity . no significant differences were observed in the total number of monocyte - derived cd11b dcs between wt and mif recipient mice after the transfer with wt or mif ly6c monocytes ( figures 7(b ) and 7(c ) , resp . ) . moreover , we sought the tipdcs subset in the population of cd11b dcs and found that tipdcs were missing in both healthy wt and mif recipient mice ( figures 7(a ) , 7(d ) , and 7(e ) , day 0 ) . however , after 5 days of t. gondii infection , wt and mif recipient mice showed a subset of ly6c monocytes expressing markers for tipdcs ( figure 7(a ) , day 5 ) . interestingly , wt and mif ly6c monocytes displayed similar ability to differentiate into tipdcs after being transferred to wt recipient mice ( figures 7(d ) and 7(e ) , wt recipient mice ) . however , both wt and mif ly6c monocytes were less able to differentiate into tipdcs when transferred into recipient mif mice compared to recipient wt mice ( figure 7(d ) , p = 0.0049 ; figure 7(e ) , p = 0.0047 ) . these results indicate that ly6c monocytes differentiate into cd11b dcs in mif - independent manner ( figures 7(b ) and 7(c ) ) , but endogenous mif levels could be required to induce maturation of monocyte - derived cd11b dcs into tipdcs during acute toxoplasmosis . on the other hand , ly6c monocytes displayed high expression of mif receptors cxcr4 ( figure s4 : ( a)-(b ) ) and cd74 ( figure s4 : ( c)-(d ) ) , compared to ly6c monocytes at 5 days after infection or resident ms ( f4/80 ) from uninfected mice , which could explain the selective role of mif in inducing activation and differentiation of ly6c monocytes into tipdcs . no differences were observed in cxcr2 expression ( figure s4 : ( e ) and ( f ) ) . early studies by goldszmid et al . have demonstrated that natural killer ( nk ) cell - derived ifn- is responsible for driving the differentiation of mononuclear phagocytes into macrophages and il-12 producing cd11b dcs during experimental toxoplasmosis . in this context , the role of mif in regulating nk cell - derived ifn- at the site of infection with t. gondii could be essential for the differentiation of ly6c monocytes into tipdcs . therefore , we analyzed the ifn- production in peritoneal nk cells from t. gondii - infected wt and mif mice ; in figure 8(a ) , we show the gating strategy used . we observed that either wt or mif nk cells ( cd3 cd49b ) displayed low percentages of ifn- cells under steady state ( figure 8(b ) ) . however , upon t. gondii infection , wt and mif nk cells ( cd3 cd49b ) drastically increased their ifn- production at 2 and 3 days after infection ( figure 8(b ) ) . interestingly , mif nk cells showed a reduced percentage of ifn- cells , compared to wt nk cells ( figure 8(b ) ) . this observation was in line with a higher number of tachyzoites observed in the peritoneum of mif compared with wt mice at days 5 and 7 after t. gondii infection ( figure s5 ) . the data suggest that mif induces ifn--producing nk cells during the acute infection with t. gondii . these findings could be related to a recent study in a murine model of skin inflammation , demonstrating a role for mif in inducing the recruitment of ifn--producing nkt cells . therefore , mif could promote the migration and/or activation of nk cells during acute t. gondii infection , a crucial event in the differentiation of ly6c monocytes into tipdcs . because our results indicated that systemic mif levels are critical for resistance and induction of tipdcs during acute toxoplasmosis , we confirmed these data by administration ( via i.p . ) of rmif into mif mice ( 0.5 g per mouse ) the rmif administration fully abolished the susceptibility of infected mif mice , which reached a survival rate of 100% , whereas untreated mif mice displayed a survival rate of 40% ( p = 0.0114 ) ( figure 9(a ) ) . the enhanced resistance induced by rmif administration was associated with decreased numbers of cysts in the brain from mif mice ( p = 0.0234 ; figure 9(b ) ) after 25 days after infection . in addition , serum ifn- levels were significantly recovered in mif mice that received rmif compared to mif that did not receive rmif ( p = 0.0107 ; figure 9(c ) ) . strikingly , rmif administration reconstituted the absolute numbers of tipdcs at 5 days after t. gondii infection ( figure 9(d ) ) . altogether , these data demonstrate that induced mif levels during acute toxoplasmosis have a crucial role in the resistance and the development of the protective cell - mediated immune response against t. gondii . we have previously demonstrated that mif favors immunity to t. gondii by inducing inflammatory cytokines ( il-12 and ifn- ) essential to control both acute and chronic infections with this parasite . moreover , mif has a role in inducing maturation of cd11c cells , which indicates that mif promotes cell - mediated immune responses against t. gondii infection . however , it is not known whether this inflammatory mediator induces maturation of specific dcs subsets required to control acute toxoplasmosis . cd8 and cd11b dcs have prominent roles as the major sources of the inflammatory cytokine il-12 , required for ifn--mediated resistance to t. gondii [ 1012 , 31 ] . therefore , in the present study , we sought to determine the role of mif in the maturation of cd11b and cd8 dcs during acute t. gondii infection . we found that mif was one of the first cytokines increased in serum from infected wt mice , and in agreement with previous studies , the lack of this inflammatory mediator reduced the levels of other inflammatory cytokines , such as il-12 , ifn- , and tnf- , with all of them involved in immunity against t. gondii [ 32 , 5355 ] . interestingly , cd11b but not cd8 dcs from infected mif mice showed impaired maturation characterized by deficient il-12p70 production and low expression of the costimulatory molecule cd86 . therefore , as cd11b dcs have a crucial role in the control of acute toxoplasmosis , an important mechanism by which mif promotes resistance to t. gondii may be through inducing maturation of cd11b dcs . additionally , cd11b dcs displayed high expression of mif receptors cxcr4 , cd74 , and cxcr2 compared to cd8 dcs , suggesting that cd11b dcs are more sensitive to paracrine / autocrine mif stimulus than cd8 dcs during acute toxoplasmosis . parasitic or microbial infections with trypanosoma brucei [ 38 , 39 ] or listeria monocytogenes , respectively , induce potent inflammatory immune responses that generate inos / tnf--producing cd11b dcs ( tipdcs ) , which derive from inflammatory monocytes recruited in the site of infection . t. gondii infection induces monocyte - derived il-12 producing cd11b dcs , which accumulate in the peritoneal cavity and have a crucial role in the protective immune response to the parasite . nevertheless , the production of inos and tnf- , essential factors in the control of t. gondii infection [ 4 , 3235 ] , has not been addressed on this dc subset [ 32 , 49 , 57 , 58 ] . here infection with t. gondii , a population of tipdcs gradually increased in the peritoneal cavity from infected wt and mif mice . interestingly , infected mif mice displayed reduced numbers of tipdcs ( 5 days after infection ) compared to infected wt mice , indicating a novel role for mif in inducing tipdcs during experimental toxoplasmosis . however , it is important to note that although the term tipdcs has been widely accepted to designate inos / tnf--producing dcs , previous reports have argued that it does not necessarily refer to a distinct dc subset , but rather to common dcs responding to their environment with inos and tnf- production [ 36 , 37 ] . therefore , as comparable numbers of cd11b dcs were detected in both infected mif and wt mice , but reduced numbers of tipdcs were observed in the absence of mif , these data suggest that mif induces maturation of cd11b dcs into tipdcs , rather than recruitment of tipdcs . furthermore , a small population of cd8 dcs was detected during acute t. gondii infection ( figure 4(b ) ) , corroborating a previous report . cd8 dcs displayed mif - independent maturation , characterized by increased tnf- but not inos production , which also indicates that cd11b but not cd8 dcs are able to become tipdcs during acute toxoplasmosis . previous studies have demonstrated that nk cell - derived ifn- is required for local differentiation of inflammatory monocytes into both macrophages and mature il-12 producing dcs . in contrast , maturation of cd8 dcs does not require priming by ifn- [ 31 , 59 ] but is critically dependent on tlr stimuli . interestingly , the role of mif inducing the recruitment of ifn--producing nkt cells in a murine model of psoriasis has been recently demonstrated . therefore , we analyzed ifn--producing nk cells from t. gondii - infected wt and mif mice . we found that t. gondii - infected mif mice displayed a lower percentage of ifn- nk cells compared to infected wt mice , which could alter the activation and local differentiation of inflammatory monocytes into tipdcs . inflammatory monocytes are known as the main precursors of tipdcs during parasitic and microbial infections [ 36 , 39 ] . a variety of studies indicate that ly6c monocytes are required to control cerebral toxoplasmosis , and depletion of inflammatory monocytes ( ly6c ) but not neutrophils ( ly6 g ) increases the susceptibility of c57bl/6 mice to oral t. gondii infection [ 4649 ] . therefore , we analyzed the activation state and ability of inflammatory monocytes to differentiate into tipdcs during acute toxoplasmosis . infection with t. gondii , newly recruited monocytes ( ly6c and ly6c ) populated the peritoneal cavity of infected mice in a mif - independent manner . however , the absence of mif reduced the activation of ly6c monocytes as indicated by significant lower inos / tnf- production ( well - established markers for m1 polarization ) . in contrast , this was not observed on ly6c monocytes , suggesting a role for mif in promoting the activation of ly6c monocytes into a m1 profile . furthermore , adoptive transfer of bone marrow ly6c monocytes revealed that mif monocytes were as capable as wt monocytes of converting into tipdcs when transferred to infected wt mice . however , this ability was reduced in both , wt and mif monocytes , when transferred into infected mif mice , demonstrating that the presence of mif in ly6c monocytes has a limited role in the conversion of this population into tipdcs , compared to systemic mif levels released / produced by other cell types during acute t. gondii infection . finally , administration of rmif to infected mif mice over the first 5 days of infection with t. gondii fully restored the resistance of mif mice and reconstituted the absolute numbers of tipdcs as well as serum ifn- levels . enhanced resistance by rmif administration was associated with reduced parasite loads in brain , which indicated a better control of t. gondii infection . our data demonstrate a novel role for mif promoting the resistance to t. gondii - infection by inducing classical activation of inflammatory monocytes ly6c and their conversion into tipdcs . in addition , mif induced ifn--producing nk cells during the acute phase of infection with t. gondii , required for differentiation of inflammatory monocytes into tipdcs . further experiments are required to detail the mechanism by which mif regulates ifn- production in nk cells . the administration of rmif into mif mice fully restored the resistance to acute toxoplasmosis , which highlights the crucial role of this inflammatory mediator in the development of the protective cell - mediated immune response to t. gondii and indicates a potential use of rmif as a therapeutic tool on immune - compromised hosts to control toxoplasmosis and probably other protozoan infectious diseases .

macrophage migration inhibitory factor ( mif ) mediates immunity against toxoplasma gondii infection by inducing inflammatory cytokines required to control the parasite replication . however , the role of this inflammatory mediator in the cell - mediated immune response against this infection is still poorly understood . here , we used t. gondii - infected wt and mif/ mice to analyze the role of mif in the maturation of cd11b+ and cd8+ dendritic cells ( dcs ) . we found that mif promotes maturation of cd11b+ but not cd8+ dcs , by inducing il-12p70 production and cd86 expression . infected mif/ mice showed significantly lower numbers of tnf and inducible nitric oxide synthase- ( inos- ) producing dcs ( tipdcs ) compared to infected wt mice . the adoptive transfer of ly6chigh monocytes into infected wt or mif/ mice demonstrated that mif participates in the differentiation of ly6chigh monocytes into tipdcs . in addition , infected mif/ mice display a lower percentage of ifn--producing natural killer ( nk ) cells compared to wt mice , which is associated with reducing numbers of tipdcs in mif/ mice . furthermore , administration of recombinant mif ( rmif ) into t. gondii - infected mif/ mice restored the numbers of tipdcs and reversed the susceptible phenotype of mif/ mice . collectively , these results demonstrate an important role for mif inducing cell - mediated immunity to t. gondii infection .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

implantation always involves penetration to the skin and damage of smaller or larger blood vessels through the surgical procedure and the implanted scaffold material will have direct contact with human blood . scaffolds as medical implants require assessment of hemocompatibility to predict potential procoagulation or immune system activity [ 1 , 2 ] . antithrombogenic biomaterial is being extensively studied in order to fabricate artificial organs and biomaterials in contact with blood . a significant goal for the application of antithrombogenic biomaterial is to prevent thrombus formation on the material surface . in general , the factors , which influence the hemocompatibility of a material , include the chemical structure of the surface , the hydrophobicity / hydrophilicity , surface charge , surface roughness and the thrombus formation when the surface is in contact with blood . the design of a suitable biomaterial that offers improved blood biocompatibility is highly desirable for blood - contacting devices . the fabrication and design of submicron to nanoscale structural architectures , which geometrically or topologically mimic the native state of extra cellular matrix , have received much attention in regenerative medical applications . electrospinning has recently emerged as a leading technique for the formation of nanofibers because it can produce fibers with diameters ranging from several microns to tens of nanometer depending upon the solution and process parameters . nanofibrous scaffolds have attracted lot of attention as scaffolds for tissue engineering applications due to their structural similarity to extra cellular matrix , having very large surface area to volume ratio , flexibility in surface functionality , superior mechanical properties , and its high porosity [ 5 , 6 ] . zein is a protein present in corn in the seeds of maize in large amounts . due to its biodegradability and biocompatibility , researchers have provided proofs that zein was also used as a biomaterial in various biomedical applications . the proposed uses of zein in biomedical applications are as carriers for drug delivery [ 810 ] , food packaging , and scaffolding materials for cell / tissue culture [ 7 , 12 ] . however the mechanical strength of the electrospun zein scaffold was found to be very low . in an effort to improve the tensile properties of zein nanofiber , we have incorporated zein with the swcnt . due to the unique properties of cnts such as mechanical , electrical , thermal , optical , and structural properties , currently researchers have been being explored its applications in biomedical engineering and medical chemistry [ 13 , 14 ] . researchers have focused on utilizing these remarkable characteristics for engineering applications such as polymeric composites , materials for energy storage , electronics , catalysis , and vaccine delivery . a recent report on safety issues and toxic effects of cnts argued that exposure to pristine cnts causes minimal cytotoxicity at higher concentrations , while chemically functionalized cnts did not show any toxicity for drug delivery applications . furthermore , the cell growth on cnts - based materials has been shown to change cell behavior , such as migration and viability due to the influence of electric fields . however , it has been shown that cnts can be discharged from the body without any side effect or mortality . in recent years , considerable attention has been focused on preparing nanocomposites wherein cnts are dispersed in different polymeric matrices [ 2325 ] . the dispersion of nanometer - sized materials in the polymer medium was suggested as an effective method to increase the mechanical and electrical properties of the system [ 2628 ] . these composites may consist of synthetic polymers [ 29 , 30 ] , naturally derived biopolymers or a combination of both . the reinforcement of naturally derived polymers with cnts is another promising area that is just beginning to be explored . up to date , the nanoscale fillers and polymer composite reinforced with electrospun nanofibers have been developed mainly for providing some outstanding physical ( e.g. , optical and electrical ) and chemical properties and provides superior structural properties such as high modulus and strength to weight ratios . the rigidity and cylindrical shape of cnts make their surfaces good supports for protein crystallization which can improve the mechanical properties of the electrospun nanofibers . supronowicz and webster et al . , have observed that the potential use of composites of synthetic polymers and cnt in neural and orthopedic tissue engineering applications [ 34 , 35 ] . the inert nature and biocompatible chemical surfaces to cells and tissues , multiwalled carbon nanotubes polyurethane composite and poly(carbonate urethane ) have been demonstrated to have excellent antiadhesion to platelets . inspired by these promising results , we aim to develop a novel nanofibrous blood - compatible scaffold incorporating cnts for its reduced thrombogenicity effect and with improved mechanical strength . in addition , electrospinning method offers the synthesis polymer / carbon nanotubes ( cnts ) nanocomposite fibers without compromising the structural integrity of the individual cnts [ 38 , 39 ] . in this study , we have attempted the coelectrospinning method to prepare swcnts - zein nanofiber with different swcnts content ( ranging from 0.2 wt% to 1 wt% ) through a solution - based method , which has the potential of providing much better dispersion of swcnts on the polymer matrix yielding a composite with uniform structure . we are reporting here the effect of swcnts content on the morphology , mechanical properties thermal stability , and its excellent antiadhesion to platelets of zein - swcnt nanocomposite scaffolds . we found that zein - swcnt composite containing 22 wt% zein and 0.8 wt% swcnt is very good candidate for biomaterial applications . the solvent used trifluoro ethanol ( tfe ) was purchased from kanto chemical co. ( tokyo , japan ) used as such without further purification . zein was dissolved in tfe ( 100% ) to form a homogeneous solution and maintained under constant stirring for 24 hrs . zein ( 22 wt% ) was added to the swcnt - tfe mixture and further sonicated for an hour and then stirred for another hour . to fabricate the ultrafine composite nanofibrous scaffold we have used nanon electrospinning setup ( nanon-01a , mecc co. , ltd . , fukuoka , japan ) . for electrospinning , 10 ml of each kind of zein - swcnts solution was loaded into a 10 ml glass syringe and injected through an 18 g stainless - steel blunt - ended needle . the syringe was then placed in a syringe pump at a flow rate of 0.5 mlh . the electric field 2.0 kvcm ( expressed in terms of voltage / distance ) between the collection plate ( cathode ) and the needle tip ( anode ) was applied . the collector covered with aluminum foil placed at 10 cm on which fibers were collected . the morphology and diameters of electrospun fibers were determined using scanning electron microscope ( jsm-7400f , jeol , japan ) . the sample was sputter coated with a thin platinum layer using an autosputter fine coater ( e-1030 ion sputter , hitachi , japan ) before imaging . according to the sem images , additionally , zein - swcnt composite fibers were examined in a tem ( jem 2100 , jeol , japan ) . the samples were prepared by drawing out small fibrils with the aid of tweezers and placed on carbon - coated copper grids . the accelerating voltage used was 120 kv . to measure the thermal properties of the electrospun nanocomposite fibers , the thermal stability was analyzed in a thermogravimetric analyzer ( tga ) ( dtg-60h , shimadzu , japan ) . the runs were performed in the temperature range of 30c to 1000c and consisted of a ramp at a steady rate of 10c min with continuous nitrogen flow . the tensile properties of electrospun nanocomposite fibrous scaffolds , approximately 8 0.03 25 mm ( l w h ) , were characterized using a universal testing machine ( instron 3345 , uk ) equipped with a 500 n load cell . the ends of the rectangular specimens were mounted vertically on two mechanical gripping units of the tensile tester , leaving a 40 mm gauge length for mechanical loading at an extension rate of 1 mm min . the weights of the completely dried films were determined directly with an analytical balance ( wdry ) . strips of zein - swcnt - based scaffold ( 1 cm 2 cm ) were immersed into deionized water at 37c in an incubator for 24 h. the resultant swollen scaffold was gently blotted with filter paper to remove excess surface water and weighed again ( wwet ) . the water uptake ( wt ) of the scaffold is expressed as the percentage of weight obtained using ( 1 ) : ( 1)wt%= wwetwdrywdry100 . to measure the water retention ability , the wet scaffolds were transferred to centrifuge tubes with filter paper at the bottom , centrifuged at 500 rpm for 3 m and weighed immediately ( wwet ) . the percentage of water retention ( wr ) of the scaffolds at equilibrium was calculated using following ( 2 ) : ( 2)wr%=wwet(r)wdrywdry100 , where wwet(r ) is the wet weight after a predetermined time , wdry is the original weight of the sample . the nanocomposite scaffolds ( zein nanofiber ; zein-0.2 wt% swcnt ; zein-0.5 wt% swcnt ; zein-0.8 wt% swcnt ; zein-1 wt% swcnt ) were cut into small pieces and the samples were equilibrated in normal saline water for 30 min at room temperature . rabbit blood obtained from nihon seibutsu zairyo centre , japan . 200 l was added to each scaffold after taking dry weight of each scaffold . after a predetermined time period , 4 ml of saline water added to each sample to stop hemolysis and the samples were kept at constant temperature ( 35c ) for 1 h. positive and negative controls were produced by adding 200 l of rabbit 's blood to 4 ml of distilled water and saline water respectively . was measured at 545 nm using spectrophotometer ( v-650 spectrophotometer , jasco , japan ) . the percent of hemolysis was calculated using ( 3 ) : ( 3)% hemolysis ( hp ) = od of test sampleod of ve controlod of + ve controlod of ve control100 . for platelet adhesion studies , nanocomposite scaffolds of 1.5 1.5 cm size were used . experiments were carried out with anticoagulated rabbit blood bought from the nihon seibutsu zairyo centre , japan . an anticoagulated blood was centrifuged at 2500 rpm for 5 min to obtain platelet - rich plasma ( prp ) . to perform the platelet adhesion examination , then , a sample of 20 l of prp was carefully dropped on the scaffold center . after incubation for 30 min at room temperature ( about 37c ) , the scaffold was carefully rinsed several times in phosphate buffer solution ( ph-7.4 ) to remove non - adhering platelets . adherent platelets on the scaffolds were preserved with 2.5% glutaraldehyde / pbs solution for 30 min , followed by dehydration procedure using a series of ethanol - water mixtures ( 0 , 30 , 50 , 70 , 90 , 100 vol % of ethanol ) for 30 min , respectively . for electron microscopy , samples were then air dried and coated with platinum and examined in a scanning electron microscope ( jsm-7400f , jeol , japan ) . swcnt - zein solutions with varying swcnt concentrations were prepared under sonication without phase separation and maintained homogenous solution . due to the methods of dispersion of the swcnts by sonication and mechanical stirring , the swcnt clusters break down . the addition of zein forms a coating around each individual cnt and keeps them from aggregating or binding together . solutions with 0 wt% , 0.2 wt% , 0.5 wt% , 0.8 wt% , and 1 wt% swcnt content are spun according to the spinning conditions . continuous fibers were obtained using a zein concentration of 24 wt% and electrospinning at a distance of 10 cm under electric field strength of 2 kvcm . as can be seen from figure 1(a ) , the absence of beads and the uniform fibers with smooth surface morphology was obtained for all experimental materials ( figures 1(b)1(e ) ) . among them , the electrospun pure zein nanofibers figure 1(a ) had an average fiber diameter of 230 nm and diameter distribution for all loadings of swcnt in the zein fibers ( figures 1(b)1(e ) ) are all below the 300 nm range . however , at low concentration of nanotubes , relatively good dispersion was achieved , but as the concentration of nanotubes increased from 0.5 wt% to 0.8 wt% and 1 wt% swcnts promoted the creation of web - like structures in comparison with the zein nanofibers without swcnts . random nanofiber structures and web - like structures can be obtained ( figures 1(d ) and 1(e ) ) , whereas the web - like structures consisted of regularly distributed very fine nanofibers with diameters of just about 2040 nm , which were strongly embedded in the zein nanofibers . the web formation could be a result of the inclusion of carbon nanotubes into the fibers . during electrospinning the swcnts are expelled from the polymer jet under extremely high force and velocity , which causes opening of the cluster to form the web - like structure . the zein - swcnt electrospun web like structure is very similar to the structure previously reported with using bombyx mori silk nanofibers containing swcnts . we do believe that these nanowebs were created because of strong secondary electric fields occurring between individual swcnts or their agglomerated form during the electrospinning process . tem analysis of the zein - swcnt nanofibers prepared by the electrospinning process is provided in figure 2 with the aim of analyzing the creation of the nanoweb fiber . the high resolution tem micrograph shows the close inspection on electrospun composite fibers which indicates that the swcnts are embedded in the nanofibers without any sign of agglomerates . in many regions of the electrospun nanofibers ; the embedded nanotubes appeared to be well oriented along the fiber axis . such alignment is obviously associated with the extreme high longitudinal strain rate of jet during electrospinning process , which may cause disentanglement or pulling out of curved nanotubes under high shear force . . similar orientation of cnts in the electrospun nanofibers has also been observed on other composite systems and it confirms that the original dispersion contains individual cnts rather than aggregates or bulk [ 4345 ] . thermogravimetric curves of electrospun zein nanofiber and nanocomposite ( zein - swcnt ; 0.21 wt% ) are shown in figure 3 . thermal analysis shows that the improvement in thermal stability in case of zein - swcnts nanocomposite than that of pure zein nanofiber . the initial weight loss observed for all samples at 80c this can be attributed to the breakdown of the amino acid residues , as well as cleavage of the peptide bonds . the initial degradation temperature is at 230c and full degradation occurs at 455c . from their degradation curves , it seems like the degradation of the swcnt composite fibers occurs in two distinct phases . the electrospun zein fibers on the other hand , have an initial degradation temperature of 280c and final degradation temperature of 370c at which the rate of mass loss is greatest . the 1 wt% swcnt - zein composite fiber has the highest thermal stability , with onset degradation at 250c and full degradation occurring at 470c . du et al . reported that the tensile strength , fracture toughness , and hardness tests showed improved properties up to 7 wt% of cnts . when the cnt content exceeds 7 wt% the mechanical properties of the composites decreases . the tensile strength of pmma by the addition of 3 wt% functionalized cnts increased by 21% , which was low compared to a 90% increase in the modulus of pmma by the addition of 2 wt% nonfunctionalized swcnts . figure 4 illustrates the typical stress strain curves of zein and zein - swcnts composite nanofibrous scaffold . pure zein nanofiber shows a tensile strength of 1.4 mpa , while the tensile strength of zein - swcnts nanofiber increased with increasing swcnts content ( 0.2 ; 0.5 and 0.8 wt% ) to 3.2 mpa . moreover , the zein-0.8 wt% swcnts sample exhibited the maximum strength ( about 7.7 mpa ) . subsequently , further increasing the swcnts content ( 1 wt% ) lead to the decrease of tensile strength ( 6.8 mpa ) of zein - swcnts nanofiber scaffold . it was observed that zein nanofibrous scaffold with swcnts content higher than 1 wt% gives poor mechanical properties , which could be explained due to poor dispersions of the cnt within the fiber , result in forming defects of the scaffold . the above results indicate that the mechanical properties of zein nanofiber can be improved by the addition of swcnts . the tensile tests have revealed that the scaffolds containing swcnts were able to withstand a higher stress than the corresponding unreinforced scaffolds . this can be explained taking into account the tem images , which have clearly shown that the swcnts are aligned within and along the fiber orientation , thereby improving the mechanical properties . nanomaterials have high surface energy and are easy to aggregate , which lead to the poor dispersion of nanomaterials in polymer matrix results in poor mechanical properties . thus , good dispersion of swcnts in a polymer matrix the composite exhibited significant mechanical properties increased by incorporating the cnts . the composite materials were expected to be used as the scaffolds ; hence their water retention ability of the materials to keep water inside the matrix has an important role for the absorption of body fluid and for a transfer of cell nutrients and metabolites through the materials . scaffolds showing higher degree of water uptake will have a larger surface area / volume ratio thus allowing the scaffold to have the maximum probability of cell growth in 3d scaffold . the increase in water uptake the results in figure 5 give the water uptake ratios of five groups of scaffolds . the prepared 3d nanocomposite scaffolds based on zein showed significant water uptake ability ; the values were over 100% , and the highest value reached 128 1.09% for zein nanofiber . after 24 h of water absorption we have observed only 12% difference in the equilibrium water uptake capacity between native ( 128 1.09% ) and composite nanofiber ( 109 0.45% ) with 1 wt% of swcnts . these results demonstrate that the presence of swcnts has led to decrease on the water uptake capacity of the scaffold . the percent water retention values of the nanocomposite scaffolds were measured and showed in figure 5 . we found that the values of water retention were still higher than 75% even if swcnt was used , implying that the scaffolds could retain water whose weight was more than their own . water retention meant that the scaffolds could absorb water to some extent and the tight aggregation of nanofibers might make the scaffold stable in sizes and shapes . in this research work , the hemolysis percentage ( hp ) represents the extent of red blood cells hemolysis when they come in contact with sample . when the polymeric scaffold in contact with blood it must not induce thrombosis , thromboembolisms , antigenic responses , destruction of blood constituents , plasma proteins , and so forth . thus , biocompatibility , especially blood compatibility , is the most important property with regard to biomedical materials . results obtained for hemolysis of rabbit blood with nanocomposite scaffolds were shown in table 1 . the positive reference ( 100% lysis ) was blood / water mixture and the negative reference ( 0% lysis ) was a blood / saline mixture . each absorbance data point was obtained by measuring three samples and also the deviations of the three tests were determined . this results well within the permissible limit set by autian , who reported that a value of up to 5% hemolysis is permissible for biomaterials . the maximum hp value ( 4.0 0.29% ) when the swcnts content of the zein was altered , no significant difference was observed in the hemolysis assay , indicating good character of antihemolysis among all the zein - swcnts nanofiber scaffolds ( table 1 ) . it may be conclude from the hemolysis percentage that the zein - swcnt composite scaffold may be suitable as biomaterials for specific implant clinical application purpose . to determine the hemocompatibility of the zein - swcnt composite nanofiber scaffolds , as is well known , platelet adhesion has generally been applied to evaluate the hemocompatibility of materials . when a foreign material comes into contact with blood , the initial blood response is the adsorption of blood proteins , followed by platelet adhesion and the activation of coagulation pathways , leading to thrombus formation . the morphologies of activated platelets can be divided into 5 categories including dendritic , dendritic spread , spread , fully spread , and nonviable . these criteria were used to assess the activation state of the platelets that adhered to the surface of zein - swcnt in the current study . figure 6 shows the electron micrographs of platelet adhesion on zein and zein - swcnt composite nanofiber scaffolds . as can be seen from the photomicrographs , the both platelet adhesion and activation are observed on the zein nanofiber ( figure 6(a ) ) . the promotion of activation and adhesion of platelets was obviously due to the presence of nanofibers . we have observed a trend in the direction of decrease in platelet adhesion and absence of activation while increasing the swcnts and found very low in 1 wt% swcnt - zein composite ( figure 6(e ) ) , which might be due to a lower water adsorption . however , on zein nanofiber scaffold with a higher swcnt content , some of the platelets have extended , but many retain a discoid shape which is similar to the original shape of the platelet and indicates an unactivated state . changes in surface chemistry or roughness of sample surface will have an effect on the adsorption characteristic . surfaces with negatively charged groups were reported to be antithrombogenic , whereas positively charged surfaces are thrombogenic . we hypothesize that the decrease in the platelet adhesion on the zein - swcnt composite is influenced by the surface chemistry as well the surface morphology , where hydrophilic repulsion occurs and prevented the direct contact between the platelets with the zein - swcnt composite surface . these results may suggest that zein - swcnt nanofibrous composite containing 22 wt% zein and 0.8 wt% swcnt could be a potential candidate for anti - thrombogenicity , which would be particularly useful for artificial blood prostheses . we have developed nanofibrous nanocomposite scaffolds which were prepared by electrospinning of zein and zein - swcnts solutions . microscopy images show good dispersion of swcnts and the composite exhibited significant mechanical properties as well as thermal stability of electrospun zein - swcnt nanocomposites . we have demonstrated that when the swcnts content of the zein was altered , no significant difference was observed in the hemolysis assay , while it did alter the response in platelet adhesion with the absence of platelet activation on zein - swcnt composite . this suggested that platelet activation could be efficiently suppressed on this nanostructured composite with its excellent antiadhesion and subsequently low platelet activation . the developed zein - swcnt composite with homogeneous microstructure and improved mechanical properties can be used as a potential biomaterial for implant applications .

design of blood compatible surfaces is required to minimize platelet surface interactions and increase the thromboresistance of foreign surfaces when they are used as biomaterials especially for artificial blood prostheses . in this study , single wall carbon nanotubes ( swcnts ) and zein fibrous nanocomposite scaffolds were fabricated by electrospinning and evaluated its antithrombogenicity and hydrophilicity . the uniform and highly smooth nanofibers of zein composited with different swcnts content ( ranging from 0.2 wt% to 1 wt% ) were successfully prepared by electrospinning method without the occurrence of bead defects . the resulting fiber diameters were in the range of 100300 nm without any beads . composite nanofibers with and without swcnt were characterized through a variety of methods including scanning electron microscopy , transmission electron microscopy , thermogravimetric analysis , and tensile mechanical testing . the water uptake and retention ability of composite scaffolds decreased whereas thermal stability increased with an addition of swcnts . hemolytic property and platelet adhesion ability of the nanocomposite ( zein - swcnts ) were explored . these observations suggest that the novel zein - swcnts composite scaffolds may possibly hold great promises as useful antithrombotic material and promising biomaterials for tissue engineering application .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

the purpose of this study was to investigate the efficacy and safety of fixed dose combination ( fdc ) of olanzapine 5 mg and fluoxetine 20 mg in indian patients with severe or treatment resistant depression . this was an open , non - comparative study of seven weeks duration with an initial placebo run in period of one week . one hundred and forty - four patients completed the study as per protocol and 151 patients were safety evaluable . one hundred and eleven patients ( 77% ) received one tablet of fdc of olanzapine 5 mg / fluoxetine 20 mg once daily for 6 weeks , in patients ( 14% ) , the dose was stepped up at the end of 2 weeks to 2 tablets of fdc of olanzapine 5 mg/ fluoxetine 20 mg once daily for a further 4 weeks and 13 patients ( 9% ) required dose to be stepped up at the end of 4 weeks to 3 tablets of fdc of olanzapine 5 mg and fluoxetine 20 mg once daily for last 2 weeks . one hundred and thirty four patients ( 93% ) responded to fdc of olanzapine and fluoxetine therapy ( a responder was defined as a patient with 50 % reduction over baseline in hdrs total score at the end of therapy).statistically significant ( p < 0.0001 ) reductions in hdrs total score , madrs total score and cgi severity scores were seen with olanzapine/ fluoxetine combination . one hundred and four patients ( 72% ) were remitters ( hdrs total score of < 7 ) after 6 weeks of therapy . treatment with fdc of olanzapine 5 mg / fluoxetine 20 mg was highly effective and well tolerated in indian patients with severe or treatment resistant depression .

objective : the purpose of this study was to investigate the efficacy and safety of fixed dose combination ( fdc ) of olanzapine 5 mg and fluoxetine 20 mg in indian patients with severe or treatment resistant depression.design : this was an open , non - comparative study of seven weeks duration with an initial placebo run in period of one week.method : one hundred and fifty three patients were enrolled . one hundred and forty - four patients completed the study as per protocol and 151 patients were safety evaluable . one hundred and eleven patients ( 77% ) received one tablet of fdc of olanzapine 5 mg / fluoxetine 20 mg once daily for 6 weeks , in patients ( 14% ) , the dose was stepped up at the end of 2 weeks to 2 tablets of fdc of olanzapine 5 mg/ fluoxetine 20 mg once daily for a further 4 weeks and 13 patients ( 9% ) required dose to be stepped up at the end of 4 weeks to 3 tablets of fdc of olanzapine 5 mg and fluoxetine 20 mg once daily for last 2 weeks . results : one hundred and thirty four patients ( 93% ) responded to fdc of olanzapine and fluoxetine therapy ( a responder was defined as a patient with 50 % reduction over baseline in hdrs total score at the end of therapy).statistically significant ( p < 0.0001 ) reductions in hdrs total score , madrs total score and cgi severity scores were seen with olanzapine/ fluoxetine combination . one hundred and four patients ( 72% ) were remitters ( hdrs total score of < 7 ) after 6 weeks of therapy.adverse experiences were reported by thirty one patients ( 20.5% ) . majority of them were mild in intensity . no serious adverse event was recorded with study therapy . three patients were withdrawn from the therapy due to adverse event.conclusion : treatment with fdc of olanzapine 5 mg / fluoxetine 20 mg was highly effective and well tolerated in indian patients with severe or treatment resistant depression .

Objective : Design : Method : Results : Conclusion :

for ensuring post - endodontic restorations which provide tooth function and form with adequate force distribution , placement of fiber posts to the root canal are used commonly.1 moreover , the placement of a post is often needed for the restoration of a root canal treated tooth in order to support the core material.2,3 due to the requirement for aesthetics , circular fiber posts have recently gained popularity and these materials are developed gradually.2 the lack of adaptation of the circular posts to the canal walls are filled with resin cements . but , the major factor for clinical performance of the post supported restorations is cement thickness.4 adhesive failures associated with fiber posts are common and usually happens along the resin cement that fills the post - dentin interface.5 although the ideal thickness of the resin cement needed to improve retentive bond strength is unknown , the fit of the fiber posts into the post spaces should be as tight as possible.6 ovoid shaped fiber posts have recently been introduced because of the clinical problems in oval - shaped canals , especially in canines and mandibular premolars.7 oval fiber posts are produced to mimic the oval - shaped canals , thus it can be a better fit to the post - spaces.7,8 the present study evaluated whether the push - out bond strength to dentin varies between oval and circular fiber posts , and how the resin cement thickness around oval and circular fiber posts cemented into oval shaped canals differed . the first null hypothesis of the current study was that the push - out bond strength is not significantly different circular versus oval fiber posts in ovoid root canals . the second null hypothesis of the current study was that the resin cement thickness is not significantly different circular versus oval fiber posts in ovoid root canals . eighteen human mandibular first premolars with similar size that was free of restoration and caries , and that had been stored in normal saline solution immediately after extraction , were used in this study . first , the root canals were determined as ovoid shape when the ratio of the bucco - lingual to mesio - distal root canal diameter , calculated at 5 mm from the apex , was 2 , as described by wu et al.9 in addition , all teeth were scanned with a cone - beam computerized tomography ( newtom 5 g fp , verona , italy ) to identify the oval - shaped root canals . external debris on the teeth was removed with a cavitron ( cavitron ; dentsply , york , pa , usa ) and the root surfaces were gently scraped with curettes to clean periodontal ligament remnants . the crowns of the teeth were removed at the cemento - enamel junction with a slow - speed diamond saw ( isomet ; buehler , lake bluff , il , usa ) under water cooling . the root canal lengths were standardized by cutting the roots to a uniform length of 14 mm . the root canals were prepared with protaper ni - ti rotary instruments ( dentsply maillefer , ballaigues , switzerland ) up to protaper f3 instrument . irrigation was performed using 5 ml of 2.5% naocl between each instrument during the cleaning and shaping of the root canal . the final irrigation was performed using 5 ml of 17% ethylenediaminetetraacetic acid ( edta ) for 1 minute , followed by copious irrigation with distilled water . after drying with paper points , the root canal treatments were done with a cold lateral condensation technique using gutta - percha ( dentsply maillefer , petropolis , rj , brazil ) and resin sealer ( ah plus ; dentsply detrey gmbh , konstanz , germany ) . the pulp chambers of the roots were temporarily filled with cavit ( 3 m espe ag , seefeld , germany ) , and the roots were stored at 37 , 100% humidity for 7 days . after storage , roots were randomly separated into two groups for oval and circular fiber posts ( n=9 ) and the procedures mentioned below were done by one operator in a standardized procedure . tochigi , japan ) was used to remove the gutta - percha and the post spaces were all prepared with special preparation drills ( d.t . # 0.5 and d.t . # 2 , bisco inc . , schaumburg , il , usa ) to a depth of 10 mm from the cemento - enamel junction under continuous water cooling from a handpiece ( 25 ml / min ) . group 2 : a # 2 gates glidden bur was used to remove the gutta - percha ( mani inc . ) and an oval - shaped medium - grit ( 76-m ) diamond - coated ultrasonic tip ( ellipson tip ; rtd / satelec , merigcac , france ) that was mounted on an ultrasonic unit ( satelec p5 newtron xs ; acteon group , mount laurel , nj , usa ) at medium power until a 10-mm post space was obtained . incessant water cooling from a handpiece ( 25 ml / min ) was used at the entire stages of the preparations . the oval fiber posts ( with an apical width and thickness dimensions are 1.1 and 0.5 mm , respectively ; whereas the bucco - lingual dimension is 1.9 mm , and mesio - distal dimension is 1.1 mm cervically ) and circular fiber posts ( with an apical diameter of 1 mm ; and cervical diameter of 1.8 mm ) were then luted with dual - polymerizing luting agent ( panavia f 2.0 , kuraray , japan ) to the post spaces . the posts were cleaned properly with alcohol , rinsed with distilled water , and air - dried . the ed primer ii ( kuraray , japan ) was mixed at a ratio of 1 : 1 , applied to the dentin walls of the post spaces using a microbrush ( microbrush x , microbrush corp , grafton , wi , usa ) for 30 seconds , and slowly air - dried ; the excess was then removed with paper points . panavia f 2.0 was mixed for 20 seconds and placed in the post spaces using a lentulo spiral filler ( dentsply - maillefer ) . cement was polymerized for 40 seconds using a light - polymerizing unit ( 3 m espe , elipar s10 , germany ) by placing the light tip perpendicular to the post for 40 seconds . then , the roots were stored at 37 , 100% humidity for 7 days before testing . each root was cut horizontally with a slow - speed diamond saw ( buehler ) to obtain six 1-mm - thick specimens ( two apical , two middle , and two cervical ) . afterwards , all specimens were examined with an operation microscope ( zeiss , opmipico , germany ) to determine any artifacts arised by the slicing process , and no artifacts were observed . a digital image of each specimen was taken to measure the resin cement thicknesses using a metallographic optical microscope ( leica , germany ) with 5 magnification . eight points were determined in each digital image and resin cement thicknesses were measured between the canal wall and the fiber - post perimeter at these points . following the resin cement thickness measurement procedures , the push - out tests were done at a cross - head speed of 0.5 mm / min with a universal testing machine ( instron , canton , ma , usa ) . due to the tapered design of the posts , three different sizes of plungers were used for the push - out tests . the diameter of the plunger was 1 mm for the cervical two specimens , 0.5 mm for the two middle specimens , and 0.3 mm for the two apical specimens . the force ( f ) required to dislodge the fiber posts was transformed into tension ( in mpa ) by dividing the dislodgement force in newtons by the interfacial area of the post fragment . transformation to mpa was calculated differently for the different geometrical shape of the circular and oval fiber posts . for circular posts that were considered truncated cones , the method used to transform to mpa was similar to that used by costa et al.10 the upper and lower diameters of the specimens were measured individually , and the following formula was used : mpa = f / sl . sl was calculated using the following equation : sl=(r+r)g ; where sl = sealer adhesion area ; =3.14 ; r = mean radius of the cervical post ( mm ) ; r = mean radius of the apical post ( mm ) ; g = slice thickness ( mm ) . the above formula could not be used because the oval post specimen shape is not considered a truncated cone . the oval post presents a section made up of a rectangle and two equal circular segments . therefore , a fragment of an oval post was considered as a geometric solid figure made up of a truncated rectangular based pyramid ( thicker lines ) and two equal parts of a truncated cone . therefore the lateral surface area was calculated using a method similar to that used by coniglio et al.7 two digital images of each specimen were taken from apical and cervical sides using a metallographic optical microscope with 5 magnification . then , an image processing software program ( photoshop cs5 , adobe , san jose , ca , usa ) was used to determine points ' axis and ordinate as pixel . r1 , r2 , oh , o'h ' hd , h'd ' , ab , a'b ' distances stated in the formula were translated to mm from the pixel format : sl={r12arccos[1/r1oh]+r22arccos[1/r2oh]}[(r1-r2)+ h]+(hd+hd ' ) [[(ab - ab')/2]+ h ] ; where o = the center of the circle of the oval post section ; h= the intersection of the major ( cf ) and minor axis ( de ) of the oval post ; a , b , d , e= the corners of the oval post section ; r1=mean radius of the cervical side of the post ( mm ) ; r2=mean radius of the apical side of the post ( mm ) ; and o was calculated with an analytical geometry rule which is the center of the circle from three identified points ( a , b , c points ) . the symbol ( ' ) indicates the equivalent segments on both sides of the specimen . two separate kruskal - wallis anova on ranks were applied to compare the push - out and resin cement thickness data in each canal third . mann - whitney u - tests were done to detect differences between the oval and circular post groups for each canal third . statistical analyses were performed using sigmastat software , version 12.0 ( systat software , san jose , ca , usa ) , and the statistical significance was determined as p<.05 . table 1 is presented to show push - out test results . in terms of the push - out test results of the cervical , middle and apical specimens of the oval and circular fiber - post groups , comparisons in terms of root segments for the oval fiber - post group revealed that the bond strengths in the apical specimens were lower than in the cervical specimens and the middle specimens ( p<.05 ) . the bond strength results in the cervical and middle specimens did not reveal statistically significance ( p>.05 ) . when the bond strengths were evaluated in terms of the root segments for the circular fiber - post group , significantly higher bond strength values were measured in the cervical compared with the apical specimens ( p<.05 ) . there were no significant differences between the bond strengths in the cervical and middle specimens and in the middle and apical specimens ( p>.05 ) . the resin cement thicknesses of the oval posts were higher than those of the circular post group in the cervical , middle and apical specimens ( p<.05 ) ( table 2 ) . circular posts had a significantly higher resin cement thickness in the cervical third than in the apical and middle thirds ( p<.05 ) . in addition , the resin cement layer of the oval posts was thicker in the cervical and apical specimens than in the middle specimen ( p<.05 ) . according to the chi - square test for the failure mode comparisons within the groups no significant differences were revealed ( p>.05).the most frequent type of failure mode in all groups was adhesive failure between cement and dentine . to reflect the root canal morphology after drilling the root canals in oval shaped teeth and to eliminate possible disadvantages of circular fiber posts , oval fiber posts were developed with a minimally invasive diamond - coated ultrasonic tip.8,11 the anatomical , oval ellipson fiber post is formed with a high percentage loading 64% vol . ( 80% wt . ) of pretensed long continuous unidirectional quartz fibers with epoxy resin , and is radiopaque . ellipson post has an elastic modulus of 13 gpa , and a flexural strength of 1600 mpa , and has no risk of corrosion . the ellipson tip for the minimally invasive oval preparation with ultrasonic , is stainless steel with a diamond coated tip of 76 micron grain , a diameter of 1.8 mm and has depth gauge markings . this tip can be used to simultaneously remove root canal filling material , clean the canal and shape the canal to adapt the oval ellipson fiber post.12 to assess the bond strength between fiber posts and the root canal dentin , conventional shear and tensile tests , microshear , microtensile , and pull - out and push - out tests have been used.13,14,15,16 it is suggested that the bond strength is better obtained by the push - out test than with the conventional shear test because the fracture occurs parallel to the dentin bonding interface in the push - out test , which makes it a true shear test.13 chen et al.17 stated that , the stresses concentrate at the filler - loading pin and filler - dentin interfaces in push - out method . additionally , as premature failures occur during specimen preparation and because of the large data distribution observed in microtensile tests , the push - out test is considered more reliable.15,16,18 the shear stress achieved with the push - out tests is comparable to the stress , under clinical conditions , at the interface between the dentin and the luting cement , as well as between the post and the luting cement.19 according to a previous study , investigators showed the pin diameter , specimen thickness , and elastic modulus of the filling material all affected the push - out bond strength values.17 in the present study , luting resin cement , specimen thickness and pin diameter was set standard ; also , oval and circular posts have the same elastic modulus . this situation might be one of the factors that lead to similar push - out results between the groups . to determine the interfacial area of the circular and oval fiber posts , which have different geometrical shapes , two distinct formulas were applied to calculate the push - out bond strength in megapascals . the interfacial area of the circular fiber - post specimens was calculated as described by costa et al.,10 whereas a specific formula that was introduced by coniglio et al.7 was modified in the present study to calculate the interfacial area of the oval fiber - post specimens . in this study , the push - out bond strengths and resin cement thicknesses of two post systems were evaluated . the push - out bond strengths of the oval and circular fiber posts were not significantly different . therefore , the results obtained support the first null hypothesis that the push - out bond strengths of the oval and circular fiber posts would not differ significantly in ovoid root canals . these results are in agreement with those of coniglio et al.,7 who found that the oval tip - oval post system resulted in comparable push - out bond strength values to the circular drill - post system . the results of the study do not support the second hypothesis that the resin cement thickness would not differ significantly whether oval and circular fiber posts were used in ovoid root canals . muoz et al.20 reported no significant difference in resin cement thicknesses between oval and circular fiber posts , whereas coniglio et al.8 showed that the resin cement thicknesses of oval fiber posts were significantly less than those of circular fiber posts in ovoid root canals . in a recent study , rengo et al.21 evaluated the volume of luting cement around the oval and circular fiber posts by means of ct imaging in ovoid root canals ; and found that there were significantly higher cement thicknesses around oval post group than the circular post group as our study . in the present study , the resin cement thicknesses of the oval fiber posts were significantly greater than those of the circular fiber posts . in our study , the cervical diameter of the circular fiber posts was 1.8 mm , whereas the oval fiber posts had a bucco - lingual dimension of 1.9 mm , and a mesio - distal dimension of 1.1 mm cervically . further , the apical diameter of the circular fiber posts was 1 mm , and the apical width and thickness dimensions of the oval fiber posts were 1.1 and 0.5 mm , respectively . the explanation for the smaller resin cement thickness of the circular fiber posts in our study may be related to the wider mesial - distal dimension of circular fiber posts compared to oval fiber posts . in addition , the vibration of the medium grit diamond - coated ultrasonic tip used for oval fiber posts might have resulted in a wider post space than the original dimension of the post . therefore , using the fine grit diamond - coated ultrasonic tip could be recommended for achieving lower resin cement thicknesses.8 the differing results of muoz et al.20 and coniglio et al.8 may be related to the circular fiber post diameters that were not explained clearly in these studies . additionally , in these studies the post space lengths were 11 and 8 mm , respectively , whereas our study used 10-mm post - space lengths . furthermore , in our study root canals were prepared using protaper system up to f3 instrument . however , muoz et al.20 and coniglio et al.8 prepared narrower root canals in their study , with protaper f2 and mtwo 25/0.6 as the master apical files , respectively . in the present study , for both oval and circular fiber posts , the bond strengths in the apical specimens were significantly lower compared to the cervical specimens . factors possibly affecting the lower bond strengths to root dentin in the apical root specimens could be the non - uniform adaptation of the luting agent or its incomplete polymerization , both related to the difficult access of postspace walls during handling.22 the oval and circular posts used in the current study were both of quartz fiber . the only criterion that may affect the push - out bond strength is resin cement thickness . previous studies reported that , regardless of the anatomy of the posts , the resin cement thickness did not affect the push - out bond strength.8,23,24 in the light of the results of the current study , the resin cement thickness in the oval fiber - post group was greater than in the circular fiber - post group , and resin cement thickness did not affect the push - out bond strength . when considering failure modes after push - out tests , there were no significant difference between groups ; in addition , adhesive failure between dentin and cement were the most frequent type ; and this shows the weak link between the root dentin and luting cement . the situation might be a result of debris that have remained on canal walls and reduced the bonding . according to the results , it can be stated that resin cement thickness does not affect the push - out bond strength .

purposethe aim of this study was to evaluate whether the push - out bond strength varies between oval and circular fiber posts , and to examine the effect on the resin cement thicknesses around the posts.materials and methodseighteen mandibular premolar roots were separated into two groups for oval and circular fiber posts systems . post spaces were prepared and fiber posts were luted to the post spaces . roots were cut horizontally to produce 1-mm - thick specimens . resin cement thicknesses were determined with a metallographic optical microscope and push - out tests were done.resultsno significant differences were observed in terms of push - out bond strength between the oval and circular fiber posts ( p>.05 ) the resin cement thicknesses of the oval posts were greater than those of the circular posts group in the coronal , middle and apical specimens ( p<.05).conclusionin the light of these results , it can be stated that resin cement thickness does not affect the push - out bond strength .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

pediatric soft - tissue sarcomas ( stss ) account for approximately 7% of all childhood tumors . out though surgery is the mainstay of treatment , advent of neoadjuvant chemotherapy ( nact ) has reduced the incidence of recurrence / metastasis . we present a case of ifs with early and unusual distant metastasis , localized on fluorodeoxyglucose positron emission tomography - computed tomography ( fdg pet - ct ) scan . the patient , a 4-year - old girl child , is a known case of ifs , primarily involving right proximal tibia and staging whole body pet / magnetic resonance ( mr ) scan not suggestive of disease elsewhere . she was detected with local relapse 3 months later for which she underwent chemotherapy followed by right above knee amputation . on physical examination , she had a palpable mildly tender lump in right proximal thigh . an mr imaging of the right thigh was obtained , which showed a neoplastic lesion involving right proximal shaft of femur . the maximum intensity projection [ figure 1 ] was suggestive of significant tracer uptake in right facial , lower lumbosacral , and bilateral proximal thigh regions . the axial ct and fused pet - ct images demonstrated fdg avid hypermetabolic foci in soft - tissue lesions involving right zygoma with intraorbital extension ( maximum standardized uptake value [ suvmax 9 ] ) [ figure 2a ] , right proximal femur [ suvmax 6.1 , figure 2b ] , sacrum with involvement of right sacroiliac joint [ suvmax 16 , figure 2c ] , and right suprascapular region [ suvmax 9 , figure 2d ] . maximum intensity projection of f-18 fluorodeoxyglucose positron emission tomography - computed tomography showing increased tracer uptake in regions pointed by arrowheads transaxial computed tomography and fusion positron emission tomography - computed tomography images on f-18 fluorodeoxyglucose positron emission tomography - computed tomography scan showing fluorodeoxyglucose avid hypermetabolic foci in soft - tissue lesions involving ; ( a ) right zygomatic bone with intraorbital extension , ( b ) right proximal femur , ( c ) sacrum and right sacroiliac joint , and ( d ) right suprascapular region subsequently , biopsy was obtained from sacral and right proximal femoral lesions . the tumor cells were arranged in interlacing fascicles and herringbone pattern [ figure 3a ] , with pleomorphic nuclei and brisk mitotic activity of > 10/10 hpf . microscopic images of hematoxylin and eosin stained biopsy slides obtained from sacral and right proximal femur lesions showing ; ( a ) arrangement of tumor cells in interlacing fascicles and herringbone pattern , with ( b ) multiple blood vessels dispersed within the tumor tissue ifs has incidence of 5 per million in the pediatric age group and majority of the patients are < 2 years old . although its etiology is unknown , a fusion transcript etv6-ntrk3 resulting from a chromosomal translocation t(12;15 ) is commonly associated . the extremities account for the primary in almost 74% of the cases , followed by head and neck region . most common site of origin is around knee joint followed by thigh and hip regions . the pathologic appearance of ifs includes spindle cells with many blood vessels arranged in hemangiopericytoma - like fascicular pattern . advent of nact allowed conservative surgeries and decreased local as well as metastatic relapses . in a large study comprising 56 infants by orbach et al . seventy - three percent of these were found to be chemosensitive and 22% maintained stable disease . performed a retrospective study with 11 patients who were treated with surgery alone or nact + surgery . rest , all were followed up for varying periods of 18 months to 13.5 years and were found to be disease free . three patients who had primary in extremities achieved complete remission and were disease free even after 2 years of follow - up . one infant had a neck primary and developed metastases to brain , lungs , and kidneys , which responded to chemotherapy . in addition , studies have proved that ifs carries overall 5-year survival rate of > 85% . overall , 1743% of cases present with local recurrence within 1 year after curative treatment . further , ifs originating from extremities is found less likely to cause distant metastases ( 8% ) than axial ifs ( 26% ) . who classification of stss categorizes ifs in intermediate rarely metastasizing neoplasm , which is defined as the ones which have a documented ability to metastasize but seldom do . as a group , they have < 2% chances of distant spread which can not be predicted on the basis of histomorphology . the more common sites of distant metastasis are lungs and lymph nodes although distant seeding of kidneys and brain have been documented . it has been well documented in adult stss for staging , response evaluation , and recurrence setting . in a meta - analysis , the sensitivity and specificity of fdg pet - ct in identifying primary as well as metastatic disease in stss were found to be 92% and 73% . chen et al . reported a case of ifs with local recurrence demonstrated by fdg pet - ct . the lesion was found to be low - grade fdg avid ( suvmax < 2.5 ) . our case of this rare pediatric neoplasm originating from an extremity uniquely presented with distant soft - tissue metastasis within 1 year of receiving nact and surgery . the fdg avidity of metastatic lesions was unusually high unlike reported in the literature so far . our findings revealed fdg pet - ct as a potentially useful tool in detection of metastatic disease recurrence in ifs cases . furthermore , metabolic parameters such as suvmax can be evaluated as prognostic tools to assess the tumor aggressiveness .

infantile fibrosarcoma ( ifs ) is a rare soft - tissue sarcoma originating from extremities and occasionally from axial soft tissue . the prognosis is good with favorable long - term survival . it is rarely metastasizing tumor , the chances being lesser with ifs originating from extremities . use of neoadjuvant chemotherapy ( nact ) as a treatment regime further reduces the chances of local relapse and distant metastasis . the organs commonly affected in metastatic ifs are lungs and lymph nodes . we report an unusual case of an ifs originating from extremity , which received nact , yet presented with an early metastatic disease involving soft tissues and sparing lungs and lymph nodes , as demonstrated on fluorodeoxyglucose positron emission tomography - computed tomography .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

we studied 1,297 patients with type 1 diabetes from the nationwide finnish diabetic nephropathy study ( finndiane ) . patients were required to have an onset of diabetes before 35 years of age and initiation of permanent insulin treatment within 1 year of diagnosis . patients were classified into four groups based on the urinary albumin excretion rate ( aer ) or the presence of end - stage renal disease ( esrd ) ( table 1 ) . patients with normal aer were required to have a duration of diabetes over 15 years . serum concentration of mbl was determined in 1,064 patients ( available in the supplemental methods at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1495/dc1 ) . for nondiabetic control subjects , 701 finnish blood donors ( 49% men ; mean age 46.1 years ) from all over the country were applied and compared with an age- and sex - matched subgroup of patients with type 1 diabetes ( n = 701 ; 49% men ; mean age 43.9 years ) . the power of our study sample was calculated using the genetic power calculator ( http://pngu.mgh.harvard.edu/purcell/gpc/ ) ( 21 ) . clinical characteristics of the patients grouped by their nephropathy status data are means sd , median ( interquartile range ) , or percent unless otherwise indicated . patients were classified into three groups based on the aer in at least two of three consecutive overnight or 24-h urine collections . a fourth patient group consisted of patients on dialysis ( n = 34 ) and patients who had received a kidney transplant ( n = 144 ) and were thus classified as having esrd . the 24-h aer and serum creatinine values were derived from the last central laboratory measurements . therefore , single values may exceed or fall behind the thresholds for the classification due to effects of treatment . estimated glomerular filtration rate ( egfr ) was calculated using the cockcroft - gault formula adjusted for body surface area ( ref . < 0.0001 versus microalbuminuria . p < 0.01 versus microalbuminuria . p < 0.0001 versus macroalbuminuria . dbp , diastolic blood pressure ; dnp , diabetic nephropathy ; sbp , systolic blood pressure . we selected 17 snps using the hapmap database release 21a ( ceu ) ( http://www.hapmap.org/ ) and the haploview tagger program ( http://www.broad.mit.edu/mpg/haploview/index.php ) ( 22 ) from a 23-kb region covering the 6.3-kb mbl2 gene and the 5 untranslated region and 3 untranslated region . snps were chosen to capture all known hapmap snps having a minor allele frequency ( maf ) > 0.01 in the ceu population with pairwise r 0.8 . additionally , three functional snps ( allele c , allele d , and variant comparisons between groups were performed using the mann - whitney u test because mbl concentrations were not normally distributed . these analyses were done using the spss v. 15.0 software ( spss , chicago , il ) . allele frequencies and genotype distributions for single snps were compared between the control subjects and the matched subset of patients with type 1 diabetes as well as between patients with macroalbuminuria and patients with type 1 diabetes but normal aer . we also compared patients having esrd with patients with normal aer and compared a combined group of patients with macroalbuminuria or esrd with patients with normal aer . an allelic association test and three genotypic tests ( general , dominant , and recessive models ) were performed for each snp . additionally , analyses with adjustment for potential confounders ( age , sex , a1c , diabetes duration , and history of smoking ) were performed . the plink analysis program , version 1.00 , was applied in all analyses ( http://pngu.mgh.harvard.edu/purcell/plink/ ) ( 23 ) . for haplotype association analyses , we selected 17 snps using the hapmap database release 21a ( ceu ) ( http://www.hapmap.org/ ) and the haploview tagger program ( http://www.broad.mit.edu/mpg/haploview/index.php ) ( 22 ) from a 23-kb region covering the 6.3-kb mbl2 gene and the 5 untranslated region and 3 untranslated region . snps were chosen to capture all known hapmap snps having a minor allele frequency ( maf ) > 0.01 in the ceu population with pairwise r 0.8 . additionally , three functional snps ( allele c , allele d , and variant comparisons between groups were performed using the mann - whitney u test because mbl concentrations were not normally distributed . these analyses were done using the spss v. 15.0 software ( spss , chicago , il ) . allele frequencies and genotype distributions for single snps were compared between the control subjects and the matched subset of patients with type 1 diabetes as well as between patients with macroalbuminuria and patients with type 1 diabetes but normal aer . we also compared patients having esrd with patients with normal aer and compared a combined group of patients with macroalbuminuria or esrd with patients with normal aer . an allelic association test and three genotypic tests ( general , dominant , and recessive models ) were performed for each snp . additionally , analyses with adjustment for potential confounders ( age , sex , a1c , diabetes duration , and history of smoking ) were performed . the plink analysis program , version 1.00 , was applied in all analyses ( http://pngu.mgh.harvard.edu/purcell/plink/ ) ( 23 ) . for haplotype association analyses , the 17 tag snps genotyped captured the 68 hapmap snps having an maf>0.01 with a mean pairwise r of 0.97 . all snps were in hardy - weinberg equilibrium ( p > 0.01 ) both in the healthy control subjects ( supplementary table 1 ) and in type 1 diabetic patients ( data not shown ) . the frequencies of the exon 1 variants were 0.13 ( b ) , 0.06 ( c ) , and 0.006 ( d ) in the healthy subjects , which is in line with the previously published frequencies in the finnish population ( 17 ) . of the patients with diabetes , 30.6% were heterozygous carriers of one of these variants ( a / o genotype ) and 5.8% were homozygotes or compound heterozygotes ( o / o genotype ) . the median serum concentration of mbl was higher in patients with macroalbuminuria ( 1,881 g / l [ interquartile range 6083,124 ] ) than in patients with normal aer ( 1,548 g / l [ 5142,635 ] ) ; p = 0.019 ( fig . 1 ) . supplementary table 2 shows the distribution of the mbl2 diplotypes and the corresponding median mbl concentrations . as expected , the carriers of the exon 1 variants and the individuals homozygous for the x promoter polymorphism had clearly reduced mbl concentrations , with a median of 397 g / l . when the patients were stratified both by nephropathy status and mbl2 diplotype category , it was evident that patients with macroalbuminuria had significantly higher mbl concentrations than patients with normal aer for two of the six ( ya / ya : p = 0.0002 ; ya / yo : p = 0.003 ) diplotype categories ( supplementary table 2 and fig . box plot diagram showing the distribution of serum mbl concentrations , for patients with type 1 diabetes , stratified by nephropathy status . black horizontal lines , median values ; , interquartile ranges ; , outliers . 1,881 g / l [ interquartile range 6083,124 ] ) than in patients with normal aer ( 1,548 g / l [ 5142,635 ] ) , p = 0.019 . the median concentration was 1,645 g / l ( 5313,220 ) in patients with microalbuminuria and 1,359 g / l ( 3432798 ) in patients with esrd , p = 0.17 and p = 0.45 , respectively , compared with patients with normal aer . distribution of serum mbl concentrations in patients with normal aer and patients with macroalbuminuria , stratified by the mbl2 diplotype . there were no significant differences in allele frequencies or genotype distributions between the patients with type 1 diabetes and nondiabetic control subjects ( supplementary table 3 ) . although nominal evidence of allelic association ( p = 0.010.04 ) was seen for four snps ( rs930507 , rs2384045 , rs11003132 , and rs11003137 ) , the p values did not remain significant after correction for the number of tests performed . men and women were also tested separately , but no significant p values were achieved ( data not shown ) . association analyses showed no significant differences in allele frequencies or genotype distributions between patients with macroalbuminuria and patients with type 1 diabetes but normal aer ( supplementary table 4 ) . when patients with esrd were compared with patients with normal aer , the maf of this snp was 0.19 in patients with normal aer and 0.29 in patients with esrd ( p = 0.00009 ) . the genotype distribution of this snp was also significantly different between these groups ( p = 0.0002 ) , with homozygous individuals being more common among esrd patients ( 10 vs. 3% ) . the same snp had a p value of 0.006 in the genotypic test when a combined group of patients with macroalbuminuria or esrd was compared with patients with normal aer . the analyses were also performed with adjustment for potential confounders ( supplementary table 4 ) . all snps , except rs10824793 , were associated with mbl concentration ( supplementary table 5 ) . the snps showing the strongest associations were rs7899547 ( p = 3.0 10 ) , rs1031101 ( tagging the b allele ; p = 8.0 10 ) , rs2384045 ( p = 2.2 10 ) , and rs920727 ( p = 7.6 10 ) . the promoter variants h / l ( rs11003125 ) and p / q ( tagged by rs920724 ) had p values of 8.8 10 and 6.1 10 , respectively , whereas the alleles c and d had p values of 1.5 10 and 9.0 10 , respectively . the analyses were also performed with adjustment for potential confounders ( supplementary table 5 ) . the haplotypes constructed using the haploview program were studied for association with type 1 diabetes and diabetic nephropathy . the distribution of the mbl2 diplotypes , diplotype categories , and the high- and low - mbl genotypes in each patient group is presented in table 2 . there were no differences in the frequency of the high - mbl genotypes between the patients with normal aer ( 0.60 ) and macroalbuminuria ( 0.61 ; p = 0.39 ) . similarly , when the distribution of the six diplotype categories was analyzed , no differences were seen ( p = 0.63 ) . distribution of the mbl2 genotypes within the different patient groups data are n or n ( percent ) . the mbl2 haplotypes were determined based on the co - occurrence of the three promoter variants ( h / l , rs11003125 ; x / y , rs7096206 ; and p / q , rs7095891 ) and the three exon 1 variants ( b , rs1800450 ; c , rs1800451 ; and d , rs5030737 ) . diplotypes were grouped into six categories ( ya / ya , ya / xa , xa / xa , ya / yo , xa / yo , and yo / yo ) based on the x / y polymorphism and the presence of any of the exon 1 variants ( b , c , and d ) , collectively designated with o , and further into low- and high - mbl genotypes . there were no differences in the frequency of the high - mbl genotypes between the patients with normal aer and macroalbuminuria . however , the frequency of the high - mbl genotypes within the group of esrd patients ( 0.54 ) was lower than in patients with normal aer ( 0.60 ) , although this difference was not significant ( p = 0.10 ) . the 17 tag snps genotyped captured the 68 hapmap snps having an maf>0.01 with a mean pairwise r of 0.97 . all snps were in hardy - weinberg equilibrium ( p > 0.01 ) both in the healthy control subjects ( supplementary table 1 ) and in type 1 diabetic patients ( data not shown ) . the frequencies of the exon 1 variants were 0.13 ( b ) , 0.06 ( c ) , and 0.006 ( d ) in the healthy subjects , which is in line with the previously published frequencies in the finnish population ( 17 ) . of the patients with diabetes , 30.6% were heterozygous carriers of one of these variants ( a / o genotype ) and 5.8% were homozygotes or compound heterozygotes ( o / o genotype ) . the median serum concentration of mbl was higher in patients with macroalbuminuria ( 1,881 g / l [ interquartile range 6083,124 ] ) than in patients with normal aer ( 1,548 g / l [ 5142,635 ] ) ; p = 0.019 ( fig . 1 ) . supplementary table 2 shows the distribution of the mbl2 diplotypes and the corresponding median mbl concentrations . as expected , the carriers of the exon 1 variants and the individuals homozygous for the x promoter polymorphism had clearly reduced mbl concentrations , with a median of 397 g / l . when the patients were stratified both by nephropathy status and mbl2 diplotype category , it was evident that patients with macroalbuminuria had significantly higher mbl concentrations than patients with normal aer for two of the six ( ya / ya : p = 0.0002 ; ya / yo : p = 0.003 ) diplotype categories ( supplementary table 2 and fig . box plot diagram showing the distribution of serum mbl concentrations , for patients with type 1 diabetes , stratified by nephropathy status . black horizontal lines , median values ; , interquartile ranges ; , outliers . the median serum concentration of mbl was higher in patients with macroalbuminuria ( median 1,881 g / l [ interquartile range 6083,124 ] ) than in patients with normal aer ( 1,548 g / l [ 5142,635 ] ) , p = 0.019 . the median concentration was 1,645 g / l ( 5313,220 ) in patients with microalbuminuria and 1,359 g / l ( 3432798 ) in patients with esrd , p = 0.17 and p = 0.45 , respectively , compared with patients with normal aer . distribution of serum mbl concentrations in patients with normal aer and patients with macroalbuminuria , stratified by the mbl2 diplotype . there were no significant differences in allele frequencies or genotype distributions between the patients with type 1 diabetes and nondiabetic control subjects ( supplementary table 3 ) . although nominal evidence of allelic association ( p = 0.010.04 ) was seen for four snps ( rs930507 , rs2384045 , rs11003132 , and rs11003137 ) , the p values did not remain significant after correction for the number of tests performed . men and women were also tested separately , but no significant p values were achieved ( data not shown ) . association analyses showed no significant differences in allele frequencies or genotype distributions between patients with macroalbuminuria and patients with type 1 diabetes but normal aer ( supplementary table 4 ) . when patients with esrd were compared with patients with normal aer , significant evidence of association the maf of this snp was 0.19 in patients with normal aer and 0.29 in patients with esrd ( p = 0.00009 ) . the genotype distribution of this snp was also significantly different between these groups ( p = 0.0002 ) , with homozygous individuals being more common among esrd patients ( 10 vs. 3% ) . the same snp had a p value of 0.006 in the genotypic test when a combined group of patients with macroalbuminuria or esrd was compared with patients with normal aer . the analyses were also performed with adjustment for potential confounders ( supplementary table 4 ) . all snps , except rs10824793 , were associated with mbl concentration ( supplementary table 5 ) . the snps showing the strongest associations were rs7899547 ( p = 3.0 10 ) , rs1031101 ( tagging the b allele ; p = 8.0 10 ) , rs2384045 ( p = 2.2 10 ) , and rs920727 ( p = 7.6 10 ) . the promoter variants h / l ( rs11003125 ) and p / q ( tagged by rs920724 ) had p values of 8.8 10 and 6.1 10 , respectively , whereas the alleles c and d had p values of 1.5 10 and 9.0 10 , respectively . the analyses were also performed with adjustment for potential confounders ( supplementary table 5 ) . the haplotypes constructed using the haploview program were studied for association with type 1 diabetes and diabetic nephropathy . the distribution of the mbl2 diplotypes , diplotype categories , and the high- and low - mbl genotypes in each patient group is presented in table 2 . there were no differences in the frequency of the high - mbl genotypes between the patients with normal aer ( 0.60 ) and macroalbuminuria ( 0.61 ; p = 0.39 ) . similarly , when the distribution of the six diplotype categories was analyzed , no differences were seen ( p = 0.63 ) . distribution of the mbl2 genotypes within the different patient groups data are n or n ( percent ) . the mbl2 haplotypes were determined based on the co - occurrence of the three promoter variants ( h / l , rs11003125 ; x / y , rs7096206 ; and p / q , rs7095891 ) and the three exon 1 variants ( b , rs1800450 ; c , rs1800451 ; and d , rs5030737 ) . diplotypes were grouped into six categories ( ya / ya , ya / xa , xa / xa , ya / yo , xa / yo , and yo / yo ) based on the x / y polymorphism and the presence of any of the exon 1 variants ( b , c , and d ) , collectively designated with o , and further into low- and high - mbl genotypes . there were no differences in the frequency of the high - mbl genotypes between the patients with normal aer and macroalbuminuria . however , the frequency of the high - mbl genotypes within the group of esrd patients ( 0.54 ) was lower than in patients with normal aer ( 0.60 ) , although this difference was not significant ( p = 0.10 ) . our study showed no evidence of association between the mbl2 snps and type 1 diabetes , although weak association signals ( uncorrected p = 0.010.04 ) were seen for four snps . importantly , using tag snps , we have captured information on the whole gene and its surroundings , whereas the other studies addressed only the functional exon 1 variants . in a danish study ( 6 ) , genotypes producing high mbl concentrations were more common in patients having diabetic nephropathy than in patients with normal aer . we found no evidence of such an association , although our study sample was about double the size ( 6 ) . furthermore , we thoroughly studied association between both single mbl2 snps and haplotypes and nephropathy , but all the results were negative . in accordance with previous studies ( 6,7 ) , we showed that the median serum mbl concentration was significantly higher in patients with macroalbuminuria compared with the patients with normal aer . this result persisted even when the patients were stratified by the mbl diplotype categories , although the difference was significant in only two of them . thus , it seems that the high serum mbl concentration in patients with nephropathy is likely to reflect some still unknown pathogenic event such as chronic low - grade inflammation . further studies are needed to resolve whether elevated mbl concentrations are a marker associated with some other contributing factor or a consequence of nephropathy or diabetic microvascular complications in general . the minor allele of the snp rs920727 was more common in esrd patients than in the other patients 0.29 vs. 0.190.20 ) . furthermore , the frequency of the high - mbl genotypes was somewhat lower in the esrd patients than in the other groups ( 0.54 vs. 0.600.61 ) , potentially explaining the relatively low mbl concentration in the esrd patients . however , we do not consider these differences as an indication of a causal association with esrd phenotype . most likely they are due to chance or even signs of selective mortality . supporting this hypothesis , evidence exists that mortality of patients with type 2 diabetes is higher among individuals with an mbl concentration 1,000 g / l ( 24 ) . moreover , most of the esrd patients in our study have received a kidney transplant , and graft rejection is less common for the group of patients with low mbl concentrations ( 25 ) . many of the snps showing strong association with mbl concentration ( including the esrd - associated rs920727 ) did not belong to the group of snps forming the common mbl2 haplotypes . some of these variants may have an independent effect on the mbl concentration or tag other still unknown functional variants . however , this somewhat surprising association pattern can mainly be explained by ld between the associated and haplotype - forming snps ( supplementary table 6 ) . our study sample has a reasonably high power to detect associations with relatively common snps ( population frequency > 20% ) with modest effects . the previously described higher median mbl concentration in patients with macroalbuminuria ( 6,7 ) was evident also in our sample . we have thoroughly covered the common variation within the mbl2 gene in carefully characterized finnish type 1 diabetic patients . we conclude that although most of the mbl2 snps studied were associated with the mbl concentration , neither any single snp nor any of their haplotype combinations confer risk of type 1 diabetes or diabetic nephropathy .

objectivemannose - binding lectin ( mbl ) is an essential component of the acute - phase immune response and may thus play a role in the pathogenesis of type 1 diabetes and diabetic nephropathy . the serum concentration of mbl is mainly genetically determined , and elevated concentrations have been associated with both type 1 diabetes and diabetic nephropathy . previous genetic studies have not been conclusive due to the small number of patients and polymorphisms studied . we investigated whether mbl2 polymorphisms are associated with type 1 diabetes or diabetic nephropathy and whether patients with nephropathy have elevated mbl concentrations as indicated previously . furthermore , we studied the association between mbl2 polymorphisms and mbl concentration.research design and methodswe genotyped 20 mbl2 single nucleotide polymorphisms ( snps ) in a large , well - characterized finnish case - control sample consisting of 1,297 patients with type 1 diabetes with or without nephropathy and 701 nondiabetic individuals . the serum concentration of mbl was available for 1,064 patients.resultswe found that 19 snps were associated with the mbl concentration ( p = 3 10817 104 ) . mbl concentrations were higher in patients with macroalbuminuria compared with patients without nephropathy even when the patients were stratified by the mbl2 genotypic background in accordance with previous studies . however , no evidence of association between any of the snps or their haplotype combinations and type 1 diabetes or diabetic nephropathy was observed.conclusionsalthough most of the mbl2 snps studied were associated with the mbl concentration , no common variations ( neither single snps nor their haplotype combinations ) confer risk of type 1 diabetes or diabetic nephropathy .

RESEARCH DESIGN AND METHODS SNP selection and genotyping. Statistical analyses of MBL concentrations. Association analyses. RESULTS SNP genotyping. MBL concentrations. Association analyses between single SNP and type 1 diabetes. Association analyses between single SNPs and nephropathy. Association analyses between single SNPs and MBL concentrations. Haplotype and diplotype analyses. DISCUSSION Supplementary Material

gwas2 included 450 unrelated generalized vitiligo patients ( cases ) of non - hispanic / latino european ancestry ( eur ) from north america and europe , who met strict clinical criteria for generalized vitiligo . controls for gwas2 were 3182 eur individuals not specifically known to have any autoimmune disease or malignant melanoma , for whom genome - wide genotypes were obtained from the database of genotypes and phenotypes ( dbgap ; phs000092v1 , phs000125v1 , phs000138v2 , phs000168v1 , and phs000206v3 ) , or from the illumina icontroldb . the replication study included 1440 unrelated eur generalized vitiligo cases and 1316 unrelated eur controls from north america and europe , principally spouses of vitiligo patients from the gwas2 study and the replication study itself . there was no overlap of cases and controls between the gwas1 , gwas2 , and replication cohorts . cases and controls provided clinical history regarding vitiligo and other autoimmune diseases as described previously for gwas1 , and controls having known relatives with vitiligo or reporting any known autoimmune diseases or melanoma were excluded . this study was approved by each institutional review board and was conducted according to declaration of helsinki principles . genomic dna was prepared from saliva specimens using a dna self - collection kit per the manufacturer 's instructions ( oragene , dna genotek ) . for genome - wide genotyping , dna concentrations were assayed by both fluorescence staining ( picogreen method , invitrogen ) and ultraviolet a260 spectrophotometry ( nanodrop , thermo scientific ) . for genotyping specific snps in the replication study , dna concentrations were assayed by nanodrop . genome - wide genotyping for gwas2 cases was performed for 657,366 snps using illumina human660w - quad beadchips per the manufacturer 's instructions . gwas2 controls obtained from dbgap and illumina icontroldb had been genotyped using illumina human 610-quad and human 1mv1 beadchips . genotyping of 46 snps in the replication study was performed using a custom illumina goldengate assay per the manufacturer 's instructions . quality control filtering of genome - wide genotype data in gwas2 was carried out as described for gwas1 using illumina genomestudio , version 3 and plink , version 1.07 . cases were excluded on the basis of snp call rates < 98.5% ( n = 16 ) , discordance between reported and observed sex ( n = 0 ) , and/or inadvertent subject duplication ( n = 0 ) . beyond prior quality control procedures , controls were excluded on the basis of snp call rates < 95% ( n = 0 ) . additional cases ( n = 6 ) and controls ( n = 356 ) were excluded on the basis of cryptic relatedness based on pair - wise identity - by - descent estimation ( pi - hat > 0.05 ) of the entire ( gwas1 + gwas2 ) summary dataset , in which case the individual with lower snp call rate was excluded . snps were excluded on the basis of genotype missing rate 2% overall ( n = 97,301 ) in cases plus controls , observed minor allele frequency < 0.01 ( n = 23,064 ) , significant deviation ( p < 10 ) from hardy - weinberg equilibrium in the control dataset ( n = 5,241 ) , and/or significant difference ( p < 10 ) in genotype missing rate in cases versus controls ( n = 35,939 ) . data for snps with p values < 10 were reviewed with respect to genotype clusters and allele calls in cases , and minor allele frequency in controls compared to data in public data sources , and were excluded if there were apparent data quality problems ( n = 2 ) . to control for population stratification , we performed principle components analysis using eigensoft , version 4.2 , and excluded as outliers cases ( n = 10 ) and controls ( n = 16 ) whose ancestry was 6 standard deviations from the mean on one of the top ten eigenvectors . in the replication study we successfully determined genotypes for 46 snps that showed suggestive ( p < 10 ) or significant p values in the genome - wide meta - analysis of gwas1 and gwas2 , using a custom illumina goldengate assay . snp genotypes were subjected to quality control filters similar to those in gwas1 and gwas2 , as appropriate . for gwas2 , after quality control filtering of subjects and snp data and removal of genetic outliers , we compared allele frequencies of the remaining 495,821 snps in the final 418 cases and 2810 controls using the unadjusted cochran - armitage trend test implemented in plink and the adjusted cochran - armitage trend test implemented in eigensoft , in which both phenotypes and genotypes of subjects were adjusted for ancestry using the top ten eigenvectors . the unadjusted cochran - armitage trend tests and the adjusted cochran - armitage trend tests yielded genomic inflation factors of 1.054 and 1.050 , respectively , indicating that residual population stratification was negligible . odds ratios and 95% confidence limits were calculated by logistic regression analysis by use of plink . to fully assess association at the 24 novel suggestive loci , we imputed genotypes for each locus using mach , ver.1.0 based on patterns of haplotype variation in the 1000 genomes project european ancestry samples ( release aug 4 , 2010 ) . we retained imputed snps with r > 0.3 and minor allele frequency > 0.01 for further analyses . for the replication study , after quality control filtering , we compared allele frequencies for genotyped snps in the remaining 1377 patients and 1284 controls using the cochran - armitage trend test . odds ratios and 95% confidence limits were calculated by logistic regression analysis . to obtain combined ors and p values for gwas1 and gwas2 , and for the combined gwas1 , gwas2 , and replication studies , we performed meta - analysis using a cochran - mantel - haenszel test . a breslow - day test was used to test for heterogeneity of ors of the same snp in different study cohorts . calculation of linkage disequilibrium between snps in regions of association was carried out using haploview , version 4.2 . as a test of the independent effect of a given locus conditioned on the effect of another locus , we compared the fit of a model containing both loci to a model containing only the conditioning locus , assuming a multiplicative genotypic effect for the high - risk allele of each locus . we estimated the contribution of known vitiligo susceptibility loci to the total variance in vitiligo liability as the difference between the variance accounted for by all snps genome - wide and the variance remaining after removing snps in known vitiligo susceptibility loci , using gcta to estimate the two components of variance . we estimated heritability of vitiligo liability assuming a vitiligo prevalence in the eur population of 0.0038 and sibling risk 0.06 . to gain insights into potential functional relationships among proteins encoded by vitiligo risk loci , we carried out functional interaction network analysis using the search tool for the retrieval of interacting genes ( string ) 9.0 . input data were all known vitiligo susceptibility loci ( including ticam1 , and selecting btnl2 to represent the mhc class ii gene region ) . in addition , we iteratively tested inclusion of all proteins encoded by genes in the 16q24.3 and 22q13.2 association regions as well as fam76b as potentially representing the 11q21 association region as a means of possible gene identification . gwas2 included 450 unrelated generalized vitiligo patients ( cases ) of non - hispanic / latino european ancestry ( eur ) from north america and europe , who met strict clinical criteria for generalized vitiligo . controls for gwas2 were 3182 eur individuals not specifically known to have any autoimmune disease or malignant melanoma , for whom genome - wide genotypes were obtained from the database of genotypes and phenotypes ( dbgap ; phs000092v1 , phs000125v1 , phs000138v2 , phs000168v1 , and phs000206v3 ) , or from the illumina icontroldb . the replication study included 1440 unrelated eur generalized vitiligo cases and 1316 unrelated eur controls from north america and europe , principally spouses of vitiligo patients from the gwas2 study and the replication study itself . there was no overlap of cases and controls between the gwas1 , gwas2 , and replication cohorts . cases and controls provided clinical history regarding vitiligo and other autoimmune diseases as described previously for gwas1 , and controls having known relatives with vitiligo or reporting any known autoimmune diseases or melanoma were excluded . this study was approved by each institutional review board and was conducted according to declaration of helsinki principles . genomic dna was prepared from saliva specimens using a dna self - collection kit per the manufacturer 's instructions ( oragene , dna genotek ) . for genome - wide genotyping , dna concentrations were assayed by both fluorescence staining ( picogreen method , invitrogen ) and ultraviolet a260 spectrophotometry ( nanodrop , thermo scientific ) . for genotyping specific snps in the replication study , genome - wide genotyping for gwas2 cases was performed for 657,366 snps using illumina human660w - quad beadchips per the manufacturer 's instructions . gwas2 controls obtained from dbgap and illumina icontroldb had been genotyped using illumina human 610-quad and human 1mv1 beadchips . genotyping of 46 snps in the replication study was performed using a custom illumina goldengate assay per the manufacturer 's instructions . quality control filtering of genome - wide genotype data in gwas2 was carried out as described for gwas1 using illumina genomestudio , version 3 and plink , version 1.07 . cases were excluded on the basis of snp call rates < 98.5% ( n = 16 ) , discordance between reported and observed sex ( n = 0 ) , and/or inadvertent subject duplication ( n = 0 ) . beyond prior quality control procedures , controls were excluded on the basis of snp call rates < 95% ( n = 0 ) . additional cases ( n = 6 ) and controls ( n = 356 ) were excluded on the basis of cryptic relatedness based on pair - wise identity - by - descent estimation ( pi - hat > 0.05 ) of the entire ( gwas1 + gwas2 ) summary dataset , in which case the individual with lower snp call rate was excluded . snps were excluded on the basis of genotype missing rate 2% overall ( n = 97,301 ) in cases plus controls , observed minor allele frequency < 0.01 ( n = 23,064 ) , significant deviation ( p < 10 ) from hardy - weinberg equilibrium in the control dataset ( n = 5,241 ) , and/or significant difference ( p < 10 ) in genotype missing rate in cases versus controls ( n = 35,939 ) . data for snps with p values < 10 were reviewed with respect to genotype clusters and allele calls in cases , and minor allele frequency in controls compared to data in public data sources , and were excluded if there were apparent data quality problems ( n = 2 ) . to control for population stratification , we performed principle components analysis using eigensoft , version 4.2 , and excluded as outliers cases ( n = 10 ) and controls ( n = 16 ) whose ancestry was 6 standard deviations from the mean on one of the top ten eigenvectors . in the replication study we successfully determined genotypes for 46 snps that showed suggestive ( p < 10 ) or significant p values in the genome - wide meta - analysis of gwas1 and gwas2 , using a custom illumina goldengate assay . snp genotypes were subjected to quality control filters similar to those in gwas1 and gwas2 , as appropriate . for gwas2 , after quality control filtering of subjects and snp data and removal of genetic outliers , we compared allele frequencies of the remaining 495,821 snps in the final 418 cases and 2810 controls using the unadjusted cochran - armitage trend test implemented in plink and the adjusted cochran - armitage trend test implemented in eigensoft , in which both phenotypes and genotypes of subjects were adjusted for ancestry using the top ten eigenvectors . the unadjusted cochran - armitage trend tests and the adjusted cochran - armitage trend tests yielded genomic inflation factors of 1.054 and 1.050 , respectively , indicating that residual population stratification was negligible . odds ratios and 95% confidence limits were calculated by logistic regression analysis by use of plink . to fully assess association at the 24 novel suggestive loci , we imputed genotypes for each locus using mach , ver.1.0 based on patterns of haplotype variation in the 1000 genomes project european ancestry samples ( release aug 4 , 2010 ) . we retained imputed snps with r > 0.3 and minor allele frequency > 0.01 for further analyses . for the replication study , after quality control filtering , we compared allele frequencies for genotyped snps in the remaining 1377 patients and 1284 controls using the cochran - armitage trend test . odds ratios and 95% confidence limits were calculated by logistic regression analysis . to obtain combined ors and p values for gwas1 and gwas2 , and for the combined gwas1 , gwas2 , and replication studies , we performed meta - analysis using a cochran - mantel - haenszel test . a breslow - day test was used to test for heterogeneity of ors of the same snp in different study cohorts . calculation of linkage disequilibrium between snps in regions of association was carried out using haploview , version 4.2 . as a test of the independent effect of a given locus conditioned on the effect of another locus , we compared the fit of a model containing both loci to a model containing only the conditioning locus , assuming a multiplicative genotypic effect for the high - risk allele of each locus . we estimated the contribution of known vitiligo susceptibility loci to the total variance in vitiligo liability as the difference between the variance accounted for by all snps genome - wide and the variance remaining after removing snps in known vitiligo susceptibility loci , using gcta to estimate the two components of variance . we estimated heritability of vitiligo liability assuming a vitiligo prevalence in the eur population of 0.0038 and sibling risk 0.06 . to gain insights into potential functional relationships among proteins encoded by vitiligo risk loci , we carried out functional interaction network analysis using the search tool for the retrieval of interacting genes ( string ) 9.0 . input data were all known vitiligo susceptibility loci ( including ticam1 , and selecting btnl2 to represent the mhc class ii gene region ) . in addition , we iteratively tested inclusion of all proteins encoded by genes in the 16q24.3 and 22q13.2 association regions as well as fam76b as potentially representing the 11q21 association region as a means of possible gene identification .

in previous linkage and genome - wide association studies we identified 17 susceptibility loci for generalized vitiligo . by a second genome - wide association study , meta - analysis , and independent replication study , we have now identified 13 additional vitiligo - associated loci , including oca2-herc2 , a region of 16q24.3 containing mc1r , a region of chromosome 11q21 near tyr , several immunoregulatory loci including ifih1 , cd80 , clnk , bach2 , sla , casp7 , cd44 , ikzf4 , sh2b3 , and a region of 22q13.2 where the causal gene remains uncertain . functional pathway analysis shows that most vitiligo susceptibility loci encode immunoregulatory proteins or melanocyte components that likely mediate immune targeting and genetic relationships among vitiligo , malignant melanoma , and normal variation of eye , skin , and hair color .

METHODS Subjects Genotyping and quality control Statistical analyses Functional network analysis Supplementary Material

now they need more attention because as the average life expectancy , elderly population , and subsequent resulting osteoporosis continue to increase , orthopaedic surgeons will get more such cases [ 14 ] . intertrochanteric fractures in the elderly are associated with high rates of mortality , ranging from 15 to 20% , as they are at a high risk for deep vein thrombosis ( dvt ) , urinary tract infections , and pulmonary embolism if they fail to mobilize or ambulate early . surgical stabilization fulfills the aim of early mobilization and facilitates union in an anatomical position . due to this , operative stabilization of these fractures is now the gold standard treatment . although other options are available , the standard approach is to use a dynamic hip screw ( dhs ) with a 4-holed side plate in stable fractures in most centers [ 68 ] . traditionally a wide surgical exposure is necessary for this procedure which comes with its drawbacks like a large skin incision , considerable soft tissue trauma , significant blood loss , and pain . to avoid these problems minimally invasive it has theoretical advantages of decreased blood loss , better cosmesis , less pain , and rapid rehabilitation . we conducted a prospective comparative study of conventional ( open ) dhs and minimally invasive dhs at our center to test the utility of this new approach . this study was carried out in the department of orthopaedic surgery , sohar hospital , oman , between 2008 and 2011 . a total of 60 patients with intertrochanteric femoral fractures were selected for this study and all of them gave informed written consent for the same . all the fractures were reduced and fixed with 135 degree dynamic hip screws with 4-hole side plate , 30 using conventional ( open ) technique ( cdhs ) and 30 with minimally invasive technique ( midhs ) . patients in both the groups were matched with respect to age , preoperative hemoglobin level , and morbidity . in particular , we also measured the difference between pre- and postoperative hemoglobin levels ( hemoglobin drop ) , which is an indicator of blood loss the operating time was measured from beginning of skin incision to skin closure . in all cases of both conventional dhs group and all patients were rehabilitated using the same standard postoperative hip fracture management protocol by starting mobilization and weight bearing within 24 hours of surgery . the length of hospital stay was noted for each case and complications were also recorded for both the groups . the surgical technique for both the procedures is described below [ 3 , 4 , 7 ] . a longitudinal skin incision 1015 cm in length was made over the lateral aspect of upper thigh , starting from the middle of the greater trochanteric prominence and extending down the lateral aspect of femoral shaft . fracture was reduced and its confirmation done with fluoroscope . following fixation of the fracture in the standard fashion , a drain was used as per surgeon 's preference , and the incision was closed in layers . all fractures in this study received adequate closed reduction under c arm guidance ( anatomical to 10 of valgus on anteroposterior radiograph and anatomical on lateral radiograph ) prior to the start of operation . the incision was placed under fluoroscopic guidance by the identification of the site on the hip that corresponded to the position of the fracture . the size of the incision was not longer than 5 cm in any case . the iliotibial band and vastus muscles were split through one incision . after the insertion of a guide wire , after this barrel plate was also introduced through the same incision , turning the barrel from 180 to 90 as shown in figure 1 . the guide wire was then reintroduced through the side plate barrel and then rotated until the side plate lied suitably under the soft tissues . the barrel was then engaged in the lag screw and advanced in the conventional fashion . the side plate screws were then placed in the usual manner through side plate holes by retracting the skin and subcutaneous tissue with a right angled soft tissue retractor . compared to patients in the conventional group , those in the minimally invasive group had shorter operating times ( mean 50 versus 40 minutes ) and a higher proportion of cases whose drain was removed within 24 hours ( 26% versus 71% ) . the drain output and decrease in haemoglobin level were not significantly different in the 2 groups . there was no intraoperative and 30-day mortality in both the groups , but the 6-month mortality was 6.6% ( 2/30 ) in conventional group while being 0% in the minimally invasive group . while one - year mortality of 13.3% ( 4/30 ) was found in the conventional dhs group , 3.33% ( 1/30 ) was found in minimally invasive group . both groups have been compared in table 1 and figures 3 , 4 , 5 , 6 , 7 , 8 , 9 , and 10 . hip fractures are a common cause of morbidity and mortality in the elderly population and are associated with considerable health expenditure . although many internal fixation devices provide sufficient stabilization , the surgical treatment of intertrochanteric femoral fractures is still challenging . the dynamic hip screw , which provides rigid fixation and allows early mobilization as it enables optimal collapse and compression of the fracture site , is the most common extramedullary device used for intertrochanteric fractures and has reasonable results [ 6 , 8 ] . in addition , when compared with sliding hip screws , no definite evidence exists of a reduced failure rate with intramedullary nails in unstable intertrochanteric fractures . therefore , the routine use of intramedullary devices has not been recommended for the treatment of intertrochanteric fractures , and the dynamic hip screw is still the standard type of fixation for intertrochanteric fractures [ 6 , 11 ] . however , insertion of this conventionally requires a 1015 cm incision splitting the vastus lateralis , causing considerable bleeding and damage to the overlying soft tissues , and intertrochanteric fractures often occur in the elderly , who commonly have multiple comorbid conditions that may be worsened by the surgical trauma associated with a major operation . in order to find less invasive techniques to simplify surgery and lower complication rate by reducing surgical time and blood loss , some authors used custom made implants or new devices ( e.g. , per cutaneous compression plate , pccp ) which require the purchase of additional instruments and implants by the hospital [ 3 , 4 , 7 ] . on the other hand , the minimally invasive dhs technique uses the existing instruments with which the operating team is familiar and confident , with no need to purchase new instruments . several authors have shown that the same advantages can be gained by modifying the surgical approach while using existing fixation devices , thus requiring neither a new plating system nor training of operating theatre staff to familiarize with them . therefore , the development of the minimally invasive dynamic hip screw technique , which causes less tissue damage and bleeding and shorter operative times and provides good fixation , may result in better outcomes , especially in elderly patients . a reduced operative time , especially in elderly patients with comorbid conditions or poor cardiopulmonary reserve , is desirable because it reduces the risks of general anesthetic . this , along with reduced surgical trauma , may be significant in reducing postoperative morbidity and mortality in such patients . with regard to surgical blood loss , a previous angiographic study revealed that the average distance from the vastus lateralis ridge to the first significant perforating branch was 9.3 cm . therefore this area is relatively a safe vascular zone . in the minimally invasive dynamic hip screw technique , a 35 cm incision is made , and the incision point is approximately 4 cm below the vastus lateralis ridge . therefore , blood loss decreases due to less soft tissue dissection and less fracture exposure and because an incision is made in the safe vascular zone [ 3 , 4 ] . because decreased blood loss is thought to be an explanation of reduced cardiovascular complications , which decrease the need for blood transfusion , this may have great clinical significance [ 9 , 12 ] . wong et al . proposed a novel and precise technique for determining the guide wire entry site which was the first step of their midhs surgical technique based on the concept of an isosceles right triangle ( in such a triangle the two angles along the hypotenuse are equal to 45 and the external angle is 180 45 = 135 which is the same as the angle of the guide plate , as demonstrated in figure 2 . by placing a guide plate with guide wire on the anterior hip and placing the plate along the lateral border of the proximal femur , under fluoroscopic guidance , an ap line was traced along the femoral head and neck region along the guide wire and another along the side plate , with the two lines meeting at a point e. a lateral radiograph was then obtained , a guide wire was placed along the centre of femoral head and neck , and a lateral line was traced . a vertical line dropped from the previously mentioned point intersects this lateral line at another point i. fluoroscopy is used to measure the distance of this point from skin to bone . this distance was then used to finally mark the entry site at the same distance along the lateral line distally . a 2.5 cm long incision was then made from the guide wire entry site distally . quantified the surgical trauma in conventional and minimally invasive surgical techniques for pertrochanteric fracture surgery based on measurement of markers of inflammation ( interleukins ) . significantly higher level of interleukin 6 was found in the postoperative period in patients operated by conventional technique than in those operated by minimally invasive technique . results from the literature and their study indicate that il-6 levels enable measurement of not only local tissue trauma / invasiveness but also the subsequent systemic response . by measuring the invasiveness of the intervention ( second hit / additional tissue trauma ) based on levels of interleukins , it could become possible not only to detect local damage but also to obtain an independent predictor of risk / outcome in elderly patients with pertrochanteric fracture . however a study by lee et al . showed a relatively high incidence of avascular necrosis of the femoral head with the minimally invasive technique . vascular insult to the femoral head may therefore be considered as one potential drawback of this technique . zhou et al . carried out a meta - analysis of studies on minimally invasive versus conventional dhs [ 3 , 4 , 7 , 9 ] and found that there was a lower rate of serious postoperative complications in the minimally invasive dynamic hip screw group compared with the conventional dynamic hip screw group ( relative risk , 0.35 ; 95% confidence interval ( ci ) , 0.16 , 0.78 ) . also the average operative time ( weighted mean difference , 16.32 ; 95% ci , 28.78 to 3.86 ) , hemoglobin decrease ( weighted mean difference , 1.44 ; 95% ci , 1.98 to 0.89 ) , and length of stay ( weighted mean difference , 3.72 ; 95% ci , 5.44 to 2.01 ) were lower in the minimally invasive dynamic hip screw group , while the postoperative harris hip score ( weighted mean difference , 1.42 ; 95% ci , 0.23 to 2.60 ) was higher in the minimally invasive dynamic hip screw group . recent studies [ 15 , 16 ] showed that stable pertrochanteric had successful fixation with two - hole dhs plate . it appears that the widespread use of four - hole side plate dhs in stable pertrochanteric fractures is merely based on tradition and needs to be reconsidered in the present era of evidence - based medicine . biomechanical studies have also demonstrated equivalent peak load to failure when comparing the two- and four - hole dhs plates . therefore , using the two - hole dhs may be at least as safe as the four - hole dhs in nonosteoporotic patients , and the surgical exposure required will be smaller . it may also be economical , both financially and in the use of operating time . in osteoporotic bone , postoperatively , elderly patients are at a high risk for dvt , urinary tract infections , and pulmonary embolism if they fail to mobilize or ambulate early . reduced operative time , less bleeding , and less postoperative pain may promote earlier ambulation in the minimally invasive dynamic hip screw group , which may contribute to a more favorable outcome in terms of serious postoperative complications [ 7 , 13 ] . also it may fasten overall patient recovery , thereby facilitating early discharge and , therefore , having significant financial implications for hospitals . because intertrochanteric fractures usually occur in elderly patients who may have cognitive deficits from age or have medical diseases , it is important for patients to return to preinjury activity levels as soon as possible to avoid complications . the minimally invasive dynamic hip screw , as it offers faster rehabilitation , is especially beneficial for older patients [ 4 , 7 , 13 ] . further studies with larger number of patients , proper randomization , blinding procedure , and robust analysis will give more conclusive results . to conclude , the minimally invasive dynamic hip screw and the conventional dynamic hip screw both are effective , simple , and safe for the treatment of intertrochanteric fractures . compared with the conventional dynamic hip screw , the minimally invasive dynamic hip screw usually has a shorter operative time , less hemoglobin decrease , and a shorter length of stay , which benefit patients and reduce hospital costs and may therefore be recommended in place of conventional technique .

background . intertrochanteric fractures of the proximal femur are one of the most common fractures encountered , and dynamic hip screw with a side plate is the standard treatment . we compared a minimally invasive surgical technique with the conventional surgical technique used in the fixation of intertrochanteric fractures with the dynamic hip screw ( dhs ) device . methods . thirty patients with such fractures were treated with the conventional open technique and 30 with a new minimally invasive technique . patients in both groups were followed up for 1 year . results . there was less blood loss , minimal soft tissue destruction , shorter hospital stay , and early mobilization with the minimally invasive technique . conclusion . the present study finds minimally invasive technique superior to conventional ( open ) dhs .

1. Introduction 2. Methods 3. Results 4. Discussion

nucleic acids are highly attractive class of therapeutics due to their potential to regulate any selected gene of interest . given their capacity to modulate conventionally undruggable targets , oligonucleotides ( ons ) have been extensively investigated as potential therapeutics to treat cancer , viral infections , genetic diseases , and immunological disorders . despite the clear therapeutic potential of ons , their poor permeability across cellular membranes ( due to their intrinsic polyanionic nature and high molecular weight ) and susceptibility to degradation by ubiquitous nucleases hamper their clinical translation . recent advances in the development of various delivery vehicles ( e.g. , polymer- , lipid- , peptide- , nano / microparticles- , or viral - based ) have helped overcoming some of the on delivery problems ; however , issues such as systemic toxicity , low concentration at target sites and pharmaceutical complexity of the delivery systems still represent obstacles to the clinical translation of on therapeutics . the conception of stable ons with enhanced affinity via various chemical modifications is one of the most remarkable achievements in this field . for example , the combination of phosphorothioate ( ps ) backbone modification with 2-o - methyl ( ome ) and 2-o-(2-methoxyethyl ) ( moe ) moieties in the sugar units or bicyclic ribonucleosides are the most widely used chemical strategies under clinical investigation . another approach is modification with 2-deoxy-2-fluoro - arabinonucleic acid ( fana ) , which upon binding to the target mrna induces its rnase h - mediated degradation . several chemically stabilized ons are already marketed ( e.g. , mipomersen for homozygous familial hypercholesterolemia ) or in late - phase clinical trials . nucleic acid therapy could be especially beneficial for several disorders of the gastrointestinal ( gi ) system that currently lack appropriate treatments such as inflammatory bowel diseases , colon cancer , and familial adenomatous polyposis . the delivery of nucleic acids directly to the gi mucosa is ideal to achieve high local concentrations while minimizing systemic exposure and subsequent side - effects . indeed , a group of carrier - free ons targeting gi mucosa for inflammatory bowel disease therapy is progressing through clinical trials , although high doses of ons are required to obtain the positive therapeutic effects . therefore , a safe and efficient delivery approach to the gi mucosa would be desirable to facilitate the cellular uptake of on and to decrease dosing . two major strategies are currently investigated to improve the on delivery efficacy to the intestinal tissue : particle - based systems ( e.g. , polyplex- or lipoplex - based ) and single - molecule - based conjugates ( e.g. , free on or cell - penetrating peptide - on conjugates ) . on incorporated in particles can be taken up primarily by m cells in the peyer 's patches of the intestine and eventually by mucosal macrophages via phagocytosis . therefore , particle - based systems would be suitable for the targeting of disease - related genes expressed mainly in the immune cells , such as tnf-. in contrast , single - molecule - based system can be taken up not only by lamina propria immune cells but also by epithelial cells . considering that the dysregulated expression of genes causing intestinal disease is often localized on the gut epithelium , single - molecule - based systems could open promising therapeutic avenues for previously inaccessible epithelium - specific targets . in addition , these systems possess the advantage of reduced carrier toxicity and immunogenicity , as well as simpler characterization processes , compared with particle - based systems . recently , we have shown that the conjugation of a long - chain lipid moiety such as docosanoyl ( dsa ) group to chemically modified ons enabled significant target mrna knockdown in a prostate cancer cell line in the absence of transfection reagents . their binding to serum proteins , however , suggested that amphiphilic on conjugates might constitute an effective delivery approach primarily for topical applications or liver targeting . however , their applicability to the intestinal mucosa remains questionable since the harsh gi environment containing digestive enzymes coupled with the known difficulties transfecting differentiated epithelium in vitro suggests that on delivery will be limited . in this work , dsa was conjugated to various chemically modified ons targeting a model bcl-2 mrna , and the transfecting properties of the resulting conjugates were evaluated in vitro . the integrity and transfection efficiency of the most potent conjugate with lowest toxicity were assessed under various conditions mimicking the intestinal environment ( inclusion of food - derived fats and digestive enzymes ) . in a previously published study , we reported that lipophilic docosanoic acid ( l ; dsa ) conjugated to ons modified with 2-f - arabinonucleosides were more potent than nucleic acids derivatized with cholesterol or docosahexaenoic acid to transfect prostate cancer cells . in a search for novel and safe amphiphilic ons capable of modulating gene expression in intestinal cells , we synthesized and characterized a set of conjugates by linking dsa to different single - stranded antisense ons and double - stranded small interfering rnas ( sirnas ) targeting the mrna of the oncoprotein bcl-2 ( table 1 ) as previously described . the antisense ons were based on a single parent dna sequence ( oblimersen ) and were modified by incorporating ome , moe - ribonucleosides , or 2-f - modified arabinonucleosides connected via ps linkages ( l - dna , l - ome , l - moe , and l - fana , respectively ) . these chemical modifications of nucleotides are commonly employed to enhance the binding affinity of ons for target mrnas as well as to increase their stability against nuclease digestion . typically , antisense ons ' mode of action involves recruitment of rnase h , which recognizes the thus formed dna : rna heteroduplex leading to a processive cleavage of the mrna strand in a catalytic fashion . since oligoribonucleotides and their 2-o - modified analogues generally do not support rnase h binding , a gapmer design , in which a central dna stretch is flanked by modified ribonucleotides ( ome and moe ) at both termini , is preferred for preserving an rnase h binding site , while providing the on with higher nuclease resistance . in contrast to 2-o - modified ribonucleotides , the fana modification can be incorporated throughout an on sequence , since upon binding to complementary mrna , the fana nucleotide adopts a conformation similar to that of dna and therefore supports rnase h recognition . since an altimer design in our previous work , it was chosen for the fana - modified on in this study . in order to test whether dsa is capable of facilitating the intracellular delivery of double - stranded sirnas , it was conjugated to the unmodified phosphodiester sirna ( l - sirna ) and its fully phosphorothioated counterpart ( l - ps sirna ) . as shown in figure 1a , b , both single- and double - stranded l - ons decreased target mrna levels in colon carcinoma cells in the absence of transfecting reagent . l - on conjugates showed the following order of efficacy ( based on statistically significant differences at various concentrations ) : l - fana > l - ome > l - sirna > > l - dna , where l - dna did not exhibit a statistically significant reduction . there was no significant difference between the efficacies of l - fana and l - moe or l - ps sirna and l - ome at any of the concentrations tested . l - moe , l - ps sirna , and l - ome caused a small but significant decrease in cell viability 24 hours after transfection ( figure 1a , dot plot ) . however , the difference in cell viability upon treatment with the different l - on conjugates was negligible for longer incubation times ( 2.5 days post - transfection ) ( see supplementary figure s1 ) . l - on conjugates downregulated their target mrna expression in a dose - dependent manner , and the ec50 values of l - ps sirna , l - ome , l - moe , and l - fana were 0.86 , 0.69 , 0.47 , and 0.28 mol / l , respectively ( figure 1b ) . these results indicate that the silencing potency and effect on cell viability of the l - on conjugate depends on the type of on used and on its chemical modification . dsa coupled to the unmodified sirna was less efficient than l - ps sirna in the absence of transfection reagent . since l - ps sirna possessed slightly lower silencing potency compared with l - sirna upon the lf - mediated transfection ( see supplementary figure s2 ) , the superior silencing properties of carrier - free l - ps sirna could have been due to its higher resistance to extra- and intracellular nucleases and/or higher uptake of ps - modified oligonucleotides . we selected the l - fana conjugate as a promising candidate for further investigation based on a combination of lowest ec50 with a favorable cytotoxicity profile . we further investigated the target mrna silencing effect of l - fana by transfecting two human colorectal carcinoma cell lines , hct-116 and caco-2 , with l - fana and its control groups . at a concentration of 1 mol / l , l - fana downregulated bcl-2 mrna in hct-116 and caco-2 cells by 81 and 82% , respectively ( figure 2 ) . monitoring the bcl-2 mrna silencing over time showed that the knockdown efficacy of l - fana was constant from 1 to 3.5 days post - transfection ( see supplementary figure s3 ) . transfection of free fana and negative control conjugate with an irrelevant nucleic acid sequence ( l - fananc ) did not change the bcl-2 mrna expression levels , indicating that target mrna inhibition is caused by a sequence - specific antisense mechanism and that lipid conjugation contributes to the improved intracellular delivery of fana . in order to assess whether sedimentation influenced the transfection efficiency , experiments with cells in inverted position recent studies with nanoparticles demonstrated that cellular uptake can be dramatically reduced in the inverted configuration ( cells on top ) , as opposed to the conventional in vitro setup where cells are on the bottom of the culture plate and sedimentation can artificially promote internalization . indeed , we observed that transfection efficiency of sirna / lf lipoplex was significantly reduced using the inverted setup , whereas the silencing efficiency of l - fana conjugate was the same in both cell setups . these results indicated that l - fana was predominantly taken up by cells via sedimentation - independent uptake routes , which was in line with the outcome of our previous work on peptide - nucleic acid conjugates . in the case of the sirna / lf lipoplex , it is likely that the rapid onset of silencing was a consequence of the fast uptake of sedimented particles ( see supplementary figure s4 ) . this was in contrast to the behavior of l - fana , where increasing the exposure time to the oligonucleotide conjugate from 5 to 15 hours resulted in significantly higher knockdown efficacy ( 38 versus 65% , respectively , at 0.5 mol / l ; see supplementary figure s4 ) , further supporting a presumed sedimentation - independent uptake . an efficient gene silencing in intestinal epithelium first requires that the nucleic acid drugs be stable against the attack of intestinal enzymes . to this end , we tested whether the preincubation of l - fana conjugate in simulated intestinal fluid ( sif ) containing pancreatic digestive enzymes would impair its transfection efficacy ( figure 4 ) . importantly , l - fana conjugate was stable even after 15 hours of incubation with sif , as assessed by polyacrylamide gel electrophoresis analysis ( figure 4a ) , and the lipid moiety was not cleaved off upon incubation with pancreatic enzymes containing lipases ( figure 4b ) . for the silencing experiments , l - fana and its negative control ( l - fananc ) conjugates were incubated with pancreatic enzymes at ph 6.8 for 2 hours at 37c , and after the heat - inactivation of the digestive enzymes and dilution with cell culture medium , the mixture was directly added to the hct-116 cells . the difference between relative expression levels of target bcl-2 mrna after the treatment with l - fana with or without pancreatin preincubation was not statistically significant ( 31 and 19% , respectively ; figure 4c ) . this result shows that the preincubation with pancreatin did not strongly affect the silencing efficacy of the l - fana conjugate due to the enzymatic degradation or unspecific protein binding . treatments with pancreatin alone or pancreatin with l - fananc did not change the target mrna expression , indicating that the silencing effect was caused by l - fana in a sequence - specific manner . it was previously demonstrated that amphiphilic on conjugates can bind to lipid - containing particles ( e.g. , low - density lipoprotein or chylomicrons ) , implying the possibility of interaction of l - on conjugates with food - derived fats in the intestine . using a gel - based binding assay , we observed that l - fana indeed bound to soybean oil in a concentration - dependent manner , while the migration of unconjugated fana was not retarded in the presence of oil ( figure 4a and supplementary figure s5 ) . the decrease of silencing efficacy observed for l - fana in the presence of oil emulsion could be attributed to the interaction between the oil and the lipid moiety of the conjugate interfering with the cellular uptake ( figure 4c ) . however , the interaction of l - fana with the oil emulsion could be disrupted after the digestion of the oil by the sif ( figure 4a ) . importantly , the released l - fana from sif - digested oil emulsion fully preserved its silencing capacity ( figure 4c ) . this finding suggests that the interaction of amphiphilic ons with food - derived fat would not hamper their cellular uptake and subsequent silencing activity . intestinal epithelial cells which are differentiated have reduced proliferative and endocytic capacity which makes their in vivo transfection rather challenging . to compare the delivery of modified on into proliferating cells and difficult - to - transfect epithelial cell monolayers , the l - fana conjugate was tested on differentiated caco-2 cells . to illustrate the resistance to transfection of fully differentiated caco-2 cell monolayers , experiments were performed with bcl-2 targeting sirna complexed with lf ( figure 5a , b ) . mol / l elicited a small decrease of bcl-2 mrna expression ( 21% , figure 5a ) , which was not accompanied by its downregulation at the protein level ( figure 5b ) . we could not achieve dose - dependent bcl-2 mrna knockdown even with sirna concentrations as high as 0.4 mol / l , at which the control sirnanc possessing a target - unrelated sequence caused appreciable suppression of bcl-2 mrna , probably due to the toxicity caused by high concentrations of lf . in contrast , bcl-2 silencing was successfully achieved in proliferating caco-2 cells at a dose of 0.05 mol / l of sirna ( see supplementary figure s6 ) . strikingly , the single - molecule - based l - fana conjugate was able to knockdown bcl-2 mrna in differentiated caco-2 cell monolayers in a sequence - specific and dose - dependent manner ( figure 5a ) . at l - fana concentrations of 1.25 , 2.5 , and 5 mol / l the target bcl-2 mrna expression was reduced to 56 , 32 , and 26% , respectively . at 5 mol conjugation of dsa was found to be essential for successful delivery , as unconjugated fana did not have any effect on bcl-2 mrna expression even at 5 mol / l . consistent with mrna silencing , western blot analysis demonstrated that l - fana reduced efficiently the target bcl-2 protein level ( by 53% at 2.5 importantly , the treatment with relatively high dose of l - fana neither caused cytotoxicity ( figure 5c ) nor decreased the transepithelial electrical resistance ( teer ) of caco-2 monolayers ( figure 5d ) , which is a measurable indicator of the monolayer integrity . in comparison , the treatment with sodium decanoate , a widely used absorbefacient disrupting the tight junctions , caused a pronounced drop in teer . based on these results , it is likely that l - fana conjugates will be taken up primarily by epithelial cells in vivo with minimal systemic translocation via the paracellular route . in a previously published study , we reported that lipophilic docosanoic acid ( l ; dsa ) conjugated to ons modified with 2-f - arabinonucleosides were more potent than nucleic acids derivatized with cholesterol or docosahexaenoic acid to transfect prostate cancer cells . in a search for novel and safe amphiphilic ons capable of modulating gene expression in intestinal cells , we synthesized and characterized a set of conjugates by linking dsa to different single - stranded antisense ons and double - stranded small interfering rnas ( sirnas ) targeting the mrna of the oncoprotein bcl-2 ( table 1 ) as previously described . the antisense ons were based on a single parent dna sequence ( oblimersen ) and were modified by incorporating ome , moe - ribonucleosides , or 2-f - modified arabinonucleosides connected via ps linkages ( l - dna , l - ome , l - moe , and l - fana , respectively ) . these chemical modifications of nucleotides are commonly employed to enhance the binding affinity of ons for target mrnas as well as to increase their stability against nuclease digestion . typically , antisense ons ' mode of action involves recruitment of rnase h , which recognizes the thus formed dna : rna heteroduplex leading to a processive cleavage of the mrna strand in a catalytic fashion . since oligoribonucleotides and their 2-o - modified analogues generally do not support rnase h binding , a gapmer design , in which a central dna stretch is flanked by modified ribonucleotides ( ome and moe ) at both termini , is preferred for preserving an rnase h binding site , while providing the on with higher nuclease resistance . in contrast to 2-o - modified ribonucleotides , the fana modification can be incorporated throughout an on sequence , since upon binding to complementary mrna , the fana nucleotide adopts a conformation similar to that of dna and therefore supports rnase h recognition . since an altimer design in our previous work , it was chosen for the fana - modified on in this study . in order to test whether dsa is capable of facilitating the intracellular delivery of double - stranded sirnas , it was conjugated to the unmodified phosphodiester sirna ( l - sirna ) and its fully phosphorothioated counterpart ( l - ps sirna ) . as shown in figure 1a , b , both single- and double - stranded l - ons decreased target mrna levels in colon carcinoma cells in the absence of transfecting reagent . l - on conjugates showed the following order of efficacy ( based on statistically significant differences at various concentrations ) : l - fana > l - ome > l - sirna > > l - dna , where l - dna did not exhibit a statistically significant reduction . there was no significant difference between the efficacies of l - fana and l - moe or l - ps sirna and l - ome at any of the concentrations tested . l - moe , l - ps sirna , and l - ome caused a small but significant decrease in cell viability 24 hours after transfection ( figure 1a , dot plot ) . however , the difference in cell viability upon treatment with the different l - on conjugates was negligible for longer incubation times ( 2.5 days post - transfection ) ( see supplementary figure s1 ) . l - on conjugates downregulated their target mrna expression in a dose - dependent manner , and the ec50 values of l - ps sirna , l - ome , l - moe , and l - fana were 0.86 , 0.69 , 0.47 , and 0.28 mol / l , respectively ( figure 1b ) . these results indicate that the silencing potency and effect on cell viability of the l - on conjugate depends on the type of on used and on its chemical modification . dsa coupled to the unmodified sirna was less efficient than l - ps sirna in the absence of transfection reagent . since l - ps sirna possessed slightly lower silencing potency compared with l - sirna upon the lf - mediated transfection ( see supplementary figure s2 ) , the superior silencing properties of carrier - free l - ps sirna could have been due to its higher resistance to extra- and intracellular nucleases and/or higher uptake of ps - modified oligonucleotides . we selected the l - fana conjugate as a promising candidate for further investigation based on a combination of lowest ec50 with a favorable cytotoxicity profile . we further investigated the target mrna silencing effect of l - fana by transfecting two human colorectal carcinoma cell lines , hct-116 and caco-2 , with l - fana and its control groups . at a concentration of 1 mol / l , l - fana downregulated bcl-2 mrna in hct-116 and caco-2 cells by 81 and 82% , respectively ( figure 2 ) . monitoring the bcl-2 mrna silencing over time showed that the knockdown efficacy of l - fana was constant from 1 to 3.5 days post - transfection ( see supplementary figure s3 ) . transfection of free fana and negative control conjugate with an irrelevant nucleic acid sequence ( l - fananc ) did not change the bcl-2 mrna expression levels , indicating that target mrna inhibition is caused by a sequence - specific antisense mechanism and that lipid conjugation contributes to the improved intracellular delivery of fana . in order to assess whether sedimentation influenced the transfection efficiency , experiments with cells in inverted position recent studies with nanoparticles demonstrated that cellular uptake can be dramatically reduced in the inverted configuration ( cells on top ) , as opposed to the conventional in vitro setup where cells are on the bottom of the culture plate and sedimentation can artificially promote internalization . indeed , we observed that transfection efficiency of sirna / lf lipoplex was significantly reduced using the inverted setup , whereas the silencing efficiency of l - fana conjugate was the same in both cell setups . these results indicated that l - fana was predominantly taken up by cells via sedimentation - independent uptake routes , which was in line with the outcome of our previous work on peptide - nucleic acid conjugates . in the case of the sirna / lf lipoplex , it is likely that the rapid onset of silencing was a consequence of the fast uptake of sedimented particles ( see supplementary figure s4 ) . this was in contrast to the behavior of l - fana , where increasing the exposure time to the oligonucleotide conjugate from 5 to 15 hours resulted in significantly higher knockdown efficacy ( 38 versus 65% , respectively , at 0.5 mol / l ; see supplementary figure s4 ) , further supporting a presumed sedimentation - independent uptake . an efficient gene silencing in intestinal epithelium first requires that the nucleic acid drugs be stable against the attack of intestinal enzymes . to this end , we tested whether the preincubation of l - fana conjugate in simulated intestinal fluid ( sif ) containing pancreatic digestive enzymes would impair its transfection efficacy ( figure 4 ) . importantly , l - fana conjugate was stable even after 15 hours of incubation with sif , as assessed by polyacrylamide gel electrophoresis analysis ( figure 4a ) , and the lipid moiety was not cleaved off upon incubation with pancreatic enzymes containing lipases ( figure 4b ) . for the silencing experiments , l - fana and its negative control ( l - fananc ) conjugates were incubated with pancreatic enzymes at ph 6.8 for 2 hours at 37c , and after the heat - inactivation of the digestive enzymes and dilution with cell culture medium , the mixture was directly added to the hct-116 cells . the difference between relative expression levels of target bcl-2 mrna after the treatment with l - fana with or without pancreatin preincubation was not statistically significant ( 31 and 19% , respectively ; figure 4c ) . this result shows that the preincubation with pancreatin did not strongly affect the silencing efficacy of the l - fana conjugate due to the enzymatic degradation or unspecific protein binding . treatments with pancreatin alone or pancreatin with l - fananc did not change the target mrna expression , indicating that the silencing effect was caused by l - fana in a sequence - specific manner . it was previously demonstrated that amphiphilic on conjugates can bind to lipid - containing particles ( e.g. , low - density lipoprotein or chylomicrons ) , implying the possibility of interaction of l - on conjugates with food - derived fats in the intestine . using a gel - based binding assay , we observed that l - fana indeed bound to soybean oil in a concentration - dependent manner , while the migration of unconjugated fana was not retarded in the presence of oil ( figure 4a and supplementary figure s5 ) . the decrease of silencing efficacy observed for l - fana in the presence of oil emulsion could be attributed to the interaction between the oil and the lipid moiety of the conjugate interfering with the cellular uptake ( figure 4c ) . however , the interaction of l - fana with the oil emulsion could be disrupted after the digestion of the oil by the sif ( figure 4a ) . importantly , the released l - fana from sif - digested oil emulsion fully preserved its silencing capacity ( figure 4c ) . this finding suggests that the interaction of amphiphilic ons with food - derived fat would not hamper their cellular uptake and subsequent silencing activity . intestinal epithelial cells which are differentiated have reduced proliferative and endocytic capacity which makes their in vivo transfection rather challenging . to compare the delivery of modified on into proliferating cells and difficult - to - transfect epithelial cell monolayers , the l - fana conjugate was tested on differentiated caco-2 cells . to illustrate the resistance to transfection of fully differentiated caco-2 cell monolayers , experiments were performed with bcl-2 targeting sirna complexed with lf ( figure 5a , b ) . transfection of sirna / lf at a concentration of 0.2 mol / l elicited a small decrease of bcl-2 mrna expression ( 21% , figure 5a ) , which was not accompanied by its downregulation at the protein level ( figure 5b ) . we could not achieve dose - dependent bcl-2 mrna knockdown even with sirna concentrations as high as 0.4 mol / l , at which the control sirnanc possessing a target - unrelated sequence caused appreciable suppression of bcl-2 mrna , probably due to the toxicity caused by high concentrations of lf . in contrast , bcl-2 silencing was successfully achieved in proliferating caco-2 cells at a dose of 0.05 mol / l of sirna ( see supplementary figure s6 ) . strikingly , the single - molecule - based l - fana conjugate was able to knockdown bcl-2 mrna in differentiated caco-2 cell monolayers in a sequence - specific and dose - dependent manner ( figure 5a ) . at l - fana concentrations of 1.25 , 2.5 , and 5 / l the target bcl-2 mrna expression was reduced to 56 , 32 , and 26% , respectively . at 5 mol conjugation of dsa was found to be essential for successful delivery , as unconjugated fana did not have any effect on bcl-2 mrna expression even at 5 mol / l . consistent with mrna silencing , western blot analysis demonstrated that l - fana reduced efficiently the target bcl-2 protein level ( by 53% at 2.5 importantly , the treatment with relatively high dose of l - fana neither caused cytotoxicity ( figure 5c ) nor decreased the transepithelial electrical resistance ( teer ) of caco-2 monolayers ( figure 5d ) , which is a measurable indicator of the monolayer integrity . in comparison , the treatment with sodium decanoate , a widely used absorbefacient disrupting the tight junctions , caused a pronounced drop in teer . based on these results , it is likely that l - fana conjugates will be taken up primarily by epithelial cells in vivo with minimal systemic translocation via the paracellular route . intestinal delivery of nucleic acid drugs is a promising therapeutic strategy for treatment of several diseases but faces numerous challenges associated with the complexity of the gi environment . to identify a potent delivery platform , a set of l - on conjugates although all the l - on conjugates carried the same dsa lipid moiety , they induced different degrees of cytotoxicity . this could be attributed to the modification - dependent protein binding of ons or bcl-2-level - dependent cell death . superior silencing efficacy of l - fana and l - moe conjugates compared to those of l - dna and l - ome could result from a combination of factors including higher nuclease resistance and higher affinity for the complementary mrna . a fully phosphorothioated l - ps sirna conjugate showed significant bcl-2 silencing upon carrier - free transfection , while ps sirna without a dsa group did not ( see supplementary figure s2 ) , suggesting that the uptake of l - ps sirna was mediated by the lipid moiety . a phenomenon called gymnosis was recently reported in which target genes are sequence - specifically suppressed in cells by chemically modified ons , such as locked nucleic acids and fana , in the absence of transfection reagents or delivery moiety conjugation . for an efficient and nontoxic gymnotic transfection , prolonged exposure of proliferating cells ( 6 10 days ) to high ( mol / l ) concentrations of ons is required . considering that the average transit times in the small and large intestines of healthy humans are 3 hours and 27 hours , respectively ( as reviewed in refs . 57,58 ) , gymnotic on delivery is likely to be too slow for intestinal tissues , at least in the absence of frequent dosing . moreover , the renewal cycle of intestinal epithelial cells lasts barely 3 5 days , and therefore an intestinal on therapy needs an efficient delivery method to facilitate the target mrna and protein knockdown . in this study , dsa conjugation to ons promoted the delivery of single - stranded antisense ons and even double - stranded sirnas during limited exposure times . several groups have reported that the conjugation of neutral lipids , such as cholesterol and aliphatic fatty acids , to ons improves their uptake and silencing efficacy , both in vitro and in vivo . however , the mechanism of cellular uptake of amphiphilic ons and their trafficking remain poorly understood and appear to be system - dependent . for a successful in vivo delivery of on to intestinal epithelium , l - on conjugates must remain functional in the intestinal environment , and they should be able to silence target genes in difficult - to - transfect epithelial cell monolayers . one concern regarding their biological activity in the intestine was that amphiphilic on conjugates might bind to intestinal lipophilic content , potentially leading to reduced activity . here , in a model system , we demonstrated that free l - fana is released from oil phase after digestion by pancreatic enzymes and retains its silencing ability . the combination of the extreme stability of fana - modified ons toward nucleases and hydrolysis at low ph , together with the high stability of dsa under similar conditions found in the gi tract makes dsa - fana conjugates particularly suitable for gi applications . differentiated intestinal epithelial cells featuring microvilli and expressing tight junctions represent a difficult target for nucleic acid delivery . their reduced proliferation and endocytosis rate in comparison to undifferentiated cells are largely responsible for poor transfection efficacy . regarding particle - based delivery systems , the resistance to transfection observed with differentiated cells may be partially attributed to the structure of their apical membrane featuring microvilli , which limits access to the absorptive membrane . several studies have described a variety of attempts to overcome this barrier by , for example , pretreatment with membrane - disturbing agents , transfection of proliferating caco-2 in the suspension state followed by accelerated differentiation , formulation with small lipid nanoparticles , use of 1-integrin - mediated endocytosis or electroporation . as previously reported for sirna / lf lipoplexes , we were unable to efficiently downregulate target bcl-2 gene in polarized caco-2 cell monolayers . in contrast , the single - molecule - based l - fana conjugate was able to effectively silence the bcl-2 gene expression at both mrna and protein levels in differentiated monolayers . importantly , despite lower potency of carrier - free amphiphilic conjugates in comparison to sirna / lf lipoplexes in classical in vitro assays based on rapidly proliferating cancer cells , they by far outperform particulate delivery vehicles under more stringent conditions , such as the inverted setup or using differentiated cells . the involvement of cell surface receptors , such as fatty acid receptors , better access of l - fana to the adsorptive cell membrane due to the smaller size , or other uptake routes different from lf - mediated endocytosis may explain the efficient target silencing by l - fana conjugate in a nondividing polarized epithelium . although several studies have extrapolated the possible internalization routes of amphiphilic on conjugates in proliferating cells , it is possible that the uptake mechanism and intracellular trafficking can vary among different cell types and states of cell differentiation . the present report demonstrates that amphiphilic on conjugates can be efficiently delivered to colon carcinoma cells in the absence of delivery agents , causing target gene silencing . conjugation of dsa and chemical modification of the on backbone were essential for efficient delivery and enzymatic resistance , respectively . the most encouraging finding was that an l - on conjugate was able to silence bcl-2 mrna and protein in fully differentiated caco-2 cell monolayers . this well - defined single - molecule - based approach proved to be superior to conventionally employed lipoplexes , which were ineffective for transfecting the epithelium . to the best of our knowledge , this is the first study showing the efficient gene silencing in differentiated epithelial cells by an oligonucleotide conjugate in the absence of complexation , delivery device , or membrane - disturbing agents . we believe that l - fana represents a suitable approach to further improve the efficacy of on enteral treatments currently under clinical investigation . in addition , l - fana would also provide a carrier - free tool for molecular biologists studying gene functions in differentiated intestinal epithelium . future work will focus on evaluation of the proposed delivery platform in intestinal disease relevant targets in vivo . azzalin 's group at eth zurich and caco-2 cells were purchased from atcc ( manassas , va ) . dulbecco 's modified essential medium ( dmem ) with glutamax , opti - mem medium , fetal bovine serum ( fbs ) , nonessential amino acids , penicillin - streptomycin solution , trypsin , lipofectamine 2000 ( lf ) , phosphate - buffered saline ( pbs ; 1 mmol / l kh2po4 , 3 mmol / l na2hpo4 , 155 mmol / l nacl , ph 7.4 ) , and rnase - free distilled water were obtained from invitrogen ( carlsbad , ca ) . porcine pancreatin ( 4usp ) , ammonium persulfate , triethylammonium acetate ( teaa ) buffer 1 mol / l , intralipid ( 20% w / v of soybean oil , 1.2% of egg yolk phospholipids , 2.25% of glycerol , ph 68.9 ; mimic of high - fat meal ) , chloroform ( chcl3 ) , triton x-100 , naf , na3vo4 , tris , and skim milk powder were obtained from sigma - aldrich ( buchs , switzerland ) . duplex annealing buffer ( 100 mmol / l potassium acetate , 30 mmol / l hepes , ph 7.5 ) was purchased from integrated dna technologies ( idt , coralville , ia ) . methanol ( meoh ) , n , n , n,n-tetramethylethylenediamine ( temed ) , and phenylmethylsulfonyl fluoride ( pmsf ) were purchased from acros organics ( geel , belgium ) . ethylenediaminetetraacetic acid ( edta ) and polysorbate 20 were purchased from applichem ( darmstadt , germany ) . gel red nucleic acid gel stain was obtained from biotium ( hayward , ca ) . cell counting kit-8 ( cck-8 ) was obtained from dojindo molecular technologies ( rockville , md ) . thermanox coverslips , dna loading dye , nacl , and micro bca protein assay kit were purchased from thermo fisher scientific ( waltham , ma ) . low - binding microcentrifugation tubes ( dna lobind ) were purchased from eppendorf - vaudaux ( schnenbuch , switzerland ) . rneasy mini kit and specific primers for -splicing variant of human bcl-2 mrna ( hs_bcl2_1_sg ; qt00025011 ) and human -actin ( hs_actb_2_sg ; qt01680476 ) were obtained from qiagen ( valencia , ca ) . high - capacity cdna reverse transcription kit and power sybr green polymerase chain reaction ( pcr ) master mix were purchased from applied biosystems ( foster city , ca ) . complete edta - free protease inhibitors ' cocktail was purchased from roche diagnostics ( mannheim , germany ) . poly(vinylidene difluoride ) membranes ( pvdf ) were obtained from bio - rad laboratories ( hercules , ca ) . mouse antihuman bcl-2 monoclonal antibody and horseradish peroxidase ( hrp)-conjugated goat antimouse igg polyclonal antibody were purchased from dako ( glostrup , denmark ) . rabbit anti--actin polyclonal antibody and hrp - conjugated goat antirabbit igg polyclonal antibody were obtained from abcam ( cambridge , uk ) . immunocruz western blotting luminol reagent was purchased from santa cruz biotechnology ( dallas , tx ) . super rx x - ray films were obtained from fujifilm ( tokyo , japan ) . unmodified bcl-2 targeting sirna and negative control sirnanc with nontargeting sequence were synthesized by bioneer ( daejeon , south korea ) . all ons were synthesized according to the standard protocol for automated phosphoramidite solid - phase synthesis except for l - ome conjugate , which was provided by microsynth . dsa was conjugated via an aminohexanol - linker to the 5-end of ons in line with previously described method . all l - on conjugates were purified by reverse - phase hplc , analyzed by lc - ms , and quantified via uv spectrophotometry ( nanophotometer p 330 , implen , germany ) . the ons ' molar extinction coefficients at 260 nm were calculated using the software of idt website ( oligoanalyzer tool , www.idtdna.com/calc/analyzer ) . these modifications were assumed to have negligible effect on the extinction coefficients , as previously described . the complementary single strands of sirnas were combined in duplex annealing buffer at a concentration of 50 mol / l each , heated up to 95c for 1 minute , and cooled slowly to 4c overnight to ensure proper annealing . various ons and l - on conjugates were dissolved in rnase - free deionized water at a concentration of 100 hct-116 cells were maintained in dmem medium supplemented with glutamax containing 10% fbs , 100 units / ml penicillin , and 100 g / ml streptomycin at 37c in a 5%-co2 humidified atmosphere . the cells were seeded in a 24-multiwell plate at a density of 4 10 cells / well . for the inverted transfection , the cells were seeded on thermanox coverslips in a 24-multiwell plate at a density of 1 10 cells / well . caco-2 cells were maintained in dmem medium supplemented with glutamax containing 10% fbs , 100 units / ml penicillin , 100 g / ml streptomycin , and 1% of nonessential amino acids at 37c in a 5%-co2 humidified atmosphere . cells with passage number between 58 and 77 were seeded in a 12-multiwell plate at a density of 7 10 cells / well . for the differentiated caco-2 cell monolayer transfection , the cells were seeded in transwell inserts with polyester membrane with pore size of 0.4 m in a 12-multiwell plate at a density of 1.12 10 cells / well as previously described . the medium was exchanged every other day , and cells between 13 and 17 days of differentiation were used for the experiments . the differentiation of monolayers was monitored by measuring teer using an evom epithelial voltmeter with stx2 electrode ( world precision instruments , sarasota , fl ) . all the monolayers achieved teer higher than 1,000 cm after the 2 weeks of culturing , indicating the completion of differentiation process . teer values of individual wells measured just before the transfection with ons were set to 100% and their change was monitored for the three following days . all experiments were performed on mycoplasma - free cell lines ( regularly checked by mycoalert plus mycoplasma detection kit ) , and only cells in the exponential phase of growth were used for seeding . hct-116 cells were seeded in a 96-multiwell plate at a density of 7 10 cells / well the day before the experiment . alternatively , caco-2 cells were seeded in a 96-multiwell plate , and the culture medium was exchanged every other day for 2 weeks to obtain differentiated monolayers . the cells were treated with various concentrations of l - on conjugates in 50 l of serum - deficient opti - mem medium for 15 hours . the opti - mem medium containing no l - on was used as a control . the medium was exchanged for 100 l of dmem supplemented with 10% fbs , and the cells were further incubated for 24 hours , after which the cell viability was assessed using tetrazolium - based cck-8 reagent following the manufacturer 's instructions . screening of bcl-2 mrna silencing efficiencies of various l - ons . to assess the silencing efficiency of various l - on conjugates , the conjugates at various concentrations ( 0.25 1 given the absence of intact serum in the intestinal environment , all transfection experiments were performed in serum deficient opti - mem medium . the opti - mem medium containing no ons was used as a control . following overnight incubation ( 15 hours ) after 2.5 days of further incubation cells were washed with pbs , and total rna was isolated using rneasy mini kit ( abs260 /abs230 > 1.8 ) according to the previously optimized method . the expression levels of bcl-2 mrna relative to the internal control -actin mrna were quantified by two - step quantitative real - time pcr . briefly , cdna was synthesized from 1.2 g of total mrna using high - capacity cdna reverse transcription kit according to the manufacturer 's instructions . quantitative real - time pcr was performed using power sybr green pcr master mix and specific primers for human bcl-2 and -actin on a 7900ht fast real time pcr instrument ( applied biosystems ) according to the manufacturer 's instructions . briefly , the reaction mixtures were incubated at 50c for 2 minutes and 95c for 10 minutes followed by 40 cycles of denaturation ( 95c for 15 seconds ) and extension / detection ( 60c for 1 minute ) . relative mrna expression levels were calculated using the delta delta ct ( 2 ) method ( the fluorescence threshold was set to 0.4 ) . results are expressed as the bcl-2 mrna level change between on - treated and on - free medium treated cells . l - on potency ( effective concentration causing 50% of target mrna silencing , ec50 ) was calculated using a four - parameter logistic function to fit the dose - response data via sigmaplot 13.0 software . the transfection medium consisted of 250 l of opti - mem containing either 1 mol / l of carrier - free bcl-2 targeting l - fana conjugate or 0.05 mol / l of bcl-2 specific sirna complexed with lf according to the manufacturer 's instructions as a particle - mediated delivery control . hct-116 cells grown on the coverslips were washed with opti - mem , and the coverslips were transferred using tweezers into a new 24-multiwell plate for the transfection . for the upright transfection , the cells were placed on the bottom of the multiwell plate followed by the addition of the transfection medium . for the inverted transfection , the transfection medium was added to the empty well , and the cells grown on coverslips were carefully deposited upside down onto the surface of the medium . the coverslips floated on the surface of the medium due to the surface tension of the medium . after overnight incubation ( 15 hours ) , the cells were transferred to a new plate and further cultured for 2.5 days in 500 l of dmem supplemented with 10% fbs . subsequently , total rna was isolated and gene expression levels of bcl-2 mrna were assessed as described above . l - fana conjugates stability in sif and 0.5% soybean oil emulsion . to investigate the influence of digestive enzymes and food - derived fats present in intestine on the biological function of l - fana , its stability and efficacy were tested in simulated intestinal environment containing pancreatic enzymes and lipids . for polyacrylamide gel electrophoresis analysis , 1 l of l - fana ( 100 mol / l ) was mixed with 9 l of usp sif ( 2.5 g / l porcine pancreatin ( 4 usp ) , 50 mmol / l kh2po4 , ph 6.8 ) or water and incubated for 2 hours or 15 hours at 37c . samples were kept at 95c for 15 minutes to heat - inactivate the enzymes and mixed with 1 l of dna loading dye . alternatively , 1 l of l - fana was premixed with 1 l of 5% soybean oil emulsion in opti - mem ( prepared by diluting 20% intralipid with opti - mem ) for 30 minutes followed by incubation at 37c for 2 hours with 8 l of active / heat - inactivated sif or water . samples were then loaded onto 20% ( w / v ) polyacrylamide gel prepared in a tris - acetate - edta buffer ( tae : 40 mmol / l tris - acetate , 1 mmol / l edta , ph 8.0 ) by free - radical polymerization with ammonium persulfate / temed as an initiator . the gel was then immersed in tae buffer and electrophoresed at constant voltage of 150 v for 60 min . l - fana was revealed following manufacture 's protocol for gel red nucleic acid gel stain , and fluorescence was recorded on a chemidoc xrs ( bio - rad laboratories ) . for the lc - ms analysis , 2 l of l - fana ( 100 mol / l ) were mixed with 18 l of sif or water and incubated for 2 hours at 37c , then at 95c for 15 minutes , and centrifuged at 14000 g at room temperature for 10 minutes . the supernatants were mixed with 50 l of chcl3 , and shaken to extract possible hydrophobic contaminants from sif . after incubating the mixtures at room temperature for a few minutes , analytical liquid chromatography - mass spectrometry ( lc - ms ) was carried out on agilent lc - ms using a reverse phase column ( waters acquity ost c18 , 2.1 x 50 mm , 1.7 m ) with solvent a being 400 mmol / l hfip and 15 mmol / l teaa in water and solvent b being meoh . the flow was set at 0.3 ml / min , and a gradient was run at 65c from 5 to 90% b in 14 minutes . the influence of preincubation of l - fana conjugates with sif on the transfection efficacy was investigated . hct-116 cells were seeded one day prior to the experiment in a 24-multiwell plate at a density of 4 10 cells / well in dmem containing 10% fbs . two and a half microliters of l - fana were pre - incubated with 22.5 l of sif for 2 hours at 37c followed by heat - inactivation of enzymes for 15 minutes at 95c . the mixtures were diluted ten times with opti - mem to a final l - fana concentration of 1 mol / l and incubated with cells overnight ( 15 hours ) . after 2.5 days of further incubation , total rna was isolated , and gene expression levels of bcl-2 mrna were assessed as described above . to study the silencing activity of l - fana released from sif - digested oil emulsion , 2.5 l of l - fana ( 100 mol / l ) were preincubated with 6.25 l of 20% intralipid for 30 minutes at room temperature followed by incubation with 25 l of sif for 2 hours at 37c . the released l - fana was separated from cytotoxic oil digestion products by preparative polyacrylamide gel electrophoresis before transfection experiments . the l - fana band was excised , weighed , and immersed in 250 l of opti - mem . for l - fana extraction , samples containing gel pieces were flash - frozen in liquid nitrogen , heated at 90c for 15 minutes , and agitated at room temperature for 3 hours . the differentiated caco-2 cell monolayers grown in transwell inserts for 2 weeks were washed with opti - mem medium from apical and basal sides . the 500 l of opti - mem medium containing either naked on derivative ( 0.625 5 mol / l ) or sirna ( 0.2 0.4 mol / l ) complexed with lf according to the manufacturer 's instructions was added to the apical compartment . following the overnight incubation ( 15 hours ) , the transfection medium was exchanged with fresh dmem supplemented with 10% fbs in both compartments . for bcl-2 mrna expression analysis by qrt - pcr for bcl-2 protein expression analysis by western blot , cell monolayers were lysed 4 days after transfection in 25 l of lysis buffer ( 20 mmol / l tris hcl ph 7.7 , 150 mmol / l nacl , 5 mmol / l edta , 1% v / v triton x-100 , 25 mmol / l naf , 1 mmol / l pmsf , 1 mmol / l na3vo4 supplemented with complete protease inhibitors ) in line with previously described method . briefly , cell lysates were scraped from the transwells , centrifuged at 10,000 g for 15 minutes at 4c to remove cell debris , and protein concentration in the supernatants was determined by the micro bca assay according to the manufacturer 's instructions . 50 g of total protein per sample were resolved on 12% sds - page under reducing conditions and transferred to a pvdf membrane . the membrane was washed once with tbs - t buffer ( 20 mmol / l tris hcl ph 7.7 , 150 mmol / l nacl , 0.1% v / v polysorbate 20 ) and blocked with tbs - t containing 5% w / v skim milk ( blocking buffer ) for 1 hour . the membrane was cut in two at 35 kda ; the lower part containing bcl-2 ( 26 kda ) was incubated with anti - bcl-2 antibody diluted to 1:100 in blocking buffer , and the upper part containing -actin ( 42 kda , loading control ) was incubated with anti--actin antibody diluted to 1:4,000 overnight at 4c . membranes were washed 3 times for 5 minutes with pbs - t followed by 1.5-hour - incubation with the corresponding hrp - conjugated secondary antibodies diluted to 1:4,000 in blocking buffer . membranes were washed three times with tbs - t , and protein bands were detected with immunocruz luminol reagent and revealed on super rx x - ray films using an agfa curix 60 film processor ( agfa , mortsel , belgium ) . the relative intensities of the bands were analyzed using image j software ( national institutes of health , bethesda , md ) . statistical analysis . all treatment groups were compared pairwise using the one - way analysis of variance ( anova ) test combined with tukey 's ( holm - sidak ) post - hoc test assuming normal data distribution . the differences between treatment groups were considered statistically significant at p - values < 0.05 . supplementary material figure s1 . viability of hct-116 cells after transfection with various on derivatives at a dose of 1 mol / l in opti - mem medium overnight . bcl-2 mrna silencing and viability of hct-116 cells after transfection with various sirna derivatives complexed with lf and free ps sirna . mol / l of l - fana or 0.05 mol / l of sirna / lf in opti - mem medium . figure s4 . the influence of incubation time on knockdown efficacy in hct-116 cells transfected with l - fana or sirna / lf lipoplex . polyacrylamide gel electrophoresis images of l - fana conjugate and unconjugated fana incubated with oil emulsion . transfection of proliferating caco-2 cells with sirna / lf and negative control sirna ( sirnanc)/lf lipoplexes .

nucleic acid therapy can be beneficial for the local treatment of gastrointestinal diseases that currently lack appropriate treatments . indeed , several oligonucleotides ( ons ) are currently progressing through clinical trials as potential treatments for inflammatory bowel diseases . however , due to low uptake of carrier - free ons by mucosal cells , strategies aimed at increasing the potency of orally administered ons would be highly desirable . in this work , we explored the silencing properties of chemically modified and highly resistant ons derivatized with hydrophobic alkyl chain on intestinal epithelial cells . we screened a set of lipid - on conjugates for the silencing of model bcl-2 mrna and selected 2-deoxy-2-fluoro - arabinonucleic acid modified on bearing docosanoyl moiety ( l - fana ) as the most potent candidate with lowest toxicity . the efficacy of l - fana conjugate was preserved in simulated intestinal fluids and in the inverted transfection setup . importantly , l - fana conjugate was able to downregulate target gene expression at both mrna and protein levels in a difficult - to - transfect polarized epithelial cell monolayer in the absence of delivery devices and membrane disturbing agents . these findings indicate that lipid - on conjugates could be promising therapeutics for the treatment of intestinal diseases as well as a valuable tool for the discovery of new therapeutic targets .

Introduction Results Screening of a set of L-ON conjugates for Bcl-2 mRNA knockdown efficacy Target Bcl-2 mRNA silencing by L-FANA conjugate None Discussion Materials and methods Supplementary Material

increasing numbers of aesthetic procedures - especially cosmetic nonsurgical injection procedures - are performed every year ( 1 ) . these procedures are generally safe , although cosmetic facial filler injections could lead to devastating complications such as blindness . there are several reports ( most of which were case reports ) of cosmetic facial filler injection - associated retinal artery occlusion ( 234567891011 ) . a nation - wide survey was recently performed and a thorough analysis was performed on 44 patients regarding the clinical features of this condition with respect to its fluorescein angiographic findings . our group participated in that study and classified occlusion of the ophthalmic artery and its branches into 6 types on the basis of fluorescein angiographic findings and found that the more diffuse occlusion type was associated with poor visual outcomes ( 12 ) . several researchers proposed that the occlusion was caused by retrograde embolism by the injected material ( 378 ) . the supratrochlear and supraorbital arteries are thought to be the possible route for retrograde embolism in the glabellar region and the anastomosis of the dorsal nasal artery and angular artery seems to be the possible inlet of nasally injected embolic material ( 8) . however , the exact mechanism of retrograde embolism is still elusive and precise localization of emboli is difficult when it is evaluated only by fundus fluorescein angiography , especially when the presumed occlusion site is proximal to central retinal arteries . in the previous studies , the two most commonly injected materials , autologous fat and hyaluronic acid ( ha ) showed different clinical features . autologous fat injection was interestingly more frequently associated with diffuse occlusion , compared to ha injection ( 812 ) , while skin necrosis associated with facial filler injection was more common in ha injected cases ( 12 ) . the size difference between autologous fat and ha seems to be related in part to the differences in the clinical features of retinal artery occlusions associated with cosmetic facial injections of these materials ; however , the exact pathophysiology has never been thoroughly scrutinized . cerebral angiography provides more detailed information on blood flow of ophthalmic artery as well as surrounding orbital area which can not be covered by fundus fluorescein angiography . in this study , we aimed to evaluate cerebral angiographic features of cosmetic facial filler - related ophthalmic and retinal artery occlusion patients who had undergone intra - arterial thrombolysis ( iat ) , thus elucidate the pathophysiology of the disease . we retrospectively reviewed the medical records of patients who were diagnosed as having ophthalmic artery and/or retinal artery occlusion associated with cosmetic facial filler injections of autologous fat or ha and underwent iat along with transfemoral cerebral angiography at the seoul national university bundang hospital ( seongnam , korea ) between january 1 , 2008 and august 31 , 2014 . in particular , iat was considered for patients who presented less than 24 hr after symptom onset and for patients without any systemic conditions that restricted thrombolysis , such as uncontrolled hypertension , coagulation disorders , or a history of intracranial or extracranial hemorrhages within 6 months before presenting to the hospital . after a detailed ophthalmologic evaluation that included fundus fluorescein angiography , iat was performed with transfemoral cerebral angiography using a biplane angiographic unit ( integris allura ; philips medical systems , eindhoven , the netherlands ) . a microcatheter ( excelsior sl-10 ; stryker neurovascular , fremont , ca , usa ) was placed in the proximal part of the ophthalmic artery , and a thrombolytic agent - urokinase ( in patients with fat embolism , green cross , yongin , korea ) or hyaluronidase ( in patients with ha embolism , kuhnil pharm , seoul , korea ) or both- was slowly injected with mechanical disruption by microwire to dislodge the emboli distally . the hyaluronidase dosages ranged between 1,000 units and 9,000 units , and the urokinase dosage was up to 500,000 units . we evaluated cerebral angiography by localizing the embolic obstruction site on ophthalmic angiogram and characterizing the pattern of distal angiographic runoff on external carotid angiogram , which was corresponded to skin necrosis lesion . this study was approved by the institutional review board of seoul national university bundang hospital ( seongnam , korea , no . this study was approved by the institutional review board of seoul national university bundang hospital ( seongnam , korea , no . a total of 17 patients ( 10 ha - injected patients and 7 autologous fat - injected patients ) sustained ophthalmic artery and/or retinal artery occlusion associated with cosmetic facial filler injections during the period . of these patients , 7 patients ( 4 ha - injected patients and 3 autologous fat - injected patients ) underwent iat along with cerebral angiography , and were finally included in this study . the clinical findings for 4 of 7 patients had already been published in the literature ( 68912 ) . table 1 summarizes the demographics , clinical characteristics and cerebral angiographic findings of the study patients . all patients were women and most were young ( mean age of 40.612.7 yr ) . diffuse occlusions such as complete ophthalmic artery occlusion or occlusion of its branches were noted in all patients . three of 4 ha - injected patients showed skin necrosis , whereas all fat - injected patients and one ha - injected patient who were immediately treated with subcutaneous hyaluronidase injection by the physician who performed cosmetic filler injection showed none or mild skin lesion . one patient in fat - injected group showed concomitant middle cerebral artery territory infarct on brain magnetic resonance image . all patients arrived at the emergency room immediately ( i.e. , 4 hr or less ) after symptom onset and underwent iat on the same day . however , the result of thrombolysis was unfavorable because only 2 patients showed partial recanalization of the obstruction ( table 1 ) . the visual outcome was poor that all patients had final vision of no light perception . a case of autologous fat injection - associated retinal artery occlusion is shown in fig . 1 . on fundus photography , initially it appeared as occlusion of a branch of the retinal artery because one branch of the artery is occluded and retinal edema was present in the involved area ( fig . however , with fluorescein angiography , retinal perfusion and the choroidal perfusion were severely delayed ( fig . there is abrupt cut off of some of the arteriolar ends and showed focal hyperfluorescence in the late phase of fluorescein angiography , which suggests direct embolic obstruction of the arterioles ( fig . the selective ophthalmic angiogram revealed a large filling defect in the proximal ophthalmic artery , which explains the retinal and choroidal hypoperfusion in fluorescein angiography ( fig . the day after iat , retinal vessels were still segmented and the margin was blurred due to retinal edema secondary to ischemic injury ( fig . the choroidal perfusion was improved after iat , while retinal perfusion remained compromised ( fig . however , selective ophthalmic artery angiographic findings were different between ha - injected patients and fat - injected patients . a large filling defect was visible in the proximal part of the ophthalmic artery , and blood flow was compromised to the supratrochlear or supraorbital branch , and to the posterior ciliary branch in the fat - injected patients ( table 1 and fig . 3e - g ) . on the other hand , in the ha - injected patients , although there was flow stagnation in the distal branches of ophthalmic artery on initial angiogram , selective , pressurized infusion of contrast dye revealed grossly no mechanical obstruction in the supratrochlear branch or the supraorbital branch , while blood flow to the eyeball was compromised ( fig . however , the exact obstruction level was obscure . in two patients , obstruction was present at the level of the second segment of ophthalmic artery including the posterior ciliary branch ( table 1 , fig . 3a and d ) , while the other 2 patients did not show definite obstruction point in the second segment of ophthalmic artery ( table 1 , fig . the selective angiographic findings for the external carotid artery were also distinctly different between the ha - injected and fat - injected groups . three ha - injected patients showed diminished angiographic runoff in the distal branches of the internal maxillary and facial arteries , and decreased contrast staining in the periorbital area ( table 1 and fig . this finding was corresponded with skin lesion of the patients , as these patients revealed skin necrosis on injected area ( fig . on the other hand , all fat - injected patients and one ha - injected patient who was also treated with subcutaneous hyaluronidase injection showed preserved distal runoff in the distal branches of the internal maxillary and facial arteries and more prominent contrast staining in the periorbital area ( table 1 and fig . in this study , we carefully reviewed the angiographic findings of cosmetic facial filler injection - associated ophthalmic artery occlusions . although it is known that both ha and autologous fat injection could result in various spectrum of ophthalmic and retinal arterial occlusion ( 12 ) , all cases included in this study showed diffuse ophthalmic artery and its branches occlusion . both ha and autologous fat injection group showed severely compromised choroidal and retinal perfusion on fundus fluorescein angiography . despite these similar fundus findings , the cerebral angiographic findings were distinctively different between the ha - injected patients and the fat - injected patients . on selective ophthalmic angiography , all fat - injected patients had visible , large filling defects at the proximal part of the ophthalmic artery , whereas the ha - injected patients had obstruction at a more distal area than that observed in fat - injected patients . another interesting finding is that skin necrosis was mostly present in the ha - injected patients . in the previous study , our group also found the trend that 5 ( 23% ) of 22 fat - injected patients had skin lesions , whereas 9 ( 69% ) of 13 ha - injected patients had skin lesions ( p=0.007 ) ( 12 ) . however , by comparing the selective external carotid angiograms , we found that the angiographic runoff is diminished primarily in the distal branches of internal maxillary and facial arteries only in ha - injected group . this could have resulted from direct vascular obstruction by the injected filler material . on the other hand , the wide range of vascular runoff decrease around the filler - injected facial area also suggests another possibilities that the impediment of normal blood flow caused by elevation of distal intra - tissue pressure . some authors suggest that injected ha expands as it attracts water ; the facial artery and the angular artery or its branches become compressed , and skin necrosis ensues ( 1314 ) . in our cases , the skin necrosis lesion was most severe on a few days after cosmetic filler injection and this also supports the pressure necrosis mechanism secondary to local ischemic edema or to hydrophilic , volume - expansion properties of ha . interestingly , the patient who underwent immediate subcutaneous hyaluronidase injection showed relatively preserved angiographic runoff in the distal branches of internal maxillary and facial arteries and she sustained only mild erythema in filler injected area . hyaluronidase might have dissolved ha in injected area and reduced intra - tissue pressure , which improved vascular supply in the area and prevented skin necrosis . however , skin necrosis in ha - injected patients can not be fully explained only by pressure necrosis mechanism , as only small proportions of ha - injected patients suffer these complications . it would be more reasonable to explain as mechanical interruption of the vasculature of injected area are further compromised by increased tissue pressure secondary to both ischemic tissue edema and hydrophilic , volume - expansion properties of ha . in addition , increased distal tissue pressure could have worsened the blood flow into the periorbital area from the ophthalmic artery because the pressure gradient from ophthalmic artery to its peripheral branch is diminished . during the cerebral angiography in ha - injected patients , there was initial flow stagnation in the supratrochlear or supraorbital branches of ophthalmic artery , which was proven to be no mechanical obstruction after selective , pressurized infusion of contrast dye into ophthalmic artery . this finding also suggests that some proportion of flow impediment in ha - injected patients stems from decreased pressure gradient secondary to increased distal tissue pressure . previously thought as partial recanalization of frontal branches of the ophthalmic artery after iat might have been in reality , forced flow with pressure in the stagnated area ( 9 ) . based on all these findings , we summarized the different mechanisms of occlusion of the ophthalmic artery and its branches caused by ha and autologous fat in fig . fat particles in an aggregated form could completely block the proximal part of the ophthalmic artery . small fat particles could also obstruct smaller vessels , as proven by the presence of branch retinal artery occlusion cases in the previous literature ( 12 ) , and arteriolar obstruction found in late fundus fluorescein angiography in this study . on the other hand , ha seems to be more uniform in size and could obstruct the more distal part , compared to a fat embolism . this could be the reason for the less prevalent diffuse occlusion of ophthalmic and its branches in ha - injected patients compared to autologous fat - injected group ( 12 ) . furthermore , the exact obstruction level would be different between ha and autologous fat injected group with diffuse occlusion , although the clinical manifestation is similar as complete ophthalmic artery or central retinal artery occlusion . it is likely that diffuse ophthalmic artery occlusions caused by ha injection may arise from multiple obstructions of the retinal and posterior ciliary vessels rather than by a large bolus of filler material completely obstructing the proximal part of the ophthalmic artery , as in the fat - injected patients . another remarkable finding is that ha might increase distal intra - tissue pressure by attracting water , and thereby impede blood flow into these areas since the pressure gradient between the ophthalmic artery and its distal branches may be diminished ( fig . molecular characteristics of ha is determined by the amount of molecular cross - linking ( 15 ) . recently , by adding low molecular weight ha polymer chains into high molecular weight ha , more efficient cross - linking capability was achieved . the resultant material became more cohesive and viscous , and showed good clinical outcomes ( 16 ) . in addition to the size of the material , cohesiveness or viscosity might also affect material embolism . unfortunately , the information on the exact composition or brand name of ha injected in this study is lacking , thus the influence of cohesiveness or viscosity of the injected material on embolism is obscure . further study with regard to the cohesiveness or viscosity of injected material and its relationship with embolism is needed . only 2 patients showed partial recanalization of the obstructed vessel , but they had no visual gain . hyaluronidase is a soluble protein enzyme that breaks down and hydrolyzes ha by splitting the glucosaminidic bond of glucuronic acid ( 1718 ) . it is also used in cases of skin necrosis derived from ha filler injections , and results in a good clinical course ( 19 ) . the experimental study also suggested that hyaluronidase may reduce skin necrosis if injected within the first 4 hr ( 20 ) . in our study , in contrast to other three ha - injected patients , the patient who underwent subcutaneous hyaluronidase injection showed good vascular supply in periorbital area and no significant skin lesion . however , with regard to ophthalmic artery obstruction , the role of iat and hyaluronidase seems to be very limited . complete obstruction by a large fat aggregate may be associated with a poor outcome , and no current treatment method can be recommended . our study is limited by the small number of patients included in this study . however , considering that cosmetic facial filler related ophthalmic and retinal artery occlusion is very rare complication , this is by far the largest case series on cerebral angiographic findings of ophthalmic complication following cosmetic facial filler injection . furthermore , the distinctive angiographic characteristics between ha - injected and fat - injected patients noted even in this small case series provide valuable information on the pathophysiology of cosmetic facial filler injection - associated occlusion of the ophthalmic artery and its branches . in conclusion , the size difference between injected materials is associated with different angiographic findings . large , aggregated autologous fat particle is more prone to obstruct proximal part of ophthalmic artery , whereas small ha particle obstructs distal branches compared to fat embolism . in addition , hydrophilic and volume - expansion property of ha might exacerbate blood flow on injected area , either by compressing already disrupted vessels or by diminishing the pressure gradient between the ophthalmic artery and its distal end , which is also related to skin necrosis . considering the angiographic findings of the involved cases , iat has a limited role in reconstituting blood flow or regaining vision in cosmetic facial filler - associated ophthalmic artery occlusions .

cosmetic facial filler - related ophthalmic artery occlusion is rare but is a devastating complication , while the exact pathophysiology is still elusive . cerebral angiography provides more detailed information on blood flow of ophthalmic artery as well as surrounding orbital area which can not be covered by fundus fluorescein angiography . this study aimed to evaluate cerebral angiographic features of cosmetic facial filler - related ophthalmic artery occlusion patients . we retrospectively reviewed cerebral angiography of 7 patients ( 4 hyaluronic acid [ ha ] and 3 autologous fat - injected cases ) showing ophthalmic artery and its branches occlusion after cosmetic facial filler injections , and underwent intra - arterial thrombolysis . on selective ophthalmic artery angiograms , all fat - injected patients showed a large filling defect on the proximal ophthalmic artery , whereas the ha - injected patients showed occlusion of the distal branches of the ophthalmic artery . three ha - injected patients revealed diminished distal runoff of the internal maxillary and facial arteries , which clinically corresponded with skin necrosis . however , all fat - injected patients and one ha - injected patient who were immediately treated with subcutaneous hyaluronidase injection showed preserved distal runoff of the internal maxillary and facial arteries and mild skin problems . the size difference between injected materials seems to be associated with different angiographic findings . autologous fat is more prone to obstruct proximal part of ophthalmic artery , whereas ha obstructs distal branches . in addition , hydrophilic and volume - expansion property of ha might exacerbate blood flow on injected area , which is also related to skin necrosis . intra - arterial thrombolysis has a limited role in reconstituting blood flow or regaining vision in cosmetic facial filler - associated ophthalmic artery occlusions .

INTRODUCTION MATERIALS AND METHODS Ethics statement RESULTS DISCUSSION

with the ever increasing importance of clinical effectiveness , audit and quality assurance ; it is becoming mandatory to grade one 's own treatment results . the idea of individuals grading their own performance is a self - teaching exercise and improves the quality of future treatment . the assessment of orthodontic treatment needs and the outcome has traditionally been accomplished using subjective opinion and the experiences of clinicians . however , the variations in criteria used by different orthodontists and lack of reproducibility are limitations of the subjective evaluation . visual analog scale ( vas ) has been the most widely used as a subjective assessment method for the validation of various indices . in early surveys , various classifications were used as determinants of treatment needs and outcome . however , various authors such as massler and frankel , drakers , bjoerk et al . , and summers devised indices to evaluate malocclusion on the basis of objective requirements of occlusal discrepancies . pickering and vig were the first to investigate the use of summers occlusal index as objective grading version to assess the outcome of treatment . devised peer assessment rating ( par ) indices to evaluate malocclusion on the basis of objective requirements of occlusal discrepancies . the american board of orthodontics ( abo ) model grading system is presently one of the most detailed scoring systems in use . comprehensive clinical evaluation as outcome assessment was developed which included facial form , dental esthetics , vertical control , arch form , periodontium management , root structure preservation , and treatment efficiency . to assess clinical performance , both objective and although there are many studies in the literature mentioning the orthodontic treatment outcome of various bracket systems , various extraction pattern , various bracket slot size , type of orthodontic practice , that is , private versus university practice , timing of treatment ; and general practitioner versus orthodontist but , to our knowledge , there are very few studies in the literature mentioning the effect of assessment of treatment outcome on the orthodontic treatment outcome . thus , the present study was conducted to find out the role of posttreatment critical evaluation ( ptce ) implementation on the effect of orthodontic treatment outcome . to eliminate any institutional bias , the study sample comprised of pretreatment and post treatment orthodontic records of 235 consecutively debonded cases in the department of orthodontics , oral health sciences centre , postgraduate institute of medical education and research , chandigarh . cases whose orthodontic treatment was completed during the period 1999 and 2004 were included in phase - i ( n = 109 ) evaluation . a total of 278 cases were debonded during this period , out of which 120 cases comprised of compromised debond and incomplete records and 49 cases comprised of cleft and surgical cases . cases whose orthodontic treatment was completed during the period 2006 and 2010 were included in phase - ii ( 126 ) evaluation . the sample was extracted from a total of 328 debonded cases , out of which 108 comprised of cleft and surgical cases , 94 had incomplete records . while selecting a case for the evaluation , no attempt was made to select a case on the basis of malocclusion type , gender or extraction pattern . orthodontic cases having good quality pretreatment and posttreatment records such as study models , photographs , and orthopantomograms ( opgs ) ; and orthodontic cases those had completed comprehensive orthodontic treatment in both the arches were included in the study . orthodontic cases having good quality pre - treatment and post - treatment records like study models , photographs and orthopantomograms and orthodontic cases those had completed comprehensive orthodontic treatment in both the arches were included in the study . in order to improve the quality of orthodontic care , ptce of each case was made mandatory as a part of the clinical protocol after phase - i study . the power point presentation contained detailed pre and post treatment records which included study models , intraoral and extra - oral photographs , intraoral periapical radiographs , opg , lateral cephalograms . detailed history , progress of treatment , number of missing appointments , data from study model , opg and lateral cephalometric analysis and abo model grading , superimpositions of pretreatment , stage , and post - treatment cephalograms ( to evaluate growth , change in facial profile and incisor molar positions ) were also included in the power point presentation . during the presentation , pre- and post - treatment records , data and treatment plan were critically evaluated by all the postgraduate residents and faculty . the presence of any lacunae in the treatment was discussed , and special emphasis was given to improve these lacunae subsequently . then , 6-years after implementation of compulsory ptce for each case , the orthodontic treatment outcome of all consecutively debonded cases was evaluated ( phase - ii ) . the treatment outcome was evaluated by american board of orthodontics model grading system ( abo mgs ) and subjective evaluation . the abo model grading system included eight criteria to measure the post - treatment finishing of the occlusion . post - treatment study models and panoramic radiographs were scored by one examiner for eight components of the abo mgs using the abo measuring gauge . the intraexaminer calibration was done by repeated abo scoring by the examiner at the interval of 4 weeks . as per the abo instruction , a case with < 20 points would pass , and the case with 30 points would fail . a case with points more than 20 but thus , the scores were thus divided into three categories , that is , grade - i ( score 020 points ) , grade - ii ( score 2030 points ) , and grade - iii ( score > 30 points ) . the subjective evaluation was carried out by three external examiners who were senior orthodontists with a minimum of 7 years of clinical experience and also involved in orthodontic teaching . the external examiners were chosen to avoid any bias in scoring cases from one 's own department . each of the three examiners judged debonded cases independently at different time periods for treatment outcome based on combined assessment of the pre- and post - treatment dental casts and photographs ( extraoral and intraoral , pre- and post - treatment photographs ) . the mean of the vas score allotted for each case by the three examiners was calculated for the purpose of analyzing the results . the scale used was 11-point ( 010 ; 0 = very poor , and 10 = excellent ) vas , which was anchored at its two ends with extreme limits of very poor and excellent . the total vas score was divided into three grades , that is , poor ( vas score 04.9 ) , fair ( vas score 56.9 ) , and good ( vas score 710 ) . the treatment outcome of cases in phase - i and phase - ii evaluation were noted on a standard performa . the mean values with standard deviation for the individual components and the total abo score of the abo model grading system for the total sample was recorded . the mean of the vas score allotted for each case by the three examiners was calculated for the purpose of analyzing the results . the statistical analysis was carried out using spss - software version-16.0 ( spss inc . released 2007 . the intra examiner reliability was determined among the various components of the abo mgs and the total score by using paired t - test and pearson 's correlation coefficient . the cronbach 's alpha test was used to determine the intraexaminer reliability for each of the three examiners . unpaired t - test was used to compare various components and a total score of abo model grading system and subjective evaluation between phase - i and phase - ii . the chi - square test was used for comparison between phase - i and phase - ii for different categories of abo model grading and subjective evaluation . the statistical analysis was carried out using spss - software version-16.0 ( spss inc . released 2007 . the intra examiner reliability was determined among the various components of the abo mgs and the total score by using paired t - test and pearson 's correlation coefficient . the cronbach 's alpha test was used to determine the intraexaminer reliability for each of the three examiners . unpaired t - test was used to compare various components and a total score of abo model grading system and subjective evaluation between phase - i and phase - ii . the chi - square test was used for comparison between phase - i and phase - ii for different categories of abo model grading and subjective evaluation . the intra examiner reliability among the various components of the abo mgs and the total score was found to be between 0.888 and 1 . the description of cases evaluated during the phase - i and phase - ii evaluation is summarized in table 1 . description of cases evaluated during phase - i and phase - ii evaluation the mean value for the individual components of the abo mgs and the total abo score for the total sample in phase - i and phase - ii evaluation is described in table 2 . the mean scores of alignment , marginal ridge relationship , occlusal contacts , and interproximal contacts were improved in phase - ii evaluation as compared to phase - i evaluation ; and the difference was comparable . the buccolingual inclination , occlusal relationship , and root angulation were improved significantly during phase - ii evaluation ( p < 0.001 ) . the score for overjet was improved from phase - i evaluation to the phase - ii evaluation ( p < 0.01 ) . the total abo score was improved significantly from 30.06 10.54 at phase - i evaluation to the 26.67 7.77 at phase - ii evaluation ( p < 0.01 ) . the mean values for the individual components of the abo mgs and the total abo score for the total sample in phase - i and phase - ii evaluation and their comparison the distribution of the sample according to abo score during phase - i and phase - ii evaluation is described in table 3 . the percentage of cases in the grade - i of abo category was similar during phase - i and phase - ii evaluation ( 20.10% vs. 20.63% ) . the percentage of cases in the grade - ii of abo category was improved significantly from phase - i evaluation ( 34.03% ) to phase - ii evaluation ( 50.79% ) ( p < 0.01 ) . the percentage of cases in the grade - iii of abo category was decreased significantly during phase - ii evaluation ( 45.87% ) as compared to the phase - i evaluation ( 28.57% ) ( p < 0.01 ) . comparison of total number of cases falling in each category of abo model grading system between phase - i and phase - ii evaluation the value of reliability for three examiners was found as 0.675 that indicated the good reliability between the examiners . the vas score for the total samples evaluated in phase - i and phase - ii is described in table 4 . the mean vas score for the total sample was improved from 5.66 0.77 at phase - i to 6.02 0.99 during phase - ii . the percentage of cases in the poor and fair grades was decreased from phase - i evaluation to the phase - ii evaluation . the percentage of cases scoring good score was increased significantly from 7.34% at phase - i evaluation to 19.05% at phase - ii evaluation indicating improvement in the orthodontic treatment outcome ( p < 0.01 ) . comparison of mean vas score and total number of cases falling in each category of vas grading between phase - i and phase - ii evaluation the excellence in finishing and the quality displayed at the end of orthodontic treatment constitutes a fundamental goal of orthodontic specialty . during all stages of treatment , one should keep the end results in mind , providing a protected occlusion , better aesthetics ( both dental and facial ) , good periodontal health and long - term stability , which are correlated to proper finishing . the sample for the study was collected from the records available in the department for a large sample in order to draw generalized conclusions . the gender distribution was not considered while including a case for the study because of uneven distribution of males and females . all the cases were evaluated by the same observer and the intraexaminer reliability value was found as 0.985 , which was > 0.85 recommended by abo members . the results of the present study showed a reduction in the mean total abo score from 30.06 10.54 to 26.67 7.77 . there was an improvement in the score of each component of abo model grading system . the cases falling in the grade - ii category had also been increased from 33.03% to 50.79% from the phase - i evaluation to phase - ii evaluation . the implementation of compulsory ptce was responsible for the improvement in the treatment outcome at phase - ii evaluation . the average total abo score ( 26.67 ) that we observed at the end of phase - ii evaluation was less than the average score of 45.54 18.33 for university group of illinois and 33.88 for abo group . the results of the present study correspond with the study done in indiana university school of dentistry . the better results in our study could be secondary to the implementation of compulsory ptce for orthodontic residents . we also considered a subjective assessment by three external orthodontists to compare the overall treatment outcome and treatment quality . in the subjective evaluation , not only study models were evaluated , but also intraoral and extraoral photographs were evaluated to identify the improvement in the profile . as the scoring on the vas was totally based on the personal opinion and judgment of the external examiners , this evaluation was purely subjective in nature and no standardization in terms of any set criteria or guidelines was carried out . therefore , an absolutely independent judgment was done by removing the confounding bias related to a discussion among the examiners . similar to abo model grading scores , the vas score was also improved at phase - ii evaluation , and the implementation of compulsory ptce was responsible for such improvement . however , unlike abo model grading system , the subjective evaluation scored the treatment results by looking at the change in occlusion , as well as facial appearance , thus it did not have the inherent limitation of objective indices . the lack of any objective measures to determine the results explained the low reliability of subjective criteria . similarly , to our study low reliability values were also reported by richmond et al . , where they used a 9-point scale for subjective assessment of dental casts with respect to deviation from normal occlusion in the validation study of the par index by 74 dentists . to reduce the effect of interexaminer variability the mean score of three examiners was used for the final score in the statistical comparison of results . thus , the present study showed that the implementation of ptce improved the quality of orthodontic treatment among orthodontic residents , and the ptce should be implemented as compulsory in a postgraduate orthodontic clinic . the quality of orthodontic care was improved significantly following the implementation of ptce in a postgraduate orthodontic clinic .

objective : the aim of the study was to evaluate the effect of post- treatment critical evaluation on the quality of orthodontic care in a postgraduate orthodontic clinic.materials and methods : orthodontic treatment outcome of 109 consecutively treated cases was evaluated in phase - i evaluation . following phase - i evaluation , ptce of each case was made mandatory . after 6-years of implementation of compulsory ptce for each case , orthodontic treatment outcome of all consecutively treated cases ( n = 126 ) was evaluated ( phase - ii ) . the treatment outcome was evaluated by american board of orthodontics model grading system ( abo mgs ) and subjective evaluation ( visual analogue scale , vas).results : based on the abo scores , the cases were divided into three grades , that is , grade - i , grade - ii , and grade - iii . the mean total abo score was improved significantly in phase - ii evaluation ( p < 0.01 ) . the total number of cases in abo grade - ii were increased significantly ( p < 0.01 ) whereas cases in abo grade - i remained comparable . the vas score was improved from 5.66 0.77 at phase - i to 6.02 0.99 at phase - ii evaluation ( p < 0.01).conclusion : the implementation of ptce significantly improved the quality of orthodontic care in a postgraduate orthodontic clinic.clinical significance : grading one 's own treatment improves the quality of future treatment .

Clinical Significance: INTRODUCTION MATERIALS AND METHODS Statistical analysis RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

concentrations of ambient pm2.5 ( particulate matter < 2.5 microm in aerodynamic diameter ) were associated with increased mortality in two prospective cohort studies . in this paper , i assess whether the weight of the evidence supports a causal association . i assumed the study population in each city to have the same exposure ; therefore , these are ecologic studies because exposure is at the group level . health outcome and confounding data are at the individual level . ambient pm concentrations are inadequate surrogates for personal exposure because they are at the group level and comprise only a small proportion of personal exposure , they change over time , and they constitute only a small proportion of a life span . the strength of association and exposure - response relationships can not be determined because the ecologic group - level risks of pm2.5 are overestimated 150- to 300-fold based on an analogy with individual - level exposure to inhaled cigarette smoke . risk estimates may also be high because of confounding from factors such as physical activity and lung function . the evidence is not coherent because the stronger associations are expected to be with morbidity , but instead are with mortality . for example , pm2.5 was associated with mortality but not with measurable reductions in lung function . biological plausibility is lacking because lifetime exposure of rats to combustion products at concentrations two to three orders of magnitude higher than air pollution levels cause lung overloading but no consistent reduction in survival . criteria for quantitative risk assessment are not met so the data are not useful for setting air quality standards . the weight of evidence suggests there is no substantive basis for concluding that a cause - effect relationship exists between long - term ambient pm2.5 and increased mortality.imagesfigure 1figure 2figure 3figure 4figure 5

Images

beryllium was released into the air from routine operations and three accidental fires at the rocky flats plant ( rfp ) in colorado from 1958 to 1989 . we evaluated environmental monitoring data and developed estimates of airborne concentrations and their uncertainties and calculated lifetime cancer risks and risks of chronic beryllium disease to hypothetical receptors . this article discusses exposure - response relationships for lung cancer and chronic beryllium disease . we assigned a distribution to cancer slope factor values based on the relative risk estimates from an occupational epidemiologic study used by the u.s . environmental protection agency ( epa ) to determine the slope factors . we used the regional atmospheric transport code for hanford emission tracking atmospheric transport model for exposure calculations because it is particularly well suited for long - term annual - average dispersion estimates and it incorporates spatially varying meteorologic and environmental parameters . we accounted for model prediction uncertainty by using several multiplicative stochastic correction factors that accounted for uncertainty in the dispersion estimate , the meteorology , deposition , and plume depletion . we used monte carlo techniques to propagate model prediction uncertainty through to the final risk calculations . we developed nine exposure scenarios of hypothetical but typical residents of the rfp area to consider the lifestyle , time spent outdoors , location , age , and sex of people who may have been exposed . we determined geometric mean incremental lifetime cancer incidence risk estimates for beryllium inhalation for each scenario . the risk estimates were < 10(-6 ) . predicted air concentrations were well below the current reference concentration derived by the epa for beryllium sensitization.imagesfigure 1figure 2figure 3figure 4figure 5figure 6

Images

the motility of nk cells in tissue or tumor microenvironment is likely driven by chemotactic signaling resulting in an approximation to key sites of interest , although nk cell motility in tumors is also driven by the expression of nkg2d ligands . therefore , similar to a t - cell sampling dendritic cells , nk cells undergo brief , exploratory interactions with multiple cell types , which may represent their initial encounter with a target ( figure 1a ) . it is not known what molecules specifically mediate these interactions , although there are a number of candidate receptors expressed on resting or primed nk cells , including a variety of tethering ' receptors as well as potentially more robust adhesion receptors . the former potentially include cd62l and psgl-1 ; the latter include cd2 , dnam-1 , nkg2d , the natural cytotoxicity receptors and lymphocyte function associated antigen-1 ( lfa-1 ) . unlike t cells , a subset ( 10% ) of freshly isolated human nk cells express the activated conformation of lfa-1 at rest , which presumably allows adhesion to a target before the engagement of other activating receptors . the transmission of a second activating signal through a receptor such as nkg2d , dnam-1 , 2b4 ( cd244 ) or cd2 strengthens these interactions by further activating lfa-1 , resulting in firm adhesion to the target and potentially providing minimal requirements for progression to mediating cytotoxicity . we are still learning of surprising interactions that nk cells engage in , likely in part due to the complex microenvironment that they patrol . one such unconventional form of communication is the formation of membrane nanotubes ( figure 1a ) . nanotubes appear to serve as intercellular tethers formed rapidly after contact with the target cell and can help guide the nk cell to the target cell or provide traction during its initial interaction . rather than hollow tubes that mediate free diffusion , nk cell nanotubes are heterogeneous structures that transmit signals over long distances and can even deliver lytic granules from an nk cell to a target . importantly , their formation enhances cytotoxicity . nkg2d and downstream activation molecules including dap10 and vav1 accumulate at the nanotube junction , resulting in the description of this junction as a nanoscale synapse . however , blocking either lfa-1 or 2b4 does not reduce the frequency of nanotube formation , suggesting that this is not simply a stretched conventional lytic synapse . cd2 expression specifically increases the frequency of nk target cell nanotubes , suggesting a role for specific receptor ligand interactions in their formation and partially explaining the observation that cd2 enhances nk cell cytotoxicity . the mechanism by which this occurs , and the prevalence of nanotubes during routine physiological nk surveillance , remains unclear . another example of the complex initial interaction may be the newly observed phenomenon of nk cell - derived exosomes : nk surface marker - expressing , fasl and perforin - containing nanovesicles ( 50100 nm ) that , upon release from nk cells , can mediate target cell killing independent of is formation . they may also potentially transfer key ligands to target cells to enable more robust interactions in environments in which exosome concentrations are high . this concept , in concert with nanotubes , harkens to a provocative early proposal of harpooning ' as a contributor to nk cell cytolytic function . despite their apparent constitutive secretion by human nk cells isolated from peripheral blood , the relative contribution of exosomes to an nk - mediated cytotoxic response following target cell contact , lfa-1 engagement initializes the first steps of is formation , including protein tyrosine kinase activation , pip(4,5)p2 generation and f - actin reorganization ( figure 1b ) . in synergy with activating receptor ligation , lfa-1 also induces an arrest signal to migrating cells , with a strong activating signal resulting in a stable radially symmetrical synapse and inhibitory signaling resulting in asymmetry and subsequent resumption of migration . whether nk cells kill through kinapses ' , or moving synapses , as has been described in t cells , remains to be determined . lfa-1-mediated outside - in signaling for f - actin polymerization brings together all the requisite components for f - actin polymerization and initiates this process . this initial signaling also includes the phosphorylation of vav1 by a src family kinase , its recruitment to lipid rafts and subsequent further activation as discussed in subsequent steps below . therefore , initial engagement of lfa-1 in concert with a second signal can help to ready an nk cell for target cell lysis . at this point the nk cell is likely still highly sensitive to a balance of activating and inhibitory signaling , and control of vav1 phosphorylation and subsequent actin accumulation is thought to be a critical axis in the regulation of cytotoxicity . at this stage , microclusters are likely present , may be functional and are also described further below . despite the tightly regulated steps leading to nk cell cytotoxicity , there is evidence that pre - docked granules are present in the cell cortex and can be accessed rapidly by nk cells . lytic granule secretion at the is before microtubule - organizing center ( mtoc ) polarization has been described in primary human cytotoxic t lymphocytes ( ctls ) . although it is conceivable that antigen specificity of t cells allows for the circumvention of further checkpoints to cytotoxicity , lytic granules are present in the cortex of resting nk cells and initial exocytosis bursts are detected ( figure 1b ) . despite these observations , imaging of both nk cell lines and primary nk cells by both live and fixed cell microscopy indicates that the majority of nk cells go through the multistep , highly regulated steps to cytotoxicity ( figure 2 ) . therefore , it is unclear as to what the significance of the presence and potential exocytosis of pre - docked granules is . in this light , it is also still unclear how many lytic granules are required to kill specific types of target cells . polarization of the mtoc and lytic granules to the is is required for nk cell cytotoxicity and occurs in the effector stage . however , preceding mtoc polarization , lytic granules rapidly move along microtubules and converge upon the mtoc ( figure 1c ) . this minus - ended lytic granule movement depends on dynein motor function but is independent of actin polymerization or microtubule dynamics . it also occurs whether the nk cell is conjugated to a susceptible or resistant target cell , as it is observed in the presence of an inhibitory synapse . this suggests that granule convergence is a step that precedes nk cell commitment to cytotoxicity , instead preparing the cell for it . accordingly , ligation of cd28 or lfa-1 alone is sufficient to induce lytic granule convergence , as is activation by soluble interleukin-2 . disruption of lamp-1 ( cd107a ) expression also results in impaired lytic granule motility , which corresponds with a decrease in association of the dynein component p150 with lytic granules . although this suggests that lamp-1 itself may mediate the interaction of granules with dynein , the mechanism of this is unknown . interestingly , mtoc polarization in lamp-1-deficient cells is intact , suggesting that convergence is not a prerequisite for polarization . lytic granule convergence before mtoc polarization likely represents the final juncture at which nk cells are susceptible to inhibitory signaling before a commitment to cytotoxicity . signaling through immunoreceptor tyrosine - based inhibitory motif ( itim)-containing inhibitory receptors induces formation of the inhibitory synapse , which is functionally dominated by phosphatases , particularly shp-1 , leading to exclusion of the downstream signaling molecules from the contact region ( figure 1d ) . inhibitory signaling acts swiftly to disrupt multiple points of activation , including conjugate formation and f - actin accumulation , lfa-1 activation , activating receptor clustering at the is and critically , ca flux . dephosphorylation of the activating phospho - tyrosine residues of vav1 appears to be a critical molecular switch for this control but this response is likely fine - tuned by other factors . these include the adaptor protein crk , which is also phosphorylated following inhibitory signaling and recruited to the inhibitory synapse . crk , through its association with c3 g and subsequent control of rap1 , likely has a role in the regulation of lfa-1 activation and subsequent target cell adhesion . interestingly , inhibitory receptors also serve to license ' nk cells during their developmental process , and nk cells that lack the recognition of mhc molecules during maturation are rendered hyporesponsive , at least partially by reduced signaling from activating receptors to lfa-1 . unlicensed cells form fewer conjugates , but those that do conjugate mediate lytic granule polarization normally . other mechanisms by which these unlicensed ' or anergic ' nk cells are restrained in their cytotoxic capacity represents an unknown cellular checkpoint that will be of great value in understanding full access to lytic capacity . at the beginning of the effector stage this stage is marked largely by significant cytoskeletal rearrangements , beginning with significant de novo f - actin polymerization and reorganization ( figure 1e ) . although the importance of the f - actin cytoskeleton in nk cell cytotoxicity has been appreciated for some time , recently many new contributors to the regulation of f - actin have been highlighted . one of these is the wiskott - aldrich syndrome protein ( wasp ) homolog wave2 . interestingly , while both wasp and wave2 are expressed in t and nk cells , wave2 may be critical for f - actin polymerization in ctls but is normally not accessed by nk cells . in nk cells , wasp appears to be the predominantly utilized family member . as an illustration , wiskott - aldrich syndrome patients who are deficient in wasp have severe nk cell functional impairment linked to an inability to rearrange f - actin . this can be overcome with interleukin-2 treatment , which activates wave2 in nk cells and restores f - actin rearrangement in was patient nk cells in vitro and in vivo . this not only offers therapeutic options for treatment of was but highlights an important difference between nk- and t - cell cytotoxicity . it also illustrates the potential cooperativity between adaptive and innate immunity via the ability of t cell - produced interleukin-2 to access distinct cell biology in nk cells . the rho gtpase cdc42 is also critical for f - actin polymerization by arp2/3 through direct binding and activation of wasp . recently , a role for the cdc42 effector dock8 has been described in nk cells . patients deficient in dock8 have decreased nk cell function with accompanying lytic synapse assembly and function defects that we now recognize as hallmarks of defective actin polymerization , including decreased lfa-1 recruitment , loss of granule polarization and accompanying decrease in cytotoxic function . importantly , dock8 deficiency does not affect overall nk cell f - actin content , but more specifically the targeted accumulation and polarization of f - actin at the synapse . this is in contrast to wasp deficiency in which nk cells have a reduced total f - actin content in addition to an inability to target actin accumulation . loss of dock2 function in mouse nk cells also results in impaired rac activation and subsequent loss of nk cell cytotoxic function , suggesting this family is an important regulator of nk cell cytotoxicity . in addition to the wasp and wave / scar family members , the arp2/3 complex can be activated by cortactin . the hematopoietic - specific homolog of cortactin , hs1 , is localized to the nk cell lytic synapse , where it is critical for signaling to and from lfa-1 . in nk cells , the formin homolog hdia is not required for lytic synapse branched actin , but instead is required for nk cell cytotoxicity by targeting microtubules to the synapse and subsequent lytic granule polarization , suggesting its function as the poorly understood link between the microtubule and actin cytoskeleton . once f - actin polymerization has been initiated , firm adhesion to the target cell is achieved and sustained ( figure 1e ) . as f - actin polymerization is required for lfa-1 recruitment and maintenance at the synapse , this synergy between actin and integrins provides firm adhesion throughout the period of nk cell activation . this transmembrane linkage results in the generation of significant force , which has been measured directly through the application of single - cell force spectroscopy . engagement of 2b4 leads to rapid , lfa-1- and actin - dependent increase in the force sufficient to disengage an nk cell from a susceptible target . therefore , the mechanical forces generated at the synapse also have an important role in adhesion activation signaling . this observation is supported by the increased lfa-1-mediated adhesion of nk cells bound to targets in which intercellular adhesion molecule-1 ( icam-1 ) is tethered and restrained , as opposed to freely diffusible . firm adhesion to the target cell and f - actin polymerization leads to the nk cell flattening and extending the diameter of the synapse ( figure 1f ) . this cell shape change ' is an actin - dependent process , as nk cells treated with actin inhibitors or from was patients fail to show this characteristic shape change . similarly , nk cells engaging in inhibitory synapses remain rounder , further underscoring the regulation of f - actin as a mechanism of nk cell inhibition . these can be defined as a critical mass of receptors that in concert can promote signal transduction . in t cells , f - actin - dependent microcluster movement occurs toward an actin - poor sink , with productive signaling occurring in the periphery of the synapse and terminating in the center . myosin iia also is required for centripetal microcluster movement and this sustained retrograde flow of microclusters is required for sustained ca release and activation signaling . although the kinetics may be different in nk cells , microclusters of both activating and inhibitory receptors are present and appear to have similar dynamics compared with those in t cells . studies using nk target cell conjugates show that phosphorylated kir2dl1-containing clusters originate in the periphery and coalesce in the center , thus reaffirming both the presence of microclusters and suggesting their utility in nk cells . furthermore , highly motile nkg2d - dap10-containing microclusters are also seen in the periphery of the synapse , and contain high levels of phospho - tyrosine , suggesting that , as in t cells , the periphery may also be the predominant site of activating signaling in nk cells . interestingly , kir2dl1 microclusters are found on resting nk cells , but become smaller and denser when nkg2d is ligated . this surprising observation was made possible using super - resolution microscopy , which allows for measurement of microcluster density and size ( 920 proteins / cluster and 120 nm , respectively ) . it is unclear what the significance of this microcluster compression actually is , but may reflect an interplay required for nk cell licensing , as speculated previously . the lipid microenvironment may also have a role in the spatial organization of receptors ( figure 1f ) . the role of higher - ordered microdomains , or lipid rafts , has been somewhat contentious . the use of multivalent labels , such as cholera toxin , always raises the possibility that aggregation of these probes may result in inaccurate detection . early studies , however , have implicated the recruitment of activating receptors to , and exclusion of inhibitory receptors from , lipid rafts . recent experiments in live jurkat t cells using a novel phase - sensitive membrane dye and high - resolution imaging have resolved higher - order membrane at the periphery of the synapse , suggesting that these domains may support microcluster or signaling platform formation . it remains to be seen whether this is also the case with nk cells , and what the effect of inhibitory signaling is on the membrane order at the synapse . two main axes of signaling are initiated and sustained through cytotoxicity once appropriate receptor ligand pairs are in place , namely , the pi3k and phospholipase c pathways . engagement of activating receptors leads to signaling through itam and yinm motifs and recruitment and activation of both membrane - proximal and distal proteins signaling and adaptor proteins . it is worth emphasizing the interdependence of activating signaling with the cytoskeleton , as disruption of one affects the other and prevents functional cytotoxicity . that said , the exact cellular mechanism of signaling protein localization and re - localization in nk cells remains unknown . one key outcome of activating receptor signaling is mobilization of ions , particularly calcium ( figure 1f ) . initial calcium flux occurs as a result of rapid release from endoplasmic reticulum ( er ) calcium stores mediated by ip3 channels downstream of plc signaling . depletion of er ca stores is sensed first by stim1 on the er surface . following activation , stim1 complexes reposition proximal to the plasma membrane ( visualized as puncta on the er surface ) and activate plasma membrane - associated ora1 . human genetic immunodeficiency has defined critical roles for both orai1 and stim1 in nk cell cytotoxicity . one manifestation of these patients ' disease is profound susceptibility to viral infection , a hallmark of reduced nk cell function , although they also present with many other signs and symptoms and have substantive defects in t - cell and b - cell function . importantly , while orai1-deficient nk cells form conjugates with target cells and polarize the mtoc and lytic granules , they fail to degranulate . although the two ca flux systems are the best characterized , there are other ion channels expressed and utilized by nk cells . recently , a critical role for intracellular mg has been described by a rare primary immune deficiency affecting the mg transporter magt1 . in these patients , intracellular levels of free mg are decreased , accompanied by defective nk cell and ctl killing and subsequent uncontrolled epstein interestingly , the role of mg in both ctl and nk cell control of epstein barr virus is through maintaining the stability of nkg2d at the cell surface , suggesting an unappreciated role for nkg2d in controlling epstein in addition , potassium and zinc channels are expressed and utilized by t cells ( reviewed in feske et al . ) , prompting the question of whether nk cells utilize similar mechanisms . presumably , in and around these steps a lytic cleft forms ( figure 1 g ) . once thought to be simply a gasket to prevent the leakage of lytic granules to surrounding tissues , it is now appreciated that the cleft is dynamic and complex . much of the activity that takes place in the cleft is critical to cytotoxic function , yet remains mysterious because of its inaccessibility . measurement of the lytic cleft by transmission electron microscopy in inhibitory and activating synapses shows that both have a similar range of distances between the nk cell and the apposing target cell membrane ( 1030 nm ) , which are proposed to account for distribution of proteins of different sizes at the synapse . these synaptic membrane features may also be a source of membrane transfer ( trogocytosis ) between an nk cell and a target ( figure 1 g ) , which has been defined for a number of receptors . this process is reciprocal , as transfer of both ligand from the target cell and receptor from the nk cell is observed . additional transmission electron microscopy experiments demonstrate that the target cell - derived receptors enter the nk cells in small , enclosed pits . both inhibitory and activating receptor exchange occurs across the nk cell synapse , although there is controversy as to whether cognate ligand engagement is required . the functional outcome of trogocytosis and intercellular receptor transfer is unclear , although transfer of nkg2d and micb at the synapse results in lower nk cell cytotoxic function . fascinatingly , nk cells that acquire nkg2d ligand from target cells become targets themselves , and are victims of fratricide by neighboring nk cells . this suggests that this ligand transfer may act to both enable and even control nk cell activity during infection , again suggesting the theory of harpooning . following firm adhesion and the formation of a cleft , f - actin continues to undergo substantial remodeling at the synapse . traditionally , this remodeling was thought to result in a large , central clearing of f - actin to enable centrosomal docking and lytic granule secretion . recent advances in imaging technology , namely , the adoption of super - resolution microscopy , have revealed that ligation of activating receptors creates granule - sized conduits through which granules are secreted ( figure 1h ) . interestingly , viral influenza particles can also result in conduit formation , presumably through the ligation of nkp46 , but this signal requires co - stimulation through lfa-1 . other activating receptors , such as nkg2d or cd16 , can signal solely for clearance formation . although not entirely understood , this seems to be an elegant mechanism by which an nk cell could discern a free viral particle from one bound to a target cell . whether proteins on the granules themselves form lytic granule conduits , they are a result of the inherent dynamism at the synapse , or occur in specific hotspots of signaling remains to be determined . it seems likely , based on the presence of actin nucleating factors at the synapse , that f - actin is dynamic and is likely undergoing continual remodeling . this may contribute to conduit kinetics , as has been suggested by analyses of synaptic plane actin dynamics using total internal reflection fluorescence imaging . the process of remodeling and specifically breaking down as opposed to building is of particular interest as conduits in f - actin are a requirement for degranulation . cofilin , which severs and depolymerizes f - actin , works in concert with arp2/3 to remodel actin to enable secretion in muscle cells . coronin 1a , which promotes the turnover of actin through binding to both arp2/3 and cofilin , regulates arp2/3 localization to the t - cell synapse , although a role for this important immune cell regulator in nk cells has yet to be defined . one appealing hypothesis is that hypodensity formation occurs at regions of high activating receptor density as a result of highly localized signaling events , such as is seen in mast cells . however , this is difficult to reconcile with what is likely the dynamic movement of microclusters of activating receptors themselves . an alternative explanation is that lytic granules create their own conduits , enabled by the presence of actin - remodeling proteins on their surface . this would be compatible with the observation that myosin iia is present on lytic granules and appears required for their penetrance through f - actin , but this hypothesis has not been directly tested . perhaps , in preparation for potential serial killing or nk cell recycling , lytic synapse formation also activates transcription factors and gene transcription ( figure 1i ) . ligation of nkp30 results in rapid translocation of nuclear factor b to the nucleus and de novo protein synthesis . perhaps , not surprisingly , perforin and granzyme is refilled in ctl lytic granules while they kill . the newly produced perforin then reaches the synapse independently of conventional lysosomal granules and mediates cytotoxicity . whether nk cells employ such a mechanism remains to be determined , as does the precise program of gene transcription that is activated during cytotoxicity . following the dynamic rearrangement of the actin cytoskeleton , microtubule dynamics result in a dramatic reorientation of the mtoc and associated lytic granules toward the synapse ( figure 1j ) . requirements for centrosome polarization include lfa-1 , pyk2 , erk2 , cip4 , the formin hdia and vav1 . however , it is important to note that f - actin polymerization is required for mtoc polarization ; therefore , any interference with f - actin dynamics will subsequently impair mtoc and granule polarization . one consideration in mtoc polarization is the significant amount of force likely needed to generate this reorientation . it is assumed from studies in other systems that microtubule insertion and anchoring in the cell cortex lead to either pushing ( microtubule growth ) or pulling ( microtubule shrinkage ) forces that can reposition the centrosome . dynein may again have a role , as a minus - ended motor it can generate significant pulling forces on shrinking microtubules when anchored in the cortex , and may contribute to the fine - tuning and positioning of microtubule asters . accordingly , it was recently shown that in t cells , mtoc repositioning occurs as a result of end - on capture shrinkage of microtubule focused at the center of the is and anchored to cortical dynein . interestingly , in nk cells , it appears that kinesin-1 has a role in the initial movement of the mtoc to the synapse , mediated through interactions with the small gtpase arl8b . iq motif containing gtpase - activating protein 1 ( iqgap1 ) may act as a linker between clip-170 on the plus ends of microtubule and specific regions of cortical actin . loss of iqgap1 results in a failure of nk cells to polarize the mtoc and degranulate . cip4 has also been implicated as a link between microtubules and f - actin at the cortex . although in t cells the mtoc docks in contact with the plasma membrane at the synapse , this has not been directly observed in nk cells . as the mtoc polarizes to the synapse , cellular organelles also reposition with some moving toward and others away from the synapse ( figure 1j ) . reorientation of the golgi along with microtubules toward the is presumably aids in directed secretion of granules toward the target cell . in t - helper cells , the mitochondria polarize toward the synapse to maintain ca flux across the plasma membrane for t - cell activation . in nk cells , the mitochondria reposition toward the nk cell is following nk stimulation with anti - nkgd2 antibodies but not with anti - kir2dl1 antibodies , suggesting that the mitochondrial dynamics are triggered as a result of nk cell activation . the polarization of these organelles is important for sufficient ca influx for signaling and granule exocytosis . it is conceivable that polarized mitochondria further serve as local sources of energy to power synaptic function , although this needs to be proven . following mtoc polarization to the is and anchoring at the plasma membrane , the delivery of the polarized lytic granules to the synapse occurs ( figure 1k ) . in t cells , this process requires plus - ended , kinesin-1-dependent movement of lytic granules upon microtubules to the membrane . in nk cells , other cellular machinery could also have a role in lytic granule movement . as mentioned above , whether this is through the facilitation of short runs across f - actin following mtoc polarization , the penetration of granules through the actin meshwork or the exocytosis of lytic granules is unclear , although obviously these scenarios are not mutually exclusive . following delivery to the plasma membrane , lytic granules have significant dynamic movement , which is followed by arrest , and subsequent degranulation in only a subset of granules ( figure 1l ) . this movement is not dependent upon f - actin dynamic rearrangement , but a role for microtubule dynamics has not been excluded . granule movement may be undirected rolling on synaptic actin , seeking regions of hypodensity . alternatively , it may represent the requirement for granules to find a primed fusion / tethering complex to mediate their arrest , as is suggested by high - resolution imaging of lytic granules in ctl utilizing munc 13 - 4 rab27a complexes for granule arrest and subsequent degranulation . at some point , lytic granules must traverse the pervasive actin network at the synapse ( figure 1 m ) . lytic granule may mechanistically identify areas of hypodense f - actin regions to pass through , or directed f - actin remodeling at the activating synapse may be required for clearing the way for lytic granules to transit through minimally permissive f - actin hypodensities . however , even in the presence of f - actin clearances , it is likely that lytic granule transit through the cortex requires the generation of force as was suggested by experiments evaluating degranulation in the absence of an f - actin meshwork . myosin iia may mechanically facilitate lytic granule motility through the f - actin - rich area of the is or may be involved in inducing local changes in the f - actin structure to allow polarized lytic granules access to the plasma membrane . after polarizing to the is and before degranulation , lytic granules dock at the is and fuse with the plasma membrane ( figure 1n ) . docking is likely mediated primarily by munc 13 - 4 and rab27a , both of which are recruited to lytic granules following activating receptor ligation . in ctl , lytic granules become fully mature only at late stages of the exocytic pathway , when munc13 - 4 and rab27a associate with perforin- and granzyme - containing lysosomal components . upon interacting with rab27a , munc13 - 4 may also regulate the interaction between vesicle and target soluble nsf attachment protein receptor ( snare ) required for lytic granule fusion with the plasma membrane . alternatively , this may be mediated by the interaction of syntaxin 11 and munc18 - 2 with r - snares ( such as vamp7 ) on the lytic granule membrane . priming then occurs as a result of munc13 - 4-mediated activation of syntaxin 11 or bridging of the plasma membrane with lytic granule . fusion occurs as a result of snare complex formation , and although this complex has not been defined in nk cells , mutations in the snare components syntaxin 11 , vamp4 and vamp7 prevent nk cell degranulation . in mast cells , coordinated oscillations of calcium in concert with n - wasp and pip(4,5)p2 whether such localized signaling dynamics contribute to nk cell exocytosis remains to be seen , although this hypothesis would complement the localized generation of actin hypodensities . in addition to the global calcium reserves such as the er and the store - operated reservoirs , local ca nanodomains created by channels on the lytic granule membrane in t cells are essential for their exocytosis . thus , local synaptic membrane nanoalterations may factor into a final step in allowing the release of lytic granule contents . nk cell lytic granules use at least two distinct modes of fusion : ( 1 ) complete fusion where granule content is completely discharged and the contents diffuse rapidly at the plasma membrane and ( 2 ) incomplete fusion , whereby formation of a transient fusion pore at the plasma membrane is accompanied by release of some but retention of most of the granule contents . this latter form of degranulation is suggestive of alternate forms of granule fusion seen in other secretory cells such as chromaffin cells and neurons . kiss and run ' , in which a granule pore is formed and resealed , preventing full release of granule contents , kiss and stay ' , in which granules remain at the membrane and are re - acidified , presumably for rapid recycling or reuse and crash fusion ' , in which granule contents are released without stable docking and priming . the true existence and significance of these alternate forms of granule fusion in nk cells is incompletely understood , although it is conceivable that it could be a means of facilitating serial killing through the rapid recycling of granule contents . as such , two - way vesicular trafficking occurs at the nk cell synapse , and rapid munc13 - 4-clathrin mediated endocytosis of granule membrane proteins exposed at the plasma membrane is necessary for the recycling of a pool of endocytic vesicles , allowing the serial killing event ( figure 1p ) . f - actin dynamics may have a role in the extrusion of granule contents and the persistence of lytic granules at the membrane following exocytosis . although this is presumably owing to force generation , the direct proof is presently unavailable . after degranulation , a period of relative inactivity begins and is presumably required as lytic granule contents cross the lytic cleft to act upon the target cell ( figures1o and p ) . the sustained presence of fused granules at the synaptic membrane , however , may serve additional functions as well . interestingly , the exposure of lamp-1 on the nk cell surface protects the nk cell from cytotoxicity - induced suicide , although this is likely not the only mechanism . subsequently , uptake of lytic granule contents by the target cell initiates apoptosis and marks the end of the effector stage of cytotoxicity , as the lytic hit has been administered . the termination stage of the synapse refers to the steps that immediately follow the release of lytic granules and up to either the reinitiating of a subsequent recognition or return to a resting state . initially , there is a longer time of apparent relative inactivity . during this time the target cell continues its death process , primarily by apoptosis ( figure 1q ) . phosphatidylserine on the surface of the cell may provide signaling to the nk cell to terminate the response , as nk cells express proteins that have been shown to bind to phosphatidylserine such as the itim - containing molecule cd300a . a further mechanism by which the nk cell could relax its activation status is through receptor downmodulation as has been documented for cd16 and nkg2d . ongoing is new lg biogenesis during this relatively quiet period as a likely requirement for nk cell recharging ' and subsequent serial kills . the final stage of cytotoxicity is defined by detachment from the target cell , a process that is not entirely arbitrary . kinetic studies show that the decision to end stable contacts with target cells is made faster when killing occurrs . interestingly , detachment was sometimes seen along with the formation of nanotubes connecting the nk and target cells ( figure 1r ) . the purpose of these connections in the context of a dying cell , however , is unclear and they may just represent the default behavior of an nk cell to tether to activating objects of interest . insight into the steps of the termination stage can be seen during the process of nk cell serial killing . serial killing can demonstrate burst kinetics , with a delayed first kill followed by more rapid subsequent kills . a proposed mechanism for burst kinetics is the idea of kinetic priming , which suggests that nk target interactions depend upon recent killing events . it is proposed that kinetic priming is a continuity of signaling , as interactions with old targets remain until a new target is found . as such , lytic granule may remain converged to the mtoc following target cell lysis in preparation for subsequent kills , as previously proposed . a consequence of serial killing is a near depletion of lytic granules and cytotoxic effector molecules . this depletion can leave the nk cells in an exhausted state until they detach from the target cell that has depleted their contents . after separation , exposure to locally available activating factors such as interleukin-2 can restore their cytotoxic function . interestingly , in cd8 cytotoxic t cells , it was found that rapid upregulation of nongranule - restricted perforin can be transported to the is and participate in cytotoxicity . as this form of perforin was identified in nk cells , perhaps this observation carries over to nk cells and contributes to the reacquisition of effector function after exhaustion . although seemingly the least is known about the specifics of the termination phase of the synapse , it can be interpreted as one of the most important parts , as recycling of nk cells in vivo in diseased tissue environments is likely to be of the essence in host defense . in recent years , explosive advances in technology have driven us deeper within the nk cell to better understand the mechanism of its critical function . in doing so , we have a much better understanding of the tightly regulated steps leading to cytotoxicity . there are critical and fundamental questions that remain to be answered , some of which require substantive technology development . these include , but are not limited to the following : ( 1 ) the exact number of , and temporospatial requirements for , degranulation events needed to kill particular target cells ; ( 2 ) how both inhibitory signaling and anergy ' restrain progression through the cell biological steps of synaptic formation ; ( 3 ) the mechanism by which conduits in the cell cortex are created to enable lytic granules to reach the nk cell synaptic membrane ; ( 4 ) the true purpose of lytic granule convergence to the mtoc , ( 5 ) the mechanism of delivery of lytic granules from mtoc to plasma membrane ; and ( 6 ) what specifically governs the release of an nk cell from its target cell . in addition , we still have much to learn about the fine - tuning of the cytotoxic response and the subversion of it by viruses and malignant cells . these represent only a sampling of the many questions begotten by the last 15 years of discovery , the answers to which will provide the tools to manipulate and control cytolytic host defense . better understanding of these facets of nk cells will enable more effective harnessing of nk cell functions and therapeutic intervention . the motility of nk cells in tissue or tumor microenvironment is likely driven by chemotactic signaling resulting in an approximation to key sites of interest , although nk cell motility in tumors is also driven by the expression of nkg2d ligands . therefore , similar to a t - cell sampling dendritic cells , nk cells undergo brief , exploratory interactions with multiple cell types , which may represent their initial encounter with a target ( figure 1a ) . it is not known what molecules specifically mediate these interactions , although there are a number of candidate receptors expressed on resting or primed nk cells , including a variety of tethering ' receptors as well as potentially more robust adhesion receptors . the former potentially include cd62l and psgl-1 ; the latter include cd2 , dnam-1 , nkg2d , the natural cytotoxicity receptors and lymphocyte function associated antigen-1 ( lfa-1 ) . unlike t cells , a subset ( 10% ) of freshly isolated human nk cells express the activated conformation of lfa-1 at rest , which presumably allows adhesion to a target before the engagement of other activating receptors . the transmission of a second activating signal through a receptor such as nkg2d , dnam-1 , 2b4 ( cd244 ) or cd2 strengthens these interactions by further activating lfa-1 , resulting in firm adhesion to the target and potentially providing minimal requirements for progression to mediating cytotoxicity . we are still learning of surprising interactions that nk cells engage in , likely in part due to the complex microenvironment that they patrol . one such unconventional form of communication is the formation of membrane nanotubes ( figure 1a ) . nanotubes appear to serve as intercellular tethers formed rapidly after contact with the target cell and can help guide the nk cell to the target cell or provide traction during its initial interaction . rather than hollow tubes that mediate free diffusion , nk cell nanotubes are heterogeneous structures that transmit signals over long distances and can even deliver lytic granules from an nk cell to a target . importantly , their formation enhances cytotoxicity . nkg2d and downstream activation molecules including dap10 and vav1 accumulate at the nanotube junction , resulting in the description of this junction as a nanoscale synapse . however , blocking either lfa-1 or 2b4 does not reduce the frequency of nanotube formation , suggesting that this is not simply a stretched conventional lytic synapse . cd2 expression specifically increases the frequency of nk target cell nanotubes , suggesting a role for specific receptor ligand interactions in their formation and partially explaining the observation that cd2 enhances nk cell cytotoxicity . the mechanism by which this occurs , and the prevalence of nanotubes during routine physiological nk surveillance , remains unclear . another example of the complex initial interaction may be the newly observed phenomenon of nk cell - derived exosomes : nk surface marker - expressing , fasl and perforin - containing nanovesicles ( 50100 nm ) that , upon release from nk cells , can mediate target cell killing independent of is formation . they may also potentially transfer key ligands to target cells to enable more robust interactions in environments in which exosome concentrations are high . this concept , in concert with nanotubes , harkens to a provocative early proposal of harpooning ' as a contributor to nk cell cytolytic function . despite their apparent constitutive secretion by human nk cells isolated from peripheral blood , the relative contribution of exosomes to an nk - mediated cytotoxic response following target cell contact , lfa-1 engagement initializes the first steps of is formation , including protein tyrosine kinase activation , pip(4,5)p2 generation and f - actin reorganization ( figure 1b ) . in synergy with activating receptor ligation , lfa-1 also induces an arrest signal to migrating cells , with a strong activating signal resulting in a stable radially symmetrical synapse and inhibitory signaling resulting in asymmetry and subsequent resumption of migration . whether nk cells kill through kinapses ' , or moving synapses , as has been described in t cells , remains to be determined . lfa-1-mediated outside - in signaling for f - actin polymerization brings together all the requisite components for f - actin polymerization and initiates this process . this initial signaling also includes the phosphorylation of vav1 by a src family kinase , its recruitment to lipid rafts and subsequent further activation as discussed in subsequent steps below . therefore , initial engagement of lfa-1 in concert with a second signal can help to ready an nk cell for target cell lysis . at this point the nk cell is likely still highly sensitive to a balance of activating and inhibitory signaling , and control of vav1 phosphorylation and subsequent actin accumulation is thought to be a critical axis in the regulation of cytotoxicity . at this stage , microclusters are likely present , may be functional and are also described further below . despite the tightly regulated steps leading to nk cell cytotoxicity , there is evidence that pre - docked granules are present in the cell cortex and can be accessed rapidly by nk cells . lytic granule secretion at the is before microtubule - organizing center ( mtoc ) polarization has been described in primary human cytotoxic t lymphocytes ( ctls ) . although it is conceivable that antigen specificity of t cells allows for the circumvention of further checkpoints to cytotoxicity , lytic granules are present in the cortex of resting nk cells and initial exocytosis bursts are detected ( figure 1b ) . despite these observations , imaging of both nk cell lines and primary nk cells by both live and fixed cell microscopy indicates that the majority of nk cells go through the multistep , highly regulated steps to cytotoxicity ( figure 2 ) . therefore , it is unclear as to what the significance of the presence and potential exocytosis of pre - docked granules is . in this light , it is also still unclear how many lytic granules are required to kill specific types of target cells . polarization of the mtoc and lytic granules to the is is required for nk cell cytotoxicity and occurs in the effector stage . however , preceding mtoc polarization , lytic granules rapidly move along microtubules and converge upon the mtoc ( figure 1c ) . this minus - ended lytic granule movement depends on dynein motor function but is independent of actin polymerization or microtubule dynamics . it also occurs whether the nk cell is conjugated to a susceptible or resistant target cell , as it is observed in the presence of an inhibitory synapse . this suggests that granule convergence is a step that precedes nk cell commitment to cytotoxicity , instead preparing the cell for it . accordingly , ligation of cd28 or lfa-1 alone is sufficient to induce lytic granule convergence , as is activation by soluble interleukin-2 . disruption of lamp-1 ( cd107a ) expression also results in impaired lytic granule motility , which corresponds with a decrease in association of the dynein component p150 with lytic granules . although this suggests that lamp-1 itself may mediate the interaction of granules with dynein , the mechanism of this is unknown . interestingly , mtoc polarization in lamp-1-deficient cells is intact , suggesting that convergence is not a prerequisite for polarization . lytic granule convergence before mtoc polarization likely represents the final juncture at which nk cells are susceptible to inhibitory signaling before a commitment to cytotoxicity . signaling through immunoreceptor tyrosine - based inhibitory motif ( itim)-containing inhibitory receptors induces formation of the inhibitory synapse , which is functionally dominated by phosphatases , particularly shp-1 , leading to exclusion of the downstream signaling molecules from the contact region ( figure 1d ) . inhibitory signaling acts swiftly to disrupt multiple points of activation , including conjugate formation and f - actin accumulation , lfa-1 activation , activating receptor clustering at the is and critically , ca flux . dephosphorylation of the activating phospho - tyrosine residues of vav1 appears to be a critical molecular switch for this control but this response is likely fine - tuned by other factors . these include the adaptor protein crk , which is also phosphorylated following inhibitory signaling and recruited to the inhibitory synapse . crk , through its association with c3 g and subsequent control of rap1 , likely has a role in the regulation of lfa-1 activation and subsequent target cell adhesion . interestingly , inhibitory receptors also serve to license ' nk cells during their developmental process , and nk cells that lack the recognition of mhc molecules during maturation are rendered hyporesponsive , at least partially by reduced signaling from activating receptors to lfa-1 . unlicensed cells form fewer conjugates , but those that do conjugate mediate lytic granule polarization normally . other mechanisms by which these unlicensed ' or anergic ' nk cells are restrained in their cytotoxic capacity represents an unknown cellular checkpoint that will be of great value in understanding full access to lytic capacity . at the beginning of the effector stage , the nk cell commits to cytotoxicity and proceeds toward degranulation . this stage is marked largely by significant cytoskeletal rearrangements , beginning with significant de novo f - actin polymerization and reorganization ( figure 1e ) . although the importance of the f - actin cytoskeleton in nk cell cytotoxicity has been appreciated for some time , recently many new contributors to the regulation of f - actin have been highlighted . one of these is the wiskott - aldrich syndrome protein ( wasp ) homolog wave2 . interestingly , while both wasp and wave2 are expressed in t and nk cells , wave2 may be critical for f - actin polymerization in ctls but is normally not accessed by nk cells . in nk cells , wasp appears to be the predominantly utilized family member . as an illustration , wiskott - aldrich syndrome patients who are deficient in wasp have severe nk cell functional impairment linked to an inability to rearrange f - actin . this can be overcome with interleukin-2 treatment , which activates wave2 in nk cells and restores f - actin rearrangement in was patient nk cells in vitro and in vivo . this not only offers therapeutic options for treatment of was but highlights an important difference between nk- and t - cell cytotoxicity . it also illustrates the potential cooperativity between adaptive and innate immunity via the ability of t cell - produced interleukin-2 to access distinct cell biology in nk cells . the rho gtpase cdc42 is also critical for f - actin polymerization by arp2/3 through direct binding and activation of wasp . recently , a role for the cdc42 effector dock8 has been described in nk cells . patients deficient in dock8 have decreased nk cell function with accompanying lytic synapse assembly and function defects that we now recognize as hallmarks of defective actin polymerization , including decreased lfa-1 recruitment , loss of granule polarization and accompanying decrease in cytotoxic function . importantly , dock8 deficiency does not affect overall nk cell f - actin content , but more specifically the targeted accumulation and polarization of f - actin at the synapse . this is in contrast to wasp deficiency in which nk cells have a reduced total f - actin content in addition to an inability to target actin accumulation . loss of dock2 function in mouse nk cells also results in impaired rac activation and subsequent loss of nk cell cytotoxic function , suggesting this family is an important regulator of nk cell cytotoxicity . in addition to the wasp and wave / scar family members , the arp2/3 complex can be activated by cortactin . the hematopoietic - specific homolog of cortactin , hs1 , is localized to the nk cell lytic synapse , where it is critical for signaling to and from lfa-1 . in nk cells , the formin homolog hdia is not required for lytic synapse branched actin , but instead is required for nk cell cytotoxicity by targeting microtubules to the synapse and subsequent lytic granule polarization , suggesting its function as the poorly understood link between the microtubule and actin cytoskeleton . once f - actin polymerization has been initiated , firm adhesion to the target cell is achieved and sustained ( figure 1e ) . as f - actin polymerization is required for lfa-1 recruitment and maintenance at the synapse , this synergy between actin and integrins provides firm adhesion throughout the period of nk cell activation . this transmembrane linkage results in the generation of significant force , which has been measured directly through the application of single - cell force spectroscopy . engagement of 2b4 leads to rapid , lfa-1- and actin - dependent increase in the force sufficient to disengage an nk cell from a susceptible target . therefore , the mechanical forces generated at the synapse also have an important role in adhesion activation signaling . this observation is supported by the increased lfa-1-mediated adhesion of nk cells bound to targets in which intercellular adhesion molecule-1 ( icam-1 ) is tethered and restrained , as opposed to freely diffusible . firm adhesion to the target cell and f - actin polymerization leads to the nk cell flattening and extending the diameter of the synapse ( figure 1f ) . this cell shape change ' is an actin - dependent process , as nk cells treated with actin inhibitors or from was patients fail to show this characteristic shape change . similarly , nk cells engaging in inhibitory synapses remain rounder , further underscoring the regulation of f - actin as a mechanism of nk cell inhibition . these can be defined as a critical mass of receptors that in concert can promote signal transduction . in t cells , f - actin - dependent microcluster movement occurs toward an actin - poor sink , with productive signaling occurring in the periphery of the synapse and terminating in the center . myosin iia also is required for centripetal microcluster movement and this sustained retrograde flow of microclusters is required for sustained ca release and activation signaling . although the kinetics may be different in nk cells , microclusters of both activating and inhibitory receptors are present and appear to have similar dynamics compared with those in t cells . studies using nk target cell conjugates show that phosphorylated kir2dl1-containing clusters originate in the periphery and coalesce in the center , thus reaffirming both the presence of microclusters and suggesting their utility in nk cells . furthermore , highly motile nkg2d - dap10-containing microclusters are also seen in the periphery of the synapse , and contain high levels of phospho - tyrosine , suggesting that , as in t cells , the periphery may also be the predominant site of activating signaling in nk cells . 2b4-containing interestingly , kir2dl1 microclusters are found on resting nk cells , but become smaller and denser when nkg2d is ligated . this surprising observation was made possible using super - resolution microscopy , which allows for measurement of microcluster density and size ( 920 proteins / cluster and 120 nm , respectively ) . it is unclear what the significance of this microcluster compression actually is , but may reflect an interplay required for nk cell licensing , as speculated previously . the lipid microenvironment may also have a role in the spatial organization of receptors ( figure 1f ) . the role of higher - ordered microdomains , or lipid rafts , has been somewhat contentious . the use of multivalent labels , such as cholera toxin , always raises the possibility that aggregation of these probes may result in inaccurate detection . early studies , however , have implicated the recruitment of activating receptors to , and exclusion of inhibitory receptors from , lipid rafts . recent experiments in live jurkat t cells using a novel phase - sensitive membrane dye and high - resolution imaging have resolved higher - order membrane at the periphery of the synapse , suggesting that these domains may support microcluster or signaling platform formation . it remains to be seen whether this is also the case with nk cells , and what the effect of inhibitory signaling is on the membrane order at the synapse . two main axes of signaling are initiated and sustained through cytotoxicity once appropriate receptor ligand pairs are in place , namely , the pi3k and phospholipase c pathways . engagement of activating receptors leads to signaling through itam and yinm motifs and recruitment and activation of both membrane - proximal and distal proteins signaling and adaptor proteins . it is worth emphasizing the interdependence of activating signaling with the cytoskeleton , as disruption of one affects the other and prevents functional cytotoxicity . that said , the exact cellular mechanism of signaling protein localization and re - localization in nk cells remains unknown . one key outcome of activating receptor signaling is mobilization of ions , particularly calcium ( figure 1f ) . initial calcium flux occurs as a result of rapid release from endoplasmic reticulum ( er ) calcium stores mediated by ip3 channels downstream of plc signaling . depletion of er ca stores is sensed first by stim1 on the er surface . following activation , stim1 complexes reposition proximal to the plasma membrane ( visualized as puncta on the er surface ) and activate plasma membrane - associated ora1 . human genetic immunodeficiency has defined critical roles for both orai1 and stim1 in nk cell cytotoxicity . one manifestation of these patients ' disease is profound susceptibility to viral infection , a hallmark of reduced nk cell function , although they also present with many other signs and symptoms and have substantive defects in t - cell and b - cell function . importantly , while orai1-deficient nk cells form conjugates with target cells and polarize the mtoc and lytic granules , they fail to degranulate . although the two ca flux systems are the best characterized , there are other ion channels expressed and utilized by nk cells . recently , a critical role for intracellular mg has been described by a rare primary immune deficiency affecting the mg transporter magt1 . in these patients , intracellular levels of free mg are decreased , accompanied by defective nk cell and ctl killing and subsequent uncontrolled epstein interestingly , the role of mg in both ctl and nk cell control of epstein barr virus is through maintaining the stability of nkg2d at the cell surface , suggesting an unappreciated role for nkg2d in controlling epstein in addition , potassium and zinc channels are expressed and utilized by t cells ( reviewed in feske et al . ) , prompting the question of whether nk cells utilize similar mechanisms . presumably , in and around these steps a lytic cleft forms ( figure 1 g ) . once thought to be simply a gasket to prevent the leakage of lytic granules to surrounding tissues , it is now appreciated that the cleft is dynamic and complex . much of the activity that takes place in the cleft is critical to cytotoxic function , yet remains mysterious because of its inaccessibility . measurement of the lytic cleft by transmission electron microscopy in inhibitory and activating synapses shows that both have a similar range of distances between the nk cell and the apposing target cell membrane ( 1030 nm ) , which are proposed to account for distribution of proteins of different sizes at the synapse . these synaptic membrane features may also be a source of membrane transfer ( trogocytosis ) between an nk cell and a target ( figure 1 g ) , which has been defined for a number of receptors . this process is reciprocal , as transfer of both ligand from the target cell and receptor from the nk cell is observed . additional transmission electron microscopy experiments demonstrate that the target cell - derived receptors enter the nk cells in small , enclosed pits . both inhibitory and activating receptor exchange occurs across the nk cell synapse , although there is controversy as to whether cognate ligand engagement is required . the functional outcome of trogocytosis and intercellular receptor transfer is unclear , although transfer of nkg2d and micb at the synapse results in lower nk cell cytotoxic function . fascinatingly , nk cells that acquire nkg2d ligand from target cells become targets themselves , and are victims of fratricide by neighboring nk cells . this suggests that this ligand transfer may act to both enable and even control nk cell activity during infection , again suggesting the theory of harpooning . following firm adhesion and the formation of a cleft , f - actin continues to undergo substantial remodeling at the synapse . traditionally , this remodeling was thought to result in a large , central clearing of f - actin to enable centrosomal docking and lytic granule secretion . recent advances in imaging technology , namely , the adoption of super - resolution microscopy , have revealed that ligation of activating receptors creates granule - sized conduits through which granules are secreted ( figure 1h ) . interestingly , viral influenza particles can also result in conduit formation , presumably through the ligation of nkp46 , but this signal requires co - stimulation through lfa-1 . other activating receptors , such as nkg2d or cd16 , can signal solely for clearance formation . although not entirely understood , this seems to be an elegant mechanism by which an nk cell could discern a free viral particle from one bound to a target cell . whether proteins on the granules themselves form lytic granule conduits , they are a result of the inherent dynamism at the synapse , or occur in specific hotspots of signaling remains to be determined . it seems likely , based on the presence of actin nucleating factors at the synapse , that f - actin is dynamic and is likely undergoing continual remodeling . this may contribute to conduit kinetics , as has been suggested by analyses of synaptic plane actin dynamics using total internal reflection fluorescence imaging . the process of remodeling and specifically breaking down as opposed to building is of particular interest as conduits in f - actin are a requirement for degranulation . cofilin , which severs and depolymerizes f - actin , works in concert with arp2/3 to remodel actin to enable secretion in muscle cells . coronin 1a , which promotes the turnover of actin through binding to both arp2/3 and cofilin , regulates arp2/3 localization to the t - cell synapse , although a role for this important immune cell regulator in nk cells has yet to be defined . one appealing hypothesis is that hypodensity formation occurs at regions of high activating receptor density as a result of highly localized signaling events , such as is seen in mast cells . however , this is difficult to reconcile with what is likely the dynamic movement of microclusters of activating receptors themselves . an alternative explanation is that lytic granules create their own conduits , enabled by the presence of actin - remodeling proteins on their surface . this would be compatible with the observation that myosin iia is present on lytic granules and appears required for their penetrance through f - actin , but this hypothesis has not been directly tested . perhaps , in preparation for potential serial killing or nk cell recycling , lytic synapse formation also activates transcription factors and gene transcription ( figure 1i ) . ligation of nkp30 results in rapid translocation of nuclear factor b to the nucleus and de novo protein synthesis . perhaps , not surprisingly , perforin and granzyme is refilled in ctl lytic granules while they kill . the newly produced perforin then reaches the synapse independently of conventional lysosomal granules and mediates cytotoxicity . whether nk cells employ such a mechanism remains to be determined , as does the precise program of gene transcription that is activated during cytotoxicity . following the dynamic rearrangement of the actin cytoskeleton , microtubule dynamics result in a dramatic reorientation of the mtoc and associated lytic granules toward the synapse ( figure 1j ) . requirements for centrosome polarization include lfa-1 , pyk2 , erk2 , cip4 , the formin hdia and vav1 . however , it is important to note that f - actin polymerization is required for mtoc polarization ; therefore , any interference with f - actin dynamics will subsequently impair mtoc and granule polarization . one consideration in mtoc polarization is the significant amount of force likely needed to generate this reorientation . it is assumed from studies in other systems that microtubule insertion and anchoring in the cell cortex lead to either pushing ( microtubule growth ) or pulling ( microtubule shrinkage ) forces that can reposition the centrosome . dynein may again have a role , as a minus - ended motor it can generate significant pulling forces on shrinking microtubules when anchored in the cortex , and may contribute to the fine - tuning and positioning of microtubule asters . accordingly , it was recently shown that in t cells , mtoc repositioning occurs as a result of end - on capture shrinkage of microtubule focused at the center of the is and anchored to cortical dynein . interestingly , in nk cells , it appears that kinesin-1 has a role in the initial movement of the mtoc to the synapse , mediated through interactions with the small gtpase arl8b . iq motif containing gtpase - activating protein 1 ( iqgap1 ) may act as a linker between clip-170 on the plus ends of microtubule and specific regions of cortical actin . loss of iqgap1 results in a failure of nk cells to polarize the mtoc and degranulate . cip4 has also been implicated as a link between microtubules and f - actin at the cortex . although in t cells the mtoc docks in contact with the plasma membrane at the synapse , this has not been directly observed in nk cells . as the mtoc polarizes to the synapse , cellular organelles also reposition with some moving toward and others away from the synapse ( figure 1j ) . reorientation of the golgi along with microtubules toward the is presumably aids in directed secretion of granules toward the target cell . in t - helper cells , the mitochondria polarize toward the synapse to maintain ca flux across the plasma membrane for t - cell activation . in nk cells , the mitochondria reposition toward the nk cell is following nk stimulation with anti - nkgd2 antibodies but not with anti - kir2dl1 antibodies , suggesting that the mitochondrial dynamics are triggered as a result of nk cell activation . the polarization of these organelles is important for sufficient ca influx for signaling and granule exocytosis . it is conceivable that polarized mitochondria further serve as local sources of energy to power synaptic function , although this needs to be proven . following mtoc polarization to the is and anchoring at the plasma membrane , the delivery of the polarized lytic granules to the synapse occurs ( figure 1k ) . in t cells , this process requires plus - ended , kinesin-1-dependent movement of lytic granules upon microtubules to the membrane . in nk cells , as mentioned above , myosin iia is associated with lytic granules and required for nk cell cytotoxicity . whether this is through the facilitation of short runs across f - actin following mtoc polarization , the penetration of granules through the actin meshwork or the exocytosis of lytic granules is unclear , although obviously these scenarios are not mutually exclusive . following delivery to the plasma membrane , lytic granules have significant dynamic movement , which is followed by arrest , and subsequent degranulation in only a subset of granules ( figure 1l ) . this movement is not dependent upon f - actin dynamic rearrangement , but a role for microtubule dynamics has not been excluded . granule movement may be undirected rolling on synaptic actin , seeking regions of hypodensity . alternatively , it may represent the requirement for granules to find a primed fusion / tethering complex to mediate their arrest , as is suggested by high - resolution imaging of lytic granules in ctl utilizing munc 13 - 4 rab27a complexes for granule arrest and subsequent degranulation . at some point , lytic granules must traverse the pervasive actin network at the synapse ( figure 1 m ) . lytic granule may mechanistically identify areas of hypodense f - actin regions to pass through , or directed f - actin remodeling at the activating synapse may be required for clearing the way for lytic granules to transit through minimally permissive f - actin hypodensities . however , even in the presence of f - actin clearances , it is likely that lytic granule transit through the cortex requires the generation of force as was suggested by experiments evaluating degranulation in the absence of an f - actin meshwork . myosin iia may mechanically facilitate lytic granule motility through the f - actin - rich area of the is or may be involved in inducing local changes in the f - actin structure to allow polarized lytic granules access to the plasma membrane . after polarizing to the is and before degranulation , lytic granules dock at the is and fuse with the plasma membrane ( figure 1n ) . docking is likely mediated primarily by munc 13 - 4 and rab27a , both of which are recruited to lytic granules following activating receptor ligation . in ctl , lytic granules become fully mature only at late stages of the exocytic pathway , when munc13 - 4 and rab27a associate with perforin- and granzyme - containing lysosomal components . upon interacting with rab27a , munc13 - 4 may also regulate the interaction between vesicle and target soluble nsf attachment protein receptor ( snare ) required for lytic granule fusion with the plasma membrane . alternatively , this may be mediated by the interaction of syntaxin 11 and munc18 - 2 with r - snares ( such as vamp7 ) on the lytic granule membrane . priming then occurs as a result of munc13 - 4-mediated activation of syntaxin 11 or bridging of the plasma membrane with lytic granule . fusion occurs as a result of snare complex formation , and although this complex has not been defined in nk cells , mutations in the snare components syntaxin 11 , vamp4 and vamp7 prevent nk cell degranulation . in mast cells , coordinated oscillations of calcium in concert with n - wasp and pip(4,5)p2 whether such localized signaling dynamics contribute to nk cell exocytosis remains to be seen , although this hypothesis would complement the localized generation of actin hypodensities . in addition to the global calcium reserves such as the er and the store - operated reservoirs , local ca nanodomains created by channels on the lytic granule membrane in t cells are essential for their exocytosis . thus , local synaptic membrane nanoalterations may factor into a final step in allowing the release of lytic granule contents . nk cell lytic granules use at least two distinct modes of fusion : ( 1 ) complete fusion where granule content is completely discharged and the contents diffuse rapidly at the plasma membrane and ( 2 ) incomplete fusion , whereby formation of a transient fusion pore at the plasma membrane is accompanied by release of some but retention of most of the granule contents . this latter form of degranulation is suggestive of alternate forms of granule fusion seen in other secretory cells such as chromaffin cells and neurons . kiss and run ' , in which a granule pore is formed and resealed , preventing full release of granule contents , kiss and stay ' , in which granules remain at the membrane and are re - acidified , presumably for rapid recycling or reuse and crash fusion ' , in which granule contents are released without stable docking and priming . the true existence and significance of these alternate forms of granule fusion in nk cells is incompletely understood , although it is conceivable that it could be a means of facilitating serial killing through the rapid recycling of granule contents . as such , two - way vesicular trafficking occurs at the nk cell synapse , and rapid munc13 - 4-clathrin mediated endocytosis of granule membrane proteins exposed at the plasma membrane is necessary for the recycling of a pool of endocytic vesicles , allowing the serial killing event ( figure 1p ) . f - actin dynamics may have a role in the extrusion of granule contents and the persistence of lytic granules at the membrane following exocytosis . although this is presumably owing to force generation , the direct proof is presently unavailable . after degranulation , a period of relative inactivity begins and is presumably required as lytic granule contents cross the lytic cleft to act upon the target cell ( figures1o and p ) . the sustained presence of fused granules at the synaptic membrane , however , may serve additional functions as well . interestingly , the exposure of lamp-1 on the nk cell surface protects the nk cell from cytotoxicity - induced suicide , although this is likely not the only mechanism . subsequently , uptake of lytic granule contents by the target cell initiates apoptosis and marks the end of the effector stage of cytotoxicity , as the lytic hit has been administered . the termination stage of the synapse refers to the steps that immediately follow the release of lytic granules and up to either the reinitiating of a subsequent recognition or return to a resting state . initially , there is a longer time of apparent relative inactivity . during this time the target cell continues its death process , primarily by apoptosis ( figure 1q ) . phosphatidylserine on the surface of the cell may provide signaling to the nk cell to terminate the response , as nk cells express proteins that have been shown to bind to phosphatidylserine such as the itim - containing molecule cd300a . a further mechanism by which the nk cell could relax its activation status is through receptor downmodulation as has been documented for cd16 and nkg2d . ongoing is new lg biogenesis during this relatively quiet period as a likely requirement for nk cell recharging ' and subsequent serial kills . the final stage of cytotoxicity is defined by detachment from the target cell , a process that is not entirely arbitrary . kinetic studies show that the decision to end stable contacts with target cells is made faster when killing occurrs . interestingly , detachment was sometimes seen along with the formation of nanotubes connecting the nk and target cells ( figure 1r ) . the purpose of these connections in the context of a dying cell , however , is unclear and they may just represent the default behavior of an nk cell to tether to activating objects of interest . insight into the steps of the termination stage can be seen during the process of nk cell serial killing . serial killing can demonstrate burst kinetics , with a delayed first kill followed by more rapid subsequent kills . a proposed mechanism for burst kinetics is the idea of kinetic priming , which suggests that nk target interactions depend upon recent killing events . it is proposed that kinetic priming is a continuity of signaling , as interactions with old targets remain until a new target is found . as such , lytic granule may remain converged to the mtoc following target cell lysis in preparation for subsequent kills , as previously proposed . a consequence of serial killing is a near depletion of lytic granules and cytotoxic effector molecules . this depletion can leave the nk cells in an exhausted state until they detach from the target cell that has depleted their contents . after separation , exposure to locally available activating factors such as interleukin-2 can restore their cytotoxic function . interestingly , in cd8 cytotoxic t cells , it was found that rapid upregulation of nongranule - restricted perforin can be transported to the is and participate in cytotoxicity . as this form of perforin was identified in nk cells , perhaps this observation carries over to nk cells and contributes to the reacquisition of effector function after exhaustion . although seemingly the least is known about the specifics of the termination phase of the synapse , it can be interpreted as one of the most important parts , as recycling of nk cells in vivo in diseased tissue environments is likely to be of the essence in host defense . in recent years , explosive advances in technology have driven us deeper within the nk cell to better understand the mechanism of its critical function . in doing so , we have a much better understanding of the tightly regulated steps leading to cytotoxicity . there are critical and fundamental questions that remain to be answered , some of which require substantive technology development . these include , but are not limited to the following : ( 1 ) the exact number of , and temporospatial requirements for , degranulation events needed to kill particular target cells ; ( 2 ) how both inhibitory signaling and anergy ' restrain progression through the cell biological steps of synaptic formation ; ( 3 ) the mechanism by which conduits in the cell cortex are created to enable lytic granules to reach the nk cell synaptic membrane ; ( 4 ) the true purpose of lytic granule convergence to the mtoc , ( 5 ) the mechanism of delivery of lytic granules from mtoc to plasma membrane ; and ( 6 ) what specifically governs the release of an nk cell from its target cell . in addition , we still have much to learn about the fine - tuning of the cytotoxic response and the subversion of it by viruses and malignant cells . these represent only a sampling of the many questions begotten by the last 15 years of discovery , the answers to which will provide the tools to manipulate and control cytolytic host defense . better understanding of these facets of nk cells will enable more effective harnessing of nk cell functions and therapeutic intervention .

natural killer ( nk ) cell - mediated cytotoxicity is governed by the formation of a lytic immune synapse in discrete regulated steps , which give rise to an extensive array of cellular checkpoints in accessing nk cell - mediated cytolytic defense . appropriate progression through these cell biological steps is critical for the directed secretion of specialized secretory lysosomes and subsequent target cell death . here we highlight recent discoveries in the formation of the nk cell cytolytic synapse as well as the molecular steps and cell biological checkpoints required for this essential host defense process .

STAGES OF LYTIC SYNAPSE FORMATION Recognition Effector Termination Summary and future thoughts

appropriate timing of treatment is the key to successful intensive care ; treatment that is delayed could be as detrimental as treatment that is premature . therefore , lange and colleagues , in this issue of critical care , reported on the time course of the expression of the different isoforms of the nitric oxide synthase ( nos ) - that is , neuronal nos [ nnos ] , inducible nos [ inos ] , and endothelial nos [ enos ] ( also known as nos1 , nos2 , and nos3 , respectively ) - of the tissue levels of nitrotyrosine and poly(adp - ribose ) , markers of nitrosative stress , and dna damage resulting from peroxynitrite formation as well as p65 , a mirror of the activation of the nuclear factor - kappa - b ( nf-b ) , in a well - established resuscitated ovine model of septic shock induced by pseudomonas aeruginosa pneumonia . ' downstream effects ' were evaluated by measuring nos activity , nitric oxide ( no ) production , and interleukin-8 concentrations . during the early phase ( that is , 4 to 12 hours after induction of pneumonia ) , enos expression was increased , and this coincided with increased tissue levels of nitrotyrosine , poly(adp - ribose ) , and nf-b activation , whereas in the later phase ( that is , until 24 hours of pneumonia ) , measurable nos activity and no production were related mainly to inos activation . the authors ' ' two - hit ' model of cotton smoke inhalation and subsequent instillation of live bacteria is characterized by a hyperdynamic circulation , hypoten - sion , tissue acidosis , and progressive impairment of gas exchange , lung mechanics , and morphological alterations typical of acute lung injury . furthermore , the model comprises resuscitation measures and thus allows the study of pathophysiological pathways in a clinically relevant , large - animal setting . numerous studies evaluated the no - related mediator orchestra and highlighted the friend - and - foe character of excess no formation : no not only is well established as a reactive nitrogen species ( rns ) , often referred to as a ' final mediator ' of sepsis - induced hypotension , but also acts as a scavenger of reactive oxygen species ( ros ) , such as the superoxide radical . this reaction , however , leads to the formation of the even more toxic peroxynitrite , which ultimately results in protein nitrosylation , dna damage , and activation of poly(adp - ribose ) polymerase ( parp ) . finally , the no production rate depends on the stimulus and the species , and therefore rodent data can not be transferred directly to the clinical scenario . endogenous no production in large animals is much closer to that of human beings , but although increased no production during sepsis is well established , these models yielded controversial results . the early and transient ( within minutes ) activation of parp would make parp inhibition an attractive approach , but unfortunately medical care is usually not available during this very early phase . moreover , the pathophysiological consequences of parp-1 activation are opposed to its vital role in the maintenance of genomic integrity through its function in base excision repair , and the effects of parp inhibition on dna damage and repair during shock are still a matter of debate . therefore , parp inhibitors are currently investigated in ischemia - reperfusion , oncology , and diabetes rather than in sepsis or acute lung injury , and peroxynitrite - neutralizing agents are a tempting alternative . several studies explored the potential of selective inhibition of nos isoforms under the assumptions that nnos and enos are constitutively producing homeostatic no and that inos responds to acute stimuli with excessive no production . in fact , the crucial role of enos expression seems to be unequivocal : enos activation improved microvascular perfusion and cardiac function in rodents , and enos polymorphism was associated with hypotension during human gram - negative sepsis . clearly , inos still seems to be a ' bad guy ' : several studies showed beneficial effects of various selective inos inhibitors on hemodynamics , lung function , deranged microcirculatory perfusion , coagulation disorders , and visceral organ injury [ 12 - 14 ] . recent data , however , suggest that nnos activation may also assume major importance , and a combined approach using selective nnos inhibition during the early phase ( 0 to 12 hours ) and inos inhibition during the later phase ( 12 to 24 hours ) yielded improved pulmonary function and attenuated nitrosative stress . finally , selective inos inhibition together with the ros scavenger tempol also afforded significant protection , further emphasizing the close interaction of no and oxidative / nitrosative stress . despite these encouraging results , nothing is simple or easy : in resuscitated murine septic shock , both genetic deletion and selective pharmacologic blockade of the inos were associated with markedly improved systolic contraction and catecholamine responsiveness but simultaneously deteriorated diastolic relaxation unfortunately , the authors did not report data on oxidative stress , so a complete overview of the whole rns - and ros - related mediator orchestra is only implicitly provided . nevertheless , the authors add an important piece to the complex puzzle of the no - related pathophysiological pathways : nitrosative stress ( that is , increased nitrotyrosine and poly[adp - ribose ] levels ) was aggravated only during the early phase up to 12 hours , whereas clear - cut increases in nos activity , no metabolites , and subsequently cytokines occurred only later on . interestingly , in this experiment , in contrast to previous reports from the same group , nnos synthesis was not increased . finally , despite its inherent protective properties , enos activation was also involved in the initiation of the septic response , and it remains to be elucidated whether this mirrors an adaptive or pathologic mechanism . how can we translate these data to daily care ? usually , there are few chances to intervene during the very early , evolving phase of sepsis and acute lung injury , and at the time of full - blown sepsis , all members of the mediator orchestra are already playing their ( un)coordinated , and unfortunately sometimes uncontrollable , concert . there are two ways to go from here , and both are worthy of being followed ! first , though extremely time- and resource - consuming , long - or longer - term large - animal models with a more prolonged observation period ( that is , days ) are needed and will probably yield valuable clues to the design of clinical studies . second , more studies on humans are warranted in order to better describe early and later phases of human sepsis in terms of nos , peroxynitrite formation , and parp activation . enos : endothelial nitric oxide synthase ; inos : inducible nitric oxide synthase ; nf-b : nuclear factor - kappa - b ; nnos : neuronal nitric oxide synthase ; no : nitric oxide ; nos : nitric oxide synthase ; parp : poly(adp - ribose ) polymerase ; rns : reactive nitrogen species ; ros : reactive oxygen species .

appropriate timing of treatment assumes particular importance in critical care . lange and colleagues recently reported on the time course of the different nitric oxide synthase ( nos ) isoforms , nitrosative stress , and poly(adp - ribosylation ) during pseudomonas aeruginosa pneumonia - induced ovine septic shock . initially , endothelial nos expression was increased together with markers of peroxynitrite formation , dna damage , and nuclear factor - kappa - b activation . later on , measurable nos activity and nitric oxide production resulted mainly from inducible nos activation . these results emphasize the need for long - term , large - animal studies investigated over days so that future therapeutic interventions can be better tailored and matched to the exact time course of the activation of the mediator orchestra .

None Abbreviations Competing interests

steroid hormones have been traditionally associated with regulation of peripheral organs , associated with stress ( corticosterone ) or with gonadal function ( estrogen and androgens ) . over the years , it became evident that these hormones also act within the hypothalamus , in a feedback regulatory loop , to affect the release of the neural factors that modulate production of the steroid hormones . more recently , several observations have elucidated new roles of steroid hormones in modulating higher cns functions . specifically , both stress and steroid hormones have been shown to affect synaptic receptors and ion channels and therefore regulate in several different ways synaptic transmission and neuronal plasticity . consequently , stress hormones have been implicated in processes ranging from homeostatic to cognitive functions . furthermore , in some disorders of the nervous system , hormones have been shown to play critical roles : favoring or halting the disease process . thus , the interaction between peripheral hormones and central networks seem to be more intense than ever imagined before . in the present study we review current knowledge on the effects of steroid hormones on synaptic plasticity and define their influence on hippocampal cognitive and emotional functions . following the exposure to stressful stimuli , the steroid hormone corticosterone ( cortisol in humans ) is released from the adrenal glands in order to set up the best response to the challenge by acting on steroid receptors ( de kloet et al . , 2005 ) . these are distributed throughout the body and have a particularly dense distribution in the cns ( de kloet et al . , 2005 ) . in the brain , the cellular and molecular targets for the action of corticosterone include , in addition to basic metabolic processes , an effect on excitatory ( karst and joels , 2005 ) and inhibitory ( maggio and segal , 2009a ) synaptic transmission , as well as an effect on voltage - gated calcium channels ( vgcc ; karst et al . , 2000 ; these effects are mediated by the activation of mineralocorticoid receptors ( mrs ) and glucocorticoid receptors ( grs ; joels , 1999 , 2008 ; de kloet et al . , 2005 ) . initially , it was suggested that both receptors act as nuclear transcription factors that modify protein synthesis and produce a slow , persistent change in the function of the cell ( de kloet et al . more recently , the existence of a new family of membrane - bound mr and gr ( mmr and mgr , respectively ) , which act through novel non - genomic pathways , has been reported ( karst et al . , 2005 ; de kloet et al . , 2008 ) . in this route , mmr and mgr can rapidly affect ionic conductances and thereby modify cell excitability and function ( karst et al . these membrane - bound receptors appear to differ from their intracellular cognates , not only in their location on the cell membrane , but also in their molecular structures ( joels et al . , 2008 ) , in their affinities for corticosterone , and in their downstream mechanisms of action which involve activation of g proteins ( joels et al . , 2008 ) . specifically , intracellular mr ( imr ) have a very high affinity for corticosterone and are highly expressed in all hippocampal subfields , as well as in cells of the central amygdala , lateral septum , and some motor nuclei in the brainstem ( joels , 2006 ) . intracellular gr ( igr ) have a relatively low affinity , are widely distributed throughout the brain , and are expressed both in neurons and in glia ( joels , 2006 ) . consequently , it has been proposed that imr hardly participate , if at all , in the fast response to stressful stimuli , due to their characteristic of being already saturated by the low ambient levels of corticosterone at rest ( joels , 2006 , 2008 ) . conversely , igr have been reported to become gradually activated by rising levels of corticosterone following a stressful event ( joels , 2006 , 2008 ; figure 1a ) . therefore , under physiological conditions , cells that coexpress both receptor types , such as principal cells in the ca1 region , the dentate gyrus ( dg ) , and the central amygdala , will shift between predominant imr activation and concurrent mmr and igr activation ( joels and krugers , 2007 ) . ( a ) time course of mr and gr activation following stressful stimuli . at a resting level , imr are already saturated by the baseline levels of corticosterone . rising concentration of corticosterone activates both mmr and igr , whereas an additional increase in corticosterone levels also activates mgr . mmr- and mgr - mediated effects appear in a faster time course than those mediated by the intracellular receptors . modified from maggio and segal ( 2010 ) . ( b ) proposed mechanism by which corticosteroid receptors differently regulate ltp and ltd in the hippocampus . imr are believed to be fully occupied at baseline level of corticosterone , therefore they might play a marginal role in synaptic plasticity . mmr might play a fundamental role in synaptic plasticity especially in vh : mmr activation reduces ipsc frequency . this determines an increase in the excitability of the pyramidal cells and raises the possibility of vgcc activation , thus enhancing ltp . in addition , a decrease in gabaergic inhibition can impair ltd through a group i mglur - mediated mechanism . igr are thought to both decrease nmda - mediated ltp and increase vgccs mediated ltp both in the hippocampus and amygdale . their effects may occur at longer time scale due to their lower affinity to corticosterone . mgr might be involved in the regulation of synaptic plasticity mainly in dh : mgr activation increases ipsc amplitude and following hyperpolarization of the pyramidal cell membrane and inactivation of nmda receptors , might impair ltp and enhance ltd . modified from maggio and segal ( 2010 ) . the identification of the molecular cascades linked to the effects of corticosteroids in the brain resulted in a series of studies examining the role of corticosterone in neuronal plasticity as well as in the cellular mechanisms underlying learning and memory such as long - term potentiation ( ltp ) and long - term depression ( ltd ; bliss and collingridge , 1993 ) . initial studies indicated that induction of ltp in the hippocampal area ca1 is impaired in a rat exposed to behavioral stress , such as inescapable shock ( foy et al . administration of high doses of corticosterone either in vivo ( diamond et al . , 1992 ) or in vitro ( pavlides et al . , 1996 ; alfarez et al . , 2002 ) produced the same effects , indicating that corticosterone is likely to mediate this action of stress . specifically , corticosterone - induced impairment of ltp seems to be due to the activation of igr , which depresses nmda receptor - dependent ltp ( krugers et al . conversely , it was also shown that ltp could be enhanced in the presence of low to moderate concentrations of corticosterone , while in absence of corticosterone ltp induction was impaired ( diamond et al . , 1992 ) . these studies show that the effects of corticosteroids on ltp induction are dose - dependent and follow an inverted u - shaped relationship ( diamond et al . , 1992 ; joels , 2006 ) . further studies , however , have presented a more complex picture of the effects of steroids on synaptic plasticity . specifically , it seems that the same dosage of corticosterone that impairs nmda - dependent ltp can indeed enhance vgcc - dependent ltp ( krugers et al . , 2005 ) . this species of ltp is found in the amygdale where it is believed to underlie the formation of fear memories ( blair et al . , 2001 ; bauer et al . , 2002 ) and can be evoked in the hippocampus as well ( borroni et al . , 2000 ; interestingly , in the hippocampus , corticosterone appears to enhance vgcc ltp through an igr - dependent mechanism ( krugers et al . , 2005 ) . it has been proposed that this effect requires a genomic pathway , as it occurs after a long delay between the exposure to stress and/or corticosterone and the recordings ( krugers et al . , 2005 ) , thus probably depending on the binding of gr homodimers to dna that causes an increase in calcium currents ( karst and joels , 2005 ; chameau et al . , 2007 ) . recent data from our group have shown that mrs are also able to enhance vgcc ltp ( maggio and segal , 2007b ) : either stress or physiological concentrations of corticosterone can enhance ltp in the ventral hippocampus ( vh ) , while inhibiting it in the dorsal hippocampus ( dh ; maggio and segal , 2007b ) . in particular , corticosterone enhances ltp through mrs since a selective mr agonist , aldosterone , shares the same effect in the vh ( maggio and segal , 2007b ) . the proposed mechanism excludes an interaction between mr and nmda receptors , as aldosterone by itself does not increase nmda - dependent synaptic potentials ( maggio and segal , 2007b ) . conversely , mr - induced ltp can be blocked by nifedipine , suggesting that vgccs are likely responsible for this effect ( maggio and segal , 2007b ; figure 1b ) . it is likely that mr activates vgcc by modulating ionic conductances or changing vgcc activation kinetics . in vivo experiments have shown that mr activation is able to increase ltp in the dh as well ( avital et al . , 2006 ) . specifically , animals which were injected with a gr antagonist prior to the stressful exposure , such that only mr could be activated by stress , show a much larger ltp than controls . in contrast , those animals previously injected with an mr antagonist and then exposed to stress , allowing only gr activation , show a much lower ltp than controls ( avital et al . , 2006 ) . these recordings were performed in the dg and even though there could be differences in the effects of stress and steroids between the dg and ca1 ( joels and krugers , 2007 ) , mrs were still shown to mediate an enhancement of ltp . it could be argued that the experiments in the vh were conducted using an in vitro preparation where ambient corticosterone maintained normally through the circulation is washed out . consequently , mrs are not occupied , and are ready to be activated by the superfused drug and produce ltp enhancement in the vh . this might not reflect the situation in the intact animal , where the brain is constantly exposed to fluctuating concentrations of corticosterone . in fact , mr should be already saturated by the resting concentration of corticosterone and should not respond to the stress - induced rise of corticosterone in the presence of a gr blockade . this , however , does not seem to be the case ( avital et al . , 2006 ) . furthermore , even though both mr and gr are expressed in the vh , corticosterone action is mediated by activation of mr rather than gr . this reflects the observation that in the vh , mr concentration is double that of gr ( robertson et al . , 2005 ) . if so , according to the u - shaped curve model of corticosterone effects , mr should be saturated rapidly by the rising concentration of corticosterone and their effect should fade away faster in favor of the slower gr activation . altogether , it seems that the simple , dose - dependent , inverted , u - shaped curve does not fully explain the modulatory functions of mr and gr on ltp in the different sectors of the hippocampus , therefore calling for the involvement of other factors . a possible mechanism that may clarify the mr - dependent enhancement of ltp should take into consideration the activation of mmr . these receptors act through a faster mechanism ( de kloet et al . , 2008 ) and have lower affinities for corticosterone compared to their intracellular cognates ( joels , 2008 ) and similar to that of the igr ( joels , 2008 ) . in addition , mr activation enhances ltp in the vh within 1 h , too short time window to be accounted for by activation of genomic mechanisms ( joels and krugers , 2007 ; joels , 2008 ) , but compatible with the faster time course of the non - genomic routes . thus , mmr could be the preferential target for rising concentrations of corticosterone in the vh if one takes into account the similar affinities for corticosterone between mmr and igr , and the denser distribution of the former over the latter ( robertson et al . this could most likely be due to the shorter time window of observation in our experiments compared to those done by others ( krugers et al . , both mr and gr were reported to increase vgcc ltp ( krugers et al . , 2005 ; maggio and segal , 2007b ) . this apparent contrast could probably be explained by considering the different time courses of mr and gr enhancement of vgcc ltp . specifically , mr has an earlier effect than gr and it could be that in the vh stress mediates a fast enhancement of ltp by mr followed by a second , slow increase in ltp due to gr activation . this proposal is compatible with the proposed role of the vh as a key player in the pathway that conveys stressful information to the hypothalamus and the amygdale so as to organize the stress response ( moser and moser , 1998 ; maggio and segal , 2010 ; segal et al . , 2010 ) . following stress , the quick mr - mediated increase in ltp facilitates the flow of the information related to stress from the vh to the ventral hypothalamus and other lower brain centers , so that the autonomic response to stress can be organized . later on , the mr - mediated response fades away and the effect of gr dominates . as previously mentioned , gr enhancement of vgcc ltp has been shown to have a role in the formation of fear memories in the amygdale ( blair et al . , 2001 ; bauer et al . , , gr could play the same function in the vh : the formation of the memory for the stressful event at the vh indeed , the evidence that mr and gr act on the same mechanism can have different purposes due to the time window of the respective outcomes that take place . considering this , it could be interesting to study the relationship between the mr and gr responses in the vh . in the dh , the reduction of ltp is mediated by gr ( maggio and segal , 2007b ) . this effect seems to occur in less than 1 h , a relatively quick response that is unlikely to be mediated by a genomic mechanism . gr could reduce nmda - mediated ltp either by a direct or an indirect mechanism . as far as it concerns the indirect mechanism hypothesis , we have demonstrated that a gr agonist , dexamethasone , increases ipscs and mipscs amplitude in the dh within 10 min ( maggio and segal , 2009a , 2012 ) , consistent with the possible activation of mgr . therefore , the increase in gabaa conductance could hyperpolarize the membrane , thus preventing the cell from reaching the threshold of depolarization that unlocks nmda receptors from the mg block ( figure 1b ) . all in all , our experiments indicate that gr affect ltp through a fast , probably non - genomic mechanism . even though this hypothesis needs to be explored further , the fast suppression of ltp in the dh can underlie the switch in the weight between the dh and vh ; by reducing dh ltp and simultaneously enhancing ltp in the vh , the stressful stimuli could temporarily suppress the cognitive route of the hippocampus to cortical structures and enable the transmission of the emotional information through the vh to the amygdala . conversely , ltd induction is facilitated by behavioral stress , through a mechanism that requires gr ( pavlides et al . we replicated previous experiments where both stress and corticosterone facilitate ltd through a gr - dependent mechanism in the dh , but we have also shown that ltd is impaired in the vh through a mr - dependent mechanism ( maggio and segal , 2009b ) . specifically in the latter case , ltd is transformed into a slow - onset ltp following the exposure to stressful stimulation ( maggio and segal , 2009b ) . as is the case for ltp , changes in ltd either in the dh or vh were observed at approximately 1 h after the exposure to the stress , a time window that could be compatible with non - genomic mechanisms . the mr - induced conversion of ltd to ltp in the vh could be due to the activation of vgcc , which will further facilitate the ventral route to the amygdale ( figure 1b ) . group i mglur have been shown to enhance ltd in ca1 ( fitzjohn et al.,2001 ; rammes et al . , 2003 ) , but , interestingly , they have been reported to induce a slow - onset potentiation in the dg ( manahan - vaughan and reymann , 1996 ) . in a previous study , we showed that , in the vh , application of dhpg , a group i mglur agonist , increases the population spike amplitude in response to a baseline stimulation ( maggio and segal , 2007a ) . taken together , these observations suggest that in the vh , a decrease in gabaergic inhibition can shift ltd to a slow - onset ltp through a group i mglur - mediated mechanism ( figure 1b ) . in conclusion , corticosteroid regulation of synaptic plasticity in the hippocampus is affected by several factors . an inverted u - shape effect of corticosterone partially explains the observed modulation of ltp . indeed , this hypothesis mainly refers to the activation of intracellular corticosteroid receptors and does not take into account the contribution of membrane - bound steroid receptors . in fact , mmr , which bears a similar corticosterone affinity to that of igr , will be activated at similar steroid concentrations . this implies that the effect of mmr appears earlier than that of igr , thus inducing an enhancement of ltp instead of ltd an additional factor to be considered is the distribution of mr and gr in specific brain areas , and the ratio of membrane - bound to intracellular receptors expressed therein . this is because at the same affinity value for corticosterone concentration , the receptor that is highly expressed will lead the effects on synaptic plasticity . mrs , for example , exist in different molecular configurations ( joels , 2008 ) , thus these receptors can be very diverse . this diversity in molecular structure could be linked to diverse intracellular pathways that differently influence neuronal functions . another issue that has to be considered is the clusters of brain areas that are involved in a particular stress situation . various brain regions have specific properties and are incorporated into unique networks , so that even if corticosterone evokes the same effect at the single cell level , this would not always result in the same effect on network functions such as ltp . for instance , both ca1 pyramidal neurons and granule cells in the dg highly express mr as well as gr ( joels , 2008 ) . in the dh , corticosterone and stress consistently suppress the induction of ca1 ltp in vivo and in vitro , unlike the case for the dg . tail shocks ( shors and dryver , 1994 ) can indeed suppress ltp ; however , in other situations , either no effect ( bramham et al . , 1998 ; gerges et al . , 2001 ; alfarez et al . , 2003 ) or enhancement of ltp has been reported ( kavushansky et al . , 2006 ) . this is because ltp in the dg seems to be more dependent on indirect inputs from the amygdale ( akirav and richter - levin , 2002 ; kavushansky and richter - levin , 2006 ) . finally , the response to a stressor is also determined by the history of the organism . for instance , the induction of ltp is impaired in animals that have been exposed to repetitive stress in the weeks prior to the experiment , even if corticosterone levels , at the time of ltp induction , are compatible with the expression of a normal ltp ( alfarez et al . , 2003 ) . studies on the effect of maternal care on synaptic plasticity report that animals that received very little maternal care have poor ltp when they are adult , as opposed to animals that received high maternal care ( champagne et al . , 2008 ) . interestingly , while ltp is suppressed by corticosterone in the latter group , it is enhanced in the former ( champagne et al . , 2008 ) . all in all , corticosteroid modulation of synaptic plasticity in the hippocampus seems to be more complex than previously thought and additional experiments are needed to address the role of membrane - bound as well as intracellular receptors on ltp / ltd regulation . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

several new observations have shifted the view of the hippocampus from a structure in charge of cognitive processes to a brain area that participates in the formation of emotional memories , in addition to its role in cognition . specifically , while the dorsal hippocampus is involved in the processing of cognitive memories ; the ventral sector is mainly associated with the control of behavioral inhibition , stress , and emotional memory . stress is likely to cause this switch in control of hippocampal functions by modulating synaptic plasticity in the dorsal and ventral sectors of the hippocampus through the differential activation of mineralocorticosteroid or glucocorticosteroid receptors . herein , we will review the effects of stress hormones on synaptic plasticity in the hippocampus and outline the outcomes on stress - related global functions of this structure . we propose that steroid hormones act as molecular switches : by changing the strength of synaptic connectivity in the hippocampus following stress , they regulate the routes by which the hippocampus is functionally linked to the rest of the brain . this hypothesis has profound implications for the pathophysiology of psychiatric disorders .

INTRODUCTION THE DIFFERENT FAMILIES OF CORTICOSTEROID RECEPTORS IN THE BRAIN THE ROLES OF CORTICOSTEROID RECEPTORS IN THE REGULATION OF HIPPOCAMPAL LTP CORTICOSTEROID REGULATION OF SYNAPTIC PLASTICITY REGULATES HIPPOCAMPAL FUNCTIONS CONCLUSION Conflict of Interest Statement

primary amenorrhea is the absence of menstruation and secondary sexual characteristics in phenotypic women aged 14 years or older . common hormonal cause of primary amenorrhea includes pituitary dysfunction , chronic systemic disease , and absent ovarian function . gonadal failure in genetically xx individuals is ovarian failure ; when this occurs at any time before onset of sexual maturation , there will be primary amenorrhea and incomplete breast development . xy individuals with gonadal failure will have female genitalia because mullerian inhibiting factor and testosterone will not be produced . gonadal tumors occur in up to 25% of women with a y chromosome ; unlike complete androgen insensitivity , these gonads do not secrete hormones and should be removed at the time of diagnosis . the incidence of the chromosomal abnormality ( ca ) in live births is around 90 per 10,000 . included in the incidence are the numerical ( monosomy / trisomy / mosaicism ) as well as the structural ( translocation / isochromosome / deletion / duplication / ring ) ca . 233 women with primary amenorrhea who were referred to cytogenetic unit , children hospital , mansoura university , egypt from july 2008 to december 2010 . for all patients , steroidal hormonal assay were setup according to elisa technique,[810 ] and chromosomal cultures were setup according to g- banding , about 1 ml of blood was mixed with 5 ml of rpmi medium , 1 ml of fetal bovine serum , 0.1 g / ml of phytohemagglutinin ( pha ) and was incubated at 37c . after 72 hour of incubation , the colcimid ( 1 mg / ml ) was added and incubated for another 1.5 hour . the cells were then harvested by hypotonic treatment ( 1.5 hour with 0.075 m kcl at 37c ) , fixed and washed thrice with fixative solution ( methanol and acetic acid in a ratio of 3:1 ) , and then metaphases were spread and stained using standard g - banding technique . for each case , 50 spread metaphases were analyzed with cytovision system . fluorescence in situ hybridization ( fish ) technique was carried out in some of cases to more evaluation according to technique of . 10 l of the x , y centromeric probe were applied to the target area , and the cover slip was applied to the slide immediately . the cover slip was sealed with rubber cement , and the slide was placed on hot plate at 72c for 2 minutes . the slide was placed in a warmed humidified box , and the box was placed at 37c in an incubator overnight . the cover slip was removed from slide , and it was immersed in 70 ml of the 0.4 x ssc/0.3% np-40 in a coplin jar at a 731c water bath for 2 minutes . then , the slide was immersed in 70 ml of the 2 x ssc/0.1% np-40 in coplin jar at 25c for 2 minutes . the slide was air - dried in the dark , and 10 l of dapi ii counter stain were applied to the target area of slide , and the cover slip was applied to the each slide . 233 patients with primary amenorrhea were referred from different parts of egypt to cytogenetic laboratory of genetic unit , children hospital mansoura university , from july 2008 to december 2010 . ( 1 ) the numerical abnormalities of the x chromosome were detected in 23 ( 50% ) . ( 2 ) structural abnormalities of the x chromosome were detected in 11 ( 23.91% ) . ( 4 ) male karyotype 46 , xy was presented in 2 ( 4.35% ) , [ table 1 ] . the two patients with association of chromosome y was confirmed by fish [ figure 1 ] , and the presence of deletion of long arm of chromosome x in 3 patients was confirmed , using fish [ figure 2 ] . classification of chromosomal abnormalities of patients with primary amenorrhea interphase and metaphase from fish analysis showing one x chromosome and one y chromosome of female confirming the testicular feminization syndrome ( xy ) metaphase from fish analysis showing one x chromosome and short arm of another x of female confirming the form x , xq in table 2 , follicle stimulating hormone ( fsh ) and luteinizing hormone ( lh ) mean levels in sera of females with primary amenorrhea , whether they have numerical , structural , or mosaicism chromosomal abnormalities , were significantly higher than those of the control group ( p<0.05 ) . but , estradiol ( e2 ) mean levels in sera of them were significantly lower than those of the control group ( p<0.05 ) . 20.63% of chromosomal abnormalities in primary amenorrhea of present study compared with those in various study conducted between 1983 and 2010 [ table 3 ] . chromosome abnormalities in primary amenorrhea in various study and compared with present study genes essential for gonadal function are located on the proximal part of xp , the long arm of x proximal to xq13 and/or the long arm of x distal to xq26 . large deletion of xq with breakpoints at or proximal to q13 are expected to produce gonadal dysgenesis with primary amenorrhea , half of the patients with such deletions have turner`s syndrome . that explained the cause of our two patients with deletion of xq have primary amenorrhea , but have not feature of turner syndrome , whereas other three patients who have deletion of xp have primary amenorrhea and all the features of turner syndrome . ten et al . found one patient with primary amenorrhea and 47 , xxx had mental retardation and the cause of that , an extra x , can slow down embryonic cell development in a special way . similar to that , there were mental retardation in two of our patients with karyotype of 47 , xxx . xy individuals with gonadal failure will have female genitalia because mullerian inhibiting factor and testosterone will not be produced . gonadal tumors occur in up to 25% of women with a y chromosome ; unlike complete androgen insensitivity , these gonads do not secrete hormones and should be removed at the time of diagnosis . in our study , we diagnosed two patients of primary amenorrhea as testicular feminization syndrome ( xy ) using fish technique . the molecular cytogenetic technique , fish , accurately delineate the nature and origin of marker chromosomes in primary amenorrhea patients , which is difficult by conventional cytogenetics . as similar to that , in present study , the presence of deletion of long arm of chromosome x in 2 patients was confirmed , using fish , which is very difficult by conventional cytogenetic where short arm of the x chromosome is similar to the y chromosome . ten et al . found that , serum follicle stimulating hormones and luteinizing hormones were always increased in primary amenorrhea patients with chromosomal abnormalities . the present study showed that karyotype and fish are necessary to detect the causes of primary amenorrhea . this study also revealed the incidence of chromosomal abnormalities in women with primary amenorrhea in egypt is similar to that reported in previous literatures .

background : primary amenorrhea is defined as the absence of menstruation and secondary sexual characteristics in phenotypic women aged 14 years or older . hormonal disorders are main causes of primary amenorrhea . common hormonal cause of primary amenorrhea includes pituitary dysfunction and absent ovarian function . the aim of this study was to estimate the incidence and types of chromosomal abnormalities in patients with primary amenorrhea in egypt.materials and methods : chromosomal analysis and hormonal assay were carried out on 223 patients with primary amenorrhea that were referred from different parts of egypt to cytogenetic laboratory of genetic unit , children hospital mansoura university , from july 2008 to december 2010 . fish technique was carried out in some of cases to more evaluation.results:the frequency of chromosomal abnormalities was 46 ( 20.63% ) in primary amenorrhea patients . the chromosomal abnormalities can be classified into four main types . ( 1 ) the numerical abnormalities of the x chromosome were detected in 23 ( 50 % ) . ( 2 ) structural abnormalities of the x chromosome were detected in 11 ( 23.91% ) . ( 3 ) mosaicism of x chromosome was found in 10 ( 21.74% ) . ( 4 ) male karyotype 46 , xy was presented in 2 ( 4.35%).conclusion : the present study showed that karyotype and fish are necessary to detect the causes of primary amenorrhea . this study also revealed the incidence of chromosomal abnormalities in women with primary amenorrhea in egypt is similar to that reported in previous literatures .

Introduction Materials and Methods Results Discussion Conclusion

we report the case of a 13yearold boy with neuromuscular proximal thoracic scoliosis who was found to have significant torsion of the left main bronchus during general anesthesia for posterior instrumented spinal fusion of t2 to l4 . this patient had a background history of multicore myopathy , which resulted in progressive scoliosis . endotracheal intubation was noted to be difficult on review of a previous anesthetic chart ( grade iii on the cormack and lehane scale ) . this patient reported increasing shortness of breath over the preceding few months , particularly on exertion . as part of his preoperative investigations , spirometry was performed , which showed that the forced vital capacity ( fvc ) was 36% of predicted ( 1.09 l ) and the forced expiratory volume in 1 sec ( fev1 ) to fvc ratio was 101% , which was in keeping with a restrictive lung defect . he underwent a level1 sleep study preoperatively which showed normal gas exchange with no significant desaturations or hypercapnoeic episodes . anesthesia was induced using a targetcontrolled infusion ( tci ) technique with propofol and remifentanil . the patient 's trachea was intubated using the airtraq videolaryngoscope ( prodol meditec s.a . , vizcaya , spain ) with the aid of a bougie . this resulted in rapid desaturation , a significant decrease in the end tidal carbon dioxide values and hypotension . there was a precipitous decrease in the expired tidal volume ( vte ) from 400 to 100 ml . a total of 100% oxygen , small aliquots of phenylephrine , and intravenous fluids was administered . the attending respiratory physician was called in for advice and flexible bronchoscopy was performed , which revealed a slitlike left main bronchus . following a multidisciplinary discussion involving the spinal surgeon , the anesthetic team and the respiratory physician , the decision was made to apply halo traction through the spine in order to reduce the magnitude of the scoliosis and , therefore , the extrinsic compression on the bronchus . this was achieved using gardner wells tongs to the skull and bilateral lower limb skin traction with 4 kg weight to the tongs and each lower limb . improved lung compliance and tidal volumes were achieved following application of traction , and the patient was able to tolerate the prone position without further ventilatory complication . neuromuscular scoliosis is caused by a heterogeneous group of conditions , in which the underlying pathology will have significant impact on the patient 's perioperative course 1 . he was noted to have restrictive lung disease on spirometry , which is well known to be the most common lung defect in young patients with progressive scoliosis 2 . extensive pulmonary testing including measurement of flowvolume loops and lung volumes were not carried out preoperatively . boyer et al . 3 in their review of lung function tests of 44 children with idiopathic scoliosis found that while only 7% met the criteria for airflow obstruction using standard spirometric techniques , 46% were found to have moderatetosevere gas trapping using by plethysmography and helium dilution methods . 2 demonstrated in a small case series of 18 pediatric patients with syndromic and congenital scoliosis that 33% of these patients had obstructive lung disease ( old ) as evidenced by pulmonary function tests . all patients with old demonstrated compression of the bronchial main stems as confirmed by preoperative flexible bronchoscopy and computed tomography ( ct ) . our patient had compression of his left main bronchus , which was associated with his primary leftsided thoracic curvature ( fig . it is also worth noting that this patient 's main curve was relatively proximal compared to the majority of patients with a main thoracic curve ; the apex was located at t6 compared to the usual t89 . furthermore , as the spirometric evidence of old in the above case series was supported by radiological imaging which showed airway compression , it is likely that we will consider performing preoperative thoracic ct imaging with threedimensional reconstruction on all our highrisk patients undergoing this type of surgery , particularly patients with significant or worsening respiratory symptoms . spinal radiograph taken preoperatively demonstrating a 79 left convex proximal thoracic scoliosis from t2t10 , apex at t6 , with compensatory thoracolumbar curve . we postulate that the degree of bronchial compression worsened significantly in prone position , resulting in gas trapping , high peak airway pressures , and the consequent circulatory disturbances . describe a similar case of a patient with thoracolumbar scoliosis whose ventilation deteriorated rapidly when moved into prone position . urgent flexible bronchoscopy performed in prone position revealed complete collapse of the trachea proximal to the carina . the principle anesthetist addressed the problem by inserting the endotracheal tube further , beyond the collapsed trachea , thus stenting the trachea open . this would not have possible in the case of our patient as the obstruction was at the level of the left main bronchus 4 . the application of modified halofemoral traction to this patient resulted in an immediate improvement in the ventilatory parameters , and the patient was moved to the prone position successfully . although studies have shown an improvement in pulmonary function with perioperative application of halogravity traction 5 , to the best of our knowledge , this is the first reported case of using halofemoral traction to negate the pressure effects of prone position in the context of bronchial torsion .

key clinical messagepulmonary function tests such as flowvolume loops and reconstructive radiological imaging may aid the detection of large airway obstruction prior to corrective surgery for severe scoliosis . intraoperative use of halogravity traction may help to reduce the severity of the scoliosis , and thus the extrinsic compression or torsion of the airways .

Case Presentation Discussion Conflict of Interest

portal hypertension , always accompanies by cirrhosis , can lead to lots of complications including varices hemorrhage , ascites , hypersplenism and hepatic encephalopathy . the risk of varices bleeding in patients with portal hypertension was approximately 30% over 2 years . nowadays , the treatment for patients with varices hemorrhage mainly depends on medical treatment , endoscopic therapy , and surgical shunting procedures . transjugular intrahepatic portosystemic shunts ( tipss ) are currently widely used to prevent or control variceal rebleeding for it could serve as a bridge to hepatic transplantation or fit for patients who are in need of portal decompression . tips was usually regarded as a first - line therapy and cost - effective solution to portal hypertension concomitant with variceal hemorrhage in recent years . therefore , tips has generally replaced surgical shunts , which require the involvement of surgeons and general anesthesia as the first treatment for patients with portal hypertension . besides advantages of cost - effective and less invasive , tips , however , was always accompanied by complications mainly including stenosis / occlusion , recurrent varices hemorrhage , and hepatic encephalopathy . its effectiveness beyond surgical shunting in bridging to hepatic transplantation , to some extent , was arguable . in addition , with issues of postoperative shunt stenosis , thrombosis and migration , almost half of the patients undergoing tips experienced shunt failure within 1 year of tips placement . however , surgical shunting that mostly refers to distal splenorenal shunts ( dsrss ) , portacaval shunts ( pcss ) or h - graft pcss ( hgpcss ) has generally disappeared for the widespread application of tips . recent article reported that patients receiving dsrs would have significantly lower rebleeding and encephalopathy rates than tips in the management of refractory variceal bleeding . also , pcs was reported significantly superior to endoscopic therapy in a longer survival rate , less morbidity and lower direct and indirect costs . with more randomized controlled trials ( rcts ) comparing tips with surgical shunting undertaken , the optimal management for patients with portal hypertension can be tested . there was still no all - round systemic evaluation comparing tips with surgical shunts for patients with portal hypertension . specifically , we focused on comparing postoperative complications ( including recurrent variceal hemorrhage , shunt stenosis , and encephalopathy ) , mortality and survival rate after surgery in patients undergoing tips versus surgical shunting . therefore , we performed a meta - analysis of all rcts concerning tips and surgical shunting ( including dsrs , pcs , and hgpcs ) to evaluate the optimal management for patients with portal hypertension . the aims of this study were to give more information concerning tips and surgical shunting with our proposed approach in evaluating the morbidity , mortality , and long - term survival . all databases including cbm , cnki , wfpd , pubmed , medline , embase and cochrane were searched using the mesh terms : hypertension , portal / complications , liver cirrhosis / complications , portosystemic shunt , transjugular intrahepatic / mortality , portosystemic shunt , surgical , esophageal and gastric varices / surgery , hypertension , portal / surgery independently or in combination for clinical trials comparing tips with surgical shunts . all literatures were screened to identify all suitable published rcts for eligibility until february 2014 . all eligible rcts were screened for their methods , characteristics and risk of bias strictly . in this meta - analysis , two different kinds of groups were generated from the included papers that met the criterion : the tips group and the surgical shunting group . the surgical shunting group referred to traditional portosystemic shunts that contained dsrs , hgpcs , and pcs . in sub - group analysis , hgpcs and pcs could be recognized as one group for their similar modus operandi and decompression principle . in our research , 246 patients underwent tips and 247 patients underwent surgical shunts . all included rcts were required to contain a direct comparison between portosystemic shunts ( including dsrs , hgpcs , and pcs ) and tips in a controlled manner . each trial was required to include postoperative complications , mortality and long - term survival rate in detail . primary outcomes to be assessed were mortality , 2- and 5-year survival and postoperative complications including recurrent variceal hemorrhage , shunt stenosis , and hepatic encephalopathy . secondary outcomes to be assessed were length of hospital stay , operating time and hospitalization charges . each of these papers was assessed using a standardized evaluation form by two investigators ( author # 1 , author # 5 ) independently for extraction in this meta - analysis . when consensus could nt be reached , discussion and joint collection of the paper could resolve . otherwise , a third reviewer ( author # 2 ) would take part in the discussion and determine the definite inclusion of papers as a referee . general information collected from abstracts , included the authors , publication year , characteristics of patients and outcomes . all papers were assessed for the risk of bias by two investigators ( author # 1 , author # 5 ) on the following areas : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , other sources of bias . outcomes , including morbidity , mortality , 2-year survival rate , 5-year survival rate , hospital stay , operating time and hospitalization charge , were extracted from included papers . survival was defined as the time from the shunt procedure to the time of death from any cause . mortality in this meta - analysis was defined as postoperative death before discharge or within 30 postoperative days . transjugular intrahepatic portosystemic shunt placement referred to the technical procedure via interventional therapy that stents were placed between the portal vein and hepatic vein until a 510 mmhg gradient was achieved . the technique of hgpcs was described that small - diameter ( 810 mm ) externally ring - reinforced polytetrafluoroethylene graft was used with beveled ends oriented perpendicular ( 90 ) to each other to accommodate for the orientation of the portal vein to the inferior vena cava . pcs was defined as direct pcs , usually side to side , rarely end to side . dsrs was defined as distal splenic vein and renal vein shunted from end to side . the verified data were analyzed using review manager ( version 4.2 , oxford , england , the cochrane collaboration , 2003 ) . the odds ratio ( or ) , mean difference ( md ) and their corresponding 95% confidence intervals ( 95% cis ) were calculated for dichotomous or continuous outcome data respectively . statistical heterogeneity was assessed with the i test and q - test to justify the accuracy of the fixed or random effects model . a significant effect was assumed if the 95% ci did not include the value 1.0 for or or 0 for md . a fixed - effect model was used in case of no relevant statistical heterogeneity when i was < 50% and p > 0.1 . if the heterogeneity was high ( i > 50% and p < 0.1 ) , a sub - group analysis could be used to decrease the risk of bias . a fixed - effect model also could be used in sub - group analysis for decreased heterogeneity . a random - effect model was used when i > 50% and p < 0.1 . all databases including cbm , cnki , wfpd , pubmed , medline , embase and cochrane were searched using the mesh terms : hypertension , portal / complications , liver cirrhosis / complications , portosystemic shunt , transjugular intrahepatic / mortality , portosystemic shunt , surgical , esophageal and gastric varices / surgery , hypertension , portal / surgery independently or in combination for clinical trials comparing tips with surgical shunts . all literatures were screened to identify all suitable published rcts for eligibility until february 2014 . all eligible rcts were screened for their methods , characteristics and risk of bias strictly . in this meta - analysis , two different kinds of groups were generated from the included papers that met the criterion : the tips group and the surgical shunting group . the surgical shunting group referred to traditional portosystemic shunts that contained dsrs , hgpcs , and pcs . in sub - group analysis , hgpcs and pcs could be recognized as one group for their similar modus operandi and decompression principle . in our research , 246 patients underwent tips and 247 patients underwent surgical shunts . all included rcts were required to contain a direct comparison between portosystemic shunts ( including dsrs , hgpcs , and pcs ) and tips in a controlled manner . each trial was required to include postoperative complications , mortality and long - term survival rate in detail . primary outcomes to be assessed were mortality , 2- and 5-year survival and postoperative complications including recurrent variceal hemorrhage , shunt stenosis , and hepatic encephalopathy . secondary outcomes to be assessed were length of hospital stay , operating time and hospitalization charges . each of these papers was assessed using a standardized evaluation form by two investigators ( author # 1 , author # 5 ) independently for extraction in this meta - analysis . when consensus could nt be reached , discussion and joint collection of the paper could resolve . otherwise , a third reviewer ( author # 2 ) would take part in the discussion and determine the definite inclusion of papers as a referee . general information collected from abstracts , included the authors , publication year , characteristics of patients and outcomes . all papers were assessed for the risk of bias by two investigators ( author # 1 , author # 5 ) on the following areas : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , other sources of bias . outcomes , including morbidity , mortality , 2-year survival rate , 5-year survival rate , hospital stay , operating time and hospitalization charge , were extracted from included papers . survival was defined as the time from the shunt procedure to the time of death from any cause . mortality in this meta - analysis was defined as postoperative death before discharge or within 30 postoperative days . transjugular intrahepatic portosystemic shunt placement referred to the technical procedure via interventional therapy that stents were placed between the portal vein and hepatic vein until a 510 mmhg gradient was achieved . the technique of hgpcs was described that small - diameter ( 810 mm ) externally ring - reinforced polytetrafluoroethylene graft was used with beveled ends oriented perpendicular ( 90 ) to each other to accommodate for the orientation of the portal vein to the inferior vena cava . pcs was defined as direct pcs , usually side to side , rarely end to side . dsrs was defined as distal splenic vein and renal vein shunted from end to side . the verified data were analyzed using review manager ( version 4.2 , oxford , england , the cochrane collaboration , 2003 ) . the odds ratio ( or ) , mean difference ( md ) and their corresponding 95% confidence intervals ( 95% cis ) were calculated for dichotomous or continuous outcome data respectively . statistical heterogeneity was assessed with the i test and q - test to justify the accuracy of the fixed or random effects model . a significant effect was assumed if the 95% ci did not include the value 1.0 for or or 0 for md . a fixed - effect model was used in case of no relevant statistical heterogeneity when i was < 50% and p > 0.1 . if the heterogeneity was high ( i > 50% and p < 0.1 ) , a sub - group analysis could be used to decrease the risk of bias . a fixed - effect model also could be used in sub - group analysis for decreased heterogeneity . a random - effect model was used when i > 50% and p < 0.1 . searching in medline , embase , pubmed and cochrane data of clinical trials was 376 trials . after checking for abstracts according to our predefined inclusion and exclusion criterion , 76 references remained for further evaluation . eventually , four rcts that documented adequate comparisons between tips and surgical shunting for portal hypertension were determined for this meta - analysis . no additional eligible studies were found after carefully examined the reference lists of all included papers [ figure 1 ] . the characteristics and risk of bias for included four studies that compared tips and surgical shunting for portal hypertension are performed in table 1 as suggested in the cochrane handbook . three included papers reported patients from america while the remaining one from india [ table 1 ] . characteristics of included rcts and risk of the bias summary tips : transjugular intrahepatic portosystemic shunting ; dsrs : distal splenorenal shunts ; pcs : portacaval shunts ; hgpcs : h - graft portacaval shunt ; rct : randomized clinical trial . from the four included trials , 493 patients of child - pugh a to c were included in our analysis . long - term results and postoperative complications mainly including recurrent variceal hemorrhage , shunt stenosis , and encephalopathy are summarized in table 2 . results and clinical characteristics comparing tips with surgical shunting tips : transjugular intrahepatic portasystemic shunting ; dsrs : distal splenorenal shunts ; pcs : portacaval shunts ; hgpcs : h - graft portacaval shunt ; sd : standard deviation ; na : not applicable . variceal rebleeding occurred in 27.6% of patients in tips group and in 4.5% of patients in surgical shunting group , shunt stenosis occurred in 66.1% of patients in tips group and in 9.9% of patients in surgical shunting group , hepatic encephalopathy occurred in 53.9% of patients in tips group and in 32.0% of patients in surgical shunting group . from our meta - analysis , morbidity in variceal rehemorrhage was significantly higher in tips than in surgical shunts ( or = 7.45 , 95% ci : ( 3.9314.15 ) , p < 0.00001 ) [ figure 2 ] . patients occurring postoperative shunt stenosis also was significantly higher in tips than in surgical shunts ( or = 20.01 , 95% ci : ( 6.6759.99 ) , p < 0.000001 ) [ figure 3 ] . besides , morbidity in hepatic encephalopathy was also significantly higher in tips than in surgical shunts ( or = 2.50 , 95% ci : ( 1.633.84 ) , p < 0.0001 ) , especially when compared with pcs in sub - group analysis ( or = 6.00 , 95% ci : ( 2.9312.27 ) , p < 0.00001 ) [ figure 4 ] . a sub - group analysis was conducted in the comparison of variceal rehemorrhage ( = 8.07 , p = 0.04 , i = 62.8% ) and hepatic encephalopathy ( = 12.41 , p = 0.002 , i = 83.9% ) to decrease high heterogeneity . mortality in this meta - analysis referred to the death rate at 30 days . in our research , mortality was equivalent among patients undergoing tips or surgical shunts ( or = 0.76 ; 95% ci : ( 0.451.30 ) , p = 0.32 ) [ figure 5 ] . no significant heterogeneity was found from the trials ( = 1.80 , p = 0.61 , i = 0% ) . survival at 2 years in sub - group analysis was also significantly higher among patients undergoing pcs than patients undergoing tips ( or = 0.48 ; 95% ci : ( 0.290.77 ) , p = 0.003 ) , but in sub - group analysis survival at 2 years was equivalent among patients undergoing tips and dsrs ( or = 1.38 , 95% ci : ( 0.662.88 ) , p = 0.39 ) . significant heterogeneity was found from the trials , and a sub - group analysis was conducted ( = 6.30 , p = 0.10 , i = 52.4% ) [ figure 6 ] . survival at 5 years was greater for patients undergoing surgical shunting than patients undergoing tips ( or = 0.44 ; 95% ci : ( 0.300.65 ) , p < 0.0001 ) , and survival in sub - group analysis was also higher among patients undergoing pcs than patients undergoing tips ( or = 0.29 ; 95% ci : ( 0.170.47 ) , p < 0.00001 ) . significant heterogeneity was found from the trials , and a sub - group analysis was conducted ( = 12.32 , p = 0.002 , i = 83.8% ) [ figure 7 ] . five - year survival comparing transjugular intrahepatic portosystemic shunt with surgical shunting . in the included rcts , only 1 paper reported the length of hospital stay in the form of the mean and standard deviation ( sd ) comparing tips with dsrs ( 3.1 [ 4.3 day ] vs. 10.5 [ 11.3 day ] ) , which suggested tips treatment had a shorter hospital stay [ table 2 ] . in this research , only 1 trial reported hospitalization charges comparing tips with dsrs ( 21,607 vs. 28,734 ) . however , cost analysis data of this article showed no overall significant difference in the cost of managing patients with either procedure [ table 2 ] . in our meta - analysis , only 1 paper reported operating time in the form of the mean and the range comparing tips with pcs ( 3 [ 1.2525 ] h vs. 3.8 [ 2.611 ] h ) [ table 2 ] . searching in medline , embase , pubmed and cochrane data of clinical trials was 376 trials . after checking for abstracts according to our predefined inclusion and exclusion criterion , 76 references remained for further evaluation . eventually , four rcts that documented adequate comparisons between tips and surgical shunting for portal hypertension were determined for this meta - analysis . no additional eligible studies were found after carefully examined the reference lists of all included papers [ figure 1 ] . the characteristics and risk of bias for included four studies that compared tips and surgical shunting for portal hypertension are performed in table 1 as suggested in the cochrane handbook . three included papers reported patients from america while the remaining one from india [ table 1 ] . characteristics of included rcts and risk of the bias summary tips : transjugular intrahepatic portosystemic shunting ; dsrs : distal splenorenal shunts ; pcs : portacaval shunts ; hgpcs : h - graft portacaval shunt ; rct : randomized clinical trial . from the four included trials , 493 patients of child - pugh a to c were included in our analysis . long - term results and postoperative complications mainly including recurrent variceal hemorrhage , shunt stenosis , and encephalopathy are summarized in table 2 . results and clinical characteristics comparing tips with surgical shunting tips : transjugular intrahepatic portasystemic shunting ; dsrs : distal splenorenal shunts ; pcs : portacaval shunts ; hgpcs : h - graft portacaval shunt ; sd : standard deviation ; na : not applicable . variceal rebleeding occurred in 27.6% of patients in tips group and in 4.5% of patients in surgical shunting group , shunt stenosis occurred in 66.1% of patients in tips group and in 9.9% of patients in surgical shunting group , hepatic encephalopathy occurred in 53.9% of patients in tips group and in 32.0% of patients in surgical shunting group . from our meta - analysis , morbidity in variceal rehemorrhage was significantly higher in tips than in surgical shunts ( or = 7.45 , 95% ci : ( 3.9314.15 ) , p < 0.00001 ) [ figure 2 ] . patients occurring postoperative shunt stenosis also was significantly higher in tips than in surgical shunts ( or = 20.01 , 95% ci : ( 6.6759.99 ) , p < 0.000001 ) [ figure 3 ] . besides , morbidity in hepatic encephalopathy was also significantly higher in tips than in surgical shunts ( or = 2.50 , 95% ci : ( 1.633.84 ) , p < 0.0001 ) , especially when compared with pcs in sub - group analysis ( or = 6.00 , 95% ci : ( 2.9312.27 ) , p < 0.00001 ) [ figure 4 ] . a sub - group analysis was conducted in the comparison of variceal rehemorrhage ( = 8.07 , p = 0.04 , i = 62.8% ) and hepatic encephalopathy ( = 12.41 , p = 0.002 , i = 83.9% ) to decrease high heterogeneity . mortality in this meta - analysis referred to the death rate at 30 days . in our research , mortality was equivalent among patients undergoing tips or surgical shunts ( or = 0.76 ; 95% ci : ( 0.451.30 ) , p = 0.32 ) [ figure 5 ] . no significant heterogeneity was found from the trials ( = 1.80 , p = 0.61 , i = 0% ) . survival at 2 years in sub - group analysis was also significantly higher among patients undergoing pcs than patients undergoing tips ( or = 0.48 ; 95% ci : ( 0.290.77 ) , p = 0.003 ) , but in sub - group analysis survival at 2 years was equivalent among patients undergoing tips and dsrs ( or = 1.38 , 95% ci : ( 0.662.88 ) , p = 0.39 ) . significant heterogeneity was found from the trials , and a sub - group analysis was conducted ( = 6.30 , p = 0.10 , i = 52.4% ) [ figure 6 ] . survival at 5 years was greater for patients undergoing surgical shunting than patients undergoing tips ( or = 0.44 ; 95% ci : ( 0.300.65 ) , p < 0.0001 ) , and survival in sub - group analysis was also higher among patients undergoing pcs than patients undergoing tips ( or = 0.29 ; 95% ci : ( 0.170.47 ) , p < 0.00001 ) . significant heterogeneity was found from the trials , and a sub - group analysis was conducted ( = 12.32 , p = 0.002 , i = 83.8% ) [ figure 7 ] . in the included rcts , only 1 paper reported the length of hospital stay in the form of the mean and standard deviation ( sd ) comparing tips with dsrs ( 3.1 [ 4.3 day ] vs. 10.5 [ 11.3 day ] ) , which suggested tips treatment had a shorter hospital stay [ table 2 ] . in this research , only 1 trial reported hospitalization charges comparing tips with dsrs ( 21,607 vs. 28,734 ) . however , cost analysis data of this article showed no overall significant difference in the cost of managing patients with either procedure [ table 2 ] . in our meta - analysis , only 1 paper reported operating time in the form of the mean and the range comparing tips with pcs ( 3 [ 1.2525 ] h vs. 3.8 [ 2.611 ] h ) [ table 2 ] . nowadays , tips placement has become the preferred first - line management for patients with portal hypertension . the present study is the first meta - analysis of studies comparing tips with surgical shunting in patients with portal hypertension focused on complications and survival . this meta - analysis included four rcts , the populations in three studies were from america and in the remaining study were from india . currently , there were few papers concerning tips versus surgical shunting in outcomes and survival rates , so the difference between tips and surgical shunting was unclear . in clinical practice , there was the lack of a definite guidance to determine the optimal treatment for patients with portal hypertension . this meta - analysis would help make a better decision in clinical work or develop a guideline . transjugular intrahepatic portosystemic shunt was generally considered as a first - line therapy in the definitive treatment of portal hypertension concomitant with variceal bleeding ; however , trials comparing tips with surgical shunts were few and drew little attention , so some disadvantages of tips were ignored . in this meta - analysis , we conducted a comparison between tips and surgical shunting in patients with cirrhosis , portal hypertension and bleeding varices from four trials , in order to get an all - around evaluation and give more information about how to decide the optimal management for patients with portal hypertension . as the measurement of patient 's survival and postoperative complications was representative , we could conclude that long - term survival and morbidity after shunting were promoted by surgical shunting relative to tips . but surgical shunts in this meta - analysis included dsrs and hgpcs , and the relations between the two types of surgeries and tips were unclear . as a result , the outcomes of this meta - analysis were proved to be helpful in answering questions that arose when comparing tips with surgical shunting . although each included trial did nt individually reveal the comparison between surgical shunting and tips in all respects , the outcomes of this meta - analysis proved the superiority of surgical shunting over tips . as a matter of fact , the outcomes were obvious that the results supported a role for surgical shunts in patients with portal hypertension over tips . in terms of morbidity , mortality , 2- and 5-year survival , in the included papers , three of four trials found significantly higher postoperative bleeding , stenosis and encephalopathy rates after tips . postoperative complications , including recurrent variceal hemorrhage , hepatic encephalopathy , shunt stenosis , severe infection and so on , were all deadly sign for patients after surgery that could lead to a series of disorders in metabolic systems . complications of tips placement proved to be critical when hepatic encephalopathy occurred , a limited number of procedures should be typically considered for the management . the postoperative rehemorrhage rate of nearly 11% after tips was the lowest reported in included trials while the rebleeding rate was reaching 5.5% after dsrs in two included papers and 7.5% after hgpcs in included paper . shunt stenosis could also cause recurrent variceal hemorrhage and result in a series of severe syndromes . the comparison of shunt stenosis between tips and surgical shunting was obvious as the rate was reaching almost 82% after tips and no more than 11% after surgical shunts . tips could effectively lower portal hypertension due to cirrhosis . according to past experience , it is significantly effective for hemorrhage of the digestive tract due to rupture of esophageal and fundic veins and for ascites and hydrothorax caused by portal hypertension . although shunt dysfunction has confused surgeons for the incidence of tips stenosis and occlusion , trials of successful treatment with tips of recurrent massive rectal bleeding due to portal hypertension has reinforced the confidence of surgeons in tips . recent article also reported bleeding from focal varices in the stoma could be treated with tips that spread the use of tips in other situations . in addition , a 25% incidence of hernia complications following tips creation in patients being treated for refractory ascites was higher than expected . the most common indications for tips placement were refractory ascites and variceal hemorrhage , also in properly selected candidate , tips placement could serve as a bridge to liver transplantation for tips was initially less expensive and led to an easier transplantation process . tips also performed as an effective way in preventing variceal rebleeding and may be more cost effective . in other words , it was equal to surgical procedures in preventing variceal rebleeding in patients who are medical failures . besides , when aimed at treating the budd chiari syndrome , a therapeutic strategy has been proposed that angioplasty for short length venous stenosis , tips , and ultimately liver transplantation could be done in proper order . although tips revealed superiority in some parts of treatment in patients with portal hypertension , the results of this meta - analysis performed significant deficiency in morbidity and survival . to some extent , people preferred shunting subjectively only when nonshunting modalities to control variceal bleeding failed or when these modalities were considered nonapplicable , thus strong points of this method were difficult to appear . this meta - analysis , which contained a number of patients in these trials , was able to give great credibility to the results and conclusions . pcs permanently stopped variceal bleeding and gained a longer time survival than tips , but nowadays the widespread practice of using pcs only served as a management for failure of endoscopic therapy or tips in unselected patients with cirrhosis . however , the 2-year survival was higher in pcs than in tips ( or = 0.48 ; 95% ci : ( 0.290.77 ) , p = 0.003 ) , and 5-year survival after pcs was longer than that after tips ( or = 0.29 ; 95% ci : ( 0.170.47 ) , p < 0.00001 ) . no matter what the surgical shunts include , the consecutive experiences of shunt operation are important for the improvement of surgical skills , both of the individual surgeon and the team . since 1988 , more and more patients have received hgpcs treatment for its effectiveness in reducing portal hypertension , and the outcome was favorable that the actual survival was better than predicted before . the actual 5- and 10-year survival after hgpcs by child class was : ( a ) 67% and 33% , ( b ) 49% and 16% , ( c ) 29% and 7% . hgpcs has been identified as an effective procedure for the treatment of variceal bleeding , as well as for the prevention of re - bleeding in patients , with a low rate of complications . some papers indicated that pcs with a small diameter interposition h - graft was an effective procedure for the treatment of variceal bleeding or as an elective or emergency procedure with a low rate of complications . papers published recently also indicated that the actual survival after hgpcs was better than other surgical procedures . central splenorenal shunt showed more negatively effect on hemodynamics of left kidney and symptoms of renal venous hypertension obviously due to shunting the large amounts of blood from a system of high pressure to a low . in contrast , dsrs or 8 mm h - graft shunt showed similar efficacy to tips , and it also served as the proper choice in preventing recurrent variceal bleeding . dsrs also revealed an effective and reliable procedure for children with portal hypertension and was still useful for selected pediatric patients . dsrs was suggested to be useful for the management of esophagogastric varices in patients with idiopathic portal hypertension . although a number of surgical procedures have been developed to manage esophageal varices , dsrs with splenopancreatic disconnection plus gastric transection was considered as an adequate treatment for patients with esophagogastric varices . the included studies regarding surgical shunting versus tips were rare , and surgical shunts in these papers included several kinds of operation methods . this could result in instability of the comparison between tips and surgical shunting as the different surgical types of shunts may lead to a slight bias of outcome . although sub - group analysis was taken , the bias of the result still existed . the only way to solve the problem was that more clinical trials comparing surgical shunting with tips should be undertaken . data such as cost and hospital stay from the included studies were rare , so further evidence concerning hospital charges and hospital stay was needed to fulfill this meta - analysis . although tips was performed most often with the use of the covered stent currently , there were no studies comparing covered stent with surgical shunting scientifically . the outcomes and survival rates between covered and uncovered tips varied , clark et al . concluded that there were no differences in rates of encephalopathy or survival between covered and uncovered tips , but bureau et al . revealed polytetrafluoroethylene - coated stents were superior to uncovered stents in morbidity , so more rcts concerning covered stents versus surgical shunting should be conducted to provide more evidence . limited rcts concerning covered tips was the restriction in this meta - analysis , so more clinical trials should be undertaken . finally , the risk of bias and heterogeneity of included rcts were still existed according to the cochrane handbook . allocation concealment was missed in some included rcts and high risk of bias was existed in some parts of our bias summary , these could lead to the bias of outcomes and influence the validity of result to some extent , so cochrane risk of bias should be examined exactly to reduce bias . in summary , surgical shunting would be recommended because of increased survival rate and fewer postoperative complications when compared with tips . as the patients with portal hypertension concomitant with variceal hemorrhage always remained in a large number and needed necessary treatment , they should be given more surgical advices for the superiority concerning complications and survival .

background : the purpose of this article was to clarify the optimal management concerning transjugular intrahepatic portosystemic shunts ( tipss ) and surgical shunting in treating portal hypertension.methods:all databases , including cbm , cnki , wfpd , medline , embase , pubmed and cochrane up to february 2014 , were searched for randomized controlled trials ( rcts ) comparing tips with surgical shunting . four rcts , which were extracted by two independent investigators and were evaluated in postoperative complications , mortality , 2- and 5-year survival , hospital stay , operating time and hospitalization charges.results:the morbidity in variceal rehemorrhage was significantly higher in tips than in surgical shunts ( odds ratio [ or ] = 7.45 , 95% confidence interval[ci ] : ( 3.9314.15 ) , p < 0.00001 ) , the same outcomes were seen in shunt stenosis ( or = 20.01 , 95% ci : ( 6.6759.99 ) , p < 0.000001 ) and in hepatic encephalopathy ( or = 2.50 , 95% ci : ( 1.633.84 ) , p < 0.0001 ) . significantly better 2-year survival ( or = 0.66 ; 95% ci : ( 0.440.98 ) , p = 0.04 ) and 5-year survival ( or = 0.44 ; 95% ci : ( 0.300.66 ) , p < 0.00001 ) were seen in patients undergoing surgical shunting compared with tips.conclusions:compared with tips , postoperative complications and survival after surgical shunting were superior for patients with portal hypertension . application of surgical shunting was recommended for patients rather than tips .

I M Search strategy and selection of papers Reviewing and data extraction Quality of studies Outcomes and definition Data analysis R Description of studies Postoperative morbidity Mortality Long-term result Length of hospital stay Hospitalization charges Operating time D

the frequency of prenatal hydronephrosis diagnosed by ultrasound has been reported to be 0.65.4% of newborns [ 39 ] . among infants with hydronephrosis , hydronephrosis has been reported to be transient or physiological in nature ( 4188% ) or secondary to pelviureteric junction obstruction ( 1030% ) , vesicoureteric reflux ( 1020% ) , vesicoureteric junction obstruction ( 510% ) , multicystic dysplastic kidney ( 46% ) , duplex kidney with or without ureterocele ( 27% ) , and posterior urethral valves ( 12% ) . nevertheless , the detection of fetal hydronephrosis by ultrasound presents a dilemma in terms of diagnosis and treatment , and there is considerable debate and controversy regarding the optimal management of children with prenatally - diagnosed hydronephrosis . a recent report highlighted the substantial variations in the use of grading criteria for the diagnosis of fetal hydronephrosis and in the management of mild prenatal hydronephrosis . hence , antenatal hydronephrosis does not necessarily indicate the presence of an obstruction or poor renal function . indeed , most of the cases of antenatal hydronephrosis resolve spontaneously by the time of birth or during infancy period . the pediatric surgeon thus faces the challenge of distinguishing the affected infants who require long - term observation or surgical intervention from those who do not require observation or intervention . postnatal ultrasound is considered a critical investigation tool used to follow affected infants to monitor the progression of the disease , and can be complemented by other investigations such as micturating cystourethrography ( mcu ) and diuretic renography . therefore , in order to shed some light on the diagnosis and management of antenatal hydronephrosis , the present study aimed to examine the postnatal follow - up and treatment for hydronephrosis diagnosed prenatally in a pediatric hospital in china . this was a retrospective study of infants prenatally diagnosed with hydronephrosis and treated at the department of pediatric surgery of qilu hospital , shandong university ( china ) between january 2005 and december 2013 . the need for individual consent was waived by because of the retrospective nature of the study . exclusion criteria were : ( 1 ) patients with sfu grade 4 ; ( 2 ) ipsilateral or contralateral reflux ; ( 3 ) solitary kidney ; ( 4 ) pelvic stones ; ( 5 ) ureteral dilatation ; 6 ) anatomical or neurogenic abnormality of the lower urinary tract ; or ( 7 ) abnormality other than ureteropelvic junction obstruction of the contralateral normal kidney all patients underwent initial assessment of hydronephrosis by ultrasound one week after birth and underwent standardized dtpa renography one month after birth . the maximum anteroposterior diameter ( apd ) of the renal pelvis was measured on a transverse renal image . parenchymal thickness was measured at upper , middle , and lower poles , and the maximum parenchymal thickness was used as a variable . the society for fetal urology ( sfu ) grading system was used for hydronephrosis4[1921 ] as well as the method designed by grignon et al . infants who had an ultrasound within 72 hours of birth because of an emergency clinical status were re - evaluated at one week of age . for diuretic renogram , oral hydration was started two hours before the scan ; intravenous dn/2 was started at 15 ml / kg over 30 minutes , beginning 15 minutes before injection of the radiotracer , and then at 4 ml / kg / hour for the remaining of the study . furosemide 1 mg / kg was injected at the start of the study and renal function was measured , along with assessment of isotope washout after diuresis . during the diuresis phase , some patients were additionally investigated using emission computed tomography ( ect ) and magnetic resonance urography ( mru ) . urinary and blood urea nitrogen ( uun , bun ) and urinary and serum creatinine ( cr ) were measured routinely . patients with sfu grade 1 hydronephrosis ( equivalent to pyelectasis 1.5 cm in grignon s approach ; table 1 ) had follow - up with b - mode ultrasound . a regular follow - up examination to clarify the pathological obstruction was deemed necessary in patients with sfu grade 2 hydronephrosis ( expanded renal pelvis of > 1.5 cm ) . patients diagnosed with sfu grade 3 hydronephrosis were closely followed due to the possibility of obstructive pathological factors and permanent renal damage . the ect and mru investigations were carried out at one month of age , and ultrasound examinations were undertaken every two to four weeks . surgery was performed at the time of presentation if the initial differential renal function ( drf)was < 35% , with an obstructed curve on renogram and/or parenchymal thickness below 3.5 mm . post - surgery , the patients were closely monitored by ultrasound and followed at one , three , six , and 12 months . the other patients were followed using a standard protocol , with ultrasound and radionuclide studies being performed every three months during the first two years . if renal function and sfu grade remained stable , the patients were followed by ultrasound every six months for another two years . all patients were followed for at least two years after birth . normally distributed continuous variables are presented as mean standard deviation ( sd ) and were analyzed using the student s t test or anova with the tukey s post hoc test , as appropriate . non - normally distributed continuous variables are presented as median ( range ) and were analyzed using the mann - whitney test . the occurrence of surgery during follow - up was analyzed using kaplan - meier curves , which were analyzed by the log - rank test . a multivariate analysis using cox regression analysis was performed to identify the independent factors involved in the occurrence of surgery . the receiver operating characteristic ( roc ) curve approach was used to determine the accuracy of factors associated with the occurrence of surgery . spss 16.0 ( ibm , armonk , ny , usa ) was used for analysis . this was a retrospective study of infants prenatally diagnosed with hydronephrosis and treated at the department of pediatric surgery of qilu hospital , shandong university ( china ) between january 2005 and december 2013 . the need for individual consent was waived by because of the retrospective nature of the study . exclusion criteria were : ( 1 ) patients with sfu grade 4 ; ( 2 ) ipsilateral or contralateral reflux ; ( 3 ) solitary kidney ; ( 4 ) pelvic stones ; ( 5 ) ureteral dilatation ; 6 ) anatomical or neurogenic abnormality of the lower urinary tract ; or ( 7 ) abnormality other than ureteropelvic junction obstruction of the contralateral normal kidney all patients underwent initial assessment of hydronephrosis by ultrasound one week after birth and underwent standardized dtpa renography one month after birth . the maximum anteroposterior diameter ( apd ) of the renal pelvis was measured on a transverse renal image . parenchymal thickness was measured at upper , middle , and lower poles , and the maximum parenchymal thickness was used as a variable . the society for fetal urology ( sfu ) grading system was used for hydronephrosis4[1921 ] as well as the method designed by grignon et al . ( table 1 ) . infants who had an ultrasound within 72 hours of birth because of an emergency clinical status were re - evaluated at one week of age . for diuretic renogram , oral hydration was started two hours before the scan ; intravenous dn/2 was started at 15 ml / kg over 30 minutes , beginning 15 minutes before injection of the radiotracer , and then at 4 ml / kg / hour for the remaining of the study . furosemide 1 mg / kg was injected at the start of the study and renal function was measured , along with assessment of isotope washout after diuresis . during the diuresis phase , some patients were additionally investigated using emission computed tomography ( ect ) and magnetic resonance urography ( mru ) . urinary and blood urea nitrogen ( uun , bun ) and urinary and serum creatinine ( cr ) were measured routinely . patients with sfu grade 1 hydronephrosis ( equivalent to pyelectasis 1.5 cm in grignon s approach ; table 1 ) had follow - up with b - mode ultrasound . a regular follow - up examination to clarify the pathological obstruction was deemed necessary in patients with sfu grade 2 hydronephrosis ( expanded renal pelvis of > 1.5 cm ) . patients diagnosed with sfu grade 3 hydronephrosis were closely followed due to the possibility of obstructive pathological factors and permanent renal damage . the ect and mru investigations were carried out at one month of age , and ultrasound examinations were undertaken every two to four weeks . surgery was performed at the time of presentation if the initial differential renal function ( drf)was < 35% , with an obstructed curve on renogram and/or parenchymal thickness below 3.5 mm . post - surgery , the patients were closely monitored by ultrasound and followed at one , three , six , and 12 months . the other patients were followed using a standard protocol , with ultrasound and radionuclide studies being performed every three months during the first two years . if renal function and sfu grade remained stable , the patients were followed by ultrasound every six months for another two years . normally distributed continuous variables are presented as mean standard deviation ( sd ) and were analyzed using the student s t test or anova with the tukey s post hoc test , as appropriate . non - normally distributed continuous variables are presented as median ( range ) and were analyzed using the mann - whitney test . the occurrence of surgery during follow - up was analyzed using kaplan - meier curves , which were analyzed by the log - rank test . a multivariate analysis using cox regression analysis the receiver operating characteristic ( roc ) curve approach was used to determine the accuracy of factors associated with the occurrence of surgery . spss 16.0 ( ibm , armonk , ny , usa ) was used for analysis . most patients ( 59.5% ) were sfu grade 1 . at the last follow - up figure 1 presents the kaplan - meier curves of the occurrence of surgery according to the sfu grade determined one week after birth by ultrasound . only a small proportion of patients who were originally grade 1 underwent surgery ( n=3 ) , while most grade 23 patients underwent surgery . patients who underwent surgery were more often sfu grade 2 or 3 ( p<0.001 ) , had a larger apd ( p<0.001 ) , and had a smaller parenchymal thickness ( p<0.001 ) . the variables that were significant in univariate analyses were included in a multivariate model ( table 4 ) . results showed that sfu grade 3 ( hr=9.23 , 95% ci : 1.4359.74 , p=0.02 ) , apd ( hr=2.81 , 95% ci : 1.117.10 , p=0.03 ) , and parenchymal thickness ( hr=0.42 , 95% ci : 0.240.71 , p=0.001 ) were independently associated with the occurrence of surgery . figure 2 presents the roc curve analysis for the accuracy of apd and parenchymal thickness for predicting the occurrence of surgery . for apd , using a cut - off point of 1.1 , the area under the curve ( auc ) was 0.86 , youden index was 0.556 , sensitivity was 70.4% , and specificity was 85.3% . for parenchymal thickness , using a cut - off point of 5 , auc was 0.79 , youden index was 0.478 , sensitivity was 74.1% , and specificity was 73.8% . most patients ( 59.5% ) were sfu grade 1 . at the last follow - up figure 1 presents the kaplan - meier curves of the occurrence of surgery according to the sfu grade determined one week after birth by ultrasound . only a small proportion of patients who were originally grade 1 underwent surgery ( n=3 ) , while most grade 23 patients underwent surgery . patients who underwent surgery were more often sfu grade 2 or 3 ( p<0.001 ) , had a larger apd ( p<0.001 ) , and had a smaller parenchymal thickness ( p<0.001 ) . the variables that were significant in univariate analyses were included in a multivariate model ( table 4 ) . results showed that sfu grade 3 ( hr=9.23 , 95% ci : 1.4359.74 , p=0.02 ) , apd ( hr=2.81 , 95% ci : 1.117.10 , p=0.03 ) , and parenchymal thickness ( hr=0.42 , 95% ci : 0.240.71 , p=0.001 ) were independently associated with the occurrence of surgery . figure 2 presents the roc curve analysis for the accuracy of apd and parenchymal thickness for predicting the occurrence of surgery . for apd , using a cut - off point of 1.1 , the area under the curve ( auc ) was 0.86 , youden index was 0.556 , sensitivity was 70.4% , and specificity was 85.3% . for parenchymal thickness , using a cut - off point of 5 , auc was 0.79 , youden index was 0.478 , sensitivity was 74.1% , and specificity was 73.8% . hydronephrosis is a common congenital condition that can be detected by prenatal ultrasound , but there is considerable debate and controversy regarding the optimal management of children with prenatally - diagnosed hydronephrosis . therefore , this study aimed to examine postnatal follow - up and treatment for hydronephrosis diagnosed prenatally , as well as the characteristics associated with the occurrence of surgery . results showed that 2.4% , 18.9% , and 90.9% of patients with sfu grade 1 , 2 , and 3 hydronephrosis , respectively , underwent surgery . sfu grade 3 , apd , and parenchymal thickness were independently associated with the occurrence of surgery . for anterioposterior diameter , using a cut - off point of 1.1 , sensitivity was 70.4% , and specificity was 85.3% . for parenchymal thickness , using a cut - off point of 5 , sensitivity was 74.1% , and specificity was 73.8% . . however , the recent developments in ultrasound and prenatal medical technologies have allowed for the diagnosis of hydronephrosis during the fetal period , and its monitoring after birth . studies are now available concerning the management of hydronephrosis in children , and guide clinicians to make better decisions regarding the selection of suitable follow - up strategies and surgical interventions . indeed , compared with a newborn , a fetus has a relatively low renal vascular resistance and a relatively high renal blood flow , and the combination of a higher glomerular filtration rate and a lower renal concentrating capacity may thus lead to a relatively high urine volume . in addition , as the compliance of the ureter increases , it becomes easier to expand . since the fetal and neonatal kidneys are not fully developed , the renal medullary cone may be transparent under ultrasound examination , which leads to a wrong diagnosis of hydronephrosis . in contrast , pathological hydronephrosis is due to renal obstruction , resulting in the separation of the collection system . since the fetal and neonatal renal tubules are relatively short and straight , the consequences of obstruction are more serious than in the adult . hence , it is very important to distinguish between physiological and pathological hydronephrosis , since their management is different . ultrasound investigations that ate carried out during prenatal screening and subsequent follow - up after birth , are the primary and preferred means of monitoring patients diagnosed with hydronephrosis . although ultrasound has a limited role in predicting the degree of renal impairment and identifying the cause of the restriction / obstruction , it is highly useful for the diagnosis of hydronephrosis and evaluation of disease progression . early studies have shown that the patients with renal parenchyma thickness > 4 mm had normal glomerular , tubular , and cell structure ; at 3 mm thickness of renal parenchyma , some surviving glomeruli and tubules were evident but there was cell deformation with the presence of abnormal nuclei , and removal of the obstruction resulted in partial restoration of the cell morphology ; at 2 mm , glomerular and tubular structures were not apparent , and the normal cell structure was not evident through electron microscopy . after a gestational age of 24 weeks , ultrasound is able to demonstrate clearly the structure of the fetal kidney , enabling direct measurement of the collection system , the expansion of the renal pelvis , and the thickness of the renal cortex . since it is a non - invasive and straightforward technique , it has an advantage over other methods such as ect , mru , and intravenous pyelography , particularly in young children . an apd of 4 mm or greater at 20 weeks of gestation or larger threshold of 7 mm in the third trimester has been used as an indicator for the diagnosis of prenatal hydronephrosis . in addition to diagnosis of the condition , antenatal ultrasound has also been reported to have some prognostic value . interestingly , the second and third trimester apd cut - offs of 5 mm and 8 mm to10 mm , respectively , have been reported to have 100% sensitivity for predicting the requirement for postnatal surgery . similarly , in another study , apd thresholds of 10 mm at 20 weeks and 12 mm at 30 weeks of gestation were found to have 100% sensitivity , and 86% and 67% specificity ( respectively ) for the diagnosis of hydronephrosis postnatally . the risk of postnatal pathology increases with the severity of prenatal hydronephrosis , while antenatal apd of < 12 mm is associated with stabilization or resolution in 98% of the infant population with hydronephrosis . in this study , using an apd cut - off of 1.1 had 70.4% sensitivity and 85.3% specificity for the occurrence of surgery . using parenchymal thickness of 5 mm had 74.1% sensitivity and 73.8% specificity . the sfu guidelines recommend that all children with a prenatal diagnosis of hydronephrosis should be investigated with an ultrasound within one week of birth , and the results should be compared with the last prenatal ultrasound , in order to determine the classification of the hydronephrosis . have reported that ultrasound examination 48 hours after birth showed either no hydronephrosis or a mild hydronephrosis with no obvious significant obstructive renal injury at one year . however , wiener et al . have reported that the grading of hydronephrosis using an ultrasound examination two days after birth may differ from the ultrasound examination 710 days after birth , possibly due to the presence of oliguria in the first few days . the present study suggests that an initial b - mode screening 710 days after birth with a second investigation 42 days after birth could be a good approach , but severe cases may be investigated earlier . the hydronephrosis may then be graded based on these investigations , and an appropriate management approach can be selected . some authors believe that the majority of young infants with mild - to - moderate hydronephrosis may be managed by observation rather than surgery . a previous study showed that there was a recovery rate of 98% in infants with sfu grade 1 or 2 hydronephrosis or apd < 12 mm , compared with 51% recovery with grade 3 or 4 hydronephrosis or apd > 12 mm . in addition , the sfu reported that surgery was eventually needed in 25% of children aged < 6 months with grade 34 hydronephrosis and a relative renal function > 40% . furthermore , surgery was found to reduce the degree of hydronephrosis and improve the renal pelvis evacuation , and was superior to the conservative approach of close observation . reported that almost all children with grade 34 hydronephrosis required surgery : in a review of 464 medical records , the vast majority of patients receiving surgery had grade 3 or 4 hydronephrosis with an evidence of obstruction ( renography ) , whereas those managed by observation tended to have grade 2 or 1 disease without obstruction . consistent with these data , a recent retrospective review of 629 infants found that the proportion of patients requiring surgery for grade 1 , 2 , 3 , and 4 hydronephrosis was 0,% 13% , 70% , and 100% , respectively . in clinical practice , the decision to go ahead with surgical intervention , and its timing , are based on the following main considerations : ( 1 ) sfu grade 34 ; ( 2 ) continued expansion of the renal pelvis collection system ; ( 3 ) a renal cortex < 5 mm ; and ( 4 ) a single - kidney decrease in gfr , as reflected by ect and mru examinations . future research should be directed at improving the understanding of areas where knowledge remains limited such as the renal processes underlying physiological and pathological hydronephrosis and their progression or resolution , and the optimization of the point at which surgical intervention is deemed necessary . it is important to standardize the guidelines based on up - to - date research , to help clinicians to make better decisions regarding the management of infants with a prenatal diagnosis of hydronephrosis . in conclusion , patients with sfu grade 2 hydronephrosis require long - term follow - up . surgery and close postsurgical observation may be necessary for patients with sfu grade 3 and 4 hydronephrosis . an initial b - mode ultrasound screening at 710 days after birth may help making an optimal diagnosis and treatment selection .

backgroundhydronephrosis is a common congenital condition . the detection of fetal hydronephrosis by ultrasound presents a treatment dilemma . this study aims to examine postnatal follow - up and treatment for hydronephrosis diagnosed prenatally.material/methodsthis was a retrospective study of 210 infants with hydronephrosis diagnosed at the qilu hospital ( shangdong , china ) between january 2005 and january 2013 . the patient cohort was divided into four groups based on prenatal ultrasound examinations using the society for fetal urology ( sfu ) classification system . data on follow - up investigations and treatment methods were extracted from the charts and analyzed.resultspatients with sfu grade 1 , 2 , and 3 hydronephrosis ( n=125 , n=74 , and n=11 , respectively ) were followed for two years . in all , 2.4% , 18.9% , and 90.9% of patients with sfu grade 1 , 2 , and 3 hydronephrosis , respectively , underwent surgery . sfu grade 3 ( hr=9.23 , 95% ci : 1.4359.74 , p=0.02 ) , apd ( hr=2.81 , 95% ci : 1.117.10 , p=0.03 ) , and parenchymal thickness ( hr=0.42 , 95% ci : 0.240.71 , p=0.001 ) were independently associated with the occurrence of surgery . for anterioposterior diameter , using a cut - off point of 1.1 , the area under the curve was 0.86 , youden index was 0.556 , sensitivity was 70.4% , and specificity was 85.3% . for parenchymal thickness , using a cut - off point of 5 , auc was 0.79 , youden index was 0.478 , sensitivity was 74.1% , and specificity was 73.8%.conclusionspatients with sfu grade 2 hydronephrosis require long - term follow - up . surgery and close postsurgical observation may be necessary for patients with sfu grade 3 and 4 hydronephrosis . an initial b - mode ultrasound screening at 710 days after birth may help make an optimal diagnosis and treatment selection .

Background Material and Methods Study design Patients Imaging Biochemistry Treatments and follow-up Statistical analysis Results Characteristics of the patients Surgery Univariate analyses Multivariate analysis ROC analysis Discussion Conclusions

d - penicillamine has been known as one of the agents that are able to induce pemphigus ( 1,2 ) . n-(2-mercapto-2-methylpropionyl)-l - cysteine ] is a thiol compound contained two free sulfhydryl groups , whereas d - penicillamine has only one sulfhydryl radical ( 3 ) . while drug - induced pemphigus was not infrequently demonstrated in association with d - penicillamine , it has rarely been reported with bucillamine and has never been reported in rheumatoid arthritis ( ra ) and polymyositis ( pm ) overlap syndrome . hereby , we report a case of bucillamine - induced pemphigus vulgaris in a patient with ra and pm overlap syndrome . a 46-yr - old woman was referred to our rheumatology department due to polyarthralgia , and myalgia in may 2001 . soft tissue swelling and tenderness were bilaterally noted at the proximal interphalangeal and metacarpophalangeal joints with morning stiffness lasting at least 1 hr . proximal motor weakness on upper arms and legs has insidiously developed over three months and findings of magnetic resonance image on both thighs were compatible with myositis . in addition , elevated level of muscle enzymes including creatine kinase ( ck ) , aldolase , alanine aminotransferase ( ast and alt ) , and lactate dehydrogenase was shown . antinuclear antibody was positive at 1:80 of speckled pattern , and 1:2,560 of cytoplasmic pattern . auto - antibodies including anti - jo-1 , anti - rnp , anti - double stranded dna , anti - sm , and anti - ss - a / ss - b were absent . level of rheumatoid factor was 3,420 iu / ml , but level of c3 and c4 was 97.9 mg / dl ( normal range 79 - 152 mg / dl ) and 30.8 mg / dl ( normal range 16 - 38 mg / dl ) respectively . chest radiograph showed pattern of interstitial lung disease and pulmonary function test revealed significantly decreased dlco . she was diagnosed as ra and pm overlap , and had been treated with prednisolone , azathioprine and non - steroidal anti - inflammatory drug since may 2001 . myositis became silent over time with above regimen , however she had continuous synovitis and joint pain on right knee and small joints on both hands . blisters consisted of erythematous patches and superficial erosions with turbid bullae suggesting pemphigus vulgaris ( fig . laboratory tests showed c - reactive protein 0.831 mg / dl ( normal range < 0.8 mg / dl ) , and erythrocyte sedimentation rate 66 mm / hr . a skin biopsy revealed intraepidermal vesicle formation with acantholysis and the vesicle formation is suprabasal ( fig . indirect immunofluorescence , performed by using serial dilutions of the patient 's serum , demonstrated no igg , iga and c3 staining along epidermis and papillary dermis . bucillamine was discontin - ued and the patient was placed on oral prednisolone 20 mg daily . d - penicillamine and bucillamine have been used for patients with rheumatoid arthritis as a disease modifying anti - rheumatic drug . d - penicillamine can cause various autoimmune diseases including pemphigus , pm , and myasthenia gravis ( 4 - 6 ) . although bucillamine has a chemical structure similar to d - penicillamine , autoimmune diseases are rarely associated with bucillamine . some cases of bucillamine - induced interstitial lung disease , nephropathy , and myasthenia gravis were described ( 7 - 9 ) . it was reported that the incidence of d - penicillamine - induced pemphigus was about 7% ( 5,10 ) and mean duration until the onset of pemphigus was 11 to 13 months ( 11,12 ) . it has been suggested that the epidermal cell surface proteins play a role as an antigen to the host through a sulfhydryl radical and other unknown factors ( 1 ) . in d - penicillamine- induced pemphigus , the prevalence of igg and iga antibodies directed against the intercellular region is lower than that in spontaneously occurring pemphigus ( 13 ) . it has been shown that these antibodies might not be detected in some cases of drug - induced pemphigus like our case ( 13,14 ) . to date , only 2 cases of bucillamine - induced pemphigus were reported in english literature . one was drug - induced pemphigus foliaceus with features of pemphigus vulgaris and the other was subcorneal pustular dermatosis - type iga pemphigus induced by thiol drugs ( 12,14 ) . the discontinuation of d - penicillamine may be inadequate in treatment because it frequently fails to stop disease progression.initial dose of corticosteroid is typically about 0.75 - 1 mg / kg / day . it has been suggested that high - dose or pulse therapy with steroids usually clears blisters promptly . prednisolone at a lower dose of 20 - 30 mg / day can maintain these patients without blistering but other adjuvant immunosuppressive drugs is need to achieve steroid - sparing effect or prevention of relapse ( 15,16 ) . bucillamine may cause pemphigus even at a low rate therefore we have to keep in mind that skin lesions with blisters should be carefully investigated in patients with bucillamine treatment .

bucillamine is a disease modifying anti - rheumatic drug , structurally similar to d - penicillamine . although d - penicillamine - induced pemphigus has been not infrequently demonstrated , pemphigus associated with bucillamine was rarely reported . we describe a patient complicating pemphigus vulgaris after bucillamine treatment in rheumatoid arthritis ( ra ) and polymyositis ( pm ) overlap syndrome . pm and ra overlap syndrome was diagnosed three years ago and bucillamine was administrated for 20 months . skin lesions including erythematous flaccid blisters on her chest , axillae , and back were occurred and were compatible with pemphigus vulgaris by typical pathology . withdrawal from bucillamine and prednisolone treatment made rapid improvement of pemphigus lesions .

INTRODUCTION CASE REPORT DISCUSSION

the - and -lactam scaffolds are found in various biologically relevant compounds . additionally , these core structures are crucial intermediates in the synthesis of various natural products as well as pharmaceuticals , prompting the development of new methods for the synthesis of these valuable structures . our group has explored the synthesis of -lactams by the reactions of aryl- , thioaryl- , and cyano - substituted anhydrides . furthermore , we have demonstrated that one - pot four - component reactions ( 4crs ) are possible in the case of thioaryl substitution . recent computational studies of the cyanosuccinic anhydride reactions demonstrate that they proceed by a mannich - like mechanism via the enol tautomer of the anhydride . related reactions reported by castagnoli , cushman , and haimova likely proceed by this mechanism as well . consistent with the proposed mechanism , those anhydrides are poorly enolizable and require forcing conditions . two decades later , cushman and haimova reported analogous reactions with homophthalic anhydride , which is highly enolizable . the high reactivity of this anhydride at lower temperatures is consistent with the mannich - like mechanism . these results prompted us to explore mannich - type reactions and related 4crs of variously substituted anhydrides . although aryl - substituted succinic anhydrides showed some variation in reactivity based on the substituents attached to the aromatic ring , direct attachment of an electron - withdrawing group resulted in higher reactivity . furthermore , in the case of cyanosuccinic anhydrides , the diastereoselectivity was reversed relative to the aryl and thioaryl cases and could be controlled by resident stereogenic centers . we envisioned that the electron - withdrawing capability of a sulfone would impart the anhydride with similar reactivity as the nitrile - substituted anhydride , albeit with drastically different steric requirements ( scheme 1 ) . herein we report the development of anhydride mannich reactions ( amrs ) using sulfone - substituted anhydrides for the synthesis of - and -lactams as well as a six - step formal synthesis of ( )-isoretronecanol . multigram - scale syntheses of anhydrides 3a d were achieved from readily available starting materials . anhydride 3a was synthesized by conjugate addition of benzenesulfinic acid sodium salt ( 7 ) to maleic anhydride to yield a diacid , which was cyclized in one step ( scheme 2a ) . the syntheses of anhydrides 3b d were achieved by michael addition of sulfone acetate 8 to various tert - butyl acrylates followed by ester cleavage and cyclization ( scheme 2b ) . anhydride 3a readily reacted with imines to form -lactams . as with previous amrs , the carboxylic acid 5 ( table 1 ) is the first - formed product . unlike all previous related intermediates , these carboxylic acids were prone to facile decarboxylation . mild heating drove the decarboxylation to completion , allowing isolation of the sulfone - substituted lactams in high yields with only the anti diastereomer detectable by h nmr spectroscopy . in all cases , non - enolizable substrates the lack of reactivity of ketones and enolizable aldehydes in the amr probably stems from the rapid equilibration to the enamine tautomer , which is unreactive in the mannich addition step . the stereochemical configuration of the products was assigned by x - ray crystallography . lactam 10e has an anti configuration between the aromatic ring and the sulfonyl group . the other lactams were assigned by comparison of the coupling constants of the adjacent protons ( e.g. , 10f ; figure 1a ) . furthermore , acid intermediate 5f , which leads to 10f by decarboxylation , was also crystalline and was found to have an anti configuration between the sulfone and aromatic substituents ( figure 1b ) . our previous mechanistic work on the cyano - substituted anhydrides suggests that the anti - configured carboxylic acids are the kinetic products of the amrs . subsequent decarboxylation leads to the anti - sulfones , which would also be expected to be thermodynamically preferred . x - ray structures of 5f , 10f , and 10 g and j values for 10e and 10j . the stereochemical outcome of the reactions of imines with 3a is adequately explained by a transition state that is analogous to what is operative for cyanosuccinic anhydrides the iminium ion is attacked by the enolate of the anhydride , and the cyclic transition state is stabilized by hydrogen bonding to the sulfone . after the mannich reaction , subsequent rapid transannular acylation forms the lactam product.1 the carboxylic acid intermediates could be trapped with trimethylsilyldiazomethane ( tmschn2 ) . after many esterification conditions were tried , treatment of crude mixtures of 5 with a commercially available solution of tmschn2 resulted in reasonable yields of methyl esters 11a c ( table 2 ) . these intermediates could also be smoothly desulfonylated with magnesium in methanol to produce the corresponding esters 12 in good yield . although this reaction was successful for 11a and 11b , no ester product was observed in the attempted desulfonylation of 11c . unlike the analogous -lactams , these intermediates were impossible to isolate , thus preventing assignment of the configuration of the predominant diastereomer . upon decarboxylation , sulfone lactams 13 were formed as single isomers in high yields ( table 3 ) . determined by h this change in diastereoselectivity upon decarboxylation suggests the formation of a planar anion followed by selective protonation from one face of the anion . this result is in accordance with experimental data and models of sulfone anions proposed by corey . similar to our results with the succinic anhydride , the reaction tolerated a variety of non - enolizable aldehydes and a variety of alkylamines and anilines . while some of our initial reactions gave low yields ( 4050% ) , the use of commercially available imines or those purified by distillation significantly increased the yields of the lactam products . methyl - substituted anhydrides 3c and 3d provided trisubstituted -lactams in high yields with good diastereomeric ratios ( scheme 3 ) . these results suggest that substitution on the anhydride provides excellent facial selectivity , resulting in the formation of only two diastereomers of the intermediate carboxylic acids . studies are ongoing in our laboratory to develop an enantioselective michael addition with sulfone acetate 8 to provide the anhydrides as single enantiomers , which would presumably provide enantiomerically pure lactam products . this new amr was applied to a formal synthesis of ( )-isoretronecanol ( scheme 4 ) . the reaction of imine 16 with anhydride 3a followed by ring - closing metathesis provides the pyrrolizidine core of the natural product from cinnamaldehyde , allylamine , and 3a in two steps . the elimination of 18 yields 21 , which has been converted to ( )-isoretronecanol in two steps in low yield . further reduction yields lactam ester 22 , which has been converted to ( )-isoretronecanol in one step . while this second route is redox - inefficient , it provides material in a much higher yield and avoids the high - pressure conditions necessary to reduce pyrrole 21 . this synthetic route showcases the versatility of the anhydride michael reaction of the sulfone - substituted anhydride , exemplifying its usefulness in the assembly of heterocyclic targets . this synthesis demonstrates that the amr of sulfone - substituted anhydrides will be useful for the assembly of many heterocyclic targets , natural and otherwise . in summary , we have successfully synthesized various sulfone - substituted - and -lactams in good yields with high diastereoselectivities ( > 95:5 ) by an anhydride mannich reaction . we have previously studied the reactivity of several different substituted succinic anhydrides , but these are the first new results employing glutaric anhydyrides since the original work of castagnoli . unlike previous reactions of this type to date , the carboxylic acid products were prone to decarboxylation . although the -lactam acids derived from the substituted succinic anhydride could be trapped as esters , the analogous -lactam products could not be intercepted . another important difference was observed in the diastereoselectivity of the initial mannich - type reaction . although the reactions of succinic anhydyrides were very selective , the acid products derived from the glutaric anhydrides were generally formed as diastereomeric mixtures . in both cases , we have shown that this methodology is highly robust and have showcased it in the formal synthesis of a biologically active natural product . unless otherwise specified , all commercially available reagents were used as received . all reactions using dried solvents were carried out under an atmosphere of argon in flame - dried glassware with magnetic stirring . dry solvent was dispensed from a solvent purification system that passes solvent through two columns of dry neutral alumina . h nmr spectra and proton - decoupled c nmr spectra were obtained on a 400 or 600 mhz nmr spectrometer . chemical shifts ( ) are reported in parts per million ( ppm ) relative to residual solvent ( chcl3 , s , 7.26 ) . multiplicities are given as s ( singlet ) , d ( doublet ) , t ( triplet ) , dd ( doublet of doublets ) , m ( multiplet ) , br m ( broad multiplet ) , or br s ( broad singlet ) ; c nmr chemical shifts are reported relative to cdcl3 ( t , 77.23 ) unless otherwise noted . high - resolution mass spectra were recorded in positive esi mode in methanol or acetonitrile . silica gel chromatographic purifications were performed by flash chromatography with silica gel packed in glass columns . the eluting solvent for each purification was determined by thin - layer chromatography ( tlc ) on glass plates coated with silica gel and visualized by uv light or by staining with ceric ammonium molybdate ( cam ) followed by gentle heating . the following abbreviations are used throughout : ethyl acetate ( etoac ) , hexanes ( hex ) , dichloromethane ( dcm ) , triethylamine ( tea ) , diisopropylethylamine ( dipea ) . benzenesulfinic acid sodium salt ( 10.0 g , 60.9 mmol ) was dissolved in 100 ml of h2o at 0 c . then 10% hcl was added , and the mixture was extracted two times with etoac . the combined organic layers were dried over na2so4 , and the solvent was removed in vacuo to yield a white solid , which was dissolved in 50 ml of toluene . ac2o ( 70 ml , 20 mmol ) was added , and the reaction mixture was heated at reflux for 3 h. the solvent was evaporated in vacuo , and the resulting brown solid was washed several times with cold dcm and collected in a fritted funnel , yielding a white to light - brown solid ( 6.8 g , 46% yield over the two steps ) . mp 132.4133.1 c ( dec . ) ; h nmr ( 400 mhz , cdcl3 ) 7.96 ( dd , j = 8.4 , 1.3 hz , 2h ) , 7.867.76 ( m , 1h ) , 7.727.63 ( m , 2h ) , 4.52 ( dd , j = 10.3 , 4.4 hz , 1h ) , 3.68 ( dd , j = 19.9 ( gem ) , 4.4 hz , 1h ) , 3.39 ( dd , j = 19.7 ( gem ) , 10.6 hz , 1h ) ; c nmr ( 100 mhz , cdcl3 ) 166.0 , 162.9 , 135.8 , 135.4 , 129.9 , 129.7 , 64.4 , 30.1 ; ir ( neat ) 1782 , 1739 ( c = o ) , 1169 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + h ] calcd for c10h9o5s 241.0171 , found 241.0165 . the amine and the aldehyde were dissolved in thf ( 0.10 m ) , and 3 equiv of triethyl orthoformate was added . the anhydride was added , and then the reaction mixture was allowed to stir for 3 h. water was added to the mixture ( final concentration 0.05 mmol ) , followed by the addition of 3 equiv of k2co3 and heating at reflux for 4 h , unless otherwise stated . the reaction mixture was allowed to cool to rt and then extracted two times with etoac . the solvent was evaporated in vacuo , and the crude mixture was purified by flash chromatography using an etoac/3050% gradient , unless otherwise stated . general procedure a was used with sulfone anhydride 3a ( 0.24 g , 0.99 mmol ) , benzylamine ( 109 l , 0.99 mmol ) , and benzaldehyde ( 102 l , 1.0 mmol ) to yield 10a ( 0.32 g , 83% ) as a foam ( 50:50 etoac / hex , rf = 0.59 ) . h nmr ( 600 mhz , cdcl3 ) 7.687.64 ( m , 2h ) , 7.62 ( tt , j = 7.5 , 1.3 hz , 1h ) , 7.487.41 ( m , 2h ) , 7.327.23 ( m , 6h ) , 7.097.06 ( m , 2h ) , 6.836.79 ( m , 2h ) , 5.09 ( d , j = 14.9 hz , 1h ) , 4.70 ( d , j = 3.3 hz , 1h ) , 3.66 ( ddd , j = 9.9 , 4.4 , 3.3 hz , 1h ) , 3.44 ( d , j = 14.9 hz , 1h ) , 3.03 ( dd , j = 18.2 ( gem ) , 4.3 hz , 1h ) , 2.95 ( ddd , j = 18.2 ( gem ) , 9.9 , 1.2 hz , 1h ) ; c nmr ( 101 mhz , cdcl3 ) 170.5 , 137.7 , 136.4 , 134.7 , 134.4 , 129.5 , 129.3 , 128.9 , 128.7 , 128.7 , 128.4 , 127.8 , 126.1 , 63.5 , 60.6 , 44.5 , 30.7 ; ir ( thin film ) 1692 ( c = o ) , 1322 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c23h21no3sna 414.1140 , found 414.1120 . general procedure a was used with sulfone anhydride 3a ( 0.30 g , 1.26 mmol ) and ( e)-n - methyl-1-phenylmethanimine ( 156 l , 1.26 mmol ) . because the commercially available imine was used in this experiment , the anhydride was added immediately after the imine was dissolved instead of waiting for 3 h or overnight . the reaction yielded 10b ( 0.332 g , 83% ) as a foam ( 50:50 etoac / hex , rf = 0.35 ) . h nmr ( 600 mhz , cdcl3 ) 7.89 ( d , j = 7.5 hz , 2h ) , 7.69 ( t , j = 7.5 hz , 1h ) , 7.58 ( t , j = 7.8 hz , 2h ) , 7.367.31 ( m , 3h ) , 7.067.02 ( m , 2h ) , 4.97 ( d , j = 3.5 hz , 1h ) , 3.66 ( dt , j = 9.8 , 4.1 hz , 1h ) , 2.90 ( dd , j = 18.1 ( gem ) , 4.7 hz , 1h ) , 2.82 ( dd , j = 18.1 ( gem ) , 9.8 hz , 1h ) , 2.64 ( s , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 170.6 , 138.2 , 136.8 , 134.6 , 129.7 , 129.5 , 129.0 , 128.9 , 126.1 , 64.3 , 63.6 , 31.0 , 28.4 ; ir ( thin film ) 1690 ( c = o ) , 1308 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c17h17no3sna 338.0827 , found 338.0818 . general procedure a was used with sulfone anhydride 3a ( 0.240 g , 1.00 mmol ) , prop-2-yn-1-amine ( 64.0 l , 1.00 mmol ) , and benzaldehyde ( 102 l , 1.00 mmol ) to yield 10c ( 0.182 g , 54% ) as a foam . the residue was purified by flash column chromatography ( 50:50 etoac / hex , rf = 0.53 ) . h nmr ( 600 mhz , cdcl3 ) 7.89 ( m , 2h ) , 7.68 ( t , j = 7.4 hz , 1h ) , 7.607.53 ( t , 2h ) , 7.357.29 ( m , 3h ) , 7.077.02 ( m , 2h ) , 5.23 ( d , j = 4.0 hz , 1h ) , 4.51 ( dd , j = 17.6 , 2.6 hz , 1h ) , 3.75 ( ddd , j = 9.4 , 5.1 , 4.0 hz , 1h ) , 3.253.20 ( m , 1h ) , 2.96 ( dd , j = 18.2 ( gem ) , 5.1 hz , 1h ) , 2.89 ( ddd , j = 18.2 ( gem ) , 9.8 , 1.1 hz , 1h ) , 2.25 ( t , j = 2.5 hz , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 169.9 , 137.3 , 136.6 , 134.6 , 129.6 , 129.4 , 129.0 , 128.9 , 126.4 , 76.2 , 73.3 , 63.9 , 60.9 , 31.1 , 30.5 ; ir ( thin film ) 1699 ( c = o ) , 1414 , 1322 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c19h17no3sna 362.0827 , found 362.0831 . general procedure a was used with sulfone anhydride 3a ( 0.24 g , 0.99 mmol ) , propylamine ( 82 l , 0.99 mmol ) , and furan-2-carbaldehyde ( 83 l , 1.00 mmol ) to yield 10d ( 0.167 g , 50% ) as a foam . the residue was purified by flash column chromatography ( 50:50 etoac / hex , rf = 0.47 ) . h nmr ( 600 mhz , cdcl3 ) 7.907.86 ( m , 2h ) , 7.707.65 ( m , 1h ) , 7.57 ( dd , j = 8.3 , 7.2 hz , 2h ) , 7.32 ( d , j = 1.8 hz , 1h ) , 6.27 ( dd , j = 3.3 , 1.9 hz , 1h ) , 6.19 ( d , j = 3.3 hz , 1h ) , 5.07 ( d , j = 4.1 hz , 1h ) , 3.96 ( ddd , j = 8.9 , 6.1 , 4.1 hz , 1h ) , 3.40 ( ddd , j = 13.9 , 8.8 , 7.1 hz , 1h ) , 2.952.85 ( m , 2h ) , 2.65 ( ddd , j = 13.9 , 8.6 , 5.2 hz , 1h ) , 1.471.37 ( m , 1h ) , 1.331.24 ( m , 1h ) , 0.82 ( t , j = 7.4 hz , 3h ) ; c nmr ( 75 mhz , cdcl3 ) 169.9 , 149.4 , 143.5 , 136.7 , 134.5 , 129.6 , 128.6 , 110.6 , 109.8 , 60.8 , 55.2 , 42.7 , 31.2 , 20.1 , 11.1 ; ir ( thin film ) 1690 ( c = o ) , 1416 , 1308 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c17h19no4sna 356.0932 , found 356.0929 . general procedure a was used with sulfone anhydride 3a ( 0.3 g , 1.2 mmol ) , propylamine ( 100 l , 1.2 mmol ) , and benzaldehyde ( 126 l , 1.2 mmol ) to yield 10e ( 0.36 g , 87% ) as a solid ( 50:50 etoac / hex , rf = 0.36 ) . mp 149.8150.4 c ; h nmr ( 400 mhz , cdcl3 ) 7.89 ( dt , j = 8.5 , 1.4 hz , 2h ) , 7.767.54 ( m , 3h ) , 7.437.24 ( m , 3h ) , 7.136.98 ( m , 2h ) , 5.09 ( d , j = 3.5 hz , 1h ) , 3.703.56 ( m , 2h ) , 2.972.76 ( m , 2h ) , 2.54 ( dddd , j = 13.7 , 8.4 , 5.1 , 1.1 hz , 1h ) , 1.551.31 ( m , 2h ) , 0.85 ( td , j = 7.3 , 1.2 hz , 3h ) ; c nmr ( 100 mhz , cdcl3 ) 170.6 , 138.4 , 136.7 , 134.5 , 129.6 , 129.3 , 128.8 , 128.7 , 126.0 , 63.8 , 61.1 , 42.6 , 30.9 , 19.9 , 11.1 ; ir ( thin film ) 1688 ( c = o ) cm ; hrms ( esi - tof ) m / z [ m h ] calcd for c19h20no3s 342.1164 , found 342.1155 . general procedure a ( except that the decarboxylation was performed at room temperature overnight ) was used with sulfone anhydride 3a ( 0.3 g , 1.2 mmol ) , propylamine ( 102 l , 1.2 mmol ) , and 4-cyanobenzaldehyde ( 0.164 g , 1.3 mmol ) to yield 10f ( 0.36 g , 80% ) as a foam ( 50:50 etoac / hex , rf = 0.35 ) . h nmr ( 600 mhz , cdcl3 ) 7.89 ( dt , j = 8.5 , 1.8 hz , 2h ) , 7.777.54 ( m , 5h ) , 7.26 ( m , 2h ) , 5.20 ( d , j = 3.6 hz , 1h ) , 3.67 ( dt , j = 13.7 , 8.0 hz , 1h ) , 3.57 ( dt , j = 10.0 , 4.3 hz , 1h ) , 2.88 ( dd , j = 18.2 ( gem ) , 4.5 hz , 1h ) , 2.76 ( dd , j = 18.1 ( gem ) , 10.0 hz , 1h ) , 2.52 ( ddd , j = 13.8 , 8.6 , 5.0 hz , 1h ) , 1.44 ( m , 2h ) , 0.87 ( t , j = 7.3 hz , 3h ) ; c nmr ( 600 mhz , cdcl3 ) 170.7 , 144.1 , 136.6 , 134.9 , 133.3 , 129.9 , 128.9 , 127.2 , 118.1 , 113.1 , 63.8 , 60.6 , 43.1 , 31.3 , 20.1 , 11.2 ; ir ( thin film ) 1692 ( c = o ) , 1445 , 1412 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h20n2o3sna 391.1092 , found 391.1098 . general procedure a was used with sulfone anhydride 3a ( 88 mg , 0.36 mmol ) , propylamine ( 30 l , 0.36 mmol ) , and aldehyde ( 50 mg , 0.37 mmol ) to yield 10 g ( 87 mg , 65% ) as a solid ( 50:50 etoac / hex , rf = 0.17 ) . mp 125.3126.1 c ; h nmr ( 600 mhz , cdcl3 ) 7.927.86 ( m , 2h ) , 7.697.62 ( m , 1h ) , 7.55 ( t , j = 7.9 hz , 2h ) , 7.28 ( m , 1h ) , 6.936.82 ( m , 3h ) , 5.16 ( s , 1h ) , 3.80 ( d , j = 9.8 hz , 1h ) , 3.69 ( s , 3h ) , 3.49 ( dt , j = 13.5 , 8.1 hz , 1h ) , 2.96 ( dd , j = 17.9 ( gem ) , 4.0 hz , 1h ) , 2.85 ( dd , j = 17.9 ( gem ) , 9.9 hz , 1h ) , 2.48 ( ddd , j = 13.7 , 8.5 , 5.2 hz , 1h ) , 1.461.28 ( m , 2h ) , 0.82 ( t , j = 7.3 hz , 3h ) ; c nmr ( 151 mhz , cdcl3 ) 171.2 , 157.5 , 137.7 , 134.2 , 130.5 , 129.5 ( 2c ) , 129.0 ( 2c ) , 125.7 , 121.1 , 111.5 , 62.8 , 55.6 , 42.8 , 31.7 , 20.3 , 11.3 ; ir ( thin film ) 1681 ( c = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h23no4sna 396.1245 , found 396.1252 . general procedure a was used with sulfone anhydride 3a ( 0.18 g , 0.73 mmol ) , benzylamine ( 76 l , 0.69 mmol ) , and aldehyde ( 0.1 ml , 0.79 mmol ) to yield 10h ( 0.25 g , 82% ) as a foam ( 50:50 etoac / hex , rf = 0.36 ) . h nmr ( 600 mhz , cdcl3 ) 7.817.74 ( m , 2h ) , 7.657.14 ( m , 13h ) , 6.12 ( d , j = 15.8 hz , 1h ) , 5.74 ( dd , j = 15.6 , 8.5 hz , 1h ) , 4.93 ( d , j = 15.0 hz , 1h ) , 4.38 ( dd , j = 8.8 , 4.3 hz , 1h ) , 3.90 ( d , j = 15.0 hz , 1h ) , 3.65 ( dt , j = 9.9 , 5.1 hz , 1h ) , 3.01 ( dd , j = 18.0 ( gem ) , 5.5 hz , 1h ) , 2.86 ( dd , j = 18.1 ( gem ) , 10.0 hz , 1h ) ; c nmr ( 151 mhz , cdcl3 ) 170.1 , 136.8 , 135.3 , 135.2 , 135.0 , 134.4 , 129.5 , 128.8 , 128.7 , 128.7 , 128.4 , 127.7 , 126.8 , 126.7 , 125.3 , 61.7 , 59.9 , 44.7 , 30.8 ; ir ( thin film ) 1690 ( c = o ) , 1146 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c25h23no3sna 440.1296 , found 440.1282 . general procedure a was used with sulfone anhydride 3a ( 0.3 g , 1.26 mmol ) , isopropylamine ( 100 l , 1.22 mmol ) , and benzaldehyde ( 128 l , 1.26 mmol ) to yield 10i ( 0.297 g , 70% ) as a foam ( 50:50 etoac / hex , rf = 0.42 ) . h nmr ( 600 mhz , cdcl3 ) 7.987.86 ( m , 2h ) , 7.72 ( tt , j = 7.2 , 1.5 hz , 1h ) , 7.687.56 ( m , 2h ) , 7.407.26 ( m , 3h ) , 7.176.97 ( m , 2h ) , 5.10 ( d , j = 2.3 hz , 1h ) , 4.203.98 ( m , 1h ) , 3.57 ( ddd , j = 9.6 , 2.6 , 2.1 hz , 1h ) , 2.93 ( ddd , j = 18.2 ( gem ) , 9.6 , 1.9 hz , 1h ) , 2.882.75 ( m , 1h ) , 1.21 ( dd , j = 6.8 , 2.0 hz , 3h ) , 0.85 ( dd , j = 6.9 , 1.9 hz , 3h ) ; c nmr ( 151 mhz , cdcl3 ) 170.7 , 140.7 , 136.6 , 134.5 , 129.6 , 129.2 , 128.8 , 128.7 , 125.9 , 64.5 , 60.1 , 45.5 , 31.2 , 20.8 , 19.5 ; ir ( thin film ) 1693 ( c = o ) , 1145 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c19h21no3sna 366.1140 , found 366.1147 . general procedure a was used with sulfone anhydride 3a ( 0.30 g , 1.26 mmol ) , allylamine ( 93 l , 1.24 mmol ) , and benzaldehyde ( 128 l , 1.26 mmol ) to yield 10j ( 0.33 g , 78% ) as a foam ( 50:50 etoac / hex , rf = 0.42 ) . h nmr ( 600 mhz , cdcl3 ) 7.88 ( dt , j = 8.5 , 2.0 hz , 2h ) , 7.777.67 ( m , 1h ) , 7.59 ( m , 2h ) , 7.437.27 ( m , 3h ) , 6.99 ( m , 2h ) , 5.55 ( dddd , j = 17.6 , 10.0 , 7.8 , 4.3 hz , 1h ) , 5.235.15 ( m , 1h ) , 5.145.02 ( m , 2h ) , 4.40 ( ddt , j = 15.4 , 3.9 , 1.9 hz , 1h ) , 3.753.65 ( m , 1h ) , 2.95 ( m , 3h ) ; c nmr ( 151 mhz , cdcl3 ) 170.42 , 138.2 , 136.8 , 134.5 , 131.0 , 129.7 , 129.5 , 129.4 , 128.9 , 126.2 , 119.0 , 63.9 , 60.7 , 43.4 , 31.0 ; ir ( thin film ) 1691 ( c = o ) , 1145 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c19h19no3sna 364.0983 , found 364.0974 . general procedure a was used with sulfone anhydride 3a ( 0.30 g , 1.2 mmol ) , propylamine ( 100 l , 1.2 mmol ) , and 4-methoxybenzaldehyde ( 151 l , 1.2 mmol ) to yield 10k ( 0.38 g , 84% ) as a foam ( 50:50 etoac / hex , rf = 0.27 ) . h nmr ( 600 mhz , cdcl3 ) 7.927.86 ( d , j = 7.8 hz , 2h ) , 7.69 ( m , 1h ) , 7.58 ( t , j = 7.8 hz , 2h ) , 6.96 ( dd , j = 9.2 , 2.5 hz , 2h ) , 6.84 ( dd , j = 9.0 , 2.5 hz , 2h ) , 5.04 ( d , j = 3.5 hz , 1h ) , 3.80 ( sharp s , 3h ) , 3.663.53 ( m , 2h ) , 2.90 ( dd , j = 18.2 ( gem ) , 4.7 hz , 1h ) , 2.852.76 ( dd , j = 18.2 ( gem ) , 10.2 hz , 1h ) , 2.52 ( m , 1h ) , 1.511.32 ( m , 2h ) , 0.880.79 ( t , j = 7.8 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 170.4 , 159.9 , 136.9 , 134.4 , 130.3 , 129.6 , 128.8 , 127.4 , 114.7 , 64.1 , 60.7 , 55.3 , 42.5 , 31.1 , 20.0 , 11.1 ; ir ( thin film ) 1687 ( c = o ) , 1354 , 1144 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h23no4sna 396.1245 , found 396.1252 . n - benzylidenebenzylamine ( 0.1 ml , 0.53 mmol ) was added to a round - bottom flask containing na2so4 ( 0.37 g , 2.6 mmol ) and thf ( 6 ml ) , and then sulfone anhydride 3a ( 0.13 g , 0.54 mmol ) was added . the reaction mixture was allowed to stir for 1.5 h , after which the na2so4 was removed by filtration and the solvent was removed in vacuo . the residue was redissolved in etoac , transferred to a separatory funnel , and washed with hcl ( 1.2 m or 10% ) and brine . the combined organic layers were dried over na2so4 , and the solvent removed in vacuo . the resulting acid was redissolved in a mixture of toluene and methanol ( 12 ml:7 ml ) and cooled to 0 c . to the cold solution , tmschn2 ( 0.53 ml , 1.1 mmol , 2 m solution in hexanes ) after 2 h the solvent was removed in vacuo , and the resulting material was purified by column chromatography ( 3060% etoac : hex ) to yield 11a ( 0.157 g , 66% over the two steps ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.47 ) . h nmr ( 600 mhz , cdcl3 ) 7.647.18 ( m , 15h ) , 5.21 ( d , j = 14.5 hz , 1h ) , 4.89 ( s , 1h ) , 3.70 ( d , j = 18.7 ( gem ) hz , 1h ) , 3.383.30 ( m , 2h ) , 3.13 ( s , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 170.0 , 164.9 , 134.9 , 134.8 , 134.8 , 134.4 , 131.1 , 129.6 , 129.5 , 129.5 , 129.0 , 128.9 , 128.9 , 128.2 , 76.2 , 63.9 , 52.7 , 44.9 , 35.0 ; ir ( thin film ) 1783 , 1784 ( c = o ) , 1124 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c25h23no5sna 472.1195 , found 472.1176 . propylamine ( 68 l , 0.83 mmol ) and 3,5-dimethoxybenzaldehyde ( 0.14 g , 0.84 mmol ) were dissolved in thf ( 8 ml ) . na2so4 ( 0.59 g , 4.2 mmol ) was added , and the mixture was allowed to stir for 1.5 h. sulfone anhydride 3a ( 0.20 g , 0.83 mmol ) was added , and the reaction was allowed to stir for an additional 1 h. the na2so4 was filtered off , and the solvent was removed in vacuo . the residue was redissolved in etoac , transferred to a separatory funnel , and washed with hcl ( 1.2 m or 10% ) and brine . the combined organic layers were dried over na2so4 , and the solvent was removed in vacuo . the resulting crude acid was dissolved in a mixture of toluene and methanol ( 13 ml:7 ml ) and cooled to 0 c . to the cold solution , tmschn2 ( 0.83 ml , 1.7 mmol , 2 m solution in hexanes ) was added dropwise over a period of 5 min , and the reaction was monitored by tlc for the disappearance of starting material . after 2 h the solvent was removed in vacuo , and the resulting material was purified by column chromatography ( 3060% etoac : hex ) to yield 11b ( 0.22 g , 57% over the two steps ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.31 ) . h nmr ( 600 mhz , cdcl3 ) 8.017.83 ( m , 2h ) , 7.817.68 ( m , 1h ) , 7.687.52 ( m , 2h ) , 6.39 ( d , j = 2.3 hz , 1h ) , 6.22 ( s , 2h ) , 5.38 ( s , 1h ) , 3.74 ( s , 6h ) , 3.663.59 ( m , 1h ) , 3.55 ( d , j = 18.4 ( gem ) hz , 1h ) , 3.26 ( m , 3h ) , 3.14 ( d , j = 18.5 ( gem ) hz , 1h ) , 2.58 ( ddd , j = 13.8 , 8.7 , 5.2 hz , 1h ) , 1.651.32 ( m , 2h ) , 0.92 ( t , j = 7.3 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.9 , 164.7 , 160.9 , 137.3 , 135.3 , 134.9 , 130.4 , 129.2 , 100.8 , 76.7 , 64.3 , 55.4 , 52.8 , 43.2 , 35.8 , 20.2 ( 2c ) , 11.3 ; ir ( thin film ) 1748 , 1702 ( c = o ) , 1144 , 1457 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c23h27no7sna 484.1406 , found 484.1404 . n - benzylidenemethylamine ( 0.1 ml , 0.81 mmol ) was added to a round - bottom flask containing na2so4 ( 0.57 g , 4.0 mmol ) and thf ( 8 ml ) , and then sulfone anhydride 3a ( 0.19 g , 0.80 mmol ) was added . the reaction mixture was allowed to stir for 1.5 h , after which the na2so4 was removed by filtration and the solvent removed in vacuo . the residue was redissolved in etoac , transferred to a separatory funnel , and washed with hcl ( 1.2 m or 10% ) and brine . the combined organic layers were dried over na2so4 , and the solvent was removed in vacuo . the crude acid was redissolved in a mixture of toluene and methanol ( 13 ml:7 ml ) and cooled to 0 c . to the cold solution , tmschn2 ( 0.81 ml , 1.6 mmol , 2 m solution in hexanes ) was added dropwise over a period of 5 min , and the reaction was monitored by tlc for the disappearance of starting material . after 2 h the solvent was removed in vacuo , and the resulting material was purified by column chromatography ( 3060% etoac : hex ) to yield 11c ( 0.20 g , 67% over the two steps ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.28 ) . h nmr ( 400 mhz , cdcl3 ) 7.88 ( dt , j = 8.6 , 2.2 hz , 2h ) , 7.727.63 ( m , 1h ) , 7.647.50 ( m , 2h ) , 7.367.23 ( m , 4h ) , 7.05 ( d , j = 7.2 hz , 2h ) , 5.31 ( s , 1h ) , 3.49 ( d , j = 18.4 ( gem ) hz , 1h ) , 3.15 ( d , j = 2.3 hz , 3h ) , 3.01 ( d , j = 18.5 ( gem ) hz , 1h ) , 2.58 ( s , 2h ) ; c nmr ( 100 mhz , cdcl3 ) 169.75 , 164.51 , 135.32 , 135.1 , 134.3 , 130.2 , 129.4 , 129.3 , 128.7 , 127.6 , 76.7 , 66.5 , 52.9 , 35.5 , 28.3 ; ir ( thin film ) 1736 , 1690 ( c = o ) , 1177 , 1360 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c19h19no5sna 396.0882 , found 396.0887 . ester 11a ( 0.104 g , 0.23 mmol ) was dissolved in anhydrous meoh ( 12 ml ) , and magnesium turnings ( 169 mg , 6.9 mmol , flame - dried under argon ) were added to the reaction mixture . the mixture was heated to 50 c for 15 min and then to 64 c for 1.5 h , cooled to rt , poured into an erlenmeyer flask containing 10% hcl ( 20 ml ) , and extracted with diethyl ether . the organic layer was dried over na2so4 , and the solvent was removed in vacuo . purification by flash chromatography ( 3050% etoac / hex ) yielded 12a as an oil ( 0.54 g , 76% ) . h nmr data for the major diastereomer ( 600 mhz , cdcl3 ) : 7.417.33 ( m , 4h ) , 7.307.23 ( m , 3h ) , 7.187.13 ( m , 1h ) , 7.057.01 ( m , 2h ) , 5.11 ( d , j = 14.7 hz , 1h ) , 4.634.56 ( d , j = 5.4 hz , 1h ) , 3.64 ( s , 3h ) , 3.48 ( d , j = 14.9 hz , 1h ) , 3.07 ( m , 1h ) , 2.942.75 ( m , 2h ) . the h nmr data are in accordance with the literature . ester 11b ( 75.4 mg , 0.163 mmol ) was dissolved in anhydrous meoh ( 12 ml ) , and magnesium turnings ( 162 mg , 6.67 mmol , flame - dried under argon ) were added to the reaction mixture . the mixture was heated to 50 c for 15 min and then to 64 c for 1.5 h , cooled to rt , poured into an erlenmeyer flask containing 10% hcl ( 30 ml ) , and extracted with diethyl ether . the organic layer was dried over na2so4 , and the solvent was removed in vacuo . purification by flash chromatography ( 3050% etoac / hex ) yielded 12b as an oil ( 0.35 g , 67% ) . h nmr ( 400 mhz , cdcl3 ) 6.42 ( t , j = 2.2 hz , 1h ) , 6.35 ( d , j = 2.3 hz , 2h ) , 4.83 ( d , j = 5.3 hz , 1h ) , 3.79 ( s , 6h ) , 3.74 ( s , 3h ) , 3.66 ( dt , j = 13.6 , 8.1 hz , 1h ) , 3.04 ( ddd , j = 9.6 , 7.0 , 5.2 hz , 1h ) , 2.84 ( dd , j = 17.2 , 9.8 hz , 1h ) , 2.76 ( d , j = 7.0 hz , 1h ) , 2.61 ( ddd , j = 13.6 , 8.3 , 5.2 hz , 1h ) , 1.541.37 ( m , 2h ) , 0.84 ( t , j = 7.4 hz , 3h ) ; c nmr ( 100 mhz , cdcl3 ) 173.1 , 172.7 , 161.5 , 142.0 , 104.5 , 100.1 , 64.2 , 55.5 , 52.6 , 45.9 , 42.5 , 33.8 , 20.2 , 11.3 ; hrms ( esi - tof ) m / z [ m + na ] calcd for c17h23no5na 344.1474 , found 344.1465 . to a 500 ml round - bottom flask were added benzenesulfinic acid sodium salt ( 5.1 g , 30.8 mmol ) , tert - butyl bromoacetate ( 3.8 ml , 25.6 mmol ) , and 170 ml of ethanol . the crude mixture was suspended in et2o ( 150 ml ) and washed with water ( 2 150 ml ) and brine ( 150 ml ) . the organic layer was dried over sodium sulfate and concentrated in vacuo to yield 8 ( 6.31 g , 96% ) as a clear oil . h nmr ( 300 mhz , cdcl3 ) 7.90 ( m , 2h ) , 7.68 ( m , 1h ) , 7.55 ( m , 2h ) , 4.03 ( s , 2h ) , 1.33 ( s , 9h ) ; c nmr ( 75 mhz , cdcl3 ) 161.2 , 138.8 , 134.1 , 129.1 , 128.5 , 83.6 , 62.0 , 27.6 . these data are in accordance with the literature . to a dry 250 ml round - bottom flask were added 8 ( 6.31 g , 24.6 mmol ) , cesium carbonate ( 400 mg , 1.23 mmol ) , tert - butyl acrylate ( 3.6 ml , 24.6 mmol ) , and 80 ml of acetonitrile . the reaction mixture was heated to 50 c overnight and then diluted with water and extracted with ethyl acetate ( 3 100 ml ) . the crude product was purified on silica gel ( 20:80 etoac / hex ) to yield 3ba ( 4.91 g , 52% ) as an amorphous solid . h nmr ( 300 mhz , cdcl3 ) 7.89 ( d , j = 7.3 hz , 2h ) , 7.68 ( m , 1h ) , 7.57 ( dd , j = 8.4 , 6.9 hz , 2h ) , 3.99 ( m , 1h ) , 2.24 ( m , 4h ) , 1.42 ( s , 9h ) , 1.35 ( s , 9h ) ; c nmr ( 75 mhz , cdcl3 ) 170.9 , 164.4 , 137.4 , 134.1 , 129.4 , 129.0 , 83.5 , 81.0 , 70.1 , 32.1 , 28.0 , 27.7 , 22.3 ; ir ( thin film ) 2979 , 1730 , 1309 , 1138 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c19h28o6sna 407.1504 , found 407.1502 . to a dry 250 ml round - bottom flask were added 8 ( 3.00 g , 11.7 mmol ) , cesium carbonate ( 382 mg , 1.17 mmol ) , tert - butyl crotonate ( 1.90 ml , 11.7 mmol ) , and 40 ml of acetonitrile . the reaction mixture was heated to reflux overnight and then diluted with water and extracted with ethyl acetate ( 3 100 ml ) . the crude product was purified on silica gel ( 20:80 etoac / hex ) to yield 3ca ( 3.75 g , 80% ) as an amorphous solid ( mixture of diastereomers ) . nmr data for one diastereomer : h nmr ( 600 mhz , cdcl3 ) 7.90 ( m , 3h ) , 7.64 ( m , 2h ) , 7.53 ( m , 3h ) , 4.10 ( d , j = 8.0 hz , 1h ) , 2.71 ( m , 2h ) , 2.43 ( m , 1h ) , 1.42 ( s , 16h , overlap with minor diastereomer ) , 1.27 ( s , 14h , overlap with minor diastereomer ) , 1.12 ( d , j = 6.7 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 170.7 , 164.4 , 138.4 , 134.0 , 129.2 , 128.9 , 83.3 , 80.8 , 73.7 , 39.9 , 29.6 , 28.1 , 27.6 , 17.1 ; ir ( thin film ) 2980 , 1729 , 1325 , 1135 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h30o6sna 421.1661 , found 421.1653 . to a dry 250 ml round - bottom flask were added 8 ( 3.00 g , 11.7 mmol ) , cesium carbonate ( 382 mg , 1.17 mmol ) , tert - butyl methacrylate ( 1.90 ml , 11.7 mmol ) , and 40 ml of acetonitrile . the reaction mixture was heated to reflux for 48 h and then diluted with water and extracted with ethyl acetate ( 3 100 ml ) . the crude product was purified on silica gel ( 20:80 etoac / hex ) to yield 3da ( 4.20 g , 90% ) as an amorphous solid ( mixture of diastereomers ) . nmr data for one diastereomer : h nmr ( 400 mhz , cdcl3 ) 7.89 ( m , 2h ) , 7.69 ( m , 1h ) , 7.58 ( m , 2h ) , 4.03 ( dd , j = 11.9 , 3.3 hz , 1h ) , 2.28 ( m , 2h ) , 1.99 ( m , 1h ) , 1.43 ( s , 9h ) , 1.37 ( s , 9h ) , 1.16 ( d , j = 6.6 hz , 3h ) ; c nmr ( 101 mhz , cdcl3 ) 174.2 , 164.7 , 137.6 , 134.3 , 129.5 , 129.2 , 83.6 , 81.1 , 69.6 , 38.2 , 30.6 , 28.2 , 27.8 , 18.4 ; ir ( thin film ) 2978 , 2936 , 1727 , 1325 , 1138 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h30o6sna 421.1661 , found 421.1662 . to a dry 250 ml flask were added 3ba ( 4.91 g , 12.7 mmol ) , ch2cl2 ( 50 ml ) , and trifluoroacetic acid ( 50 ml ) . the reaction mixture was stirred for 1 h and then concentrated in vacuo and azeotropically distilled with ch2cl2 ( 3 10 ml ) . the crude mixture was taken up in 45 ml of trifluoroacetic anhydride and stirred overnight . the reaction mixture was concentrated in vacuo and azeotroped with toluene ( 3 10 ml ) . filtering the off - white solid with diethyl ether yielded 3b ( 3.01 g , 93% ) as a white solid . mp 122.2122.8 c ; h nmr ( 600 mhz , cd3cn ) 7.97 ( m , 2h ) , 7.83 ( m , 1h ) , 7.70 ( m , 2h ) , 4.55 ( m , 1h ) , 3.06 ( m , 1h ) , 2.87 ( m , 1h ) , 2.50 ( m , 2h ) ; c nmr ( 150 mhz , cd3cn ) 165.3 , 160.7 , 137.3 , 135.0 , 129.5 , 129.0 , 63.4 , 27.1 , 17.1 ; ir ( thin film ) 3098 , 2929 , 1816 , 1746 1322 , 1152 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c11h10o5sna 277.0147 , found 277.0145 . to a dry 250 ml flask were added 3ca ( 3.73 g , 9.30 mmol ) , ch2cl2 ( 50 ml ) , and trifluoroacetic acid ( 50 ml ) . the reaction mixture was stirred for 1 h and then concentrated in vacuo and azeotropically distilled with ch2cl2 ( 3 10 ml ) . to the crude mixture was added acetic anhydride ( 33 ml ) , and the mixture was taken up in 100 ml of toluene and stirred overnight . the mixture was concentrated in vacuo and azeotroped with benzene ( 3 10 ml ) . trituration with diethyl ether afforded 3c ( 2.31 g , 92% ) as a solid ( mixture of diastereomers ) . nmr data for one diastereomer : h nmr ( 600 mhz , cd3cn ) 7.93 ( m , 2h ) , 7.84 ( m , 1h ) , 7.70 ( m , 2h ) , 4.40 ( m , 1h ) , 3.29 ( m , 1h ) , 3.03 ( m , 1h ) , 2.75 ( m , 1h ) , 1.18 ( m , 3h ) ; c nmr ( 151 mhz , cd3cn ) 164.8 , 160.4 , 135.2 , 129.6 , 129.3 , 128.9 , 69.6 , 33.9 , 24.4 , 19.4 ; ir ( thin film ) 2991 , 2957 , 1814 , 1758 , 1311 , 1146 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c12h12o5sna 291.0293 , found 291.0303 . to a dry 250 ml flask were added 3da ( 4.00 g , 10.0 mmol ) , ch2cl2 ( 50 ml ) , and trifluoroacetic acid ( 50 ml ) . the reaction mixture was stirred for 1 h and then concentrated in vacuo and azeotropically distilled with ch2cl2 ( 3 10 ml ) . to the crude mixture were added acetic anhydride ( 33 ml ) and 100 ml of toluene , and the resulting mixture was stirred overnight , concentrated in vacuo , and azeotroped with benzene ( 3 10 ml ) . trituration with diethyl ether afforded 3d ( 2.53 g , 94% ) as a solid ( mixture of diastereomers ) . nmr data for one diastereomer : h nmr ( 400 mhz , cdcl3 ) 7.90 ( m , 2h ) , 7.74 ( m , 1h ) , 7.62 ( m , 3h , overlap with minor diasteromer ) , 4.22 ( dd , j = 3.0 , 9.0 hz , 1h ) , 2.95 ( ddd , j = 2.1 , 6.1 , 15.2 hz , 1h ) , 2.762.58 ( m , 1h ) , 2.13 ( ddd , j = 6.2 , 13.2 , 15.2 hz , 1h ) , 1.44 ( s , 3h ) ; c nmr ( 100 mhz , cdcl3 ) 167.8 , 160.3 , 137.1 , 135.2 , 129.8 , 129.4 , 64.8 , 32.6 , 25.5 , 16.4 ; ir ( thin film ) 3066 , 2970 , 1803 , 1755 , 1310 , 1154 cm ; hrms ( esi - tof ) m / z [ m + h2o + na ] calcd for c12h14o6sna 309.0409 , found 309.0402 . to a dry 10 ml flask were added 2 ml of acetonitrile , triethyl orthoformate ( 0.11 ml , 0.63 mmol ) , amine ( 0.39 mmol ) , and aldehyde ( 0.39 mmol ) . anhydride 3b ( 0.39 mmol ) in 2 ml of acetonitrile was added , and the reaction mixture was stirred for 30 min at room temperature and then refluxed for 4 h. the mixture was cooled to room temperature and concentrated in vacuo . the product was purified by flash column chromatography ( conditions given for each compound ) . to a dry 10 ml flask was added 4 ml of acetonitrile , triethyl orthoformate ( 0.11 ml , 0.63 mmol ) , the prepared imine ( 0.39 mmol ) , and anhydride 3b d ( 0.39 mmol ) . the reaction mixture was stirred for 30 min at room temperature and then refluxed for 4 h. the mixture was cooled to room temperature and concentrated in vacuo . the residue was purified by flash column chromatography ( conditions given for each compound ) . general procedure c. the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.40 ) to yield 13a as a solid ( 105 mg , 80% ) . mp 152.6153.1 c ; h nmr ( 300 mhz , cdcl3 ) 7.91 ( m , 2h ) , 7.69 ( m , 1h ) , 7.59 ( m , 2h ) , 7.32 ( m , 3h ) , 7.04 ( m , 2h ) , 5.10 ( s , 1h ) , 3.36 ( ddd , j = 5.0 , 4.9 , 2.3 hz , 1h ) , 2.84 ( s , 3h ) , 2.73 ( m , 1h ) , 2.45 ( ddd , j = 17.9 ( gem ) , 6.6 , 4.6 hz , 1h ) , 2.08 ( m , 2h ) ; c nmr ( 75 mhz , cdcl3 ) 169.3 , 139.0 , 137.3 , 134.4 , 129.6 , 129.3 , 128.6 , 128.4 , 126.0 , 65.0 , 60.7 , 34.4 , 27.9 , 17.8 ; ir ( thin film ) 3057 , 2930 , 1635 , 1302 , 1142 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c18h19no3sna 352.0983 , found 352.0973 . general procedure b. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.40 ) to yield 13b as a foam ( 117 mg , 84% ) . h nmr ( 300 mhz , cdcl3 ) 7.92 ( m , 2h ) , 7.747.64 ( m , 1h ) , 7.60 ( m , 2h ) , 7.30 ( m , 3h ) , 7.15 ( m , 2h ) , 5.40 ( s , 1h ) , 4.68 ( m , 1h ) , 3.28 ( m , 1h ) , 2.78 ( m , 1h ) , 2.49 ( ddd , j = 12.3 , 11.9 , 9.8 hz , 1h ) , 1.92 ( m , 2h ) , 1.31 ( d , j = 6.8 hz , 3h ) , 0.89 ( d , j = 7.0 hz , 3h ) ; c nmr ( 75 mhz , cdcl3 ) 169.7 , 141.6 , 137.5 , 134.3 , 129.6 , 129.0 , 128.6 , 128.0 , 126.0 , 65.0 , 53.8 , 47.6 , 28.5 , 20.3 , 20.1 , 17.5 ; ir ( thin film ) 2967 , 2945 , 1641 , 1303 , 1143 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h23no3sna 380.1296 , found 380.1306 . general procedure c. the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.48 ) to yield 13c as a foam ( 130 mg , 85% ) . h nmr ( 600 mhz , cdcl3 ) 7.63 ( t , j = 7.4 hz , 1h ) , 7.39 ( m , 7h ) , 7.30 ( m , 3h ) , 7.25 ( t , j = 6.1 hz , 2h ) , 6.79 ( m , 2h ) , 5.76 ( d , j = 14.6 hz , 1h ) , 4.69 ( s , 1h ) , 3.22 ( d , j = 14.6 hz , 1h ) , 3.17 ( m , 1h ) , 3.07 ( m , 1h ) , 2.67 ( dd , j = 18.1 ( gem ) , 6.8 hz , 1h ) , 2.43 ( m , 1h ) , 2.18 ( m , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 169.0 , 138.8 , 137.0 , 136.1 , 134.0 , 129.5 , 129.4 , 129.3 , 128.6 , 128.6 , 128.5 , 127.7 , 125.9 , 63.9 , 57.2 , 47.6 , 28.3 , 16.1 ; ir ( thin film ) 3059 , 2936 , 1642 , 1307 , 1144 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c24h23no3sna 428.1296 , found 428.1303 . general procedure c. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.40 ) to yield 13d as a foam ( 103 mg , 75% ) . h nmr ( 600 mhz , cdcl3 ) 7.99 ( m , 2h ) , 7.69 ( m , 1h ) , 7.59 ( m , 2h ) , 7.30 ( m , 3h ) , 6.98 ( dd , j = 7.3 , 2.0 hz , 2h ) , 5.40 ( d , j = 2.4 hz , 1h ) , 4.95 ( dd , j = 17.5 , 2.6 hz , 1h ) , 3.38 ( td , j = 5.0 , 2.5 hz , 1h ) , 3.30 ( dd , j = 17.5 , 2.5 hz , 1h ) , 2.81 ( ddd , j = 17.7 , 10.5 , 6.9 hz , 1h ) , 2.52 ( ddd , j = 18.0 ( gem ) , 6.7 , 4.3 hz , 1h ) , 2.28 ( m , 1h ) , 2.12 ( m , 2h ) ; c nmr ( 150 mhz , cdcl3 ) 168.7 , 138.4 , 137.3 , 134.4 , 129.5 , 129.3 , 128.9 , 128.6 , 126.2 , 77.7 , 73.1 , 64.6 , 57.9 , 34.3 , 28.3 , 17.3 ; ir ( thin film ) 3303 , 3055 , 1650 , 1267 , 1148 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h19no3sna 376.0983 , found 376.0977 . general procedure c. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.40 ) to yield 13e as a foam ( 124 mg , 89% ) . h nmr ( 600 mhz , cdcl3 ) 7.92 ( m , 2h ) , 7.71 ( m , 1h ) , 7.60 ( m hz , 2h ) , 7.29 ( m , 3h ) , 6.96 ( dd , j = 7.5 , 1.9 hz , 2h ) , 5.83 ( dddd , j = 17.7 , 10.5 , 8.2 , 4.3 hz , 1h ) , 5.21 ( m , 2h ) , 5.11 ( s , 1h ) , 4.86 ( ddd , j = 15.0 , 4.3 , 2.0 hz , 1h ) , 3.31 ( td , j = 4.7 , 1.8 hz , 1h ) , 3.002.82 ( m , 2h ) , 2.54 ( ddd , j = 18.0 ( gem ) , 6.8 , 3.7 hz , 1h ) , 2.19 ( m , 2h ) ; c nmr ( 151 mhz , cdcl3 ) 169.1 , 139.1 , 137.3 , 134.4 , 132.4 , 129.5 , 129.3 , 128.7 , 128.4 , 126.0 , 118.8 , 64.4 , 57.2 , 47.9 , 28.0 , 17.1 ; ir ( thin film ) 3054 , 2988 , 1641 , 1307 , 1148 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h21no3sna 378.1140 , found 378.1136 . general procedure c. the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.40 ) to yield 13f as a foam ( 110 mg , 72% ) . h nmr ( 600 mhz , cdcl3 ) 7.92 ( m , 2h ) , 7.67 ( t , j = 7.5 hz , 1h ) , 7.56 ( m , 2h ) , 7.32 ( m , 2h ) , 7.27 ( m , 3h ) , 7.19 ( m , 5h ) , 5.54 ( s , 1h ) , 3.48 ( m , 1h ) , 2.95 ( m , 1h ) , 2.66 ( dt , j = 18.1 ( gem ) , 6.2 hz , 1h ) , 2.20 ( m , 2h ) ; c nmr ( 150 mhz , cdcl3 ) 169.8 , 142.3 , 139.7 , 137.2 , 134.4 , 129.6 , 129.2 , 129.1 , 128.6 , 128.3 , 127.3 , 127.0 , 126.2 , 64.9 , 62.2 , 28.8 , 18.2 ; ir ( thin film ) 3066 , 3008 , 2946 , 1654 , 1304 , 1143 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c23h21no3sna 414.1140 , found 414.1131 . general procedure c. the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.46 ) to yield 13 g as a foam ( 126 mg , 91% ) . h nmr ( 600 mhz , cdcl3 ) 7.91 ( m , 2h ) , 7.69 ( m , 1h ) , 7.59 ( t , j = 7.8 hz , 2h ) , 7.31 ( dd , j = 8.4 , 6.6 hz , 2h ) , 7.25 ( m , 1h ) , 7.05 ( d , j = 7.4 hz , 2h ) , 5.22 ( s , 1h ) , 3.95 ( dtd , j = 13.6 , 6.8 , 3.3 hz , 1h ) , 3.32 ( td , j = 5.0 , 2.0 hz , 1h ) , 2.81 ( m , 1h ) , 2.43 ( m , 2h ) , 1.99 ( m , 2h ) , 1.61 ( m , 2h ) , 0.87 ( t , j = 7.4 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.2 , 139.7 , 137.4 , 134.3 , 129.6 , 129.2 , 128.5 , 128.3 , 126.1 , 64.7 , 57.9 , 48.0 , 28.0 , 20.3 , 17.6 , 11.3 ; ir ( thin film ) 2967 , 2929 , 2871 , 1639 , 1308 , 1147 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h23no3sna 380.1296 , found 380.1290 . general procedure b. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.50 ) to yield 13h as an orange amorphous solid ( 101 mg , 68% ) . h nmr ( 300 mhz , cdcl3 ) 7.93 ( dd , j = 7.2 , 1.6 hz , 2h ) , 7.70 ( m , 1h ) , 7.60 ( dd , j = 8.2 , 6.6 hz , 2h ) , 7.32 ( m , 5h ) , 6.37 ( dd , j = 16.0 , 1.2 hz , 1h ) , 6.07 ( dd , j = 15.8 , 6.4 hz , 1h ) , 4.94 ( dt , j = 6.6 , 1.6 hz , 1h ) , 4.66 ( m , 1h ) , 3.35 ( td , j = 6.4 , 2.0 hz , 1h ) , 2.68 ( dt , j = 17.2 , 7.0 hz , 1h ) , 2.40 ( dt , j = 17.2 , 7.1 hz , 1h ) , 2.09 ( dt , j = 14.4 , 7.2 hz , 1h ) , 1.99 ( dt , j = 14.4 , 7.2 hz , 1h ) , 1.33 ( d , j = 6.8 hz , 3h ) , 1.18 ( d , j = 6.9 hz , 3h ) ; c nmr ( 75 mhz , cdcl3 ) 169.7 , 137.6 , 135.4 , 134.2 , 132.0 , 129.8 , 129.6 , 128.8 , 128.6 , 128.4 , 126.5 , 63.5 , 51.8 , 47.3 , 29.1 , 20.7 , 20.2 , 18.78 ; ir ( thin film ) 3059 , 2975 , 1639 , 1446 , 1305 , 1145 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c22h25no3sna 406.1453 , found 406.1447 . general procedure b. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.42 ) to yield 13i as a foam ( 96 mg , 69% ) . h nmr ( 600 mhz , cdcl3 ) 7.92 ( d , j = 8.4 hz , 2h ) , 7.69 ( t , j = 7.4 hz , 1h ) , 7.60 ( t , j = 7.8 hz , 2h ) , 6.97 ( d , j = 8.6 hz , 2h ) , 6.84 ( m , 2h ) , 5.18 ( m , 1h ) , 3.93 ( m , 1h ) , 3.77 ( s , 3h ) , 3.30 ( m , 1h ) , 2.81 ( m , 1h ) , 2.45 ( m , 2h ) , 2.01 ( m , 2h ) , 1.61 ( m , 2h ) , 0.88 ( t , j = 7.5 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.2 , 159.5 , 134.2 , 131.5 , 129.5 , 128.6 , 127.3 , 114.5 , 105.0 , 64.9 , 57.5 , 55.3 , 48.0 , 28.1 , 20.3 , 17.6 , 11.3 ; ir ( thin film ) 2964 , 2920 , 1633 , 1250 , 1144 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c21h25no4sna 410.1402 , found 410.1400 . general procedure c. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.40 ) to yield 13j as a foam ( 133 mg , 87% ) . h nmr ( 600 mhz , cdcl3 ) 7.89 ( m , 2h ) , 7.69 ( m , 1h ) , 7.59 ( m , 2h ) , 7.28 ( m , 2h ) , 7.01 ( m , 2h ) , 5.21 ( s , 1h ) , 3.92 ( ddd , j = 13.6 , 9.0 , 7.4 hz , 1h ) , 3.27 ( td , j = 5.1 , 2.2 hz , 1h ) , 2.78 ( ddd , j = 17.4 , 10.1 , 6.8 hz , 1h ) , 2.41 ( m , 2h ) , 1.96 ( m , 2h ) , 1.59 ( m , 2h ) , 0.86 ( t , j = 7.4 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.2 , 138.3 , 137.2 , 134.4 , 134.2 , 129.6 , 129.4 , 128.5 , 127.5 , 64.6 , 57.5 , 48.0 , 28.1 , 20.3 , 17.9 , 11.3 ; ir ( thin film ) 2964 , 2937 , 1641 , 1306 , 1146 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c20h22clno3sna 414.0907 , found 414.0921 . general procedure c. the residue was purified by flash column chromatography ( 60:40 etoac / hex , rf = 0.42 ) to yield 13k as a foam ( 92 g , 61% ) . h nmr ( 600 mhz , cdcl3 ) 7.95 ( d , j = 8.4 hz , 2h ) , 7.70 ( t , j = 7.4 hz , 1h ) , 7.61 ( t , j = 7.9 hz , 2h ) , 7.24 ( m , 1h ) , 7.17 ( m , 2h ) , 7.05 ( d , j = 7.8 hz , 1h ) , 5.51 ( s , 1h ) , 3.97 ( m , 1h ) , 3.14 ( m , 1h ) , 2.94 ( m , 1h ) , 2.53 ( dd , j = 18.3 ( gem ) , 7.4 hz , 1h ) , 2.42 ( m , 1h ) , 2.34 ( m , 2h ) , 2.07 ( m , 1h ) , 1.98 ( m , 1h ) , 1.69 ( m , 2h ) , 1.14 ( t , j = 7.5 hz , 3h ) , 0.92 ( t , j = 7.4 hz , 3h ) ; c nmr ( 151 mhz , cdcl3 ) 168.9 , 141.1 , 137.6 , 136.1 , 134.3 , 129.63 , 129.60 , 128.63 , 128.60 , 126.5 , 126.1 , 62.5 , 54.2 , 48.2 , 27.3 , 24.3 , 20.4 , 16.3 , 15.4 , 11.5 ; ir ( thin film ) 3006 , 2966 , 1639 , 1300 , 1144 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c22h27no3sna 408.1609 , found 408.1620 . general procedure b. the residue was purified by flash column chromatography ( 80:20 etoac / hex , rf = 0.50 ) to yield 13l as a foam ( 104 mg , 64% ) . h nmr ( 600 mhz , cdcl3 ) 7.92 ( m , 2h ) , 7.69 ( t , j = 7.1 hz , 1h ) , 7.60 ( m , 2h ) , 6.32 ( s , 1h ) , 6.16 ( d , j = 2.1 hz , 2h ) , 5.14 ( d , j = 2.1 hz , 1h ) , 3.95 ( ddd , j = 13.4 , 9.6 , 6.5 hz , 1h ) , 3.72 ( s , 6h ) , 3.34 ( td , j = 4.8 , 1.9 hz , 1h ) , 2.79 ( m , 1h ) , 2.46 ( m , 2h ) , 2.03 ( m , 2h ) , 1.63 ( m , 2h ) , 0.89 ( t , j = 7.4 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.1 , 161.5 , 142.3 , 137.4 , 134.2 , 129.6 , 128.6 , 104.2 , 99.5 , 64.6 , 58.0 , 55.4 , 48.2 , 28.0 , 20.3 , 17.7 , 11.3 ; ir ( thin film ) 2962 , 2937 , 1641 , 1594 , 1306 , 1145 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c22h27no5sna 440.1508 , found 440.1517 . general procedure b. the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.35 ) to yield 13 m as a foam ( 101 mg , 75% ) . h nmr ( 600 mhz , cdcl3 ) 7.88 ( d , j = 7.2 hz , 2h ) , 7.65 ( m , 1h ) , 7.56 ( t , j = 7.7 hz , 2h ) , 7.27 ( dd , j = 1.9 , 1.0 hz , 1h ) , 6.24 ( m , 1h ) , 6.10 ( m , 1h ) , 5.16 ( d , j = 2.9 hz , 1h ) , 3.78 ( ddd , j = 13.6 , 9.6 , 6.4 hz , 1h ) , 3.59 ( td , j = 6.1 , 3.1 hz , 1h ) , 2.71 ( m , 2h ) , 2.43 ( dt , j = 17.5 , 6.6 hz , 1h ) , 2.09 ( m , 2h ) , 1.58 ( m , 1h ) , 1.49 ( m , 1h ) , 0.85 ( t , j = 7.4 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 169.4 , 151.3 , 143.0 , 137.3 , 134.2 , 129.5 , 128.5 , 110.6 , 108.4 , 61.8 , 52.9 , 47.8 , 28.5 , 20.4 , 19.0 , 11.3 ; ir ( thin film ) 2965 , 2933 , 2875 , 1647 , 1503 , 1306 , 1148 cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c18h21no4sna 370.1089 , found 370.1076 . the residue was purified by flash column chromatography ( 70:30 etoac / hex , rf = 0.35 ) to yield 14 as a solid ( 111 mg , 87% ) . mp 127.4128.1 c ; h nmr ( 600 mhz , cdcl3 ) 7.99 ( m , 2h ) , 7.74 ( m , 1h ) , 7.65 ( m , 2h ) , 7.35 ( dd , j = 8.4 , 7.1 hz , 2h ) , 7.28 ( m , 1h ) , 7.05 ( d , j = 6.8 hz , 2h ) , 5.21 ( s , 1h ) , 3.45 ( d , j = 6.9 hz , 1h ) , 2.91 ( s , 3h ) , 2.53 ( m , 1h ) , 2.45 ( dd , j = 15.7 , 5.3 hz , 1h ) , 2.11 ( dd , j = 15.8 , 11.6 hz , 1h ) , 0.91 ( d , j = 6.7 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 171.1 , 139.3 , 137.0 , 134.5 , 129.6 , 129.4 , 129.1 , 127.9 , 125.3 , 73.7 , 60.3 , 38.1 , 34.4 , 29.1 , 22.4 ; ir ( thin film ) 2912 , 1658 , 1305 , 1130 cm ; hrms ( esi - tof ) m / z the residue was purified by flash column chromatography ( 80:20 etoac / hex , rf = 0.35 ) to yield 15 as a white solid ( 169 mg , 79% ) . mp 143.7144.3 c ; h nmr ( 600 mhz , cdcl3 ) 7.70 ( d , j = 7.5 hz , 2h ) , 7.50 ( t , j = 7.4 hz , 1h ) , 7.37 ( t , j = 7.7 hz , 2h ) , 5.89 ( s , 2h ) , 5.31 ( d , j = 9.5 hz , 1h ) , 4.22 ( ddd , j = 13.4 , 9.5 , 3.6 hz , 1h ) , 3.72 ( s , 3h ) , 3.71 ( s , 6h ) , 2.48 ( m , 4h , nch3 and 1 methylene h ) , 2.40 ( m , 1h ) , 1.84 ( m , 1h ) , 1.27 ( d , j = 6.9 hz , 3h ) ; c nmr ( 150 mhz , cdcl3 ) 173.1 , 161.4 , 158.6 , 137.4 , 133.4 , 128.50 , 128.48 , 106.8 , 90.6 , 61.9 , 55.6 , 55.2 , 51.9 , 35.0 , 31.8 , 29.3 , 17.1 ; ir ( thin film ) 3006 , 2939 , 1614 , 1286 , 1134 cm ; hrms ( esi - tof ) m / z [ m + h ] calcd for c22h28no6s 434.1637 , found 434.1649 . allylamine ( 0.29 ml , 3.8 mmol ) and trans - cinammaldehyde ( 0.53 ml , 4.2 mmol ) were added to a round - bottom flask containing thf ( 38 ml ) and na2so4 ( 3.3 g , 23.0 mmol ) , and the mixture was allowed to stir for 1 h. the anhydride ( 0.92 g , 3.8 mmol ) was added , and the resulting mixture was allowed to stir for 2 h. the na2so4 was filtered off , and the solvent was evaporated in vacuo . the residue was triturated with hexanes , transferred to a fritted funnel , and washed in portions with hexanes five times ( 5 ml ) and two times with a 9:1 mixture of cold hexanes and chcl3 ( 10 ml total ) , yielding 1.2 g of an off - white solid , which was 85% pure by nmr . a portion of the resulting acid ( 0.885 g , 2.2 mmol ) was redissolved in anhydrous toluene and methanol ( 60 ml:30 ml ) , and tmschn2 ( 2.2 ml , 4.4 mmol , 2 m in hexanes ) was added at 0 c dropwise over a period of 5 min . the mixture was allowed to stir for 1.5 h and monitored by tlc for disappearance of the starting material . the solvent was removed in vacuo , and the crude mixture was purified by flash column chromatography ( etoac / hex 3060% ) , yielding 17 ( 0.85 g , 92% ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.44 ) . h nmr ( 600 mhz , cdcl3 ) 7.987.89 ( m , 2h ) , 7.817.56 ( m , 3h ) , 7.417.24 ( m , 5h ) , 6.54 ( d , j = 15.8 hz , 1h ) , 5.845.72 ( m , 2h ) , 5.345.25 ( m , 2h ) , 5.02 ( d , j = 8.4 hz , 1h ) , 4.40 ( ddt , j = 15.3 , 4.7 , 1.7 hz , 1h ) , 3.713.42 ( m , 3h ) , 3.443.27 ( m , 2h ) , 3.13 ( d , j = 18.2 ( gem ) hz , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 169.4 , 165.3 , 136.7 , 135.8 , 135.2 , 135.0 , 131.7 , 130.6 , 129.3 , 128.9 , 128.9 , 126.8 , 121.9 , 119.4 , 76.1 , 62.0 , 53.4 , 43.8 , 35.6 . ir ( thin film ) 1736 , 1715 , 1694 ( c = o ) , 1309 , 1148 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c23h23no5sna 448.1195 , found 448.1195 . ester 17 ( 0.602 g , 1.41 mmol ) was dissolved in anhydrous benzene ( 114 ml ) , which was degassed by bubbling with argon for approximately 5 min . then grubbs second - generation catalyst ( 35 mg , 3 mol % ) was added , and the mixture was heated to reflux for 9 h. the solvent was evaporated in vacuo , and the residue was redissolved in etoac ( 30 ml ) . saturated nh4cl ( 10 ml ) was added , and the mixture was allowed to stir for 30 min . the mixture was transferred to a separtory funnel , and the organic layer was washed with brine , dried over na2so4 , and then purified ( etoac / hex 3060% ) , yielding 18 ( 0.39 g , 86% ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.16 ) . h nmr ( 600 mhz , cdcl3 ) 8.027.93 ( m , 2h ) , 7.74 ( td , j = 7.4 , 1.3 hz , 1h ) , 7.61 ( t , j = 7.9 hz , 2h ) , 5.90 ( dq , j = 6.0 , 2.1 hz , 1h ) , 5.55 ( dq , j = 6.2 , 2.2 hz , 1h ) , 5.38 ( tt , j = 4.3 , 1.8 hz , 1h ) , 4.33 ( ddt , j = 15.7 , 4.2 , 2.1 hz , 1h ) , 3.783.67 ( m , 2h ) , 3.62 ( s , 3h ) , 3.00 ( d , j = 15.7 hz , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 172.8 , 165.7 , 136.9 , 134.9 , 130.6 , 130.3 , 129.3 , 129.2 , 79.0 , 70.1 , 53.3 , 50.7 , 39.5 ; ir ( thin film ) 1735 , 1716 , 1687 ( c = o ) , 1311 , 1148 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c15h15no5sna 344.0569 , found 344.0568 . alkene 18 ( 0.25 g , 0.77 mmol ) was dissolved in anhydrous meoh ( 30 ml ) , and the reaction mixture was degassed by bubbling with argon for 5 min . then pd / c ( 45 mg ) was added and h2 was bubbled into the reaction flask , and the mixture was allowed to stir for 3 h ( monitored by tlc ) . the pd / c was filtered off and washed with etoac ( 3 10 ml ) . the solvent was removed in vacuo , yielding 19 ( 0.246 g , 99% ) as an amorphous solid ( 50:50 etoac / hex , rf = 0.1 ) . h nmr ( 600 mhz , cdcl3 ) 7.987.90 ( m , 2h ) , 7.797.70 ( m , 1h ) , 7.60 ( dd , j = 8.5 , 7.3 hz , 2h ) , 4.61 ( dd , j = 9.7 , 5.9 hz , 1h ) , 3.72 ( s , 3h ) , 3.623.49 ( m , 2h ) , 3.17 ( d , j = 17.1 hz , 1h ) , 3.153.05 ( m , 1h ) , 2.071.93 ( m , 2h ) , 1.91 ( dtd , j = 12.2 , 6.0 , 3.9 hz , 1h ) , 1.25 ( dq , j = 12.6 , 9.3 hz , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 170.6 , 166.0 , 134.9 , 130.3 , 130.2 , 129.2 , 75.6 , 63.9 , 53.4 , 42.1 , 39.4 , 28.5 , 25.8 ; ir ( thin film ) 1734 , 1686 ( c = o ) , 1146 ( s = o ) cm ; hrms ( esi - tof ) m / z [ m + na ] calcd for c15h17no5sna 346.0725 , found 346.0730 . to sulfone 19 ( 0.10 g , 0.31 mmol ) dissolved in 3 ml of chcl3 was added dbu ( 70 l , 0.46 mmol ) , and the reaction mixture was stirred overnight . the mixture was concentrated in vacuo and purified by flash chromatography ( 70:30 etoac / hex , rf = 0.40 ) to yield 20 as a colorless oil ( 0.047 g , 84% ) . h nmr ( 600 mhz , cdcl3 ) 3.72 ( s , 3h ) , 3.58 ( t , j = 7.1 hz , 2h ) , 3.52 ( m , 2h ) , 2.93 ( m , 2h ) , 2.40 ( p , j = 7.4 hz , 2h ) ; c nmr ( 150 mhz , cdcl3 ) 172.8 , 164.0 , 161.6 , 98.6 , 51.0 , 41.5 , 41.2 , 26.6 , 25.6 . these data ester 18 ( 50 mg , 0.16 mmol ) was dissolved in 2 ml of chcl3 , and dbu ( 36 l , 0.24 mmol ) was added . after 90 min , the solvent evaporated in vacuo , and the crude mixture was purified by flash chromatography ( 20:80 etoac / hex , rf = 0.45 ) , yielding 21 as an oil ( 12 mg , 41% ) . h nmr ( 600 mhz , cdcl3 ) 7.04 ( d , j = 3.4 hz , 1h ) , 6.47 ( t , j = 3.5 hz , 1h ) , 6.17 ( d , j = 3.1 hz , 1h ) , 4.20 ( dd , j = 9 , 3 hz , 1h ) , 3.78 ( s , 3h ) , 3.48 ( dd , j = 19.8 ( gem ) , 3.6 hz , 1h ) , 3.19 ( dd , j = 18.6 ( gem ) , 9 hz , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 170.6 , 169.6 , 136.1 , 119.2 , 112.2 , 106.6 , 52.9 , 38.1 , 38.0 . alkene 20 ( 47 mg , 0.25 mmol ) was dissolved in 2.2 ml of methanol under an atmosphere of argon , and 10% pd / c ( 14 mg ) was added to the vial . the flask was purged with h2 gas via a balloon , and the reaction mixture was stirred under an atmosphere of h2 overnight . the reaction vessel was purged with argon , and then the mixture was filtered through celite and concentrated to yield 22 as an oil ( 45 mg , 99% ) . h nmr ( 600 mhz , cdcl3 ) 4.09 ( ddd , j = 9.7 , 9.1 , 3.8 hz , 1h ) , 3.69 ( s , 3h ) , 3.57 ( q , j = 9.3 hz , 1h ) , 3.38 ( td , j = 8.5 , 4.8 hz , 1h ) , 3.03 ( t , j = 11.7 hz , 1h ) , 2.78 ( d , j = 8.9 hz , 2h ) , 2.05 ( q , j = 9.5 hz , 1h ) , 1.95 ( m , 1h ) , 1.82 ( m , 1h ) , 1.24 ( m , 1h ) ; c nmr ( 150 mhz , cdcl3 ) 174.0 , 172.2 , 62.7 , 51.9 , 41.8 , 39.9 , 36.0 , 27.4 , 26.0 . these data

sulfone - substituted - and -lactams have been prepared in a single step with high diastereoselectivity . sulfonylglutaric anhydrides produce intermediates that readily decarboxylate to provide -lactams with high diastereoselectivity . substituents at the 3- or 4-position of the glutaric anhydride induce high levels of stereocontrol . sulfonylsuccinic anhydrides produce intermediate carboxylic acids that can be trapped as methyl esters or allowed to decarboxylate under mild conditions . this method has been applied to a short synthesis of the pyrrolizidine alkaloid ( )-isoretronecanol .

Introduction Results and Discussion Conclusion Experimental Section

almost 40%60% of patients with colorectal cancer ( crc ) develop metastasis , predominantly in the liver . tumor angiogenesis has been implicated as a major factor in the development and spread of these metastases . the recent discovery of vascular endothelial growth factor - c ( vegf - c ) and vegf receptor-3 ( vegfr-3 ) involvement in lymphatic vessel development and specific lymphatic markers has provided new insights into the field of lymphangiogenesis . using these markers , studies have suggested that lymphangiogenesis plays an active role in the formation and spread of colorectal liver metastases ( clm ) [ 4 , 5 ] . the patterns of intratumoral lymphatics may have potential clinical significance as a predictive marker of disease recurrence and patient survival . in this study , we investigated the patterns of tumor lymphangiogenesis using monoclonal d2 - 40 and lyve-1 antibody , as a predictive marker for disease - free survival in patients with clm . blood vessels were examined using cd34 antibody to differentiate the blood vessels from the lymphatic vessels . tissue was obtained from the victorian cancer biobank for 49 patients who underwent hepatic resection for clm . informed consent had been obtained from these patients at the time of surgery for long - term storage of specimen samples and subsequent research according to well - established protocols . formal ethics approval was obtained from the human research ethics committee ( hrec ) of the austin hospital for the study ( hrec submission number : h2012/04618 ) . the tumor mass was divided into four regions for each parameter measured ; tumor periphery , tumor centre , liver immediately adjacent to tumor , and host liver distal to tumor . previously , we demonstrated that , following the treatment with a novel vascular destructive agent ( vda ) , oxi4503 , the bulk of the tumor died leaving a viable rim of tumor cells at the periphery extending one hundred microns from the tumor - host interface towards the tumor centre . based on findings from our previous study , the tumor periphery is defined as the area covering the tumor - host interface and extending one hundred microns towards the tumor centre . the tumor centre is the remaining bulk of the tumor without considering the periphery . the liver immediately adjacent to the tumor is defined as the area at the tumor - host interface and extending one hundred microns away from the tumor . the host liver distal to the tumor is host liver which is farther than one hundred microns from the tumor . tissue samples from the specimen were fixed in 10% buffered formalin , embedded in paraffin , and cut into four m thick sections . d2 - 40 is a new selective monoclonal antibody for lymphatic endothelium which does not cross react with blood vessel endothelium . for d2 - 40 and lyve-1 staining , heat antigen retrieval was performed using tris buffer ( 50 mm ) ph 9.5 for 15 minutes at 99c . the sections were immunostained with mouse monoclonal antibody d2 - 40 used at 0.03475 mg / ml ( d2 - 40 , dako , victoria , australia ) and lyve-1 used at 0.0067 mg / ml ( abcam , cambridge , usa ) . cd34 is an established endothelial vessel marker normally expressed on tumor vessels and host vessels undergoing neovasculature . for cd34 , no antigen retrieval was required . normal goat serum ( 20% ) cd34 was used at 0.005 mg / ml ( abcam , cambridge , usa ) . a polymer - based detection kit containing goat anti - mouse immunoglobulins ( igg ) coupled with horseradish peroxidase ( hrp ) ( envision plus , dakocytomation pty , ltd , botany , nsw , australia ) was used . images of positively stained vessels were captured using a digital light microscope ( nikon coolscope , nikon corporation , japan ) between 10x and 400x magnification . the images of tumor fields were captured to be representative of the entire tumor , using a raster pattern which allowed for captured fields to be random and avoid overlap . the images were analyzed using image - pro plus ( version 5 , media cybernetics , perth australia ) . vessels were assessed as the number of positively stained vessels per tumor area to provide a microvascular density index . the lymphatic vessel density ( lvd ) assessments were performed by researchers blinded to the patient outcome data . pairwise comparisons of group means for parametric data were performed using analysis of variance ( anova ) with post hoc analysis as appropriate . nonparametric data were performed using mann - whitney u or kruskal - wallis tests , as appropriate . disease - free survival was calculated from the date of surgery to the date of progression or the date of last follow up . overall survival was not used in this study as a result of a relatively small number of deaths ( 7/49 ) within the follow up period . receiver operating characteristic ( roc ) analysis was conducted to assess the discriminative performance and the predictive capability of lvd in each region ( tumor periphery , tumor centre , and adjacent liver ) with tumor recurrence as the end point . an area under the curve ( auc ) of 1 represents a perfect test ; an area of 0.5 represents a worthless test . cut - off points that maximized sensitivity and specificity were established by analyzing roc curve coordinate points . using optimal cut - off thresholds determined from roc analysis , kaplan - meier survival curves were generated to compare survival between groups of high and low lvd in the three regions . all statistical analyses were performed using spss ( statistics package for social sciences , spss , chicago , il ) . median follow - up time for all patients was 27 months ( range 495 months ) . all patients had been assessed by a multidisciplinary team consisting of radiologists , hpb surgeons , oncologists , and nuclear physicians prior to commencement of treatment . standard indications for liver resection of clm were followed after excluding extrahepatic metastases by multidetector computed tomography ( mdct ) of chest and triple phase mdct of abdomen and pelvis in addition to whole body positron emission tomography with fluorodeoxyglucose integrated with computed tomography ( fdg pet / ct ) scans . patients received a combination chemotherapy regimen including oxaliplatin ( folfox or capecitabine / oxaliplatin ) or irinotecan ( folfiri ) based regimen . cd34 appears to only stain blood vessel endothelial cells , leaving lymphatic endothelial cells negative . serial immunohistochemistry staining using cd34 and d2 - 40 antibodies demonstrates the specificity of the markers . no overlapping of vessels was observed between cd34 and d2 - 40 ( figure 1 ) . quantification of d2 - 40 staining ( figure 2 ) revealed greater density at the tumor periphery compared to the tumor centre ( 49.22 24.3 positive lvd / mm versus 22.1 11.5 positive lvd / mm , p < 0.001 ) , adjacent liver ( 49.22 24.3 positive lvd / mm versus 4.3 4.9 positive lvd / mm , p < 0.001 ) , normal liver ( distal to the tumor ) ( 49.22 24.3 positive lvd / mm versus 6.7 3.1 positive lvd / mm , p < 0.001 ) , and benign liver ( 49.22 24.3 positive lvd / mm versus 8.7 6.2 positive lvd / mm , p < 0.001 ) . lyve-1 was found to be expressed in the liver sinusoids but absent from the tumor ( figure 3 ) . the roc curve in figures 4(a ) , 5(a ) and 6(a ) shows the ability of lvd in the tumor periphery , centre , and adjacent liver to be used as a prognostic marker to predict the likelihood of disease recurrence following hepatic resection . the roc graph shows a statistically significant ability of peripheral ( p < 0.01 ) , central ( p < 0.05 ) , and adjacent liver ( p = 0.01 ) lvd to predict disease recurrence . peripheral lvd was the most discriminative , with an area under the curve ( auc ) of 0.713 , followed by lvd in the adjacent liver with an auc equal to 0.708 and central lvd with an auc equal to 0.692 . according to the optimal cut - off values provided by roc analysis , patients were categorized into two groups : low lvd and high lvd in different regions . low d2 - 40 stained lvd in the tumor periphery ( p < 0.01 ) , centre ( p = 0.01 ) , and liver adjacent to the tumor ( p = 0.018 ) ( figures 4(b ) , 5(b ) and 6(b ) , resp . ) correlated significantly with disease - free survival . table 2 shows that patients , with high lvd in the periphery , centre , and liver adjacent to the tumor , appear to demonstrate close correlation to disease recurrence within the first and second year ( p < 0.05 ) after resection . however , only patients with high lvd in the tumor periphery significantly correlated with disease - free survival within the third year ( p = 0.009 ) after resection . in cox multivariate analysis , taking into consideration the other variables including sex , age , total tumor volume ( ttv ) , largest tumor volume ( ltv ) , and number of lesions , only high lvd in the normal liver adjacent to the tumor showed significant correlation ( p = 0.046 ) to disease recurrence following resection ( table 3 ) . the potential role of lymphangiogenesis in the process of tumor metastasis has been largely overshadowed by the role of angiogenesis . for decades , angiogenesis , the formation of new blood vessels , has been the main focus of research in the pathogenesis of tumor metastases . over the decades , much knowledge has accumulated linking angiogenesis as an essential step in tumor growth and development . it has been reported that , in the absence of active angiogenesis , the growing tumor may undergo necrosis and apoptosis beyond 1 - 2 mm in diameter due to limitation imposed by diffusion . several studies have focused on the microvessel density ( mvd ) as a prognostic tool ; hasan et al . observed elevated levels of mvd in crc to be associated with poor prognosis . our study is in concordance with those findings and demonstrates significant differences in mvd between different regions of the tumor and adjacent liver . this highlights the spatial differences within the tumor microenvironment and the heterogeneity of the tumor . in contrast to the extensive characterization of molecular mechanisms involved in angiogenesis , research into the role and mechanisms of lymphangiogenesis in cancer has been hampered by singular lack of specific markers . however , recent discovery of lymphangiogenic factor , vascular endothelial growth factor - c ( vegf - c ) , and specific lymphatic markers ( lyve-1 and d2 - 40 ) now allow researchers to identify and focus on the role of lymphangiogenesis in tumor metastases and to determine whether they have prognostic implications . the recent introduction of lyve-1 and d2 - 40 has paved the way for exciting research into the field of lymphangiogenesis : its mechanisms and the possible role these vessels play in the spread and dissemination of tumor cells [ 7 , 13 ] . despite the recent focus on lymphangiogenesis research , literature on the role of lymphatic vessels in tumor metastasis early studies reported the absence of lymphangiogenesis within the tumor , initially believed to be due to the high interstitial pressure created by rapidly proliferating tumor cells . due to the absence of intratumoral lymphatic vessels , it was suggested that lymphatic vessels at the periphery were responsible for the spread of tumors . however , more recent studies have reported the presence of intratumoral lymphatics in several different cancers such as breast cancer and colon cancer . dadras et al . investigated the possibility of using lvd as a marker for prognosis ; the study reported high intratumoral lvd in metastatic lesions compared to primary lesions significantly correlated with poor disease - free survival in cutaneous melanoma . in agreement , saad et al . also reported the presence of intratumoral lymphatics in 46% of cases with stage 1 endocervical adenocarcinoma ; however , they observed small and flattened vessels within the tumor , in contrast to the wide open lymphatic vessels found in the tumor periphery , casting a doubt of functionality of intratumoral lymphatic vessels . in contrast to dadras ' findings , saad et al . showed a significant correlation with peritumoral d2 - 40 lvd and depth of invasion . due to many conflicting results and the absence of a general consensus on the prognostic value of lvd , different types of cancers need to be investigated separately to identify the prognostic value of lymphangiogenesis . few studies have investigated lvd as a prognostic marker in clm and the results have been contradictory [ 1921 ] . despite recent progress in this field , the potential use of lvd as a prognostic marker in clm remains unclear . investigating the expression of vegf - c , a marker associated with lymphangiogenesis , matsumoto et al . reported that vegf - c overexpression significantly correlated with tumor invasion , lymphatic invasion , and lymph node metastases . in contrast , using lyve-1 as a marker for lymphatic vessels , brundler et al . observed no significant correlation between lvd and clinical outcome and concluded that lvd had no prognostic value in esophageal adenocarcinoma . one possible explanation for the results reported by brundler et al . maybe due to the antibody used to identify lymphatic vessels . lyve-1 does not appear to be a sensitive and reliable marker for lymphatic vessels in all solid tumors . in agreement with previous studies lyve-1 stained liver sinusoidal endothelial cells and was not able to identify lymphatic vessels in the tumor . lyve-1 is a known hyaluronan ( ha ) receptor found on lymphatic endothelial cells ; however , the liver sinusoidal endothelial cells play a major role in ha catabolism and as a result also display ha receptors . in addition , ichida et al . reported elevated ha levels associated with liver injury including cirrhosis and hepatocellular carcinoma ( hcc ) . it is believed that reduced expression of the scavenging lyve-1 ha receptors during liver injury and hcc leads to increased ha serum levels . indeed , in contrast to brundler et al . , saad et al . reported a significant correlation between lvd and lymph node metastasis and lymphovascular invasion and tumor stage in esophageal adenocarcinoma using d2 - 40 as a marker for lymphatic vessels . due to these few and conflicting results , clear consensus on the potential use of lvd as a prognostic marker remains to be elucidated . using d2 - 40 as a specific marker for lymphatic vessels , our data demonstrated that lvd in the tumor periphery and centre and adjacent liver significantly correlated with disease - free survival . lvd in the tumor periphery and centre and adjacent liver correlated with recurrence within the first two years following resection , while lvd in the tumor periphery continued to correlate with disease recurrence three years after resection . however , in the multivariate analysis , only the lvd in the adjacent liver was significantly correlated with disease - free survival . the contradictory results regarding the prognostic significance of lvd in tumor metastases may be due to different patient cohorts , specific tumors included in the analysis , or the method / markers used to detect lymphatic vessels . one of the limitations of this study is that samples were obtained only from a single tumor from each patient . this , therefore , may not necessarily reflect the lvd in other tumors in the same patient and , hence , be a confounding factor . this study has demonstrated that d2 - 40 is effective in identifying lymphatic vessels in human clm . the monoclonal antibody strongly labeled lymphatic vessels without staining blood vessels as observed in the serial staining of d2 - 40 and cd34 . d2 - 40 was , therefore , found to be an appropriate and selective marker for lymphatic vessels in clm . our results further demonstrate the potential predictive value of lvd detected by d2 - 40 , as a prognostic marker clm . despite the limitations imposed by the retrospective nature of the study , relatively short follow - up period , and sampling of single lesions from each patient , the results have established a foundation for investigating what appears to be a potentially significant predictive factor in the long - term survival of patients with clm . determining the lymphatic development within tumors may further play a significant role in the selective use of biological agents with the ability to target lymphatics being currently under development .

background . colorectal cancer ( crc ) is the most common form of cancer diagnosed in australia across both genders . approximately , 40%60% of patients with crc develop metastasis , the liver being the most common site . almost 70% of crc mortality can be attributed to the development of liver metastasis . this study examines the pattern and density of lymphatics in colorectal liver metastases ( clm ) as predictors of survival following hepatic resection for clm . methods . patient tissue samples were obtained from the victorian cancer biobank . immunohistochemistry was used to examine the spatial differences in blood and lymphatic vessel densities between different regions within the tumor ( clm ) and surrounding host tissue . lymphatic vessel density ( lvd ) was assessed as a potential prognostic marker . results . patients with low lymphatic vessel density in the tumor centre , tumor periphery , and adjacent normal liver demonstrated a significant disease - free survival advantage compared to patients with high lymphatic vessel density ( p = 0.01 , p > 0.01 , and p = 0.05 , resp . ) . lymphatic vessel density in the tumor centre and periphery and adjacent normal liver was an accurate predictive marker of disease - free survival ( p = 0.05 ) . conclusion . lymphatic vessel density in clm appears to be an accurate predictor of recurrence and disease - free survival .

1. Introduction 2. Patients and Methods 3. Results 4. Discussion 5. Conclusion

carotid blow - out syndrome is the most feared complication in head and neck surgery . the syndrome occurs in 3% to 4% of all head and neck cancer patients and is easy to happen following fistula formation , bad wound healing and tumor recurrence . carotid blow - out syndrome presents an average of 2.7 years after the initial diagnosis of cancer , usually occurs proximal to the carotid bifurcation , and is bilateral in 2% of cases . carotid blow - out syndrome occurred in a patient undergoing reoperation for recurrent thyroid cancer , and was repaired using the remaining carotid sheath , sterno - thyroid muscle , sterno - hyoid muscle and the harvested external jugular vein . local recurrence occurred on both sides 5 years and 6 months later , and the re - operation was done by an otolaryngologist ( fig . 1 ) . the sterno - hyoid muscle and sterno - thyroid muscle was severed and the tumor around the cricoid cartilage was removed . the tumor extended into the space between the right common carotid artery and internal jugular vein . the recurrent tumor was also located under the right common carotid artery and vagus nerve on the lateral side . enhanced cervical ct scan showed the recurred thyroid cancer in juxta - carotid regions of both sides . the tumor on the right side ( white arrowhead ) attached to the right common carotid artery ( white arrow ) . the carotid sheath of the right common carotid artery was hard and had no elasticity . the right common carotid artery had two layers , which were very fragile , so the direct suture or repair with a graft was impossible . the carotid artery could not be trapped with ligation because the cerebral vascular supply was not examined preoperatively . the carotid sheath was sutured to the carotid artery on the distal and proximal end of the lacerated portion ( fig . thereafter , the lacerated portion was covered with the remaining carotid sheath surrounding the carotid artery ( fig . fibrin glue was used to seal the space between the carotid artery and carotid sheath . however , re - bleeding occurred spontaneously at the proximal portion of the previous laceration during the dissection of the opposite side . fibrin glue with oxidized cellulose was initially used to seal the second small hole in this lesion ( fig . the ruptured section was then covered with the remaining sterno - thyroid muscle as the first layer and the sterno - hyoid muscle as the second layer ( fig . the proximal portion of the right common carotid artery was covered with the harvested external jugular vein because there were no vascularized tissues surrounding this artery ( fig . finally , the repaired right common carotid artery was widely covered with the sternomastoid muscle . blood pressure was strictly controlled after the operation , and no anti - platelet drugs were administered . the carotid sheath ( arrows ) was sutured to the right common carotid artery at the distal end of the lacerated portion ( arrowhead ) . the lacerated portion was covered with the remaining carotid sheath surrounding the right common carotid artery . re - bleeding occurred at the proximal portion ( black arrow ) of the previous laceration . fibrin glue with oxidized cellulose ( arrow head ) was initially used to seal the second small hole ( black arrow ) in this lesion . the ruptured section was then covered with the remaining sterno - thyroid muscle ( white arrow ) as the first layer . the ruptured section was then covered with the remaining sterno - hyoid muscle ( white arrow ) as the second layer . the proximal portion of right common carotid artery ( black arrow ) was covered with the harvested external jugular vein ( white arrow ) . three - dimensional ct angiography showed irregular stenosis in the right common carotid artery just after the re - operation ( fig . 3 ) . digital subtraction angiography also showed irregular stenosis in the right common carotid artery 5 days after the re - operation ( fig . however , the stenosis was found to recover on magnetic resonance angiography 11 days later . no cerebral infarction occurred after the operation and the patient s general condition was good . the pathological specimen revealed the papillary carcinoma which showed prominent invasion of the nervous system . the patient is in good condition without neurological complication , and recurrence of the tumor 22 months after the operation . the carotid sheath used for the repairment was partially pushed into the arterial cavity ( white arrow ) . thyroid cancer frequently invades the recurrent laryngeal nerve , strap muscles and trachea , and it is followed by invasion of the esophagus , internal jugular vein and carotid artery . surgical resection is the primary treatment for locally advanced thyroid cancer , and the carotid sheath invaded by a tumor must be excised with the thyroid tumor . during this procedure , carotid blow - out syndrome patients present with sentinel bleeding , but 60% of patients will develop a life - threatening hemorrhage requiring emergent intervention . the incidence is higher due to the lack of supporting healthy tissues if there is a history of radical neck dissection . other risk factors for carotid blow - out syndrome include radiotherapy , flap necrosis , mucocutaneous fistula , wound infection , and recurrent tumor invasion . injury to the vasa vasorum and necrotizing vasculitis in all three layers is an important factor in the development of radiation - induced vasculopathy of large arteries . the carotid rupture in the current case was related to the previous radical neck dissection followed by the recurrent tumor invasion . over 90% of patients with carotid blow - out syndrome are treated with endovascular therapy ( embolization 56% , stenting 36% ) , and surgical ligation ( 7% ) is rarely indicated . carotid artery embolization has a 15% to 20% neurologic morbidity rate and a lower incidence of associated mortality . endovascular embolization can also help predict cerebrovascular complications with temporary balloon occlusion and collateral cerebral blood flow analysis . stent - grafts may be useful in the treatment of carotid blow - out syndrome and show a high procedural success rate in selected cases . however , stent placement has a higher risk of recurrent carotid blow - out syndrome ( 44% ) than embolization therapy ( 10% ) . other studies of carotid blow - out syndrome treated with surgical ligation report an average mortality rate of 40% and an average morbidity rate of 60% . although trapping with ligation was considered in the current case , trapping of the right common carotid artery was not done , because the cerebral vascular supply was not assessed preoperatively . instead fibrin glue was used to seal the space between the carotid artery and the surrounding covering flap . we thought that it was important to seal the ruptured portion in multiple layers using vital , vascularized tissue . thus , the reconstruction was reinforced by covering the common carotid artery with the harvested external jugular vein and sternocleidomastoid muscle . this surgical technique was an emergency measure following the sudden rupture of the common carotid artery . given the large diameter of the common carotid artery , obstruction could be avoided even after the thrombus was formed around the repaired sites . this procedure can be one option when an unexpected rupture of the carotid artery occurs .

abstractthe patient had thyroid cancer and underwent subtotal thyroidectomy . local recurrence occurred on both sides 5 years and 6 months later . the sterno - hyoid muscle and sterno - thyroid muscle were severed and the tumor around the cricoid cartilage was removed . the tumor extended into the space between the right common carotid artery and internal jugular vein and was located under the right common carotid artery and vagus nerve on the lateral side . the carotid sheath was peeled off of the carotid artery quite easily . the right common carotid artery ruptured abruptly at the distal side during this procedure.the right common carotid artery had two layers , which were very fragile , so the direct suture or repair with a graft was impossible . the carotid artery could not be trapped with ligation because the cerebral vascular supply was not examined preoperatively . this portion was repaired using the remaining carotid sheath . however , re - bleeding occurred at the proximal portion of the previous laceration spontaneously . fibrin glue with oxidized cellulose was initially used to seal the second small hole in this lesion . the second ruptured section was repaired using the remaining sterno - thyroid and sterno - hyoid muscles . the proximal portion of the right common carotid artery was reinforced with the harvested external jugular vein.these procedures resulted in hemostasis . three - dimensional ct angiography showed irregular stenosis just after the operation , but it recovered 11 days later . no cerebral infarction occurred after the operation and the patient s general condition was good .

INTRODUCTION CASE REPORT DISCUSSION

errors in the health care system are due to a diverse interaction of human behavior , socio - cultural aspects , technical aspects of the system , as well as a range of system weaknesses . various categories of errors present as an overlap between human and system causes . when working conditions lead to circumstances in which it is easy to commit an error , this is known as a latent error or system failure. lack of experienced staff on duty , leading to staff fatigue and poor administration verdicts for example , may lead to latent errors or system failure . this , in turn , can lead to violation - producing conditions , where an individual has little choice but to violate protocol . this includes knowledge - based errors , rule - based errors , skill - based errors , technical errors and violations . tackling only the active failures will lead to an accretion of latent conditions , and an inevitable error will ultimately occur , completing the cascade and resulting in a tragic outcome . a holistic approach to incident reporting would allow for the possibility that an error or adverse event suffered by a patient in one part of the world would be a transmitted source of learning that benefits future patients in many other countries . learning from both adverse events and near misses is essential for improving the quality of care however one of the greatest frustrations for patients and professionals alike is the apparent failure of the health care systems to learn from their mistakes . commonly , neither health care professionals nor health care organizations counsel others when a mishap occurs , nor do they share what they have learned when an investigation has been carried out . consequently , the same mistakes occur repeatedly in many settings and patients continue to be harmed by preventable errors . health - care organizations and individuals benefit from incident reporting if they receive back useful information , gained by analysis of similar cases at other institutions . if the event and the results of the analysis are not reported to an external authority , the lessons learned are trapped within the walls of that hospital . the opportunity to analyze the problem although the importance of incident reporting has been established , under - reporting remains a significant problem occurring for example , at a rate of 50%96% annually in the united states . one solution to this dilemma is reporting by the primary care providers within the hospital or health - care organization , and by the organization to a broader audience through a system - wide , regional , or national reporting system . researchers in the field of quality in health care believe that an effective reporting system is the foundation of safe practice and , within a hospital or other health - care organization , a corner stone towards achieving a culture of safety . at a minimum , reporting can help identify hazards and risks , and provide information as to where the system is breaking down . this can help target improvement efforts and systems changes to reduce the likelihood of injury to future patients . extensive work has been done in the west regarding the role of incident reporting systems in preventing harm to patients thus improving the quality and safety of health care . a report prepared for the department of health in the uk indicated that an adverse event was associated with 10% of hospital admissions . with over 850,000 events per year , costing more than 2 billion per year in direct health care costs . in one year , errors involving medical devices led to death or serious injury in 400 people . the cost of hospital - acquired infection was over 1 billion in direct health care costs alone , of which 15% were considered to be preventable . clinical negligence claims currently amount to 400 million annually , with an estimated potential liability of 2.4 billion in existing and expected claims . in the united states , analysis of the harvard medical practice study of 1984 medical records and the colorado / utah study of 1992 records showed adverse events to have been associated with 3.7% and 2.9% of admissions , 13.6% and 8.8% deaths respectively . peer review indicated that 55% of these events were preventable , and almost 28% were due to negligence . medication errors , technical errors , diagnostic errors and failure to prevent injury were the most common type of incidences reported . this report estimated that the total cost of preventable adverse events is between $ 17 billion and $ 29 billion , with direct health care costs accounting for over half . adverse events were associated with 16.6% of hospital admissions ( with approximately half leading to the admission , and half occurring during the admission ) , 4.9% mortality and permanent disability in 13.7% . of all adverse events , the preventable cost of adverse events may be as much as $ 2 billion annually , or 5% of the $ 40 billion spent each year on health care . in addition , costs arising from legal expenses and compensation for medical error currently total $ 400 million per year , which consumes a further 1% of the health budget . since the publication of the us institute of medicine report to err is human , and the uk department of health report an organization with a memory , there has been increasing recognition of the need for healthcare organizations to monitor and learn from patient safety incidents . over the last few years , several countries have established national or system - wide reporting systems to facilitate large scale monitoring and analysis of incident data[1517 ] . the national reporting and learning system ( nrls ) for england and in wales , established by the national patient safety agency , was rolled out in late 2003 and has now received over one million reports , mainly from acute hospitals . limited framework for incident reporting system exists in most of the health care system in pakistan and therefore poses risk to the patients and results in compromised quality of care . development of a nationwide incident reporting system is inevitable in pakistan . recognizing the attitudes and perceptions of health professionals who will implement this system is mandatory for its success . this study aims assess the attitudes and perceptions of doctors and nurses towards incident / error reporting in tertiary level health care of pakistan and to identify potential barriers at the grass root level to the implementation of an error reporting system . to the best of our knowledge the study was conducted in shifa international hospital ( sih ) , a 600 bed tertiary care facility , employing 520 registered health professionals . fifty percent reporting of error was taken as identified factor . for 95% confidence interval and precision of 5% , the questionnaire was designed by modifying those currently used by agency of health related quality ( ahrq ) and other researchers . a small description of key terminology such as incidence , error , adverse events , near misses or close calls , and medication errors was attached to each copy of the questionnaire . the questionnaire consisted of 3 sections , which encompasses determination of : the support or lack thereof provided by the working environment to affirm incident reporting ; health care professional 's perception regarding attitudes of managers and most important barriers to incident reporting ; the motivators to incident reporting ; and patient outcomes that influence reporting behavior of health professionals . variables explored were : working environment ( supportive , culture of blame and shame ) ; attitudes of managers ( " we are informed about the errors that happen in this unit " ) ; reasons to report the incident ( to get immediate help for patient , system development so that repetition of incidents can be minimized ) ; to whom incident reporting would be easy ( administration , head of the department ) ; and perceived barriers to incident reporting ( lack of feedback , legal and financial penalties and administrative sanctions ) . mean standard deviation ( sd ) of age and working hours per week were reported . frequency ( percentage % ) were presented for gender , staff position , primary area of employment , patient 's outcome influencing reporting behavior , and individual reporting of an un - witnessed incident . chi square test was used to test the significance of association of professional groups ( doctors and nurses ) with reasons to report , to whom incident reporting would be easy , perceived barriers to incident reporting and patient outcomes that influence reporting behavior . the only exclusion criteria used in the study was medical and nursing students . the ethical approval of the study was obtained from the institutional review board ( irb ) of shifa college of medicine . written informed consent was obtained from all participants . one hundred and fourteen doctors ( 52.5% ) and 103 nurses ( 47.5% ) completed and returned the questionnaire . of these participants , 116 ( 53.5% ) were men and 101 ( 46.5% ) were women . background details of the sample ( n=217 ) considerable homogeneity is found in the incident reporting attitude among different health professionals : 100% among consultants and registrars , 94% among medical officers and 97% among nurses are ready to report the incident happened through them . house officers are reluctant to report the incident happened through them , that is , 75% responded impartially ( neither likely / unlikely ) to report the incident . ( n=217 ) only 19.3% ( n=42 ) doctors and nurses believe that tertiary health care centers have enough staff to handle the workload . this result matches up with the findings that 70% percent ( n= 151 ) health professional believe that their working hours are too long and 60.4% ( n=131 ) health professional are working more than 80 hours per week . some other characteristics of the working environment ( such as mutual respect among workers ) and attitudes of management towards patient safety ( working fast by taking shortcuts ) are depicted in table 2 . working environment and attitudes of management ( agreed ) frequency - percentage ( n=217 ) table 3 shows the main motivator for incident reporting ; to whom reporting is easy ; perceived barriers to incident reporting and patient outcome that influence the reporting behavior of doctors and nurses . a statistically significant difference ( p<0.001 , or 5.035 , 95%ci 2.52 , 10.04 ) was found between doctors ( 42% ) and nurses ( 13% ) in learning for self and others from your mistake as the main reason for incident reporting . eighty percent doctors and 84% nurses think that system development to minimize the repetition of particular incidents is the main reason for incident reporting , although this association is not significant ( or 0.727 . sixty percent doctors ( n=69 ) and 80% nurses ( n= 83 ) think that incidents should be reported to the head of the department ( or 0.37 , 95% ci 0.19 , 0.68 . eighty eight percent of doctors ( n=101 ) and 84% of nurses ( n=87 ) share a common barrier to incident reporting as lack of feedback generation while the significance of association is low ( or 1.42 , 95% ci 0.65 , 3.13 . reasons ( motivators ) to report , feasible to report to and barriers to incident reporting ( n=217 ) we presented three hypothetical situations , in which different outcomes of patients could influence the reporting behavior of health professionals . in first situation , an incident occurred but was corrected before affecting the patient . in the second , the incident happened but has no potential harm to the patient and lastly , an incident happened that can harm the patient but does not . in all three situations nurses tend to report more than doctors and the associations were statically significant ( p<0.001 ) . only 37% doctors will report the incident that could harm the patient contrary to their counterparts nurses ( 79% ) who reported significantly more in this situation ( or 0.13 , 95% ci 0.07 , 0.24 . overall results of health professional 's incident reporting behaviors in different situations are shown in table 4 . any program that aims to improve patient safety must contain all - inclusive information on incidents , near misses , adverse events or errors so that , as a source , it can be used for learning and grounds for precautionary action in the future . some systems focus on specific types of incidents / errors concerning technologies or on areas where incidents / errors occur frequently ( i.e. beeping equipment , infusion pumps , and blood transfusion ) . some systems are open ended taking into account all incidents/ errors along with the entire spectrum of quality of care provided . the rationale for any reporting system is learning . reporting can lead to learning and patient safety in several ways . first , through generating alerts regarding new hazards ( e.g. complications or adverse effects of new drugs ) . finally , report analysis can provide insight into recognizing hazard trends and system failures to aid in the establishment of best practices guidelines . our study shows that incident reporting for the purpose of learning is not well avowed by health professionals , particularly nurses . significant differences exist between doctors ( 42% ) and nurses ( 12% ) for learning as the main reason for incident reporting ( or 5.035 , 95% ci 2.52 , 10.04 . p<0.001 ) . whereas the majority of health professionals ( doctors 80% and nurses 84% ) will report an incident in order to minimize its repetition in the future . incident - reporting behavior differs between doctors and nursing professional groups , with nurses reporting significantly more often than doctors . a study in the uk indicated that health professionals are reluctant to report an incident in which there was a negative outcome for the patient . our study showed similar findings in that nurses are more willing to report than doctors . an incident which harmed the patient negatively influenced the reporting behavior of both doctors and nurses . this may be because health professionals feel insecure about their job and are afraid that they will have to face administrative fury after committing and reporting an error . this is supported by the finding in our study that 69% of doctors ( n=79 ) and 68% of nurses ( n=70 ) believe that administrative sanction is the most important barrier to incident reporting . it is vital to note that a reporting system itself does not bring about or improve patient safety . it is the action or response to the reporting that brings the change . within an organization , reporting of incidents/ adverse events should lead to an in - depth investigation to assess the etiological factors ( active or latent ) so the system can be changed and recurrence can be prevented . at a national level , report analysis by experts and dissemination of information is required to improve patient safety through incident reporting . in this study more than 88% of doctors and 84% of nurses believe that the lack of feedback generation is the most influential barrier to incident reporting . a similar study conducted in south australia ( 2006 ) also found that almost two thirds of the health professionals ( doctors and nurses ) believed lack of feedback was the greatest deterrent to reporting . a non - supportive environment , a culture of blame and shame and the culture of medicine , with its emphasis on professional autonomy , collegiality , and self - regulation , is unlikely to foster incident reporting . our study identified that only 54% of health professionals believe that their hospital environment is supportive . moreover 57.1% of health professionals perceive lack of value in incident reporting because when an event is reported , it feels like the person is written up , not the problem. some other barriers to incident reporting identified from peer reviewed literature is the lack of knowledge about how , what and whom to report . the evidence suggests that an autonomous body to collect and analyze incident reports should be established within the hospitals and that it should not work under the influence of manager / supervisors , head of the department or senior faculty members . our study shows that a significant proportion of doctors ( 60% ) and nurses ( 80% ) are in favor of reporting an incident to the head of the department , while , only 19% of doctors and 9% of nurses prefer reporting to the hospital administration . this preference may be because department heads are more accessible , offer a certain level of confidentiality and feedback may be pursued easily . our research confirms the previous finding that , in the presence of written protocols and guidelines , an incident is more likely to be reported . this finding may provide an initiative to introduce protocols and guidelines in writing , as these are less likely to be violated and violations are more likely to be reported . the willingness of health professionals to report incidents in order to improve patient safety indicates that fertile grounds are available for development of an incident reporting system in pakistan . the core and theme of any incident / error reporting system is to learn from mistakes . this fact however , is not well acknowledged by health professionals in pakistan . more work is needed to raise the awareness among health professionals pertaining to incident reporting . furthermore , any system of incident reporting that might be implemented in the future would need to consider providing : a supportive working environment ; prompt feedback ; and immunity from penalties ( administrative and financial ) .

background : a limited framework of incident reporting exists in most of the health care system in pakistan . this poses a risk to the patient population and therefore there is a need to find the causes behind the lack of such a system in healthcare settings in pakistan.aims:to determine the attitudes and perceived barriers towards incident reporting among tertiary care health professionals in pakistanmaterials and methods : the study was done in shifa international hospitals and consisted of a questionnaire given to 217 randomly selected doctors and nurses . mean sd of continuous variables and frequency ( percentage % ) of categorical variables are presented . chi square statistical analysis was used to test the significance of association among doctors and nurses with various outcome variables ( motivators to report , perceived barriers , preferred person to report and patient 's outcome that influence reporting behaviors ) . p value of < 0.05 was considered significant . student doctors and student nurses were not included in the study.results:unlike consultant , registrars , medical officers and nurses ( more than 95% are willing to report ) , only 20% of house officers will report the incident happened through them . sixty nine percent of doctors and 67% of nurses perceive administration sanction as a common barrier to incident reporting . sixty percent of doctors and 80% of nurses would prefer reporting to the head of the department.conclusions:by giving immunity from administrative sanction , providing prompt feedback and assurance that the incident reporting will be used to make changes in the system , there is considerable willingness of doctors and nurses to take time out of their busy schedules to submit reports .

Introduction Materials and Methods Results Discussion Conclusion

sulfonamides and sulfones serve both as useful intermediates in organic synthesis and as important target molecules in their own right . for example , enantioenriched secondary benzylic sulfonamides and sulfones display a range of biological activity ( e.g. , protein tyrosine phosphatase inhibitor , antisepsis agent , and -secretase inhibitor ) . however , to the best of our knowledge , there are no methods for the direct catalytic asymmetric synthesis of such sulfonamides , and just a few for such sulfones . one potential route to these compounds is the stereoconvergent coupling of a racemic -halosulfonamide / sulfone with an appropriate nucleophile ( eq 1 ) . during the past several years , we have described an array of nickel - catalyzed enantioselective cross - couplings of secondary alkyl electrophiles . whereas couplings of activated electrophiles ( a leaving group to a carbonyl , aryl , alkenyl , alkynyl , or cyano group ) proceed in good ee with a variety of nucleophiles ( alkyl- , aryl- , and alkenylmetal ) , reactions of unactivated electrophiles have been limited , with three exceptions , to alkylmetals , specifically alkyl-(9-bbn ) reagents.1 because -halosulfonyl compounds are generally poor substrates for sn2 reactions , and the sulfonyl group does not effectively stabilize an adjacent radical ( bond dissociation energy for a c h bond of dimethylsulfone : 99 kcal / mol ) , we view them as unactivated alkyl electrophiles . herein , we report the first examples of the stereoconvergent cross - coupling of unactivated alkyl electrophiles with nucleophiles other than organoboranes , as well as the first general method for their coupling with aryl- or alkenylmetal reagents ; in particular , we describe nickel / bis(oxazoline)-catalyzed cross - couplings of racemic -bromosulfonamides and -sulfones with organozinc and organozirconium reagents , thereby furnishing secondary benzylic and allylic sulfonamides and sulfones in good enantiomeric excess ( eq 2).2 upon investigating a variety of reaction parameters , we determined that a nickel / bis(oxazoline ) catalyst can achieve the cross - coupling of an -bromosulfonamide with an arylzinc reagent in very good ee and yield at 20 c ( table 1 , entry 1 ) ; nicl2glyme and bis(oxazoline ) l1 ( ( r , r ) and ( s , s ) ) are commercially available . all previous reports of stereoconvergent negishi reactions of racemic electrophiles have employed activated coupling partners . the yield was determined through gc analysis with the aid of a calibrated internal standard . essentially no cross - coupling is observed in the absence of nicl2glyme ( table 1 , entry 2 ) , and a low yield of the desired product is obtained if ligand l1 is omitted ( entry 3 ) . at room temperature , the coupling proceeds in good ee , but hydrodebromination predominates over c c bond formation . the corresponding valine - derived bis(oxazoline ) ( l2 ) is nearly as effective as phenylglycine - derived l1 ( entries 1 and 5 ) , whereas removal of the gem - dimethyl substituents on the linker between the oxazolines of l1 leads to a substantial drop in efficiency ( entry 6 ) . although pybox ligands are often the ligand of choice for nickel - catalyzed stereoconvergent negishi reactions , pybox l4 is not effective for this particular cross - coupling , nor is a 1,2-diamine ligand ( entries 7 and 8) . the use of phmgbr in place of phzni leads to a small loss in ee and a substantial loss in yield ( entry 9 ) . when the catalyst loading is reduced in half , no erosion in enantioselectivity is observed , although the yield falls by a modest amount ( entry 10 ) . the process is somewhat oxygen - sensitive ( entry 11 ; 66% conversion ) but not particularly moisture - sensitive ( entry 12 ) . under these conditions , we can achieve stereoconvergent negishi cross - couplings of a variety of racemic -bromosulfonamides with phzni to generate highly enantioenriched benzylic sulfonamides ( table 2 ) . the nitrogen of the sulfonamide can bear either an alkyl or an aryl substituent , with little impact on ee or yield ( entries 15 ) . furthermore , the r side chain can include functional groups and can be either primary ( entries 68 ) or secondary ( entry 9 ) , although in the case of the latter a diminished yield is observed . on a gram scale , the cross - coupling illustrated in entry 2 proceeds in 92% ee and 98% yield . the conditions that we developed for stereoconvergent negishi reactions of -bromosulfonamides ( table 2 ) can be applied without modification to the corresponding sulfones ( table 3 ) . thus , the r substituent can range in steric demand from methyl to t - butyl ( entries 14 ) , and it can be aromatic ( entry 5 ) . with respect to the r group , it may be linear or branched ( entries 15 ) . we have examined the scope of arylzinc nucleophiles that participate in this method for the catalytic asymmetric synthesis of benzylic sulfonamides and sulfones ( table 4 ) . electron - rich and electron - poor arylzinc reagents are suitable partners , as is a heteroarylzinc reagent , furnishing the desired product in very good ee . especially noteworthy is our observation that o - substituted phenylzinc reagents can be employed with both sulfonamide- and sulfone - based electrophiles ( entries 57 and 911 ) ; in our previous studies of nickel - catalyzed enantioselective arylations , o - substituted nucleophiles have generally been poor coupling partners . all data are the average of two experiments . amount of arzni : 2.0 equiv ; amount of catalyst : 20% nicl2glyme , 26% ( r , r)-l1 . next , we sought to expand the scope of stereoconvergent cross - couplings of -bromosulfonamides and -sulfones to include a second family of nucleophiles , specifically , alkenylmetal reagents . we determined that , whereas reactions of alkenylzinc reagents proceed in poor yield using the method described above , alkenylzirconium reagents serve as suitable nucleophiles under modified conditions ( table 5 ) . thus , an array of allylic sulfonamides and sulfones can be synthesized with good enantioselectivity in the presence of functional groups such as a thiophene and a primary alkyl chloride . we have suggested that , for at least some nickel - catalyzed cross - couplings of alkyl electrophiles , an alkyl radical may be generated during the oxidative - addition step of the catalytic cycle . in the case of electrophiles that bear an appropriately positioned pendant olefin , we have observed complete cyclization of the putative radical onto the olefin in some instances , and no cyclization in another . in order to gain insight into the mechanism of the stereoconvergent arylations described herein , we investigated the negishi reaction of an -bromosulfonamide bearing a pendant olefin ( eq 3 ) . at 70% conversion of the electrophile , we observe a 38% yield of the direct ( uncyclized ) cross - coupling product ( 8) and a 17% combined yield of cyclized cross - coupling products ( 9).3 cyclopentane derivatives cis-9 and trans-9 are each an 1:1 mixture of diastereomers ( differing in the relative stereochemistry at the deuterium - bearing carbon ) , consistent with the expectation for cyclization of radical intermediate 10 ( but not for a simple organometallic pathway involving only -migratory insertion and then reductive elimination ) . our observation that uncyclized cross - coupling product 8 has deuterium only in the trans position suggests that , when intermediate 10 does cyclize , the process is irreversible . simple 5-hexenyl radical cyclizations proceed with first - order rate constants of 10 s. although , to the best of our knowledge , the rate of cyclization of sulfonamide - substituted radical 10 has not been determined , it is very likely to be significantly slower than diffusion ( 10 s ) . our observation of cyclized , cross - coupled products ( 9 ) therefore represents evidence that a nickel - catalyzed asymmetric cross - coupling process may include a noncage radical pathway . consistent with this suggestion , the ratio of uncyclized ( d)/cyclized ( c ) product changes as the concentration of catalyst changes ( figure 1 ) . dependence of the ratio of uncyclized ( d)/cyclized ( c ) product on the concentration of nickel . we have developed methods for the enantioselective synthesis of secondary sulfonamides and sulfones , specifically , nickel - catalyzed negishi arylations and alkenylations of racemic -bromosulfonamides and -sulfones with readily available organozinc and organozirconium reagents ; with regard to stereoconvergent couplings of unactivated alkyl electrophiles , previous examples had been limited to organoboron nucleophiles and , with the exception of three isolated examples , to alkylation reactions . in terms of mechanism , a cyclization / stereochemical probe has provided evidence for a radical intermediate that has a sufficient lifetime to escape the solvent cage and cyclize irreversibly under the coupling conditions . additional studies directed at elucidating the mechanisms of cross - coupling reactions of alkyl electrophiles , as well as expanding the scope of such processes , are underway .

the development of efficient methods for the generation of enantioenriched sulfonamides and sulfones is an important objective for fields such as organic synthesis and medicinal chemistry ; however , there have been relatively few reports of direct catalytic asymmetric approaches to controlling the stereochemistry of the sulfur - bearing carbon of such targets . in this report , we describe nickel - catalyzed stereoconvergent negishi arylations and alkenylations of racemic -bromosulfonamides and -sulfones that furnish the desired cross - coupling product in very good ee and yield for an array of reaction partners . mechanistic studies are consistent with the generation of a radical intermediate that has a sufficient lifetime to diffuse out of the solvent cage and to cyclize onto a pendant olefin .

Introduction Results and Discussion Conclusions

gold nanorods ( gnrs ) are anisotropic particles whose surface plasmon modes can be tuned as a function of aspect ratio , with optical resonances ranging from visible to near - infrared wavelengths . gnrs have been investigated as contrast agents for optical biomedical imaging modalities such as optical coherence tomography and photoacoustic tomography ; they are also capable of producing linear and two - photon excited luminescence , with detection limits at the single - particle level . the large absorption cross sections of gnrs can also generate localized photothermal effects , with application toward the release of molecular cargo and hyperthermic effects on diseased cells and tissues . these attributes have sparked a global effort to develop gnrs into theranostic agents for nanomedicine . one hurdle in the scalable manufacturing of gnr - based materials is the efficient exchange and removal of cetyltrimethylammonium bromide ( ctab ) , a micellar surfactant used in the batch synthesis of gnrs . ctab is cationic and moderately cytotoxic ( although not insupportably so ) , most of which can be removed by multiple washes and exchanges with chemisorptive surfactants ( e.g. , pegylated thiols or dithiocarbamates ) , phospholipids , or other surface - active agents . however , ctab - coated gnr dispersions are frequently destabilized during surfactant exchange , resulting in partial aggregation and low recovery yields . furthermore , ligand - modified gnrs are often contaminated with residual ctab , which can induce nonspecific protein adsorption and cell uptake under physiological conditions , or produce surface charge defects in materials applications . we have previously shown that ctab - depleted gnr dispersions can be prepared when using sodium polystyrenesulfonate ( na - pss ) as a mild detergent ; nevertheless , the stability of such suspensions remains capricious in subsequent manipulations . we thus sought to develop a practical method for producing ctab - free gnr dispersions that would be universally compatible with surface conjugation protocols . in this letter we describe an efficient method for converting ctab - stabilized gnrs into citrate - stabilized gnrs ( cit - gnrs ) via intermediate treatment with pss . the surface exchange process was monitored in stages by x - ray photoelectron spectroscopy ( xps ) , an invaluable tool for quantitative elemental analysis of surface adsorbates , as well as by attenuated total reflectance infrared ( atr - ir ) spectroscopy and surface - enhanced raman scattering ( sers ) . our analyses indicate that ctab removal by pss treatment is highly efficient , as is the subsequent displacement of pss by citrate . the cit - gnrs are fully dispersible in low - salt solutions , and are easily functionalized by further ligand exchange ( discussed in a companion article ) . a six - stage protocol was developed to convert ctab - gnrs ( 68 26 nm , lpr = 713 nm ) into cit - gnrs , using standard ultrafiltration and centrifugation equipment . ctab - gnrs were prepared on a gram scale by the method described by khanal and zubarev , and diluted 4-fold to prevent premature flocculation of ctab - gnrs during the initial purification stages . in a typical process , a suspension of gnrs ( optical density ( o.d . ) = 3.2 ) stabilized in 25 mm ctab was concentrated by stirred ultrafiltration to remove excess surfactant , then diluted with deionized water ( stage 1 ; figure 1 ) . the gnrs were then subjected to three cycles of centrifugation and redispersion ( c / r ) to deplete ctab to trace levels , using 0.15 wt % na - pss ( mw = 70 kda ; stages 24 ) . we note that the residual ctab in the pss - stabilized gnr suspension after stage 4 is < 1 m based on simple dilution factors ; however , the free ctab concentration is likely even lower due to its favorable adsorption to pss . the pss - gnrs were then subjected to two additional c / r cycles using 5 mm sodium citrate ( stages 5 and 6 ) for exchange with pss , yielding stable dispersions of cit - gnrs . a complete procedure with exact volumes and concentrations is provided in the supporting information . process flow diagram for converting ctab - gnrs into cit - gnrs by ultrafiltration ( stage 1 ) with successive c / r cycles using 0.15 wt % na - pss ( stages 24 ) and 5 mm na3-cit ( stages 5 and 6 ) , with estimated surfactant concentrations after each stage . the conversion of ctab - gnrs into cit - gnrs was achieved with an overall efficiency of 7585% , based on initial and final o.d . the main source of loss is due to incomplete recovery of gnrs during the first two c / r cycles . absorption spectroscopy and transmission electron microscopy ( tem ) analysis of the citrate - stabilized gnrs indicated essentially no changes in optical resonance ( max = 710 nm ; figure 2 ) or size distribution ( figure s1 , supporting information ) . on the other hand , the exchange of pss to citrate was readily discernible by electrokinetic measurements : the zeta potential of gnrs in dilute na - pss solution ( 0.25 mg / ml , ph 5 ) was 55.6 8.3 mv , while that of cit - gnrs in dilute phosphate buffered solution ( pbs ) adjusted to ph 9.5 ( i 8.2 mm ) was less negative ( mean 26.9 13.2 mv ; mode 21.1 7.1 mv ) . the cit - gnr suspensions are stable for months at low ionic strength but aggregate if dispersed in highly saline solutions ( also see below ) , and thus behave similarly as other citrate - stabilized au nanoparticles . normalized absorption spectra of gnr dispersions after ultrafiltration ( stage 1 , red ) , c / r cycles with na - pss ( stage 3 , green ) , and c / r cycles with na3-cit ( stages 5 and 6 , blue ) . the incubation of gnrs with 70-kda na - pss ( minimum 1 h , prior to each c / r step ) is essential for producing well - dispersed cit - gnrs . previous studies in our laboratory have established that pss is useful as a detergent for removing residual ctab from gnr dispersions , below the level of observable cytotoxicity . however , na - pss by itself is not suitable as a peptizing agent : it adsorbs weakly onto gnr surfaces in the absence of ctab , resulting in metastable dispersions whose relative stability depends on polymer concentration , suggestive of depletion effects . gnrs cleansed with pss can be stabilized afterward by introducing surface - active agents that do not associate strongly with the polyelectrolyte . in this regard , polyanions with moderate binding activity such as citrate are ideal for surface exchange ; the pss is gently displaced from the gnrs while maintaining a negative zeta potential during the exchange process . nonionic , hydrophilic surfactants can also be used to displace pss from gnr surfaces , but the efficiency of exchange depends on the specific qualities of the surface - active agent . attempts to treat ctab - gnrs directly with citrate without na - pss cleansing invariably led to rapid aggregation , regardless of surfactant concentrations ( figure s2 , supporting information ) . this is not surprising , as the citrate anions neutralize the positive surface charge supported by the resident ctab layer , resulting in particle destabilization prior to complete ligand exchange . it has been reported that citrate preferentially adsorbs onto the ends of ctab - gnrs , resulting in their end - to - end aggregation . the ligand exchange process from stage 3 ( pss wash # 2 ) to stage 6 ( citrate wash # 2 ) was evaluated by xps , based on the binding energies ( b.e . ) of various atomic species ( table 1 and figure 3 ) . the xps signal corresponding to bromine ( br 3d ; 68.5 ev ) could not be detected even at stage 3 , whereas that of nitrogen ( n 1s ; 401 ev ) was reduced below the limit of detection by stage 5 , establishing the essentially complete displacement of ctab from the gnr surfaces . the xps signals for carbon ( c 1s ) , oxygen ( o 1s ) , sodium ( na 1s ) , and sulfur ( s 2p ) were also greatly reduced upon washing with 5 mm citrate ( stage 5 ) , indicating the gross displacement of na - pss from the gnr surfaces ( figure 3a ) . the s 2p signal was almost completely gone by the second citrate wash ( stage 6 ) , and below trace levels in the supernatant . high - resolution analysis of the c 1s region further revealed that citrate exchange was accompanied by a change in the population of carbon subtypes , with a reduction in hydrocarbon species ( c h / c c ; b.e . = 284.8 ev ) and an increase in the density of carboxyl groups ( c(=o)o ; b.e . = 288.2 ev ) , corresponding with the adsorption of citrate ( figure 3b ) . binding energies from survey xps spectra . at or below limit of detection . ( a ) survey xps spectra acquired from pelleted gnr samples after stage 4 ( pss wash # 3 ) and stage 5 ( citrate wash # 1 ; 5 magnification ) , indicating the disappearance of the n 1s signal . ( b ) high - resolution ( regional ) xps spectra of the c 1s region , indicating relative changes in carbon subtype after treatment with citrate . it is worth noting that the xps spectra also indicated the significant presence of silver ( ag 3d ; ca . 25% versus au 4f ) , which remained approximately constant throughout the ligand exchange process . agno3 is used as an additive in the seeded growth of gnrs , and has been postulated to contribute toward shape control by its selective deposition onto longitudinal facets . this notion has recently been brought into question by high - resolution tem imaging using energy dispersive x - ray spectroscopy , which indicated the distribution of ag over the entire gnr surface . regardless of mechanism , the intensity of the ag 3d xps signal in our study also suggests that the deposited ag is mostly localized near the gnr surface . the ligand exchange process was also characterized by atr - ir spectroscopy and sers , to identify the molecular species associated with the gnr samples ( figures s3 and s4 , supporting information ) . ir analysis of pelleted gnr samples from stages 1 , 3 , and 4 confirmed the presence ( and depletion ) of ctab and pss , with the former producing strong bands associated with sp c h stretching ( 28002900 cm ) , ch3 deformation ( 14501480 cm ) , and c n stretching ( 900950 cm ) , and the latter producing peaks associated with the so3 group ( 10201200 cm ) . pss displacement by citrate anions produced additional spectral changes , dominated by co2 stretching ( 1575 cm ) and ch2 deformation ( 1390 cm ) . sers analysis also confirmed that pss was adsorbed onto gnrs by the enhanced so3 raman signal , but was displaced after two washes with na3-cit . overall , these vibrational analyses further support the conclusions drawn from the xps data . citrate - stabilized au nanoparticles are widely appreciated for their versatility in surface modification protocols , with minimal interference by the displaced electrolyte . we conducted a preliminary survey of cit - gnrs dispersed in different aqueous solutions , to determine their relative stability during surface functionalization . dispersions of cit - gnrs are stable in 10 mm sodium citrate ( i = 60 mm ) , but slowly aggregate in standard pbs ( i 160 mm ) or 1 m nacl . however , cit - gnrs treated with nonionic surfactants such as tween-20 , chemisorptive surfactants such as thiolated polyethylene glycol , or serum proteins such as albumin all form stable dispersions in pbs . such coated gnrs have been characterized and are further described in our companion paper . the protocol described above is a mild and general approach for depleting ctab and other cationic surfactants from aqueous nanoparticle suspensions , allowing their clean exchange with citrate ions . the citrate - stabilized gnrs are compatible with surface conjugation chemistries commonly applied to metal colloids , and provide a reliable platform for making rational changes in chemical and biological properties as a function of surface modification .

stable aqueous dispersions of citrate - stabilized gold nanorods ( cit - gnrs ) have been prepared in scalable fashion by surfactant exchange from cetyltrimethylammonium bromide ( ctab)-stabilized gnrs , using polystyrenesulfonate ( pss ) as a detergent . the surfactant exchange process was monitored by infrared spectroscopy , surface - enhanced raman scattering ( sers ) , and x - ray photoelectron spectroscopy ( xps ) . the latter established the quantitative displacement of ctab ( by pss ) and of pss ( by citrate ) . the cit - gnrs are indefinitely stable at low ionic strength , and are conducive to further ligand exchange without loss of dispersion stability . the reliability of the surface exchange process supports the systematic analysis of ligand structure on the hydrodynamic size of gnrs , as described in a companion paper .

Introduction Experimental Section Results and Discussion Outlook

are commonly used on the other hand an opioid consumption is traditionally common in iran . the effects of different addictives on body systems have been reported ; however , there is not enough information about different blood parameters ( 2 ) . the effect of some psychoactive substances on commonly observed diseases like coronary artery disease , diabetes mellitus and some psychiatric disorders has been investigated , but effects of long - term use of these substances on endocrine system have not been studied enough ( 3 ) . studies have demonstrated controversial results about effects of psychoactive substances on hypothalamic - pituitary axis and thyroid function ( 4 ) . psychoactive substances have many different effects on physiologic and neuroendocrine functions in humans ( 5 ) . it has been demonstrated that endogenous opioids like -endorphin , enkephalins and opiate receptors influence neuroendocrine regulation ( 6 ) . previous studies showed that some psychoactive substances modulate immune function and affect resistance to bacterial , viral and protozoan infections ( 7 , 8) . monitorization of the psychoactive substance use can be done objectively by urine analysis . since substance concentrations in urine are higher than blood , urine is the preferred material for determination of substance use . testing schedules and determination of cut - offs are important for confirmation of the psychoactive substance use ( 9 ) . since polydrug abuse is common worldwide , determination of the effects of only one drug is difficult ( 10 ) . recent studies demonstrated controversial results about the effects of opium on serum electrolytes , lipid markers and glucose metabolism . defining the real side effects of these psychoactive substances may increase awareness about disadvantages of consumption ( 11 ) . studies about the effects of psychoactive substances on different biochemical and hematological parameters were limited in number ( 2 , 12 ) . this study was conducted to determine the effects of different psychoactive substances on serum biochemical parameters . this study was conducted on 324 patients and 69 controls admitted to erenkoy mental health and neurology training and research hospital between january 2013 and january 2014 . patients were determined according to the diagnostic and statistical manual of mental disorders , fourth edition dependent group involves subjects determined as at least one or more than one type of psychoactive substance users . in the control group urine toxicology results were negative . levels of toxicology parameters were determined using a hitachi model 902 automatic analyzer ( hitachi high - technologies corporation , roche diagnostics ) with an enzyme immunoassay ( microgenics cedia fremont , california , usa , for urine toxicology ) . after hospitalization , each patient s first urine and blood sample before treatment were taken into account for comparison . cases and controls with accompanying diseases like diabetes , cancer , metabolic disorders etc . are excluded from the study . urine samples were tested simultaneously for heroin , cannabinoids , cocain , benzodiazepins , opiates , buprenorfine , amphetamines , extacy and ethyl glucuronide . routine biochemistry parameters were measured using the architect ci 4100 ( abbott diagnostics products ) automatic biochemistry analyzer . this study was approved by the ethics committee of erenkoy mental health and neurology training and research hospital . spss ibm 20.0 software ( chicago , illinois , usa ) was used for statistical analysis . spss ibm 20.0 software ( chicago , illinois , usa ) was used for statistical analysis . a total of 324 patients ( 316 males and 8 females ) and 69 controls ( 64 males and 5 females ) were involved in this study . the median ages of psychoactive substance users and controls were 26.5 ( 23 - 34 ) and 27 ( 20.5 - 34.5 ) years , respectively ( table 1 ) . the concentration of biochemical parameters in the serum of the substance - dependent group was compared to the control group ( table 2 ) . we found a statistically significant difference in gamma - glutamyl transferase ( ggt ) , uric acid , creatinin , urea , albumin , aspartate aminotransferase ( ast ) medians between the patient and control groups ( p < 0.05 ) . abbreviations : alp , alkaline phosphatase ; alt : alanine aminotransferase ; ast : aspartate aminotransferase ; crp , c - reactive protein ; ggt , gamma - glutamyl transferase ; hdl , high density lipoprotein ; ldh , lactate dehydrogenase ; and ldl , low density lipoprotein . forty - six out of 424 addicts tested positive for only opium ( cut - off , 300 ng / ml ) . several biochemical parameters in the opium - dependent group were compared to the control group ( table 3 ) . there was a statistically significant difference in the serum concentrations of sodium and albumin between the opium - dependent and the control groups ( p < 0.05 ) . moreover , sixty - nine patients were tested positive for only cannabinoids ( cut - off , 50 ng / ml ) . biochemical parameters did not show any significant difference in the cannabinoid - dependent group compared to the control group ( p > 0.05 ) . thirteen out of all addicts were tested positive for only benzodiazepine ( cut - off > 300 ng / ml ) . there was a statistically significant difference in ggt , urea , glucose , sodium , total protein , and ast levels between the benzodiazepine - dependent group and control group ( p < 0.05 ) . also , 12 patients were tested positive for only ethyl glucuronide ( cut - off > 500 ng / ml ) . a statistically significant difference was found in triglyceride and ggt levels between the ethyl glucuronide and control groups ( p < 0.05 ) . clinical observations demonstrated that adverse effects of psychoactive substances were associated with the addiction period and route of administration . psychoactive substance users commonly have nutritional problems since they spend their money largely for drugs ( 13 ) . coexistence of psychiatric disorders in drug addicts is also important since some psychiatric disorders may cause loss of appetite and poor nutritional status and changes in biochemical parameters ( 14 ) . clinical studies showed that long - term use of opium and heroin can affect serum glucose , potassium , calcium , uric acid and cholesterol levels ( 12 ) . in our study , we found a significant difference in ggt , uric acid , creatinine , urea , albumin , and ast medians between the dependent and control groups ( p < 0.05 ) . studies about the effects of opium addiction on blood glucose showed that the opium - dependence decreased fasting blood glucose temporarily without any effect on hemoglobin a1c ( 15 ) . we found a statistically significant decrease in glucose levels only in patients tested positive for benzodiazepine ( p < 0.05 ) . some psychoactive substances may affect gluconeogenesis so that blood glucose levels may decrease , especially in cases with poor nutrition . some people believe that psychoactive substances like opium can have beneficial effects on blood lipid profile and cardiovascular disease , but clinical observations demonstrated that opium can increase risk of atherosclerotic plaque formation and adversely affect lipid profile in animal models ( 16 ) . we found a statistically significant increase in triglyceride levels in ethylglucuronide group ( p < 0.05 ) . in our study , we did not found statistically significant difference in total cholesterol , low density lipoprotein ( ldl ) , and high density lipoprotein ( hdl ) levels between dependent and control groups ( p > 0.05 ) . cardiovascular side effects of some psychoactive substances may not be attributed to changes in lipid profile . there is a need to conduct a prospective study with the larger sample size for the prevalence of the cardiovascular disease . another study , which was performed on opium addicts showed that serum adiponectin levels were decreased but no significant change was observed in serum leptin levels . it was also indicated in previous studies that a decrease in adiponectin levels can be associated with an increased risk of metabolic disorders like insulin resistance and cardiovascular disease since it has known antidiabetic and antiatherogenic effects ( 17 ) . changes in nutritional patterns may also be related with changes in albumin levels in these patients ( 18 ) . we found a statistically significant difference in albumin levels between the drug - dependant and control groups . in our study , the amount of total protein showed a significant difference only in the benzodiazepine dependent group ( p < 0.05 ) . since in our study , patients with significant derangements were referred to specialized medical centers for further assessment and excluded from the study , changes in their albumin levels may not be due to viral infections or metabolic disorders . in a previous study , it has been demonstrated that morphine consumption for long period in animal models increases uric acid and creatinine levels ( 19 ) . we found a statistically significant decrease in uric acid and creatinine levels in the dependant group compared to the control group ( p < 0.05 ) . poor living conditions and nutritional factors like low protein intake may likely to contribute to changes in biochemical parameters in psychoactive substance users . these effects on renal system include changes in urinary output and urinary sodium excretion ( 20 ) . divsalar et al . showed that a sodium level in the heroin - dependent group did not change ; however , it was significantly high in the ex - heroin dependent group compared to the control group . however , no significance difference was found in potassium and calcium levels between the ex - heroin dependent and control groups ( 14 ) . we found that the concentration of sodium in the serum of the opium - dependent and benzodiazepine dependent groups was significantly increased compared to the control group ( p < 0.05 ) . no statistically significant difference was observed in calcium levels between the dependent and control groups ( p > 0.05 ) . routine biochemistry , and hematology parameters , and vitamin , and mineral levels are affected by nutritional factors . determining the differences in biochemical parameters , vitamin and mineral levels between addicts and healthy subjects may help to define individuals at nutritional risk and provide these patients with the corrective nutritional programs ( 18 ) . in this study we tried to describe the extent of changes in various blood parameters due to psychoactive drug use . our study involves a range of psychoactive substances like heroin , cannabinoids , cocaine , benzodiazepine , opiate , buprenorphine , amphetamine , extacy , ethyl glucuronide and their potential effects on many biochemical parameters . raising awareness about potential adverse effects of psychoactive substances health problems associated with physiological side effects of these substances may increase economic burden on health care resources . therefore , in psychoactive substance users defining the real need for intensive monitoring and treatment programs are extremely important .

background : psychoactive substances affect mainly central nervous system and brain function causing changes in behavior.objectives:the purpose of this study was to determine the effects of different psychoactive substances on serum biochemical parameters.patients and methods : the study included 324 drug dependents , and 69 controls . the patient group was determined according to dsm - iv ( the diagnostic and statistical manual of mental disorders , fourth edition ) criteria . all patients and control subjects were tested for routine biochemical parameters and urine toxicology parameters for psychoactive substance use . cases and controls with accompanying diseases like diabetes , cancer , metabolic disorders etc . are excluded from the study . moreover , an association between urine toxicology results and changes in biochemical parameters was evaluated for statistical significance.results:there was a statistically significant difference in the gamma - glutamyl transferase ( ggt ) , uric acid , creatinine , urea , albumin , aspartate aminotransferase ( ast ) medians between the dependent and control groups ( p < 0.05 ) . we found a statistically significant difference in sodium and albumin levels between the opium - dependent and control groups ( p < 0.05 ) . in the benzodiazepin dependent group , we found a significant difference in ggt , urea , glucose , sodium , t protein , and ast levels ( p < 0.05 ) . moreover , a statistically significant difference was observed in triglyceride and ggt levels between the ethyl glucuronide and control groups ( p < 0.05).conclusions : in psychoactive substance dependents , serum routine biochemistry parameters can be used to predict the need for intensive monitoring and treatment programs .

1. Background 2. Objectives 3. Patients and Methods 3.1. Statistical Analysis 4. Results 5. Discussion

research interest is increasing in biomaterials with the potential to stimulate bone healing have gained interest to improve treatment outcome for patients with osteoporotic fractures . calcium phosphate cements ( cpc ) has been used in bone surgery for many years . the bio - inspired combination of the inorganic component silica and the organic component collagen has lead to a novel class of innovative biomaterials because silica and collagen turned out to be ideal partners for composite formation , resulting in advantageous synergistic effects in material properties suitable for soft - tissue or hard - tissue substitution applications . the chemical and technological flexibility of the silica / collagen system has generated a remarkably wide range of biomaterials individually adapted for a large number of biomedical applications , including soft hydrogels , macroposous scaffolds , and solid compact xerogels . in addition , metal foams open new opportunities for design of bone implants due to their mechanically stability . in cardiovascular applications , iron has been used successfully in animal implantation studies and in clinical cases . the use of pet scanning as a diagnostic tool for fracture healing is attractive because it can provide a direct quantitative assessment of metabolic activity in a region of interest . we recently showed that the fixation of fluoride in the bone matrix may be enhanced using cpc , especially cpc with strontium carbonate as biomaterial for bone replacement and defect healing in osteoporotic bone . the present study was designed to examine the efficacy of multifunctional bioabsorbable implants , including cpc - based , silica / collagen - based , and iron - based composites for the treatment of experimental osteoporotic fractures . the treatment response was assessed by f-18-sodium fluoride ( naf ) dynamic pet - ct ( dpet - ct ) . all animal procedures were carried out in accordance with the guide for care and use of laboratory animals of the national institutes of health . the animal studies were approved by the corresponding authority ( regierungsprsidium gieen , gi 20/28 nr . the study included 65 3-month - old female sprague - dawley rats ( charles rivers wiga , sulzbach , germany ) with a body weight between 250 and 400 g. after an acclimatization of 4 weeks , an osteoporotic bone status was induced by bilateral ovariectomy and a calcium- , phosphorous- , vitamin d3- , soy- , and phytoestrogen - free diet , as previously described by heiss et al . . after 3 months , the animals underwent femur surgery under general anaesthesia with xylazine ( 4 mg / kg body weight , rompun , bayer ) and ketamine ( 100 mg / kg body weight , hostaket , hoechst ) by intraperitoneal injection . the left femur was desinfected with povidone iodine ( braunol , braun , melsungen , germany ) and draped in a sterile manner . after making a 4-cm skin incision at the lateral aspect of the distal thigh , the lateral vastus muscle and the lateral head of the femoral biceps muscle were dissected in their septum intermusculare and the femur from shaft to the condyle massif was exposed . subsequently , a 7-hole t - shaped miniplate ( leibinger xs - miniplate , stryker , schnkirchen , germany ) was slightly bent and fixed to the lateral femur with 1.2-mm screws . afterwards , a wedge - shaped defect with a lateral height of 4 mm was then created at the metaphyseal area of the femur . the cutting lines were marked with a custom - made triangular sawing guide with a lateral length of 4 mm . the distal transverse osteotomy was made just above the border of the femoropatellar joint , without bruising the articular cartilage . calcium phosphate cement ( cpc ) and cpc enriched with strontium ( srcpc ) were prepared as described previously . in brief , cpc powder was composed of -tricalcium phosphate ( -ca3(po4)2 ) , calcium hydrogen phosphate ( cahpo4 ) , calcium carbonate ( caco3 ) , and hydroxyapatite ( ca10(po4)6(oh)2 ) , and was supplied by innotere gmbh ( radebeul , germany ) . srcpc powder was obtained by substitution of caco3 by srco3 ( alfa aesar ) in the cpc cement precursor powder . a mouldable paste was obtained by mixing the cement powder with na2hpo4 solution using a liquid - to - powder ratio of 500 and 350 l / g for cpc and srcpc , respectively , immediately prior to implantation . srcpc was previously shown to release significant amounts of sr upon immersion in aqueous media ( e.g. , cell culture medium ) and to positively influence both in vitro osteoblast proliferation and differentiation and in vivo bone formation ( 15 ) . composites of silica and fibrillar bovine collagen were used for implantation as monolithic xerogels ( b30 , 70 wt% silica , 30 wt% collagen ) or as porous scaffold ( sc - b30 , xerogel particles b30 , size < 250 m , embedded in a collagen matrix with xerogel / matrix weight ratio of 1.0 ) . for preparation of compact silica / collagen xerogels , bovine tropocollagen type i ( gfn , germany ) was dialysed ( nominal molecular weight cut - off 1214 kda , roth , germany ) against deionized water followed by fibrillation in 30-mm neutral sodium phosphate buffer solution , lyophilisation ( christ alpha 14 laboratory freeze - dryer , osterode , germany ) , and resuspension in 0.1 m trishcl ph 7.4 ( roth ) to obtain homogeneous 30 mg / ml suspensions . the silica component was prepared by hydrolysing tetraethoxysilane ( teos , 99% , sigma , germany ; molar ratio teos / water=1/4 ) under acidic conditions ( 0.01 m hcl ) to obtain silicic acid . vigorous stirring of calculated volumes of silicic acid and collagen suspension to obtain a final composition of 70% silica and 30% collagen ( b30 ) resulted in the formation of 800-l hydrogels . a modification of the scaffolds was prepared by using xerogel particles consisting of 50 wt% silica , 30 wt% fibrillar bovine collagen , and 20 wt% strontium carbonate ( sc - b30sr20 ) . strontium carbonate was introduced as a third phase by being previously added to the collagen suspension . b30 or b30sr20 gels were transferred to molds , stabilized , and dryed for 7 days in an espec sh-221 climate chamber ( japan ) at 37c and 95% relative humidity . the resulting xerogel samples were ground and classified according to the particle size . on the one hand , b30 xerogel particles < 0.250 mm were compacted using a custom - made pressing tool to obtain monolithic b30 xerogel samples exhibiting exactly the above - described bone defect shape . on the other hand , b30 or b30sr20 xerogel particles < 0.120 mm were added to a 30-mg / ml collagen suspension adjusting a xerogel / collagen weight ratio of 1/1 . these xerogel particle / collagen suspensions were transferred to custom - made silicon molds to again obtain the above - described bone defect shape , cooled at 0.5 k / min to 20c ( espec sh-221 climate chamber , osaka , japan ) followed by lyophilisation ( christ alpha 14 laboratory freeze - dryer , osterode , germany ) . the scaffolds were chemically cross - linked by immersing in 1 wt% n-(3-dimethylaminopropyl)-n0-ethylcarbodiimide ( edc)/n - hydroxysuccinimide ( nhs ) ( sigma ) in 40% ethanol for 24 h. finally , the scaffolds were rinsed in deionized water and freeze - dried again . according to the xerogel particle composition used , scaffold sample labels were scb30 or scb30sr20 , respectively . all xerogel or scaffold samples were gamma - sterilized at 25 kgy before used for implantation . moreover , iron foam with interconnected pores ( fe ) was applied . for preparation of strontium coating of iron foams , 153 ml of ultrapure water and 17 ml of phosphoric acid ( 85% h3po4 ) were added in a 250-ml glass bottle . the supernatant was diluted 20-fold using ultrapure water , which yielded the solution of sr(h2po4)2 . ten fe foams eroded and cleaned by ifam ( fraunhofer institute for manufacturing technology and advanced materials , dresden ) with an average weight of 170 mg were coated by suspension in 100 ml of sr(h2po4)2 solution for 4 h under vacuum . sr - coated foams were settled in fresh coating solution for another 3 days at room temperature and rinsed 3 times using absolute ethanol with subsequent drying at 40c in a drying cabinet . sr - coating resulted in an average weight gain of 37 mg or approximately 22% . in addition , the alloy element phosphor is added with fe3p - powder ( atmix , japan ) with a particle size of 3.8 m . to achieve a phosphate ratio of 0.6% the iron foam was coated with zolendronic acid ( fe - bp ) that is a member of the bisphosphonate family . . then the complex was carefully washed , dried , ground , and finally led to a coating of 35-g zolendronic acid , the basic iron foam . these 8 different formulations of bone substitution materials were implanted in the current animal model ( n=78 ) ( table 1 ) . eighteen weeks after induction of osteoporosis and 6 weeks after femoral surgery , dpet - ct with f - sodium fluoride ( naf ) scans were performed . during scanning , rats were anesthetized using a mixture of nitrous oxide ( 1 l / min ) , oxygen ( 0.5 l / min ) and isoflurane ( 1.5 vol.% ) . dpet - ct studies were performed for 60 min after the intravenous application of 20 to 40 mbq f - sodium fluoride , using a 28-frame protocol ( 10 frames of 30 s , 5 frames of 60 s , 5 frames of 120 s , and 8 frames of 300 s ) . a dedicated pet - ct system ( biograph mct , 128 s siemens co , erlangen , germany ) with an axial field of view of 21.6 cm with truev and truepoint , operated in a 3-dimensional mode , was used for all animal studies . the system provides the simultaneous acquisition of 369 transverse pet slices with a slice thickness of 0.6 mm . two rats were examined in parallel and were positioned in the axial plane of the system to maintain the optimum resolution in the center of the system . a high - resolution ct scan was performed prior the pet scanning with 160 ma , 80 kv , pitch of 0.85 cm in addition to the low - dose attenuation ct ( 80 ma , 80 kv ) for attenuation correction of the acquired dynamic emission pet data . all pet images were attenuation - corrected and an image matrix of 400400 pixels was used for iterative image reconstruction ( voxel size 1.5651.5650.6 mm ) based on the syngo mi pet / ct 2009c software version . the reconstructed images were converted to standardized uptake value ( suv ) images based on the formula ( 18 ) : suv = tissue concentration ( bq / g)/[injected dose ( bq)/body weight ( g ) ] . volumes of interest were placed over the created defect area in the femur , and rotated pet images according to the ct images . irregular regions of interest were drawn manually according to the fused pet - ct images , as mentioned before . to precisely select the region to draw the voi of the created defect , the fusion of pet images and ct scans by co - registration preprocessing was performed after rotation of each rat individually . first , we rotated the ct series to determine the optimum angle for the visualisation of the complete defect and the adjacent metal plates in the longitudinal direction . the next step was to fuse ct and pet and to use these fused images for the quantitative pet evaluation . the spatial resolution was 2 mm for pet image and 0.33 mm for ct image . the voi for the defect was placed between the 2 screws located at the left and the right side of the 4-mm created defect . for input , we used 10 contiguous pet slices in the middle and lower third of the aorta . we avoided using the upper part of the thoracic aorta due to spillover from the heart . herein , a 2-tissue compartment model was used to evaluate the dynamic studies and to gain quantitative data about the kinetics . in the current study , the learning - machine 2-tissue compartment model was used for the fitting , and provided 5 parameters : the plasma clearance to the bone extracellular fluid ( ecf ) compartment and the rate constant for return of tracer to plasma ; k1 and k2 ; the rate constants describing movement of tracer into and out of the bound bone compartment ; k3 and k4 ; and the fractional blood volume , also called vessel density ( vb ) , which reflects the amount of blood in the voi . following compartment analysis , we calculated the plasma clearance of tracer to bone mineral from the compartment data using the formula : influx ( ki)=(k1*k3)/(k2+k3 ) . compared to the standard iterative method , the machine learning method has the advantage of a fast convergence and avoidance of over - fitting . the model parameters were accepted when k1k4 was less than 1 and vb exceeded 0 . the fractal dimension is a parameter of heterogeneity and was calculated for the time - activity data of each individual volume of interest . the values for fractal dimension vary from 0 to 2 , showing the deterministic or chaotic distribution of tracer activity . we used a subdivision of 77 and a maximal suv of 20 for the calculation of fractal dimension . statistical evaluation was performed with stata / se 11.1 ( statacorp , college station , tx , usa ) using the descriptive statistics and box plots . linear discriminant analysis was performed for calculating the sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) and highest accuracy . the 2-sided wilcoxon rank sum test was applied for all pet parameters , which also included suv , using a single parameter analysis to assess groups . all animal procedures were carried out in accordance with the guide for care and use of laboratory animals of the national institutes of health . the animal studies were approved by the corresponding authority ( regierungsprsidium gieen , gi 20/28 nr . the study included 65 3-month - old female sprague - dawley rats ( charles rivers wiga , sulzbach , germany ) with a body weight between 250 and 400 g. after an acclimatization of 4 weeks , an osteoporotic bone status was induced by bilateral ovariectomy and a calcium- , phosphorous- , vitamin d3- , soy- , and phytoestrogen - free diet , as previously described by heiss et al . . after 3 months , the animals underwent femur surgery under general anaesthesia with xylazine ( 4 mg / kg body weight , rompun , bayer ) and ketamine ( 100 mg / kg body weight , hostaket , hoechst ) by intraperitoneal injection . the left femur was desinfected with povidone iodine ( braunol , braun , melsungen , germany ) and draped in a sterile manner . after making a 4-cm skin incision at the lateral aspect of the distal thigh , the lateral vastus muscle and the lateral head of the femoral biceps muscle were dissected in their septum intermusculare and the femur from shaft to the condyle massif was exposed . subsequently , a 7-hole t - shaped miniplate ( leibinger xs - miniplate , stryker , schnkirchen , germany ) was slightly bent and fixed to the lateral femur with 1.2-mm screws . afterwards , a wedge - shaped defect with a lateral height of 4 mm was then created at the metaphyseal area of the femur . the cutting lines were marked with a custom - made triangular sawing guide with a lateral length of 4 mm . the distal transverse osteotomy was made just above the border of the femoropatellar joint , without bruising the articular cartilage . calcium phosphate cement ( cpc ) and cpc enriched with strontium ( srcpc ) were prepared as described previously . in brief , cpc powder was composed of -tricalcium phosphate ( -ca3(po4)2 ) , calcium hydrogen phosphate ( cahpo4 ) , calcium carbonate ( caco3 ) , and hydroxyapatite ( ca10(po4)6(oh)2 ) , and was supplied by innotere gmbh ( radebeul , germany ) . srcpc powder was obtained by substitution of caco3 by srco3 ( alfa aesar ) in the cpc cement precursor powder . a mouldable paste was obtained by mixing the cement powder with na2hpo4 solution using a liquid - to - powder ratio of 500 and 350 l / g for cpc and srcpc , respectively , immediately prior to implantation . srcpc was previously shown to release significant amounts of sr upon immersion in aqueous media ( e.g. , cell culture medium ) and to positively influence both in vitro osteoblast proliferation and differentiation and in vivo bone formation ( 15 ) . composites of silica and fibrillar bovine collagen were used for implantation as monolithic xerogels ( b30 , 70 wt% silica , 30 wt% collagen ) or as porous scaffold ( sc - b30 , xerogel particles b30 , size < 250 m , embedded in a collagen matrix with xerogel / matrix weight ratio of 1.0 ) . for preparation of compact silica / collagen xerogels , bovine tropocollagen type i ( gfn , germany ) was dialysed ( nominal molecular weight cut - off 1214 kda , roth , germany ) against deionized water followed by fibrillation in 30-mm neutral sodium phosphate buffer solution , lyophilisation ( christ alpha 14 laboratory freeze - dryer , osterode , germany ) , and resuspension in 0.1 m trishcl ph 7.4 ( roth ) to obtain homogeneous 30 mg / ml suspensions . the silica component was prepared by hydrolysing tetraethoxysilane ( teos , 99% , sigma , germany ; molar ratio teos / water=1/4 ) under acidic conditions ( 0.01 m hcl ) to obtain silicic acid . vigorous stirring of calculated volumes of silicic acid and collagen suspension to obtain a final composition of 70% silica and 30% collagen ( b30 ) resulted in the formation of 800-l hydrogels . a modification of the scaffolds was prepared by using xerogel particles consisting of 50 wt% silica , 30 wt% fibrillar bovine collagen , and 20 wt% strontium carbonate ( sc - b30sr20 ) . strontium carbonate was introduced as a third phase by being previously added to the collagen suspension . b30 or b30sr20 gels were transferred to molds , stabilized , and dryed for 7 days in an espec sh-221 climate chamber ( japan ) at 37c and 95% relative humidity . the resulting xerogel samples were ground and classified according to the particle size . on the one hand , b30 xerogel particles < 0.250 mm were compacted using a custom - made pressing tool to obtain monolithic b30 xerogel samples exhibiting exactly the above - described bone defect shape . on the other hand , b30 or b30sr20 xerogel particles < 0.120 mm were added to a 30-mg / ml collagen suspension adjusting a xerogel / collagen weight ratio of 1/1 . these xerogel particle / collagen suspensions were transferred to custom - made silicon molds to again obtain the above - described bone defect shape , cooled at 0.5 k / min to 20c ( espec sh-221 climate chamber , osaka , japan ) followed by lyophilisation ( christ alpha 14 laboratory freeze - dryer , osterode , germany ) . the scaffolds were chemically cross - linked by immersing in 1 wt% n-(3-dimethylaminopropyl)-n0-ethylcarbodiimide ( edc)/n - hydroxysuccinimide ( nhs ) ( sigma ) in 40% ethanol for 24 h. finally , the scaffolds were rinsed in deionized water and freeze - dried again . according to the xerogel particle composition used , all xerogel or scaffold samples were gamma - sterilized at 25 kgy before used for implantation . moreover , iron foam with interconnected pores ( fe ) was applied . for preparation of strontium coating of iron foams , 153 ml of ultrapure water and 17 ml of phosphoric acid ( 85% h3po4 ) were added in a 250-ml glass bottle . the supernatant was diluted 20-fold using ultrapure water , which yielded the solution of sr(h2po4)2 . ten fe foams eroded and cleaned by ifam ( fraunhofer institute for manufacturing technology and advanced materials , dresden ) with an average weight of 170 mg were coated by suspension in 100 ml of sr(h2po4)2 solution for 4 h under vacuum . sr - coated foams were settled in fresh coating solution for another 3 days at room temperature and rinsed 3 times using absolute ethanol with subsequent drying at 40c in a drying cabinet . sr - coating resulted in an average weight gain of 37 mg or approximately 22% . in addition , the alloy element phosphor is added with fe3p - powder ( atmix , japan ) with a particle size of 3.8 m . to achieve a phosphate ratio of 0.6% the iron foam was coated with zolendronic acid ( fe - bp ) that is a member of the bisphosphonate family . . then the complex was carefully washed , dried , ground , and finally led to a coating of 35-g zolendronic acid , the basic iron foam . these 8 different formulations of bone substitution materials were implanted in the current animal model ( n=78 ) ( table 1 ) . eighteen weeks after induction of osteoporosis and 6 weeks after femoral surgery , dpet - ct with f - sodium fluoride ( naf ) scans were performed . during scanning , rats were anesthetized using a mixture of nitrous oxide ( 1 l / min ) , oxygen ( 0.5 l / min ) and isoflurane ( 1.5 vol.% ) . dpet - ct studies were performed for 60 min after the intravenous application of 20 to 40 mbq f - sodium fluoride , using a 28-frame protocol ( 10 frames of 30 s , 5 frames of 60 s , 5 frames of 120 s , and 8 frames of 300 s ) . a dedicated pet - ct system ( biograph mct , 128 s siemens co , erlangen , germany ) with an axial field of view of 21.6 cm with truev and truepoint , operated in a 3-dimensional mode , was used for all animal studies . the system provides the simultaneous acquisition of 369 transverse pet slices with a slice thickness of 0.6 mm . two rats were examined in parallel and were positioned in the axial plane of the system to maintain the optimum resolution in the center of the system . a high - resolution ct scan was performed prior the pet scanning with 160 ma , 80 kv , pitch of 0.85 cm in addition to the low - dose attenuation ct ( 80 ma , 80 kv ) for attenuation correction of the acquired dynamic emission pet data . all pet images were attenuation - corrected and an image matrix of 400400 pixels was used for iterative image reconstruction ( voxel size 1.5651.5650.6 mm ) based on the syngo mi pet / ct 2009c software version . the reconstructed images were converted to standardized uptake value ( suv ) images based on the formula ( 18 ) : suv = tissue concentration ( bq / g)/[injected dose ( bq)/body weight ( g ) ] . volumes of interest were placed over the created defect area in the femur , and rotated pet images according to the ct images . irregular regions of interest were drawn manually according to the fused pet - ct images , as mentioned before . to precisely select the region to draw the voi of the created defect , the fusion of pet images and ct scans by co - registration preprocessing was performed after rotation of each rat individually . first , we rotated the ct series to determine the optimum angle for the visualisation of the complete defect and the adjacent metal plates in the longitudinal direction . the next step was to fuse ct and pet and to use these fused images for the quantitative pet evaluation . the spatial resolution was 2 mm for pet image and 0.33 mm for ct image . the voi for the defect was placed between the 2 screws located at the left and the right side of the 4-mm created defect . for input , we used 10 contiguous pet slices in the middle and lower third of the aorta . we avoided using the upper part of the thoracic aorta due to spillover from the heart . herein , a 2-tissue compartment model was used to evaluate the dynamic studies and to gain quantitative data about the kinetics . in the current study , the learning - machine 2-tissue compartment model was used for the fitting , and provided 5 parameters : the plasma clearance to the bone extracellular fluid ( ecf ) compartment and the rate constant for return of tracer to plasma ; k1 and k2 ; the rate constants describing movement of tracer into and out of the bound bone compartment ; k3 and k4 ; and the fractional blood volume , also called vessel density ( vb ) , which reflects the amount of blood in the voi . following compartment analysis , we calculated the plasma clearance of tracer to bone mineral from the compartment data using the formula : influx ( ki)=(k1*k3)/(k2+k3 ) . compared to the standard iterative method , the machine learning method has the advantage of a fast convergence and avoidance of over - fitting . the model parameters were accepted when k1k4 was less than 1 and vb exceeded 0 . the unit for the rate constants k1k4 was 1/min . besides the compartmental analysis , a noncompartmental model based on the fractal dimension was used . the fractal dimension is a parameter of heterogeneity and was calculated for the time - activity data of each individual volume of interest . the values for fractal dimension vary from 0 to 2 , showing the deterministic or chaotic distribution of tracer activity . we used a subdivision of 77 and a maximal suv of 20 for the calculation of fractal dimension . statistical evaluation was performed with stata / se 11.1 ( statacorp , college station , tx , usa ) using the descriptive statistics and box plots . linear discriminant analysis was performed for calculating the sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) and highest accuracy . the 2-sided wilcoxon rank sum test was applied for all pet parameters , which also included suv , using a single parameter analysis to assess groups . we have reported that k3 was the most sensitive pet parameter for the characterization of healing process and revealed the best differentiation for the empty defect and the cpc group , as well as the srcpc , for the defect region . however , no pet parameter demonstrated a significant difference between the cpc and srcpc group in the defect region . in this study , the volume of interest ( voi ) of the biomaterial - bone interface was selected for evaluation ( figure 1 ) . k3 showed a statistically significant increase in the bone formation for the srcpc group compared to the cpc group ( p=0.018 ) in the biomaterial - bone interface ( figure 2 ) . three types of the composites were used : monolithic xerogels ( b30 ) and porous scaffolds ( sc - b30 and sc - b30sr20 ) . comparing the pet parameters , we could not detect significant changes between the 3 composites and the empty defect for both rois . only k3 in the sc - b30 group exhibited a significant increase in comparison to the b30 group in the defect region ( figure 3 , p=0.022 ) . three different formulations of the iron foam were used as implants in the different rat groups : a ) plain iron foam ( fe ) , b ) strontium functionalized iron foam ( fe - s ) , c ) iron foam with coating of the bisphosphonate zoledronic acid ( fe - bp ) . no significant differences were found in the pet parameters between the 3 implants and the empty defect for both rois . however , there was a significant increase of ki in the fe - bp group as compared with the fe group for the defect region ( figure 4 , p=0.037 ) . a multiparameter analysis was performed to find differences between the 2 different groups based on the dpet - ct data . the aim was to identify a combination of variables that best discriminate each group of rats with different biomaterials in the defect region . an overall accuracy of > 75% was achieved for the combination of some kinetic parameters between the 2 different groups . furthermore , all sensitivity and specificity values from the multiparameter analysis were high ( > 71% ) ( table 2 ) . the highest overall accuracy of 78.6% was achieved for k3 between the cpc and srcpc group based on the biomaterial - bone interface . the positive predictive value ( npv ) and the negative predictive value ( ppv ) were 85.7% and 71.4% , respectively . therefore , 6/7 rats with cpc in the defect and as 5/7 rats with srcpc in the defect could be correctly classified based on the k3 as measured . between the sc - b30 and sc - b30sr group , the highest overall accuracy of 86.7% was achieved for a combination of k1 , k3 , ki , and suv . we could correctly classify 7/8 rats with sc - b30 in the defect ( npv of 86.3% ) and 6/7 rats with sc - b30sr ( ppv of 85.7% ) . between the sc - b30 and b30 group , the highest overall accuracy of 92.3% was achieved for a combination of k3 and ki . we could correctly classify 5/6 rats with b30 in the defect ( npv of 83.3% ) and 7/7 rats with sc - b30 ( ppv of 100% ) . between the sc - b30sr20 and b30 group , the highest overall accuracy of 78.6% was achieved for a combination of k3 and vb . we could correctly classify 3/6 rats with b30 in the defect ( npv of 50.0% ) and 8/8 rats with sc - b30sr20 ( ppv of 100% ) . between the fe and fe - s group , we could correctly classify 6/8 rats with fe - s in the defect ( npv of 75.0% ) and 5/7 rats with fe ( ppv of 71.4% ) . between the fe and fe - bp groups , the highest overall accuracy of 80.0% we could correctly classify 7/8 rats with fe - bp in the defect ( npv of 86.3% ) and 5/7 rats with fe ( ppv of 71.4% ) . between the fe - s and fe - bp , the highest overall accuracy of 75.0% was achieved for a combination of vb , k1 , k3 , ki , and suv . we could correctly classify 6/8 rats with fe - bp in the defect ( npv of 75.0% ) as well as 6/8 rats with fe ( ppv of 75.0% ) . we have reported that k3 was the most sensitive pet parameter for the characterization of healing process and revealed the best differentiation for the empty defect and the cpc group , as well as the srcpc , for the defect region . however , no pet parameter demonstrated a significant difference between the cpc and srcpc group in the defect region . in this study , the volume of interest ( voi ) of the biomaterial - bone interface was selected for evaluation ( figure 1 ) . k3 showed a statistically significant increase in the bone formation for the srcpc group compared to the cpc group ( p=0.018 ) in the biomaterial - bone interface ( figure 2 ) . three types of the composites were used : monolithic xerogels ( b30 ) and porous scaffolds ( sc - b30 and sc - b30sr20 ) . comparing the pet parameters , we could not detect significant changes between the 3 composites and the empty defect for both rois . only k3 in the sc - b30 group exhibited a significant increase in comparison to the b30 group in the defect region ( figure 3 , p=0.022 ) . three different formulations of the iron foam were used as implants in the different rat groups : a ) plain iron foam ( fe ) , b ) strontium functionalized iron foam ( fe - s ) , c ) iron foam with coating of the bisphosphonate zoledronic acid ( fe - bp ) . no significant differences were found in the pet parameters between the 3 implants and the empty defect for both rois . however , there was a significant increase of ki in the fe - bp group as compared with the fe group for the defect region ( figure 4 , p=0.037 ) . a multiparameter analysis was performed to find differences between the 2 different groups based on the dpet - ct data . the aim was to identify a combination of variables that best discriminate each group of rats with different biomaterials in the defect region . an overall accuracy of > 75% was achieved for the combination of some kinetic parameters between the 2 different groups . furthermore , all sensitivity and specificity values from the multiparameter analysis were high ( > 71% ) ( table 2 ) . the highest overall accuracy of 78.6% was achieved for k3 between the cpc and srcpc group based on the biomaterial - bone interface . the positive predictive value ( npv ) and the negative predictive value ( ppv ) were 85.7% and 71.4% , respectively . therefore , 6/7 rats with cpc in the defect and as 5/7 rats with srcpc in the defect could be correctly classified based on the k3 as measured . between the sc - b30 and sc - b30sr group , the highest overall accuracy of 86.7% was achieved for a combination of k1 , k3 , ki , and suv . we could correctly classify 7/8 rats with sc - b30 in the defect ( npv of 86.3% ) and 6/7 rats with sc - b30sr ( ppv of 85.7% ) . between the sc - b30 and b30 group , the highest overall accuracy of 92.3% was achieved for a combination of k3 and ki . we could correctly classify 5/6 rats with b30 in the defect ( npv of 83.3% ) and 7/7 rats with sc - b30 ( ppv of 100% ) . between the sc - b30sr20 and b30 group , the highest overall accuracy of 78.6% was achieved for a combination of k3 and vb . we could correctly classify 3/6 rats with b30 in the defect ( npv of 50.0% ) and 8/8 rats with sc - b30sr20 ( ppv of 100% ) . between the fe and fe - s group , we could correctly classify 6/8 rats with fe - s in the defect ( npv of 75.0% ) and 5/7 rats with fe ( ppv of 71.4% ) . between the fe and fe - bp groups , the highest overall accuracy of 80.0% we could correctly classify 7/8 rats with fe - bp in the defect ( npv of 86.3% ) and 5/7 rats with fe ( ppv of 71.4% ) . between the fe - s and fe - bp , the highest overall accuracy of 75.0% was achieved for a combination of vb , k1 , k3 , ki , and suv . we could correctly classify 6/8 rats with fe - bp in the defect ( npv of 75.0% ) as well as 6/8 rats with fe ( ppv of 75.0% ) . in this study , 3 different classes of biomaterials , including cpc - based implants , composites of silica , and collagen and iron foam implants , were investigated using dpet - ct after they were implanted in 4-mm created rat femoral defects . cpc is a well - defined , hydroxyapatite - forming cement with a formulation based on -tricalcium phosphate as initially described by driessens et al . . srcoc is a strontium - enriched modification thereof , in which caco3 was substituted with srco3 during cement precursor fabrication . this srcpc was recently shown to enhance osteoblast precursor proliferation and osteogenic differentiation in vitro as well as to support new bone formation in vivo . the 4-mm defect represented a critical - size defect with a fracture gap , which has been proven to be a good model to investigate potential bone enhancement effects of biomaterials . our data demonstrate differences in the tracer kinetics within the region of the 4-mm created defect , which includes new bone formation in the defects filled with biomaterials . for f - sodium fluoride , pet parameter k3 describes the formation of fluoroapatite , which is indicative of new bone formation . both cpc and srcpc revealed statistically significant enhanced new bone formation as compared to the empty defect in the defect region . however , no significant difference between the 2 different biomaterials in the defect region was detected . recently , ventura et al . reported pet - suv only indicated the speed of new bone formation but not the absolute amount by correlation of pet - ct and histology . therefore , it might be possible that pet in our study also describes the speed of new bone formation . bone healing is a dynamic process over time , and the use of a single time point is a limitation of this study . we are considering a series of measurements in further related studies , as part of an ongoing project . in addition , in this study , srcpc - treated animals exhibited a statistically significant higher rate of new bone formation at the biomaterial - bone interface , suggesting that a considerable amount of strontium is released from the srcpc into the interface region and into the surrounding tissue , which are most likely related to enhanced bone formation . recently , andersen et al . revealed that local delivery of strontium from surface - functionalized titanium implants could increase bone - to - implant interaction for implants in the femoral shaft of healthy female wister rats . demonstrated a high sr concentration in the interface region of the srcpc implant by tof - sims , which is in line with our findings . it may be concluded that strontium is released into the local milieu of osseointegrating implants , enhancing bone ingrowth into the implant surface . bone tissue has a highly nano - hierarchical structure , consisting mainly of collagen type i fibres and nano hydroxyapatite crystals as the matrix . scaffolds based on polymeric materials act as temporary templates for bone regeneration and actively stimulate vascularized bone growth by improving material - tissue interaction due to the porous form of the biomaterial structure . our results demonstrate significantly higher k3 values of f - sodium fluoride in the defect of rats filled with porous silicate / collagen ( sc - b30 ) than with silicate / collagen ( b30 ) ( figure 3 ) , which allows us to conclude that the formation of fluoroapatite , and therefore the new bone formation , is enhanced in the porous form of the biomaterial structure rather than in the solid form . however , a non - significant increase of k3 in the sc - b30sr20 group was detected as compared with the b30 group . it is uncertain if this is caused by a lack of statistical power or by a greater degree of tissue heterogeneity than can be explained by a 2-tissue compartmental model . the efficacy of bisphosphonates in reducing bone resorption has been clinically estimated using biochemical indices of bone turnover . reported a highly significant correlation ( r=0.84 ) between ki and bone formation rate assessed by levels of serum alkaline phosphatase , as well as histomorphometry in patients with renal osteodystrophy . our results demonstrate that ki , which reflects bone remodeling , was significantly higher in the defect with fe - bp than in the defect with fe only ( figure 4 ) . the increase of ki is related to the enhanced bone formation , confirming the reduced rate of bone resorption . however , a non - significant increase of ki in the fe - s group was detected as compared with the fe group . although we did not find further significant differences for any pet parameters between the other 2 different material group in the defect or in the biomaterial - tissue interface region , each group could be still well classified by the combination of some parameters as measured in the defect ( table 2 ) . it is unclear whether this is because pet is not sensitive enough for discriminating differences of bone metabolism due to the small changes of bone remodeling using different biomaterials and their enrichments , or is due to lack of statistical power . with f - sodium fluoride , k3 was the most significant parameter for the characterization of healing processes and showed the best differentiation between the 2 different biomaterials . pet scanning using f - sodium fluoride seems to be a sensitive and useful method for evaluation of bone healing after replacement with these biomaterials .

backgroundthe aim of the current study was to measure and compare the effect of various biomaterials for the healing of osteoporotic bone defects in the rat femur using 18f - sodium fluoride dpet-ct.material/methodsosteoporosis was induced by ovariectomy and a calcium - restricted diet . after 3 months , rats were operated on to create a 4-mm wedge - shaped defect in the distal metaphyseal femur . bone substitution materials of calcium phosphate cement ( cpc ) , composites of collagen and silica , and iron foams with interconnecting pores were inserted . strontium or bisphosphonate , which are well known for having positive effects in osteoporosis treatment , were added into the materials . eighteen weeks after osteoporosis induction and 6 weeks following femoral surgery , dpet - ct studies scan were performed with 18f - sodium fluoride . standardized uptake values ( suvs ) and a 2-tissue compartmental learning - machine model ( k1-k4 , vessel density [ vb ] , influx [ ki ] ) were used for quantitative analysis.resultsk3 , reflecting the formation of fluoroapatite , revealed a statistically significant increase at the biomaterial - bone interface due to the sr release from strontium - modified calcium phosphate cement ( srcpc ) compared to cpc , which demonstrated enhanced new bone formation . in addition , k3 as measured in the porous scaffold silica / collagen xerogel ( sc - b30 ) , showed a significant increase based on wilcoxon rank - sum test ( p<0.05 ) as compared with monolithic silica / collagen xerogel ( b30 ) in the defect region . furthermore , ki , reflecting the net plasma clearance of tracer to bone mineral measured in the iron foam with coating of the bisphosphonate zoledronic acid ( fe - bp ) , was enhanced as compared with plain iron foam ( fe ) in the defect region.conclusionsk3 was the most significant parameter for the characterization of healing processes and revealed the best differentiation between the 2 different biomaterials . pet scanning using 18f - sodium fluoride seems to be a sensitive and useful method for evaluation of bone healing after replacement with these biomaterials .

Background Material and Methods Ethics statement Animal characteristics, operative protocol Bone substitution materials PET, kinetic model Statistical analysis Results CPC based implants Composites of silica and collagen Iron foam implants Multiparameter analysis Discussion Conclusions

m. tuberculosis isolates were obtained from the laboratory of mycobacteriology of the institut pasteur de tunis as part of the national tuberculosis surveillance program . all samples ( 884 specimens ) from patients with suspected tb residing in northern tunisia ( bizerte ) from august 2001 to october 2003 were forwarded to us by the referral regional hospital . the incidence of tb in this area from 2001 to 2002 was 29/100,000 male patients and 11/100,000 female patients . all patients received the standard chemotherapy regimen of the tunisian national tuberculosis program , i.e. , 2 months of rifampicin , isoniazid , pyrazinamide , and streptomycin , followed by 4 months of rifampicin and isoniazid ( 2rhzs/4rh ) . the corresponding patients were interviewed , and detailed epidemiologic investigations were conducted according to described protocols ( 6 ) . in april 2004 , while the study was in progress , a new mdr case was diagnosed . analyses by is6110 restriction fragment length polymorphism ( is6110 rflp ) , ligation - mediated polymerase chain reaction ( pcr ) , and spoligotyping were carried out by using standard protocols ( 79 ) . typing of the polymorphic gc - rich repetitive sequence ( pgrs ) with probe mtb484 ( 1 ) was conducted according to a previously reported protocol ( 10 ) , with the exception that dna was digested with alui . isolates were assigned to principal genetic groups according to the polymorphisms in the katg and gyra genes ( 11 ) . the following primer pairs were used to sequence rpob , katg , and pnca gene mutations that confer resistance to rifampicin , isoniazid , and pyrazinamide , respectively : rpob ( 5-atcacaccgcagacgttg-3 , 5-tgcatcacagtgatgtagtcg-3 ) ; katg ( 5- cgtcgaaacagcggcgctga-3 , 5-caagcgccagcagggctctt-3 ) ; and pnca ( 5-ggcgcacacaatgatcggtg-3 , 5-gctttgcggcgagcgctcca-3 ) . the recently described single nucleotide polymorphisms in putative m. tuberculosis mutator genes mutt1 , mutt2 , mutt3 , and ogt were investigated with the same protocol reported by rad et al . ( 12 ) . dna sequencing was conducted directly on the purified pcr products by using the prism ready reaction dye deoxy terminator cycle sequencing kit on an abi prism 377 dna sequencer ( applied biosystems , foster city , ca , usa ) . epidemiologic and clinical data indicated that all patients with mdr - tb were male with a mean age of 31 years at diagnosis ( table 1 ) . all were tunisians and permanently resided in the northern part of the country ( bizerte ) . all patients were seronegative for hiv with no documented history of travel abroad , and none had a history of immunosuppression , diabetes , or respiratory diseases other than tb . mapping of the 21 patients with mdr - tb according to their residence sites showed that they were mostly scattered over the northeastern part of the region ( surface area 1,000 km ) with no concentration in a particular locality ( data not shown ) . resistance to 5 first - line drugs was observed for most isolates ( table 2 ) . * pt , previously treated ; nc , new case ; nd , not determined . * rflp , restriction fragment length polymorphism ; pgg , principal genetic grouping ; wt , wild type ( identical to strain h37rv ) ; nd , not determined . h , isoniazid ; s , streptomycin ; r , rifampicin ; e , ethambutol ; z , pyrazinamide . number of is6110 bands . principal genetic grouping according to gyra and katg polymorphisms ( 11 ) . # is6110 typing was determined by ligation - mediated polymerase chain reaction and the profile was identical to the other outbreak - associated strains . * * absence of spacers 15 , 2124 , and 3336 . as indicated in table 1 , with the exception of patient p20 , the dna samples subjected to molecular typing were obtained from the initial isolate of all new patients . rflp showed that 18 patients had nearly identical is6110 profiles ( figures 1 and 2 ) . the predominant profile ( occurring in 13 patients ) showed 11 bands , while the remaining 5 patients had an additional is6110 band . the presence or absence of the additional is6110 band the rflp pattern of patient p11 , a new patient , clearly showed a mixture of the 12-band profile and some additional is6110 bands ( figure 2a ) . typing of his follow - up culture , which was obtained after 6 months of directly observed short - course therapy , as recommended by the world health organization , yielded only the 12-band profile ( figure 2a ) . is6110 restriction fragment length polymorphism ( rflp ) analysis of mycobacterium tuberculosis isolates from 16 patients associated with the multidrug - resistant tuberculosis outbreak , bizerte , tunisia , 20012004 . a ) is6110 restriction fragment length polymorphism ( rflp ) analysis ( left ) and polymorphic gc - rich repetitive sequence ( pgrs ) typing ( right ) of patient p11 . lane 1 , initial isolate ; lane 2 , follow - up isolate . b ) is6110 rflp ( left ) and pgrs typing ( right ) of patient p20 ( lane 1 ) compared with patient p3 ( lane 2 ) , a typical outbreak - associated patient . effective epidemiologic links were identified for 9 ( 47% ) patients ( table 1 ) . it shows 10 is6110 bands ( figure 2b ) , 9 of which are common to the 12-band rflp pattern described for the other isolates . the isolate from patient p19 displayed a 9-band is6110 profile that was clearly distinct from all the other patients with mdr - tb ( data not shown ) . with the exception of patient p19 , the mdr isolates were identical in their pgrs profile ( figure 2 ) and spoligotype patterns ( table 2 ) , which is characteristic of the haarlem3 type ( 4 ) . sequence analysis of mutator and drug resistance genes conclusively confirmed that the 19 mdr isolates with nearly identical is6110 ( both 12- and 11-band profiles ) are genetically closely related . they all harbor the l209l , t15s , s531l , and s315 t mutations in mutt3 , ogt , rpob , and katg genes , respectively ( table 2 ) , whereas mutt1 and mutt2 showed a wild type genotype ( data not shown ) . the occurrence of an additional uncommon mutation in the rpob gene ( v610 m ) confirmed the clonality of this mdr haarlem strain since it was present only in 19 patients with mdr - tb . the variability of resistance to pyrazinamide and the mutational profile within the pnca gene ( table 2 ) strongly suggest that primary transmission from person to person occurred mainly with a strain that was simultaneously resistant to isoniazid and rifampicin . to extend our analysis of the situation that prevailed in this region , samples from 143 ( 83% ) of 172 patients without mdr strains were spoligotyped . of these 143 patients , 41 ( 29% ) in contrast to the mdr - tb outbreak that involved only men , 6 women had a non - mdr haarlem3 strain . aside from the absence of clustering , ligation - mediated pcr typing showed that none of these non - mdr haarlem3 isolates displayed a profile similar to the 19 mdr isolates involved in the transmission chain . sequencing of the rpob gene of 10 isolates randomly selected from the 31 non - mdr haarlem isolates showed the absence of the outbreak - associated mutation v610 m . this finding is strongly indicative of a true clonal expansion and a typical mdr - tb outbreak . the results indicate that an mdr strain of m. tuberculosis has been actively transmitted among 19 hiv - negative male patients in tunisia . several observations indicate that this particular haarlem strain displays increased transmissibility , virulence , or both . first , the outbreak peaked suddenly within a relatively short period of 21 months ; 17 new cases ( 89% ) were reported from september 2001 to june 2003 . inspection of the hospital register for 2000 showed only 3 new patients with mdr isolates , including outbreak - associated patients p5 and p7 ( table 1 ) . second , no epidemiologic links or contact points could be traced for several patients , which suggests that brief exposure would have been sufficient for effective transmission . because patients with mdr - tb do not respond to treatment such a situation is likely to have occurred for the patients with established epidemiologic links . third , the incidence of tb in the region in which the outbreak occurred is not particularly high . fifth , no aids - associated tb outbreak that might have increased the adaptability of the strain within the indigenous population had occurred in the region . sixth , although the haarlem strain was mdr , it was able to cause an outbreak in those vaccinated with bacille calmette - gurin and in persons who were not hospitalized . among the identified m. tuberculosis strain families ( 4,5 ) , the w / the haarlem strain family appears to be widespread ( 4 ) , but its ability to cause outbreaks has been reported only twice , once in argentina ( 13 ) and once in the czech republic ( 14 ) . the distinctive feature of the present haarlem mdr - tb outbreak is its accelerated transmission compared with the first 2 mdr - tb outbreaks . alterations within dna repair genes ( mutator genes ) are thought to favor the emergence of mdr strains with an increased adaptability ( 12 ) . in this respect , both widespread mdr strains might also benefit from their intrinsic adaptability ( 15 ) . from an epidemiologic point of view , tb programs must conduct extensive surveillance of mdr strains of m. tuberculosis strain families because they might cause serious outbreaks .

multidrug - resistant tuberculosis was diagnosed in 21 hiv - negative , nonhospitalized male patients residing in northern tunisia . a detailed investigation showed accelerated transmission of a mycobacterium tuberculosis clone of the haarlem type in 90% of all patients . this finding highlights the epidemic potential of this prevalent genotype .

The Study Conclusions

the goals of surgical management include correction and maintenance of sagittal and coronal alignment , establishment of length and rotation , and early functional range of movements of knee and ankle . interlocking nailing of tibial fractures is desirable because this technique allows some load sharing , spares extra osseous blood supply , avoids extensive soft tissue dissection , and is familiar to most surgeons . nailing of metaphyseal fractures with short distal fragment is associated with an increase in malalignment particularly in coronal plane , nonunion , and need for secondary procedures to achieve union . as there is a mismatch between the diameters of the nail and the medullary canal , with no nail - cortex contact , the nail may translate laterally along coronally placed locking screws and increased stress is placed on the locking holes to maintain fracture alignment after surgery . various techniques have been recommended to improve nailing the metaphyseal fractures including blocking screws ( poller screw ) , temporary unicortical plating , percutaneous reduction clamps , and fibular plating . blocking screws placed adjacent to the nail and perpendicular to the screw holes usually in an anteroposterior direction had been suggested as one possible method of improving the stability of metaphyseal fractures and had been described as a reduction tool used to overcome the displacing forces at the time of introduction of intramedullary nail . the blocking screws functionally decrease the width of the metaphyseal medulla and are particularly useful with nails of smaller diameter . in 1994 krettek et al . described the clinical application of blocking screws , termed poller screws , as a tool for the prevention of axial deformities of proximal and distal third fractures of tibia during intramedullary nailing [ 2 , 3 ] . this was a prospective study of 20 cases of distal tibial metaphyseal fractures treated with statically locked intramedullary nailing with supplementary blocking screws between august 2006 and september 2007 at our institute with a minimum followup of 5 years . displaced distal tibial metaphyseal fractures in adults treated with intramedullary nailing were included in the study . the fractures included were acute fractures and delayed union . both open and closed fractures were included in the study . metaphyseal fractures treated with statically locked intramedullary nails but with additional procedures like fibular plating were also excluded from the study . among there were 16 males and 4 female patients with a mean age of 37.75 years ( 95% lower confidence limit of ( lcl ) 33.13 years and 95% upper confidence limit of ( ucl ) 42.36 ) . the mechanism of injury was road traffic accident in all except three in whom it was fall from height in two and fall of a heavy object over the leg in one . according to ao guidelines there were five type 43 a1 , eleven type 43 a2 , and four type 43 a3 fractures . injury was closed in 15 fractures and gustilo anderson grade i in 2 and grade ii in 3 patients . the mean distance from the articular surface was 4.6 cm ( 95% lcl 2.8 cm and 95% ucl 5.5 cm ) and the mean length of the fracture was 3.4 cm ( 95% lcl 2.69 cm and 95% ucl 4.10 cm ) . the mean delay between the injury and the surgery was 3.75 weeks ( 95% lcl 1.23 weeks and 95% ucl 6.26 weeks ) . among the 20 cases two the mean diameter of the medullary canal at the level of isthmus was 11.9 mm and at the fracture site was 22.9 mm ( table 1 ) . blocking screws were selected for use for one or more of the following reasons : to correct alignment after insertion of nail ( 8 fractures),to maintain alignment or to improve the stability of bone implant complex ( 20 fractures),to control the nail during insertion ( 5 fractures ) . to correct alignment after insertion of nail ( 8 fractures ) , to maintain alignment or to improve the stability of bone implant complex ( 20 fractures ) , to control the nail during insertion ( 5 fractures ) . in 7 cases single blocking screw was used on the concave side of the deformity , close to the fracture site in the short fragment . in 2 cases single blocking screw was used on the convex side of the deformity , near the end of the nail . and in the rest of cases 2 blocking screws were placed , the first one on the concave side of the deformity close to the fracture site and the second screw on the convex side of deformity near the end of the nail in the distal fragment . depending on the amount of correction needed , the screws used for blocking were 4 mm locking screws or 4.5 mm cortical screws . x - ray of the injured leg in ap and lateral views was taken . the fracture tendency for valgus or varus and antecurvatum or recurvatum malalignment the diameters of medullary canal at isthmus and at the level of fracture were also measured . appropriate length of the nail was measured in the contralateral leg , from the tibial tuberosity to medial malleolus . metaphyseal fractures were stabilized with statically locked intramedullary nails on a standard radio lucent table with manual traction . tourniquet was not used in any case . through patellar tendon splitting approach , entry point was made in the midline . closed reduction was attempted and we had to do open reduction as there was a marked overriding of the fragments due to a delay of 18 weeks before surgery . the nails used were unreamed cannulated stainless nails , with 2 proximal ( mediolateral ) and 3 distal ( 2 mediolateral and 1 anteroposterior ) locking options , of diameter 8 or 9 mm . in one case the tibia was too narrow and too short where we have used a nail of 7 mm diameter . the blocking screw was used on the concave side of the deformity close to the fracture in the short fragment when single screw was used between the cortex and the nail under image intensification . when 2 blocking screws were placed , the second screw was on the convex side of deformity near the end of the nail in the short fragment . but in 2 cases the distal segments were too short and there was significant comminution on the concave side of the deformity . hence we used single poller screw on the convex side of deformity near the tip of the nail . in cases of malalignment and instability the screw holes 2.5 mm or 3 mm k wire was used to drill the pilot hole for poller screw as the drill bit may damage the nail while drilling with the nail in situ . for fractures which were stable but malaligned , the nail was temporarily removed , the blocking screws were placed , and the nail was reinserted ( figures 1 and 2 ) . distal and proximal locking was done after achieving the alignment using blocking screws ( figure 3 ) . partial weight bearing was started in the second postoperative week in all except two cases . in one where we have used 7 size nail , we recommended non - weight - bearing till radiological evidence of union and in the other where tibialis anterior tendon was found cut and the patient had both bones fractures in the contralateral leg , partial weight bearing could not be started . partial weight bearing continued up from 4 to 8 weeks ; thereafter full weight bearing started depending on clinical and radiological evidence of union . all the fractures were followed through till union of fracture with clinical and radiological examination at intervals of 4 to 6 weeks . valgus and antecurvatum were expressed as positive values and varus and recurvatum were expressed as negative values . radiographs were analyzed for correction , maintenance of position , or loss of reduction . shortening and rotational malalignment were not measured . fracture was defined as united when patient was able to bear full weight on the injured limb without pain and without support and when radiographs showing bridging call us in at least 3 cortices . it is an independent measurement , not influenced by other comorbid conditions and associated injuries . all the fractures eventually united in a mean period of 11.5 weeks ( 95% lcl 10.11 weeks and 95% ucl 12.88 weeks ) . karlstrom - olerud score was excellent in 14 fractures ( 70% ) , good in 4 patients ( 20% ) , and fair in 2 patients ( 10% ) . radiologically the mean postoperative varus / valgus alignment was 1.7 degrees ( 95% lcl 0.5 degrees and 95% ucl 2.9 degrees ) when compared to the mean preoperative varus / valgus alignment of 10.3 degrees ( 95% lcl 8.2 degrees and 95% ucl 12.4 degrees ) . the alignment was maintained till union with the mean remaining the same in the coronal plane . repeated measures anova test showed the f - test value of 45.29 which is significant as the p value is 0.00000 ( p < 0.05 ) . the mean postoperative antecurvatum / recurvatum alignment was 0.2 degrees ( 95% lcl 0.1 degrees and 95% ucl 0.5 degrees ) when compared to the mean preoperative antecurvatum / recurvatum alignment of 8.0 degrees ( 95% lcl 4.6 degrees and 95% ucl 11.3 degrees ) . f - test value in repeated measures anova is 22.845 with a p value of 0.0000 ( < 0.05 ) which is statistically significant . the mean ratio of fracture segment to the nail length ( i.e. , the length of tibia ) was 14% . the poller screw related complication was encountered in one case where we had new fracture lines while introducing the nail after placement of poller screw ( figures 4 and 5 ) . but the alignment was achieved and maintained and the fracture united within 8 weeks ( figure 6 ) . complications which were not related to poller screw were encountered in two cases . both of them had developed deep infection and went in for delayed union of which one required dynamisation to achieve union . there were no incidences of breakage of nail , locking screw , or blocking screw . we can not overemphasize the potential advantages of intramedullary nailing more than any other form of fixation like external fixator or plating in tibial fractures . but the problems in extending the indications to metaphyseal fractures have to be analyzed and resolved . trafton 's recommendation is generally agreed on by many authors . as per trafton 's recommendation the acceptable malalignment is less than 5 degrees of varus - valgus angulation , 10 degrees of anteroposterior angulation , 10 degrees of rotation , and 15 mm of shortening . in our study merchant and dietz in 1989 suggested that for tibial fractures deformity of > 5 was associated with radiographic changes in the ankle . van der schoot reported a 15-year followup of 88 patients with fractures of lower leg . more arthritis was found in the knee and ankle adjacent to fracture than in comparable joints of the uninjured leg . recorded the long - term effects of tibial angular malunion on knee and ankle joints in his 28 tibial fractures with an average followup of 8.2 years . kyro a in his series of 64 tibial shaft fractures concluded that malunion of tibial shaft fractures seems to be especially harmful in distal fractures , in fractures with marked previous displacement , in fractures caused by high - energy injury , and among patients less than 45 years of age . ahlers and von issendorf analyzed 386 fractures of tibia treated by intramedullary nailing of which 32 were proximal and 138 were distal third fractures . in both the groups one - quarter to one - third had varus - valgus deformities greater than 4 degrees . in another study , mosheiff in 1999 found that 42% of distal third fractures treated with interlocking nailing required secondary procedures to achieve union . there has been discrepancy in the literature regarding the locking bolt orientation and its effect on fracture nail construct stability . chen compared the intrinsic stability in tibial intramedullary nail constructs in distal third diaphyseal fractures without isthmal support , between two mediolateral distal locking screws and two perpendicular ( one mediolateral and one anteroposterior ) distal locking screws . he concluded that fixation stability of intramedullary nail is not significantly influenced by distal locking screw orientation in response to sagittal , coronal , or rotational forces . on the contrary , smucker et al . found two parallel locking bolts being a better construct than perpendicular locking bolts in their study . we have analyzed the mismatch between the diameters of medullary canal at the level of isthmus ( i.e. , maximum possible nail size ) and at the fracture site in all cases . the mean diameter of medullary canal at the level of isthmus was 11.9 mm compared to 22.9 mm at the level of fracture site . this mismatch explained the cause of instability in metaphyseal fractures when treated with intramedullary nailing . to overcome the issue of malalignment various techniques have been developed . in distal third fractures , fibular plating , one cross screw across fracture site as lag screw , use of large reduction forceps , temporary unicortical plating , percutaneous manipulation with shanz pins , femoral distracter and cutting the distal few millimeters of nail distal to the distal screw hole to allow two cross locking screws in the distal fragment , have been the supplementary procedures used to achieve the alignment [ 1424 ] . the primary aim of the study was to analyze the effectiveness of achieving and maintaining reduction in metaphyseal fractures of tibia treated with intramedullary nailing using supplementary blocking screws . we have also measured the maximum diameter of the metaphysis distal tibia , thereby the length of the distal metaphyseal segment in our population was reached . as described in various literatures the malalignment in these circumstances was significantly high when done without any supplementary procedures . published the mechanical effect of blocking screw in stabilizing tibial fractures with short proximal or distal fragments after insertion of small diameter intramedullary nails . created bone implant constructs ( bic ) in fresh cadaveric tibiae and demonstrated in distal bics the addition of blocking screws decreasing the average deformation of the bics by 57% ( p < 0.0001 ) [ 25 , 26 ] . explored the effect of blocking screws on the breakage of interlocking intramedullary nails and concluded that blocking screws improve the stability of fracture area distinctively and hence reduce the breakage of intramedullary nailing . according to james kellam , meticulous intramedullary techniques combined with the use of fibular plate fixation or blocking screws will achieve the best results in maintaining the reduction of distal tibial fractures till union . the use of blocking screw as reduction tool was established in our study by the repeated measures anova test and was comparable to the study by krettek . blocking screws improved the stability of the metaphyseal fractures after nailing and promoted union in our study . the fracture was originally a grade ii compound fracture treated with external fixator which was removed once the wound healed . no cases required bone grafting , bone marrow injection , or exchange of nailing . the ratio of short metaphyseal fragment length to the total tibial length was analyzed . the total length of the tibia was approximately derived from the length of the nail used . this indicates that even such short metaphyseal fragments had been effectively stabilized till union with intramedullary nailing when supplemented with blocking screw . blocking screws functionally reduce the width of the metaphyseal medulla , and usually blocking screw is applied in anteroposterior direction as the coronal plane malalignment is more prone to occur than the sagittal plane . moreover deformities in the sagittal plane are better tolerated and are less common if the fracture is reduced at the time of initial locking . but when the fracture pattern suggests instability in sagittal plane , blocking screw should be used in the mediolateral direction . paige whittle a and george w wood ii in their analyses of the influence of fibular fractures on maintaining alignment in 40 distal tibial fractures treated with locked intramedullary nailing concluded that 60% of unfixed fibular fractures occurring at the same level as the tibial fracture were malaligned . in our study , it was at the same level of tibial fracture in 18 cases of which 2 were segmental and distal to tibial fracture in two cases . only 11% ( 2/18 ) of unfixed fibular fractures occurring at the same level as the tibial fractures were malaligned , which is statistically not significant . we found that in interlocking nailing of distal third tibial fractures , when supplemented with blocking screw , level of fibula fracture did not influence the stability or the functional outcome . when compared to other techniques described for preventing metaphyseal malalignment during nailing , blocking screws are technically easy and reproducible , do not require any special instrumentation , and do not need any special design modifications in the nail . there is no need for excessive soft tissue dissection or additional hardware like unicortical plating or fibular plating . we had excellent to satisfactory outcome in 90% by karlstrom - olerud scoring which is comparable to the results of krettek et al . we conclude that blocking screw by acting as a reduction tool , functionally reducing the medullary width and preventing the loss of initial reduction , definitely extends the indication of intramedullary nailing to distal tibial metaphyseal fractures .

aim . to evaluate the clinical use of blocking screws as a supplement to stability in distal tibial metaphyseal fractures treated with statically locked intramedullary nail . main outcome measurement . alignment and reduction preoperatively , postoperatively , and at healing were the main outcome measured with an emphasis on maintenance of initial reduction on followup . patients and methods . this was a prospective study of 20 consecutive cases of distal tibial metaphyseal fractures treated with statically locked intramedullary nailing with supplementary blocking screw between august 2006 and september 2007 with a maximum followup of 3 years . medullary canal diameter was measured at the levels of fracture and isthmus . results . the mean diameter of tibia at the level of isthmus was 11.9 mm and at the fracture site was 22.9 mm . mean length of distal fracture segment was 4.6 cm . mean varus / valgus alignment was 10.3 degrees preoperatively and 1.7 degrees immediatly postoperatively and was maintained till union . using karlstrom - olerud score the outcome was excellent to good in 90% . conclusion . we conclude that the use of blocking screw as a supplement will aid in achieving and maintaining the reduction of distal tibial metaphyseal fractures when treated with intramedullary nailing thereby extending the indication of intramedullary nailing .

1. Introduction 2. Blocking Screw 3. Patients and Methods 4. Results 5. Discussion 6. Conclusion

this was a retrospective study that included consecutive cases undergoing surgery for primary rhegmatogenous rd in patients with pseudophakia after phacoemulsification between the dates of january 2000 and june 2008 that had a follow - up duration of at least 12 months . eyes were excluded from the study if they had non - primary rhegmatogenous rds , such as from trauma , rds associated with coloboma , uveitis , or glaucoma , rds with a macular hole , or had an axial length > 26 mm . patients were excluded from the study if they had atopic dermatitis or if they had a pre - operative proliferative vitreoretinopathy grade c-1 or higher according to the retina society classification . the baseline data ( gender , age , laterality , intraocular lens [ iol ] status , best - corrected visual acuity , and intraocular pressure [ iop ] ) and the intra - operative findings ( operative procedure , macular status , lens capsule status , extension of the rd , number of retinal breaks , and location of retinal breaks ) were recorded . the visual acuity was recorded in snellen units and converted to logarithm of the minimum angle of resolution ( logmar ) units for statistical analysis . each patient underwent a slit lamp biomicroscopy , fundus photography , and goldmann 's three mirror lens in order to identify retinal breaks at baseline . the duration of time from when the cataract surgery took place to the time at which the rd was diagnosed was recorded as the time of rd evolution . scleral buckling ( sb ) or 20-gauge pars plana vitrectomy was performed according to the surgeon 's preference . vitrectomy combined with sb was considered for total rd , and multiple or unidentified retinal breaks . univariate and multivariate linear regression analyses were undertaken for the dependent variable in each model . univariate categorical analysis was performed using the two paired t - test , chi - square test , mann - whitney u - test , or the fisher exact test , as appropriate . data were analyzed via a repeated - measures analysis of variance with a bonferroni correction . statistical significance was set at 0.05 ( two - sided ) for all of the tests . this study comprised 106 eyes of 104 patients ( 70 males and 34 females ) , with a mean age of 55.4 16.7 years ( range , 20 to 85 years ) . the time between onset of rd ( defined by the onset of early signs and symptoms , including flashes and floaters ) and surgery was 15.4 34.7 days ( range , 4 to 75 days ) . the time of rd evolution was 35.8 26.9 months ( range , 1 to 120 months ) . the mean duration of follow - up was 18.0 8.7 months ( range , 12 to 60 months ) . ten of the eyes ( 9.4% ) have had previous ocular surgery ( an anterior vitrectomy in six eyes , a penetrating keratoplasty in one eye and refractive surgery in two of the eyes ) . cataract surgery was performed on 16 eyes in our hospital and surgery was performed on the remaining 90 eyes in another hospital . there were no sclera tunnel incisions and no iris - fixated or anterior chamber lenses . a superior incision was made in four of the eyes ( 3.8% ) and 60 eyes ( 56.5% ) had a temporal incision . the incisional approach for 42 of these eyes ( 39.6% ) was ill - defined . the location of the iol was in the ciliary sulcus in six eyes , scleral fixation in four eyes , and in the bag in the remaining eyes . univariate analysis did not show any statistically significant differences between the baseline visual acuity and the following variables : gender ; age ; laterality ; the time of rd evolution ; the duration of symptoms ; lower iop ; iol location ; lens capsule status ; identification of a retinal break ; number of retinal breaks ; location of retinal breaks ; and type of surgery . a smaller extension of the rd and a macula - on rd had better baseline visual acuity ( p = 0.005 , p = 0.002 ) . in the sb group ( 14 eyes ) , ten of the eyes had segmental sb and four of the eyes had encircling with segmental sb . a primary vitrectomy was performed in 56 eyes ( 52.8% ) and a vitrectomy with sb was performed in 36 eyes ( 33.9% ) ( table 1 ) . intraocular gas tamponade was used for all 92 eyes that underwent vitrectomy ( 20% sf6 [ 40 eyes ] and 14% c3f8 [ 52 eyes ] ) . there were no cases in which air or silicone oil tamponade was used during the primary surgery . post - operatively , 24 eyes ( 22.6% ) underwent re - operation due to recurrence of rd . ten eyes had repeat vitrectomies , eight eyes had vitrectomies with silicone oil tamponade , and six of the eyes had fluid - gas exchange . silicone oil was used for the long - standing tamponade according to the surgeon 's preference and the removal of the silicone oil was performed in four of the eyes one year from the date of the last surgery . three of the four eyes that underwent silicone oil removal achieved final and complete retinal attachment . the remaining eye that had the silicone oil removal received a silicone - oil re - injection due to a recurrence of the rd . at the time of the last follow - up , silicone oil tamponade was continued in eight eyes including the cases that received further silicone oil injections . there were no significant silicone oil - related complications in the silicone oil - filled eyes throughout the follow - up period except for controlled iop elevation . in addition , one eye with permanent silicone tamponade and one eye receiving further fluid - gas exchange presented complete retinal attachment at the time of the patient 's last follow - up . thus , among the 24 eyes that were re - operated on , five of them ( 20.8% ) achieved retinal reattachment . the final visual acuities of the recurrent rd cases were 1.80 0.25 ( range , 0 to 3 ) , which were worse than the 0.63 0.55 of the eyes without recurrence ( p = 0.045 ) ( table 2 ) . the major complications after surgery were macular pucker , which occurred in four of the eyes , and iol dislocation , which occurred in another four eyes . visually significant macular pucker was diagnosed approximately 3 to 6 months after surgery in three of the eyes and all of these eyes underwent a subsequent removal of the epiretinal membrane . four eyes began to develop iol dislocation , and thus two of these eyes underwent one or two point iol fixation and the other two eyes underwent iol repositioning . intra - operatively , the macula was already detached in 58 of the eyes ( 54.7% ) . twenty - eight eyes ( 26.4% ) had a defect in the posterior lens capsule and the remaining 78 eyes had an intact posterior lens capsule . during surgery , a retinal break was not identified in 30 of the eyes ( 28.3% ) , even though the surgeon performed a careful examination with 360 indentations . in regards to the number of retinal breaks that occurred in 76 eyes , 50 of the eyes had on break , 14 eyes had two breaks , eight of the eyes had more than three breaks present , and four eyes presented with retinal dialysis < 1 quadrant . retinal breaks were predominately small horse - shoe tears that were often located anterior to the equator , near the ora serrata . breaks were found in the superotemporal quadrant in 32 of the eyes , the superonasal quadrant in 16 of the eyes , the inferotemporal quadrant in 14 of the eyes , the inferonasal quadrant in 12 of the eyes , and the perimacular area in two of the eyes ( table 1 ) . the retina was attached in 82 of the eyes ( 77.3% ) after primary surgery and in 87 of the eyes ( 82.1% ) at the time of the last follow - up . multivariate analysis did not show any statistically significant differences between anatomic success and the following pre - operative variables : baseline visual acuity ; gender ; age ; laterality ; presence of systemic complications ; the time of rd evolution ; the time between the onset of rd and surgery ; an intact lens capsule ; the location of the intraocular lens ; and a lower iop . an inability to indentify retinal breaks was associated with a significantly lower anatomic success rate ( p = 0.002 ) . the other analyzed intra - operative factors and surgical factors were not associated with different reattachment rates ( table 3 ) . in eyes with unidentified retinal breaks , the retinal attachment rate after the primary surgery was performed was 15 ( 50% ) out of 30 eyes . fifteen ( 50% ) of 30 eyes had a re - operation and tiny retinal breaks were identified in three eyes during the re - operation . the final retinal attachment rate was 20 ( 66.6% ) of 30 eyes , which is significantly lower than the eyes with identified breaks ( p = 0.02 ) ( table 4 ) . the final visual acuities ( logmar ) were improved from the baseline of 1.51 1.14 ( range , 0.1 to 3 ) to 0.65 0.49 ( range , 0 to 3 ) ( p < 0.001 ) . there was no correlation between the baseline and the final visual acuity ( r = 0.128 , p = 0.463 ) . at the last follow - up , 50 of the eyes ( 47.1% ) had a visual acuity of 20/50 or better and 42 of the 106 eyes ( 39.6% ) achieved a visual acuity of 6 / 18 or better . based on multivariate analysis , the characteristics associated with a worse final visual acuity were an inability to identify retinal breaks , a lower iop , and recurrence after the primary surgery ( table 3 ) . the operative procedure , including the use of perfluorocarbon liquid , gas for intraocular tamponade , retinotomy for drainage , and type of implant used for encircling bands and/or scleral sponges , did not influence the final visual acuity . eyes with unidentified retinal breaks presented larger extension of the rd and a higher rate of pre - operative macula - off rd and the final visual acuity in the eyes with unidentified retinal breaks was worse than in the eyes with identified breaks ( 1.40 1.32 and 0.73 0.75 , respectively ; p = 0.02 ) ( table 4 ) . in addition , a lower iop was observed in 10 of the eyes ( 9.4% ) pre - operatively and a lower iop resulted in worse final visual acuity when compared to the eyes with an iop in the normal range ( 2.50 0.83 and 1.39 1.12 , respectively ; p = 0.02 ) . in the sb group ( 14 eyes ) , ten of the eyes had segmental sb and four of the eyes had encircling with segmental sb . a primary vitrectomy was performed in 56 eyes ( 52.8% ) and a vitrectomy with sb was performed in 36 eyes ( 33.9% ) ( table 1 ) . intraocular gas tamponade was used for all 92 eyes that underwent vitrectomy ( 20% sf6 [ 40 eyes ] and 14% c3f8 [ 52 eyes ] ) . there were no cases in which air or silicone oil tamponade was used during the primary surgery . post - operatively , 24 eyes ( 22.6% ) underwent re - operation due to recurrence of rd . ten eyes had repeat vitrectomies , eight eyes had vitrectomies with silicone oil tamponade , and six of the eyes had fluid - gas exchange . silicone oil was used for the long - standing tamponade according to the surgeon 's preference and the removal of the silicone oil was performed in four of the eyes one year from the date of the last surgery . three of the four eyes that underwent silicone oil removal achieved final and complete retinal attachment . the remaining eye that had the silicone oil removal received a silicone - oil re - injection due to a recurrence of the rd . at the time of the last follow - up , silicone oil tamponade was continued in eight eyes including the cases that received further silicone oil injections . there were no significant silicone oil - related complications in the silicone oil - filled eyes throughout the follow - up period except for controlled iop elevation . in addition , one eye with permanent silicone tamponade and one eye receiving further fluid - gas exchange presented complete retinal attachment at the time of the patient 's last follow - up . thus , among the 24 eyes that were re - operated on , five of them ( 20.8% ) achieved retinal reattachment . the final visual acuities of the recurrent rd cases were 1.80 0.25 ( range , 0 to 3 ) , which were worse than the 0.63 0.55 of the eyes without recurrence ( p = 0.045 ) ( table 2 ) . the major complications after surgery were macular pucker , which occurred in four of the eyes , and iol dislocation , which occurred in another four eyes . visually significant macular pucker was diagnosed approximately 3 to 6 months after surgery in three of the eyes and all of these eyes underwent a subsequent removal of the epiretinal membrane . four eyes began to develop iol dislocation , and thus two of these eyes underwent one or two point iol fixation and the other two eyes underwent iol repositioning . intra - operatively , the macula was already detached in 58 of the eyes ( 54.7% ) . twenty - eight eyes ( 26.4% ) had a defect in the posterior lens capsule and the remaining 78 eyes had an intact posterior lens capsule . during surgery , a retinal break was not identified in 30 of the eyes ( 28.3% ) , even though the surgeon performed a careful examination with 360 indentations . in regards to the number of retinal breaks that occurred in 76 eyes , 50 of the eyes had on break , 14 eyes had two breaks , eight of the eyes had more than three breaks present , and four eyes presented with retinal dialysis < 1 quadrant . retinal breaks were predominately small horse - shoe tears that were often located anterior to the equator , near the ora serrata . breaks were found in the superotemporal quadrant in 32 of the eyes , the superonasal quadrant in 16 of the eyes , the inferotemporal quadrant in 14 of the eyes , the inferonasal quadrant in 12 of the eyes , and the perimacular area in two of the eyes ( table 1 ) . the retina was attached in 82 of the eyes ( 77.3% ) after primary surgery and in 87 of the eyes ( 82.1% ) at the time of the last follow - up . multivariate analysis did not show any statistically significant differences between anatomic success and the following pre - operative variables : baseline visual acuity ; gender ; age ; laterality ; presence of systemic complications ; the time of rd evolution ; the time between the onset of rd and surgery ; an intact lens capsule ; the location of the intraocular lens ; and a lower iop . an inability to indentify retinal breaks was associated with a significantly lower anatomic success rate ( p = 0.002 ) . the other analyzed intra - operative factors and surgical factors were not associated with different reattachment rates ( table 3 ) . in eyes with unidentified retinal breaks , the retinal attachment rate after the primary surgery was performed was 15 ( 50% ) out of 30 eyes . fifteen ( 50% ) of 30 eyes had a re - operation and tiny retinal breaks were identified in three eyes during the re - operation . the final retinal attachment rate was 20 ( 66.6% ) of 30 eyes , which is significantly lower than the eyes with identified breaks ( p = 0.02 ) ( table 4 ) . the final visual acuities ( logmar ) were improved from the baseline of 1.51 1.14 ( range , 0.1 to 3 ) to 0.65 0.49 ( range , 0 to 3 ) ( p < 0.001 ) . there was no correlation between the baseline and the final visual acuity ( r = 0.128 , p = 0.463 ) . at the last follow - up , 50 of the eyes ( 47.1% ) had a visual acuity of 20/50 or better and 42 of the 106 eyes ( 39.6% ) achieved a visual acuity of 6 / 18 or better . based on multivariate analysis , the characteristics associated with a worse final visual acuity were an inability to identify retinal breaks , a lower iop , and recurrence after the primary surgery ( table 3 ) . the operative procedure , including the use of perfluorocarbon liquid , gas for intraocular tamponade , retinotomy for drainage , and type of implant used for encircling bands and/or scleral sponges , did not influence the final visual acuity . eyes with unidentified retinal breaks presented larger extension of the rd and a higher rate of pre - operative macula - off rd and the final visual acuity in the eyes with unidentified retinal breaks was worse than in the eyes with identified breaks ( 1.40 1.32 and 0.73 0.75 , respectively ; p = 0.02 ) ( table 4 ) . in addition , a lower iop was observed in 10 of the eyes ( 9.4% ) pre - operatively and a lower iop resulted in worse final visual acuity when compared to the eyes with an iop in the normal range ( 2.50 0.83 and 1.39 1.12 , respectively ; p = 0.02 ) . surgical techniques in patients with pseudophakia after phacoemulsification have rapidly advanced in parallel with the development of better equipment . previous studies involving patients with pseudophakic rds have been reported before the era of phacoemulsification with micro - corneal incisions . thus , the reported surgical outcomes of patients with pseudophakic rds may be improved upon . this retrospective study involved 106 patients with a primary of idiopathic pseudophakic rhegmatogenous rds who had surgery by one surgeon over an 8-year period . data relating to 21 pre- , intra- , and post - operative variables were studied . the final reattachment rate was 82% , which is slightly greater than what previous studies have reported [ 6 - 8 ] . previous reports have identified the following negative prognostic factors for reattachment after surgery : age > 65 years ; poor pre - operative vision ; rd involving > 3 quadrants ; macula - off rds ; a lower iop ; inability to identify a retinal break ; longer duration of symptoms ; and grades c or d of proliferative vitreoretinopathy [ 6 - 13 ] . in the current study , only an inability to identify a retinal break was significantly associated with lower reattachment success . proliferative vitreoretinopathy grade c or d was not analyzed due to the exclusion criteria used in this study . a critical step in successful rd surgery is to locate and seal all of the causative retinal breaks . however , in pseudophakia , tiny breaks , poor mydriasis , cortical remnants , capsular opacification , glare or pitting from the intraocular lens implant , and corneal or vitreous opacities may make identification difficult , especially since anterior breaks commonly occur in pseudophakic and aphakic rds . thus , a retinal break is not identified in 9% to 20% of pseudophakic rds , which would be a risk factor for surgical failure [ 11 - 17 ] . cases with unidentified retinal breaks have traditionally been managed using sb and broad application cryopexy , which has a reported primary success rate of 53% to 70% . we think an internal approach with vitrectomy offers some advantages that might result in the detection of these breaks . scleral external indentation together with endoillumination and magnification during the vitrectomy may help locate previously undetected breaks . also during vitrectomy , breaks can be searched for with an aspirating instrument or by using perfluorocarbon liquids that may identify a stream of fluid that is exiting the subretinal space via the hole . we performed vitrectomy combined with either segmental or encircled sb in all 30 of the eyes that had unidentified breaks with a final anatomical success rate of 66% . previous case series have reported that the anatomical success rate of vitrectomy when combined with sb was superior to sb alone [ 19,22 - 24 ] . in contrast , some authors have found that vitrectomy was not of additional value in terms of a better success rate . a larger prospective randomized trial is needed in order to determine an accurate surgical method for rds with unidentified breaks . as mentioned above , we indicated that identifying a retinal break is an important factor for both anatomic and functional outcomes for pseudophakic rd repair . one of the most important changes in the posterior segment after cataract surgery is anomalous posterior vitreous detachment , which would induce a retinal tear [ 27 - 29 ] . although the reasons for an increased incidence of posterior vitreous detachment after cataract surgery remain unknown , it is thought that the anterior movements of the vitreous during surgery might play a role in the development of posterior vitreous detachment . we believe that it is possible that the insertion of an instrument during surgery via the main incision could produce vitreous movement and the subsequent vitreous traction may then result . in the current cases , the main incision for the cataract surgery was via a temporal approach and the eyes with an undetermined incisional approach may have undergone a temporal corneal approach . although it is not clear why retinal breaks occur more frequently in the superiotemporal quadrant , meticulous examinations of the superiotemporal area during surgery are important to identify these retinal breaks . it has been reported that the previously mentioned negative prognostic variables for anatomical outcomes are also associated with worse visual outcomes [ 5 - 13 ] . among these variables , a lower iop , unidentified retinal breaks , and the recurrence after primary surgery were associated with poorer final visual acuity in the current study . a lower iop was related to a poor final visual acuity and this relationship has previously been reported [ 32 - 35 ] . this finding might reflect a more bullous rd , a pre - operative choroidal detachment or surgical difficulty . these factors are related with retinal glial cell up - regulation and retinal pigment epithelium dispersion , which resulted in a delayed morphologic recovery including that of the photoreceptor reposition of the reattached retina . it is thought that the visual results of pseudophakic detachment depend on the pre - operative macula status and approximately 80% of pseudophakic rd typically presents with the macula detached [ 12 - 14 ] . however , 45% of the rds in this study were macula - on at the time of surgery . we showed that the macula - off rd is not more highly related to poorer outcome , in spite of the worse baseline visual acuity , and that pseudophakic detachment is not present more often with the macula detached . we believe that patients tend to have accurate and frequent eye examinations , which would lead to an earlier diagnosis before there is macular involvement and this is reflected in our final results . in addition , both vitreous loss at the time of the cataract surgery and nd : yag posterior capsulotomy appear to increase the risk of rd when performed after cataract surgery . a defect in the lens capsule may be related to more vitreous involvement and reflect more complex intraocular manipulations . we investigated the defects in the lens capsules and the iol position , but defects in the lens capsules and the iol position were not prognostic factors for post - operative outcomes . although earlier reports suggested that vitrectomy without sb , the use of perflurocarbon liquids during vitrectomy , and the performance of a drainage retinotomy were associated with the existence of more complex rds , and consequently poorer functional results [ 38 - 40 ] , more recent reports have shown that the surgical outcomes appear to be independent of the surgical procedure that is chosen to resolve the rd . in the current study , the type of surgical procedure ( vitrectomy or sb ) and intra - operative factors were not associated with the post - operative results . thus , these results suggest that surgical outcomes are independent of the methods or complexity of the surgery . this retrospective series had a relatively small sample size within one retinal center and the surgical procedures that were used were heterogeneous . we did not describe the size of the retinal breaks , vitreous status , or the intra - operative events that occurred during the cataract surgery . a large , multicenter study is needed to evaluate the precise prognostic factors for surgical outcomes in patients with pseudophakic rds . however , the surgical treatment of all the patients in this study was performed by one experienced retinal specialist . we believe this report is of importance to clinicians who perform surgery for rds in pseudophakic patients . consequently , retinal breaks that were not identified during surgery were related to poor anatomic and functional outcomes . clinicians should perform careful examinations in the superotemporal quadrant to find retinal breaks when visible breaks are not identified . a poorer pre - operative state , including a worse pre - operative visual acuity , the macula - off rd , a larger area involved in the rd , and multiple breaks was not related to a poorer surgical outcome . adequate surgery that is performed according to the preference of the surgeon may lead to successful outcomes in patients with pseudophakic rds .

purposeto evaluate the clinical features and surgical outcomes for primary rhegmatogenous retinal detachments ( rds ) in patients with pseudophakia after phacoemulsification.methodsthe medical records of patients with pseudophakia after phacoemulsification and intraocular lens implantation who had undergone surgery for primary rhegmatogenous rds with a minimum duration of follow - up of 12 months were reviewed retrospectively.resultsa total of 104 patients were enrolled in this study and 106 eyes were analyzed . post - operative retinal attachment was achieved in 87 of the eyes ( 82.1% ) and the final visual acuities ( logarithm of the minimum angle of resolution ) were improved to 0.65 0.49 from the baseline measurement of 1.51 1.14 ( p < 0.001 ) . re - operations were performed in 24 of the eyes ( 22.6% ) and there were no visible retinal breaks in 30 of the eyes ( 28.3% ) . the failure to identify a retinal break during surgery was associated with a lower rate of retinal reattachment , worse final visual acuity , and a higher rate of re - operation ( p = 0.002 , p = 0.02 , and p = 0.002 , respectively ) . the location of the identified retinal break was more common in the superotemporal quadrant than in the other quadrants.conclusionsthe inability to identify a retinal break during surgery was associated with a poor final outcome . other factors were less important for the functional and anatomic success in patients with pseudophakic rds .

Materials and Methods Results Surgical management Intra-operative findings Anatomical results Functional results Discussion

the patient was an 11-year - old boy with no family history of optic neuropathy or dystonia . he presented with focal dystonia in the right upper limb at 3 years of age , and his disease progressed over 4 years to dystonia in both the upper and the lower limbs on his dominant right side . at 5 years of age however , at 7 years of age , he had severe dysarthria and was unable to walk without support owing to dystonia and spasticity . he had neither mental retardation ( verbal iq , 129 ; performance iq , 97 ; full - scale iq , 115 by the weschler intelligence scale for children ) nor short stature . magnetic resonance imaging findings at 3 years of age showed high signal intensity lesions in bilateral putamina on fluid - attenuated inversion recovery images ( figure 1a - c ) and diffusion - weighted images ( figure 1d ) . with time , the high signal intensity lesions on diffusion - weighted images migrated from the putamina to the caudate nuclei ( figure 1e - l ) . the mri findings obtained at 6 years of age showed that the high signal intensity lesions had spread to the bilateral caudate nuclei and the midbrain on fluid - attenuated inversion recovery images ( figure 1i - k ) and diffusion - weighted images ( figure 1l ) . on laboratory examination at 7 years of age , blood cell counts were normal , and the concentrations of lactate and pyruvate were not elevated in serum and cerebrospinal fluid . the serum concentrations of copper and ceruloplasmin were normal . in the serum amino acid analysis , organic acid level in urine , and levels of lysosomal enzyme in white blood cells were found to be normal . sequence analysis of the white blood cell mitochondrial dna from this patient showed the presence of a homoplasmic g > a transition mutation at nucleotide position 14 459 in the reduced nicotinamide adenine dinucleotide dehydrogenase subunit 6 gene ( figure 2 ) . a - d , brain magnetic resonance imaging ( mri ) obtained at 3 years 2 months of age shows high signal intensity lesions with partially cystic lesions in the bilateral putamina on fluid - attenuated inversion recovery images ( a - c ) and diffusion diffusion - weighted imaging ( d ) . e - h , brain mri obtained at 5 years 2 months of age show a high signal intensity lesion that is newly detected in the left caudate nucleus on fluid - attenuated inversion recovery images ( e - g ) . diffusion - weighted imaging shows that the bilateral putamina are iso- or hypointense and the left caudate nucleus is hyperintense ( h ) . i - l , brain mri obtained at 6 years 11 months of age shows high signal intensity lesions spread to bilateral caudate nuclei and the midbrain ( right substantia nigra ) on fluid - attenuated inversion recovery images ( i - k ) and diffusion - weighted imaging ( l ) , in addition to the putaminal hyperintensities . m - o , brain mri obtained at 8 years 6 months of age shows high signal intensity lesions in the bilateral putamina and caudate nuclei on t2-weighted ( m - o ) and diffusion - weighted imaging ( p ) . q - t , brain mri obtained at 10 years 5 months of age shows high signal intensity lesions in the bilateral putamina and caudate nuclei on t2-weighted ( q - s ) and diffusion - weighted imaging ( t ) . a - c , e - g , i - k : fluid - attenuated inversion recovery images ; m - o , q - s : t2-weighted images ; and d , h , l , p , t : diffusion - weighted images . sequence analysis of the white blood cell mitochondrial dna from this patient shows the presence of a homoplasmic g > a transition mutation at nucleotide position 14 459 in the reduced nicotinamide adenine dinucleotide dehydrogenase subunit 6 gene . the patient had been treated with coenzyme q10 ( 2 mg / kg / d ) , l - carnitine ( 90 mg / kg / day ) , and vitamins since the age of 4 years . however , his symptoms and mri abnormalities progressed gradually despite treatment . therefore , oral administration of sodium succinate ( 250 mg / kg / d ) was started from the age of 7 years , on the basis of the presence of g14459a mitochondrial dna mutation ( which can cause complex i deficiency ) and a previous case report of a patient with mitochondrial encephalomyopathy , lactic acidosis , and stroke - like episodes ( melas ) . on the follow - up mri examinations over the subsequent 4 years , progression of mri abnormalities appeared suppressed , but there was no improvement in dystonia ( figure 1m - t ) . in the present case , mitochondrial dna analysis of the entire region revealed a g > a transition mutation at nucleotide position 14 459 , leading to alanine - to - valine amino acid substitution at position 72 of the reduced nicotinamide adenine dinucleotide dehydrogenase subunit 6 of complex i. the g14459a mitochondrial dna mutation has been reported in the following patients : 9 with childhood - onset dystonia , 6 with leber hereditary optic neuropathy , 4 with leber hereditary optic neuropathy plus dystonia , 4 with leigh or leigh - like syndrome , and 4 who were clinically asymptomatic . the general features of cases reported to be of the dystonia phenotype were progressive generalized dystonia and/or optic neuropathy . the clinical findings of leigh disease are optic involvement , early developmental delay , and hypotonia . the patients with leigh - like encephalopathy showed visual dysfunction , ataxia , and hearing loss . t2-weighted magnetic resonance images showed high signal intensity lesions in the medial thalamic nuclei , anterior pons , and cerebral peduncles in one patient and in the dorsal midbrain and red nucleus in other patients , in addition to a basal ganglia lesion . the patient reported in our study presented with the dystonic phenotype and leigh - like findings on neuroimaging , showing degeneration in the bilateral striata and right substantia nigra . the variation in clinical expression indicates that modifying nuclear factors are likely involved , playing a role in the clinical expression of mitochondrial diseases . the diffusion - weighted mri findings in our patient are characteristic . with time , high signal intensity lesions on diffusion - weighted images migrated from the putamina to the caudate nuclei , which closely correlated with his disease progression . diffusion - weighted images enhance the restricted mobility of water molecules in the brain , and it is a useful tool for detecting acute ischemic lesions in patients with stroke . the pathophysiology of the diffusion abnormalities associated with mitochondrial diseases remains unclear , although it has been reported in some patients with leigh disease . considering the finding that diffusion abnormalities migrated from the putamina to the caudate nuclei in parallel with the disease progression in this patient , diffusion abnormalities might be caused by the chronic mitochondrial respiratory dysfunction due to the mutation of the reduced nicotinamide adenine dinucleotide dehydrogenase subunit 6 gene . they include coenzyme q10 , cytochrome c nicotinamide , dichloroacetate , l - arginine , and succinate . these drugs ( except for l - arginine ) are mitochondrial respiratory chain enzymes or its substrates and are considered to compensate for the defects in the corresponding pathways . because the g14459a mitochondrial dna mutation could cause complex i deficiency , oral administration of sodium succinate was started on the basis of a previous case report of a patient with melas . the proposed pharmacological mechanism is that the respiratory capacity with the defect in complex i can be improved or restored by succinate administration through the activation of the complex ii system . it has been reported that succinate enhances electron flow from complex ii to complex iii ( coenzyme q cytochrome c reductase ) and to complex iv ( cytochrome c oxidase ) , enabling these 2 energy coupling sites to operate normally . in the present case , progression of mri abnormalities appears to have been suppressed for 4 years after treatment with sodium succinate . there is a possibility that treatment with sodium succinate is helpful in patients with g14459a mitochondrial dna mutation , although further investigation is necessary .

this article reports the case of an 11-year - old boy with progressive dystonia caused by the homoplasmic g14459a mitochondrial dna mutation . the patient presented with focal dystonia in the right upper limb at 3 years of age , which progressed over 4 years to exhibit dystonia in both the upper and lower limbs . at 7 years of age , high signal intensity lesions in the bilateral striata and the midbrain were observed on fluid - attenuated inversion recovery images . it was observed on diffusion - weighted images that with time , these high signal intensity lesions migrated from the putamen to the caudate nuclei , which closely correlated with disease progression . because his symptoms and abnormal magnetic resonance imaging findings progressed despite treatment with coenzyme q10 and l - carnitine , at 7 years of age he was then started on sodium succinate , hoping to improve his complex i deficiency . after treatment , progression of mri abnormalities appeared to have been suppressed for 4 years , although no improvement was observed in dystonia .

Case Report Discussion

fibrous dysplasia of bone is characterized by the replacement of medullary bone with fibro - osseous tissue . this results in the distortion and overgrowth of bone , leading to characteristic deformities . based on the bony involvement , fibrous dysplasia is divided into three types : monostotic , polyostotic , and mccune albright syndrome ( mas ) . mas is characterized by a triad of monostotic / polyostotic fibrous dysplasia , caf-au - lait macules ( calms ) , and endocrine hyperfunction . the disease is congenital but not hereditary and is due to an activating mutation in g protein - coupled receptor . it manifests usually in childhood , with recurrent fractures , distorted bones , precocious puberty , acromegaly , or hyperthyroidism . untreated disease leads to permanent disfigurement , and the disease is classified as paucibacillary or multibacillary depending on the proliferation of the bacilli . the risk factors for the disease are living in endemic areas with poor hygiene conditions and defects in cell - mediated immunity . we recently encountered a patient with mas who presented with cutaneous features of hansen 's disease . we report the same for the unusual association and to highlight the relevant review of the literature . a 30-year - old man presented with hypoesthetic , depigmented patches over the skin of the chest and back of 1 year duration . he gave history of recurrent fractures since the age of 4 years with shortening of right leg . the parents gave history of hyperpigmented macules over the trunk since birth and denied similar features in family members . the patient attained puberty at the age of 14 years and denies history suggestive of acral enlargement , thyrotoxicosis , cushing 's syndrome , and swellings in any part of the body . examination revealed ( height 152 cm ) asymmetry of the face with expansion of right maxilla and lower jaw and short right leg ( 82 vs 86 cm ) [ figures 1 and 2 ] . cutaneous examination revealed a large calm over the back , extending across the midline and multiple anesthetic patches over scapula and lower back [ figure 3 ] . there was no evidence of goiter , acromegaloid features , and thickened nerves , and the rest of the examination was normal . facial photograph showing craniofacial dysplasia legs showing short right leg ( arrow ) with expansile lesion of tibia ( arrow head ) skin over the back showing a large calm crossing midline ( long arrows ) with depigmented hypoesthetic patches ( short arrow ) hormonal profile revealed normal thyroid adrenal and gonadal axes evaluation . skeletal survey revealed expansile osteolytic lesion over right maxilla , right hip , and shoulder . skin biopsy specimens were obtained from ear lobes , legs , and depigmented lesions over the back , avoiding areas of calm . specimens revealed the presence of acid - fast bacilli along with noncaseating granulomas consistent with the diagnosis of tuberculoid leprosy . the diagnosis of fibrous dysplasia is made by the presence of bone pains , recurrent fractures , deformity of bone , and radiological evidence of fibro - osseous tissue showing expansile lytic lesion . biopsy and tc - mdp scan of the bone were not considered necessary to establish the diagnosis in this classical case . other laboratory workup showed elevated alkaline phosphatase ( 388 u / l ) with normal calcium , phosphorus , parathyroid hormone , and 25-hydroxy vitamin d levels . he was treated with triple drug regimen for leprosy and also given oral calcium carbonate 1.5 g daily along with the first dose of zoledronic acid 4 mg as an intravenous infusion . mas is characterized by the triad of polyostotic fibrous dysplasia , calm , and endocrinopathy . the diagnosis of fibrous dysplasia is based on classical radiological findings supported by histopathology and bone scan . hyperfunctioning of endocrine glands in mas presents with precocious puberty , hyperthyroidism , acromegaly , or cushing 's syndrome . our patient had only two features of the triad and did not have any evidence of endocrine hyperfunction syndromes . the calm is unusual in our patient in that it crossed the midline and was seen on both sides of the body . the calms in mas do not cross the midline and follow the developmental lines of blashko , thus differentiating from those in neurofibromatosis . our patient had an exceptionally large calm that crossed the midline interspersed with anesthetic depigmented macular lesions of hansen 's disease . hansen 's disease is caused by mycobacterium leprae , and the disease spreads via respiratory droplets between close personal contacts over a prolonged duration . immunocompromised situations are the predominant risk factors for the disease , and defects in cell - mediated immunity are implicated in persons with genetic predisposition . the mode of acquisition of hansen 's disease in our patient is possibly due to frequent stay in the hospitals due to multiple fractures and contact with a patient . screening of the persons involved in personal care of the patient did not reveal features of hansen 's disease . the association of hansen 's disease with mas appears coincidental as there is no evidence that mas predisposes to the infectious diseases or leads to immunosuppressed state . extensive literature search did not reveal any previous reports of association between hansen 's disease and mas . they are given as intravenous or oral preparation and act by suppressing the osteoclast activation . treatment of mas involves bisphosphonate therapy to reduce fracture rate apart from treating any associated endocrinopathy . to conclude , we present an interesting case of mas without associated endocrinopathy who had coexisting hansen 's disease . this unusual combination was not reported earlier in world literature .

mccune albright syndrome ( mas ) comprises a triad of fibrous dysplasia of bone , caf - au - lait macule , and endocrinopathy . the disease is due to activating mutation of g protein - coupled receptor leading to hyperfunction of glands . hansen 's disease is caused by infection with mycobacterium leprae and is seen with underlying immunosuppressed conditions in genetically predisposed individuals . we recently encountered a patient with hansen 's disease along with underlying mas and report the same in this report .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

pseudouridine ( ) is the most abundant post - transcriptional rna base modification and the enzymes responsible for this isomerization of uridine and the positions modified in the rnas , are conserved ( 14 ) . this modification is important in the structure and function of small rnas ( 511 ) , including small nuclear rnas ( snrnas ) , cofactors in pre - mrna splicing ( 1216 ) . one pathway is involved in the formation of in rrna and snrna and requires dyskerin or its homologs ( cbf5p in yeast for example ) and rnp cofactors [ most often h / aca small nucleolar ribonucleoprotein particles ( snornps ) ] that enable one enzyme to recognize many different sites for modification on different substrates ( 1725 ) . the other pathway for formation employs site - specific synthases that require no cofactors to recognize and modify the rna substrate . a number of enzymes have been identified in this pathway and are grouped in six families that all share a common basic structure ( 4 ) . guided pathway has received a great deal of attention because of its similarity to aspects of rna editing , but the site - specific pseudouridine synthases accomplish the same task , on more substrates , with fewer tools , arguably making them more interesting from an enzymatic perspective . one of the most studied site - specific enzymes is pseudouridine synthase 1 ( pus1p ) ( 2635 ) . pus1p modifies uridines in several regions of many different trnas ( 27,33,34 ) and one position in yeast u2 snrna ( 36 ) . it is a transcriptional coactivator in nuclear receptor signaling , modifying steroid receptor activator rna ( sra ) ( 37,38 ) , and when mutated or missing , leads to the disorder mitochondrial myopathy and sideroblastic anemia with lactic acidemia ( mlasa ) ( 3942 ) . in vivo and in vitro pus1p modifies positions 1 , 26 , 27 and 28 in many trnas and positions 34 and 36 in the anticodons of certain intron - containing trnas ( 2628,33 ) . in addition , yeast pus1p has been shown to modify positions 65 and 67 in vivo ( 34 ) and mouse ( mpus1p ) and human pus1p ( hpus1p ) modify position 30 in trnas , whereas yeast pus1p does not ( 29,33 ) . the presence of the intron in yeast pre - trna(uau ) is required for the formation of at positions 34 and 36 in the anticodon by pus1p in vitro ( 26,34 ) . the intron allows for the formation of a stem that contains the uridines to be modified ( 26,34,43 ) . residues that are modified in trna by pus1p are part of a base - paired stem , suggesting rna secondary structure is important for recognition by pus1p ( 26,27,3335 ) . even with all of the studies on pus1p , the only sequence consensus ( not requirement ) that has been proposed for pus1p is the presence of a pyrimidine nucleotide 3 of the site of modification ( 44 ) . interestingly , yeast pus1p has been shown to modify position 44 on yeast u2 snrna , a position that is considered to be in a non - base paired region of u2 snrna ( 36 ) . when mouse pus1p is expressed in a pus1 deleted yeast strain , the mouse enzyme can also modify yeast u2 snrna at the same position ( 33 ) . however , the modification of u2 snrna in caenorhabditis elegans does not require pus1p , since the loss of the pus-1 gene product in worms results in the absence of at known pus1p modification sites on trna , but has no effect on the modification of u2 snrna or other snrnas ( 28,45 ) . however , the structure of a member of the same synthase family , bacterial trua , in the presence of trna substrates , has been revealed ( 46,47 ) . trua modifies uridines at positions 3840 in many trnas and the equivalent activity in eukaryotes is associated with pseudouridine synthase 3 , another member of the trua family [ pus3p ; ( 48,49 ) ] . the substrate trna binds across a dimer of trua ( 46,47 ) . the anticodon stem - loop ( asl ) of the trna , as well as the dihydrouridine ( d ) stem and the elbow where the d and tc loops interact , contact the synthase ( 47 ) . trua did not interact with the variable ( v ) stem - loop or the acceptor stem of the trna substrate ( 47 ) . in order to begin to understand how pus1p can modify several positions in trnas and also modify other rnas such as u2 snrna and sra , we undertook an investigation of the sequence and structural requirements for hpus1p activity on human trna . the activity of hpus1p with wild - type and point and deletion mutants of the trna substrate indicates there are structural requirements in the formation of at position 28 in trna . a minimum level of base pairing in the asl ( the location of the modification ) and the presence of an additional 3 stem - loop , constitute the minimal substrate for hpus1p . even when all nucleotides in the asl stem other than u28 were changed in a single minimal substrate , but base pairing was retained , a near wild - type level of modification was observed . site - directed mutagenesis of human trna ( uga ) was performed with a quikchange ii kit ( stratagene ) , utilizing primers containing the mutations and the phts plasmid [ human trna(uga ) ; gift of h. gross ( 50 ) ] to create the mutants . the resulting constructs have a t7 rna polymerase promoter at the 5-end of the trna gene and a bstn1 site at the 3-end of the gene . plasmid dna digested with bstn1 will yield trnas with cca at the 3-terminus after transcription ( 29,50 ) . the primers used for mutagenesis are given below with just the forward primers listed ; the reverse primers are the inverse complement . the forward primer for : 27c was 5cgagtggttaaggcgctggacttgaaatcca,27 g was 5cgagtggttaaggcggtggacttgaaatcca,28c was 5gagtggttaaggcgacggacttgaaatcc used with the 42 g mutant to create 28c/42g,29c was 5gagtggttaaggcgatcgacttgaaatccatt,30c was 5gtggttaaggcgatgcacttgaaatccattg,31c was 5gtggttaaggcgatggccttgaaatccattgg,39 g was 5cgatggacttgaaagccattggggtc,40 g was 5gatggacttgaaatgcattggggtctc,41 g was 5gacttgaaatcgattggggtctcc , and used in the 29c/41 g mutant starting with 29c template,42c was 5ggacttgaaatcccttggggtctcc,42 g was 5ggacttgaaatccgttggggtctcc,43 g was 5ggacttgaaatccagtggggtctcc , and used in the 27c/43 g mutant starting with 27c template and in 27g/43 g mutant starting with the 27 g template,30c/40 g was 5gatgcacttgaaatgcattggggtctc , starting with the 30 g template,31c/39 g was 5cgatggccttgaaagccattggggtc , starting with the 31c template, d stem - loop was 5gtagtcgtggcgatggacttgaaatcc, d stem - loop with 28c/42 g was 5gtagtcgtggcgacggacttgaaatccgttggggtctcccc . 27c was 5cgagtggttaaggcgctggacttgaaatcca , 27 g was 5cgagtggttaaggcggtggacttgaaatcca , 28c was 5gagtggttaaggcgacggacttgaaatcc used with the 42 g mutant to create 28c/42 g , 29c was 5gagtggttaaggcgatcgacttgaaatccatt , 30c was 5gtggttaaggcgatgcacttgaaatccattg , 31c was 5gtggttaaggcgatggccttgaaatccattgg , 39 g was 5cgatggacttgaaagccattggggtc , 40 g was 5gatggacttgaaatgcattggggtctc , 41 g was 5gacttgaaatcgattggggtctcc , and used in the 29c/41 g mutant starting with 29c template , 42c was 5ggacttgaaatcccttggggtctcc , 42 g was 5ggacttgaaatccgttggggtctcc , 43 g was 5ggacttgaaatccagtggggtctcc , and used in the 27c/43 g mutant starting with 27c template and in 27g/43 g mutant starting with the 27 g template , 30c/40 g was 5gatgcacttgaaatgcattggggtctc , starting with the 30 g template , 31c/39 g was 5cgatggccttgaaagccattggggtc , starting with the 31c template , d stem - loop was 5gtagtcgtggcgatggacttgaaatcc , d stem - loop with 28c/42 g was 5gtagtcgtggcgacggacttgaaatccgttggggtctcccc . the digested plasmid dnas were transcribed with t7 rna polymerase in the presence of 25 ci [ 5-h]-utp ( 11.1 or 23.9 ci / mmol , moravek ) or 25 ci [ 5,6-h]-utp ( 38 ci / mmol , moravek ) with 100 m cold utp and 1.0 mm , non - labeled , atp , gtp and ctp ( 51 ) . additional rna substrates were synthesized using a sense t7 dna oligonucleotide , an antisense template oligonucleotide and high concentration t7 rna polymerase , as described ( 52,53 ) . the oligodeoxynucleotides used for this type of synthesis are listed below , note that the oligodeoxynucleotides that serve as the template for synthesis are antisense and have antisense t7 primer sequence at the 3-end . the template for the : asl stem - loop was 5aatggatttcaagtccatctatagtgagtcgtatta , asl & d stem - loops was 5atggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl & v stem - loops was 5ggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , d , & v stem - loops was 5ggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl , d , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta, tc stem - loop was 5tggcgtagtcggcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta, v stem - loop was 5 tggcgtagtcggcaggattcgaacctgcgaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta.asl & tc stem - loop mini - substrate required the following oligodeoxynucleotide template : 5gcaggattcgaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta . the small size of this mini - substrate and the fact that the first nucleotide transcribed is a the following mutations were incorporated into the oligodeoxynucleotide template to generate variations of the asl & tc stem - loop mini - substrate : ggacg starting at 61 was 5cgtccattcgaacctgcgccaatggatttcaagtccatcatagtgagtcgtatta , aagcuua in tc loop was 5gcaggtaagcttcctgcgccaatggatttcaagtccatcatagtgagtcgtatta,28c/42 g was 5gcaggattcgaacctgcgccaacggatttcaagtccgtctatagtgagtcgtatta,27c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtccagctatagtgagtcgtatta,27c/42c was 5gcaggattcgaacctgcgccaagggatttcaagtccagctatagtgagtcgtatta,27c/29c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtcgagctatagtgagtcgtatta,27c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtccagctatagtgagtcgtatta,27c/29c/42 g was 5gcaggattcgaacctgcgccaagggatttcaagtcgagctatagtgagtcgtatta,27c/29c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtcgagctatagtgagtcgtatta,27c/29c/39g/40g/42c was 5gcaggattcgaacctgcgccaaggcctttcaagtcgagctatagtgagtcgtatta,55 & 56 was 5gcaggattcacctgcgccaatggatttcaagtccatctatagtgagtcgtatta,5558 was 5gcaggatacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , gcaa inserted after 55 was 5gcaggattcgttgcaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , y for y r for r stem mini - substrate mutant was 5gcaggattcgaacctgcgccagcaagtttcaagcttacctatagtgagtcgtatta . asl stem - loop was 5aatggatttcaagtccatctatagtgagtcgtatta , asl & d stem - loops was 5atggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl & v stem - loops was 5ggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , d , & v stem - loops was 5ggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl , d , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , tc stem - loop was 5tggcgtagtcggcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta , v stem - loop was 5 tggcgtagtcggcaggattcgaacctgcgaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta . asl & tc stem - loop mini - substrate required the following oligodeoxynucleotide template : 5gcaggattcgaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta . the small size of this mini - substrate and the fact that the first nucleotide transcribed is a g , allows for efficient synthesis of rnas in vitro . the following mutations were incorporated into the oligodeoxynucleotide template to generate variations of the asl & tc stem - loop mini - substrate : ggacg starting at 61 was 5cgtccattcgaacctgcgccaatggatttcaagtccatcatagtgagtcgtatta , aagcuua in tc loop was 5gcaggtaagcttcctgcgccaatggatttcaagtccatcatagtgagtcgtatta , 28c/42 g was 5gcaggattcgaacctgcgccaacggatttcaagtccgtctatagtgagtcgtatta , 27c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtccagctatagtgagtcgtatta , 27c/42c was 5gcaggattcgaacctgcgccaagggatttcaagtccagctatagtgagtcgtatta , 27c/29c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtcgagctatagtgagtcgtatta , 27c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtccagctatagtgagtcgtatta , 27c/29c/42 g was 5gcaggattcgaacctgcgccaagggatttcaagtcgagctatagtgagtcgtatta , 27c/29c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtcgagctatagtgagtcgtatta , 27c/29c/39g/40g/42c was 5gcaggattcgaacctgcgccaaggcctttcaagtcgagctatagtgagtcgtatta , 55 & 56 was 5gcaggattcacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , 5558 was 5gcaggatacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , gcaa inserted after 55 was 5gcaggattcgttgcaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , y for y r for r stem mini - substrate mutant was 5gcaggattcgaacctgcgccagcaagtttcaagcttacctatagtgagtcgtatta . before incubation with hpus1p , the rna substrates were heated to 78c for 3 min and allowed to cool slowly to at least 37c ( 3040 min ) . substrate reactions with the synthases were carried out in 50 mm ammonium chloride , 5 mm dtt , 25 mm tris ( ph 7.5 ) and 1 mm mgcl2 . the amount of synthase used was ~200 ng at 37c for the times indicated . norit a charcoal binds all of the h counts in the sample except those that have been released to water in the process of forming . the released counts are separated from the charcoal - bound counts using a spin - x column ( costar ) , the filtrate is mixed with scintillation fluid , and the released h counts are measured on a scintillation counter . the equilibrium binding assays were carried out as described ( 32 ) using hpus1p concentrations of 0 , 50 , 100 , 200 , 400 and 800 nm in 50 l reactions , with the h - labeled rna substrates at 500 pm . the rnas were synthesized as described above except that the cold utp concentration in the synthesis reaction was 250 m . a slot - blot apparatus ( biorad ) was used for filtration of the samples , the resulting filters were air dried , cut into appropriate pieces and counted in scintillation fluid . site - directed mutagenesis of human trna ( uga ) was performed with a quikchange ii kit ( stratagene ) , utilizing primers containing the mutations and the phts plasmid [ human trna(uga ) ; gift of h. gross ( 50 ) ] to create the mutants . the resulting constructs have a t7 rna polymerase promoter at the 5-end of the trna gene and a bstn1 site at the 3-end of the gene . plasmid dna digested with bstn1 will yield trnas with cca at the 3-terminus after transcription ( 29,50 ) . the primers used for mutagenesis are given below with just the forward primers listed ; the reverse primers are the inverse complement . the forward primer for : 27c was 5cgagtggttaaggcgctggacttgaaatcca,27 g was 5cgagtggttaaggcggtggacttgaaatcca,28c was 5gagtggttaaggcgacggacttgaaatcc used with the 42 g mutant to create 28c/42g,29c was 5gagtggttaaggcgatcgacttgaaatccatt,30c was 5gtggttaaggcgatgcacttgaaatccattg,31c was 5gtggttaaggcgatggccttgaaatccattgg,39 g was 5cgatggacttgaaagccattggggtc,40 g was 5gatggacttgaaatgcattggggtctc,41 g was 5gacttgaaatcgattggggtctcc , and used in the 29c/41 g mutant starting with 29c template,42c was 5ggacttgaaatcccttggggtctcc,42 g was 5ggacttgaaatccgttggggtctcc,43 g was 5ggacttgaaatccagtggggtctcc , and used in the 27c/43 g mutant starting with 27c template and in 27g/43 g mutant starting with the 27 g template,30c/40 g was 5gatgcacttgaaatgcattggggtctc , starting with the 30 g template,31c/39 g was 5cgatggccttgaaagccattggggtc , starting with the 31c template, d stem - loop was 5gtagtcgtggcgatggacttgaaatcc, d stem - loop with 28c/42 g was 5gtagtcgtggcgacggacttgaaatccgttggggtctcccc . 27c was 5cgagtggttaaggcgctggacttgaaatcca , 27 g was 5cgagtggttaaggcggtggacttgaaatcca , 28c was 5gagtggttaaggcgacggacttgaaatcc used with the 42 g mutant to create 28c/42 g , 29c was 5gagtggttaaggcgatcgacttgaaatccatt , 30c was 5gtggttaaggcgatgcacttgaaatccattg , 31c was 5gtggttaaggcgatggccttgaaatccattgg , 39 g was 5cgatggacttgaaagccattggggtc , 40 g was 5gatggacttgaaatgcattggggtctc , 41 g was 5gacttgaaatcgattggggtctcc , and used in the 29c/41 g mutant starting with 29c template , 42c was 5ggacttgaaatcccttggggtctcc , 42 g was 5ggacttgaaatccgttggggtctcc , 43 g was 5ggacttgaaatccagtggggtctcc , and used in the 27c/43 g mutant starting with 27c template and in 27g/43 g mutant starting with the 27 g template , 30c/40 g was 5gatgcacttgaaatgcattggggtctc , starting with the 30 g template , 31c/39 g was 5cgatggccttgaaagccattggggtc , starting with the 31c template , d stem - loop was 5gtagtcgtggcgatggacttgaaatcc , d stem - loop with 28c/42 g was 5gtagtcgtggcgacggacttgaaatccgttggggtctcccc . the digested plasmid dnas were transcribed with t7 rna polymerase in the presence of 25 ci [ 5-h]-utp ( 11.1 or 23.9 ci / mmol , moravek ) or 25 ci [ 5,6-h]-utp ( 38 ci / mmol , moravek ) with 100 m cold utp and 1.0 mm , non - labeled , atp , gtp and ctp ( 51 ) . additional rna substrates were synthesized using a sense t7 dna oligonucleotide , an antisense template oligonucleotide and high concentration t7 rna polymerase , as described ( 52,53 ) . the oligodeoxynucleotides used for this type of synthesis are listed below , note that the oligodeoxynucleotides that serve as the template for synthesis are antisense and have antisense t7 primer sequence at the 3-end . the template for the : asl stem - loop was 5aatggatttcaagtccatctatagtgagtcgtatta , asl & d stem - loops was 5atggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl & v stem - loops was 5ggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , d , & v stem - loops was 5ggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl , d , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta, tc stem - loop was 5tggcgtagtcggcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta, v stem - loop was 5 tggcgtagtcggcaggattcgaacctgcgaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta.asl & tc stem - loop mini - substrate required the following oligodeoxynucleotide template : 5gcaggattcgaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta . the small size of this mini - substrate and the fact that the first nucleotide transcribed is a the following mutations were incorporated into the oligodeoxynucleotide template to generate variations of the asl & tc stem - loop mini - substrate : ggacg starting at 61 was 5cgtccattcgaacctgcgccaatggatttcaagtccatcatagtgagtcgtatta , aagcuua in tc loop was 5gcaggtaagcttcctgcgccaatggatttcaagtccatcatagtgagtcgtatta,28c/42 g was 5gcaggattcgaacctgcgccaacggatttcaagtccgtctatagtgagtcgtatta,27c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtccagctatagtgagtcgtatta,27c/42c was 5gcaggattcgaacctgcgccaagggatttcaagtccagctatagtgagtcgtatta,27c/29c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtcgagctatagtgagtcgtatta,27c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtccagctatagtgagtcgtatta,27c/29c/42 g was 5gcaggattcgaacctgcgccaagggatttcaagtcgagctatagtgagtcgtatta,27c/29c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtcgagctatagtgagtcgtatta,27c/29c/39g/40g/42c was 5gcaggattcgaacctgcgccaaggcctttcaagtcgagctatagtgagtcgtatta,55 & 56 was 5gcaggattcacctgcgccaatggatttcaagtccatctatagtgagtcgtatta,5558 was 5gcaggatacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , gcaa inserted after 55 was 5gcaggattcgttgcaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , y for y r for r stem mini - substrate mutant was 5gcaggattcgaacctgcgccagcaagtttcaagcttacctatagtgagtcgtatta . asl stem - loop was 5aatggatttcaagtccatctatagtgagtcgtatta , asl & d stem - loops was 5atggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl & v stem - loops was 5ggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatctatagtgagtcgtatta , asl , d , & v stem - loops was 5ggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , asl , d , v , & tc stem - loops was 5gcaggattcgaacctgcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggctatagtgagtcgtatta , tc stem - loop was 5tggcgtagtcggcgcggggagaccccaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta , v stem - loop was 5 tggcgtagtcggcaggattcgaacctgcgaatggatttcaagtccatcgccttaaccactcggccacgactactatagtgagtcgtatta . asl & tc stem - loop mini - substrate required the following oligodeoxynucleotide template : 5gcaggattcgaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta . the small size of this mini - substrate and the fact that the first nucleotide transcribed is a g , allows for efficient synthesis of rnas in vitro . the following mutations were incorporated into the oligodeoxynucleotide template to generate variations of the asl & tc stem - loop mini - substrate : ggacg starting at 61 was 5cgtccattcgaacctgcgccaatggatttcaagtccatcatagtgagtcgtatta , aagcuua in tc loop was 5gcaggtaagcttcctgcgccaatggatttcaagtccatcatagtgagtcgtatta , 28c/42 g was 5gcaggattcgaacctgcgccaacggatttcaagtccgtctatagtgagtcgtatta , 27c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtccagctatagtgagtcgtatta , 27c/42c was 5gcaggattcgaacctgcgccaagggatttcaagtccagctatagtgagtcgtatta , 27c/29c/39 g was 5gcaggattcgaacctgcgccaatggctttcaagtcgagctatagtgagtcgtatta , 27c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtccagctatagtgagtcgtatta , 27c/29c/42 g was 5gcaggattcgaacctgcgccaagggatttcaagtcgagctatagtgagtcgtatta , 27c/29c/39g/40 g was 5gcaggattcgaacctgcgccaatgcctttcaagtcgagctatagtgagtcgtatta , 27c/29c/39g/40g/42c was 5gcaggattcgaacctgcgccaaggcctttcaagtcgagctatagtgagtcgtatta , 55 & 56 was 5gcaggattcacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , 5558 was 5gcaggatacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , gcaa inserted after 55 was 5gcaggattcgttgcaacctgcgccaatggatttcaagtccatctatagtgagtcgtatta , y for y r for r stem mini - substrate mutant was 5gcaggattcgaacctgcgccagcaagtttcaagcttacctatagtgagtcgtatta . before incubation with hpus1p , the rna substrates were heated to 78c for 3 min and allowed to cool slowly to at least 37c ( 3040 min ) . substrate reactions with the synthases were carried out in 50 mm ammonium chloride , 5 mm dtt , 25 mm tris ( ph 7.5 ) and 1 mm mgcl2 . the amount of synthase used was ~200 ng at 37c for the times indicated . norit a charcoal binds all of the h counts in the sample except those that have been released to water in the process of forming . the released counts are separated from the charcoal - bound counts using a spin - x column ( costar ) , the filtrate is mixed with scintillation fluid , and the released h counts are measured on a scintillation counter . the equilibrium binding assays were carried out as described ( 32 ) using hpus1p concentrations of 0 , 50 , 100 , 200 , 400 and 800 nm in 50 l reactions , with the h - labeled rna substrates at 500 pm . the rnas were synthesized as described above except that the cold utp concentration in the synthesis reaction was 250 m . a slot - blot apparatus ( biorad ) was used for filtration of the samples , the resulting filters were air dried , cut into appropriate pieces and counted in scintillation fluid . as an initial investigation into the substrate requirements for hpus1p , it was important to choose a known pus1p substrate trna that has only one site modified by the enzyme ( 29,35 ) , to simplify the analysis of the activity . a trna that is typical in structure and has a v stem - loop that was > 6 nt , was preferred in order to be able to test the contribution of all structural components to substrate recognition by hpus1p . in addition , a trna with traditional watson - crick base - pairing in the asl stem was desired . the trna sequence database , trnadb ( 56,57 ) , was consulted to compile consensus sequences for the asl stem where a or u is found at position 28 in sequenced trnas from the fungi and metazoan group in trnadb . at least 36 trna sequences were compiled to generate each consensus shown in figure 1b . first , with a at position 28 , g30c40 is the most conserved base pair ( > 90% conserved ) but when a u is found at position 28 , this sequence is not as well conserved . therefore , one might expect that disruption of this base pair or replacement with the inverse ( c30g40 ) will affect modification . second , for sequenced trnas that have a at 28 , the preferred 2743 bp is u27a43 , whereas with those trnas with a u at 28 , the preferred base pair is c27g43 . third , a a31u39 base pair is more common in those asl stems that have a at position 28 than those with a u at position 28 . finally , the base pairs 2941 and 3139 , below the 2842 bp , are watson - crick only but the rest of the base pairs in the stem can have g - u pairing in either consensus . in the selection of a trna , a good match to this consensus was preferred , and human trna(uga ) meets most of the criteria . the only difference is that this trna has an a27u43 base pair instead of a u a base pair at that position ( figure 1a ) . ( a ) the sequence and proposed secondary structure of human trna(uga ) ( 50 ) . the major aspects of the secondary structure are labeled on the diagram and it is numbered without including most of the variable stem - loop . the single site of pus1p modification , position 28 , is boxed . ( b ) consensus sequences for sequenced trnas from the fungi and metazoa group in the trnadb ( 57 ) that have a or a u at position 28 . a solid line between nucleotides indicates watson - crick pairs only and a dash line indicates g u pairs ( < 50% ) are also found at this position . ( a ) the sequence and proposed secondary structure of human trna(uga ) ( 50 ) . the major aspects of the secondary structure are labeled on the diagram and it is numbered without including most of the variable stem - loop . the single site of pus1p modification , position 28 , is boxed . ( b ) consensus sequences for sequenced trnas from the fungi and metazoa group in the trnadb ( 57 ) that have a or a u at position 28 . the figure is presented in the output style from trnadb . a solid line between nucleotides indicates watson - crick pairs only and a dash line indicates g u pairs ( < 50% ) are also found at this position . the point mutations in the asl of full - length trna are diagrammed in figure 2h and were obtained by site - directed mutagenesis of the plasmid containing wild - type human trna [ phts , gift from h. gross ; ( 50 ) ] followed by in vitro transcription of linear templates ( see materials and methods section ) . time course analyses of the in vitro activity of the substrate rnas and hpus1p are presented in figure 2 ( panels a g ) , with the same wild - type trna curve in all panels ( figure 2a g ) . the formation of in this trna by hpus1p is reduced to background levels ( 0.02 mol /mol rna ) if the u at position 28 is changed to c and a42 is changed to g to preserve base pairing ( table 2 , second experiment ) . this shows that the only u converted to by hpus1p is the one at position 28 . the panels in figure 2 each contain the wild - type trna curve and either two or three curves generated with trna mutant substrates . this style allows for a simplification of the presentation and for the focus in most panels to be on 1 bp at a time . figure 2.time course experiments with single and double mutants in the asl of human trna . ( a g ) , h - labeled rnas were incubated with hpus1p for the times indicated and the amount of formed assayed . each panel has the same time course of wild - type ( wt ) trna values . each mutant is plotted separately and standard deviation ( sd ) bars are displayed for all time points . ( h ) diagram of asl point mutations made in the context of full - length trna that are presented in panels a ( a g ) , h - labeled rnas were incubated with hpus1p for the times indicated and the amount of formed assayed . each panel has the same time course of wild - type ( wt ) trna values . each mutant is plotted separately and standard deviation ( sd ) bars are displayed for all time points . ( h ) diagram of asl point mutations made in the context of full - length trna that are presented in panels a when the a at 27 is changed to c or g ( figure 2a ) , the levels of formed are not significantly different from wild - type trna . the curve that results when the u at 43 is changed to g is distinct from the wild - type trna curve but the difference is not statistically significant because of the relatively large error bars ( sd ) . mutation of the a at the position across from u28 to either c or g has little effect on time course of formed ( figure 2b ) . even though the a at position 42 is preferred ( figure 1b ) , the formation of 28 does not require canonical or even u g base pairing , something unanticipated given the consensus sequence ( figure 1b ) . when g29 is changed to c or c41 is changed to g ( figure 2c ) , there is a significant decrease in formation for both mutations in the formation of at 28 . however , when the base pair is reformed , but is now c - g in the case of the double mutant 29c/41 g , the curve obtained is indistinguishable from that of wild - type trna ( figure 2f ) . this introduction of a base - paired pyrimidine 3 to u28 did not enhance the formation of in the substrate , an expectation if a pyrimidine is preferred at position 29 , as suggested in the introduction . the consensus sequence shown in figure 1b revealed the g30c40 base pair to be highly conserved in the putative pus1p substrates with a at position 28 . it was expected that disruption of this base pair would affect the formation of by hpus1p . in fact , the 30c and 40 g mutants have significantly lower amounts of formed than wild - type trna ( figure 2d ) . if the base pair is reformed but inverted , as with the 30c/40 g double mutant , the time course of formed is the same as that of wild - type trna ( figure 2f ) . this result argues against the requirement for a g at position 30 , even though the 28 consensus suggests it ( figure 1b ) . when the base pair at a31u39 is disrupted by either the 31c or 39 g point mutations , the results are interesting . the curve of formation seen with the 31c substrate is significantly different from wild - type trna ( figure 2e ) , but with the 39 g mutant the curve mimics that seen with wild - type trna ( figure 2e ) . reforming the base pair with the 31c/39 g double mutant results in a curve that matches that of wild - type trna ( figure 2f ) . the only difference between the 28 consensus stem ( figure 1b ) and the stem of the trna ( figure 1a ) is the 2743 bp , which is a u in trna . the formation curves for the 27c , 27 g and 43 g mutants were not significantly different from wild - type trna ( figure 2a ) . this would suggest that the enzyme does not require a base pair at 2743 , and may in fact be indifferent to the presence of a base pair . that statement was supported by the formation curve seen with the 27g/43 g double mutant , which was not significantly different from the curve seen with wild - type trna ( figure 2 g ) , even though there is no canonical base pair formed . the results with the double mutant 27c/43 g , which would form a stronger base pair than the wild - type a u , are also not significantly different from wild - type trna ( figure 2 g ) even though this mutant now mimics the u28 consensus in figure 1b . equilibrium dissociation constants ( kd ) were determined for wild - type trna and the single- and double - mutant substrates found in the panels of figure 2 . the means and standard deviations of two separate kd determinations are presented in table 1 and that of wild - type trna ( 240 nm ) agrees with a previous determination of the kd ( 250 nm ) of hpus1p and yeast pre - trna ( 29 ) . all of the mutants have a higher mean kd than wild - type , with all but 41 g and 43 g > 300 nm . there is not a correlation between the formation levels and the kds for the mutants . it is interesting to note that a trna that is not a substrate for hpus1p , such as the 28c/42 g double mutant , binds to the enzyme with a mean kd of 332 nm . this was also as seen previously with yeast pus1p and a non - substrate trna ( 31 ) . table 1.equilibrium dissociation constants ( kd ) of hpus1p with various rnasrna substratekd mean ( sd)wild - type trna240 ( 14 ) nmsingle point mutants in trna 27c328 ( 46 ) nm 27g370 ( 14 ) nm 29c408 ( 11 ) nm 30c335 ( 120 ) nm 31c358 ( 53 ) nm 39g380 ( 28 ) nm 40g305 ( 49 ) nm 41g282 ( 18 ) nm 42c360 ( 57 ) nm 42g338 ( 46 ) nm 43g248 ( 32 ) nmdouble mutants in trna 27c/43g302 ( 39 ) nm 27g/43g375 ( 7 ) nm 28c/42g332 ( 18 ) nm 29c/41g328 ( 74 ) nm 30g/40c345 ( 21 ) nm 31c/39g315 ( 92 ) nmlisted are the means and standard deviations ( sd ) of two separate binding experiments of hpus1p and the substrates listed ( see materials and methods section for details ) . equilibrium dissociation constants ( kd ) of hpus1p with various rnas listed are the means and standard deviations ( sd ) of two separate binding experiments of hpus1p and the substrates listed ( see materials and methods section for details ) . in order to identify additional recognition elements of the hpus1p substrate , stem or stem - loop deletions of , and mini - substrates derived from trna , were tested in the formation assay . these mutant substrates were generated either by site - directed mutagenesis of phts and subsequent in vitro transcription or by in vitro transcription using oligodeoxynucleotide templates [ see materials and methods section ; ( 53 ) ] . it is understood that , with the deletion of whole stem - loops or the creation of mini - substrates , the tertiary structure of the entire trna is affected , but surprisingly , many of these mutants can function as substrates for hpus1p . the results for 120 min incubations are listed in table 2 relative to the activity seen with wild - type trna . if the d stem - loop is missing in the substrate , there is no decrease in hpus1p activity at position 28 . if the u at position 28 in the d stem - loop mutant is changed to c ( and the a at 42 is changed to g ) so that can not be formed at position 28 , there is essentially no formation ( 2% of wild - type trna formation , see table 2 ) . this result indicates the level of formation seen with the d stem - loop mutant is not due to formation at an additional site created by an altered secondary structure in the deletion mutant . if the tc stem - loop is missing from the trna , there is a significant reduction in the formation of at u28 ( 15% of wild - type trna levels , table 2 ) but the reduction is not as substantial when the v stem - loop is missing ( 67% of wild - type , table 2 ) . table 2.activity of hpus1p on trna(uga ) point and deletion mutants and mini - substratesrna substratemole /mole rna ( sd)percent of wild - type ( sd)wild - type human trna0.60 ( 0.08)100 ( 13) tc stem - loop ( deleted nucleotides 5973)0.09 ( 0.05)15 ( 8) variable stem - loop ( deleted nucleotides 4556)0.40 ( 0.08)67 ( 13)wild - type human trna0.43 ( 0.07)100 ( 16)28c/42 g ( no formation expected)0.02 ( 0)5 ( 0) d stem - loop ( deleted nucleotides 1124)0.44 ( 0.16)102 ( 37) d stem - loop with 28c/42g0.01 ( 0.01)2 ( 2)wild - type human trna0.68 ( 0.02)100 ( 3)asl stem loop alone ( includes nucleotides 2643)0.02 ( 0.01)3 ( 1)asl & d stem - loops ( includes nucleotides 1043)0.07 ( 0.01)10 ( 1)asl & v stem - loops ( includes nucleotides 2647)0.05 ( < 0.01)7 ( 1)asl , d , & v stem - loops ( includes nucleotides 1047)0.14 ( < 0.01)21 ( 1)asl , v , & tc stem - loops ( includes nucleotides 2665)0.48 ( 0.04)71 ( 6)asl , d , v , & tc stem - loops ( includes nucleotides 765)0.64 ( 0.16)94 ( 24)activities are from 2-h incubations , an average of two assays , with duplicate samples , and reported as mol /mol rna and as the percent of the level seen with wild - type trna(uga ) with the standard deviation ( sd ) also reported as percent of wild - type . these results are grouped as separate experiments with a separate wild - type control for each experiment . activity of hpus1p on trna(uga ) point and deletion mutants and mini - substrates activities are from 2-h incubations , an average of two assays , with duplicate samples , and reported as mol /mol rna and as the percent of the level seen with wild - type trna(uga ) with the standard deviation ( sd ) also reported as percent of wild - type . these results are grouped as separate experiments with a separate wild - type control for each experiment . when a mini - substrate of just the asl stem - loop was incubated with hpus1p , formation was at background levels for 2 h of incubation ( 3% of wild - type levels , table 2 ) . in addition , if either the d stem - loop or the v stem - loop was combined with the asl stem - loop , there was little increase in the amount of formed ( 10% and 7% , respectively , of the formation seen in 120 min with wild - type trna , table 2 ) . this implies that adding a single stem - loop to the 5 or 3 side of the asl stem - loop does not constitute an efficient substrate for hpus1p . if both the d and v stem - loops are added to the asl stem - loop there is a noticeable increase in formed but it is still low ( 21% ) compared to wild - type trna . when the tc stem - loop was combined with the v and asl stem - loops , there was a substantial level of hpus1p activity ( 71% of wild - type trna levels of ) . with just the acceptor stem missing from trna ( asl , d , v and tc stem - loops present ) , the activity is essentially the same as with wild - type trna ( 94% of wild - type formation at 120 min , table 2 ) . these results suggest that the secondary structure of the trna is very important for the modification at position 28 , and a minimal substrate could be created by simply connecting the asl and tc stem - loop as diagrammed ( figure 3a ) . the numbering on the diagram is consistent with full - length trna to allow comparisons with the results reported in figure 2 and table 2 . the level of formation at position 28 in this minimal substrate ( wild - type asl & tc mini - substrate ) was ~0.60 mol /mol rna after 2 h of incubation , a substantial level of modification ( table 3 ) . a mini - substrate incorporating a 28c/42 g double mutation was used in a separate experiment with little or no formation observed ( table 3 ) , providing evidence that in this mini - substrate , the u at position 28 is the only one being converted to , as expected . ( a ) predicted structure of the asl & tc stem loop mini - substrate , retaining the numbering found on the full - length trna and indicating the position of the formed . the structure for the y for y r for r stem mini - substrate mutant and the c28 mutant are also shown . ( b ) diagram of the possible base pairing in the asl stem mutants in the mini - substrate listed in table 3 . the activities in percent of the level observed with wild - type asl & tc stem - loop mini - substrate without the sd are listed above the diagrams . table 3.activity of hpus1p on the wild - type asl & tc stem - loop mini - substrate and mutantsrna substratemole /mole rna ( sd)mole /mole rna ( sd)percent of wild - type ( sd)wild - type asl & tc stem - loop mini - substrate0.60 ( 0.11)0.54 ( 0.16)100 ( 18 ) ( 30)28c/42 g ( no u at expected site of formation)0.01 ( 0.01)2 ( 2)27c/42c0.48 ( 0.04)80 ( 7)27c/39g0.24 ( 0.05)40 ( 8)27c/29c/39g0.10 ( 0.03)17 ( 5)27c/29c/42c0.04 ( 0.01)7 ( 2)27c/39g/40g<0.01 ( 0.01)2 ( 2)27c/29c/39g/40g0.02 ( 0.03)3 ( 5)27c/29c/39g/40g/42c0.02 ( < 0.01)3 ( 2)55 & 560.37 ( 0.10)62 ( 17)55580.17 ( 0.06)28 ( 10)gcaa inserted between 55 and 560.46 ( 0.04)77 ( 7)wild - type asl & tc stem - loop mini - substrate0.30 ( 0.04)100 ( 13)ggacg starting at 610.22 ( 0.03)73 ( 10)aagcuua in tc loop0.34 ( 0.04)113 ( 13)activities are from 2-h incubations , an average of two assays with duplicate samples , and reported as mol /mol rna and as the percent of the level seen with wild - type asl & tc stem loop mini substrate , with the standard deviation ( sd ) also reported as percent of wild - type . all of the listed mutants are in the context of the asl & tc stem - loop mini - substrate . ( a ) predicted structure of the asl & tc stem loop mini - substrate , retaining the numbering found on the full - length trna and indicating the position of the formed . the structure for the y for y r for r stem mini - substrate mutant and the c28 mutant are also shown . ( b ) diagram of the possible base pairing in the asl stem mutants in the mini - substrate listed in table 3 . the activities in percent of the level observed with wild - type asl & tc stem - loop mini - substrate without the sd are listed above the diagrams . activity of hpus1p on the wild - type asl & tc stem - loop mini - substrate and mutants activities are from 2-h incubations , an average of two assays with duplicate samples , and reported as mol /mol rna and as the percent of the level seen with wild - type asl & tc stem loop mini substrate , with the standard deviation ( sd ) also reported as percent of wild - type . all of the listed mutants are in the context of the asl & tc stem - loop mini - substrate . concentrating on the asl stem , a number of mutant substrates were synthesized that pick up where the previous mutations in the full length trna ( figure 2 and table 2 ) left off . the asl stem of trna has five watson - crick base pairs and the mini - substrate mutants listed in table 3 were designed to eliminate two or more of those base pairs in each mutant . the base pairs that may still form in each mutant are diagrammed in figure 3b and the levels of activity , as a percentage of the activity observed with the wild - type asl & tc mini - substrate , are given in table 3 and figure 3b . when there is no base - pairing in the stem there is little formation of , and the possibility of 1 or even 2 bp in the stem , does not substantially elevate the amount of formed . however , with the 27 c/42c mutant substrate , which has 3 bp in the stem below the site of modification , 80% of the level seen with the wild - type asl & tc mini - substrate was observed . the level of formation by hpus1p on the 27c/39 g mutant substrate was only 40% , even though it too has 3 bp in the stem . with respect to the tc stem - loop , if the nucleotides at 55 and 56 are deleted in this asl & tc mini - substrate , there is a decrease in formation relative to the wild - type asl & tc mini - substrate ( 62% of wild - type trna , table 3 ) . if the size of the tc loop is reduced further ( 5558 ) the resulting substrate is a poor one , just 28% of wild - type levels of were observed ( table 3 ) . if 4 nt ( gcaa ) are inserted into the tc loop to make it larger , the substrate still allows for a significant amount of to be formed ( 77% of wild - type asl & tc mini - substrate levels ) . in a separate experiment , if watson - crick base - pairing is disrupted in the tc stem , with the sequence ggacg starting at nucleotide 61 , the level of hpus1p activity was also substantial ( 73% or wild - type asl & tc mini - substrate levels ) , suggesting a stem loop is not required . if the sequence of the tc loop was replaced with its complement ( aagcuua ) , the amount of formed at position 28 was 113% of wild - type asl & tc mini - substrate levels , suggesting that any loop of at least 5 nt will suffice . to summarize the results from the mutation and deletion studies , the levels of formation with the single and double mutants in the context of the full - length trna suggest that the sequence of the asl stem is not an absolute determinant of hpus1p activity , except of course that there must be a u at position 28 to modify ( tables 2 and 3 ) . the preference for a pyrimidine 3 to the site of modification ( at position 29 ; see introduction section ) was not confirmed since even though the 29 c single mutant showed a decreased amount of formed and the double mutant 29 c/41 g exhibited an almost identical curve as wild - type trna , suggesting that a pyrimidine is not preferred , only the base pair . the point mutations in full - length trna show that the base pairing below the modified position ( u28 ) affects formation , whereas the 27 a the results with the asl & tc stem loop mini - substrate mutants also showed that the base pairs below u28 were the most critical . the sequence of the stem nucleotides is of less importance than the presence of base pairs , which agrees with the fact that known substrates of pus1p exhibit no absolute sequence requirement ( 26,27,3335 ) . in terms of the requirements for a particular secondary structure of trna , the d - stem loop and acceptor stem are dispensable for formation at u28 . in fact , a single stem loop , 3 to the asl , is all that is required for substantial formation at position 28 . the sequence , and possibly the structure of this additional rna , is not constrained . given the above summary of the mutation experiments , a mini - substrate where all of the nucleotides in the asl stem have been changed , except of course for the u at position 28 which is modified , should be a substrate for hpus1p . a substrate fitting this description ( figure 3a ) , along with another where the u at position 28 was changed to c , were incubated with hpus1p and assayed for activity . the y for y r for r stem mini - substrate mutant has a replaced by g , g replaced by a , c replaced by u , and u replaced by c when compared with the wild - type asl & tc mini - substrate , except at position 28 . the 28 c mutant has complete replacement of the stem sequence , and should not be modified by hpus1p . the results with these substrates , as well as with the wild - type asl & tc mini - substrate , are presented in table 4 and show that this mutant is modified by hpus1p ( 0.33 mol /mol rna ) at 80% of wild - type levels for this experiment . in addition , the 28c mutant is not modified ( 0.01 mol /mol rna ; 2% of wild - type levels ) , proving that only the u at position 28 is modified . so , even though all the asl stem nucleotides in the mutant are different from the wild - type trna asl stem , and there is a u28g42 base pair in the mutant , the u at position 28 is converted to at near wild - type levels . table 4.activity of hpus1p with wild - type asl & tc stem - loop mini - substrate and stem sequence mini - substrate mutantsrna substratemole /mole rna ( sd)percent of wild - type ( sd)wild - type asl & tc stem - loop mini - substrate0.41 ( 0.05)100 ( 12)y for y r for r stem mini - substrate mutant 27g/29a/30a/31g/39c/40u/41u/42g/43c0.33 ( 0.02)80 ( 5)y for y r for r stem mini - substrate 28c mutant 27g/28c/29a/30a/31g/39c/40u/41u/42g/43c0.01 ( 0.01)2 ( 2)activities are from 2-h incubations , an average of three separate assays , and reported as mol /mol rna and as the percent of the level seen with wild - type asl & tc stem loop mini substrate , with the standard deviation ( sd ) also reported as percent of wild - type . all of the listed mutants are in the context of the asl & tc stem - loop mini - substrate . activity of hpus1p with wild - type asl & tc stem - loop mini - substrate and stem sequence mini - substrate mutants activities are from 2-h incubations , an average of three separate assays , and reported as mol /mol rna and as the percent of the level seen with wild - type asl & tc stem loop mini substrate , with the standard deviation ( sd ) also reported as percent of wild - type . all of the listed mutants are in the context of the asl & tc stem - loop mini - substrate . a number of studies have determined the sites in trnas that are modified by pus1p ( 26,27,29,33,34 ) . yeast and mammalian pus1p are the most extensively studied and in vivo and in vitro , the enzymes are responsible for the formation of at positions 27 and 28 in many trnas , at 34 and 36 in certain intron containing trnas , and at position 1 in a few substrates ( 29,33,34 ) . the yeast enzyme can also modify uridine at positions 26 , 65 and 67 in vivo but not in vitro ( 34 ) . when the mouse enzyme was expressed in a pus1 yeast strain , position 26 was not modified , and the modification states of positions 65 and 67 were not determined ( 33 ) . sequenced human trnas do not have at positions 26 , 65 , or 67 ( 58 ) , so it is unlikely mpus1p or hpus1p exhibit activity at these sites in vivo . the mammalian enzymes do modify position 30 in a few trnas but the yeast enzyme lacks this activity ( 29,33 ) . for the purposes of the discussion of the current results , the modification at positions 27 and 28 will be considered , since these are formed in vitro in a number of substrates by the mammalian enzymes ( 27,33,35 ) . nearly all ( 17 out of 18 ) of the sequenced yeast and human trnas that have a u at position 27 have converted it to ( 58 ) . however , in the six sequenced yeast trnas that have a u at position 28 , the three that have a 27c43 g base pair lack at position 28 , whereas , the other three have a 2743a base pair and a at position 28 ( 58 ) . this completely agrees with the two consensus sequences shown in figure 1b . in the sequenced human trnas with a u at 28 ( eight total ) three of the trnas have a 2743a base pair , two have a at position 28 , but one does not . a human trna with an 27a43u base pair does have a at position 28 ( 58 ) , suggesting that an u a or a u base pair at 2743 allows for formation at 28 , whereas a 27c43 g base pair is not conducive to formation at position 28 . however , with the four remaining trnas , which have a 27c43 g base pair , two have a at position 28 and two do not ( 58 ) . the current finding that the loss of base pairing at , or the presence of , a c g base pair at 2743 does not significantly affect the formation of at position 28 in trna , correlates with the data from human trnas . human mitochondrial trna is known to be a substrate of hpus1p in vivo ( 41 ) but the sequence of the stem only matches the 28 consensus at the 2743 and 2842 bp . finally , the y for y r for r stem mini - substrate mutant is an efficient substrate for hpus1p in vitro , even though the sequence in the stem does not match the consensus at any position except 28 ( figure 3a and table 4 ) . there must be other determinants allowing for or suppressing formation in these other trnas with a u at 28 . the uridine to be modified does not have to participate in watson - crick base - pairing but nucleotides participating in base - pairing 3 to the modified position appear to be required to constitute an efficient substrate . these results correlate well with the observation that , in vivo , yeast pus1p formed at position 26 in yeast trna(cca ) , where the uridine is in the hinge between the d stem - loop and the asl , and is followed by 5 bp in the asl stem ( 33 ) . in addition , both yeast and mouse pus1p modify the uridine in position 1 on yeast trna(acg ) , with base pairing present in the acceptor stem 3 to the position of modification ( 33 ) . and finally , yeast and mammalian pus1p modifies several uridines in the extensively base - paired asl of yeast pre - trna(uau ) in vitro and in vivo ( 27,29,33 ) . the lack of a strict substrate sequence requirement for hpus1p can be contrasted with the rigid recognition motif of yeast pseudouridine synthase 7 ( pus7p ) , another synthase that can recognize more than one site in trna and other types of rna ( 44 ) . with pus7p there is an absolute requirement for a u at 2 and an a at + 1 relative to the uridine modified ( 44 ) . of the sequenced yeast and human trnas , all that have the proscribed pus7p recognition sequence ( 17 total ) the other site - specific synthases modify only one site in trnas ( pseudouridine synthases 4/10 , 6 , 8/9 ) or one small region in many trnas ( pus3p ) ( 48,49,5962 ) . with these latter synthases the local trna structure appears to be a determining factor for substrate recognition when one considers the results of trua ( pus3p homolog ) and trub ( pseudouridine synthase 4 homolog ) structural studies ( 46,47,63,64 ) . given the requirement that the uridine to be modified be in a base - paired stem , why is the uridine at position 44 in yeast u2 snrna modified by pus1p ( 33 ) when that position is not considered to be in a region that is base paired ? yeast pus1p can modify u2 snrna in vitro and in vivo , but mpus1p only modifies u44 on u2 snrna in vivo , in a pus1 strain ( 33,36 ) . an alternative structure , perhaps in the ribonucleoprotein particle where u44 is base - paired , may form in vivo . it is also possible that another rna , such as a snorna , base pairs in the region of u44 and forms a stem that can be recognized by yeast or mouse pus1p . it is interesting to note that formation in u2 snrna in c. elegans is not dependent on pus1p activity ( 28 ) . the results with mutations in the tc stem - loop suggest that there is a minimum size requirement for this loop but the actual sequence , or base pairing in the stem , are not critical . a minimum size requirement may be a reason that the v stem - loop of trna(uga ) does not substitute for the tc stem - loop when combined with the asl . the v stem - loop in trna(uga ) is predicted to have only 3 nt in the loop . the fact that the tc stem - loop is separated from the asl by 4 nt in the mini - substrate and the v stem - loop has no separation , may also be a factor in why the tc stem - loop can participate in creating a mini - substrate that is recognized by hpus1p . the only synthase in the trua family that has been crystallized is bacterial trua ( see above ) and the structures were obtained in the presence of substrate trnas ( 46,47 ) . trua is a dimer and makes contact with the asl ( positions 3840 are modified if a u is present at those sites ) , the d stem , and the elbow where the d and tc loops interact . the v loop or stem - loop and the acceptor stem did not interact with trua ( 47 ) . in this report the d stem - loop of trna(uga ) was found to be dispensable for hpus1p activity , as was the acceptor stem , but the absence of the v stem - loop from the trna does reduce the amount of formed . in this trna substrate , the tc stem - loop appears to be the more critical component for recognition by hpus1p . therefore , even though there is considerable homology between trua and hpus1p , the substrate contacts with the protein are probably different . yeast pus1p has been shown to be a monomer when bound to trna ( 30 ) and it is reasonable to assume the substrate / enzyme interactions will be fundamentally different between trua and pus1p . crystal structures for any of the pus1p proteins in the presence of trna substrates will go a long way towards reconciling these differences . with what appear to be relatively lax requirements for substrate recognition in trna , what prevents other uridines , such as those at 39 , 43 , 44 , 63 , or 70 in trna ( figure 1a ) from being modified by hpus1p in vitro ? modifications in the asl ( 26 , 27 , 28 , 30 ) of all natural substrates of pus1p are only found on the 5 side of the stem . this specificity is most likely due to the presentation of this side of the asl to the enzyme 's active site cleft , in much the same way the opposite side of the stem is presented to trua for modification of positions 3840 ( 47 ) . this flipping of the orientation of the substrate in the active site cleft could explain why the tc stem - loop is a critical part of the recognition motif for hpus1p rather than the d stem - loop . these other sites that have uridines in a stem are not recognized because they are not presented in a conformation compatible with placing the uridine in the active site . additional natural and mini - substrates will need to be studied to refine the parameters of hpus1p substrate recognition to construct a recognition site that can be used to narrow down the possible modification sites in sra , a relatively large , non - trna substrate of pus1p , where most of the actual residues have not been identified ( 37,38 ) , or to identify additional substrates . the known substrates of pus1p may just be the tip of the iceberg of actual rna substrates for this enigmatic enzyme . national institutes of health ( grant number dk074368 - 01 ) ; south carolina honors college at the university of south carolina ( undergraduate research fellowship and thesis preparation grants to b.s.s . ) .

pseudouridine synthase 1 ( pus1p ) is an unusual site - specific modification enzyme in that it can modify a number of positions in trnas and can recognize several other types of rna . no consensus recognition sequence or structure has been identified for pus1p . human pus1p was used to determine which structural or sequence elements of human trnaser are necessary for pseudouridine ( ) formation at position 28 in the anticodon stem - loop ( asl ) . some point mutations in the asl stem of trnaser had significant effects on the levels of modification and compensatory mutation , to reform the base pair , restored a wild - type level of formation . deletion analysis showed that the trnaser tc stem - loop was a determinant for modification in the asl . a mini - substrate composed of the asl and tc stem - loop exhibited significant formation at position 28 and a number of mutants were tested . substantial base pairing in the asl stem ( 3 out of 5 bp ) is required , but the sequence of the tc loop is not required for modification . when all nucleotides in the asl stem other than u28 were changed in a single mutant , but base pairing was retained , a near wild - type level of modification was observed .

INTRODUCTION MATERIALS AND METHODS Isolation of recombinant hPus1p and site directed mutagenesis of tRNA RNA synthesis, the tritium-release assay and binding assays RESULTS DISCUSSION FUNDING

midfacial defects are classified as midline midfacial defects , that include the nose and/or upper lip ; and lateral defects , which include the orbital contents and cheek . facial prosthesis is generally considered over surgical reconstruction to restore function and appearance in patients with facial defects that resulted from cancer resection.1,2 the health of the patient might not permit to undergo another surgery . an intraoral prosthesis such as an obturator is often needed to restore mastication , speech and improves patient appearance.3 fabrication of an extra oral facial prosthesis is a challenging task as it tests the creative ability of the prosthodontist . the choice of material for extraoral prosthesis depends on the need to engage desirable undercuts , mobility of tissue bed , defect size and the weight of the prosthesis . it may be retained by means of medical grade adhesives , resilient attachments , clips and osseointegrated implants . it can also be connected to obturator by magnets.4 this clinical report highlights the rehabilitation of a lateral midfacial defect with a two piece prosthesis that included an intraoral obturator and extra oral facial prosthesis with the use of magnets . a 55-year - old man reported to the department of maxillofacial prosthodontics for a definitive prosthetic rehabilitation with a surgical defect subsequent to radical surgery involving subtotal maxillectomy of left side performed six months before ( figs . radiological examinations revealed loss of floor of left orbit and left half of the maxilla along with the teeth . speech intelligibility and deglutition were severely affected since the patient 's tongue could not make effective functional contacts due to lack of anatomic boundaries during speech and deglutition . fabrication of such prosthesis was planned in two sections to close the intraoral defect and create a partition between the oral cavity and nasal cavity for facilitating speech and deglutition . firstly the extra oral prosthesis was fabricated , followed by fabrication of intraoral obturator prosthesis . a facial moulage impression was made with irreversible hydrocolloid ( algitex , dpi , mumbai , india ) to record the facial defect along with surrounding normal structures ( fig . 2 ) . opened gauze squares were placed on the alginate for mechanical retention for the rigid plaster backing ( 0.25 inch ) , which is necessary for removal of the impression without distortion . when the plaster sets the impression is removed and a definitive cast was poured with type ii gypsum ( kalstone ; kalabhai karson , mumbai , india ) . the facial prosthesis was sculpted with base plate wax and a magnet ( cobalt - samarium , ambica corporation , new delhi , india ) was attached to it on the defect side . the wax pattern with the magnet was evaluated by positioning it on the patient 's face . investing of the wax pattern was done in type ii gypsum to form a mold for packing the silicone . after complete dewaxing , a silicone adhesive ( 2-butanone , voco , germany ) was applied on the magnet . the prosthesis was packed with silicone ( maxillofacial silicone system , factor ii , lakeside , az , usa ) and colored using intrinsic stains and flocks ( silicone coloring kit ; factor ii , lakeside , az , usa ) selected to match the patient 's skin color . after deflasking and finishing , extrinsic stains were applied and the prosthesis was fitted with medical grade adhesive to flush the borders of the prosthesis with the skin ( fig . a preliminary impression of remaining maxillary arch along with the palatal defect was made in irreversible hydrocolloid impression ( algitex , dpi , mumbai , india ) material and a diagnostic cast was retrieved out of it . after adapting a layer of wax spacer an auto polymerizing resin tray was fabricated . definitive impression was made using a medium viscosity poly ( vinyl siloxane ) impression material ( reprosil ; dentsply , konstanz , germany ) and poured in type iii gypsum to get the master cast . a sheet of baseplate wax was adapted and contoured over the framework and jaw relations were recorded . after try - in the waxed - up obturator was made hollow and processed in heat - polymerizing acrylic resin . hollowing of the bulb was done by lost salt technique while the part under the teeth was hollowed with putty viscosity poly ( vinyl siloxane ) impression material ( express xt vps impression materials , 3 m , new delhi , india ) . after processing an aperture was made on the mesial aspect of the bulb and posterior to molar tooth to remove the salt and putty , thus making the obturator hollow ( figs . 4a and 4b ) . cobalt samarium magnet was attached on the supero - lateral aspect of the bulb with autopolymerizing resin so that it can contact the magnet on the extraoral prosthesis for mutual retention ( fig . movement of the prosthesis was minimized by maximal distribution of the occlusal force in centric and eccentric jaw positions . premature occlusal contacts were eliminated and wide distribution of stabilizing components resulted in diminished stress created by horizontal forces . the patient experienced marked improvement in speech intelligibility and deglutition after the placement of the intraoral obturator ( figs . 6 and 7 ) . during the prosthesis insertion appointment the maxillary obturator was placed intraorally and the facial prosthesis was positioned extraorally against the obturator magnet . a facial moulage impression was made with irreversible hydrocolloid ( algitex , dpi , mumbai , india ) to record the facial defect along with surrounding normal structures ( fig . 2 ) . opened gauze squares were placed on the alginate for mechanical retention for the rigid plaster backing ( 0.25 inch ) , which is necessary for removal of the impression without distortion . when the plaster sets the impression is removed and a definitive cast was poured with type ii gypsum ( kalstone ; kalabhai karson , mumbai , india ) . the facial prosthesis was sculpted with base plate wax and a magnet ( cobalt - samarium , ambica corporation , new delhi , india ) was attached to it on the defect side . the wax pattern with the magnet was evaluated by positioning it on the patient 's face . investing of the wax pattern was done in type ii gypsum to form a mold for packing the silicone . after complete dewaxing , a silicone adhesive ( 2-butanone , voco , germany ) was applied on the magnet . the prosthesis was packed with silicone ( maxillofacial silicone system , factor ii , lakeside , az , usa ) and colored using intrinsic stains and flocks ( silicone coloring kit ; factor ii , lakeside , az , usa ) selected to match the patient 's skin color . after deflasking and finishing , extrinsic stains were applied and the prosthesis was fitted with medical grade adhesive to flush the borders of the prosthesis with the skin ( fig . a preliminary impression of remaining maxillary arch along with the palatal defect was made in irreversible hydrocolloid impression ( algitex , dpi , mumbai , india ) material and a diagnostic cast was retrieved out of it . after adapting a layer of wax spacer an auto polymerizing resin tray was fabricated . definitive impression was made using a medium viscosity poly ( vinyl siloxane ) impression material ( reprosil ; dentsply , konstanz , germany ) and poured in type iii gypsum to get the master cast . a sheet of baseplate wax was adapted and contoured over the framework and jaw relations were recorded . after try - in the waxed - up obturator was made hollow and processed in heat - polymerizing acrylic resin . hollowing of the bulb was done by lost salt technique while the part under the teeth was hollowed with putty viscosity poly ( vinyl siloxane ) impression material ( express xt vps impression materials , 3 m , new delhi , india ) . after processing an aperture was made on the mesial aspect of the bulb and posterior to molar tooth to remove the salt and putty , thus making the obturator hollow ( figs . 4a and 4b ) . cobalt samarium magnet was attached on the supero - lateral aspect of the bulb with autopolymerizing resin so that it can contact the magnet on the extraoral prosthesis for mutual retention ( fig . 5 ) . movement of the prosthesis was minimized by maximal distribution of the occlusal force in centric and eccentric jaw positions . premature occlusal contacts were eliminated and wide distribution of stabilizing components resulted in diminished stress created by horizontal forces . the patient experienced marked improvement in speech intelligibility and deglutition after the placement of the intraoral obturator ( figs . 6 and 7 ) . during the prosthesis insertion appointment the maxillary obturator was placed intraorally and the facial prosthesis was positioned extraorally against the obturator magnet . it causes difficulty in deglutition , nasal regurgitation , loss of speech intelligibility and unesthetic appearance , leading to significant psychological problems . with acceptable cosmetic results , a reduced amount of retention can handicap the prosthesis . unlike a conventional prosthesis , additional factors should be taken into consideration such as method of impression , materials to be used in laboratory procedures , prosthesis design , method of connection , direction of insertion and removal , esthetic factors , and maintenance protocol . with the understanding of the remaining anatomic structures , intraoral and extraoral prostheses that mutually retain one various methods of retention for facial prostheses have been described in the literature ; they include eyeglasses , eye patches , extensions from the denture that engage desirable tissue undercuts , medical grade adhesives , magnets , and osseointegrated implants.5 - 7 the introduction of rare - earth permanent magnets made of alloys such as neodymium - ferro - boron and samarium cobalt has resulted in magnets of very small dimensions . tarnish and corrosion can be overcome by coating these magnets with nickel , gold and titanium.8 although osseointegrated implants may provide the most reliable prosthesis retention but additional surgeries , expenses , inadequate available bone , and prior radiation to the area may contraindicate this type of treatment.9,10 mutual retention of the intra- and extra- oral prosthesis can be successfully achieved through magnets . the force needed to separate magnets was designated as breakaway load expressed in terms of grams . the value of breakaway load is inversely proportional to the distance of separation and inclination between the magnets . these magnets are wholly biocompatible in the human body and exert no deleterious effects in human tissue . inert magnetic field is harmless to human body and can be safely used for patients with cardiac pacemaker . there may be a gradual decrease in retentive force upon usage while some open field uncoated magnet exhibits significant cytotoxic effects which may be attributed to the release of corrosion by products from them . the cast - metal framework improves retention , stability , support and bracing of the prosthesis and thus increases prosthesis longevity . problem of two piece prosthesis is that the mobility of intraoral obturator can make facial prosthesis mobile especially during functions but the light weight of the prosthesis can alleviate this problem.11 many methods and materials have been used to fabricate a hollow obturator such as salt , sugar and ice . a lightweight prosthesis which was fabricated in this case by lost salt technique and putty not only counteracted forces due to gravity but also enhanced speech intelligibility.12,13 the rehabilitation of a patient with a combined intraoral - extra oral defect has been presented . a two - piece prosthesis that included an intraoral obturator and extra oral facial prosthesis was fabricated .

facial prosthesis is generally considered over surgical reconstruction to restore function and appearance in patients with facial defects that resulted from cancer resection . retention of the prosthesis is challenging due to its size and weight . retention can be achieved by using medical grade adhesives , resilient attachments , clips and osseointegrated implants . it can also be connected to obturator by magnets . this clinical report highlights the rehabilitation of a lateral midfacial defect with a two piece prosthesis that included an extra oral facial prosthesis and an intraoral obturator with the use of magnets .

INTRODUCTION CASE REPORT Fabrication of extraoral prosthesis Fabrication of intraoral obturator prosthesis DISCUSSION CONCLUSION

the incidence of well - differentiated thyroid carcinoma , particularly papillary cancer , has been increasing since the last 2030 years . the surveillance , epidemiology and end results ( seer ) database shows more than a 2-fold increase in thyroid cancer since 1995 . an important contributing factor for the increased incidence of such well - differentiated cancers is the increasing diagnostic rates of papillary thyroid microcarcinoma ( ptm ) . other factors such as iodination programmes in low iodine intake areas , detailed histopathological examination of the excised thyroid tissue , and the increase in bilateral total excision of the thyroid gland during thyroid surgery have also been attributed to the increasing rates of large ( > 10 mm ) and micropapillary carcinoma [ 25 ] . a vast majority of ptm cases are incidentally determined on postoperative histopathological examination of the excised thyroid tissue for the surgical treatment of benign thyroid disorders . incidental ptm ( i - ptm ) is a tumour focus that is clinically unsuspected before thyroid surgery and is identified in the final pathological examination of a thyroidectomy specimen . therefore , several controversies regarding the need for completion surgery for excision of the remaining thyroid tissue and lymph nodes exist . the objectives of this study were to describe the incidence and clinical / pathological characteristics of ptm and discuss our experience with i - ptm cases in an endemic goitre area . the study involved 395 surgical patients with benign disease of the thyroid , without any diagnosis of preoperative malignancy . a total of 37 patients with ptm incidentally diagnosed on postoperative histopathological examination of the excised thyroid tissue were analysed for assessing the rate of incidental diagnosis of ptm and their demographic features and the surgical procedures used for their treatment . histopathological parameters were established by microscopic examination , including the size of ptm , location in the thyroid gland , multifocality and bilateralism in the thyroid lobes , thyroid capsule invasion , presence of lymphovascular invasion ( lvi ) , lymph node metastasis , and tumour recurrence . as an adjuvant treatment , we analysed completion thyroidectomy for i - ptm cases with unilateral hemithyroidectomy , l - thyroxin ( lt4 ) treatment for the suppression of thyroid stimulating hormone ( tsh ) , and radioiodine ( rai ) treatment . patients with i - ptm were followed up for 12 years , mean 102 ( 61144 ) months . biochemical analyses for serum tsh and free thyroxin ( ft4 ) were performed in order to determine the suppressive dose of lt4 ( suppression of tsh at a level of < 0.25 uiu / ml ) . biochemical analyses for serum tsh , ft4 , thyroglobulin ( tg ) , and anti - thyroglobulin antibody ( anti - tg ab ) were performed in total thyroidectomy cases . an ultrasound of the cervical lymph nodes in all patients and the remaining lobes in patients with hemithyroidectomy was also performed . an ultrasound of the cervical lymph nodes in all patients and the remaining lobes in patients with hemithyroidectomy was repeated . biochemical analyses for serum tsh , ft4 , tg , and anti - tg ab were performed . locoregional or distal recurrence of thyroid malignancy in the follow - up period and disease - free or overall survival of patients with i - ptm were the primary outcome parameters . during the study period , total thyroidectomy and right and left hemithyroidectomy were performed in 249 , 75 , and 71 patients , respectively , for the treatment of benign surgical diseases of the thyroid gland among the total 395 patients . i - ptm was diagnosed on histopathological examination in 37 ( 9.4% ) of the 395 patients . moreover , 47% of our i - ptm was diagnosed in 10.8% and 5% of female and male patients , respectively ( table 1 ) . the mean age of the 37 patients with i - ptm was 44.1 ( 1671 ) years . more than half of the patients ( 56.8% ) were aged between 41 and 60 years ( table 2 ) . the prevalence rates of i - ptm were 11.6% ( 29/249 ) in the total thyroidectomy specimens and 5.5% ( 8/146 ) in the unilateral hemithyroidectomy specimens ( table 3 ) . the disease was unifocal in 30 and multifocal in 7 ( 18% ) patients ( 6 cases of two and 1 case of three foci ) . of the 45 foci , 25 ( 55.6% ) were located in the left lobe ( table 4 ) . bilateral location of the ptm foci was observed in 6 ( 20.1% ) of the 29 total thyroidectomy cases ( table 3 ) . the mean size of the ptm foci was 4.88 ( 110 ) mm , and 42.2% , 64.4% , and 71% of the foci were 3 mm , 5 mm , and 6 mm , respectively ( tables 5(a ) and 5(b ) ) . microscopic examination revealed thyroid capsule invasion in 2 ( 5.4% ) of the 37 patients and in 2 ( 4.4% ) of the 45 foci . these two foci measured 3 and 6 mm in two female patients aged 41 and 57 years , respectively . based on the clinical and ultrasound findings of the cervical lymph nodes and thyroid gland , we did not perform completion thyroidectomy in eight ptm cases with unilateral hemithyroidectomy . all patients received a suppressive dose of lt4 to achieve a serum tsh level of < 0.25 uiu / ml . during the follow - up period of 102 ( 61144 ) months , we did not find any negative changes in blood chemistry and ultrasound imaging . we also did not find any unfavourable locoregional or distant events as recurrence in the remaining thyroid lobes , metastasis in the cervical nodes , and distant metastasis . papillary microcarcinoma is accordingly found more frequently and often incidentally upon histopathological examination of surgical specimens from presumed benign thyroid disease . our study region was formerly a low iodine intake ( endemic goitre ) area where preventive iodine supplementation programme has been ongoing since the last 30 years . the significant increase in the diagnostic rates of ptm , particularly the incidental findings after thyroid surgery , raises an important issue . we observed the diagnostic rate of i - ptm to be 78.7% among all the ptm cases , which corroborates our previous results . in our endemic region , the increased frequency of ptm and higher diagnostic rates of i - ptm indicate the occurrence of papillary cancer after iodine supplementation . the presence of incidental thyroid cancer is an important issue in patients with benign thyroid diseases who underwent thyroid surgery . postoperatively , we discovered that the thyroid gland harboured ptm in approximately 1 ( 9.4% ) out 10 of our patients with benign thyroid disease . previous studies have also reported the prevalence of i - ptm to be between 7.1% and 16.3% [ 610 ] . based on the present study and previous results of prevalence , we suggest that the presence of incidental cancer is not an uncommon situation . during our study period in the endemic area , the proportion of ptm was 47% among all papillary thyroid cancer cases , and a vast majority ( 78.7% ) of them showed incidental diagnosis , which indicates the importance of this pathology in the increasing rates of differentiated thyroid cancers . lombardi et al . reported the proportion of i - ptm to be 42% , of which 75.5% were incidental in an area with a high prevalence of goitre . have also reported an increase in the proportion of ptm from 35% to 56% , of which 60% were incidental . in another study , the proportion of ptm in papillary thyroid cancer cases was determined to be 49% , of which 58% were incidental . the proportion of incidental cases among all ptm cases was found to be between 49% and 75.5% [ 8 , 1115 ] . recently reported that age - standardised rates increased from 0.35 per 100,000 per year in 1996 to 0.74 per 100,000 per year in 2008 . about 59% of ptm cases were identified incidentally , and a significant rise in incidence was found only for the incidental cases . the increasing number of total thyroidectomies appears to be an important factor for the higher rate of incidental ptm . in our study , the incidence ( 11.6% ) of i - ptm among total thyroidectomy cases was more than twice the incidence ( 5.5% ) after hemithyroidectomy . rosa pelizzo et al . reported an increase in the proportion of total thyroidectomies ( from 67% to 78% ) and ptm ( from 35% to 56% ) . our incidence rate of 18% for the presence of two or more foci in the gland and the rate of 20% for the location of tumour foci in both lobes confirmed the pathological features of incidental ptm . previous studies have also reported the multifocality rate of i - ptm to be between 13% and 44.1% [ 79 , 1519 ] . some studies have reported multifocality as an independent risk factor for tumour recurrence [ 6 , 8 , 11 , 14 , 18 , 20 , 21 ] . on the other hand , the rate of recurrence is very low in patients with incidental ptm , which has been reported to range from 0% to 5% [ 6 , 8 , 11 , 14 , 15 , 18 , 19 , 22 ] . therefore , i - ptm cases with multifocality should be followed up more closely , despite the low risk of recurrence . another pathological feature arising from our study was the rate of bilateralism ( 20% ) . multiple foci were located in both lateral lobes in 20%27.3% of patients with i - ptm [ 7 , 9 ] . based on the results of both the present and previous studies , the higher rate of bilateral tumour foci in both lobes draws our attention to the remaining lobes in patients with hemithyroidectomy . in such cases , sensitive imaging methods , such as ultrasound , should be used for the detection of nodules in the remaining lobes at both early postoperative and follow - up periods . in general , the average size of the tumour foci was < 5 mm in patients with i - ptm [ 9 , 15 , 16 , 18 ] . our results confirmed the relatively small size ( average 4.88 mm ) of the tumour foci in the thyroid glands of patients with incidental ptm , of which 64% and 71% of foci were 5 mm and 6 mm , respectively . john et al . reported that the tumour foci were 6 mm in 83% of such patients . previous studies have reported tumour size as a risk factor for lymph node metastasis and recurrence . in general , tumour foci diameter > 5 or 6 mm has appeared as an independent risk factor [ 6 , 20 , 21 , 23 , 24 ] . therefore , patients with foci > 6 mm in diameter should be followed up more closely . the recurrence rate of ptm is very low even among tumour foci > 6 mm , which has been reported to range from 0% to 5% [ 5 , 6 , 8 , 14 , 2527 ] . the presence of lvi is a pathological feature showing the metastatic ability of malignancy . in our study , the absence of lvi in all our cases indicates the decreased ability of local and systemic spread of ptm . previous studies have defined thyroid capsule invasion as extrathyroid or extracapsular spread , growth , extension , or invasion . capsular invasion by ptm is an independent risk factor for tumour recurrence in the follow - up period [ 2 , 6 , 11 , 12 , 14 , 2023 , 28 ] . based on the rate of thyroid capsule invasion ( 5.4% ) in the present study , we suggest that ptm with subcapsular localisation uncommonly invades the capsule of the thyroid gland . this rate has been reported to be 3.9% by john et al . and 7.4% by sakorafas et al . . locoregional and distant spread and recurrence of malignancy are the most important factors during the follow - up period . in our study , the absence of recurrence , lymph node , or distant metastasis indicates very low risk of tumour recurrence in patients with incidental ptm . the recurrence rate is 0% in some of the previous studies [ 12 , 14 , 19 , 26 ] . in general , the overall recurrence rate was < 2% in many case series [ 2 , 5 , 15 , 22 , 27 ] . other studies have also reported a low recurrence rate between 2% and 5% [ 6 , 8 , 11 , 13 , 18 , 25 ] . i - ptm is found in the thyroid tissue after surgical treatment of benign thyroid disease . therefore , total thyroidectomy and unilateral hemithyroidectomy are usually performed in these cases . in this situation , completion thyroidectomy for hemithyroidectomy cases , rai treatment , and suppression of tsh levels with lt4 treatment are the primary adjuvant procedures for patients with differentiated thyroid cancer . however , a very low rate of recurrence in a large series of i - ptm cases does not indicate the use of adjuvant treatment , except the suppression of tsh levels with lt4 treatment . after total excision of the gland , thyroidectomized patients receive l - thyroxin ( lt4 ) replacement in order to maintain normal body function and tsh level in normal range . on the other hand , well - differentiated malignant cells of papillary cancer have thyrotropin receptors in which the growth of differentiated malignant cells is controlled by tsh . therefore , inhibition of tsh secretion has beneficial effects on management of tsh - dependent tumour growth of well - differentiated malignancies that this secretion is inhibited by lt4 administration . inhibition of tsh secretion should be provided by suppressive dose of lt4 in all patients with papillary cancer . the suppressive dose of lt4 is adjusted in individual basis by serum tsh level which is maintained between 0.1 and 0.25 uiu / ml according to patients ' tolerability . in older patients , the dose of lt4 and suppression of tsh should be balanced with the cardiac risk . after yearly follow - up the dose of lt4 can be decreased to maintain serum tsh levels between 0.5 and 1 uiu / ml in patients without unfavourable findings . in our study , surgical and nuclear adjuvant treatment was not attempted in any patients after a careful evaluation with imaging modalities and blood analysis . in our series of i - ptm cases , the absence of locoregional and distant recurrence during the follow - up period of 102 months confirmed the adequacy of the surgical treatment . similarly , several previous studies have also reported no tumour recurrences after the surgical treatment of i - ptm [ 12 , 14 , 19 , 26 ] . based on our study and previous studies , we suggest that routine completion thyroidectomy after unilateral excision , lymph node dissection , and rai application are unnecessary in most i - ptm cases . in our endemic goitre area , diagnosis of i - ptm in thyroid tissue is not an uncommon situation after thyroid surgery for benign diseases . the prevalence of i - ptm increases parallel to the increase of total thyroidectomy rate for benign thyroid diseases . size of i - ptm foci in thyroid tissue is relatively small and the majority are smaller than 6 mm . small foci of ptm create very low risk of lymph node metastasis and locoregional or distant recurrences in the follow - up period . routine adjuvant surgical and nuclear treatment as completion thyroidectomy , lymph node dissection , and rai application is unnecessary in vast majority of patients due to low risk of recurrence . such adjuvant procedures should be reserved for small number of recurrent cases discovered in the follow - up period .

clinical and pathological characteristics of incidental papillary thyroid microcancer cases , surgical , medical , and nuclear treatment methods , and patients ' outcome were studied during follow - up period of 102 months . we studied 37 patients with incidental papillary thyroid microcancer ( i - ptm ) . the surgical procedure was total thyroidectomy in 29 and hemithyroidectomy in 8 patients . size , multifocality , and bilateralism of ptm foci , thyroid capsule invasion , and presence of lymphovascular invasion were histopathological parameters . we analysed adjuvant medical and nuclear treatment and patients ' outcome during follow - up period of 102 ( 61144 ) months . the prevalence rates of i - ptm were 9.4% in 395 thyroidectomy cases . histopathological examination reported unifocal disease in 30 and multifocal disease in 7 ( 18% ) patients . multifocal disease was bilateral in 6 ( 20.1% ) patients . the mean size of the ptm foci was 4.88 mm . the rate of thyroid capsule invasion was 5.4% . all patients received a suppressive dose of lt4 to achieve a low serum tsh level . adjuvant surgical and nuclear treatment was not performed in our cases . we did not find any negative changes in blood chemistry and ultrasound imaging , and any unfavourable events as locoregional and systemic recurrence . in conclusion , diagnosis of i - ptm is common that multifocality and bilateralism appear as pathologic features . the prognosis is excellent after surgical treatment and tsh suppression . routine adjuvant nuclear treatment is unnecessary in majority of patients .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

misdiagnosis of bipolar disorder is a potentially serious problem for patients , which sometimes leads to inappropriate treatment.1 however , it is not unusual for bipolar disorder to be misdiagnosed as a major depressive disorder.2 previous studies have shown that the proportion of cases of bipolar disorder misdiagnosed as a major depressive disorder is 20.8%40%.24 nevertheless , there are few biomarkers for accurate diagnosis . if patients become depressive for the first time and have never experienced a manic episode , it is difficult to determine whether that depressive episode is unipolar or bipolar depression , and the risk of a manic switch is unknown . near - infrared spectroscopy ( nirs ) is a noninvasive and useful method that uses near - infrared light to measure hemoglobin concentration changes in the cortical surface area . although changes in the nirs signals measured on the forehead during the word fluency task may be partially associated with changes in skin blood flow,5 the changes in oxygenated hemoglobin ( [ oxyhb ] ) are associated with changes in the regional cerebral blood volume . nirs enables the assessment of brain function , and recent studies have shown that the frontal hemodynamic patterns detected by nirs can be a biomarker for the diagnosis of major psychiatric disorders.6,7 in the present case , nirs during the word fluency task was measured during the clinical course of bipolar disorder . in brief , [ oxyhb ] and deoxygenated hemoglobin ( [ deoxyhb ] ) were measured with a 52-channel nirs machine ( hitachi etg-4000 ; hitachi medical corporation , tokyo , japan ) at two wavelengths of near - infrared light ( 695 and 830 nm ) , the absorption of which was measured , and [ oxyhb ] and [ deoxyhb ] were calculated as previously described.8 the distance between pairs of source - detector probes was set at 3.0 cm and each measured area between pairs of source detector probes was defined as a channel . the probes of the nirs machine were fixed with 3 11 thermoplastic shells , with the lowest probes located along the fp1-fp2 line according to the international 1020 system used in electroencephalography . we used the word fluency task because it is easy to understand and execute , and it is also an executive task that produces distinct differences in performance and neuroimaging data among each diagnostic group of psychiatric disorders.7 additionally , plasma levels of homovanillic acid ( hva ) , a dopamine metabolite , and 3-methoxy-4hydroxyphenylglycol ( mhpg ) , a noradrenaline metabolite , were measured longitudinally using high performance liquid chromatography . in our hospital , we measured both plasma levels of monoamine metabolites ( every 3 weeks in principle ) and nirs ( before and after the treatment ) in psychiatric inpatients with mood disorders to investigate the association between plasma monoamine metabolites and nirs signals . this protocol was approved by the ethics committee of fukushima medical university , and the patient consented to participate after having been informed of the purpose of the study . the patient was a 22-year - old man who had no history of psychiatric illness . he was admitted to our hospital due to major depression that was diagnosed according to the diagnostic and statistical manual for mental disorders , fourth edition , with moderate sadness , agitation , retardation , and difficulty in concentrating . we treated the patient with paroxetine and lorazepam for about 4 weeks , but treatment was not successful . on day 4 , his montgomery sberg depression rating scale ( madrs ) score was 44 , and his plasma levels of hva and mhpg were 4.6 ng / ml and 1.9 ng / ml , respectively . figure 2 shows the waveform of [ oxyhb ] during the cognitive activation of the word fluency task . nirs signal changes were measured during a 10 second pretask baseline period , a 60 second task period , and a 55 second posttask baseline period . the initial syllables assigned were changed every 20 seconds ( /a/ , /ka/ , and /sa/ , respectively ) during the 60 second task period . during the task period , the patient was instructed to generate as many japanese words beginning with the designated syllable as possible . in the pretask and the posttask baseline periods , the patient was instructed to repeat a train of syllables ( /a/ , /i/ , /u/ , /e/ , and /o/ ) . he sat on a chair in a room with daylight with his eyes open throughout the measurements . we focused on increases in [ oxyhb ] , because this appears to reflect task - related cortical activation more directly than decreases in [ deoxyhb].7 we defined the patterns of nirs waveforms using the grand average waveforms in the frontal region ( ch 2528 , ch 3638 , and ch 4649 ; figure 3 ) and two simple visual indices,7 integral value , and centroid value . the integral value describes the size of the hemodynamic response during the 60 second activation task period , whereas the centroid value serves as an index of time course changes throughout the task , with periods representing the timing of the hemodynamic response.7 a recent study reported that the optimal threshold of the centroid value of the frontal region between major depressive disorder and two other disorders ( schizophrenia and bipolar disorder ) is 54 seconds ( major depressive disorder < other 2 disorders).7 on day 4 , the centroid value of the grand average in the central region was 68.6 seconds ( figure 2 ) , and the nirs waveforms showed an [ oxyhb ] reincrease in the posttask period ( ch 34 , 35 , 36 , 39 , 45 , 46 , 47 , and 49 ; figure 2 ) , which is characteristic of schizophrenia.6,7,911 on day 25 , his madrs score was 40 , his plasma hva level was markedly higher at 49.3 ng / ml , and his plasma mhpg level was 1.6 ng / ml . on day 27 , he was voluntarily discharged from the hospital , but was still in a depressive state . on day 30 , 3 days after leaving the hospital , he became manic and was readmitted to our hospital . he was in a state of psychotic mania with elevated mood , grandiosity , aggression , auditory hallucination , and thought broadcast , with a young mania rating scale ( ymrs ) score of 48 . we subsequently treated him with lithium , risperidone , and zotepine for approximately 3 weeks , and his manic state improved . on day 46 , his ymrs score was 29 , and plasma levels of hva and mhpg were 17 ng / ml and 1.3 ng / ml , respectively . however , he refused drugs because of extrapyramidal symptoms and became manic with psychotic symptoms again . therefore , we tried a combination of lithium , olanzapine , and zotepine , and the treatment was successful . on day 77 , the nirs waveforms turned to a negative pattern ( figure 2 ) , which was defined by an integral value of the grand average in the central region < 0 , whereas there were [ oxyhb ] reincreases in the posttask period ( ch 33 , 41 , 42 , 43 , 44 , 51 , and 52 ) . on day 99 , his ymrs score decreased to 3 , and his plasma levels of hva and mhpg were 8.7 ng / ml and 1.9 ng / ml , respectively . nine months later , he was off medication , became manic again , and was admitted to another psychiatric hospital . to the best of our knowledge , this is the first case report to measure both nirs and plasma levels of monoamine metabolites in a patient with bipolar disorder , although the clinical course in this patient was not usual as the mania occurred within the first weeks of the initiation of serotonin selective reuptake inhibitor ( ssri ) treatment . in this case , it was difficult to diagnose bipolar depression from only clinical symptoms at his first admission . we could not predict the subsequent manic switch with psychotic features , which was likely caused by paroxetine . however , the results of nirs on day 4 showed a pattern of schizophrenia , characterized by a smaller [ oxyhb ] increase during the first half of the task and an [ oxyhb ] reincrease in the posttask period,4,911 but not a unipolar depression pattern , which is characterized by only a smaller [ oxyhb ] increase during the first half of the period.4,9,12,13 care must be taken to interpret these findings as patterns of diseases because of the small number of studies . an [ oxyhb ] reincrease in the posttask period is considered as inefficient activation of the prefrontal cortex,4,9,11 which is one of the quantitative abnormalities in schizophrenia.14 these results may have predicted a possible risk of a manic switch in this patient . a recent study7 reported that the frontal hemodynamic patterns detected by nirs accurately distinguished between patients with major depressive disorder and those with bipolar disorder or schizophrenia with depressive symptoms . although the clinical status of bipolar depression may be different from that of unipolar depression,1 it is not easy to clearly distinguish without a previous manic episode . in fact , most bipolar disorder patients with depressive symptoms are initially diagnosed as having major depression.2 because there are few biomarkers for diagnosis , nirs findings may help for distinguishing unipolar and bipolar disorders . however , nirs signals changed after treatment with antipsychotics and lithium in this patient . although it is believed that nirs waveforms are a possible trait marker , nirs signals may change with the state or the medication . interestingly , nirs findings in this case showed a pattern of schizophrenia , not a pattern of bipolar disorder , which is characterized by a smaller [ oxyhb ] increase during the early period , and larger [ oxyhb ] increase during the late period of this task.15 this result is consistent with a manic episode in this case that included psychotic symptoms such as hallucination and thought broadcast . furthermore , 5 days before the manic switch , the patient s plasma hva level was almost ten times higher than just after admission . because the hva level change occurred in tandem with the manic symptoms during the clinical course , it is estimated that the manic episode in this case was associated with dopaminergic function . plasma hva levels have been considered as a possible indicator in the treatment of schizophrenia16,17 and bipolar disorder.18,19 furthermore , because ssris act on dopaminergic and serotonergic neural systems,20 the increase in the plasma hva level in this patient may have been induced by paroxetine . a previous study reported that psychosis or mania induced by ssris showed a pattern of increased plasma hva levels.21 this is consistent with our findings of the changes in plasma hva levels in this patient . taken together , the nirs findings in this patient may be based on dopaminergic dysfunction . however , the changes in the nirs may not be directly associated with the changes in plasma hva levels , because nirs findings are based on frontal brain functions , whereas plasma hva levels are related to psychotic symptoms,22 which seem to be a reflection of the mesolimbic dopamine system . in this case , nirs findings in a depressive state may predict the possible risk for a manic switch . longitudinal monitoring of plasma hva levels may be useful in the treatment of bipolar disorder , in particular in patients with psychotic symptoms like this case .

misdiagnosis of bipolar disorder is a serious , but not unusual problem for patients . nevertheless , there are few biomarkers for distinguishing unipolar and bipolar disorder . near - infrared spectroscopy ( nirs ) is a noninvasive and useful method for the measurement of hemoglobin concentration changes in the cortical surface area , which enables the assessment of brain function . we measured nirs and plasma monoamine metabolite levels in a patient with bipolar disorder . a 22-year - old man was admitted due to major depression . at admission , nirs findings showed oxygenated hemoglobin reincrease in the posttask period , which is characteristic of schizophrenia . after treatment with paroxetine , he became manic with psychotic symptoms . his plasma level of homovanillic acid just before the manic switch was ten times higher than that just after paroxetine initiation . treatment with lithium and antipsychotics was successful , and plasma homovanillic acid decreased after treatment . in this case , the nirs findings may predict a possible risk of a manic switch , which is likely induced by paroxetine . nirs may be able to help distinguish unipolar and bipolar disorder in clinical settings .

Introduction Case report Discussion Conclusion

chronic subdural hematoma ( csdh ) is a rare complication of unruptured aneurysm clipping surgery5,12 ) . because csdh signs and symptoms may appear slowly , it can cause problems such as headache , dizziness , seizure , and hemiparesis , and requires surgical drainage . mori et al.11 ) reported severe complications of surgical drainage of postoperative csdh , such as tension pneumocephalus and acute subdural hematoma , which can cause permanent neurologic deficits or death . the general incidence of csdh after brain surgery is reported to be approximately 0.3 - 1.5%8,12 ) however , aneurysm clipping surgery is regarded as an important risk factor of postoperative csdh7,10,11 ) . it is known that advanced age ( > 70 years ) and male gender may contribute to csdh after clipping surgery5,12 ) . additionally , postclipping csdh considering the relatively benign course of unruptured aneurysms , it is important to prevent csdh and identify its risk factors after clipping surgery in order to minimize treatment - related morbidity . the purpose of this study was to determine the incidence and risk factors of postoperative csdh after surgical clipping for unruptured anterior circulation aneurysms . between january 2008 to december 2013 , 980 consecutive patients with unruptured aneurysm underwent surgical clipping in a single tertiary institute . to reduce technical variables that depend on the surgeon , inclusion criteria were unruptured small to large aneurysms ( size<2.5 cm ) on anterior circulation . exclusion criteria were giant or complex aneurysms requiring complicated surgical techniques such as bypass surgery . we also excluded distal anterior cerebral artery ( aca ) aneurysms and posterior circulation aneurysms that were approached by other than pterional approach , such as anterior frontal craniotomy , subtemporal approach , and etc . we reviewed their medical records as well as radiological data including age , sex , size and location of aneurysm , size of craniotomy depending on the surgical approach , premature rupture , presence of arachnoid plasty , degree of preoperative brain atrophy , usage of antithrombotics and amount of immediate postoperative subdural fluid collection ( sdfc ) . we categorized the location of aneurysm as aca , middle cerebral artery ( mca ) , and internal carotid artery ( ica ) according to the parent artery . aneurysm sizes were divided into three groups based on diameter : tiny ( < 5 mm ) , small ( 5 - 10 mm ) , and large ( 10 - 25 mm ) . the size of all aneurysms was its maximal diameter as measured by the three - dimensional reconstructed images of digital subtraction angiography . the degree of preoperative brain atrophy was estimated using the bicaudate ratio ( bcr ) , which is defined as the ratio of the width of ventricles between the caudate nuclei and internal diameter of the vault at the same level2 ) . bcrs were measured on brain computed tomography ( ct ) scans that were taken within 6 months prior to surgery . in patients without ct scans , we used magnetic resonance t2-weighted imaging scans that were obtained within same period . postoperative sdfc was defined as the maximal distance between the inner table of the skull and the cerebral cortex . we measured its maximal vertical depth on the ipsilateral side of the clipped aneurysm on brain ct angiography that was performed 3 or 4 days after surgical clipping . we compared two groups who had postoperative sdfc less than or greater than 10 mm . the indication of surgery was determined by patient 's symptom . in the case of symptomatic patients with headache or focal neurological deficit , a surgical intervention was performed , whereas in case of asymptomatic patients were treated with conservative management with a clinical follow - up . we excluded the cases of csdh did not require surgical drainage because we did not perform routine radiological follow - up if they had no progressive symptoms . after clipping surgery , brain non - contrast ct and intracranial ct angiography was performed on postoperative days 1 and 3 or 4 , respectively . after discharge , clinical follow - ups were routinely performed 1 , 3 , and 6 months after clipping surgery at our outpatient clinic . scheduled radiologic follow - ups using intracranial ct angiography were performed after 1 or 2 years . however , imaging studies were employed when any patient showed clinical symptoms or signs that required further evaluation . surgical treatments were performed using a standard pterional approach or lateral supraorbital ( lso ) approach . the surgical techniques and average craniotomy size of these two approaches have been described previously3,16 ) . if necessary , temporary clips were placed in order to soften the aneurysm and to reduce intraoperative rupture . arachnoid plasty has been used since april 2011 . the arachnoid plasty technique applied fibrillar [ surgical fibrillar ( ethicon llc , san lorenzo , puerto rico ) ] and fibrin glue at the dissected arachnoid surface at the end of surgery ( fig . 1 ) . mean and frequency comparisons were performed using student 's t - tests , chi - square ( ) tests , mann - whitney u tests , or fisher 's exact tests as appropriate . univariate statistical analyses ( tests or fisher 's exact tests ) were performed to assess associations between variables and csdh , the categorical variable . the variables with p - values < 0.10 in univariate analyses were selected for multivariate models using multiple logistic regression analyses . statistical analyses were performed using spss 19.0 software ( spss inc . , chicago , il , usa ) . surgical treatments were performed using a standard pterional approach or lateral supraorbital ( lso ) approach . the surgical techniques and average craniotomy size of these two approaches have been described previously3,16 ) . if necessary , temporary clips were placed in order to soften the aneurysm and to reduce intraoperative rupture . arachnoid plasty has been used since april 2011 . the arachnoid plasty technique applied fibrillar [ surgical fibrillar ( ethicon llc , san lorenzo , puerto rico ) ] and fibrin glue at the dissected arachnoid surface at the end of surgery ( fig . mean and frequency comparisons were performed using student 's t - tests , chi - square ( ) tests , mann - whitney u tests , or fisher 's exact tests as appropriate . univariate statistical analyses ( tests or fisher 's exact tests ) were performed to assess associations between variables and csdh , the categorical variable . the variables with p - values < 0.10 in univariate analyses were selected for multivariate models using multiple logistic regression analyses . the patients enrolled in this study ( n=518 ) consisted of 173 males and 345 females aged 56.579.03 years ( meanstandard deviation ) . table 1 summarizes the baseline characteristics of patients . of these , 16 ( 3.1% ) patients suffered from postoperative csdh , which required burr hole drainage surgery . in univariate analyses , multivariate analyses also showed similar results [ p=0.017 , odds ratio ( or ) 4.037 , range 1.287 - 12.688 ] . in this study , we observed no statistically significant correlation with advanced age ( 65 years vs. < 65 years , 4.4% vs. 2.7% , p=0.257 based on fisher 's exact test ) . the group with higher bcr indices tended to show larger postoperative sdfc in this study ( 4.0 vs. 4.2 , p=0.083 based on mann - whitney u test ) . in addition , the bcr index was associated with postoperative csdh whereas sdfc was not ( table 2 ) . the location and diameter of aneurysms were positively associated with risk of symptomatic csdh in univariate analyses . compared to other locations , aca aneurysms had higher incidences of csdh in fisher 's exact test ( 6 cases , 5.4% , p=0.051 ) . additionally , larger aneurysms resulted in a higher incidence of csdh in fisher 's exact test ( 3 cases , 12% , p=0.030 ) . however , these differences were not significantly different in multivariate analyses using logistic regression test ( p=0.231 and p=0.243 , respectively ) . these findings were statistically significant in uni- and multivariate analyses ( p=0.004 , or 4.854 , range 1.658 - 14.085 ) . all patients who received surgical treatment recovered completely and experienced no complications or permanent neurologic deficits . no patient had recurrence of csdh , and complete csdh resorption was confirmed by follow - up brain ct scans . in this study , we found that male gender was associated with csdh , which agrees with the findings of previous studies5,12 ) . but , the reason of male preponderance ca n't be explained by the results of this study . kanat et al.6 ) suggested that the male preponderance of csdh in adults may be due to more brain atrophy and increased in cerebrospinal fluid ( csf ) in male gender and estrogens may have a protective effect on the capillaries . brain atrophy was also associated with postoperative csdh in this study , but other factors such as increment of csf or hormonal effect should be considered again in future study . in addition , previous studies have demonstrated that postoperative sdfc and advanced age were associated with postoperative csdh5,12,15 ) . we hypothesized that the degree of preoperative brain atrophy estimated by bcr and the degree of postoperative sdfc affect the development of postoperative csdh17 ) . postoperative sdfc can result from a newly developed artificial csf tract from the torn arachnoid membrane to the subdural space created by surgical dissection9 ) . if a patient has a higher degree of brain atrophy , the maximal depth of postoperative sdfc could also be higher . csdh tends to occur in elderly people because brain atrophy causes enlargement of the subarachnoid space and stretching of the bridging veins . these pre - existing conditions facilitate tearing of the arachnoid membrane and leakage of bloody csf into the subdural space after a neurosurgical procedure , thus producing overdrainage of csf from the subarachnoid space or the ventricular system13 ) . a previous study demonstrated that sdfc after aneurysm clipping might contribute to csdh12 ) . in theory , these explanations appear to be acceptable . our data indicate that higher bcr indices tended to show larger sdfc . however , sdfc itself was not associated with csdh . these differences can be explained by the following : first , the maximal vertical depth of the sdfc did not represent its total volume . if the exact volume of sdfc could be measured , the results might be different . second , the timing of brain ct scans differed and we did not checked serial follow - up ct scans , which can determine whether sdfc increased . changes in sdfc might be more predictive of the incidence of csdh rather a single measurement of sdfc . in this study , the degree of brain atrophy using bcr is a better predictor than age or sdfc to predict postoperative csdh . in order to prevent csf leakage from the subarachnoid space to the subdural space , arachnoid plasty the arachnoid plasty is not a generally accepted procedure in unruptured aneurysm surgery , but sealing of dissected arachnoid plane as an effort to prevent csf leakage seems to be convincing . if sdfc after craniotomy was related to csdh occurrence , effective arachnoid plasty would reduce postoperative csdh . mino et al.9 ) reported that arachnoid plasty using fibrin glue prevented sdfc after ruptured aneurysm surgery . differences between the mino et al.9 ) study and our study included aneurysm status ( ruptured vs. unruptured ) and number of patients . additionally , fibrin glue could spontaneously deteriorate over time , thus resulting in continuous csf leakage . however , the number of patients included in the previous study was relatively small ; therefore , it is difficult to conclude that arachnoid plasty has significant general efficacy . further studies are required to determine the detailed technical procedure as well as the role of arachnoid plasty in aneurysm surgery . the reported incidence of postoperative csdh after brain tumor removal is 0.4% , and the incidence after aneurysm clipping surgery is 2.4%12 ) . the main difference between these types of surgery is the extent of arachnoid dissection . in this study , aca location tended to be associated with csdh in univariate analyses and may have correlated with the range of cisternal dissection to soften the brain and expose the aneurysm . aca aneurysm surgery usually requires dissection of the sylvian fissure , chiasmatic cistern , and interhemispheric cistern ; however , other procedures require less . these procedures create a new csf tract from the subarachnoid space to the subdural space4 ) . although immediate sdfc was not associated with the incidence of postoperative csdh , considering the higher incidence of csdh in clipping surgery , perhaps the continuous leakage of csf through the surgically - dissected cisternal space may contribute to delayed csdh that requires surgical intervention . the maximal depth and amount of immediate postoperative sdfc can be larger in mass debulking surgeries , such as brain tumor removal , compared to aneurysm clipping . indeed , most subdural fluid collections are asymptomatic and disappear spontaneously and have thus not received much attention15,17 ) . authors thought that the association of aca aneurysms with csdh could suggest that more extensive cisternal dissection would have a clinical role in the development of postoperative csdh . in our data set , we observed a strong association between csdh and the use of antithrombotic medication . in our perioperative antithrombotic management strategy , we stopped medications such as aspirin or clopidogrel 7 days before surgery . in patients using antithrombotics , we corrected the bleeding tendency just before surgery . antithrombotic therapy was started again after we confirmed there was no evidence of hemorrhage on brain non - contrast ct scans 1 day post - surgery . the use of antithrombotic medication is known as an independent risk factor for csdh in general1,14 ) . therefore , patients using antithrombotic medication require special attention due to the potential risk of csdh . also optimal timing of resuming antithrombotics to reduce postoperative csdh should be identified in further study . we did not set routine radiological follow - up protocol for observing natural changes of asymptomatic postoperative csdh . second , the history of coexisting medical diseases was not fully considered , and could increase the risk of bleeding . prospective studies are necessary to further elucidate the incidence and risk factors of postoperative csdh after surgical clipping . this study shows that male gender , degree of brain atrophy , and the use of antithrombotic medication were associated with postoperative csdh .

objectivechronic subdural hematoma ( csdh ) is a rare complication of unruptured aneurysm clipping surgery . the purpose of this study was to identify the incidence and risk factors of postoperative csdh after surgical clipping for unruptured anterior circulation aneurysms.methodsthis retrospective study included 518 patients from a single tertiary institute from january 2008 to december 2013 . csdh was defined as subdural hemorrhage which needed surgical treatment . the degree of brain atrophy was estimated using the bicaudate ratio ( bcr ) index . we used uni- and multivariate analyses to identify risk factors correlated with csdh.resultssixteen ( 3.1% ) patients experienced postoperative csdh that required burr hole drainage surgery . in univariate analyses , male gender ( p<0.001 ) , size of aneurysm ( p=0.030 ) , higher bcr index ( p=0.004 ) , and the use of antithrombotic medication ( p=0.006 ) were associated with postoperative csdh . in multivariate analyses using logistic regression test , male gender [ odds ratio ( or ) 4.037 , range 1.287 - 12.688 ] , high bcr index ( or 5.376 , range 1.170 - 25.000 ) , and the use of antithrombotic medication ( or 4.854 , range 1.658 - 14.085 ) were associated with postoperative csdh ( p<0.05 ) . postoperative subdural fluid collection and arachnoid plasty were not showed statistically significant difference in this study.conclusionthe incidence of csdh was 3.1% in unruptured anterior circulation aneurysm surgery . this study shows that male gender , degree of brain atrophy , and the use of antithrombotic medication were associated with postoperative csdh .

INTRODUCTION MATERIALS AND METHODS Operative technique Statistical analyses RESULTS DISCUSSION CONCLUSION

helicobacter pylori have infected nearly half of the world s population . in the developing countries , more than 90% of adults are typically infected during their early childhood , and once acquired the infection would last for several decades ( 1 ) . helicobacter pylori infection is the main cause of gastritis and persistent chronic inflammation may lead to peptic ulcers or gastric cancer ( 2 - 4 ) . helicobacter pylori gastritis is associated with the expression of various cytokines and immune cells infiltration ( 1 ) . it is recently demonstrated that il-17 , il-8 and il-18 are associated with h. pylori - related gastritis diseases ( 5 - 7 ) . recently , it is found that il-17 , a pro - inflammatory cytokine that can recruit neutrophils by inducing the production of cxc chemokines , plays a vital role in the inflammatory response to the h. pylori - related diseases ( 8) . furthermore , it is also reported that il-17 , il-8 , and il-18 are important to maintain the chronic gastric inflammation in the mongolian gerbils model induced by the h. pylori ( 8 - 10 ) . considering that up - regulation of il-17 , il-8 and il-18 plays a crucial role in h. pylori infection , it was explored that the expression of il-17 , il-8 and il-18 in peripheral blood may be involved in the inflammatory response to h. pylori . the current study aimed to obtain evidence regarding the association between serum levels of il-17 , il-8 and il-18 and the stomach pathological changes induced by h. pylori infection in mongolian gerbils . three - week - old male specific pathogen - free mongolian gerbils were purchased from wenzhou medical university animal experiment center / china ( approximately 25 g ) . they were kept in polypropylene cages on saw dust bedding in groups of two per cage , and caged under a ld 12:12 cycle . the animals used in the current study were cared for according to the institutional guidelines . the experimental protocol was approved by the animal care and use committee of wenzhou medical university / china . the bacteria were cultivated in columbia agar ( oxoid england ) with 10% sheep blood ( wenzhou kont biology and technology , ltd , china ) for two to three days at 37c under microaerobic conditions ( 15% co2 ) and high humidity , on a shaker at 100 rpm . after fasting , animals were inoculated every other day for three counts with 1 ml medium of h. pylori ( 109 cfu / ml ) using a metal stomach catheter as one cycle . mongolian gerbils were randomly divided into four groups ( n = 6 in each ) . groups a , b and c were firstly inoculated by gavage with h. pylori nctc 11637 for one cycle . group b was enhanced inoculation for two counts , and group c was enhanced inoculation for three counts after the first inoculation . all the animals were sacrified under anesthesia at 35 weeks . immediately after scarifying , the stomach was quickly removed and used for macroscopic , histological and electron microscopy examinations . the serum levels of il-17il-8 and il-18 were measured using an elisa kit ( invitrogen , carlsbad , ca , usa ) according to the manufacturer s instructions . differences between the groups were tested by an anova with subsequent scheffe post - hoc test and the relationship between il and gastritis serious were tested using spearman test . three - week - old male specific pathogen - free mongolian gerbils were purchased from wenzhou medical university animal experiment center / china ( approximately 25 g ) . they were kept in polypropylene cages on saw dust bedding in groups of two per cage , and caged under a ld 12:12 cycle . the animals used in the current study were cared for according to the institutional guidelines . the experimental protocol was approved by the animal care and use committee of wenzhou medical university / china . the bacteria were cultivated in columbia agar ( oxoid england ) with 10% sheep blood ( wenzhou kont biology and technology , ltd , china ) for two to three days at 37c under microaerobic conditions ( 15% co2 ) and high humidity , on a shaker at 100 rpm . after fasting , animals were inoculated every other day for three counts with 1 ml medium of h. pylori ( 109 cfu / ml ) using a metal stomach catheter as one cycle . mongolian gerbils were randomly divided into four groups ( n = 6 in each ) . groups a , b and c were firstly inoculated by gavage with h. pylori nctc 11637 for one cycle . group b was enhanced inoculation for two counts , and group c was enhanced inoculation for three counts after the first inoculation . all the animals were sacrified under anesthesia at 35 weeks . immediately after scarifying , the stomach was quickly removed and used for macroscopic , histological and electron microscopy examinations . the serum levels of il-17il-8 and il-18 were measured using an elisa kit ( invitrogen , carlsbad , ca , usa ) according to the manufacturer s instructions . differences between the groups were tested by an anova with subsequent scheffe post - hoc test and the relationship between il and gastritis serious were tested using spearman test . the assessment was performed for inflammation , neutrophil infiltrate , mucosal atrophy and intestinal metaplasia using the semi quantitative scales ( , none ; + , mild ; + + , moderate ; + + + , severe ) of the updated sydney system ( 11 ) ( table 1 ) . note . n= number of animals ; = none ; + = mild ; + + = moderate ; + + + = severe . for control and the other groups ( n = 6 ) . the results of the analysis showed the correlation between enhance inoculation counts and gastritis serious . the serum levels of il-17 , but not il-8 and il-18 showed a correlation with the severity of gastritis ( figure 1 ) there was a correlation between serum levels of il-17 and the degree of gastritis . the current study showed that the serum levels of il-17 , il-8 and il-18 obviously increased compared to those of control group . moreover , it indicated that the serum levels of il-17 continuously increased after repetitive intragastric administration of h. pylori and were obviously correlated with the severity of gastritis . however , the serum levels of il-8 and il-18 were up - regulated after intragastric administration of h. pylori for one cycle and without increase after intragastric administration ( figure 2 ) . a : il-17 ; b : il-8 ; c : il-18 . the gastric mucosa of the control group and group a showed no visible changes . in group b , the stomach had several small ulcers and mucosa expanded and thickened slightly . in group c , erosive lesions with more ulcers were detected , covered by abundant mucus ( figure 3 ) a : control group ; b : group a ; c : group b ; antral mucosa slightly expanded and several ulcers were detected ( arrows ) ; d : group c ; mucosa was covered by abundant mucus ( arrows ) . histology examination was taken in the gastric mucosa of mongolian gerbils . in the control group , inflammatory cell infiltration in the lamina propria was inconspicuous . in group the normal gland cells disappeared , leaving elongated pseudopyloric glands with a little of mucins in the transitional zone mucosa . in the lamina propria of the pyloric mucosa , moderate amount of inflammatory infiltrating cells was observed . in group the submucosa also located similar mucous glands surrounded by interstitium with a conspicuous infiltration of lymphocytes . in group c , several ulcers were found near the transitional zone and some of them reached the muscularis propria . in the vicinity of transitional mucosa between pylori and fundic mucosa large erosion was observed , which consisted of numerous inflammatory cells ( figure 4 ) . a : control group ; b : group a ; few neutrophils infiltrated the epithelium in the transitional zone ; c : group b ; erosion was observed ; d : group c ; the glandular structures were damaged ( h & e x400 ) . electron microscopy observation was conducted on the mongolian gerbils gastric mucosa . in the control group , a , the nucleus showed mild pyknosis , mild expansion could be observed in rough endoplasmic reticulum , and the mitochondria edema could be observed in cellular . moreover , gastric mucosa microvilli showed edema and falling off . in group b , the nucleus showed pyknosis and deformation , the mitochondria vacuoles appeared , and the mucus particles of glands epithelial cells became fusion and aggregation . in group c , gap of nuclear membrane and rough endoplasmic reticulum expanded , the edema , degeneration and necrosis could be observed in mitochondria ( figure 5 ) . b : group a ; the gastric mucosa microvilli edema and falling off ( arrows ) ; c : group b. the mucus particles of glands epithelial cells became fusion and aggregation ( arrows ) ; d : group c ; autophagosome and autophagic vacuoles formatiom ( arrows ) . in the present study , it was known that the regulation of cytokines in the gastric mucosa plays a significant role in the h. pylori infections such as il-17 , il-6 , il-8 , il-18 , and tnf- ( 1 , 5 , 9 , 10 , 12 ) . mongolian gerbils are perfect animals to study gastric disease pathogenesis details ( 13 , 14 ) . the current research enriches the cytokine profiles of the chronic phases of h. pylori infections . to the authors ` best knowledge , there are no reports on the serum levels of il-17 , il-8 , il-18 and the gastric mucosa pathological changes to date . helicobacter pylori infections in the mongolian gerbils induced an antral - predominant gastritis and gradually progressed to the whole corpus ( 14 , 15 ) . some mucosal cytokines expression was paralleled with the acute inflammation such as il-1 ( 16 ) . in addition , gastric corporal mucosal chronic inflammation was paralleled with ifn- expression ( 17 ) . pro - inflammatory gene activity was highly sublimated and the risk of gastric disease was promoted for the increased inflammatory cytokines . il-17 as an emerging family member expressed in the t memory cells plays a key role in the pathogenesis of some chronic inflammatory diseases ( 18 - 20 ) . il-17 can also stimulate the expression level of il-8 and facilitate the chemotaxis of neutrophils ( 20 , 21 ) . some clinical studies found that the levels of il-17 increased in gastric mucosa of the patients infected with h. pylori ( 20 ) . it was also known that the gastric mucosal levels of il-17 increased in mongolian gerbils with h. pylori infection , especially in the chronic inflammatory phase ( 8 , 18 - 20 ) . up to now , almost all investigators only focused on studying the gastric mucosal levels of il and the mrna expression . the current study focused on studying the serum levels of il-17 and it was confirmed to be bound up with the amount of neutrophils as well as the development of gastric disease . numerous small ulcers appeared in the animals stomach and mucosa expanded and thickened slightly in the macroscopic observation . an obvious neutrophils infiltration on the background of chronic inflammation could be perceived by the ordinary microscope and the edema , degeneration and necrosis in subcellular organelles could be observed through electron microscopy . the contemporaneous appearance of pathology changes and il-17 level suggest that the inflammation of cells infiltration may be linked to the serum cytokines levels . these results suggest that il-17 plays a significant role in the inflammatory response to h. pylori infection and may serve as a potential biomarker to diagnose and predict the chronic active gastritis . il-8 acts as a chemo attractant which could enhance the migration of neutrophils and leukocytes , and regulate the processes of chronic inflammation ( 22 ) . it is also engaged in human gastric cancer cells adhesion , migration , and invasion in vitro ( 23 ) and highly expressed in gastric cancer cells ( 24 ) . yamaoka y , et al . reported that il-8 and il-18 are associated with h. pylori - related gastritis diseases ( 5 , 7 ) . the current study also demonstrated that il-8 was a marked up regulation compared with the control group , and the increased serum levels of il-8 may not promote the inflammatory response . il-18 as a member of il-1 superfamily induced by ifn- was correlated with the severity of gastric inflammation ( 25 , 26 ) . some researchers reported that il-18 is important to maintain the chronic gastric inflammation in the mongolian gerbils model induced by the h. pylori ( 8 - 10 ) . however , other studies indicated that the mrna levels of il-18 are independent of h. pylori infections ( 25 , 27 ) . in the current study , however , the serum levels of il-18 were not correlated with counts of enhanced inoculation or the severity of pathology changes . therefore , in order to understand the role of il-18 in human h. pylori infections further studies are needed . in conclusion , the current study results demonstrated that the serum levels of il-17 , il-8 and il-18 play significant roles in the progression and regulation of mongolian gerbils with h. pylori infections . moreover , the serum levels of il-17 differed among each group of animals , and depended on the severity of gastritis disease . therefore , il-17 might be related to the gastritis clinical prognosis and be used as a marker to predict the prognosis . however , in order to understand more correlation of the cytokines in h. pylori infections additional studies are required .

background : persistent helicobacter pylori infection confers an increased risk for serious illnesses such as peptic ulcers and gastric cancer . various cytokines are involved in the regulation of inflammatory immune response in h. pylori - infected gastric mucosa.objectives:the current study aimed to obtain evidence regarding the association between il-17 , il-8 and il-18 expression in peripheral blood and h. pylori infection in mongolian gerbils.materials and methods : mongolian gerbils were inoculated with h. pylori by a metal stomach catheter . after sacrifice , their gastric mucosae were examined in macroscopic , histological and electron microscopy levels . in addition , enzyme linked immunosorbent assay ( elisa ) assay was performed on the il-17 , il-8 and il-18 cytokines in the blood samples.results:serum levels of il-17 , il-8 and il-18 were remarkably up - regulated compared to those of the control group . there was an obvious correlation between the increase of il-17 and the serious extent of gastritis in the current study . however , the serum levels of il-8 and il-18 without getting increasingly more for repetitive intragastric administration . there were plenty of neutrophils infiltrating in the infected group mucosal . intestinal metaplasia and gastric ulcers were also founded in h. pylori infected animals after enhanced inoculation . the edema , degeneration and necrosis changes could be found in organelles by transmission electron microscopy . more serious pathological changes were detected in the enhanced inoculation groups compared to the cycle group.conclusions:the serum levels of il-17 , but not il-8 and il-18 may serve as a potential biomarker for diagnosis and predicting the prognosis of gastritis caused by h. pylori .

1. Background 2. Objectives 3. Materials and Methods 3.1. Animals 3.2. Bacterial Inoculation and Helicobacter pylori Colonization 3.3. Experimental Design 4. Results 5. Discussion

tuberous sclerosis complex ( tsc ) is a genetic disorder that can affect almost all organ systems . renal manifestations occur with high frequency , the most prevalent being angiomyolipoma ( aml ) . tsc - associated amls tend to be larger , more numerous , and more likely to cause spontaneous hemorrhage compared with sporadic amls . removal of renal calculi from kidneys with amls is particularly difficult because these tumors increase the potential for hemorrhage . we report the case of a 65-year - old man with tsc - associated aml and a renal calculus greater than 4 cm in his left kidney . the calculus was successfully removed by retrograde flexible ureterorenoscopy ( f - urs ) with holmium laser lithotripsy . he was previously diagnosed with tsc after being identified with the typical features , such as dermatological lesions ( facial angiofibroma , ungual fibromas , and hypomelanotic macules on the toes ) , subependymal nodules , and multiple amls in both kidneys . while there was no family history of tsc , the patient had childhood epilepsy . he also experienced two episodes of hypovolemic shock concomitant with extensive retroperitoneal hemorrhage caused by spontaneous aml rupture , once in each kidney . following the second episode , which occurred in the left kidney , he developed sepsis caused by staphylococcus aureus , which was isolated from both venous blood and urine . blood counts were within normal limits except for a low red blood cell count ( 331 10/mm ; normal , 430 10570 10/mm ) , low hemoglobin ( 9.5 g / dl ; normal , 13.517.0 g / dl ) , and a low hematocrit value ( 30.4% ; normal , 40%50% ) . serum creatinine level was 1.0 mg / dl ( normal , 0.61.1 mg / dl ) . ureter bladder ( kub ) radiography revealed a 43 16 mm renal calculus in the left kidney [ figure 1a ] . intravenous pyelography revealed that the calculus filled the pelvis and lower calyx , causing dilatation of the upper calyx [ figure 1b ] . abdominal enhanced computed tomography ( ct ) demonstrated a significant bilateral renal aml burden in addition to the renal calculus in the left kidney [ figure 2 ] . we decided to remove the renal calculus for several reasons , including the present clinical symptoms and a previous history of urinary tract infection . minimally invasive retrograde f - urs with holmium laser lithotripsy was chosen because multiple renal amls have hemorrhagic potential . ( a ) kub radiography reveals a lower pole renal calculus in the left kidney . ( b ) intravenous pyelography shows the calculus causing dilatation of the upper calyx abdominal enhanced computed tomography demonstrates significant bilateral renal aml burden and a large renal calculus in the left kidney a 6.9-fr f - urs , a 10-fr ureteral access sheath , and a 200- holmium : yag laser fibers were used for treatment . we attempted to vaporize the stone by painting the laser fiber over the stone surface . a 1.9-fr nitinol basket , which minimizes the loss of deflection during f - urs , was used to extract large fragments and reposition them from the lower pole calyx into a position more readily accessible by the laser fiber , such as the renal pelvis or upper pole calyx . no evidence of greater than 2-mm residual stones was observed before removal of the ureteral stent in postoperative kub radiography . three months after surgery , kub radiography confirmed the absence of any residual stones [ figure 3 ] , and urinalysis was also revealed normal findings . three months after flexible ureterorenoscopy , follow - up kub radiography confirms the absence of any residual stones rakowski et al . reported renal lesions in 57.5% tsc patients ; of these , aml was present in 85.4% , cysts in 44.8% , and renal cell carcinoma in 4.2% . tsc - associated aml is more likely to cause spontaneous hemorrhage compared with its sporadic counterpart , with a hemorrhagic risk of 25% to 50% . tsc patients are also predisposed to nephrolithiasis because of both the disease and its treatments . for example , drugs like topiramate have proven to be effective for some forms of tsc - associated epilepsy ; however , they also increase the risk of nephrolithiasis . patients are also at higher risk for renal cystic disease because disruption of distal tubular function by a significant cyst burden leads to hypocitraturia . our patient was not undergoing any treatment for epilepsy , and ct demonstrated no evidence of renal cystic lesions . traditional surgical treatment of renal calculi , including minimally invasive procedures like percutaneous nephrolithotomy ( pnl ) or extracorporeal shockwave lithotripsy ( eswl ) , may lead to bleeding in patients with renal amls . pnl remains a milestone technique with a high success rate and with a low percentage of major complications ; however , the blood transfusion rate reported varies from 11.2% to 17.5% . pnl involves puncture and dilation of the renal collecting system via the renal parenchyma and poses an unacceptable risk of hemorrhage in kidneys with aml , although there are two reported cases of pnl performed directly through a renal aml . on the other hand , eswl requires large numbers of shock waves , which can lead to capillary damage with parenchymal or subcapsular hemorrhage ; eswl - induced retroperitoneal bleeding has been reported in a patient with renal aml . recent studies have evaluated f - urs as an alternative treatment for patients with contraindications to pnl or eswl , such as pregnant woman , obese patients , or those with coagulopathy . indeed , f - urs using pulsed laser energy can fragment stones with less risk of hemorrhage . furthermore , f - urs is a minimally invasive procedure that can treat < 2-cm renal calculi with a low morbidity and high success rate . our case and other reported cases indicate that f - urs can also safely treat larger stones . however , the management of lower pole renal calculi with f - urs remains debatable because of limited access and poor clearance of stone fragments . by the current literature , pnl should be considered the first line of treatment for greater than 2-cm lower pole renal calculi . further advances in endoscopic technology and techniques are required to resolve the limitations of f - urs , including the technical difficulty in removing large stones , intrarenal influx with infected stones , and prolonged surgical duration . in conclusion , retrograde f - urs with holmium laser lithotripsy is an effective , minimally invasive therapy for patients at high risk of renal hemorrhage .

renal calculi in patients with renal angiomyolipomas are difficult to treat because of the hemorrhagic potential of these tumors . we describe the case of a 65-year - old man having tuberous sclerosis complex - associated multifocal renal angiomyolipomas with a large renal calculus . the patient presented with left flank dullness and a previous history of spontaneous angiomyolipoma rupture . intravenous pyelography revealed a 43 16 mm calculus in the pelvis and lower calyx of the left kidney . the calculus was successfully removed by retrograde flexible ureterorenoscopy and holmium - yag lithotripsy . flexible ureterorenoscopy is an effective , minimally invasive therapy for patients at high risk of renal hemorrhage .

INTRODUCTION CASE REPORT DISCUSSION

the diagnosis of unexplained syncopal episodes and sustained palpitations remains a difficult task in clinical cardiology . standard 24 h holter monitoring has a low diagnostic yield , while implantable loop recorder ( ilr ) has a higher diagnostic yield , but it is expensive and mildly invasive , making its role in diagnostic work - up of unexplained syncope and palpitations questionable . the utility of external prolonged electrocardiogram ( ecg ) monitoring in work - up of syncope is still undefined . the few available studies , generally single - centre and retrospective , provided conflicting results , mainly due to heterogeneity of patient populations and devices capabilities . in sustained palpitations , the external loop recorders ( elrs ) utility was more established . earlier elrs with relatively low - storage capacity and brief patient - activated ecg tracings had limited usefulness in syncope or asymptomatic arrhythmias . recently , newer elrs with auto - trigger capabilities showed 30% diagnostic yield for syncope and 75% for palpitations . external ecg recorders were also utilized to evaluate the burden of asymptomatic atrial fibrillation ( af ) , as in cryptogenic transient ischaemic attacks or after transcatheter ablation . syncope and palpitations tend to occur in clusters , with higher reoccurrence rate early after an event , thus an early use of long - term ecg monitoring may increase the likelihood of clinical diagnosis . the synarr - flash study ( monitoring of syncopes and/or sustained palpitations of suspected arrhythmic origin ; clinicaltrial.gov nct02253134 ) is the first international , multicentre , prospective trial designed to evaluate the feasibility and usefulness of external prolonged ecg monitoring in the early clinical work - up of unexplained syncope and/or sustained palpitations of suspected arrhythmic origin . at each enrolling centre , consecutive patients screened for enrolment had to meet both the following inclusion criteria : ( i ) recent ( within 1 month ) episode of syncope or sustained palpitations ( index event ) , after being discharged from emergency room or hospitalization without a conclusive diagnosis , and ( ii ) suspected arrhythmic origin according to the clinical features defined in the 2009 syncope guidelines , including the presence of cardiovascular disease or channelopathy , family history of unexplained sudden death , or abnormal ecg findings . syncope was defined as complete loss of consciousness with spontaneous recovery , while sustained palpitations as long - lasting sensation of irregular or fast heart rhythm . abnormal ecg findings included atrio - ventricular conduction disorders [ first - degree atrio - ventricular block ( avb ) i , second - degree avb ii type mobitz 1 , left or right ventricular bundle branch block ( lbbb / rbbb ) ] , supraventricular rhythm disorders [ sinus arrest or pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia > 100 b.p.m . , paroxysmal af , frequent premature atrial contractions ( pacs ) ( > 10/min ) , chronic af , paroxysmal atrial flutter / tachycardia ] , and ventricular rhythm disorders [ frequent premature ventricular contractions ( pvcs ) ( > 10/min ) , couplets , non - sustained vt ] ( table 1 ) . table 1demographic characteristicsparameters ( number , % ) itt population with syncopen = 110itt population with palpitationn = 282p - valuedemographics age , mean ( sd)65.1 ( 17.2)53.9 ( 18.4)<0.001 male gender64 ( 59.3%)101 ( 35.8%)<0.001nyha , n68191 i / ii66 ( 97.1%)190 ( 99.5%)0.170 iii / iv2 ( 2.9%)1 ( 0.5%)previous diagnosis test , n106262 24 h holter recording64 ( 60.4%)159 ( 60.7%)0.956 hut21 ( 19.8%)13 ( 5.0%)<0.001 csm27 ( 25.5%)10 ( 3.8%)<0.001 exercise stress test12 ( 11.3%)41 ( 15.6%)0.284history of previous rhythm disorders supraventricular rhythm disorders40 ( 57.1%)103 ( 66.0%)0.200 av conduction disorders32 ( 45.7%)63 ( 40.4%)0.453 ventricular rhythm disorders29 ( 41.4%)65 ( 41.7%)0.973history of cardiovascular disease , n70155 systemic hypertension41 ( 58.6%)68 ( 43.9%)0.041 coronary artery disease8 ( 11.4%)12 ( 7.7%)0.368 cerebrovascular accident8 ( 11.4%)7 ( 4.5%)0.054 ischaemic cardiomyopathy5 ( 7.1%)9 ( 5.8%)0.701 previous myocardial infarction3 ( 4.3%)6 ( 3.9%)1.000family history of sudden cardiac death9 ( 8.2%)7 ( 2.5%)0.006cardiovascular medication at the time of the test82 ( 74.5%)190 ( 67.4%)0.166 demographic characteristics sd , standard deviation ; nyha , new york heart association functional class ; av , atrio - ventricular . includes sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . include frequent pvcs ( > 10/min ) , couplets , and non - sustained vt . by study inclusion criteria , all patients were enrolled within 30 days after the index event , after being discharged from emergency room or hospitalization without a conclusive diagnosis . at enrolment , patient medical history was collected , including a detailed report of the index event ( syncope or palpitation ) and the history of events in the preceding year and of the previously performed diagnostic tests . patients were instructed by the study nurse on how to use the recorder and to report symptoms in the diary . patients had to wear the recorder for 4 weeks , and a clinic visit was scheduled at the end of the recording period ( m1 ) . patients had to contact the centre if any symptom occurred before m1 ( in case an additional clinic visit was scheduled ) or if any technical problem occurred or the recording stopped prematurely ( in order to re - initiate the recording ) . at m1 , patients were interviewed , diaries were collected , and information was cross - checked . clinical and device information , including events , device acceptance , device malfunction , adverse events , and medications , were reported in case report forms ( crfs ) . the study was conducted in accordance with guidelines for good clinical practice and declaration of helsinki and approved by relevant local ethics committees . all enrolled patients provided written informed consent to study participation . at enrolment , a prolonged high - capacity elr ( spiderflash - t , sorin group srl , saluggia , italy sized 75 50 19 mm , powered by lithium battery ) was provided to each patient . the three - wire recorder was connected to the chest using disposable adhesive electrodes , which the patient had to change daily . recorders store two leads ecg tracings on a high - capacity removable digital card capable of up to 40 day monitoring . three recording modalities are available : ( i ) manual patient activation in case of symptoms ; ( ii ) automatic activation at predefined intervals ; and ( iii ) auto - trigger activation at preselected rhythm disturbances , such as pauses or bradycardia or supraventricular tachycardia ( svt ) and ventricular tachycardia ( vt ) . all ecg monitorings were reviewed by two separate investigators ( e.t.l . and a.m. ) and categorized based on both patient diary and interview and ecg data , as follows . diagnostic monitorings include the following : conclusive events , when syncope or palpitations were reported and a readable ecg recording was available at the time of symptom ( independently of the presence or absence of arrhythmias);significant events , when the following predefined arrhythmias were detected by auto - trigger function in the absence of reported symptoms : ( i ) advanced avb ( third - degree avb or second - degree avb mobitz type 2 ) , sinus bradycardia ( < 30 b.p.m . ) , pauses 6 s ; ( ii ) fast sustained supraventricular tachycardia ( svt ) , af , or flutter ( afl ) ( rate > 180 b.p.m . , duration > 3 min ) ; and ( iii ) non - sustained ventricular tachycardia ( nsvt , duration > 10 s ) or sustained ventricular tachycardia ( > 30 s ) . those arrhythmias were considered diagnostic even in the absence of recurrent syncope according to the 2009 syncope guidelines.non-diagnostic monitorings include the following : suggestive events , when the following predefined arrhythmias were detected by auto - trigger function , in the absence of reported symptoms : ( i ) sinus bradycardia ( 3040 b.p.m . ) , 36 s pauses ; ( ii ) brief burst of svt , af , or afl ( 15180 s ) ; and ( iii ) nsvt < 10 s;negative monitorings : ( i ) monitorings without event recurrence reported in the patient diary and without recording of asymptomatic arrhythmia by auto - trigger function ; ( ii ) monitorings with recurrence of symptoms different from the index event ; and ( iii ) monitorings with recurrence of syncope or palpitations , but without available ecg recording . conclusive events , when syncope or palpitations were reported and a readable ecg recording was available at the time of symptom ( independently of the presence or absence of arrhythmias ) ; significant events , when the following predefined arrhythmias were detected by auto - trigger function in the absence of reported symptoms : ( i ) advanced avb ( third - degree avb or second - degree avb mobitz type 2 ) , sinus bradycardia ( < 30 b.p.m . ) , pauses 6 s ; ( ii ) fast sustained supraventricular tachycardia ( svt ) , af , or flutter ( afl ) ( rate > 180 b.p.m . , duration > 3 min ) ; and ( iii ) non - sustained ventricular tachycardia ( nsvt , duration > 10 s ) or sustained ventricular tachycardia ( > 30 s ) . those arrhythmias were considered diagnostic even in the absence of recurrent syncope according to the 2009 syncope guidelines . suggestive events , when the following predefined arrhythmias were detected by auto - trigger function , in the absence of reported symptoms : ( i ) sinus bradycardia ( 3040 b.p.m . ) , 36 s pauses ; ( ii ) brief burst of svt , af , or afl ( 15180 s ) ; and ( iii ) nsvt < 10 s ; negative monitorings : ( i ) monitorings without event recurrence reported in the patient diary and without recording of asymptomatic arrhythmia by auto - trigger function ; ( ii ) monitorings with recurrence of symptoms different from the index event ; and ( iii ) monitorings with recurrence of syncope or palpitations , but without available ecg recording . at each enrolling centre , consecutive patients screened for enrolment had to meet both the following inclusion criteria : ( i ) recent ( within 1 month ) episode of syncope or sustained palpitations ( index event ) , after being discharged from emergency room or hospitalization without a conclusive diagnosis , and ( ii ) suspected arrhythmic origin according to the clinical features defined in the 2009 syncope guidelines , including the presence of cardiovascular disease or channelopathy , family history of unexplained sudden death , or abnormal ecg findings . syncope was defined as complete loss of consciousness with spontaneous recovery , while sustained palpitations as long - lasting sensation of irregular or fast heart rhythm . abnormal ecg findings included atrio - ventricular conduction disorders [ first - degree atrio - ventricular block ( avb ) i , second - degree avb ii type mobitz 1 , left or right ventricular bundle branch block ( lbbb / rbbb ) ] , supraventricular rhythm disorders [ sinus arrest or pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia > 100 b.p.m . , paroxysmal af , frequent premature atrial contractions ( pacs ) ( > 10/min ) , chronic af , paroxysmal atrial flutter / tachycardia ] , and ventricular rhythm disorders [ frequent premature ventricular contractions ( pvcs ) ( > 10/min ) , couplets , non - sustained vt ] ( table 1 ) . table 1demographic characteristicsparameters ( number , % ) itt population with syncopen = 110itt population with palpitationn = 282p - valuedemographics age , mean ( sd)65.1 ( 17.2)53.9 ( 18.4)<0.001 male gender64 ( 59.3%)101 ( 35.8%)<0.001nyha , n68191 i / ii66 ( 97.1%)190 ( 99.5%)0.170 iii / iv2 ( 2.9%)1 ( 0.5%)previous diagnosis test , n106262 24 h holter recording64 ( 60.4%)159 ( 60.7%)0.956 hut21 ( 19.8%)13 ( 5.0%)<0.001 csm27 ( 25.5%)10 ( 3.8%)<0.001 exercise stress test12 ( 11.3%)41 ( 15.6%)0.284history of previous rhythm disorders supraventricular rhythm disorders40 ( 57.1%)103 ( 66.0%)0.200 av conduction disorders32 ( 45.7%)63 ( 40.4%)0.453 ventricular rhythm disorders29 ( 41.4%)65 ( 41.7%)0.973history of cardiovascular disease , n70155 systemic hypertension41 ( 58.6%)68 ( 43.9%)0.041 coronary artery disease8 ( 11.4%)12 ( 7.7%)0.368 cerebrovascular accident8 ( 11.4%)7 ( 4.5%)0.054 ischaemic cardiomyopathy5 ( 7.1%)9 ( 5.8%)0.701 previous myocardial infarction3 ( 4.3%)6 ( 3.9%)1.000family history of sudden cardiac death9 ( 8.2%)7 ( 2.5%)0.006cardiovascular medication at the time of the test82 ( 74.5%)190 ( 67.4%)0.166 demographic characteristics sd , standard deviation ; nyha , new york heart association functional class ; av , atrio - ventricular . includes sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . include frequent pvcs ( > 10/min ) , couplets , and non - sustained vt . by study inclusion criteria , all patients were enrolled within 30 days after the index event , after being discharged from emergency room or hospitalization without a conclusive diagnosis . at enrolment , patient medical history was collected , including a detailed report of the index event ( syncope or palpitation ) and the history of events in the preceding year and of the previously performed diagnostic tests . patients were instructed by the study nurse on how to use the recorder and to report symptoms in the diary . patients had to wear the recorder for 4 weeks , and a clinic visit was scheduled at the end of the recording period ( m1 ) . patients had to contact the centre if any symptom occurred before m1 ( in case an additional clinic visit was scheduled ) or if any technical problem occurred or the recording stopped prematurely ( in order to re - initiate the recording ) . at m1 , patients were interviewed , diaries were collected , and information was cross - checked . clinical and device information , including events , device acceptance , device malfunction , adverse events , and medications , were reported in case report forms ( crfs ) . the study was conducted in accordance with guidelines for good clinical practice and declaration of helsinki and approved by relevant local ethics committees . at enrolment , a prolonged high - capacity elr ( spiderflash - t , sorin group srl , saluggia , italy sized 75 50 19 mm , powered by lithium battery ) was provided to each patient . the three - wire recorder was connected to the chest using disposable adhesive electrodes , which the patient had to change daily . recorders store two leads ecg tracings on a high - capacity removable digital card capable of up to 40 day monitoring . three recording modalities are available : ( i ) manual patient activation in case of symptoms ; ( ii ) automatic activation at predefined intervals ; and ( iii ) auto - trigger activation at preselected rhythm disturbances , such as pauses or bradycardia or supraventricular tachycardia ( svt ) and ventricular tachycardia ( vt ) . all ecg monitorings were reviewed by two separate investigators ( e.t.l . and a.m. ) and categorized based on both patient diary and interview and ecg data , as follows . diagnostic monitorings include the following : conclusive events , when syncope or palpitations were reported and a readable ecg recording was available at the time of symptom ( independently of the presence or absence of arrhythmias);significant events , when the following predefined arrhythmias were detected by auto - trigger function in the absence of reported symptoms : ( i ) advanced avb ( third - degree avb or second - degree avb mobitz type 2 ) , sinus bradycardia ( < 30 b.p.m . ) , pauses 6 s ; ( ii ) fast sustained supraventricular tachycardia ( svt ) , af , or flutter ( afl ) ( rate > 180 b.p.m . , duration > 3 min ) ; and ( iii ) non - sustained ventricular tachycardia ( nsvt , duration > 10 s ) or sustained ventricular tachycardia ( > 30 s ) . those arrhythmias were considered diagnostic even in the absence of recurrent syncope according to the 2009 syncope guidelines.non-diagnostic monitorings include the following : suggestive events , when the following predefined arrhythmias were detected by auto - trigger function , in the absence of reported symptoms : ( i ) sinus bradycardia ( 3040 b.p.m . ) , 36 s pauses ; ( ii ) brief burst of svt , af , or afl ( 15180 s ) ; and ( iii ) nsvt < 10 s;negative monitorings : ( i ) monitorings without event recurrence reported in the patient diary and without recording of asymptomatic arrhythmia by auto - trigger function ; ( ii ) monitorings with recurrence of symptoms different from the index event ; and ( iii ) monitorings with recurrence of syncope or palpitations , but without available ecg recording . conclusive events , when syncope or palpitations were reported and a readable ecg recording was available at the time of symptom ( independently of the presence or absence of arrhythmias ) ; significant events , when the following predefined arrhythmias were detected by auto - trigger function in the absence of reported symptoms : ( i ) advanced avb ( third - degree avb or second - degree avb mobitz type 2 ) , sinus bradycardia ( < 30 b.p.m . ) , pauses 6 s ; ( ii ) fast sustained supraventricular tachycardia ( svt ) , af , or flutter ( afl ) ( rate > 180 b.p.m . , duration > 3 min ) ; and ( iii ) non - sustained ventricular tachycardia ( nsvt , duration > 10 s ) or sustained ventricular tachycardia ( > 30 s ) . those arrhythmias were considered diagnostic even in the absence of recurrent syncope according to the 2009 syncope guidelines . suggestive events , when the following predefined arrhythmias were detected by auto - trigger function , in the absence of reported symptoms : ( i ) sinus bradycardia ( 3040 b.p.m . ) , 36 s pauses ; ( ii ) brief burst of svt , af , or afl ( 15180 s ) ; and ( iii ) nsvt < 10 s ; negative monitorings : ( i ) monitorings without event recurrence reported in the patient diary and without recording of asymptomatic arrhythmia by auto - trigger function ; ( ii ) monitorings with recurrence of symptoms different from the index event ; and ( iii ) monitorings with recurrence of syncope or palpitations , but without available ecg recording . all analyses were performed on the intention - to - treat ( itt ) population , both overall and separately per index event ( syncope or palpitations ) . since the distribution of the data was normal , continuous data were expressed as mean standard deviation ( sd ) , while categorical variables as frequencies and percentages and differences in categorical variables were tested by test or by fisher exact test as appropriate . the time - to - first occurrence of a diagnostic event during 4-week monitoring was analysed by kaplan meier survival analysis , and survival curves of patients with syncope and palpitations were compared by log - rank test . actuarial diagnostic yields for diagnostic events were retrieved from kaplan meier statistics and compared by analysis when applicable . predictors of occurrence of diagnostic events during the 4-week monitoring were identified by multivariable cox proportional - hazard model , after proportional - hazard assumptions were verified . a stepwise procedure was applied : first , univariable analyses determined statistically significant variables at 20% , and then significant variables were introduced in the multivariable model . two - sided p values of < 0.05 were considered significant in all evaluations . analyses were performed using sas software release 9.2 ( sas institute , cary , nc , usa ) . the synarr - flash study enrolled 395 patients ( 42.3% males , age 56.9 18.7 years ) from 10 centres in five countries between august 2010 and june 2013 . as index event information was unavailable for three patients , the itt population included 392 patients ; 282 patients ( 71.9% ) enrolled for palpitations and 110 ( 28.1% ) for syncope . patients with syncope were older , more frequently males , with previous history of cardiovascular disease , family history of sudden death , hypertension , and use of cardiovascular medication ( table 1 ) . the mean duration of ecg monitoring was 23.0 8.1 days , similar for syncope and palpitations . in 22 patients , the recording was stopped for the occurrence of a major event . in four patients ( 1% ) , the recording was interrupted due to intolerance to electrodes , while two patients ( 0.5% ) withdrew from the study . skin reactions to electrodes were reported in 12 patients ( 3% ) , but all were defined as non - serious and solved spontaneously . twenty - seven patients with prior syncope ( 24.5% ) had a diagnostic event within the 4-week monitoring . conclusive events with ecg - documented syncope occurred in 11 patients ( 10% , table 2 ) : in 6 patients , supraventricular bradyarrhythmias were recorded during syncope , while in 5 cases , regular sinus rhythm or sinus tachycardia was recorded ( table 2 ) . auto - trigger function identified asymptomatic significant arrhythmias in 16 patients ( 14.5% , table 2 ) . table 2electrocardiogram findings during monitoring in patients with syncope and palpitationpatientssyncope ( n = 110)palpitation ( n = 282)n%n%diagnostic tests2724.520271.6conclusive events ( recurrence reported on patient diary)1110.019368.4non - arrhythmic ( sinus rhythm , sinus tachycardia)54.56623.4arrhythmic65.512745.0 pauses ( 6 s ) , avb 3 or avb 2 mobitz 243.610.4 pauses ( 36 s ) , sinus bradycardia21.872.5 paroxysmal af , afl ( > 3 min)00.0227.8 paroxysmal svt ( > 3 min)00.0155.3 non - sustained svt ( 15 s3 min)00.04014.2 nsvt < 10 s00.051.8 nsvt > 10 s00.010.4 frequent vpbs or apbs00.03612.7asymptomatic significant arrhythmias1614.593.2 fast sustained af / afl / svt > 3 min > 180 b.p.m.87.382.8 sinus bradycardia < 30 b.p.m . , pauses 6 s , avb 3 or avb 2 mobitz 254.510.4 nsvt > 10 s or sustained ventricular tachycardia > 30 s32.700.0non - diagnostic tests8375.58028.4negative monitoring7366.45920.9asymptomatic suggestive arrhythmias109.1217.5 sinus bradycardia 3040 b.p.m . , sinus pauses 36 s54.5113.9 nsvt < 10 s54.593.2 af / afl / svt 15 s3 min00.010.4avb 2 , avb 3 , atrio - ventricular block ( grade 2 or 3 ) ; af , atrial fibrillation ; afl , atrial flutter ; svt , supraventricular tachycardia ; nsvt , non - sustained ventricular tachycardia ; vpbs , ventricular premature beats ; apbs , atrial premature beats . electrocardiogram findings during monitoring in patients with syncope and palpitation avb 2 , avb 3 , atrio - ventricular block ( grade 2 or 3 ) ; af , atrial fibrillation ; afl , atrial flutter ; svt , supraventricular tachycardia ; nsvt , non - sustained ventricular tachycardia ; vpbs , ventricular premature beats ; apbs , atrial premature beats . the actuarial diagnostic yield , calculated by the kaplan meier cumulative occurrence of diagnostic events , was 13.2% at 1 week , 19.1% at 2 weeks , and 29.4% at 4 weeks ( figure 1 ) . figure 1kaplan meier analysis of recurrence - free rate in patients with syncope ( continuous line ) and palpitations ( dashed line ) of first diagnostic event during prolonged ecg monitoring ( log rank : p < 0.001 ) . kaplan meier analysis of recurrence - free rate in patients with syncope ( continuous line ) and palpitations ( dashed line ) of first diagnostic event during prolonged ecg monitoring ( log rank : p < 0.001 ) . auto - trigger function detected asymptomatic suggestive arrhythmias in 10 patients ( 9.1% , table 2 ) , although per definition were not included as diagnostic events . multivariable analyses to identify potential predictors of diagnostic events included age , gender , previous recording of supraventricular or ventricular arrhythmia , time from index event to enrolment ( 015 days vs. > 15 days after index syncope ) , the number of events in preceding year , history of cardiovascular disease , and family history of sudden cardiac death . the only two significant predictors for diagnostic findings during the 4-week monitoring were ( i ) early start of monitoring after index event and ( ii ) previous history of supraventricular arrhythmias [ sinus arrest or pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia > 100 b.p.m . , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , paroxysmal atrial flutter / tachycardia table 3 ] . monitoring was started within 15 days from index event in 74 patients : 4-week actuarial diagnostic yield was 33.0% in patients with early initiation compared with 15.6% in later initiation ( p = 0.021 , figure 2a ) . history of supraventricular arrhythmias was present in 39 patients : 4-week actuarial diagnostic yield was 43.6% in patients with supraventricular arrhythmias compared with 21.3% in those without ( p = 0.018 , figure 2b ) . table 3predictors for diagnosis during the 4-week ecg monitoringvariablesp - valueodds ratio95% wald confidence limitsa patients studied for syncope time between index event and enrolment015 days vs. > 15 days0.0216.21.329.6 history of supraventricular arrhythmiasyes vs. no0.0183.61.49.7b patients studied for palpitations history of previous palpitations ( in the previous 12 months)25 vs. 10.0362.61.16.3610 vs. 10.0292.81.17.311 vs. 1<0.0014.32.09.4 time between index event and enrolment07 days vs. 815 days0.0043.01.46.407 days vs. > 15 days0.0312.31.14.9supraventricular arrhythmias include sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . figure 2(a ) kaplan meier analysis of recurrence - free rate in patients with syncope enrolled at 015 days after the index syncope ( continuous line ) vs. > 15 days after the index syncope ( dashed line ) , or = 6.222 , 95% ci ( 1.30929.573 ) , p = 0.02 ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with syncope without previous history of supraventricular rhythm disorder ( continuous line ) vs. patients with previous history of supraventricular rhythm disorder ( dashed line ) , or = 3.631 , 95% ci ( 1.3569.724 ) , p = 0.01 ( see table 3 for details ) . predictors for diagnosis during the 4-week ecg monitoring supraventricular arrhythmias include sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . ( a ) kaplan meier analysis of recurrence - free rate in patients with syncope enrolled at 015 days after the index syncope ( continuous line ) vs. > 15 days after the index syncope ( dashed line ) , or = 6.222 , 95% ci ( 1.30929.573 ) , p = 0.02 ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with syncope without previous history of supraventricular rhythm disorder ( continuous line ) vs. patients with previous history of supraventricular rhythm disorder ( dashed line ) , or = 3.631 , 95% ci ( 1.3569.724 ) , p = 0.01 ( see table 3 for details ) . a total of 202 patients ( 71.6% ) had a diagnostic event within the 4-week monitoring ( table 2 ) . was present at patient - activated recording during palpitation in about two - thirds of the cases , while svt , af or afl , bradycardia , pauses or nsvt were present in the remaining cases . significant asymptomatic arrhythmias were detected by auto - trigger function in nine patients ( 3.2% ) . asymptomatic suggestive arrhythmias were detected by auto - trigger function in 21 patients ( 7.5% , table 2 ) , which per definition were not included as diagnostic events . meier cumulative occurrence of diagnostic events was 42.4% at 1 week , 57.2% at 2 weeks , and 77.0% at 4 weeks ( figure 1 ) . previous frequent palpitations and early start of recording after the index event were significant predictors of diagnostic events ( table 3 ) . the diagnostic yield progressively increased with the number of palpitations during the year preceding the enrolment ( figure 3a ) . the diagnostic yield was 46.2% in patients with 1 or no palpitation , 68.1% in patients with 25 palpitations , 76.7% in patients with 610 palpitations , and 83.1% in patients with 11 palpitations ( figure 3a ) . the 4-week diagnostic yield was higher in patients starting the recording 07 days after the index event ( table 3 , figure 3b ) . figure 3(a ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the previous number of events in the last 12 months ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the time between index event and enrolment ( see table 3 for details ) . ( a ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the previous number of events in the last 12 months ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the time between index event and enrolment ( see table 3 for details ) . the synarr - flash study enrolled 395 patients ( 42.3% males , age 56.9 18.7 years ) from 10 centres in five countries between august 2010 and june 2013 . as index event information was unavailable for three patients , the itt population included 392 patients ; 282 patients ( 71.9% ) enrolled for palpitations and 110 ( 28.1% ) for syncope . patients with syncope were older , more frequently males , with previous history of cardiovascular disease , family history of sudden death , hypertension , and use of cardiovascular medication ( table 1 ) . the mean duration of ecg monitoring was 23.0 8.1 days , similar for syncope and palpitations . in 22 patients , the recording was stopped for the occurrence of a major event . in four patients ( 1% ) , the recording was interrupted due to intolerance to electrodes , while two patients ( 0.5% ) withdrew from the study . skin reactions to electrodes were reported in 12 patients ( 3% ) , but all were defined as non - serious and solved spontaneously . twenty - seven patients with prior syncope ( 24.5% ) had a diagnostic event within the 4-week monitoring . conclusive events with ecg - documented syncope occurred in 11 patients ( 10% , table 2 ) : in 6 patients , supraventricular bradyarrhythmias were recorded during syncope , while in 5 cases , regular sinus rhythm or sinus tachycardia was recorded ( table 2 ) . auto - trigger function identified asymptomatic significant arrhythmias in 16 patients ( 14.5% , table 2 ) . table 2electrocardiogram findings during monitoring in patients with syncope and palpitationpatientssyncope ( n = 110)palpitation ( n = 282)n%n%diagnostic tests2724.520271.6conclusive events ( recurrence reported on patient diary)1110.019368.4non - arrhythmic ( sinus rhythm , sinus tachycardia)54.56623.4arrhythmic65.512745.0 pauses ( 6 s ) , avb 3 or avb 2 mobitz 243.610.4 pauses ( 36 s ) , sinus bradycardia21.872.5 paroxysmal af , afl ( > 3 min)00.0227.8 paroxysmal svt ( > 3 min)00.0155.3 non - sustained svt ( 15 s3 min)00.04014.2 nsvt < 10 s00.051.8 nsvt > 10 s00.010.4 frequent vpbs or apbs00.03612.7asymptomatic significant arrhythmias1614.593.2 fast sustained af / afl / svt > 3 min > 180 b.p.m.87.382.8 sinus bradycardia < 30 b.p.m . , pauses 6 s , avb 3 or avb 2 mobitz 254.510.4 nsvt > 10 s or sustained ventricular tachycardia > 30 s32.700.0non - diagnostic tests8375.58028.4negative monitoring7366.45920.9asymptomatic suggestive arrhythmias109.1217.5 sinus bradycardia 3040 b.p.m . , sinus pauses 36 s54.5113.9 nsvt < 10 s54.593.2 af / afl / svt 15 s3 min00.010.4avb 2 , avb 3 , atrio - ventricular block ( grade 2 or 3 ) ; af , atrial fibrillation ; afl , atrial flutter ; svt , supraventricular tachycardia ; nsvt , non - sustained ventricular tachycardia ; vpbs , ventricular premature beats ; apbs , atrial premature beats . electrocardiogram findings during monitoring in patients with syncope and palpitation avb 2 , avb 3 , atrio - ventricular block ( grade 2 or 3 ) ; af , atrial fibrillation ; afl , atrial flutter ; svt , supraventricular tachycardia ; nsvt , non - sustained ventricular tachycardia ; vpbs , ventricular premature beats ; apbs , atrial premature beats . the actuarial diagnostic yield , calculated by the kaplan meier cumulative occurrence of diagnostic events , was 13.2% at 1 week , 19.1% at 2 weeks , and 29.4% at 4 weeks ( figure 1 ) . figure 1kaplan meier analysis of recurrence - free rate in patients with syncope ( continuous line ) and palpitations ( dashed line ) of first diagnostic event during prolonged ecg monitoring ( log rank : p < 0.001 ) . kaplan meier analysis of recurrence - free rate in patients with syncope ( continuous line ) and palpitations ( dashed line ) of first diagnostic event during prolonged ecg monitoring ( log rank : p < 0.001 ) . auto - trigger function detected asymptomatic suggestive arrhythmias in 10 patients ( 9.1% , table 2 ) , although per definition were not included as diagnostic events . multivariable analyses to identify potential predictors of diagnostic events included age , gender , previous recording of supraventricular or ventricular arrhythmia , time from index event to enrolment ( 015 days vs. > 15 days after index syncope ) , the number of events in preceding year , history of cardiovascular disease , and family history of sudden cardiac death . the only two significant predictors for diagnostic findings during the 4-week monitoring were ( i ) early start of monitoring after index event and ( ii ) previous history of supraventricular arrhythmias [ sinus arrest or pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia > 100 b.p.m . , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , paroxysmal atrial flutter / tachycardia table 3 ] . monitoring was started within 15 days from index event in 74 patients : 4-week actuarial diagnostic yield was 33.0% in patients with early initiation compared with 15.6% in later initiation ( p = 0.021 , figure 2a ) . history of supraventricular arrhythmias was present in 39 patients : 4-week actuarial diagnostic yield was 43.6% in patients with supraventricular arrhythmias compared with 21.3% in those without ( p = 0.018 , figure 2b ) . table 3predictors for diagnosis during the 4-week ecg monitoringvariablesp - valueodds ratio95% wald confidence limitsa patients studied for syncope time between index event and enrolment015 days vs. > 15 days0.0216.21.329.6 history of supraventricular arrhythmiasyes vs. no0.0183.61.49.7b patients studied for palpitations history of previous palpitations ( in the previous 12 months)25 vs. 10.0362.61.16.3610 vs. 10.0292.81.17.311 vs. 1<0.0014.32.09.4 time between index event and enrolment07 days vs. 815 days0.0043.01.46.407 days vs. > 15 days0.0312.31.14.9supraventricular arrhythmias include sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . figure 2(a ) kaplan meier analysis of recurrence - free rate in patients with syncope enrolled at 015 days after the index syncope ( continuous line ) vs. > 15 days after the index syncope ( dashed line ) , or = 6.222 , 95% ci ( 1.30929.573 ) , p = 0.02 ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with syncope without previous history of supraventricular rhythm disorder ( continuous line ) vs. patients with previous history of supraventricular rhythm disorder ( dashed line ) , or = 3.631 , 95% ci ( 1.3569.724 ) , p = 0.01 ( see table 3 for details ) . predictors for diagnosis during the 4-week ecg monitoring supraventricular arrhythmias include sinus arrest / pauses <3 s , sinus bradycardia > 40 b.p.m . , sinus tachycardia , paroxysmal af , frequent pacs ( > 10/min ) , chronic af , and paroxysmal atrial flutter / tachycardia . ( a ) kaplan meier analysis of recurrence - free rate in patients with syncope enrolled at 015 days after the index syncope ( continuous line ) vs. > 15 days after the index syncope ( dashed line ) , or = 6.222 , 95% ci ( 1.30929.573 ) , p = 0.02 ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with syncope without previous history of supraventricular rhythm disorder ( continuous line ) vs. patients with previous history of supraventricular rhythm disorder ( dashed line ) , or = 3.631 , 95% ci ( 1.3569.724 ) , p = 0.01 ( see table 3 for details ) . a total of 202 patients ( 71.6% ) had a diagnostic event within the 4-week monitoring ( table 2 ) . was present at patient - activated recording during palpitation in about two - thirds of the cases , while svt , af or afl , bradycardia , pauses or nsvt were present in the remaining cases . significant asymptomatic arrhythmias were detected by auto - trigger function in nine patients ( 3.2% ) . asymptomatic suggestive arrhythmias were detected by auto - trigger function in 21 patients ( 7.5% , table 2 ) , which per definition were not included as diagnostic events . meier cumulative occurrence of diagnostic events was 42.4% at 1 week , 57.2% at 2 weeks , and 77.0% at 4 weeks ( figure 1 ) . previous frequent palpitations and early start of recording after the index event were significant predictors of diagnostic events ( table 3 ) . the diagnostic yield progressively increased with the number of palpitations during the year preceding the enrolment ( figure 3a ) . the diagnostic yield was 46.2% in patients with 1 or no palpitation , 68.1% in patients with 25 palpitations , 76.7% in patients with 610 palpitations , and 83.1% in patients with 11 palpitations ( figure 3a ) . the 4-week diagnostic yield was higher in patients starting the recording 07 days after the index event ( table 3 , figure 3b ) . figure 3(a ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the previous number of events in the last 12 months ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the time between index event and enrolment ( see table 3 for details ) . ( a ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the previous number of events in the last 12 months ( see table 3 for details ) . ( b ) kaplan meier analysis of recurrence - free rate in patients with palpitations according to the time between index event and enrolment ( see table 3 for details ) . the synarr - flash study is the first international , multicentre , observational , prospective trial designed to prove the feasibility and usefulness of external prolonged ecg monitoring in early clinical work - up of unexplained syncope and/or sustained palpitations of suspected arrhythmic origin . in unexplained syncope , prolonged external ecg monitoring achieved a diagnosis in about one - third of the patients , and most diagnoses occurred in those who started the monitoring within 15 days from index syncope ( figure 2a ) and in those with history of svt ( figure 2b ) . these findings suggest two new clinical criteria in order to increase the diagnostic likelihood in unexplained syncope , namely early initiation of monitoring after an event and previous history of supraventricular arrhythmias . in unexplained palpitations , the 4-week actuarial diagnostic yield was 77.0% , increasing up to 81.3% in patients with previous frequent palpitations ( figure 3a ) , supporting its utility as first - line diagnostic tool in palpitation work - up . all enrolled patients had unexplained syncope of suspected arrhythmic origin according to the criteria outlined in 2009 guidelines for diagnosis and management of syncope . in this study , the actuarial diagnostic yield of the 4-week ecg monitoring was 29.4% , higher than the 110% diagnostic yield generally reported for 24 h holter recording , and consistent with previous studies utilizing external long - term ecg monitoring , reporting diagnostic yields of 1520% at 1 month . in our study , the 4-week diagnostic yield for syncope was similar or higher than in studies using ilr , when considering a similar monitoring period . in the picture registry , the 3-month diagnostic yield was 19% , and in most studies , the diagnostic yield of ilr ranged from 30 up to 50% , indicating that syncope often remained unexplained even after 3-year ilr monitoring . these data support the concept that diagnostic findings in most patients with unexplained syncope occur relatively early after an index event , making prolonged external ecg monitoring sufficient to obtain a clinical diagnosis in most cases , with only a few selected patients requiring a much longer monitoring period . in our study , arrhythmias were documented during syncope in about half of the patients , typically bradycardia or pauses leading to pacemaker implant , while in the remaining cases , no arrhythmias were detected , excluding an arrhythmic origin of syncope . these patients should then be referred for further clinical evaluation , possibly including carotid sinus massage ( csm ) or head - up tilt test ( hut ) or neurological work - up , while further prolonged ecg monitoring is not necessary . asymptomatic arrhythmias predefined as significant were detected by auto - trigger function in 16 patients ( 14.5% , table 2 ) . significant arrhythmias were considered diagnostic even in the absence of recurrent syncope following the 2009 syncope guidelines , with evidence class 1 level c. this classification was specifically proposed by the international study on syncope of unknown etiology ( issue ) investigators , with the aim to group the observations from prolonged ecg monitoring into homogeneous patterns in order to define an acceptable standard useful for future studies and clinical practice . of note , this classification has been utilized in most studies with ilr , where unsuspected asymptomatic arrhythmias in the absence of syncope were generally considered diagnostic findings . to avoid potential bias , for this study , we utilized more stringent criteria for definition of significant asymptomatic arrhythmias than those proposed by the 2009 syncope guidelines . asymptomatic suggestive arrhythmias were detected in 9.1% of patients ( table 2 ) , which per definition were not included in the diagnostic yield , although some of these arrhythmias , such as 36 s pauses , would have been considered diagnostic according to 2009 syncope guidelines . patients with asymptomatic suggestive arrhythmias seem to be the ideal candidates to continue prolonged ecg monitoring by ilr , to confirm or exclude the presence of significant arrhythmias . in syncope , early initiation of recording after an index event was a significant predictor of diagnosis during the 4-week monitoring ( figure 2a ) . this is consistent with some preliminary observations suggesting that syncopal events occur in clusters , making it crucial to initiate the monitoring as soon as possible after an event . a second significant predictor of diagnostic events was history of supraventricular arrhythmias , suggesting that patients with previous paroxysmal af are reasonable candidates to prolonged ecg monitoring after an unexplained syncope . of note , af was not included among ecg criteria suggesting an arrhythmic origin for unexplained syncope in 2009 guidelines . in patients with unexplained sustained palpitations , the diagnostic yield of external monitoring was 42.4% at 1 week , 57.2% at 2 weeks , and 71.6% at 4 weeks . these data are consistent with previous studies , making the 4-week external ecg monitoring the first - choice tool in the diagnostic workflow of unexplained palpitations . only patients with palpitations remaining unexplained after the 4-week monitoring may require further observation , either by ilr or by event recorders . the diagnostic yield was 50% at 1 week and 70% at 2 weeks in patients with previous frequent palpitations ( figure 3a ) or in patients studied early after an index event ( figure 3b ) . these data support the utility of 1-week and 2-week external recordings , especially when utilized in high - risk patients and started early after an event . sinus rhythm or sinus tachycardia , or short episodes of svt were observed during palpitations in most patients , while sustained and fast svt , af , or afl were documented in 13% of the cases ( table 2 ) . in fewer cases , sinus bradycardia and pauses the clinical significance or the clinical management of such findings was beyond the scope of this study . although the main objective of prolonged external ecg monitoring was to correlate symptoms and arrhythmias , asymptomatic paroxysmal af ( either brief or sustained episodes ) was detected in 10% of the patients with unexplained palpitations . these findings support the discrepancy between perceived symptoms and documented arrhythmias , and confirm that silent af is relatively frequent even in patients with history of palpitations . one possible limitation was that not all centres contributed with the same amounts of patients , as three centres ( valld'hebron , milan , and lavagna ) enrolled 75% of the patients . the information provided in patients ' diary was used to categorize for the absence or presence and kind of symptom ( syncope or palpitation ) at the time of arrhythmias . it is impossible to verify the accuracy of events reported in the diary by each patient , although the diary information was cross - checked at m1 clinic visits . predefined criteria were utilized to distinguish between significant and suggestive asymptomatic arrhythmias detected by auto - trigger function , based on recommendation from current guidelines and on our best clinical judgement . due to lack of consensus on the minimum duration required to define an episode of paroxysmal af , we utilized a restrictive criteria ( duration > 180 s ) for significant events , while shorter events were only considered suggestive . although the presence of fast and sustained supraventricular arrhythmias may suggest a syncope of arrhythmic origin , the precise mechanism provoking the syncope in the individual patient remains unknown , and the attribution of a specific aetiology for syncope in the individual patients is beyond the scope of this study . more stringent criteria were used also for pauses and nsvt , although some suggestive asymptomatic arrhythmias may represent meaningful findings in the diagnostic workflow and would have been considered diagnostic according to the 2009 syncope guidelines . information about previous diagnostic tests , specifically csm and hut , was collected wherever available , but it was beyond the power of this study to verify why a specific diagnostic test was performed or not performed in the single patient . this study population was too small to draw any definitive conclusion on the possible correlation between elr - negative and hut - negative findings . the cumulative diagnostic yield observed in this study both for syncope and palpitation may be an overestimation of the true clinical benefit . the capability of prolonged early monitoring to influence therapeutic decisions or to improve clinical outcomes was beyond of the scope of this study and remains to be demonstrated by an appropriately designed study . all enrolled patients had unexplained syncope of suspected arrhythmic origin according to the criteria outlined in 2009 guidelines for diagnosis and management of syncope . in this study , the actuarial diagnostic yield of the 4-week ecg monitoring was 29.4% , higher than the 110% diagnostic yield generally reported for 24 h holter recording , and consistent with previous studies utilizing external long - term ecg monitoring , reporting diagnostic yields of 1520% at 1 month . in our study , the 4-week diagnostic yield for syncope was similar or higher than in studies using ilr , when considering a similar monitoring period . in the picture registry , the 3-month diagnostic yield was 19% , and in most studies , the diagnostic yield of ilr ranged from 30 up to 50% , indicating that syncope often remained unexplained even after 3-year ilr monitoring . these data support the concept that diagnostic findings in most patients with unexplained syncope occur relatively early after an index event , making prolonged external ecg monitoring sufficient to obtain a clinical diagnosis in most cases , with only a few selected patients requiring a much longer monitoring period . in our study , arrhythmias were documented during syncope in about half of the patients , typically bradycardia or pauses leading to pacemaker implant , while in the remaining cases , no arrhythmias were detected , excluding an arrhythmic origin of syncope . these patients should then be referred for further clinical evaluation , possibly including carotid sinus massage ( csm ) or head - up tilt test ( hut ) or neurological work - up , while further prolonged ecg monitoring is not necessary . asymptomatic arrhythmias predefined as significant were detected by auto - trigger function in 16 patients ( 14.5% , table 2 ) . significant arrhythmias were considered diagnostic even in the absence of recurrent syncope following the 2009 syncope guidelines , with evidence class 1 level c. this classification was specifically proposed by the international study on syncope of unknown etiology ( issue ) investigators , with the aim to group the observations from prolonged ecg monitoring into homogeneous patterns in order to define an acceptable standard useful for future studies and clinical practice . of note , this classification has been utilized in most studies with ilr , where unsuspected asymptomatic arrhythmias in the absence of syncope were generally considered diagnostic findings . to avoid potential bias , for this study , we utilized more stringent criteria for definition of significant asymptomatic arrhythmias than those proposed by the 2009 syncope guidelines . asymptomatic suggestive arrhythmias were detected in 9.1% of patients ( table 2 ) , which per definition were not included in the diagnostic yield , although some of these arrhythmias , such as 36 s pauses , would have been considered diagnostic according to 2009 syncope guidelines . patients with asymptomatic suggestive arrhythmias seem to be the ideal candidates to continue prolonged ecg monitoring by ilr , to confirm or exclude the presence of significant arrhythmias . in syncope , early initiation of recording after an index event was a significant predictor of diagnosis during the 4-week monitoring ( figure 2a ) . this is consistent with some preliminary observations suggesting that syncopal events occur in clusters , making it crucial to initiate the monitoring as soon as possible after an event . a second significant predictor of diagnostic events was history of supraventricular arrhythmias , suggesting that patients with previous paroxysmal af are reasonable candidates to prolonged ecg monitoring after an unexplained syncope . of note , af was not included among ecg criteria suggesting an arrhythmic origin for unexplained syncope in 2009 guidelines . in patients with unexplained sustained palpitations , the diagnostic yield of external monitoring was 42.4% at 1 week , 57.2% at 2 weeks , and 71.6% at 4 weeks . these data are consistent with previous studies , making the 4-week external ecg monitoring the first - choice tool in the diagnostic workflow of unexplained palpitations . only patients with palpitations remaining unexplained after the 4-week monitoring may require further observation , either by ilr or by event recorders . the diagnostic yield was 50% at 1 week and 70% at 2 weeks in patients with previous frequent palpitations ( figure 3a ) or in patients studied early after an index event ( figure 3b ) . these data support the utility of 1-week and 2-week external recordings , especially when utilized in high - risk patients and started early after an event . sinus rhythm or sinus tachycardia , or short episodes of svt were observed during palpitations in most patients , while sustained and fast svt , af , or afl were documented in 13% of the cases ( table 2 ) . in fewer cases , sinus bradycardia and pauses the clinical significance or the clinical management of such findings was beyond the scope of this study . although the main objective of prolonged external ecg monitoring was to correlate symptoms and arrhythmias , asymptomatic paroxysmal af ( either brief or sustained episodes ) these findings support the discrepancy between perceived symptoms and documented arrhythmias , and confirm that silent af is relatively frequent even in patients with history of palpitations . one possible limitation was that not all centres contributed with the same amounts of patients , as three centres ( valld'hebron , milan , and lavagna ) enrolled 75% of the patients . the information provided in patients ' diary was used to categorize for the absence or presence and kind of symptom ( syncope or palpitation ) at the time of arrhythmias . it is impossible to verify the accuracy of events reported in the diary by each patient , although the diary information was cross - checked at m1 clinic visits . predefined criteria were utilized to distinguish between significant and suggestive asymptomatic arrhythmias detected by auto - trigger function , based on recommendation from current guidelines and on our best clinical judgement . due to lack of consensus on the minimum duration required to define an episode of paroxysmal af , we utilized a restrictive criteria ( duration > 180 s ) for significant events , while shorter events were only considered suggestive . although the presence of fast and sustained supraventricular arrhythmias may suggest a syncope of arrhythmic origin , the precise mechanism provoking the syncope in the individual patient remains unknown , and the attribution of a specific aetiology for syncope in the individual patients is beyond the scope of this study . more stringent criteria were used also for pauses and nsvt , although some suggestive asymptomatic arrhythmias may represent meaningful findings in the diagnostic workflow and would have been considered diagnostic according to the 2009 syncope guidelines . information about previous diagnostic tests , specifically csm and hut , was collected wherever available , but it was beyond the power of this study to verify why a specific diagnostic test was performed or not performed in the single patient . this study population was too small to draw any definitive conclusion on the possible correlation between elr - negative and hut - negative findings . the cumulative diagnostic yield observed in this study both for syncope and palpitation may be an overestimation of the true clinical benefit . the capability of prolonged early monitoring to influence therapeutic decisions or to improve clinical outcomes was beyond of the scope of this study and remains to be demonstrated by an appropriately designed study . the early use of external 4-week ecg recorders in unexplained syncope of suspected arrhythmic origin proved to be a feasible stepwise strategy , starting the recording as soon as possible after an event in order to maximize the diagnostic yield of external ecg monitoring . in patients with unexplained syncope of suspected arrhythmic origin , in whom prolonged ecg monitoring is considered appropriate according to current guidelines , the 4-week external ecg monitoring should be utilized as first step , while more expensive and minimally invasive ilr should be reserved to those cases who remained undiagnosed after the 4-week external monitoring . in patients with unexplained palpitation , the 4-week external ecg monitoring can be considered as first - line diagnostic tool , providing a conclusive diagnosis in most cases , avoiding useless repetition of standard 24 h holter monitoring , with longer monitoring by ilr would be required only in a few selected cases . the results of this study , which utilized external loop recording with auto - trigger function , may be extended to new systems of long - lasting external ecg recordings providing continuous ecg monitoring , that may have an even higher capability of detecting asymptomatic arrhythmias . in patients with unexplained palpitation , the 4-week external ecg monitoring can be considered as first - line diagnostic tool , providing a conclusive diagnosis in most cases , avoiding useless repetition of standard 24 h holter monitoring , with longer monitoring by ilr required only in few selected cases . this study was supported by a research grant of sorin group , which supplied the spiderflash - t recorders free of charge to all enrolling centres and provided logistic support and assistance for database management and statistical analysis . r.w . was supported as a clinical researcher by the fund for scientific research flanders ( fwo ) . funding to pay

aimssynarr - flash study ( monitoring of syncopes and/or sustained palpitations of suspected arrhythmic origin ) is an international , multicentre , observational , prospective trial designed to evaluate the role of external 4-week electrocardiogram ( ecg ) monitoring in clinical work - up of unexplained syncope and/or sustained palpitations of suspected arrhythmic origin.methods and resultsconsecutive patients were enrolled within 1 month after unexplained syncope or palpitations ( index event ) after being discharged from emergency room or hospitalization without a conclusive diagnosis . a 4-week ecg monitoring was obtained by external high - capacity loop recorder ( spiderflash - t , sorin ) storing patient - activated and auto - triggered tracings . diagnostic monitorings included ( i ) conclusive events with reoccurrence of syncope or palpitation with concomitant ecg recording ( with / without arrhythmias ) and ( ii ) events with asymptomatic predefined significant arrhythmias ( sustained supraventricular or ventricular tachycardia , advanced atrio - ventricular block , sinus bradycardia < 30 b.p.m . , pauses > 6 s ) . synarr - flash study enrolled 395 patients ( 57.7% females , 56.9 18.7 years , 28.1% with syncope , and 71.9% with palpitations ) from 10 european centres . for syncope , the 4-week diagnostic yield was 24.5% , and predictors of diagnostic events were early start of recording ( 015 vs. > 15 days after index event ) ( or 6.2 , 95% ci 1.329.6 , p = 0.021 ) and previous history of supraventricular arrhythmias ( or 3.6 , 95% ci 1.49.7 , p = 0.018 ) . for palpitations , the 4-week diagnostic yield was 71.6% and predictors of diagnostic events were history of recurrent palpitations ( p < 0.001 ) and early start of recording ( p = 0.001).conclusionthe 4-week external ecg monitoring can be considered as first - line tool in the diagnostic work - up of syncope and palpitation . early recorder use , history of supraventricular arrhythmia , and frequent previous events increased the likelihood of diagnostic events during the 4-week external ecg monitoring .

Introduction Methods Study design Modality of ECG recording Event classification and computation of diagnostic yield Statistical analysis Results Study population Duration of ECG monitoring Findings in patients with syncope Findings in patients with palpitations Discussion Prolonged external ECG monitoring in unexplained syncope Prolonged external ECG monitoring in unexplained palpitations Study limitations Clinical implications and conclusions Funding

conflict of interest : jjf is a consultant for nkt therapeutics and receives research funding from nkt therapeutics and astellas . red cell transfusions are frequently used to treat severe anemia and to reduce the effects of sickle cells . unlike many patient populations , patients with scd have a much higher risk of adverse events from transfusion therapy , due in part to known antigen incompatibility between blood donors , who are mostly of european descent , and the blood recipients , who are of african descent . alloantibody formation in this population can be life - threatening , because delayed hemolytic transfusion reactions ( dhtr ) may sometimes initiate a hyperhemolytic process whereby there is not only hemolysis of transfused allogeneic cells but also the patient s own autologous cells . there are also descriptions of hyperhemolysis associated with autoantibodies , as well as cases with no antibodies . regardless of whether an antibody is present or not , the end result of these hyperhemolytic events is a profoundly low hemoglobin , even lower than pre - transfusion levels . despite profoundly low hemoglobin values in addition to avoidance of transfusions , therapies are often directed at suppressing the immune system ( i.e. corticosteroids and ivig ) . we identified an associated autoantibody that caused robust hemolysis and severe anemia , which was temporally associated with end - organ dysfunction and death . what makes this case unique is that the predominant organ affected was not the brain or the lung , but the bone marrow . bone marrow ischemia , the cause of vaso - occlusive pain , is common in scd ; however , extensive bone marrow necrosis is rare . this case underscores the risks associated with transfusion in scd , especially in a heavily alloimmunized patient . a 61 year - old female with hemoglobin sc disease on hydroxurea , a history of multiple red cell alloantibodies ( anti - e , -jk , -k , -n , -s , -cw , and js ) and previous delayed hemolytic transfusion reactions ( last recorded red cell transfusion was 3 years before the current admission ) , a chronic pain syndrome , and g6pd deficiency , presented to the hospital due to a vaso - occlusive pain crisis . on admission , her pain was reported to be located in her chest and back , which was similar to her previously reported chronic pain crises . her presenting laboratory tests were notable for a hemoglobin of 5.3 g / dl ( baseline of 8 - 9 g / dl ) , a platelet count of 120,000 cells / ul ( baseline of 140,000 cells / ul ) , and normal renal function ( baseline : 0.8 mg / dl ) . the blood bank work - up , however , was significant for a newly positive direct antiglobulin test ( dat ) ( polyspecific : 1 + , anti - igg : weak , anti - c3 : negative , eluate : negative ) , and a new anti - mcc , which was considered not clinically significant and has not been reported to cause hemolysis ( table 1 ) . she was started on a hydromorphone patient - controlled analgesia pump for pain management , and she was transfused two units of least incompatible ( incompatibility was from the new anti - mcc ) , abo compatible ( patient : b+ ) , leukocyte - reduced , sickle negative , and antigen - matched ( e- , jk(b- ) , k- , s,- by serology , and c- and js(a- ) by genotype ) red blood cells ( rbc ) , with no complications and an appropriate increase in hemoglobin to 7.4 g / dl . on her second day of admission ( hd 2 ) , her platelet count unexpectedly decreased to 61,000 cells / ul , and her count continued to decline through her hospitalization . as her reticulocyte count was also inappropriately low at the time ( 0.012 e6/l ) , her worsening thrombocytopenia was felt most likely to be due to myelosuppression from hydroxyurea . consequently , in addition to halting the hydroxyurea , she also received epoetin alfa ( 40,000 units sq ) for marrow stimulation . despite holding hydroxyurea and the dose of epoetin , she required an additional 4 units of phenotype - matched rbcs ( 1 unit hd 5 , 1 unit hd 8 , 2 units hd 12 ) during the hospitalization to maintain her hemoglobin level . although immune hemolysis was suspected at the time , no additional antibodies were identified ( table 1 ) . after her pain improved , she was discharged on hospital day 12 with a hemoglobin of 9.1 g / dl and a platelet count of 20,000 cells / ul ( a discharge lactate dehydrogenase ( ldh ) and total bilirubin were not performed ) . at her first outpatient follow - up , 6 days after discharge ( about 7 days from her last red cell transfusion ) , she reported new symptoms of fatigue , shortness of breath , and worsening pain . her hemoglobin at this visit was 2.7 g / dl , and platelet count was 20,000 cells / ul . of note , her reticulocyte percent was below the level of detection ( < 0.4% ) despite an erythropoietin level that was elevated at 132 miu / ml ( reference : 3.7 - 31.5 miu / ml ) . her laboratory results were consistent with intravascular red cell hemolysis : ldh was > 2500 u / l ( ref : 100 - 190 u / l , her baseline was 342 u / l ) , haptoglobin was 18 mg / dl ( ref : 30 - 200 mg / dl ) , and her total bilirubin was 5.0 mg / dl ( ref : 0.2 - 1.0 mg / dl ) with hemoglobinuria detected on urine screen . there was no evidence of disseminated intravascular coagulation , and no schistocytes were observed on her peripheral smear . her dat was now strongly positive , with 3 + polyspecific ahg , 1 + igg , 2 + c3 reactivity , and an eluate that was positive with all cells . of interest , the patient also had a new cold autoantibody with broad specificity and shown to react at body temperature ( 30 and 37 c ) as defined by thermal amplitude studies , suggesting a clinically - significant mixed ( igg / igm ) autoantibody . she was hospitalized again , and was given 2 units of compatible rbcs ( with an appropriate immediate post - transfusion response , post - transfusion hemoglobin 5.2 g / dl ) , epoetin alpha ( 40,000 units sq ) , and prednisone ( 1 mg / kg daily ) for a presumed mixed - type ( igg / igm ) hyperhemolysis syndrome ( figure 1 ) . . on hd 3 of readmission , she was started on intravenous immunoglobulin ( ivig ) at 500 mg / kg , received another dose of epoetin alpha ( 40,000 units ) , and 2 units of rbcs . she further developed evidence of marrow failure ( white count , 2,200 cells / ul ) on hd 4 prompting a bone marrow biopsy , which revealed diffuse and widespread bone marrow necrosis ( figure 2 ) . due to worsening of her thrombocytopenia , romiplostim ( 2 mcg / kg ) and 2 platelet transfusions were attempted without any meaningful effect on hd 10 ( figure 1 ) . she developed multisystem organ failure and continued to decline cognitively during the hospitalization , and was transitioned to comfort care . we present a unique case of transfusion - induced hyperhemolysis in an adult with scd . in this heavily alloimmunized , recently - transfused patient , an autoantibody that triggered hyperhemolysis was likely the key insult that ultimately led to her death . upon presentation with vaso - occlusive pain , the dat was only weakly positive , but after the patient received red cell transfusions , there was evidence that the autoantibody strengthened . later in the clinical course , laboratory testing clearly demonstrated complement - coated red cells , as well as a new clinically - significant mixed warm and cold autoantibody . the strengthening of the autoantibody was associated with worsening hemolysis and a clinical picture consistent with acute hyperhemolysis : a recent transfusion ( about 7 days before the hemoglobin nadir ) , a new red cell antibody , reticulocytopenia , and a severe anemia ( well below pre - transfusion levels ) . unfortunately , in this case , the severe anemia and resultant ischemia from red cell hemolysis likely fatally exacerbated extensive , clinically - significant bone marrow necrosis ; a process that likely began during her first hospitalization as reflected by her progressively strengthening dat and worsening thrombocytopenia during that time period . hyperhemolysis syndrome is a well - reported and life - threatening complication of red cell transfusions for patients with scd . clinically , the typical presentation of acute hyperhemolysis is severe anemia , developing about 7 days after a previous transfusion , with a hemoglobin that is lower than pre - transfusional levels . other common findings include reticulocytopenia , pain , fever , and signs of hemolysis , including jaundice , increased ldh , hyperbilirubinemia , and hemoglobinuria . while hyperhemolysis has no definitive diagnostic test , there is sometimes evidence of a new allo- or autoantibody . one potential reason for the autologous rbc destruction in these patients is the formation of a nonspecific antibody that binds complement and destroys both donor and recipient red cells , known as bystander hemolysis . as in our patient , previous studies have shown a strong association between the formation of nonspecific autoantibodies and the history of previous transfusions . another explanation for excess patient rbc destruction is the hyperactive phagocytic activity of macrophages . of note , sickled rbcs expose some antigens ( e.g. phosphatidylserine ) on their outer surface , which some the - orize can allow recognition by activated macrophages without antibody interactions . others consider the interaction between vcam-1 and 41 on sickled red cells , and cd11c and icam-4 on transfused donor red cells , to be critical for antibody - independent phagocytosis by activated macrophages in patients with scd . lastly , suppression of erythropoiesis has also been proposed as a cause or modulator of the disease . the severity of this patient s anemia ( hemoglobin of 2.7 g / dl ) , was notable . first , as mentioned above , this patient had an ongoing reticulocytopenia that prevented an appropriate response in the face of hemolysis . the reticulocytopenia may have developed from bone marrow necrosis and , potentially , the immune - mediated hemolysis of red cell precursors as well . second , the cold autoantibody active at 30c likely contributed to a more severe hemolysis . a recent study suggests that mixed - type immune hemolytic anemias may be more severe than other forms of immune hemolysis , with 63% of mixed hemolysis patients presenting with a hemoglobin < 6 g / dl in comparison to 29% of patients with typical warm autoimmune hemolytic anemia , and 9% of patients with cold agglutinin disease , respectively . moreover , hyperhemolysis in a patient with scd and a clinically significant cold autoantibody , anti - ih , has contributed in at least one reported fatal outcome from hyperhemolysis . our case , however , is the first where the hemolysis from a mixed - type auto agglutinin led to profound bone marrow failure . extensive bone marrow necrosis that affects hematopoiesis is a rare , but established , complication in patients with scd . greater than 90% of cases of bone marrow necrosis occur in the context of other diseases such as cancer , most often hematological malignancy , infection or autoimmune conditions . bone marrow necrosis in scd encompasses a broad spectrum of severity , from a localized process to one that is widespread . given that one of the most common sites for vaso - occlusion is in the bone marrow , aspirates often reveal patches of necrotic marrow , although rarely extensive enough to impact hematopoiesis , as was seen in our case . common symptoms of bone marrow necrosis include back pain , fever , cytopenias and a leukoerythroblastic picture ( immature white blood cells and nucleated red cells in peripheral blood ) . large autopsy studies suggest that the prevalence of diffuse bone marrow necrosis can range from 0.2 - 15 percent of susceptible patients . as of 2016 , about 60 cases of severe bone marrow necrosis in patients with scd has been reported in the literature . to our knowledge , none of these were reported to be precipitated by a previous red cell transfusion . of those reported cases , 64% had a fatal outcome and only 12 patients ( 21% ) documented complete recovery , all after receiving red blood cell exchanges . death from extensive marrow necrosis is secondary to the dissemination of fat emboli , acute multi - organ system failure , and acute chest syndrome episodes . there is no standard approach to the treatment of hyperhemolysis or extensive bone marrow necrosis . in the case of hyperhemolysis , transfusion of red cells is usually avoided , because it may precipitate increased bystander hemolysis and macrophage activation . our patient did receive red cell transfusions , especially when the clinical picture was unclear during her first admission . otherwise , our patient was treated with steroids and ivig to decrease antibody production and reduce the clearance of antibody - laden red cells , as has been reported to be beneficial in the literature . growth factors are also a mainstay , especially epoetin alpha , since reticulocytopenia is often a presenting feature . erythropoietin can correct anemia by stimulating red cell precursors and also mitigate the destruction of young red cells . additionally , rituximab ( anti - cd20 ) has been used in some cases with success . while we had some evidence that the patient s immune hemolysis was improving ( her direct antiglobulin test was showing weakening of her igg and c3 values during her second hospitalization ) , these therapies likely had no impact on her final outcome as none of these therapies will aid in bone marrow recovery . simple or exchange red cell transfusions may be beneficial for bone marrow necrosis to improve oxygenation and blood flow to the ischemic marrow ; unfortunately , aggressive transfusion therapy was not an option for our patient . this case demonstrates the unique risks of red cell transfusions in a patient with scd . severe anemia associated with hyperhemolysis was likely what caused the bone marrow necrosis that ultimately led to this patient s death . the bone marrow biopsy , which ultimately clarified her pancytopenia , should be seriously considered in patients with scd when severe anemia , reticulocytopenia , and thrombocytopenia are observed together . in conclusion , an awareness of the potential for serious complications , such as hyperhemolysis , is necessary when determining the need for transfusion in a patient with scd .

in patients with sickle cell disease , hyperhemolysis is a rare but life - threatening complication of transfusion . in this case report , we describe a 61 year - old woman with hemoglobin sickle cell ( sc ) disease and history of alloimmunization who developed hyperhemolysis associated with a transfusion . she was found to have a warm and a clinically - significant cold autoantibody . severe anemia ( hb 2.7 g / dl ) with reticulocytopenia and thrombocytopenia prompted a bone marrow biopsy , which demonstrated extensive bone marrow necrosis . despite treatment , the bone marrow failure did not improve and the patient died on hospital day 38 . this case illustrates the potential risks of transfusion in a patient with sickle cell disease , especially one with previous hemolytic reactions . while uncommon , hyperhemolysis can cause death , in this case by extensive bone marrow necrosis . in patients with sickle cell disease , judicious use of red cell transfusions with phenotypically - matched units can diminish , but never completely abrogate , the risks associated with transfusion .

Competing interest statement Introduction Case Report Discussion and Conclusions

the vertebral fractures is the most common complications of osteoporosis.13 ) these fractures result in significant mortality and morbidity including prolonged and intractable pain.4,13 ) percutaneous vertebroplasty , a therapeutic procedure for filling the collapsed vertebral body with polymethylmethacrylate , provides pain relief.2,4 ) in general , percutaneous vertebroplasty is simple and safe if performed under continuing fluoroscopic control and technical precautions . vertebroplasty has the potential risk of serious complications such as leakages of bone cement , cardiopulmonary complications , infection and the new fractures of the adjacent vertebrae.6,7 ) we present a case of extraspinal leakage after vertebroplasty at our hospital . a 73-year - old male was admitted to our hospital for low back pain after slip down at one day earlier . the patient had experienced l1 vertebroplasty and t12-l2 screw fixation for l1 compression fracture at another hospital before 2 years ago . after incision of the skin , an 11-guage vertebroplasty needle was placed percutaneously on the posterior part of the vertebral body via bilateral transpedicular approach . the needle was pushed through the cortex , situated the center of the pedicle as possible , and then directed into the vertebral body . the contrast medium ( iohexol ) was injected to estimate bone cement distribution and minimize bone cement leakage and intraoperative complication such as pulmonary thromboembolism . when a thin toothpaste consistency was achieved , the bone cement was injected into the vertebral body under continuous fluoroscopic control . the filling process was stopped immediately when leakage of bone cement was observed into lateral space of body . lumbar simple x - rays after procedure showed leakage of bone cement to right lateral side of the l4 vertebral body ( figure 1 ) . lumbar computed tomography ( ct ) scanning revealed extraforaminal leakage of bone cement to outside of right l4 pedicle and it caused significant compression of l4 nerve root ( figure 2 ) . the leaked bone cement along the l4 nerve root was removed carefully via paraspinal muscle - splitting approach . during surgery , two pieces of bone cements were removed carefully . two whitish bone cements were located in the right lateral space of l4 - 5 body and the intervertebral foramen ( figure 3 ) . postoperative lumbar spine plain images show that the leaked bone cement along right l4 nerve root was disappeared ( figure 4 ) . complications related with vertebroplasty are not uncommon such as cement extravasation , pulmonary embolism , infection , epidural hematoma , systemic toxicity , and vertebral body fractures.1,7,8 ) among the commonest complications , cement extravasation has been estimated in 70% cases for vertebroplasty procedures.3,5 ) most of the cement extravasation is asymptomatic but , disastrous complications causing paraparesis have been also reported in the literature.5,7,12 ) the biplanar fluoroscopy is the best way to monitor the leakage of cement in procedure of vertebroplasty , but sometimes it is difficult to judge the leakage of cement after injection of the contrast medium . yeom et al.14 ) described three different types of leakages of cement after vertebroplasty such as type b ( via basivertebral vein ) , type s ( via segmental vein ) , and type c ( via cortical defect ) . nieuwenhuijse et al.9 ) recommended that the high viscosity of bone cement should decrease the rate of cement leakage during vertebroplasty . due to high risk of pedicle fracture during vertebroplasty , cement leakage via pedicle violation can cause significant morbidity.11 ) park and kim10 ) mentioned technical tips while taking entry into the pedicle and the vertebral body . the bone access needle can be advanced through the center of pedicle with use of a tunnel vision technique ( turn the c - arm obliquely until pedicle can be visualized at its widest and roundest ) and verification of needle trajectory at midpedicular level and posterior surface of vertebral body on lateral view . on anterior - posterior view , if the tip is located too medially , the medial cortical wall of pedicle may be damage and leading to spinal canal violation . if the tip is located too far laterally , lateral cortical bone damage and lateral violation could occurred . in our case , the reason of cement leakage might be presumed . the tip of needle located more laterally when needle tip is located in the pedicle and vertebral body . we experienced a case of lumbar nerve root compression by leaked bone cement after vertebroplasty . proper entry point of trocar , keeping trocar within pedicle and proper position of trocar between the pedicle and spinous process under biplanar fluoroscopy view would be help to prevent leakage of bone cement after vertebroplasty .

we experienced a 73-year - old male with lumbar nerve root compression due to leakage of bone cement after vertebroplasty . he was underwent vertebroplasty for acute osteoporotic l4 compression fracture at our hospital . after vertebroplasty , his back pain was improved but right leg pain was newly developed . lumbar computed tomography scanning showed that bone cements were leaked along the l4 nerve root . the leaked cements around l4 nerve root were removed carefully via paraspinal muscle - splitting approach . after operation , severe right leg radiating pain was improved . we recommend proper entry point , high viscosity of polymethylmethacrylate and constant monitoring can reduce complication .

Introduction Case Report Discussion Conclusion

stridor in children is usually due to airway pathology but neurological conditions causing stridor are not infrequent . in cases with an underlying neurological pathology causing stridor , the treatment of the underlying cause usually relieves the stridor . we report the association of stridor in a child presenting with hydrocephalus and raised intracranial pressure following the repair of a lumbosacral myelomeningocele ; where the stridor resolved after the placement of a ventriculo - peritoneal ( v - p ) shunt . to the best of our knowledge , an 8-month - old female baby born at term by normal vaginal delivery , from a second - degree consanguinous marriage ; presented with noisy breathing and progressive increase in the size of the head for 4 weeks . the child underwent lumbosacral myelomeningocele repair 2 months ago . on examination , she was awake , irritable and had noisy breathing that was aggravated on crying . her heart rate was 123/min , blood pressure was 80/50 mm of hg , respiratory rate was 38/min and oxygen saturation was 99% on room air . glasgow coma scale was 15/15 , head circumference was 48 cm and the anterior fontanelle was bulging and tense . both upper limbs were spastic and the lower limbs were flaccid with grade 0 power . contrast enhanced computed tomography ( cect ) brain showed dilatation of all the ventricles s / o obstructive hydrocephalus [ figure 1 ] . she was posted for an emergency v - p shunt insertion . contrast enhanced computed tomography brain showing dilatation of all the ventricles s / o obstructive hydrocephalus informed high - risk consent was obtained from the parents for the procedure . standard american society of anesthesiologists monitors , including electrocardiogram , noninvasive blood pressure , spo2 , etco2 and temperature monitoring were used . the left side v - p shunt ( medium pressure chabbra system ) was placed , and tracheal extubation was uneventful . postoperatively the child 's stridor decreased , head circumference was 47 cm , anterior fontanelle became lax , and she became active , playful and started feeding normally . the association of myelomeningocele with hydrocephalous and stridor has been reported earlier . in the report by kirsch et al . , the child underwent myelomeningocele repair and a ventriculoatrial shunt was placed at the age of 23 days but presented with cyanosis and stridor at the age of 16 months requiring tracheostomy . described a child presenting with hydrocephalous and stridor , 5 months after she underwent lumbar myelomeningocele repair . solan and glaisyer described a neonate with stridor after the development of hydrocephalus secondary to surgical repair of the lumbosacral myelomeningocele . in this report , the stridor resolved completely after an emergency ventricular tap was performed , and the vp shunt procedure was performed only later . similar to our case , adeloye et al . described a child who presented initially with lumbar myelomeningocele and later developed hydrocephalus and severe laryngeal stridor , that resolved dramatically after the placement of a v - p shunt stridor is defined as the sound caused by abnormal air passage into the lungs and may be caused by extra thoracic ( nose , pharynx , larynx , trachea ) or intra - thoracic airway ( tracheobronchial tree ) obstruction . other causes include secondary airway lesions , vocal cord paralysis ( vcp ) , subglottic stenosis , tracheal anomaly , laryngeal cleft , vascular and lymphatic malformation , laryngeal papillomas , craniofacial abnormalities , and even head and neck tumors . the stridor in our case was probably due to unilateral vocal cord palsy due to stretching of the vagus nerve as it resolved promptly after the v - p shunt was performed . the differential diagnoses in our case could be bilateral vocal cord palsy or other congenital or infective laryngeal pathology causing stridor . vocal cord paralysis may be idiopathic , iatrogenic , and secondary to neurological abnormality including arnold chiari malformation [ acm ] , cerebral palsy , hydrocephalus , myelomeningocele , spina bifida , or hypoxia or birth trauma . described 21 infants and children with bilateral abductor vcp and associated meningomyelocele , acm , and hydrocephalus . they reported a temporal relationship between increased intracranial pressure ( icp ) and vcp , apnea , aspiration , and dysphagia . according to chen and inglis in infants with bilateral vcp , acm with hydrocephalous and myelomeningocele is the commonest neurologic finding . various causes have been proposed for the development of vcp in patients with raised icp with neurological disorders including ; the downward displacement of the brainstem secondary to increased icp ; stretching , compression or ischemia of the vagus nerves during their course from the nuclei ambiguii to the jugular foramen ; circulatory impairment of the brainstem and primary brainstem dysgenesis with hypoplasia of the cranial nerve nuclei . the treatment options include decompression of increased icp by temporary measures such as cerebrospinal fluid tap followed by a definitive v - p shunt or decompression of the foramen magnum to reduce the pressure difference between intracranial and intra spinal compartments . usually , the stridor will be relieved after the decompression procedure but some authors have reported worsening of symptoms after the surgical procedure . ideally the ventricular shunt should be performed within 48 h of onset of hindbrain dysfunction . tracheostomy may be required if the stridor does not resolve by 48 h after the definitive surgical procedure . in the perioperative period the avoidance of further increase in icp at the time of induction and intubation can not be over emphasized . early visualization of the larynx is required in patients who become stridulous postoperatively , especially those who have undergone prior thoracic procedures or with neurologic disorders associated with intracranial hypertension . stridor in children is not always due to airway pathology and clinicians should be aware of the neurological associations of this symptom . when associated with neurological conditions , relieving the neurological condition often decreases the stridor and hence may avoid unnecessary airway intervention and evaluation .

stridor in children is usually , but not always caused by airway pathology . the anesthesiologists should have a sound knowledge of the neurological associations of stridor and its management . in such cases , prompt treatment of the neurological pathology usually resolves the stridor and may prevent unnecessary airway evaluation and intervention in the child .

Introduction Case Report Discussion Conclusion

the success of dental implant is primarily based on good osseointegration , which depends on the biocompatibility of the implant material and implant surface properties , as well as on the quantity and quality of remaining tissue.1 commercially pure titanium and titanium alloys are traditional materials used in most commercially available endosseous implants because of favorable mechanical properties and excellent biocompatibility.2 and titanium has been proven to be safe and efficient as an implant material in many studies.3,4 but recently , the biostability of titanium is increasingly questioned . corrosion products in inner organs5 and galvanic side effects6 have been reported while using titanium implants . and allergic reactions and sensitivities to titanium have been also reported.7 esthetic problems may arise due to dark metallic color of titanium when the thickness of soft tissue is insufficient to mask it and soft tissue resorption is expected . long - term stability of esthetic implant restorations in anterior dentition is a challenge due to thin buccal bone and gingiva . while the survival rate and function of implant were main issues in implant dentistry in the past , nowadays the esthetic aspect of it became more focused . the success rate of the anterior maxillary implants was lower than other zones of the dental arch due to esthetic failure , while the survival rate of it showed no significant difference.8 thus , tooth - colored materials have been considered as an implant fixture materials and zro2 might be the choice of material as the tooth - colored implant . zirconia is a bioinert nonresorbable material that has good chemical and dimensional stability , and a high bending strength and fracture toughness.9 covacci et al . tested the potential toxicity of zirconia and the cell capability to grow and adhere upon the ceramic surfaces , and reported that zirconia showed good cytocompatibility and had no mutagenic and carcinogenic effects on cells.10 zirconia shows less accumulation of plaque than titanium , and results in less irritation through the so - called bio - film . reported the low potential for bacterial colonization of zirconia.11,12 much study on the biocompatibility and mechanical properties of zirconia has been done and zirconia has come to be used commercially as implant fixture materials . however , the gene expression levels between titanium and zirconia ceramic related to osteoblast adhesion and signal transduction are unknown . this study was performed to define attachment and growth behavior of osteoblast - like cells mc3t3-e1 cultured on zirconia discs by mtt assay , scanning electron microscope , and alp activity assay , and evaluate the gene expression of mc3t3-e1 cells on zirconium oxide surfaces compared to titanium surface using the cdna microarray . co. , ltd , suwon , korea ) used for the cell culture were machined from grade 4 titanium alloy . the discs were prepared to be 10 mm diameter and 2 mm thick and used as the culture substrate in the control group ( titanium disc group ) . paul , mn , usa ) of y - tzp ( yttria - stabilized tetragonal zirconia polycrystal ) were prepared in 10 mm diameter and 2 mm thick ( zirconia disc group ) . the surface roughness values for each group were measured using 3d - interactive display ( wyko nt8000 , veeco instruments inc . , the surface of titanium discs ( a ) had an average roughness ( ra ) value of 322 nm , while that of zirconia discs ( b ) had an average roughness ( ra ) value of 5.09 nm ( fig . disc samples were rinsed twice in absolute alcohol and once in demineralized water in ultrasonic , before sterilization by autoclave . mc3t3-e1 cells , osteoblast - like cells from rat calvaria were obtained ( korean cell line bank , seoul , korea ) and cultured in sterile cell culture plate containing alpha minimal essential medium . cells were collected and seeded at a density of 1 10 cells / ml by using 0.1% trypsin , 0.02% edta in ca and mg -free eagle 's buffer for cell release . one set of wells contained sterile 24 discs of titanium , whereas another contained 24 discs of zirconia at 37 in 5% co2 for 24 hours and the samples were moved to new dishes and media was added and the plated discs were cultured at 37 in 5% co2 for 24 hours . all cell culture media were supplemented with 100 units / ml penicillin - g , 100 g / ml streptomycin , and 0.25 g / ml fungizone ( gemini bio - products , inc . , woodland , ca , usa ) . total rna extraction was performed with qiagen mini kit ( qiagen , chatsworth , ca , usa ) for microarray assay . cell suspension ( 1 10 cell / ml ) was seeded to titanium discs and zirconia discs . the cultures were incubated for 4 and 24 hours to evaluate the influence of the substrate geometry on titanium and zirconia using sem . at the end of the various incubation times , the non - attached cells on the different substrates were removed by rinsing twice with 0.1 m sodium cacodylate buffered solution , dehydrated in a series of ethanol , dried by tetramethylsilane ( merck , darmstadt , germany ) and sputter - coated with au - pd ( bio rad , sc-500 , hertfordshire , uk ) . finally , they were observed in a sem ( jsm-6430f , jeol , tokyo , japan ) at an accelerating voltage of 15kv . three runs of experiments were carried out , which included all different samples in threefold . the mtt test assay ( sigma , st . louis , mo , usa ) was used for examining attachment of cells after culturing the cells on titanium discs and zirconia discs for 4 hours and 24 hours . the substance used for mtt test was a 3-(4 , 5-dimethylthiazol-2-yl)-2 , 5-diphenyl - tetrazolium salt , which turns into a blue formazan product due to the viable mitochondria in active cells . the cells were cultured on the 12 discs placed in 24-well culture plates and incubated at 37 in 5% co2 for 4 hours and 24 hours . the discs were moved to new 24- well culture plates after 4 hours and 24 hours of incubation and new media was added . mtt solution ( 5 mg / ml ) was added and incubated at 37 for 4 hours in 5% co2 . the media was discarded and 400 l of isopropanol with 0.04 n hcl was added in each well . the product solution was moved into 96-well plates . the absorbance at 570 nm was measured using microplate reader ( bio - rad , hercules , ca , usa ) . cell suspension ( 1 10 cell / ml ) was seeded to titanium discs and zirconia discs . the cells were added with 0.1% triton x-100 ( polyscience , warrington , pa , usa ) and cultured for 30 minutes . finally , the cells were added with 100 mm p - nitrophenyl - phosphate in 0.1 m glycine - naoh ( ph 10.4 ) and cultured for 10 minutes . the absorbance at 409 nm was measured using microplate reader ( bio - rad , hercules , ca , usa ) . the cdna microarray agilent rat 22k chip ( digital genomics , seoul , korea ) was used to monitor the expression of 21575 genes . the samples ( 10 g total rna per condition ) were processed according to the manufacturer 's recommendation . fluorescent - labeled cdna for oligo microarray analysis was prepared by amplification of total rna in the presence of aminoallyl - utp followed by the coupling of cy3 or cy5 dyes ( amersham pharmacia , uppsala , sweden ) . rna extracted from cells grown on titanium discs was labeled with cy3 and used as control against the cy5-labeled rna extracted from cells grown on zirconia discs in the first experiment and then switched . oligo microarray kit was hybridized with the fluorescently labeled rna at 60 for 16 hours and then washed . this microarray contains 21575 distinct sequences ( 1075 control spots and 20500 gene spots ) . dna chips were scanned using genepix 4000b ( axon instruments , union city , ca , usa ) . scanned images were analyzed with genepix pro 3.0 software ( axon instruments , union city , ca , usa ) to obtain gene expression ratios . test mean values and standard deviation ( sd ) were computed for mtt test and alp activity assay . nonparametric test for two group comparison by mann - whitney test was used to assess the significance level of the differences between the experimental groups . all statistical analyses were performed using spss software ( version 12.0 , spss inc . , the general shape and growth pattern of the osteoblast - like cells mc3t3-e1 was observed using sem for each group . 3 shows representative sem images of mc3t3-e1 cells cultured for 4 hours and 24 hours on titanium discs and zirconia discs . after 4 hours of culture , cells on both discs were irregularly triangular or elongated in shape with formation of filopodia that means good attachment to the substrate . after 24 hours of culture , cells on both discs were observed to be more flattened and well spread . the density of mc3t3-e1 cells was measured over 2 different time - periods ( 4 hours and 24 hours ) by using the mtt assay . 4 shows the optimal density of formazan produced by the mc3t3-e1 cells on zirconia and titanium surfaces . after 4 hours of adhesion , the osteoblast - like cell density on titanium surfaces and zirconia surfaces showed no significant difference ( p>.05 ) . after 24 hours of adhesion , the optical density of both groups significantly increased but there was no significant difference between both groups ( p>.05 ) . the optical density of cells on titanium discs was slightly higher than that of cells on zirconia discs but there was no significant difference ( p>.05 ) . 5 shows the optimal density of the differentiation rate of the cells on zirconia and titanium surfaces . up regulated genes were classified as cdna clones that exhibited a 2-fold or greater change in expression level . the up- and down - regulated genes in zirconia surface are reported in table 1 and table 2 . when an implant is inserted into bone , it is expected that an apposition of bone to the implant surface will occur , a process called osseointegration.13 for this osteoinductive event , gaps between bone and implant must be sealed , and damaged bone by preparation of implant site must be repaired . the initial responses on implant in the bone are comprised of two aspects : the response of the host to the implant and the behavior of the material in the host . the almost immediate event that occurs upon implantation of biomaterials , is adsorption of proteins.14 this biological protein layer formed on the surface of implant biomaterials is believed to be responsible for host cell response . the ability of protein adsorption depends on the surface macro- and micro - topography , chemistry , and energy of implant biomaterials.15 the host response to implants placed in bone involves a series of cell and matrix events involving many physiologic , chemical and genetic pathways.16 this study emphasizes the cell response to implant biomaterials , especially zirconia ceramics . reported that direct bone apposition was observed at bone - zirconia interfaces in histological and ultrastructural studies , and suggested that zirconia may also be a suitable implant material.17,18 ko et al . investigated the initial osteoblast - like hos cell response to yttrium - stabilized tetragonal zirconia polycrystal ( y - tzp ) and reported that y - tzp showed at least equivalent or slightly better biological response of osteoblast - like hos cells than pure titanium during a short - time cell culture period.19 in our experiment , mtt assay and sem examination showed that cellular attachment and proliferation were comparable between titanium and zirconia on a short - time cell culture period , which suggests that zirconia implants may be as favorable as titanium implants in attachment of osteoblasts on initial healing period after implant placement . alp activity is an important parameter typically used as markers of osteoblastic differentiation . in our experiment , the differentiation rate of e1 cells on cultured titanium and zirconia discs was similar each other . we used the cdna microarray technique for identifying the expression of important genes in cells adhesion , signal transduction , and transcription , based on previous literatures . cell adhesion to materials play important roles in biological processes including cell motility , cell proliferation , cell differentiation , regulation of gene expression and cell survival . there are three major parts , involved in cell adhesion to materials ; extracellular matrix ( ecm ) proteins , cytoskeletal molecules , cell adhesion molecules ( cams ) . some ecm proteins like fibronectin , osteopontin , bone sialoprotein , thrombospondin , type i collagen , vitronectin have chemotactic or adhesive properties due to their arg - gly - asp ( rgd ) sequence which is specific to the fixation of cell transmembrane receptors like integrin.20 in our experiment , fibronectin type iii , type i collagen , and vitronectin showed similar expression levels between titanium and zirconia . at the site of contact between tissue - cultured cell and extracellular matrix , absorbed onto substrate surface , specialized structures , so - called " focal contacts " or " adhesion plaque " , this adhesions are closed junctions where the distance between the substrate surface and the cell membrane is about 10 - 15 nm.21 on the intracellular part , cytoskeletal proteins are involved in signal transduction with integrin , proteases , protein kinases , kinase phosphatases , and other signaling molecules.22 among the genes related to regulation of actin cytoskeleton , integrin 8 ( itga8 ) were upregulated , while protein tyrosine kinase 2 ( ptk2 ) , integrin 3 ( itga3 ) were downregulated in zirconia . integrins are integral cell - surface proteins , which are known to participate in cell - surface adhesion , as well as cell - surface mediated signaling.23 integrin - mediated adhesion is a highly regulated process involving receptor ligand interactions and subsequent adhesion strengthening and cell spreading . in our experiment , integrin 8 ( itga8 ) was upregulated , while integrin 3 ( itga3 ) , 5 ( itga5 ) were downregulated in zirconia . it was reported that adhesion to fibronectin was inhibited by antibodies to the itga5.24 among other genes involved in focal adhesion , laminin 1 , 5 , 1 subunit 1 were down - regulated in zirconia . laminin is a major non - collagenous protein of the basal lamina and provides excellent conditions for the promotion of neurite outgrowth.25 among the cell adhesion molecules ( cams ) observed in this experiment , thiopurine methyltransferase ( tpmt ) , an enzyme that methylates thiopurine compounds , and cd6 antigen ( cd6 ) , surface molecule that may regulate cd5 tyrosine phosphorylation , were downregulated in zirconia . syndecan 1 ( sdc1 ) , a member of the syndecan proteoglycan family , was also downregulated in zirconia . the syndecans mediate cell binding , cell signaling , and cytoskeletal organization.26 tight junctions ( or zonula occludens ) are composed of transmembrane protein and a cytoplasmic " plaque " consisting of many different proteins that form large complexes . the transmembrane proteins mediate cell adhesion and constitute the intramembrane and paracellular diffusion barriers.27 tight junction protein complex , consist of cytoplasmic " plaque " of tight junctions , appears to organize the transmembrane proteins and couple them to other cytoplasmic proteins and to actin microfilaments.28 in our experiments , upregulation of tight junction protein 1 ( tjp1 ) was observed . protein tyrosine phosphatases ( ptps ) may promote the disassembly or turnover of focal contact and regulate the phosphorylation state of many signalling molecules , such as the mitogen - activated protein ( map ) kinase family.29 the expression of most of ptps showed similar expression level between titanium and zirconia . , while protein tyrosine phosphatase , receptor type , f polypeptide ( ptprf ) , interacting protein , 1 , protein tyrosine phosphatase receptor type , m ( ptprm ) , and protein tyrosine phosphatase receptor type , u ( ptpru ) were downregulated in zirconia . growth hormone receptor ( ghr ) was up regulated , while transforming growth factor , leukemia inhibitory factor ( lif ) , and fibroblast growth factor were down regulated in zirconia . using cdna microarray , total of 20215 gene expressions were observed and only 147 genes were up regulated and 838 genes were down regulated in zirconia . however , most genes related to cell adhesion showed similar expression level between titanium and zirconia , which correlated with the results of sem and mtt assay . also , most genes related to signal transduction including the activation of several pathways showed similar expression level between titanium and zirconia . thus , these results suggested that zirconia ceramics could regulate genetic effect of osteoblast - like cells , as titanium did . recently , surface treatments , like the change of surface topography , chemistry , and material composition , are on trial to improve cell adhesion and osteoinductive potential on titanium implants . further study is necessary to investigate biological response of cells on zirconia surface with various surface treatments . zirconia ceramic showed comparable biological responses of osteoblast - like cells to titanium during a short - time cell culture period . most of the genes related to cell adhesion and signal transduction including the activation of several pathways showed similar expression level between titanium and zirconia . this suggests that zirconia implants could be as favorable as titanium implants in attachment of osteoblasts on initial healing period after implant placement .

purposethis study was performed to define attachment and growth behavior of osteoblast - like cells and evaluate the gene expression on zirconia compared to titanium.materials and methodsmc3t3-e1 cells were cultured on ( 1 ) titanium and ( 2 ) zirconia discs . the tetrazolium - based colorimetric assay ( mtt test ) was used for examining the attachment of cells . cellular morphology was examined by scanning electron microscopy ( sem ) and alkaline phosphatase ( alp ) activity was measured to evaluate the cell differentiation rate . mann - whitney test was used to assess the significance level of the differences between the experimental groups . cdna microarray was used for comparing the 20215 gene expressions on titanium and zirconia.resultsfrom the mtt assay , there was no significant difference between titanium and zirconia ( p>.05 ) . from the sem image , after 4 hours of culture , cells on both discs were triangular or elongated in shape with formation of filopodia . after 24 hours of culture , cells on both discs were more flattened and well spread compared to 4 hours of culture . from the alp activity assay , the optical density of e1 cells on titanium was slightly higher than that of e1 cells on zirconia but there was no significant difference ( p>.05 ) . most of the genes related to cell adhesion showed similar expression level between titanium and zirconia.conclusionzirconia showed comparable biological responses of osteoblast - like cells to titanium for a short time during cell culture period . most of the genes related to cell adhesion and signal showed similar expression level between titanium and zirconia .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

these techniques have helped surgeons adequately manage complex trauma , tumor , and degenerative pathologies . hadra in 1890 described the use of wiring and graft techniques to perform the first spinal fusion procedures . these techniques were standard until the start of modern cervical spinal fusion with roy - camille in the 1970s . since this time there have been improvements in technique and implants , which have made the procedures safer , thus leading to increased adoption of instrumented cervical fusion . within the united states , approximately 150 000 cervical fusion procedures are performed each year . around 90% of cervical fusions the use of plate and screw instrumentation for anterior cervical fusion has become a mainstay , so much so that in 2010 the american medical association combined 2 current procedural terminology codes into a comprehensive code . the indications for cervical fusion are well established , based on an abundance of studies showing clinical and biomechanical efficacy . despite these studies there is a paucity of literature detailing the complications associated with cervical spinal fusion . most studies are retrospective in design , contain a small numbers of patients , report single - institution data , relate to a single indication , or contain information with outdated procedures . the overall complication rate for cervical fusion procedures is low , and these earlier studies may not reliably provide data on less common complications . while rare , screw backout or misplaced screws can lead to morbidity , the need for revision surgery , and increased costs . we have conducted a retrospective multicenter case series study involving 21 high - volume surgical centers from the aospine north america clinical research network , selected for their excellence in spine care and clinical research infrastructure and experience . medical records for 17 625 patients who underwent cervical spine surgery ( levels from c2 to c7 ) between january 1 , 2005 , and december 31 , 2011 , inclusive , were reviewed to identify occurrence of 21 predefined treatment complications . the complications included reintubation requiring evacuation , esophageal perforation , epidural hematoma , c5 palsy , recurrent laryngeal nerve palsy , superior laryngeal nerve palsy , hypoglossal or glossopharyngeal nerve palsy , dural tear , brachial plexopathy , blindness , graft extrusion , misplaced screws requiring reoperation , anterior cervical infection , carotid artery injury or cerebrovascular accident , vertebral artery injuries , horner s syndrome , thoracic duct injury , tetraplegia , intraoperative death , revision of arthroplasty and , pseudomeningocele . trained research staff at each site abstracted the data from medical records , surgical charts , radiology imaging , narratives , and other source documents for the patients who experienced one or more of the complications from the list . copies of case report forms were transferred to the aospine north america clinical research network methodological core for processing , cleaning , and data entry . test was used to analyze changes in clinical outcomes at follow - up compared to preoperative status . a total of 12 903 cervical procedures qualified for screening for the complication of misplaced screw requiring reoperation . there were 11 instances of misplaced screws requiring reoperation , for an incidence of 0.085% , translating to a rate of 8.5 per 10 000 cervical spine surgeries ( table 1 ) . a total of 8887 cases screened were specifically only anterior procedures making the incidence 3/8887 ( 0.034% ) . we do not have enough information on the remaining cases to make a determination of the incidence of misplacement of posterior screws requiring reoperation , but suspect it would a higher rate . the average age of the patients was 53 years , and there were 4 female patients . myelopathy and radiculopathy were the most common reasons for initial operation , 6/11 ( 55% ) and 5/11 ( 45% ) , respectively , with 1 patient having both symptoms . importantly , there were no changes in the health - related quality - of - life metrics due to this complication . there were no new neurologic deficits ; patients most often presented with pain , and screw backout was diagnosed on postoperative plain x - ray or computed tomography scan . five of 11 ( 45% ) and 3/11 ( 27% ) patients were diagnosed within the original hospital admission or postoperative clinic follow - up , respectively , while we were unable to obtain these data on 3 cases . the most common location for screw backout was c6 , 4/11 ( 36% ) ; 2 patients had screw backout at c2 . patient 4 had aggressive removal of an osteophyte complex and an anterior cervical screw penetrated into the central canal ( figure 1a and b ) . the patient had symptoms of right - sided proximal upper extremity weakness , which resolved with removal and revision of the c5 penetrating screw ( figure 1c ) . ( c ) postoperative lateral cervical spine x - ray demonstrating removal of misplaced c5 screw . due to the risk and complexity associated with cervical spinal surgery , current techniques and approaches did not become popular until the mid-20th century . advances in imaging , operative microscopes , and instrumentation have allowed cervical spinal surgery to progress to the current state . since 1891 when the first cervical fusion procedure was performed there have been sequential advances described by many authors to develop the early fixation techniques . several biomechanical animal and cadaver studies have been performed during the rapid advancement in cervical spinal instrumentation over the past 30 years . posterior instrumented fusion studies have consistently proven the stiffness of the constructs to be equal to or greater than that of an intact spine . the most common failure in these studies was screw pullout at a predictable amount of force . anterior plating studies have strongly guided the development of each type of system and have shown continued improvement in the efficacy of constructs . the advancements and improvements in cervical spinal instrumentation would be expected to decrease the rate of hardware - related complications . the overall complication rate of cervical spinal surgery is estimated to be 0.2% to 17.8% . after 30 days , the most common complication is related to instrumentation dislodgement , breakage , or both , and occurs in 2% to 25% of cases of spinal fusion procedures . reoperation rate for instrumented spinal fusions is reported between 2% and 25% , with the majority related to pseudoarthrosis . the majority of information is based on case reports , retrospective reviews , and small series of patients . there are few recent articles addressing the rate of screw backout or misplacement requiring reoperation , and many older studies include the use of unrestricted devices that permitted screw backout . fehlings et al prospectively collected 302 cervical spondylotic myelopathy patients and found a perioperative complication rate of 15.6% , with 11.6% minor and 7.0% major perioperative risk . three patients had instrumentation malposition / migration for a rate of 1% in the perioperative period . three patients had instrumentation / graft migration or instrumentation failure , making the risk of delayed hardware complications 1.1% . of 195 anterior cervical plating procedures , 5 ( 2.6% ) required reoperation for hardware failure . al used the marketscan database and identified 13 662 patients who underwent anterior or posterior cervical fusion for degenerative disc disease . the rate of any complication excluding dysphagia was 12.3% and 17.8% for anterior and posterior approaches , respectively . there is , however , no specific mention of the reason for reoperation in the study . in 2011 , katonis et al reported on 1662 consecutively placed lateral mass screws . screw pullout occurred in 3 ( 1.3% ) patients , but they did not mention if these patients required reoperation or if the system was a screw - plate or polyaxial screw - rod implant system . the report also mentioned 11 ( 0.6% ) screws had a suboptimal trajectory but no patient required reoperation for removal or replacement of hardware . al barbarawi et al had 2 screw pullout cases out of 430 lateral mass screw - rod fixation cases . two ( 4.0% ) cases were found to have screw pullout in the study by kim et al using yoon s method . kasimatis et al included 74 patients from 1990 to 2005 who underwent anterior cervical treatment of cervical spine trauma in their study looking at complications . screw backout was reported in 4 ( 5.4% ) cases , all of which were unrestricted backout plates . seven cases ( 9.5% ) had less - than - ideal positioning of the construct with only one case requiring reoperation because of a malpositioned screw being completely in the intervertebral space . veeravagu et al looked at the marketscan database from 2006 and 2010 and found in 28 777 patients a reoperation rate of 9.13% and 10.7% for single - level and multilevel anterior cervical fusion , respectively . unfortunately , their data did not include data about the rate of reoperation related specifically to hardware failure . shapiro et al found no screw pullout when using locking screw fixation in 246 consecutive anterior cervical fusion cases . several reports exist in the literature of screw pullout resulting in dysphagia and sometimes erosion into the gastrointestinal tract . they continue to document the incidence of screw pullout related to misplacement to be uncommon , but can result in complications with serious morbidity and increased costs . coe et al performed a systematic review of lateral mass screw fixation , and implant removal was defined as a surgical procedure to correct malpositioned screws , screw breakout , or loosening . reoperation as defined was necessary for 27 ( 1.2% ) of 2185 screws placed in 294 patients across 5 studies . limited information was available to determine the number of patients with screw misplacement that did not require reoperation . there was also insufficient information within the screening population to determine the number of screws placed for comparison . the screening population was divided into anterior only and posterior or anterior / posterior combined groups . this does not allow for calculation of the incidence of posterior misplacement requiring revision , and it can only be speculated that this number would be much higher than the rate for anterior alone procedures . the advancements and improvements in cervical spinal instrumentation would be expected to decrease the rate of hardware - related complications . the overall complication rate of cervical spinal surgery is estimated to be 0.2% to 17.8% . after 30 days , the most common complication is related to instrumentation dislodgement , breakage , or both , and occurs in 2% to 25% of cases of spinal fusion procedures . reoperation rate for instrumented spinal fusions is reported between 2% and 25% , with the majority related to pseudoarthrosis . the majority of information is based on case reports , retrospective reviews , and small series of patients . there are few recent articles addressing the rate of screw backout or misplacement requiring reoperation , and many older studies include the use of unrestricted devices that permitted screw backout . fehlings et al prospectively collected 302 cervical spondylotic myelopathy patients and found a perioperative complication rate of 15.6% , with 11.6% minor and 7.0% major perioperative risk . three patients had instrumentation malposition / migration for a rate of 1% in the perioperative period . three patients had instrumentation / graft migration or instrumentation failure , making the risk of delayed hardware complications 1.1% . of 195 anterior cervical plating procedures , 5 ( 2.6% ) required reoperation for hardware failure . cole et al used the marketscan database and identified 13 662 patients who underwent anterior or posterior cervical fusion for degenerative disc disease . the rate of any complication excluding dysphagia was 12.3% and 17.8% for anterior and posterior approaches , respectively . there is , however , no specific mention of the reason for reoperation in the study . in 2011 , katonis et al reported on 1662 consecutively placed lateral mass screws . screw pullout occurred in 3 ( 1.3% ) patients , but they did not mention if these patients required reoperation or if the system was a screw - plate or polyaxial screw - rod implant system . the report also mentioned 11 ( 0.6% ) screws had a suboptimal trajectory but no patient required reoperation for removal or replacement of hardware . al barbarawi et al had 2 screw pullout cases out of 430 lateral mass screw - rod fixation cases . two ( 4.0% ) cases were found to have screw pullout in the study by kim et al using yoon s method . kasimatis et al included 74 patients from 1990 to 2005 who underwent anterior cervical treatment of cervical spine trauma in their study looking at complications . screw backout was reported in 4 ( 5.4% ) cases , all of which were unrestricted backout plates . seven cases ( 9.5% ) had less - than - ideal positioning of the construct with only one case requiring reoperation because of a malpositioned screw being completely in the intervertebral space . veeravagu et al looked at the marketscan database from 2006 and 2010 and found in 28 777 patients a reoperation rate of 9.13% and 10.7% for single - level and multilevel anterior cervical fusion , respectively . unfortunately , their data did not include data about the rate of reoperation related specifically to hardware failure . shapiro et al found no screw pullout when using locking screw fixation in 246 consecutive anterior cervical fusion cases . several reports exist in the literature of screw pullout resulting in dysphagia and sometimes erosion into the gastrointestinal tract . they continue to document the incidence of screw pullout related to misplacement to be uncommon , but can result in complications with serious morbidity and increased costs . coe et al performed a systematic review of lateral mass screw fixation , and implant removal was defined as a surgical procedure to correct malpositioned screws , screw breakout , or loosening . reoperation as defined was necessary for 27 ( 1.2% ) of 2185 screws placed in 294 patients across 5 studies . limited information was available to determine the number of patients with screw misplacement that did not require reoperation . there was also insufficient information within the screening population to determine the number of screws placed for comparison . the screening population was divided into anterior only and posterior or anterior / posterior combined groups . this does not allow for calculation of the incidence of posterior misplacement requiring revision , and it can only be speculated that this number would be much higher than the rate for anterior alone procedures . this study represents the largest series to analyze and tabulate the incidence of screw backout or misplacement requiring reoperation following cervical spine surgery . the data suggest this is a very rare adverse event , despite the widespread use of cervical fixation . due to the methodology of this study , there is a potential for underestimation of screw misplacement requiring reoperation within this series of patients . this potential for underreporting is more likely to occur in the case of posterior cervical fusion as this could not be calculated based on this study . the data therefore represents a lower limit for the incidence of screw misplacement requiring reoperation . patients suffering this complication require hardware revision , but do not usually suffer neurologic sequelae . meticulous technique and thorough knowledge of the relevant anatomy are the best means of preventing this complication .

study design : a multicenter , retrospective case series.objective:in the past several years , screw fixation of the cervical spine has become commonplace . for the most part , this is a safe , low - risk procedure . while rare , screw backout or misplaced screws can lead to morbidity and increased costs . we report our experiences with this uncommon complication.methods:a multicenter , retrospective case series was undertaken at 23 institutions in the united states . patients were included who underwent cervical spine surgery from january 1 , 2005 , to december 31 , 2011 , and had misplacement of screws requiring reoperation . institutional review board approval was obtained at all participating institutions , and detailed records were sent to a central data center.results:a total of 12 903 patients met the inclusion criteria and were analyzed . there were 11 instances of screw backout requiring reoperation , for an incidence of 0.085% . there were 7 posterior procedures . importantly , there were no changes in the health - related quality - of - life metrics due to this complication . there were no new neurologic deficits ; a patient most often presented with pain , and misplacement was diagnosed on plain x - ray or computed tomography scan . the most common location for screw backout was c6 ( 36%).conclusions : this study represents the largest series to tabulate the incidence of misplacement of screws following cervical spine surgery , which led to revision procedures . the data suggest this is a rare event , despite the widespread use of cervical fixation . patients suffering this complication can require revision , but do not usually suffer neurologic sequelae . these patients have increased cost of care . meticulous technique and thorough knowledge of the relevant anatomy are the best means of preventing this complication .

Introduction Methods Results Discussion Incidence of Complications Conclusions

biological variation allows for a unique craniofacial character and many asymmetries found in each individual . a neurodevelopmental disorder has been defined as an impairment of the growth and development of the brain or central nervous system . a narrower use of the term refers to a disorder of the brain function that affects emotion , learning ability , and memory , which unfolds as the individual grows . disorders considered neurodevelopmental in origin or that have neurodevelopmental consequences when they occur in infancy and childhood include : autism and autism spectrum disorders such as asperger syndrome , fetal alcohol spectrum disorder , traumatic brain injury , ( including congenital injuries such as those that cause cerebral palsy ) , communication , speech , and language disorders , genetic disorders , such as , fragile - x syndrome , and down syndrome . the definition of children with a neurodevelopmental disorder or a neurodevelopmental impairment has varied in several studies . for the purpose of this study , we have tried as far as possible to apply a definition of children with abnormal brain development , due to neurodevelopmental disorder , to include all children who have been fully diagnosed with any form of abnormality that appears likely to affect day - to - day function , such as , a developmental quotient more than two standard deviations below the normal mean , a diagnosis of neuromotor impairment , including cerebral palsy ( cp ) , speech and language disorders , hearing and vision impairment , attention - deficit hyperactivity disorder ( adhd ) , autism spectrum disorder ( asd ) , epilepsy , learning disorders ( ld ) , and mental retardation ( mr ) . neurodevelopmental disabilities ( ndds ) among children have always been an important concern , but yet to be considered as a significant public health problem , especially in the low- and middle - income countries , including nigeria . this is probably due to the fact that attention and resources are focused on more widely prevalent and visible vaccine - preventable childhood diseases , infections , nutritional deficiencies , and neonatal issues . it is implicated that 85% of the children with ndds live in low- and middle - income countries ( lmics ) however ; there is very little evidence to support this . paucity of documented data regarding the prevalence of ndds and their risk factors in lmics , further aggravates the problem . there is also no comprehensive , valid , reliable , and culturally sensitive screening tool for multiple ndds that can be used in resource - constraint environments . the importance of conducting craniometric or cephalometric studies can not be overemphasized especially in the areas of pediatrics , plastic surgery , oral surgery , and forensic medicine . cranial index ( ci ) is one of the clinically recognized anthropometric parameters used in the investigation of a craniofacial skeleton , because of its validity and practicability . the cranial index is the most investigated craniofacial parameter , as it utilizes the length and breadth of the head which are very helpful in the study of secular trends . the cranial index is used to determine variations in the shape of the head and face in newborns , and to determine the head dimensions in fetuses . however , due to paucity of data on the physical or morphometric cranial indices of children with abnormal brain development due to neurodevelopmental disorders ( ndds ) in the low- and middle - income countries , including nigeria , this study aims to discern whether abnormal brain development in the form of a neurodevelopmental disorder can cause any deviation in the cranial index of affected children , and thus , probably , serve as a baseline reference measurement for growth monitoring and evaluation . this study was conducted in the pediatric neurology clinic ( pnc ) of the institute of the child health unit , usmanu danfodiyo university teaching hospital , sokoto , for over a period of six months , by applying the inclusion and exclusion criteria for the study . cranial measurements such as head lengths and head widths were taken from 330 children of the pediatric age group 0 - 18 years , who visited the clinic during the period of study . the subjects comprised of 112 children who had been diagnosed with at least one form of abnormal brain development as a result of neurodevelopmental disorder by the pediatric neurology department of uduth , and who attended the pediatric neurology clinic . two hundred and eighteen normal growing children without any abnormal brain development on routine check up at the center were also recruited in this study . children with craniofacial malformations or a history or signs of craniofacial syndromes were excluded from this study . the bio - data of the subjects were obtained and this includes their names , hospital card numbers , sex , and age . the head length ( greatest anteroposterior diameter ) and head width ( maximum transverse diameter between two fixed points ) were measured with the help of a spreading caliper . the tips were made to touch the cranial points and the reading was observed on the scale . the cranial index was calculated as the ratio of the head width to head length multiplied by 100 . the cranial index was used to classify the head shapes into four international categories namely dolichocephalic ( ci = < 74.9 ) , mesocephalic ( ci = 75 - 79.9 ) brachycephalic ( ci = 80 - 84.9 ) and hyperbrachycephalic ( ci = > 85 ) . the research was approved by the ethics committee of the college of health sciences , usmanu danfodiyo university , sokoto . ethical consideration included taking informed consent from the parents or guardians of study participants , using hospital card numbers , to maintain confidentiality and making recommendations to the appropriate authorities . the data obtained from the measurements of the head length and head width were used in determining the cranial index . the measurement values were entered and analyzed using the statistical package for social sciences ( spss ) version 17 for windows . the student 's t test was used for comparison between the means and the statistical significance was set at p < 0.05 . summary of the neurodevelopmental disorders seen during the course of this study comparison of the mean values of the cranial index of male children with ndds and normal growing males without ndds according to age group comparison of the mean values of the cranial index of female children with ndds and normal growing females without ndds according to age group this study was conducted in the pediatric neurology clinic ( pnc ) of the institute of the child health unit , usmanu danfodiyo university teaching hospital , sokoto , for over a period of six months , by applying the inclusion and exclusion criteria for the study . cranial measurements such as head lengths and head widths were taken from 330 children of the pediatric age group 0 - 18 years , who visited the clinic during the period of study . the subjects comprised of 112 children who had been diagnosed with at least one form of abnormal brain development as a result of neurodevelopmental disorder by the pediatric neurology department of uduth , and who attended the pediatric neurology clinic . two hundred and eighteen normal growing children without any abnormal brain development on routine check up at the center were also recruited in this study . children with craniofacial malformations or a history or signs of craniofacial syndromes were excluded from this study . the bio - data of the subjects were obtained and this includes their names , hospital card numbers , sex , and age . the head length ( greatest anteroposterior diameter ) and head width ( maximum transverse diameter between two fixed points ) were measured with the help of a spreading caliper . the tips were made to touch the cranial points and the reading was observed on the scale . the cranial index was calculated as the ratio of the head width to head length multiplied by 100 . the cranial index was used to classify the head shapes into four international categories namely dolichocephalic ( ci = < 74.9 ) , mesocephalic ( ci = 75 - 79.9 ) brachycephalic ( ci = 80 - 84.9 ) and hyperbrachycephalic ( ci = > 85 ) . the research was approved by the ethics committee of the college of health sciences , usmanu danfodiyo university , sokoto . ethical consideration included taking informed consent from the parents or guardians of study participants , using hospital card numbers , to maintain confidentiality and making recommendations to the appropriate authorities . the data obtained from the measurements of the head length and head width were used in determining the cranial index . the measurement values were entered and analyzed using the statistical package for social sciences ( spss ) version 17 for windows . the student 's t test was used for comparison between the means and the statistical significance was set at p < 0.05 . summary of the neurodevelopmental disorders seen during the course of this study comparison of the mean values of the cranial index of male children with ndds and normal growing males without ndds according to age group comparison of the mean values of the cranial index of female children with ndds and normal growing females without ndds according to age group table 1 presents a summary of the neurodevelopmental disorders seen during the course of this study . tables 2 and 3 present the mean sd values of the cranial index of children with neurodevelopmental disorders ( ndds ) and that of normal growing children without ndds . all measurements were age - related . on an average , children with ndds had a lower cranial index ( mean ci = 77.78 2.95 ) than those of normal growing children without ndds ( mean ci = 79.82 3.35 ) . however , the mean cranial index for the males with ndds was 77.54 3.19 as against 79.16 3.19 of the normal growing males without ndds , while that of the females varied from 78.21 2.42 for those with ndds to 80.63 3.36 in normal growing females without ndds . statistically , all the age groups in males with ndds when compared to the normal growing children , showed no significant difference ( p > 0.05 ) except for the age group of 16 - 18 years , where the difference was statistically significant ( p < 0.05 ) as presented in table 1 . the female children with ndds did not show any statistical significant difference in comparison to the normal growing female children without ndds , as shown in table 3 . furthermore , the differences in cranial index between the sexes in children with ndds was not significant ( p = 0.2131 ) , but it was statistically significant in the normal growing children without ndds ( p = 0.002 ) . the present study shows that the cranial index values in children with ndds are similar to those of the normal growing children without ndds , in every age group . generally , the children with ndds had a lower cranial index ( mean ci = 77.78 2.95 ) than those of normal growing children ( mean ci = 79.82 3.35 ) , but this difference was not statistically significant . these values were higher when compared to the 72.96 6.12 cephalic index mean value found in the ogbia children from nigeria and lower when compared to 80.42 from chile . the overall minimum value for cranial index reported in this study was 68.39% and the maximum value was 89.29% . in the group of children with ndds , the mean cranial index was 77.54 3.19 in males and 78.21 2.42 in females , while in the group of children without ndds , the mean cranial index was 79.16 3.19 in males and 80.62 3.36 in females [ table 4 ] . it was observed from both groups that the mean values of females in this present study was higher than that of males and these differences were not statistically significant , with a p value > 0.05 . these agreed with a previous study , which reported higher cephalic index values in females than males , while our findings did not agree with any previous study that reported a statistically significant difference between the cephalic index of both sexes . the mean values for head length , head width , and cranial index observed in both sexes of children with ndds and normal growing children without ndds the mean cranial index values in both sexes are lower than the mean cephalic index values of 82.42 5.38 ( higher value ) and 81.00 5.35 ( lower value ) in males and females , respectively , found in children from bangalore , and also lower than the mean values of 83.10 in males and 84.60 in females from the gurung community . this implies that the cephalic index can be higher in any sex , depending on the peculiarity of the population under study . the mean cranial index values observed in both males and females without ndds are higher than those reported in the ogbia children , who showed values of 73.68 6.53 for males and 72.24 5.60 for females . although , the mean cranial value for females in the group of children without ndds is higher and very similar to the 80.08 mean cephalic index value found in females from port harcourt , nigeria , those of their male counterparts is lower than the 79.73 mean cephalic index value for males from port harcourt . the maximum cranial index value of females in this study is slightly higher than that reported in a previous study , whose minimum and maximum cranial index values in females was 72 and 87% , respectively , while the minimum value of females in the present study is also slightly lower than that reported by maria et al . for the normal growing males without ndds , the minimum and maximum cranial index values in this study ( 68.39 and 86.96% , respectively ) are not the same as those in the study by maria et al . , even though the maximum cranial index value in males , 93% , is higher than the maximum value of cranial index of males in this study ( 86.96% ) and the minimum cephalic index reported in male children , ( 72% ) , is higher than the minimum cranial index value of 68.39% for males reported in this study . however , for both sexes in the group of children without ndds , the minimum cranial index values in the present study are slightly lower when compared to the minimum values reported in previous studies . an explanation for this is that it may be due to the difference in the range of the children 's age group studied . however , the unsteady increase and decrease in the mean cranial index of females with ndds , with an increase in age , observed in this study , agrees with the earlier study , while the steady decrease in cranial index of females without ndds does not agree with the study of ligha and fawehinmi . the increase in mean cranial index across all age groups observed in males with ndds agrees with the reported increase in mean cephalic index with increase in age of normal growing male children from port harcourt , nigeria , while the unsteady increase and decrease seen in males without ndds does not agree with the study by ligha and fawehinmi . there was no statistically significant difference observed in the mean cranial index between the two groups and across the age ranges . on an average , the mean cranial index values of females in the present study are higher when compared to those of males across all age groups . these higher mean head width values observed in females could be due to the nondominant lateral direction of expanding of the neural mass , by neural fibers , in females . conclusively , we can deduce from this present study that the cephalic index in children does not change due to neurodevelopmental problems . the present data can be of clinical importance in determining the timing and etiology of brain insults , especially during the critical period of brain development , as well as , help in the early identification and management of neurological abnormalities . it is recommended that further studies be conducted , possibly with a larger sample size , to corroborate these findings , so as to make further inference with regard to the clinical and anthropometric importance of such studies .

background : abnormal brain development due to neurodevelopmental disorders in children has always been an important concern , but yet has to be considered as a significant public health problem , especially in the low- and middle - income countries including nigeria.aims:the aim of this study is to determine whether abnormal brain development in the form of neurodevelopmental disorders causes any deviation in the cranial index of affected children.materials and methods : this is a comparative study on the head length , head width , and cranial index of 112 children ( 72 males and 40 females ) diagnosed with at least one abnormal problem in brain development , in the form of a neurodevelopmental disorder ( ndd ) , in comparison with that of 218 normal growing children without any form of ndd ( 121 males and 97 females ) , aged 0 - 18 years old seen at the usmanu danfodiyo university teaching hospital , sokoto , over a period of six months , june to december , 2012 . the head length and head width of the children was measured using standard anatomical landmarks and cranial index calculated . the data obtained was entered into the microsoft excel worksheet and analyzed using spss version 17.results:the mean cephalic index for normal growing children with normal brain development was 79.82 3.35 and that of the children with abnormal brain development was 77.78 2.95 and the difference between the two groups was not statistically significant ( p > 0.05).conclusion : it can be deduced from this present study that the cranial index does not change in children with neurodevelopmental disorders .

Introduction Materials and Methods Study location Measurements and procedures Ethical consideration Data analysis Results Discussion Conclusion

the verbal informed patient consent was acquired for the case report publication during the acute rehabilitation . institutional review board approval was not sought for this case report . whether a patient visits a clinic or is admitted to the hospital , the importance of a detailed physical examination must be emphasized as a resource leading to an appropriate diagnosis and treatment . every medical student starts his or her medical career with learning how to take a good history from the patient and perform a thorough physical examination . this report details such a case where a thorough initial physical examination resulted in the diagnosis of subacute hemorrhagic stroke in a patient with esophageal adenocarcinoma . a 65-year - old male , an experienced civil engineer , with a history of gastroesophageal reflux disease and hiatal hernia with a new complaint of progressive difficulty swallowing associated with a recent 20-pound weight loss was referred to an oncologist . the patient was evaluated by the oncology specialist 2 weeks later , and esophagogastroduodenoscopy was performed that revealed a distal esophageal mass , which was identified through a biopsy as moderately differentiated adenocarcinoma . subsequent positron emission tomography and computed tomography ( ct ) scan studies performed 2 weeks later revealed distal esophageal wall thickening with an increased uptake extending into the proximal stomach but no brain lesions . the patient received neoadjuvant chemotherapy and en bloc esophagectomy with cervical esophagostomy , pyloroplasty , and jejunostomy feeding tube placement during the subsequent admission to a tertiary medical center . the patient was medically stabilized and evaluated for admission to a rehabilitation unit . during the rehabilitation admission examination , the patient was found to have left homonymous hemianopsia as a new physical examination finding . the patient also had some confusion with decreased initiation , not being able to perform at his educational level . considering these new findings along with his recent history of invasive and possibly metastatic esophageal adenocarcinoma , the admission team decided to proceed with a magnetic resonance imaging ( mri ) study of the brain . the differential diagnosis of brain metastasis versus a new stroke was proposed by the primary treating team . according to the radiology department report , it was likely a primary brain neoplasm , such as a neural or glial tumor , or lymphoma , but less likely a focus of metastatic disease , given its appearance . however , according to the oncology department evaluation , the lesion was more consistent with a metastatic tumor than a primary brain lesion . he was treated with oral antiepileptics . at the same time , the patient complained of having shortness of breath and was diagnosed as having pleural effusions . a pathological examination of thorasentesis concluded that no malignant cells were present in the pleural effusion fluid . a series of two head ct scans within 2448 hours were performed to rule out any acute hemorrhage ( figure 2a ) . the tumor was found to be accessible for resection per neurosurgery evaluation with a plan for tumor resection when the patient was medically stable . a subsequent craniotomy and lesion biopsy followed by pathology investigation surprisingly identified the lesion as a subacute cortical ischemic stroke negative for neoplasm . he was provided with appropriate treatment and secondary stroke prophylaxis and was able to complete the rehabilitation on the acute rehabilitation floor . in the case presented , the diagnosis of subacute ischemic stroke was made on the basis of focal findings during a detailed admission physical examination in the university - based acute rehabilitation unit . the patient was found to have mild chronic delirium with an inability to concentrate , decreased initiation , affected short - term memory , and homonymous hemianopsia . all new focal deficit findings , such as homonymous hemianopsia , require additional attention and further investigation . there are several case reports in the literature strongly suggesting that physicians have to conduct a complete medical history and arrange a specialist consultation for all patients focal findings such as visual field cuts.1 the top differential diagnostic considerations for a presentation of homonymous hemianopsia for this patient were metastatic lesion from a known esophageal carcinoma , stroke , and a primary brain tumor . according to the mri report , the lesion was likely primary brain neoplasm , such as a neural or glial tumor , or lymphoma and less likely a focus of metastatic disease given the appearance on the scan images ( figure 1a and b ) . it is very important to use the knowledge of the morphological presentation , and probability for each type of malignancy , to perform the second step in the evaluation of the patient when the clinical presentation led to the discovery of pathology . this case presents a complicated identification of the pathology , due to a very unusual presentation of the lesion leading radiology , oncology and neurosurgery departments to believing that the lesion was a tumor with unspecified etiology . it was only surgical resection that allowed identifying the correct pathology of the brain lesion as a subacute stroke . the incidences of metastatic lesions from esophageal adenocarcinoma were previously reported in the literature , estimating 2% of patients with esophageal carcinoma having brain metastasis.2 however , a more recent cohort study found 16% of patients with esophageal carcinoma having metastasis to the brain.3 visual field defects after stroke are also well reported in the literature . the incidence of homonymous field defects was estimated at 8% in all patients with stroke with the majority ( 54% ) located in occipital lobes.4 the estimated lesions located in the lateral geniculate body ( 1% ) are published in the literature.4,5 patients impairments after stroke are significantly exacerbated by visual field defect.6 the most common clinical sign of infarctions in the posterior cerebral arteries distribution are visual field defect followed by neuropsychological deficits and higher order dysfunction including memory impairment as has been presented in this case.7 acute confusional state and delirium are also common especially in the elderly population.7 recent data suggested that confusion and delirium from a stroke in the right posterior cerebral artery distribution is significantly lower in comparison to the left or bilateral posterior artery distribution.8 delirium was reported to remain for an appreciable poststroke period and was a marker of a poor prognosis.9 in this case , the patient is a well - educated and experienced engineer and the owner of an engineering company . the slow initiation and inferior performance , in light of his level of education , on the admission physical examination , and reported delirium state during the treatment before the admission to the rehabilitation floor , could be explained by the delirium and memory impairment after the posterior artery stroke . the poststroke visual field defect can result in significant disability and reduction in quality of life . patients with visual field cut can have a severely reduced quality of life and require additional neuropsychological and visual rehabilitation.4,6 only a thorough physical examination during admission helped to challenge prior negative positron emission tomography scan data and led to the diagnosis of subacute stroke , and following appropriate treatment , secondary stroke prophylaxis and rehabilitation , instead of brain radiation and chemotherapy .

this case report describes the detection of homonymous hemianopsia and delirium during the admission physical examination of a patient with esophageal adenocarcinoma , resulting in the new diagnosis of subacute hemorrhagic stroke . the poststroke visual field defect can result in significant disability and reduction in quality of life . patients with visual field cut show a severely reduced quality of life and require additional neuropsychological and visual rehabilitation . only thorough physical examination is able to challenge prior negative positron emission tomography scan , leading to the diagnosis of subacute stroke and , following appropriate treatment , secondary stroke prophylaxis and rehabilitation , instead of brain radiation and chemotherapy .

Case presentation Discussion Conclusion

higher energy intake than expenditure causes excessive accumulation of fat and leads to the development of obesity and associated metabolic disorders , which has reached epidemic proportions not only in developed countries but worldwide . furthermore , obesity can lead to the development of various co - morbidities , like type 2 diabetes , cardiovascular diseases , neurodegenerative disorders and some types of cancers , that severely impact life quality and expectancy . while treatments for the obesity related co - morbidities are available , albeit with varying success , no therapeutic avenues , with the exception of highly invasive bariatric surgery , exist to treat obesity directly . several approaches that target the central nervous system to reduce food intake have failed in this context due to massive side effects . as it can both store and burn calories , adipose tissue has gained renewed attention recently as a possible target for the treatment of obesity due to its janus - faced character . in this context , adipose tissue can be functionally divided into two main depots , namely white and brown adipose tissue . white adipose tissue is characterized by the presence of large unilocular adipocytes whose main function is the storage of energy and the release of fatty acids during fasting and starvation . brown adipose tissue is characterized by the presence of smaller cells with multilocular lipid droplets . in contrast to that of white adipose tissue , the primary function of brown adipose tissue is to produce heat , a feature which is achieved through the function of uncoupling protein 1 ( ucp1 ) . ucp1 effects a proton leak from the mitochondrial intermembrane space to the mitochondrial matrix , effectively short circuiting the electron transport chain . thus , as its name suggests , ucp1 uncouples oxidation from phosphorylation , driving a futile cycle that produces heat . in addition , to classical brown adipocytes , which are mainly localized to the interscapular depot , other brown like adipocytes , termed either beige or brite adipocytes , can be found in predominantly white adipose tissue depots . these cells have received substantial attention in recent years due to the fact that their appearance is dependent on induction . the origin of these cells , however , remains a matter of debate [ 810 ] . during cold exposure the sympathetic system activates brown fat via secretion of catecholamines that stimulate 3-adrenergic receptors on the adipocyte surface . in rats , brown adipose tissue has been shown to be responsible for over 60 percent of the excess heat production during cold stimulation ; also in newborn humans , the role of brown fat in protecting against hypothermia has been appreciated for a long time . in addition , several independent groups recently demonstrated that brown fat is also activated by cold and contributes to heat production through non - shivering thermogenesis in adult humans [ 1418 ] . . showed in 2013 that repeated cold exposure leads to recruitment of brown fat in humans and increases cold - induced gains of energy expenditure . further corroborating a functional role for brown fat in the adult human was gained from a study by cypess et al . , which demonstrated that 3-adrenergic receptor agonists can not only increase glucose uptake of brown fat but also increase resting metabolic rate by approximately 13% . brown fat activation is achieved by a variety of factors , including but not limited to natriuretic peptide a , 3-adrenergic receptor agonists and other circulating factors such as fibroblast growth factor 21 ( fgf21 ) . until recently , the energy expenditure enhancing and weight loss effects of fgf21 were thought to be mediated mainly by brown fat thermogenesis , because fgf21 has been demonstrated to directly stimulate thermogenic gene expression and to induce browning of white fat . thus , fgf21 seemed to be a suitable candidate for both the recruitment of brown cells in the white fat , as well as for the activation of endogenous brown fat . fgf21 is a member of the prominent fibroblast growth factor ( fgf ) superfamily , which currently encompasses 22 members . based on various genetic mutations , fgfs were first implicated in embryonic development , regulating proliferation and differentiation as well as organ morphogenesis . the spectrum has been expanded recently , and it is now accepted that fgf signaling plays an important role in the pathogenesis of several diseases . this is especially true for fgf21 , which has emerged as a new therapeutic target for the regulation of whole body metabolism . only five years later it was shown by the lilly research laboratories that fgf21 is an important factor regulating glucose uptake as fgf21 knockout mice exhibit a mild weight gain , increased adipocyte size and slightly impaired glucose homeostasis . furthermore , when challenged with a ketogenic diet , fgf21ko mice develop hepatosteatosis and gain weight concomitant with an impairment in ketogenesis and glucose homeostasis , as well as a downregulation of pgc1 and pgc1 both in liver and white fat . conversely , systemic injection or transgenic overexpression of fgf21 leads to protection from diet - induced obesity , concomitant with a significant reduction in blood glucose and triglyceride levels . interestingly , fgf21 overexpression also causes a marked increase in food intake under chow and high fat conditions , suggesting that either energy expenditure and/or nutrient uptake in these animals is induced . taken together , these facts identify fgf21 as a major regulator of metabolic utilization of energy containing metabolites ; therefore fgf21 is considered a novel therapeutic target for the treatment of obesity and its associated metabolic disorders [ 6,2629 ] . fgf21 is expressed in liver , pancreas , fat tissue and muscle . in adult humans , fructose ingestion acutely stimulates circulating fgf21 levels and in liver , fgf21 expression is induced after birth in response to intake of milk during suckling through the action of ppar. due to its high expression in brown adipose tissue several studies have addressed the regulation of fgf21 expression and secretion in response to activation of this organ . for example , hondares et al . showed that higher expression leads to increased secretion by analyzing arteriovenous differences in fgf21 concentration across interscapular brown fat . in contrast , work from chartoumpekis et al . could not demonstrate an increase in fgf21 serum levels after an acute cold induction at the end of a 12 h starvation period . compared fgf21 mrna levels in muscle , heart , liver , subcutaneous white and brown fat from animals at different housing temperatures . interestingly , at thermoneutrality , only liver seems to express fgf21 at a level comparable to that in activated brown adipose tissue . in ucp1 genetically ablated mice ( ucp1ko ) , fgf21 expression is induced in brown adipose tissue as well as in circulation . this increase only occurs during cold adaptation , suggesting that brown fat communicates with other organs , maybe to compensate for the loss in thermogenic capacity . in contrast , transgenic overexpression of ucp1 switches on fgf21 production in muscle suggesting that this phenotype is specific for brown fat and might be diametrically opposite in other organs . fgf21 signaling utilizes the classical intracellular fgfr signaling pathway , but , in contrast to other fgfs , it does not bind directly to the fgfr . instead , fgf21 mediates its function via the transmembrane receptor -klotho , which is a fgfr co - receptor with a high expression in liver , fat and the central nervous system . whole body deletion of -klotho leads to a complex phenotype including developmental defects such as growth retardation and a counterintuitive increase in glucose tolerance and insulin sensitivity . in brown adipose tissue of these mice , however , ucp1 levels and body temperature are reduced , suggesting that -klotho deficient mice have less energy expenditure than wild - type mice . since it was shown that other fgfs such as fgf19 can also signal via -klotho , this finding could be explained by a broader ligand spectrum for this surface receptor . the cell autonomous effect of fgf21 on adipocytes was first reported in 2005 by kharitonenkov , et al . , who demonstrated an fgf21 mediated induction of glucose uptake in mature adipocytes . in 2012 , ding et al . showed that ap2-cre mediated ablation of -klotho leads to blockade of the acute insulin - sensitizing effect . however , given the fact that ap2-cre mediated deletion targets multiple cells within the adipose tissue including adipocyte precursors , macrophages and endothelial cells [ 3941 ] , it is unclear whether this effect is due to fgf21 signaling in adipocytes . since brown fat activity is tightly regulated by the sympathetic nervous system it remains unclear whether the systemic effects of fgf21 are due to a cell autonomous regulation of brown fat activity or if this effect is mediated via the cns . a central effect of fgf21 has been demonstrated by intracerebro - ventricular ( i.c.v . ) injection of fgf21 , which , similar to systemic fgf21 injection , led to increased energy expenditure , food uptake and insulin sensitivity . however , central fgf21 administration failed to reduce body weight and size of adipose tissue , suggesting that fgf21 effects are mediated both peripherally and centrally . further evidence for the importance of fgf21 in regulating central pathways comes from animal models with hypothalamic- and hindbrain - specific genetic deletion of -klotho in conjunction with an fgf21 overexpression model , which demonstrated that centrally or peripherally administered fgf21 increases sympathetic activation in brown adipose tissue and that this effect can be blunted by i.c.v . in addition to its endocrine function , fgf21 may have paracrine or autocrine functions , as fat - specific knockout of fgf21 inhibits browning of white adipose tissue in adaptive thermogenesis . investigate the causal link between fgf21 increased browning and the loss of body weight . in accordance with previous results , the study by veniant et al . demonstrates that fgf21 injection leads to an increase in brown adipose tissue mass concomitant with an increase in ucp1 expression in brown adipose tissue , while the effect in inguinal white adipose tissue is lost at thermoneutrality . interestingly , the effect on weight loss is retained even when fgf21 is injected into ucp1ko mice , suggesting that the effects of fgf21 on weight loss are independent of brown fat activation . a closer look at the data , however , reveals that this is a simplified assumption . scrutiny of the energy expenditure data suggests that in both studies the effect of fgf21 is reduced in ucp1ko mice , a finding that is especially evident in the study by samms et al . in which fgf21 induced energy expenditure seems to be almost completely abolished in ucp1ko mice . while the effect of fgf21 on ffa and cholesterol are retained in ucp1ko mice , the effect on circulating glucose seem to be reduced or completely blunted . one important point to note is the effect of fgf21 on food intake in the context of ucp1 ablation . observes a reduced induction of food intake in ucp1ko while the study by samms et al . does n't observe an induction of food intake by fgf21 in wild type mice and actually reports a reduction of food intake in ucp1ko mice when treated with fgf21 ; the discrepancy could be due to differences in the dosing paradigm and housing temperature . taking into account that ucp1ko mice have a reduced food intake upon fgf21 treatment , one would expect them show a reduction in body weight , a finding that is not observed . therefore , it is possible that this difference is due to the effect of fgf21 on weight loss is mediated through the activation of brown adipose tissue . in ucp1ko mice both brown fat fgf21 mrna levels and circulating levels of fgf21 are increased significantly . since some effects of fgf21 are abolished in ucp1ko animals the question remains how fgf21 reduces body weight independent of ucp1 . first of all , most tissues contribute to the metabolic rate and oxygen consumption of an organism and in the adult state the majority of calories ingested , are finally lost as heat . the contribution of different tissues to mammalian metabolic rate ( independent of exercise ) mainly depends on the genetic background and the environmental temperature . based on the reported functions for fgf21 and given the literature of fgf21 and brown fat activation , the main question that arises from the recent studies is whether fgf21 acts as a physiological feedback molecule from thermogenically active tissues to integrate information about the available capacity and , if so , whether this alteration sensitizes other tissues to the action of fgf21 . to answer these questions it is necessary to review the literature on ucp1 mediated and brown fat mediated uncoupling in detail . it is well established that the genetic ablation of ucp1 induces obesity in mice living at thermoneutrality . furthermore , overexpression of ucp1 under the ap2 and the human skeletal actin promoter protects against development of genetic and diet - induced obesity , respectively . these data , which have been reviewed comprehensively , suggest that ucp1 function is the main driver of brown adipose tissue thermogenesis and that loss of ucp1 leads to a decrease in energy expenditure and concomitant obesity . that demonstrates that loss of ucp1 can protect from diet induced obesity under certain conditions . based on this controversy , several studies have addressed the ucp1-independent adrenergic heat production with somewhat controversial results and opinions range from 20 to 50% of brown fat capacity and it has been suggested that these effects could be due to ucp1-independent increases in thermogenesis in white adipose tissue . how these thermogenic processes are regulated is unclear at the moment ; however , futile cycling as well as fatty acid mediated uncoupling of the mitochondrial membrane have been suggested as possible mechanisms . for example , in mammalian muscle , sarcolipin was identified as a regulator of non - shivering thermogenesis . increased energy expenditure associated with the activation of a futile protein turnover cycle in peripheral branched - chain amino acid metabolism . furthermore , simultaneous activation of lipogenesis and lipolysis as well as prolonged beta3-adrenergic receptor activation can induce futile cycling both in white and brown adipose tissue . fgf21 induces weight loss and leads to reduction of some key metabolic parameters in ucp1ko mice . while some of these effects seem to be conserved and thus independent of ucp1 , others seem to be blunted . in particular , the fgf21 mediated changes in food intake seem to be dependent on ucp1 , suggesting a compensatory central regulation maybe through the induction of circulating fgf21 . in line with this notion recent work by schultz et al . might be important , as it suggests a fixed thermogenic capacity , which is tightly regulated by compensatory effects . thus , it is possible that under physiological conditions the effects of fgf21 are mainly mediated by brown adipose tissue through ucp1 , while under abnormal conditions such as ucp1 ablation , these effects might be mediated via other tissues . in light of these findings , and although ucp1-dependent thermogenesis is the most potent and possibly the most relevant physiological regulator of non - shivering thermogenesis , other mechanisms that have been proven to play a role in thermogenesis should be considered in the context of fgf21 signaling .

backgroundfibroblast growth factor 21 ( fgf21 ) belongs to the large family of fibroblast growth factors ( fgfs ) . even though fgf signaling has been mainly implicated in developmental processes , recent studies have demonstrated that fgf21 is an important regulator of whole body energy expenditure and metabolism , in obesity.scope of reviewgiven the fact that obesity has developed epidemic proportions , not just in industrialized countries , fgf21 has emerged as a novel therapeutic avenue to treat obesity as well as associated metabolic disorders . while the metabolic effects of fgf21 are undisputed , the mechanisms by which fgf21 regulate weight loss have not yet been fully resolved . until recently it was believed that fgf21 induces brown fat activity , thereby enhancing energy expenditure , which concomitantly leads to weight loss . novel studies have challenged this concept as they could demonstrate that a part of the fgf21 mediated effects are retained in a mouse model of impaired brown adipose tissue function.major conclusionsthe review illustrates the recent advances in fgf21 research and discusses the role of fgf21 in the regulation of energy expenditure linked to brown fat activity .

Introduction Identification of FGF21 Regulation of FGF21 expression FGF21 signaling FGF21 and brown fat uncoupling new insights Conclusions

we report herein a modification of existing techniques to enable a small anterior resection to be done without having to open either the abdomen or the rectal lumen . the patient was a 28-year - old woman with a 10-year history of pelvic pain . the most recent had suggested tethering of the rectum to the back of the cervix . when filling out a visual analogue pain survey , she gave pain scores for dysmenorrhea ( 40/100 ) , dyspareunia ( 20/100 ) , pain on defecation ( 85/100 ) , and daily pain ( 65/100 ) . she had considerable impairment in her quality of life , and using the eq-5d quality of life assessment , she gave herself a self - rated evaluation of 31 out of 100 ( population mean=88.82 ) for the quality of her health and had a calculated health state of 0.09 out of a maximum of 1.0 ( population mean=0.93 ) . on examination , a tender nodular area was noted at the top of the posterior fornix of the vagina . she was extensively counseled prior to the procedure and received liquid oral bowel preparation the day before the surgery . the patient received a general anesthetic , during which an epidural was sited for postoperative pain relief . ureteric catheters ( 6 french gauge ) were inserted cystoscopically to facilitate identification of the ureters . after insufflating carbon dioxide to a pressure of 18 mm hg via an intraumbilical disposable verress needle , the following ports were sited : a 10-mm umbilical port , through which a 10-mm laparoscope was passed , 5-mm ports in the right and left iliac fossae , lateral to the inferior epigastric vessels , and a 12-mm port with 5-mm reducer was inserted suprapubically , to the right of the midline but medial to the inferior epigastric vessels . we found the rectum tethered to the back of the cervix and the left pelvic side wall with incomplete obliteration of the pouch of douglas ( figure 1 ) . for most of the procedure , dissection was performed using maryland grasping forceps and metzenbaum scissors with a single - patient use replaceable tip . hemostasis , suction , and irrigation were achieved using a surgiflex wave ( acmi , usa ) and 20 watts of bipolar power . the technique of opening of the peritoneum lateral to any disease and reflecting the tethered rectum off the back of the cervix has already been described and illustrated by redwine and is therefore not illustrated herein . using this technique , the peritoneum was opened laterally on the pelvic sidewall below the level of the ureters . the tethered rectum was then reflected down , allowing dissection into the rectovaginal space and leaving any disease on the surface of the rectum . the peritoneal incisions are extended medially and again are joined at the midline by incising over the serosal surface of the rectum , proximal to the diseased area . this technique allows the en - bloc excision of any diseased peritoneum either lateral to or overlying the rectum . at this point , we had isolated a 3-cm patch of nodular endometriosis that infiltrated the muscular layer of the rectum . it was apparent that this area was too large to be excised without creating a large defect in the rectum , and a decision was made to proceed to a segmental anterior resection . the mesorectum was dissected using the ultracision harmonic scalpel ( ethicon , usa ) , exposing a 6-cm length of rectum that incorporated the diseased area ( figure 2 ) . a circular end - to - end anastomosis instrument ( 28-mm premier plus ceea , tyco healthcare , usa ) was inserted through the anus and advanced up the rectum to a point proximal to the disease . by unscrewing the handle , the anvil of the ceea device was made visible through the rectal wall , and the shaft was grasped by using a soft bowel grasper ( figure 3 ) . the handle of the device was then removed , leaving the anvil held in place within the lumen of the rectum , proximal to the disease . an endogia universal stapling device ( tyco healthcare , usa ) was used to transect the rectum above and below the diseased area ( figure 4 ) . the excised tissue was removed through the 12-mm port site with the assistance of a retrieval bag . the point of the shaft of the anvil was then pushed through the transverse staple line on the proximal end of the colon ( figure 5 ) . the ceea device was reinserted through the anus , and the anvil reattached ( figure 6 ) . to reduce adhesion formation , 1000 ml of icodextrin solution ( adept , shire pharmaceuticals , uk ) was left in the abdomen . the ceea device is inserted up the rectum ; the anvil is removed and held proximal to the diseased segment before the rectal segment is excised . the rectal segment is excised using the endo - gia stapler . the point of the shaft of the anvil is pushed through the proximal end of the colon . the rectal tube was removed after liquid stool was passed on the fourth postoperative day , and the patient was discharged on the fifth day . histological examination of the rectum demonstrated endometriosis within the muscularis propria of the rectal wall . the patient was a 28-year - old woman with a 10-year history of pelvic pain . the most recent had suggested tethering of the rectum to the back of the cervix . when filling out a visual analogue pain survey , she gave pain scores for dysmenorrhea ( 40/100 ) , dyspareunia ( 20/100 ) , pain on defecation ( 85/100 ) , and daily pain ( 65/100 ) . she had considerable impairment in her quality of life , and using the eq-5d quality of life assessment , she gave herself a self - rated evaluation of 31 out of 100 ( population mean=88.82 ) for the quality of her health and had a calculated health state of 0.09 out of a maximum of 1.0 ( population mean=0.93 ) . on examination , a tender nodular area was noted at the top of the posterior fornix of the vagina . she was extensively counseled prior to the procedure and received liquid oral bowel preparation the day before the surgery . the patient received a general anesthetic , during which an epidural was sited for postoperative pain relief . ureteric catheters ( 6 french gauge ) were inserted cystoscopically to facilitate identification of the ureters . after insufflating carbon dioxide to a pressure of 18 mm hg via an intraumbilical disposable verress needle , the following ports were sited : a 10-mm umbilical port , through which a 10-mm laparoscope was passed , 5-mm ports in the right and left iliac fossae , lateral to the inferior epigastric vessels , and a 12-mm port with 5-mm reducer was inserted suprapubically , to the right of the midline but medial to the inferior epigastric vessels . we found the rectum tethered to the back of the cervix and the left pelvic side wall with incomplete obliteration of the pouch of douglas ( figure 1 ) . for most of the procedure , dissection was performed using maryland grasping forceps and metzenbaum scissors with a single - patient use replaceable tip . hemostasis , suction , and irrigation were achieved using a surgiflex wave ( acmi , usa ) and 20 watts of bipolar power . the technique of opening of the peritoneum lateral to any disease and reflecting the tethered rectum off the back of the cervix has already been described and illustrated by redwine and is therefore not illustrated herein . using this technique , the peritoneum was opened laterally on the pelvic sidewall below the level of the ureters . the tethered rectum was then reflected down , allowing dissection into the rectovaginal space and leaving any disease on the surface of the rectum . the peritoneal incisions are extended medially and again are joined at the midline by incising over the serosal surface of the rectum , proximal to the diseased area . this technique allows the en - bloc excision of any diseased peritoneum either lateral to or overlying the rectum . at this point , we had isolated a 3-cm patch of nodular endometriosis that infiltrated the muscular layer of the rectum . it was apparent that this area was too large to be excised without creating a large defect in the rectum , and a decision was made to proceed to a segmental anterior resection . the mesorectum was dissected using the ultracision harmonic scalpel ( ethicon , usa ) , exposing a 6-cm length of rectum that incorporated the diseased area ( figure 2 ) . a circular end - to - end anastomosis instrument ( 28-mm premier plus ceea , tyco healthcare , usa ) was inserted through the anus and advanced up the rectum to a point proximal to the disease . by unscrewing the handle , the anvil of the ceea device was made visible through the rectal wall , and the shaft was grasped by using a soft bowel grasper ( figure 3 ) . the handle of the device was then removed , leaving the anvil held in place within the lumen of the rectum , proximal to the disease . an endogia universal stapling device ( tyco healthcare , usa ) was used to transect the rectum above and below the diseased area ( figure 4 ) . the excised tissue was removed through the 12-mm port site with the assistance of a retrieval bag . the point of the shaft of the anvil was then pushed through the transverse staple line on the proximal end of the colon ( figure 5 ) . the ceea device was reinserted through the anus , and the anvil reattached ( figure 6 ) . to reduce adhesion formation , 1000 ml of icodextrin solution ( adept , shire pharmaceuticals , uk ) was left in the abdomen . the ceea device is inserted up the rectum ; the anvil is removed and held proximal to the diseased segment before the rectal segment is excised . the rectal segment is excised using the endo - gia stapler . the point of the shaft of the anvil is pushed through the proximal end of the colon . the rectal tube was removed after liquid stool was passed on the fourth postoperative day , and the patient was discharged on the fifth day . histological examination of the rectum demonstrated endometriosis within the muscularis propria of the rectal wall . almost all the methods involve separating the adherent rectum from the back of the vagina and cervix and dissecting down into the rectovaginal septum . as this is done , the disease can be left on the side of the rectum to be stripped off after the dissection or can be left on the vaginal side of the septum and excised vaginally . shaving the disease off the front of the rectum invariably thins the serosal surface , and procedures to plicate the uterosacral ligaments and lateral rectal peritoneum across the midline have been described . where deeper involvement of the rectal muscularis or mucosa occurs , it is necessary to excise a full - thickness part of the rectum . this can be done by excising a disc of rectal wall or performing an anterior segmental rectal resection . concerns about the safety of performing such aggressive surgery for benign disease have been raised . temporary colostomy formation has been performed when the anastomosis is extremely close to the anal margin and to manage a postoperative obstruction , but is otherwise rarely required . clinically detectable anastomotic leaks occur after 7.3% of resections for carcinoma but to our knowledge have not been reported after resections for endometriosis . other risks include fistula formation , intestinal obstruction , and pelvic abscess formation , but also appear to be very uncommon . advances in laparoscopic techniques and equipment have allowed segmental rectal resections to be performed whilst remaining loyal to the principles of laparoscopic surgery and minimizing the need for the traditional midline laparotomy . total laparoscopic anterior resection has been described in animal models and has been used extensively for benign and malignant colorectal conditions . at some points during the several described techniques , the port sites need to be enlarged or a mini - laparotomy needs to be performed to remove the specimen or insert the anvil of the circular end - to - end anastomosis device . other techniques describe the use of a 33-mm port or a hand port to facilitate the reanastomosis . most descriptions involve opening a small part of the proximal stump of sigmoid or rectum to insert the anvil into the proximal stump . at this point , the risk of fecal spillage is present , even with adequate bowel preparation , and a purse string suture is required to secure the hole in the proximal stump around the shaft of the anvil . our procedure requires a maximum port size of 12 mm , does not require a mini - laparotomy or a large port for the insertion of the anvil , and prevents any risk of fecal spillage during the operation . we hope this technique will speed postoperative recovery and improve the safety of a laparoscopic anterior resection for patients with rectal endometriosis . we believe that this sort of surgery should be performed in units where sufficient colorectal surgical backup is available and where facilities are in place to ensure that meticulous follow up and audit of these procedures occurs .

background : anterior rectal resection is sometimes necessary to treat deeply infiltrating rectovaginal endometriosis . we describe a completely laparoscopic approach as a new way of excising rectal endometriosis that can be used without opening any part of the rectum . this avoids opening the abdomen or any risk of fecal spillage.methods:the patient received preoperative oral bowel preparation . ureteric stents ( 6 f ) were inserted cystoscopically . the peritoneum in the ovarian fossae was opened lateral to any disease and the rectum reflected off the back of the cervix , leaving any endometriosis on the front of the rectum . the pelvic peritoneum was reflected medially , below the level of the ureters . the mesorectum was then dissected off a 6-cm length of rectum by using a harmonic scalpel . a circular end - to - end anastomosis instrument was passed anally until the outline of the anvil was visible , inside the colon , above the diseased rectum . the anvil was detached and held by a soft grasper before the rectum was then divided above and below the disease using a laparoscopic stapling device . the tip of the anvil was pushed through the proximal end of the colon allowing reanastomosis of the rectal stump.conclusion:the patient was discharged after 5 days without complications .

INTRODUCTION METHODS The Patient The Procedure DISCUSSION CONCLUSION

thymic carcinoma is an aggressive anterior mediastinal malignancy that can cause severe chest pain , although its incidence is rare . echocardiography is useful for assessing chest pain in the emergency room , but the diagnosis of an extracardiac mass can be missed . the purpose of this report is to describe the validation of echocardiography for accessing an extracardiac mass that presented with chest pain . an 80-year - old male visited the emergency room for sharp chest pain that had lasted for 1 month . he had a history of inferior wall myocardial infarction and percutaneous coronary intervention on the proximal - middle right coronary artery 2 years ago . on the physical examination , his temperature was 36.6 , his blood pressure was 100/60 mmhg , and his pulse was 81 beats / min . laboratory examinations showed that the levels of ck - mb , troponin - i , and brain natriuretic peptide were not significantly elevated ( 2.8 ng / ml , 0.05 ng / ml , and 143 ng / ml , respectively ) . electrocardiography revealed atrial fibrillation with q - waves in lead ii , iii , and avf . emergent coronary angiography was performed because of his history of previous myocardial infarction , but mild in - stent restenosis of the proximal right coronary artery and no new lesions of significant coronary artery stenosis for chest pain were shown . two - dimensional transthoracic echocardiography showed akinesia of the basal inferior wall , but no newly detected regional wall motion abnormality . this extracardiac mass was located in the upper anterior mediastinal area and showed vascularity by color doppler imaging ( fig . 2c ) . the right ventricle was slightly compressed by this mass , but there was no detectable pericardial effusion . the previous echocardiography 1 year ago had shown no echogenic mass in the extracardiac area ( fig . a huge anterior mediastinal mass was enhanced heterogeneously and directly invaded the sternal cartilage , costal cartilage , aortic arch , and pulmonary artery ( fig . these ct findings were suggestive of a thymic carcinoma , and the severe chest pain of this patient was due to the huge anterior mediastinal mass with bone invasion . histological findings by sonography - guided fine - needle aspiration demonstrated that the great majority of cells had tumoral necrosis and a very small number of cells had a high nucleus to cytoplasm ratio with hyperchromatin . these findings represented malignancy of the thymus ; however , it was impossible to classify the subtype of tumor because of severe necrosis ( fig . 5 ) . the patient was referred to an oncologist for further management of the left anterior mediastinal mass . however , further specific tests were refused . according to the clinical presentation , the anterior mediastinal mass with invasiveness , and ptosis and muscle weakness , however , palliative radiotherapy was discontinued because the patient complained of significant anorexia and weakness . only 15% to 20% of patients with acute chest pain actually have acute coronary syndrome.1,2 to discriminate patients with acute coronary syndrome from patients with non - cardiac chest pain is an immediate challenge to the primary clinician , especially in patients with a history of myocardial infarction and percutaneous coronary intervention . the accuracy and efficiency of the differential diagnosis of acute chest pain can be improved by combining various approaches based on vigilant history taking , electrocardiography , biochemical markers , and imaging modalities such as echocardiography , coronary computerized tomography , and coronary angiography . because transthoracic echocardiography is widely available , with bedside utility and high sensitivity and negative predictive value in patients with acute chest pain for ischemia therefore , after ruling out life - threatening conditions , it is necessary to consider other possible causes . especially when chest pain is sharp and lasts for hours , it is frequently suspicious that the chest pain originates from a musculoskeletal cause . when a mediastinal mass such as a thymic carcinoma invades the chest wall , pleura , or heart , patients frequently present with chest pain.3 our case illustrates several considerations in the initial evaluation of chest pain . first , chest ct was needed more than emergent coronary angiography because of the characteristics of the chest pain , which was sharp and had lasted for a month . although a few cases of thymic cyst and malignancy have been documented,4 - 7 there has been no report that echocardiography detected an extracardiac mediastinal mass in the course of evaluating chest pain . thymic carcinoma is a heterogeneous group of aggressive and epithelial malignancies , and its incidence is rare . most patients present with cough , dyspnea , or chest pain . while these symptoms are being evaluated , the malignancy is often incidentally detected by chest radiographs or ct scan.3 when an anterior mediastinal mass shows the presence of an irregular contour , necrotic or cystic component , heterogeneous enhancement , lymphadenopathy , and great vessel invasion on a ct scan , the mass is likely to be a thymic carcinoma.8 mediastinal tumors , including thymoma , thymic carcinoma , and seminoma have been incidentally detected by thallium-201 ( tl 201 ) imaging.9 considering that the mediastinal mass is adjacent to the cardiac chamber , echocardiography can evaluate a mediastinal mass like a ct scan or tl 201 uptake . the mediastinal mass can distort or partially displace one or more cardiac chambers , and an anterior mediastinal mass can compress the right heart chamber , which can be shown by echocardiography.5 it has been reported that thymic cancer was detected by echocardiography presenting as cardiac tamponade or supra vena cava ( svc ) echocardiography is useful for the evaluation of chest pain in emergency circumstances and can detect a mediastinal mass because mediastinal masses are just adjacent to the heart ; however , the diagnosis of an extracardiac mass can be missed . therefore , it is important to look outside the heart in addition to the heart itself in the assessment of chest pain .

we report a case of thymic carcinoma that was initially detected by echocardiography in an 80-year - old male who visited the emergency room for chest pain and had a history of myocardial infarction and percutaneous coronary intervention . transthoracic echocardiography showed a huge extracardiac mass that was located in the anterior mediastinum and was diagnosed as a thymic carcinoma by biopsy .

INTRODUCTION CASE REPORT DISCUSSION

bromodomains are epigenetic readers that specifically recognize acetyl - lysine ( kac ) marks on proteins . targeting this protein interaction module with small molecules has recently emerged as a potential therapeutic strategy for the treatment of several diseases including cancer and inflammation . to date , most inhibitor development efforts have been focused on the bet family of bromodomain proteins for which several inhibitors have now entered clinical testing . bromodomains have good predicted druggability , and selective chemical tool compounds have been developed even for less attractive binding sites that possess open or highly charged acetyl - lysine binding pockets such as baz2 and atad2 . in addition , potent inhibitors have been developed for highly druggable bromodomains present in brpf , cbp , and brd9 . interestingly , several recent inhibitor development projects have highlighted the success of fragment - based approaches identifying inhibitors , in particular for poorly druggable bromodomains . p300/cbp - associated factor ( pcaf , also known as histone acetyltransferase kat2b ) is a multidomain protein that harbors an acetyltransferase ( hat ) and e3 ubiquitin ligase domains as well as a c - terminal bromodomain that may associate with the hats p300 and cbp . while the roles of the acetyltransferase and the e3 ubiquitin ligase activities have been shown to be required for cell proliferation and apoptosis , little is known about the regulatory function of the pcaf bromodomain in cellular processes . selective inhibitors , so - called chemical probes , would therefore be interesting reagents to unravel the functions of the pcaf bromodomain and to assess its therapeutic potential as a targeting site for drug development . an important role of the pcaf acetyl - lysine recognition module has already been demonstrated for the replication of aids viruses . the pcaf bromodomain targets the hiv tat protein acetylated at k50 , an essential association that activates hiv-1 transcription and promotes the integrated proviral replication . development of pcaf bromo - domain inhibitors has therefore been proposed as a potential strategy for the treatment of aids , and this strategy has been confirmed by early n1-aryl - propane-1,3-diamine - based compounds that have been shown to prevent pcaf / tat association . this compound class has recently been followed up by the development of a series of 2-(3-aminopropylamino ) pyridine 1-oxide derivatives that however did not lead to improvement of the micromolar potency of current pcaf bromodomain inhibitors . this prompted us to identify more diverse chemical starting points using fragment screening by thermal shifts assays and nmr as well as structure - based approaches . to extend structural knowledge from our previous apo crystal structure , we initially determined the crystal structure of the pcaf - acetyl - lysine complex to provide insights into acetyl - lysine recognition . the binding mode of the acetyl - lysine in pcaf strongly resembled that observed in other bromodomains with the kac carbonyl forming two canonical hydrogen bonds to a conserved n803 and a conserved water molecule . this water is part of a conserved intricate network of structural waters located at the bottom of the pocket that bridge interaction with the za loop y760 and the backbone carbonyl of e750 ( figure 1a ) . despite sharing the conserved interactions , the kac binding groove in pcaf was fenced on one side by the bulky residue y809 , resulting in a tight and restricted pocket ( figure 1b ) . large aromatic residues in this position are not common for human bromodomains , present in less than a third of proteins in the family . ( a ) detailed interactions between the bound acetyl - lysine ( kac , shown in yellow stick ) and the pcaf bromodomain . ( b ) electrostatic surface representation reveals a tight central kac pocket that is extended by wide cavities lined by the za and bc loop regions . another interesting structural feature was the extension of the binding pocket by a shelf created by the za loop harboring a mixture of hydrophobic and polar surface residues ( figure 1b ) . however , recently the development of baz2 inhibitors demonstrated that such large binding pockets can be efficiently occupied for instance by aromatic ring systems of the baz2-icr probe that are aligned by intramolecular aromatic -stacking . the low affinities of the previously developed compounds prompted us to search for other kac mimetics that would be compatible with the constraint nature of the central pcaf pocket . we employed different techniques to screen two fragment libraries . in one set of experiments , we used a thermal stability shift assay to screen a small fragment set at 1 mm and identified several fragments that resulted in positive melting temperature ( tm ) shifts in the range of 12 c ( figure 2 ) . the highest tm shifts were recorded for 1-methylquinolin-2(1h)-one ) ( 1 , br004 ) , 1h - indole-5-carboxamide ( 2 , br005 ) , 2-methylisoindolin-1-one ( 3 , br013 ) , 4-methoxybenzo[d]isoxazol-3-amine ( 4 , mb360 ) , 2,3-dihydrobenzo[b]dioxine-5-carboxamide ( 5 , mb364 ) , and ( 4-(1,2,3-thiadiazol-4-yl)phenyl)methanamine ( 7 , mb093 ) , most of which comprised known kac mimetic scaffolds . in parallel , we used target immobilized nmr screening ( tins ) to screen a diverse collection of approximately 950 commercially available fragments . we first confirmed that binding of kac to immobilized pcaf could be observed in 2% dmso ( supporting information , figure s1 ) . subsequently mixtures of fragments were screened with a maximum of four compounds per mix such that the dmso concentration was never more than 2% . consistent with earlier predictions , we observed a tins profile indicating that pcaf is highly ligandable ( figure 2c ) . on the basis of the profile , 63 hits were selected , a 6.6% hit rate . in contrast to tins , binding of kac to immobilized pcaf in the presence of dmso could not be detected by spr . consequently , only those hits that were readily soluble in an aqueous buffer were orthogonally validated by spr . the binding of 17 hits could be fully characterized by spr , and three were selected for structural studies based on novel features ( supporting information , figure s2 and table s1 ) . these fragments ( 9 , 10 , and 11 ) also resulted in substantial tm shifts ( figure 2 ) . fragments containing kac mimetics identified as potential binders for pcaf bromodomain . chemical structures of the identified fragments are shown in ( a ) together with average tm shifts ( sem ) using triplicate experimental data listed in ( b ) . the t / r ratio of each compound screened was calculated as a height weighted average of the ratio of the peak amplitude of each nmr resonance in the presence of pcaf over that in the presence of the reference protein . the t / r ratios were then binned , and the frequency is plotted above . the asymmetry and tailing to the left ( i.e. , a large number of compounds displaying preferential binding to pcaf ) are indicative of high ligandability of pcaf . we next attempted to verify the binding modes of the identified fragments and successfully determined the complex crystal structures for seven kac mimetic fragments . as expected from their chemical structure , all of these fragments occupied the kac binding site through groups that mimicked the hydrogen bond interaction of acetyl - lysine . because the co - crystallized compounds were small , the contacts with the bromodomain were limited only to the canonical hydrogen bond with n803 and the typical water - mediated contact with y760 ( figure 3a ) . however , additional interactions were also observed for fr11 , of which the 1-ethanol decoration was oriented toward the open za cavity and formed both direct and water - mediated hydrogen bonds to the backbones of the za loop v752 and p751 . superimposition of all structures revealed that the co - crystallized fragments fit tightly into the narrow kac pocket , and most fragments formed aromatic interactions with y809 that lines the central acetyl - lysine binding groove of the pcaf bromomdomain ( figure 3b ) . no significant structural alterations were observed when comparing all complexes , suggesting that the pcaf bromodomain contains a rigid acetyl - lysine binding pocket . some kac mimetic groups of the identified fragments were not specific for pcaf and have been previously shown to bind to other bromodomains , for example , 1 also interacts with atad2 and the isoxazole 8 with brd4 and crebbp with highly conserved binding modes . ( a ) detailed interactions between the bound fragments ( yellow stick ) within the pcaf kac binding site . the conserved water molecules at the bottom of the pocket are shown in pink spheres , and an additional water molecule involving in additional water - mediated interactions observed in the complex with 11 is highlighted by magenta sphere . ( b ) superimposition of the bound fragments and kac revealed canonical acetyl - lysine mimetic binding modes and no significant conformational changes upon inhibitor binding within the pocket . coordinates have been deposited under accession codes : 5fe1 , 5fe2 , 5fe3 , 5fe4 , 5fe6 , 5fe7 , and 5fe5 . with the success in identifying the kac mimetic fragments and obtaining the complex structures , we next expanded the ligand series to more decorated compounds by choosing two diverse scaffolds ( figure 4a ) . two compounds , cpd1 ( 12 ) ( n-(1,4-dimethyl-2-oxo-1,2-dihydroquinolin-7-yl)acetamide ) and cpd2 ( 13 ) ( n-(1,4-dimethyl-2-oxo-1,2-dihydroquinolin-7-yl)methanesulfonam ) , were derivatives based on fragment hit 1 containing an additional 4-methyl group and two different decorations at the seventh position , either with n - linked acetamide or sulfonamide . a third inhibitor , cpd3 ( 14 ) ( n - methyl-5-(2-oxo-2-(phenylamino)ethoxy)-2-((tetrahydro-2h - pyran-4-yl)oxy)benzamide ) , contained instead a benzene core harboring an acetamide extension , a kac mimetic group resembling fragment 1 . in addition , this latter compound was also further decorated by tetrahydropyran and n - phenylacetamide linked to the benzene ring via an ethoxy linkage at the ortho and meta positions relative to the acetamide group , respectively . ( a ) chemical structures of three in - house available compounds that contain the fragment - related kac mimetic scaffolds . ( b ) average tm shift values from triplicate experiments for the selected compounds . ( c ) itc binding data for the interactions between 13 and 14 with pcaf with the isotherms of raw titration heat shown on the top and the normalized binding heat with the single - site fitting ( red line ) shown at the bottom . the binding of these three compounds was initially confirmed by dsf with 12 and 13 , showing a similar degree of stabilization with tm shifts of 2.62.9 c at 1 mm concentration ( figure 4b ) . because of signal interference , 14 was used at half the concentration of the others but nonetheless produced a similar tm shift of 3.3 c . as expected , the increase of the tm shift values of these three ligands suggested stronger binding to pcaf bromodomain . we used isothermal titration calorimetry ( itc ) to determine binding affinities in solution . in agreement with the dsf results , the measured kd of 13 was observed to be 21 m , which was 3-fold higher than that of the more decorated 14 ( kd of 7 m ) ( figure 4c ) . the increase in the affinity of the latter was due to significantly larger negative binding enthalpy , suggesting more favorable polar interaction of this inhibitor . however , the ligand efficiency ( le ) decreased to 0.24 for 14 compared to le of 0.34 for 13 . to gain insight into the selectivity of the most potent fragment hits , we performed a temperature shift screen using a panel of 48 recombinant bromodomains ( supporting information , figure s3 ) . this selectivity screen revealed strong interaction of 14 to bromodomains present in cecr2 ( 7.1 c ) , brd7 ( 6.5 c ) , suggesting that this fragment can also be optimized targeting other bromodomains . , both inhibitors showed strong inhibition for brd9 ( supporting information , table s2 ) . this is not surprising because 1-methylquinoline-2-ones have been developed into highly specific brd9 inhibitors . the crystal structures of the ligand pcaf complex allowed us to evaluate the interactions of the introduced decorations . all compounds could be unambiguously positioned based on the well - defined electron density map ( figure 5 ) . as expected in complexes with 12 and 13 , the 1-methylquinoline-2-one group occupied the kac binding groove and formed similar canonical interactions as observed in the pcaf complex with 1 , while the decoration of both compounds oriented toward the za pockets . in contrast , the 13 n - linked sulfonamide was observed to replace a water molecule that bridged interactions between e756 and k753 in the kac complex ( figure 1a ) , enabling the formation of two direct hydrogen bonds to these two residues as well as a water - mediated contact to the carbonyl backbone of w746 ( figure 5 ) . interestingly , a sulfonamide at this analogous position also engaged within the kac site of baz2b in the gsk2801 inhibitor complex . crystal structures of pcaf in complexes with 12 , 13 , and 14 . detailed interactions between the bound compounds with the pcaf bromodomain are shown . the conserved water at the bottom of the pocket is displayed in pink spheres , while an additional water molecule involving in contact between the 13 and protein is shown in magenta sphere . coordinates have been deposited under accession codes : 5fe8 , 5fe9 , and 5fdz , respectively . the binding mode of 14 was slightly different potentially due to its larger decorations and its different acetyl - lysine mimetic moiety ( figure 5 ) . the acetamide interacted with pcaf in a typical kac mimetic manner , with the benzene core stacking against the y809 in a similar fashion observed also for the other fragments . the tetrahydropyran expanded into the open za pocket , while the n - phenylacetamide extension occupied the bc pocket with the phenyl ring located above n803 and oriented perpendicularly to y802 and p804 within a distance for -stacking . considering its affinity , such limited interactions were rather surprising when compared to the binding mode of the weaker 13 , of which the extended group engaged in more hydrogen bond interactions . we hypothesize therefore that 14 may gain its increased binding potency through a larger contact surface . hence , an extension of the kac - mimetic fragments resulted in improved binding affinities despite the lack of direct polar interaction with the protein . in addition , the large surrounding space adjacent to the za and bc loops provides few spatial constraints , enabling the binding of diverse chemical moieties , albeit with little shape complementarity . it is likely that elongated , flexible , and uncharged substituents that could span the interface as well as engage a few interactions may be beneficial for increasing ligand potency through targeting the za and bc pockets in the pcaf bromodomain . the fragment - based approach coupled with structural information presented here offers a platform expanding the knowledge on pcaf kac - mimetic scaffolds and binding modes to aid development of potent and selective pcaf bromodomain inhibitors . the structural models provide valuable data for the rational design of inhibitors to the rigid and poorly enclosed pcaf kac binding pocket . comparison of inhibitor binding modes highlights the importance of aromatic interactions with y809 and provides several diverse acetyl - lysine mimetic chemotypes . these chemotypes may serve as attractive starting points for inhibitor development efforts targeting this interesting bromodomain . all fragments that were cocrystallized formed an acetyl - lysine mimetic hydrogen bond to n803 . thus , for future development of these fragments into more potent hits the fragment need to be grown rather than linked in order to increase potency . the pcaf bromodomain ( aa 715831 ) containing an n - terminal his6-tag was recombinantly expressed in escherichia coli rosetta . the protein was initially purified by ni - affinity chromatography and subsequently cleaved the tag with tev protease . the cleaved protein was further purified using size exclusion chromatography and stored in 25 mm hepes , ph 7.5 , 150 mm nacl , and 0.5 mm tcep . fragments were purchased from chemical vendors and were at least 95% pure according vendor specifications . the purity of the synthesized compounds 12 , 13 , and 14 was assessed by analytical hplc using an agilent 1100 equipped with photodiode array detector ( dad ) , quaternary gradient pump , and micro plate sampler ( agilent 220 ) . separation was performed upon centurysil c18-aq + 5 m , 50 mm 4.6 mm ( johnson ) . the flow rate of the mobile phase was kept at 3.5 ml / min . mobile phases b and c were acetonitrile with 0.35% cf3co2h and water with 0.35% cf3co2h , respectively . the gradient conditions were as follows : 00.5 min 1% b and 99% c , 3.7 min 90% b and 10% c , 5 min 99% b and 1% c. the injection volume was 10 l . 12 and 13 were 90% pure by hplc at 254 nm and 99% by evaporative light scattering detection ( elsd ) . the protein at 2 m in 10 mm hepes , ph 7.5 and 250 mm nacl was mixed with the fragments / compounds at 1 mm concentration ( unless stated ) . the assays , data evaluation , and melting temperature ( tm ) calculation were performed using a real - time pcr mx3005p machine ( stratagene ) with the protocols described previously . all isothermal calorimetry ( itc ) experiments were carried out on nanoitc ( ta instruments ) at 15 c in the buffer containing 25 mm hepes , ph 7.5 , 150 mm nacl , and 0.5 mm tcep . titration was performed by injecting pcaf ( 250 m ) into the reaction cell containing the compounds ( 1520 m ) . the corrected data of the integrated heat of titration were fitted to an independent single binding site model based on the manufactor protocol , from which the thermodynamics parameters ( h and ts ) , equilibrium association and dissociation constants ( ka and kd ) , and stoichiometry ( n ) were calculated . purified , biotinylated pcaf was captured onto a neutraavidin - coated cm5 sensor chip surface in 20 mm sodium phosphate ph7.5 , 150 mm nacl , 2 mm dtt , and 0.05% p20 tween . an acetyl - lys 16 peptide derived from h4 was used to monitor the ligand binding capacity of the immobilized pcaf bromodomain at regular intervals . apo crystals of pcaf ( 1418 mg / ml ) were obtained using the vapor diffusion method at 4 c and either single - peg - based ( 2135% peg 3350 , 0.1 m bis - tris ph 5.57.0 ) or peg - smear - based ( 2140% medium - molecular - weight peg smears buffered either with 0.1 m bis - tris ph 6.07.5 or 0.1 m tris ph 7.58.8 ) reservoir solutions . ligand complex crystals , soaking was performed using the mother liquor supplemented with the fragments / compounds at 1020 mm concentration and 20% ethylene glycol . diffraction data were collected either in - house or at the diamond light source . initial structure solution was achieved using molecular replacement with phaser from ccp4 suite and the published coordinates of pcaf . manual model building alternated with refinement were performed in coot and refmac , respectively .

the p300/cbp - associated factor plays a central role in retroviral infection and cancer development , and the c - terminal bromodomain provides an opportunity for selective targeting . here , we report several new classes of acetyl - lysine mimetic ligands ranging from mm to low micromolar affinity that were identified using fragment screening approaches . the binding modes of the most attractive fragments were determined using high resolution crystal structures providing chemical starting points and structural models for the development of potent and selective pcaf inhibitors .

Introduction Results and Discussion Conclusion Experimental Section

every human voice is unique as it was found to be quantitatively composed of components called phonemes that have a pitch , cadence , and inflection . hence human voice has been used as one of the popular biometrics in biosecurity applications ; it can be used to authenticate a person 's identity ( identification ) and control access ( authentication and verification ) to a protected resource . unlike other biological traits , like fingerprints and iris scans , voiceprints are relatively vulnerable to replay attack . much of the research works have been devoted to finding improved solutions in the hope of strengthening voiceprints for meeting high demands of security applications . some popular techniques include multimodal authentication that fused audio , visual , and other forms of biometrics into one . since then , voice biometrics has been largely geared towards the security directions of biometric identification and biometric verification . voice biometrics is used either alone or in combination with other biometrics . in voice verification ( vv ) , a voiceprint of a speaker who claims to be who he is , is presented to the biometrics system for a one - to - one checking of the reference voiceprint which is stored in a database . once he is successfully verified with a match , subsequent access rights would be granted to him . the other type of checking called voice identification ( vi ) relies on a one - to - many checking for identifying a previously unknown voiceprint . the unlabelled voiceprint under question is searching through the whole database with the aim of finding a match of an already known sample . we can see that both vv and vi require a priori condition that a set of voiceprints must have already been known for the matching of new samples to proceed . this is akin to database query or supervised learning where preknown samples must be initially used to train up a decision model , so testing and matching of new sample can follow . what if in a scenario where a handful of unknown voiceprints are collected , but we wish to obtain some information about them ? such scenarios may include but not limited to security surveillance problems where a list of voice traces are captured from a monitored area , how many unique speakers there are , their ages , and genders , and from their speech accents which ethnic backgrounds these people belong to ; customer - service applications where callers will be automatically classified from their tones to categories of their needs and emotions . it was only until recently , voice classification ( vc ) that attempts to determine if a speaker should be classified to a particular characteristic group rather than to a particular individual has gained popularity . vc can help complement the security of vv and vi systems too . in figure 2 an example of a voice biometric system is being compromised ; through hacking , the content of a voiceprint b is modified to that of another voiceprint ( let us say a ) that has a higher access authority . because the database of the voiceprints just like an encrypted list of passwords in a file system is accessed individually , each voiceprint is protected independently ; allowing the existence of two same voiceprints goes undetected . so an imposter with b can cheat gaining a restricted access right by matching b to a in a vi system . vc could be used to prevent this fraud by checking how many unique items there are in different groups . if extra voiceprints suddenly emerge or have gone missing from a group , the integrities of the voiceprints must have changed . for developing a vc system , several approaches have been studied , such as artificial neural networks ( ann ) , support vector machines ( svms ) , hidden markov models ( hmms ) and gaussian mixture models ( gmms ) . they have been used heavily for training up a model with predefined voice samples for voice recognition . table 1 shows a summary of the techniques by which majority of research works used . these techniques generally function like a black box ; for instance , the weights for mapping the relations of the inputs to the outputs are in plain numeric , the kernel parameters are used for low - level computation , and so forth . they require a full set of known samples to be available before they can be tuned up for actual use . in this paper voiceprints who share similar features will be placed into distinctive groups that represent some labels about the speakers . subsequently a decision tree ( classifier ) can be built after studying and confirming the characteristic groups . the advantage of decision tree is that easily comprehensible rules in terms of if - then - else conditions can be generated when the decision tree is constructed . using the features of a human voice as a voice classifier for classifying speakers has not been researched a great extent although it has a large implication in voice biometrics applications . to the best of the author 's knowledge , nobody has applied such techniques of vc before . this is the research focus of this paper ; a collection of algorithms are introduced for supporting grouping unlabeled voiceprints and then subsequently classifying new incoming voiceprints . they can be used for checking the integrity of the groups of voiceprints for solving the security problem that is illustrated in figure 2 . the contribution of this paper is an alternative computation platform for realizing voice classification ; the algorithms are relatively simpler than the existing ones and fellow researchers that can easily adopt them for implementing vc systems . the model that we proposed aims at providing a generic voice classification framework under which a collection of algorithms such as hierarchical time series clustering , dynamic time wrap transform , discrete wavelet transform and decision tree would have to work together . the prominent advantage is its generic property that can be applied across a variety of applications that capitalize on voice classification . while the inputs are previously unknown voices , the voices would be automatically grouped together according to their own characteristics . each group or cluster being formed as an output represents one pronounced characteristic which is shared in common by all the voice samples inside ( total = n ) . our model assumes that the collected voices in waveforms would be recorded in the format of time series . each time series is a vector of numeric data points that can be represented by a set of m attribute values , such as a time series s = [ x1 , x2 , , xm ] . in a collected dataset whose speakers ' identities are not known , a sufficient amount of voice samples are gathered from each speaker and these samples can then be clustered by using hierarchical time series clustering algorithm . clustering is done based on the characteristics of the voice samples themselves . at this point no classification area was sought specifically , for instance gender or ethnic background , as it was preferred to allow the results to decide the characteristics that lead to a particular clustering group . as shown in figure 3 , an example scenario by the proposed model is a surveillance eavesdropper that collects from a secret meeting a total of n voice traces . the voice traces may be spoken by more than one speaker , one trace per speaker at a time , and each voice trace can be encoded by m coefficient attributes regardless of how long the conversation is . the voices that are in the form of time series can be submitted for hierarchical clustering for self - grouping . hierarchical clustering instead of others is applied because it gives a layered structure of groupings which we do not know in advance in different resolutions . after the clustering , not only we know how the speakers whose voices are distinctively grouped , the number of unique voices ( hence the number of speakers ) can also be identified . in essence , it may be possible to infer from the groupings that how many speakers there are in the meeting , what characteristics they have in each group . however , it requires further verification and probably extra information to infer detailed assertions such as gender , age , and the emotions of the speech . with the groupings available a voice classifier can be developed after the unlabeled voice traces labeled with the classes derived from the characteristics of the groups . so that in our model , unsupervised learning by clustering comes first , and then supervised learning for building the decision tree follows . the voice traces in the form of labeled time series can be used as training data to build a classifier . however , in our experiment , we opt to transform the voice traces from time domain to frequency domain , as our experiment results show that the accuracy performance of the classifier can be significantly improved . when the classifier is ready , future new voice samples can be automatically classified into the characteristic groups . if necessary , the process of hierarchical clustering can be applied on the new samples again in case new characteristics from the voice samples may be discovered . the goal of time series clustering is to identify the speaker category to which a voice belongs given the multivariate time series points of each voice trace . in our experiments the synthetic control wave dataset and empirical datasets from uci data archive the wave has 60 coefficients and the live japanese vowel data each wave is characterized by 12 coefficients . similar waves cling together to form a cluster , and dissimilar waves tend to stay far apart in separate clusters . iteratively the time series clustering algorithm relocate the data points one step at a time to ensure that the data points inside the same cluster have the minimum intradissimilarity and data points across different clusters have the maximum inter - similarity . the similarity is defined as the multidimensional distance between two data points whose multiple attributes are measured as how close they are in values . two variables exist for time series clustering algorithm , one is for choosing the similarity function for measuring the distance between each pair of data points , and the other is the overall operation that converge from an initial assignment of data points to clusters to a converged or optimal assignment of data points to clusters . many similarity measures are available such as manhattan , euclidean and minkowski just to name a few . in our experiments , a range of popular similarity functions are compared in performance in order to observe which one performs the best . table 2 shows a list of performance results in the percentage of correctly clustered groups by using various similarity functions . because the nature of the data points that we are working with is time series , we choose to use dynamic time warping function ( dtw ) as a distance measure that finds optimal alignment between two sequences of time series data points . dtw a pairwise comparison of the feature ( or attribute ) vectors in each time series . it finds an optimal match between two sequences that allows for stretched or compressed sections of the sequences . in other words it allows some flexibility for matching two sequences that may vary slightly in speed or time . the sequences are warped nonlinearly in the time dimension to determine a measure of their similarity independent of certain nonlinear variations in the time dimension . it is popular in the application of signal processing where two signal patterns are to be matched in similarity . particularly suitable dtw is for matching sequences that may have missing information or various lengths , on condition that the sequences are long enough for matching . in theory , dtw is most suitable for voice wave patterns because exact matching for such patterns often may not occur , and voice wave patterns may vary slightly in time domain . they range from simple ones like k - means and k - medoids , to sophisticated algorithms like dbscan , density - based clustering for clustering structures . in our case , hierarchical clustering is desirable because it allows the time series which are voice waves to be grouped in different levels automatically that helps a user to explore the structure of the groupings from coarse to refined . like most of the clustering algorithms which operate by unsupervised learning , hierarchical clustering does not require the number of clusters to be predefined at the beginning ; it allows the data to decide the suitable number of groups by themselves . in our experiment , agglomerative mode which is also known as the bottom up approach is used . initially each observation starts in its own cluster , and pairs of clusters are merged as one moves up the hierarchy . for deciding which clusters should be merged , a similarity function is used between sets of observations . a variety of similarity functions are used here for experiments , they are canberra , dtw , euclidean , manhattan , and minkowski from power 1 to 10 . the clustering algorithm constructs the hierarchy from the individual time series by progressively merging clusters up . the basic process of hierarchical clustering comprises of the following steps , given n time series , and a two dimensional n n similarity matrix s. step 1each time series is assigned to a cluster of its own , with a total of n clusters for n time series . initialize s with similarity measures between the clusters which are the same as the similarity measure between the time series that they contain . each time series is assigned to a cluster of its own , with a total of n clusters for n time series . initialize s with similarity measures between the clusters which are the same as the similarity measure between the time series that they contain . retain the current level of clusters and move up a level in the hierarchy . retain the current level of clusters and move up a level in the hierarchy . step 3calculate the new similarity measures in s between the new clusters and each of the old clusters . calculate the new similarity measures in s between the new clusters and each of the old clusters . step 4finally repeat step 2 and step 3 until all the time series are clustered into a single cluster of size n. when this happens , the highest level of the hierarchy is attained . finally repeat step 2 and step 3 until all the time series are clustered into a single cluster of size n. when this happens , the highest level of the hierarchy is attained . two experiments are conducted for testing the performance of the algorithm over a synthetic control dataset and a live dataset . the synthetic control dataset contains 600 examples of time series wave forms synthetically generated by the process in alcock and manolopoulos ( 1999 ) . there are six different classes of control charts that represent generally different shapes of time series waves . each wave is characterized by 60 coefficients in the form of temporal data points , each different group ( or class ) has 100 samples and total there are 600 samples in the dataset . each class has an essentially unique bunch of waveforms that are different from those of the other classes ; hence , we can assume the six classes represent six different types of speakers who have different voiceprints from one another . for example , it could be speakers who come from six different geographical locations therefore different ascents , speakers who speak in six different emotions / languages , or speakers of six distinctively different age groups . the other empirical dataset contains 640 time series of 12 linear prediction cepstrum coefficients ( lpcs ) taken from nine male speakers . the data was initially collected by a japanese research team for examining a newly developed classifier for multidimensional curves ( multidimensional time series ) . a 12-degree linear prediction analysis was applied to obtain a discrete - time series with 12 lpc cepstrum coefficients . this means that one utterance by a speaker forms a time series whose length is in the range 729 , and each point of a time series is of 12 features ( 12 coefficients ) . analysis parameters are as follows : sampling rate = 10 khz , frame length = 25.6 ms , and shift length = 6.4 ms . blocks 130 represent speaker 1 , blocks 3160 represent speaker 2 , and so on up to speaker 9 . a sample of the time series taken from one of the voice trace is shown in figure 4 . just as shown in our model in figure 3 , the raw voice series are formatted and processed into records that have exactly 12 coefficients ( attributes ) . hierarchical time series clustering is applied over the processed data , so that each data point that the clustering algorithm works with has identical attributes and scales for similarities measures . by plotting the processed data with x - axis as the first column of a consecutive block against the rest of the series with values within the range at the y - axis , we generate some visualization of the time series points with distinguishable shapes . figure 5 shows three groups of voice series that are taken from the dataset blocks from three different speakers . just by visual inspection the four voice utterances on the top row sit at about three quarters on the x - axis , the cap of the data clusters is dominated by small square dots ( that just represent one of the coefficient values of the block of the sample ) , then followed by other shapes of dots and diamond shaped dots at the bottom . though each of the four clusters on the top row is not exactly identical to each other , they roughly have a similar structure . in the middle row , the voice visualization by another speaker has the data near the middle of x - axis , and the outlined structure has the cross - shaped markers on the cap . and the visualization on the bottom row has an obviously different formation than the other two . that shows the voices of the three speakers are essentially different as by their voice characteristics , and the differences can be visually spotted . however , computationally , the differences in voice characteristics would have to be revealed by clustering algorithm . the hierarchical clustering algorithm that we applied in the experiment is implemented in r which is a free software environment for statistical computing and graphics ( http://www.r-project.org/ ) . the synthetic data are first sampled with a ratio of 10% for producing the first iteration of data points and clusters . dtw that serves as the similarity function is embedded in the clustering algorithm for processing the time series data till convergence . a snapshot of the resulting dendrogram by using dtw similarity function is shown in figure 6(a ) . it can be seen that the dendrogram by dtw can effectively partition the time series into six distinct groups that represent six speech types . the groupings , by the dtw dendrogram as shown in figure 6(b ) , can be used to map over to the actual row number of the dataset that has a total of 600 rows . in other words , the time series that are indexed by the row numbers can be allocated to the six groups by the dendrogram as a result of time series clustering . in another counter example , similarity function by euclidean distance is applied in the experiment ; we can easily see that the groupings at the dendrogram as shown in figure 7(a ) are not in perfect order at all . we can safely remark that dtw is superior to euclidean in the clustering . from a bird - eye view , figure 8 shows clearly on the efficacy of the two similarity functions in hierarchical time series clustering . without showing the dendrogram for each of the other varieties of similarity functions , a comparison table below shows the performance of grouping of each technique . the performance is estimated by counting the number of mislocated groups in the dendrogram by that particular similarity function . dtw performs consistently well , while minkowski shows an optima when the power was increasing from 1 to 10 . this observation confirms that dtw is suitable for time series clustering as time series do vary in time domain more or less to certain extent . the subsequent experiment is to build a decision tree after the grouping has been formed by hierarchical time series clustering . ripper function is suggested to be run for generated comprehensible rules that are in the form of if - then - else . the rules specify a sequence of conditions meeting which in order lead to a predefined class label . when a new voiceprint is received , pass it over the rules by checking its coefficient values that can determine which class label the voiceprint fits in . the other decision tree algorithm is the classical c5.0 or j48 with pruning mode on , in weka which is an open source of machine learning algorithms for solving data mining problems implemented in java and open sourced under the gpl ( http://archive.ics.uci.edu/ml ) . the time series data , however , are converted to their corresponding frequency domain by discrete wavelet transformation ( dwt ) . dwt applies the the haar wavelet transform which was invented by kristian sandberg from university of colorado at boulder , usa in year 2000 . dwt in principle works better than time series points in classification because dwt can find where the energies are concentrated in the frequency domain , and remarkable coefficients called haar attributes are well describing the characteristics of the time series . a comparison of the original coefficients in time domain and transformed coefficient in frequency domain can be seen that wavelets after the transformation have sharper and narrower statistical distribution than the time series points , in figure 9 . dwt is implemented in the plug - in filter in weka called weka.filters.unsupervised.attribute.wavelet . the performance of the decision tree which is a voice classifier is defined as a composite of accuracy measures . they generally come in the following indices in data mining as ( 1 ) the percentage of correctly classified instances , ( 2 ) the root relative squared error , ( 3 ) coverage of cases , ( 4 ) overall precision ; in a classification task , the precision for a class is the number of true positives ( i.e. , the number of items correctly labeled as belonging to the positive class ) divided by the total number of elements labeled as belonging to the positive class ( i.e. , the sum of true positives and false positives , which are items incorrectly labeled as belonging to the class ) , ( 5 ) overall recall which is defined as the number of true positives divided by the total number of elements that actually belong to the positive class ( i.e. , the sum of true positives and false negatives , which are items which were not labeled as belonging to the positive class but should have been ) , and ( 6 ) f - score , which is a measure of a test 's accuracy by considering both the precision and the recall of the test to compute the score . the performance comparison table is given in table 3 . it compares mainly the classification accuracy by using a j48 decision tree in weka of the time series version and the wavelet version of the two testing datasets . it can be noticed that in general wavelets have improvement over the time series in terms of classification accuracy . the results of the empirical data are generally lower in accuracy than the synthetic control data probably due to its complex and less uniform in the time series structures , plus the normalization effect for limiting the time series into fixed length from its original variable length . a sample of the decision tree generated from the experiment is shown in figure 10 . by using the decision tree as classifier using voice as a biometrics has its advantage because it is a noninvasive nature process in human interaction , and human voice has been proven to contain biological traits that can uniquely identify an individual . in the past many studies have focused on applying voice biometrics into security - related applications such as user verification and biometric identification . voice classification is recently becoming popular as it serves as the underlying technique for monitoring different types of speakers and providing supreme customer service by estimating the natures of phone / web calls ; these applications potentially have high values in security surveillance and commercial uses . in this paper , a set of relatively simple and transparent techniques are described for enabling voice classification . fellow researchers are encouraged to test out the collection of algorithms as recommended in this paper for experimenting voice datasets pertaining to voice classification applications . in particular , we showed via experiments that hierarchical time series clustering algorithm with various similarity functions can yield different levels of accuracy . it is shown possible that time series can be grouped into different clusters , just as if some unknown voices are grouped together by their common characteristics . wavelets after transforming of time series samples into frequency domain demonstrate an improved accuracy performance in decision tree . the future works include fine - tuning the mentioned algorithms in the paper for even better performance . the algorithms should be programmed into a single software program in order to support as a core classification engine for voice biometric application systems .

voice biometrics has a long history in biosecurity applications such as verification and identification based on characteristics of the human voice . the other application called voice classification which has its important role in grouping unlabelled voice samples , however , has not been widely studied in research . lately voice classification is found useful in phone monitoring , classifying speakers ' gender , ethnicity and emotion states , and so forth . in this paper , a collection of computational algorithms are proposed to support voice classification ; the algorithms are a combination of hierarchical clustering , dynamic time wrap transform , discrete wavelet transform , and decision tree . the proposed algorithms are relatively more transparent and interpretable than the existing ones , though many techniques such as artificial neural networks , support vector machine , and hidden markov model ( which inherently function like a black box ) have been applied for voice verification and voice identification . two datasets , one that is generated synthetically and the other one empirically collected from past voice recognition experiment , are used to verify and demonstrate the effectiveness of our proposed voice classification algorithm .

1. Introduction 2. Our Proposed Model 3. Design of the Hierarchical Time Series Clustering Algorithm 4. Experiments 5. Conclusion

medical doctors move across borders being motivated by higher salaries , better working conditions , new professional experience , and training and career opportunities . in europe , migration of medical doctors has been observed since the 1940s and has shown various dynamics over the years . european integration has offered new possibilities for medical doctors to improve their skills , to study or to work in other countries . however , outflows from eastern europe started before accession , due to the political transitions of the late 1980s and the last 1990s . the eu enlargement , first in 2004 and then in 2007 , has generated increased mobility , especially from east to west , namely from eu-12 to eu-15 . studies have shown that migration of physicians from new member states has been lower than the leaving intentions . given the increasing trends in health professionals mobility , the european union has established a legal framework to regulate both the recognition of professional qualification and the free mobility of doctors and patients within europe . however , a legal framework for the recognition of professional qualification for physicians willing to work outside europe and for those coming from non - european countries is still lacking . migration of health professionals in generally and of medical doctors in particular has its roots in current problems of healthcare systems . medical doctors decide to move from one country to another not only because of higher incomes , but in search of better working environments , career opportunities and social recognition . thus , mobility of medical doctors is seen as a symptom of more fundamental health systems problems . these need to be addressed by policy makers in an integrated manner because health professional mobility can not be considered in isolation . while some european countries have to deal with major shortages of medical doctors , other are confronted with increasing pressures to manage maldistribution , both geographically and in terms of specialities needed . usually the positive effects occur when mobility is temporary and with the purpose of achieving new experiences , new specialities and training , followed by return in home country . in addition , mobility of doctors impacts positively the patients access to medical treatment and medical service , because patients can benefit of the knowledge and training achieved by medical doctors in other countries . if mobility is for long - term and outflows occur in countries struggling with shortages of medical doctors , then the negative impacts on the healthcare systems are felt both at macro level - financial loss for the country that has paid for the education of the physicians , national health system has to be adapted to the new situation , and at micro level lack of sufficient medical doctors or maldistribution will impact patients safety and access to care , and finally patients health . among the most - cited factors for physicians mobility is the financial motivation . as regards the salaries , major differences between european countries can be observed . especially since the eu became more diverse in socio - economic terms , with larger salary differentials , incentives to seek employment in another member state have increased . for example , an estonian medical doctor can earn six times more in finland while a romanian general practitioner can earn ten times more in france . in 2009 , a 25% cut in the salaries of health professionals in romania has led to an increase in the number of doctors seeking work abroad . a reverse effect has been observed in poland , lithuania and slovenia , where annual salary increases have helped to diminish the outflow of medical doctors . high salary differentials exist not only between eu-12 and eu-15 , but also between eu-15 and non - eu countries , such as us , new zeeland and australia . therefore , many doctors from western european countries ( eu-15 ) may be motivated to seek work overseas . the economic situation of a country has a major impact on the quality and standards of healthcare facilities and on the social benefits offered for health professionals . while some european countries , mostly from eu-15 , have developed high standards for healthcare such as better equipped hospitals , introduction of high technologies for diagnosis and surgery , and new tools for testing , other countries struggle with major shortages as regards the facilities named above . this is usually the case of new member states , which had to pass through a difficult transition period and are affected by economic problems that do not leave room for further development of the existent healthcare facilities . therefore , when medical doctors are forced to deal with a lower number of hospital beds than the number of patients , with old diagnostic tools , with shortage of medicines and instruments available in hospital pharmacies , or with inappropriate conditions for carrying out complex surgeries , they often decide to work in an environment that can offer them better conditions for doing their job . however , better working conditions do not only refer to access to better healthcare facilities but also to social and economic incentives , working schedule and promotion opportunities . training and career opportunities are also among the relevant decision - making factors for physicians who consider leaving their country of origin , either temporary or for a long period of time . again , the available training opportunities vary considerably across europe and there are also differences between europe and countries like us or japan . therefore , doctors migrate because they may wish to specialise in a certain medical filed which is not available in their country or , if available , it is not yet sufficiently developed . but doctors may seek training and career opportunities in other countries not only because such opportunities lack in their home country , but because the experience and the know - how achieved abroad is often very enriching and acts as a boost for their career . in addition , new professional and personal experiences achieved across the borders may widen their horizon in the medical field . finally , some medical doctors also wish to migrate because they simply want to make a change in their lifestyle . for instance , a physician from denmark or sweden could seek working in spain or in italy , because the southern european countries are well known for their warm climate , relaxed daily life , rich culture and tasty foods . similarly , a physician from bulgaria could wish to work in austria not necessarily for a higher salary but for the well organised system and infrastructure , for the austrian high living standards or for the great mountains . according to a who report on healthcare workforce migration in europe , there are also other factors associated with migration flows that can stimulate migration and affect the choice of a destination country : organizational factors , such as heavy workload , occupational risks , poor management , favouritism or lack of due process , lack of recognition;healthcare system factors , such as the absence or inadequacy of human resource policies , insufficient funding of health services , and centralised decision - making;general environmental factors , such as poor economic conditions and lack of security . organizational factors , such as heavy workload , occupational risks , poor management , favouritism or lack of due process , lack of recognition ; healthcare system factors , such as the absence or inadequacy of human resource policies , insufficient funding of health services , and centralised decision - making ; general environmental factors , such as poor economic conditions and lack of security . the mobility of doctors within the european region was to a large extent influenced by the eu enlargement in 2004 and 2007 . the eu enlargement triggered east west asymmetries in terms of inflows and outflows of health professionals , with migrants from new member states moving to countries from eu-15 . however , many of the eu-15 countries have outflows of the same magnitude as the eu-12 , but unlike the eu-15 , the eu-12 countries have only negligible inflows . in europe , among the major destination countries are germany , france , italy , uk and spain . they receive doctors from countries like poland , greece , romania , switzerland and the czech republic . germany is at the same time a big source and destination country , german doctors choosing to migrate mainly to the united kingdom and italy , followed by switzerland and us . outflows have also been observed in the uk , mainly toward neighbouring countries like ireland and france , but also to spain and the us . according to a who study on health personnel migration , the flow of migrant doctors is very dynamic in the european region . this situation is illustrated in the fig . 1 , which shows the inflows and outflow of physicians from selected european countries .fig . 1migration of physicians in the who european region ( red arrows indicate two - way flows ) , taken from migration of physicians in the who european region ( red arrows indicate two - way flows ) , taken from in fig . 1 one can observe not only a flow from east to west , but also a dynamic exchange between western countries . thus , the flow of migrant doctors among belgium , france and the netherlands is also multidirectional . although there have been several recent studies examining the migration of healthcare workforce in europe , data are still limited . policy makers , workforce planners and healthcare managers need to better understand the mobility of trends in order to react with the right measures . due to the european integration and eu enlargement , which brought more flexibility for travelling and working in europe , it became obvious that an eu framework for professional mobility is needed . in response to this situation , the european parliament and the european council adopted the directive 2005/36/ec on recognition of professional qualifications , which affects more than 800 different professions regulated by member states across the eu , including medical doctors , nurses , midwives , and dentists . the directive sets the european legal framework for the recognition of professional qualifications obtained in a member state other than the one where the person wishes to work . with directive 2005/36/ec the eu has reformed the system for recognition of professional qualifications , in order to help make labour markets more flexible , further liberalise the provision of services , encourage more automatic recognition of qualifications , and simplify administrative procedures . the most recent consolidated version of the directive was made available on 24 march 2011 . until 20 october 2007 when the transposition period ended , this directive has replaced 15 existing directives in the field of recognition of professional qualifications , providing the first comprehensive modernisation of the eu system since its introduction over 40 years ago . according to the european commission , only 22 out of 27 member states fully transposed the directive within the given timeframe . considering the complexity of directive and the degree it impacts national legislation , some member states had to adapt a significant number of measures in order to complete the transposition . directive 2005/36/ec facilitates temporary provision of services ( tps ) by replacing the previous system of prior check of qualifications by the simpler , optional , system of prior declaration . however , due to the need to protect consumers , a prior check of qualifications may be maintained for professions having public health or safety implications ( article 7(4 ) of the directive ) . according to the european commission , 26 member states have implemented article 7(4 ) of the directive by april 2010 , apart from greece where the situation was still unclear . , professionals can in principle work on the basis of a declaration made in advance . the directive also applies to professionals wishing to establish themselves in an eu country other than that in which they obtained their professional qualifications , either as an employed or self - employed person , either on a permanent basis . directive 2005/36/ec sets out three systems for the recognition of qualifications : automatic recognition for professions for which the minimum training conditions have been harmonised ( health professionals , architects , veterinary surgeons).basic medical training and general practitioner qualifications ( annex v.5.1.1 and v.5.1.4)specialist doctors qualifications are automatically recognised in certain eu countries ( annex v.5.1)the general system for other regulated professions ( including non - automatic recognition - art . . automatic recognition for professions for which the minimum training conditions have been harmonised ( health professionals , architects , veterinary surgeons).basic medical training and general practitioner qualifications ( annex v.5.1.1 and v.5.1.4)specialist doctors qualifications are automatically recognised in certain eu countries ( annex v.5.1 ) basic medical training and general practitioner qualifications ( annex v.5.1.1 and v.5.1.4 ) specialist doctors qualifications are automatically recognised in certain eu countries ( annex v.5.1 ) the general system for other regulated professions ( including non - automatic recognition - art . 10 to 15 ) . recognition on the basis of professional experience for certain professional activities . title ii of directive 2005/36/ec governs the recognition of professional qualifications in the context of a temporary move to the territory of another eu country . the temporary and occasional nature of the activities of a self - employed or employed person is assessed on a case - by - case basis , in light of the duration of the activity , its frequency , regularity and continuity . but the current system must be evaluated in order to verify whether full use has been made of all the opportunities offered by directive 2005/36/ec . the system must also take account of the considerable changes that have occurred in the member states educational and training systems . for this reason , the commission has begun working on evaluating the 2005 directive which culminated in a green paper modernising the professional qualifications directive in june 2011 . the public consultation on the green paper was launched by the commission in january 2011 and a summary report with responses is already available . specifically the mobility of health professionals , the european commission issued a green paper on european workforce for health in december 2008 and invited all interested organisation to a public consultation , which closed on 31 march 2009 . in addition to directive 2005/36/ec addressing cross - border workforce mobility across europe , on 9 march 2011 the european parliament and council adopted directive 2011/24/eu on the application of patients rights in cross - border healthcare . the directive addresses in particular the mobility of patients seeking treatment in another member state and introduces rules regarding the reimbursement of treatments and medical care or investigations received abroad . as regards the impact of directive 2011/24/eu on the mobility of health professionals , the directive stipulates that member states should facilitate cooperation between healthcare providers , purchasers and regulators of different member states at national , regional or local level in order to ensure safe , high - quality and efficient cross - border healthcare . this could be of particular importance in border regions , where cross - border provision of services may be the most efficient way of organising health services for the local population , but where achieving such cross - border provision on a sustained basis requires cooperation between the health systems of different member states . according to directive 2011/24/eu , cooperation between member states may concern practical mechanisms to ensure continuity of care or practical facilitating of cross - border provision of healthcare by health professionals on a temporary or occasional basis . however , in directive 2011/24/eu it is mentioned that this directive should be without prejudice to directive 2005/36/ec on the recognition of professional qualifications . this means that free provision of services of a temporary or occasional nature , including services provided by health professionals in another member state is not subject to specific provisions of union law and is to be restricted for any reason relating to professional qualifications . although the mobility of doctors within the european union is to an extent regulated by eu law , it is also necessary to take into consideration the national legislation from european member states . as mentioned in previous paragraphs , the existing legal framework addresses only the mobility of health professionals ( and other ) when they cross borders within europe . but thus , if a german physician would like to work in china he / she may encounter difficulties in acquiring the recognition of his / her qualifications allowing working in this country . or , if a physician from georgia is seeking work in france , again , there is to date no european legal act which can help in such cases . therefore , the european union should consider introducing further regulations or developing legal instruments aiming at solving this challenge healthcare workforce migration beyond europe s borders . besides the legislative framework aiming at regulating the mobility of doctors in europe , the world health organisation developed a non - regulatory instrument on the international recruitment of health personnel - who global code of practice on the international recruitment of health personnel . the who code of practice was adopted at the sixty - third world health assembly in geneva on 21 may 2010 and its key components are : in destination countries : ethical recruitment practices;protection of the rights of foreign healthcare workers;increased education and training for health sector students;pairing of needs and supply.in source countries : improved conditions for healthcare professionals;continued medical training and increased opportunities;incentives to retain physicians and nurses in countries and regions with human resource shortages . in destination countries : ethical recruitment practices;protection of the rights of foreign healthcare workers;increased education and training for health sector students;pairing of needs and supply . ethical recruitment practices ; protection of the rights of foreign healthcare workers ; increased education and training for health sector students ; pairing of needs and supply . in source countries : improved conditions for healthcare professionals;continued medical training and increased opportunities;incentives to retain physicians and nurses in countries and regions with human resource shortages . improved conditions for healthcare professionals ; continued medical training and increased opportunities ; incentives to retain physicians and nurses in countries and regions with human resource shortages . this initiative of who comes also in response to the consequences of the financial crisis on labour markets and addresses the need to mitigate the negative effects of migration on health systems in developing countries and to ensure equitable access to health care services while minimizing the need to rely on the immigration of health personnel from other countries . the resolution ( eur / rc59/r4 ) adopted by the regional committee urges member states to increase their efforts to develop and implement sustainable health workforce policies , strategies and plans as a critical component of health systems strengthening and to advocate the adoption of a global code of practice on the international recruitment of health personnel in line with the european values of solidarity , equity and participation , both within the who european region and globally . in order to assist the medical doctors ( and other professionals ) who intend to work across borders , national contact points have been established at the initiative of the european commission s service free movement of professionals , directorate general internal market . there are contact points in every eu country that can give information on the recognition of professional qualifications according to the national law and procedures to be followed . contact points may be ministries of education , research or science or other national institutions . the contact points also serve as a guide for the applicants , helping them to complete the required administrative formalities . but contact points can only assist the applicants with their requests and are not in charge for deciding whether the recognition of a certain profession should be granted . the decision - makers are the national competent authorities , who decide whether or not to recognise professional qualifications obtained in other eu countries , in accordance with european and national legislation . the competent authorities in member states are expected to use a set of common rules laid down by a code of conduct . as regards the procedure to be followed for the recognition of professional qualifications , the applicant must apply to the authority that oversees the doctor profession in that country and provide the authority with the proof of qualifications . the competent authority must acknowledge the application within 1 month of receiving it , and ask for missing but necessary documents to process the application . then the authority assesses the qualifications and decides whether to grant the application within 3 months . for complicated cases in the area of non - automatic recognition this procedure may last 4 months . if the applicant does not accept the decision of the competent authority , he / she can appeal to the relevant court in that country . with the aim of ensuring better coordination both among member states and between member states and ec , the tasks of this group include helping national authorities and the commission work together better , monitoring policies with a bearing on qualifications for regulated professions , and exchanging experiences and good practices in the recognition of qualifications . group s members and alternate members are appointed by national governments and they meet several times a year . experts and observers are invited to take part in the group s meetings , which are chaired by the european commission . further support for workforce mobility within europe was made available by the european commission directorate general on employment , social affairs and equal opportunities , who has established eures the european job mobility portal . the purpose of eures is to provide information , advice and recruitment / placement ( job - matching ) services for the benefit of workers and employers as well as any citizen wishing to benefit from the principle of the free movement of persons . there are currently over 20 eures cross - border partnerships , spread geographically throughout europe and involving more than 13 countries . eures plays an important especially in cross - border regions , areas in which there are significant levels of cross - border mobility . more than 600 000 people live in one eu country and work in another and they have to cope with different national practices and legal systems . they may come across administrative , legal or fiscal obstacles to mobility on a daily basis . eures advisers in these areas provide specific advice and guidance on the rights and obligations of workers living in one country and working in another . the impacts on the performance of health systems are subtle , meaning that they are indirect or hard to discern . moreover , some areas from eastern european countries ( e.g. romanian rural areas ) may be particularly vulnerable , showing some of the highest emigration rates among medical doctors and nurses . for the healthcare systems in source countries emigration can contribute to a major shortage of health professionals . this can be observed in various forms , such as loss of training capacity ( when trainers leave ) , heavier workloads for doctors who decide to stay or disruption of services when a key staff member leaves . in addition , the source country also loses the investment in the education of health professionals as well as the contribution they would have otherwise made for the healthcare system . some source countries may have also some benefits from the emigration of doctors , like reduction in staff surpluses and access to new knowledge and skills , in case the emigration is temporary . in some cases , source countries can benefit from collaborative training programmes , research projects or teaching activities which are initiated by emigrant doctors with their home country . unlike in source countries , in destination countries the benefits tend to be more obvious . for instance , migrant physicians may accept lower salaries than native ones , and they may also accept working in geographic areas avoided by national workers . however , destination countries may also encounter some difficulties related to inflow of medical doctors . cultural differences may hinder communication and lack of familiarity with advanced equipment may lead to higher error rates . for temporary migrants , investment in workplace induction can be relatively high compared to the time of service provided by the migrant physicians . as regards the policy implications of doctor s migration , first , the uncertainties surrounding the impact of the economic crises which forced some countries to drastically reduce their healthcare budgets , while in other countries budgets remained unaffected . a second factor impacting healthcare policies is the uncertainty of the development of healthcare workforce in europe . according to a european commission forecast , a shortage of around 1 million health professionals compensation of health workforce shortages by recruiting from third countries is to an extent restricted by ethical concerns , as stipulated in the who global code of practice for the international recruitment of health personnel adopted in 2010 . for these reasons , the european countries dealing with a high demand for medical doctors will face increasing difficulties in filling their vacancies with doctors from abroad . according to the european observatory on health systems and policies , there are three main sets of policy implications linked with the mobility of medical doctors : the first refers to the amount of data , intelligence and evidence , which are currently not sufficiently developed . therefore , in the absence of inflow and outflow data , policy makers can not take appropriate measures to manage doctors migration.the second set of policy implications refers to the strengthening the general workforce strategies . symptom of underlying domestic workforce aspects , such as working conditions , salaries , and training opportunities.the third policy implication is related to sustaining the re - emerging interest in workforce planning methods and techniques , by taking into account especially the dynamics and the need of healthcare force in future . the first refers to the amount of data , intelligence and evidence , which are currently not sufficiently developed . therefore , in the absence of inflow and outflow data , policy makers can not take appropriate measures to manage doctors migration . symptom of underlying domestic workforce aspects , such as working conditions , salaries , and training opportunities . the third policy implication is related to sustaining the re - emerging interest in workforce planning methods and techniques , by taking into account especially the dynamics and the need of healthcare force in future . in responding to the inflow and outflow of medical doctors , today and in future , countries may take a series of measures aiming at an appropriate management of their healthcare workforce . for instance , they may sign bi - lateral agreements or facilitate the recognition of diplomas from non - european countries or they may consider developing twinning schemes and joint training programmes . although these policy responses may facilitate a better management of doctors mobility , the european countries should seek to solve mainly the domestic problems liked to doctors migration . thus , they should seek to strengthen existing healthcare strategies by improving retention , increasing salaries and providing more advanced training opportunities . in addition , countries could develop new healthcare strategies which can better respond to the current and future mobility trends .

this chapter aims at providing an insight into some major aspects linked to migration of medical doctors within europe . the article describes main factors which contribute to doctors migration . further , the current and future mobility trends in europe are discussed . a major part of this chapter is dedicated to an overview of the eu legal framework impacting healthcare professionals mobility , followed by some useful information related to the procedures for recognition of professional qualifications and offices in charge of mobility . finally , the impacts on healthcare systems and the policy implications of doctor s mobility are described in context of personalised medicine .

Introduction Driving forces for physicians mobility in Europe Current trends in inflows and outflows Legal framework for cross-border professional mobility within Europe Offices in charge of professional mobility and recognition of professional qualifications Impact on healthcare systems and policy implications

imipramine was found to improve mood while being used in a protocol to search for an antipsychotic : ' iproniazid , a drug used in the treatment of tuberculosis , was likewise found to have beneficial effects on mood . the former , a tricyclic antidepressant ( tca ) , and the latter , a monoamine oxidase inhibitor ( maoi ) , belong to two classes of drugs still in use today . depressive mood appears to be attributable to diminished activity of the dopaminergic , noradrenergic , and serotonergic neurotransmitter systems . antidepressants restore the activity of these transmitters by inhibiting reuptake in the presynaptic neurons . additionally , the classic antidepressants have effects on other neurons ( eg , histamine , acetylcholine ) , resulting in major side effects limiting their broader use . depressive symptoms have been described in as many as 40 different disorders , which would imply that they could be used in all of them . although the efficacy of tcas has been well established , the high incidence of side effects and the high number of nonresponders or treatment - resistant patients represent drawbacks that have made it necessary to search for new drugs . the development of selective serotonin reuptake inhibitors ( ssris ) was the first attempt based on a pathophysiological approach . these drugs , which have similar efficacy , but less side effects than the tcas , have become the preferred pharmacological treatment for depression . however , the high number of nonresponders and the delay in onset of response have limited their value . today , up to seven different classes of antidepressants are available , which mainly differ in their selectivity for the respective monoamines and their receptors . these discoveries have intensively stimulated biochemical - pharmacological research into the mechanism of action of antidepressants . findings from these investigations suggest that enhanced activity of the central noradrenergic and/or serotonergic transmitter system is essential for the clinical antidepressant action . such enhancement could be achieved either presynaptically by blocking 2-adrenergic receptors , or in the synaptic cleft by inhibiting the transmitter reuptake or the main metabolic enzyme monoamine oxidase ( mao ) . the increased transmitter concentration in the synaptic cleft after chronic treatment leads to a downregulation of postsynaptic -receptors , sometimes modulated by interaction with neuropeptides and hormones . in addition , depending on the antidepressant used , the sensitivity of 5-ht2a , somatodendritic 5-ht1a , or noradrenergic 1 receptors may be reduced , leading to an overall increase in serotonin transmission . such receptor alterations appear to provide the best explanation for the delay in clinical antidepressant response . the introduction of new classes of antidepressants has led to renewed thinking about their mechanism of action . recent investigations of second messenger systems such as the adenylate cyclase system and the phosphatidylinositol system are very promising . antidepressant drugs , including the mood stabilizers lithium and carbamazepine , modulate both of these second messenger systems , which in turn modulate the phosphorylation status of neuronal proteins via protein kinase . the outcome is a positive alteration of the gene expression of the relevant biochemical structures ( enzymes , transporters , receptors ) , thus restoring the normal function of the respective neuronal systems . thanks to clearer understanding of the function of this complex serotonergic system we now know that a great number of normal and abnormal behaviors can be attributed to dysfunction of the serotonergic neurons , in addition to their role in depression . the limited number of serotonin neurons in the brain ( approximately 300 000 ) suggests that their role is mainly a modulating one . this implies that they act to either dampen or accelerate a given type of behavior . drugs targeting the serotonergic system are therefore able to influence many kinds of behavior abnormalities ( figure 1 ) . concerning the norepinephrine system as already mentioned , some forms of depression are assumed to be accompanied by reduced noradrenergic activity . however , this is a matter for discussion , and some forms of depression may even be accompanied by increased noradrenergic function . it is hypothesized that noradrenergic neurons in the locus ceruleus are activated or increased in anxiety and panic disorders . conversely , a norepinephrine deficit is invoked to explain disturbances of attention , psychomotor retardation , and impaired vigilance . some antidepressants also increase dopaminergic neuron activity , either directly or indirectly , by acting on serotonergic and noradrenergic pathways . dopamine , a major transmitter of the reward system also plays a role in depressive states . dopaminergic antidepressants could be of interest in some subgroups of depression , but so far no such drugs are available in europe . however , in some patients with refractory depression , dopaminergic drugs like amphetamine have some beneficial effects . neuronal circuits establish functional relationships between serotonergic , noradrenergic , and dopaminergic systems , which explains why deficiency in one system impairs the other systems as well , and why even specific drugs like the ssris arc also able to modulate the other systems . the variety of the clinical uses for the newer antidepressants may necessitate a reexamination of traditional diagnostic categories and of theories on the way antidepressants work . antidepressant drugs are used in a wide range of psychiatric disorders . empirical evidence in the 70s suggested that the nonselective serotonin antidepressant clomipramine improved symptoms of ocd . newer generations of antidepressants with fewer side effects have proved to be even more active in ocd . furthermore , 5-ht1a serotonin agonists are being investigated in general anxiety disorders . other potential indications for ssris and the new generation of antidepressants are panic disorders , premenstrual dysphoric disorder , eating disorders , substance abuse disorder , chronic pain , dementia , and personality disorders with aggression or impulse disturbances , and general anxiety disorders . depressive symptoms arc frequently diagnosed in patients with schizophrenia and have been described in schizoaffective disorders . . this may be the reason why such patients are frequently ( 50% of cases ) treated simultaneously with antipsychotics and antidepressants . antidepressants are also useful in the treatment of a group of disorders that may be phenomenologically and genetically related to major depression , such as fibromyalgia , chronic fatigue syndrome , migraine , irritable bowel syndrome , atypical facial pain , and premenstrual dysphoric disorder . it is likely that the etiology of depression ( as a symptom ) in these disorders is similar to that of major depression as an entity , and therefore would explain the efficacy of ssris . although not impossible , it would be contrary to expectation if the mechanism of antidepressant effect was independent of the mechanism of depression in migraine , premenstrual dysphoric disorder , and other conditions . and it would be even more difficult to believe that different , chemically unrelated antidepressant drugs , share the same pharmacological properties while having different mechanisms of action . disturbances in neurodevelopment and/or abnormal immune function may be responsible for schizophrenic symptoms . additionally , abnormal dopamine , norepinephrine , and serotonin transmitter activities in some areas of the brain may be pathophysiological relevant to some schizophrenic syndromes . other theories put forward disturbances in the glutamatergic and gabaergic circuits . because of this heterogeneity and the impossibility of characterizing clinical subgroups of schizophrenic patients , none of these theories has been conclusively proved so far . the discovery of chlorpromazine for the treatment of schizophrenia opened new perspectives for the care of psychiatric patients . unfortunately , chlorpromazine and the other classic neuroleptics produce side effects that limit their widespread use . for many years , the dopamine hypothesis , based on the assumed mechanism of action of these compounds , was the predominant theory . the introduction of new atypical neuroleptics such as clozapine , which was the first one , paved the way for revisiting the dopamine hypothesis of schizophrenia and related theories on the mechanism of action of neuroleptics . to explain the unique features of clozapine , new theories have been put forward , partly in relation to interference with dopamine receptor subtypes and partly in relation to interference with other neurotransmitters such as norepinephrine and serotonin . the nonspecificity of second - generation atypical neuroleptics for the dopaminergic system , the therapeutic ineffectiveness of some selective dopaminergic drugs , the lack of success of genetic studies targeted to the dopaminergic system , and the disappointing biochemical findings in schizophrenic patients have resulted in alternative theories of pathogenic causes of schizophrenia being proposed , opening up new perspectives for the development of future drugs . based on neuropath ological and neuroanatomical findings and in concordance with the revised dopamine hypothesis , new models have been postulated focusing attention on the excitatory amino acid y - aminobutyric acid ( gaba ) and the most ubiquitous amino acid transmitter in the brain , glutamate . psychotic symptoms of schizophrenia have been divided into negative symptoms ( blunted affect , anhedonia , asociality , inability to initiate and carry out complex tasks to completion ) , which seem to be related to cortical hypofunction , and which , in turn , may be associated with decreased mesocortical dopaminergic activity and positive symptoms ( hallucinations , delusions , and thought disorders ) . they also appear in disorders other than schizophrenia as well as many nonpsychotic disorders , and are related to increased activity of the subcortical striatal dopaminergic neurons . was considered as the standard treatment for bipolar depressive and manic patients , the pharmacological strategies for bipolar disorder included neuroleptics and antidepressants . they are now mainly used to treat the psychotic symptoms present during one of the poles of the disorder , or as an adjunctive treatment when other alternatives have failed . there have been several reports that clozapine may be more effective in patients with mania and schizoaffective disorder than in patients with schizophrenia . preliminary reports suggest that the newer atypical antipsychotics olanzapine and sertindole may also be effective in stabilizing mood or in the management of affective symptoms . the occurrence of psychotic symptoms is frequent during the evolution of idiopathic parkinson 's disease and other parkinsonian syndromes . they seem to be related to interactions between the underlying neuropathologies manifestations of the syndromes and the adverse effects associated with chronic antiparkinsonian drug administration . in patients with advanced parkinson 's disease olanzapine has been reported to be effective in the suppression of psychotic symptoms in these patients , but the currently available dose increments may result in an exacerbation of motor disability . as mentioned above , since no solid alternatives have emerged from biological research to replace the current hypothesis regarding the pathogenesis of psychiatric disorders , the development of new psychotropic drugs remains based on the restoration of the imbalance in the monoamincrgic system . this is exemplified by the development of the new antidepressants . the postulate that depression results from a dysfunction in the noradrenergic , serotonergic , and dopaminergic systems leads logically to the attempt to design antidepressants that act mainly on one of the neurotransmitter systems . the idea is to increase selectivity without compromising efficacy , while at the same time reducing the side effects that result of interactions with these and other neurotransmitter systems . thus , blockade of serotonin reuptake gave rise to the now well - known ssris . a new class of drugs , which selectively inhibit the reuptake of norepinephrine , was recently introduced onto the market however , experience with psychotropic drugs acting on either the noradrenergic or the serotonergic systems suggest how important it is ( at least in certain situations ) to act on both systems at once . research was therefore undertaken to develop new antidepressants with a dual action on these systems . although drug development tries to focus on specific mechanisms involved in depression and its symptoms , clinical research is not nosologically but transnosologically oriented . the tools used to monitor therapeutic response in clinical trials are usually rating scales that evaluate the depressive or psychotic state rather than treatment efficacy on a specific entity . efficacy , nosology , and duration of treatment are based on the antidepressant effect , and , therefore , in many of the specific entities where they are presently used , these variables have not been confirmed . similarly , in most trials focusing on therapeutic outcome , there are no differences between different drugs belonging to the same therapeutic group . the current situation is therefore characterized by disharmony prevailing between psychotropic drug development , nosological classification of diseases , clinical research , and therapeutic uses of psychotropic drugs .

the current clinical use of psychotropic drugs is transnosologically oriented . this is facilitated by the current classification of mental disorders ( international classification of diseases , 10th revision [ icd-10 ] ) and is perhaps justified if depression and psychosis ( taken here as examples ) are considered as being complex syndromes with heterogeneous etiologies , but common pathogenesis , more than specific entities . however , this approach does not identify possible differences between specific psychiatric entities , which could in turn mask differences in therapeutic responses and , therefore , therapeutic outcome . this is compounded by the current disharmony between the nosological classification of diseases , drug development , clinical research , and therapeutic uses of psychotropic drugs . functional pharmacology targeting abnormal behavioral traits could represent an avenue for future research and treatment .

Clinical treatment with antidepressants Treatment of schizophrenia and other psychiatric disorders with antipsychotics Transnosological use of psychotropics: drug development and clinical research Conclusion

africa , the population size of the city of tshwane in 2011 was roughly equal to 3 million . the city is home to over 5,000 businesses out of which 1,603 businesses operate within the central business district of tshwane , known as pretoria . according to the annual report issued by the city of tshwane metropolitan municipality for the budget year 2010 - 2011 , about 1,734,295 tons of solid waste the solid waste produced by businesses in the city includes trash or garbage such as wood , product packaging , empty bottles , used tyres and car parts , and cans , garden refuse , furniture , clothing , leftover food , newspapers , wires , grease , appliances , paint , pieces of metal , broken containers , sheet metal , used medicine , and the like . these businesses produce massive volumes of solid and liquid waste on a daily basis . taxi ranks , bus stations , open flea markets , food outlets , and small businesses located in pretoria are synonymous with litter , uncontrolled solid and liquid waste , as well as lack of capacity in the efficient management of waste . the annual report released by the city of tshwane metropolitan municipality for the year 2011 shows that massive waste is accumulated during strike action by municipal workers responsible for the removal of waste from households and businesses . the collection , disposal , and processing of waste produced by businesses and households are regulated by legislative policies set out and enforced by the municipality of tshwane and the south african national department of environmental affairs and tourism [ 2 , 3 ] . the use of an integrated municipal solid waste management system [ 47 ] has been shown to be essential for improving overall efficiency in municipal waste management in almost all developed nations of the world . in order for an integrated waste management system to perform efficiently , all relevant stakeholders of the waste chain must play a mutually collaborative role in the collection , disposal , processing and management of waste . a review of the relevant literature shows that such a measure is essential for reducing the overall cost of waste management , and for the protection of the environment [ 810 ] . overall efficiency in the management of waste depends on adherence to municipal acts on waste disposal and management [ 1113 ] . research work carried out in several developing nations of the world has shown that health education on environmental sanitation and primary health care , socioeconomic incentives , as well as a strict enforcement of municipal bylaws are all needed for ensuring overall environmental cleanliness and the efficient management of waste in metropolitan cities such as tshwane . the study was conducted against the background of a host of factors that are well known to undermine overall efficiency in the management of solid waste in almost all metropolitan cities of the developing world . these background factors are lack of infrastructural capacity required for the efficient management and processing of solid waste [ 2 , 3 , 17 , 18 ] , poor awareness about the benefits of proper waste management , lack of socioeconomic incentives to stakeholders relevant to the waste management chain , failure to adequately utilize modern waste management and processing technology [ 21 , 22 ] , failure to vigorously enforce municipal bylaws [ 2 , 3 ] , and the absence of an integrated waste management system in tshwane [ 23 , 24 ] . the study aims to identify and quantify the key predictors of inefficiency in the management of solid waste in the city of tshwane . with a view to ensure optimal efficiency in the management of solid waste , this research work will assess the degree to which municipal bylaws and regulations that are relevant to solid waste management are adhered to by businesses conducting business in the city of tshwane . the bylaws and regulations are relevant to all stages of the waste management chain ( sorting of waste at source , collection , treatment , disposal , and processing ) . the model considers 4 categories of solid waste ( municipal , organic , plastics , and electronic ) and is designed for realizing a sustainable and optimally efficient solid waste management system for the city of tshwane . the model is accompanied by a comprehensive monitoring and evaluation plan that could be used for assessing the current status - quo , and for assessing and evaluating efficiency in waste management at each stage of the waste management chain . norms and standards set out by the south african national department of environment and tourism are used for benchmarking . although more than 25% of small and medium - sized businesses as well as informal traders operating in the city of tshwane generate waste in the course of conducting routine business [ 2 , 3 , 17 ] , the pace at which such waste is properly collected and disposed of by municipal workers employed by the city of tshwane is significantly lower than the pace at which waste is generated . this situation is exacerbated at times of civil action carried out by municipal workers responsible for routine waste collection and disposal . taxi ranks , the various sources of solid and liquid waste and pollution , bus stations , liquor stores , petrol stations , schools , shops , open markets , garages , and so forth are well known contributors for the generation of high volume of solid and liquid waste in the cbd of pretoria . there is room for improvement of the current level of efficiency in the management of waste produced by the various sources of solid and liquid waste and pollution . in terms of the strategic plan adopted by the south african department of environmental affairs and tourism ( deat ) to improve efficiency in the management of waste , the various sources of solid and liquid waste and pollution are a major stakeholder , and no progress can be made unless otherwise the various sources of solid and liquid waste and pollution are involved in the implementation of the plan drawn up by the deat [ 4 , 17 ] . there is a significant accumulation of solid waste especially in townships such as mamelodi and marabastad , and at the various taxi ranks in and around the city of pretoria . there is a shortage of essential facilities such as trash cans , seats , shelters , public toilets , and clean tap water at taxi ranks and public gathering arenas . some of the various sources of solid and liquid waste and pollution do not have properly functioning toilets and washrooms although the proper functioning of such facilities is an essential requirement for business . the various sources of solid and liquid waste and pollution , taxi ranks , and public gathering arenas are often characterized by bad smell and a large accumulation of solid and liquid waste . such places are conducive for the spread of communicable diseases such as food poisoning and diarrhoea unless they are controlled and managed efficiently by the ctmm . not enough is known so far about the extent to which efficiency in waste disposal can be improved in view of the fact that there is lack of empirical evidence in this area of research interest . not enough research has been done in the cbd of pretoria to assess and identify factors that affect efficiency in proper waste disposal . there is a shortage of empirical evidence based on a properly designed multivariate modelling in areas related to the quantification of factors that contribute to poor environmental sanitation and the accumulation of solid and liquid waste in the cbd of pretoria . low level of awareness in areas related to recycling , classification of waste at source and composting plays a major role in compounding the current lack of efficiency in the efficient utilization of resources such as broken bottles , empty cans , used goods , plastic bags , and so forth . far from being put to economic use , broken bottles are harming pedestrians and school children in addition to polluting the environment and decreasing the beauty of the city in the eyes of visitors and residents . some irresponsible inhabitants of the city and visitors who travel to the city from outside do not have adequate respect for environmental sanitation and demonstrate total disregard for cleanliness of the streets of the city . . examples of such rubbish are beer bottles , empty cans , and used food packages . empty bottles break into harmful pieces as they are thrown onto the streets from moving taxis and private cars . there is a need to have irresponsible inhabitants and visitors educated and disciplined so that they show respect for environmental sanitation and cleanliness . experience drawn from large municipalities in sweden , the united states , and kenya shows that these deeply ingrained problems could be addressed adequately by enforcing the relevant municipal bylaws with vigour , by promoting health and environmental education , and by providing socioeconomic incentives to stakeholders and role - players in the waste management chain . a review of the literature shows that in cities as big as tshwane , modern waste treatment technologies such as composting , incineration , landfills , recycling , and window composting should be used for solid waste management [ 2023 ] . modern solid waste management techniques such as landfills , incineration , recycling , biological processing , energy recovery , radio frequency identification tags , global positioning system tracking integrated software packages , rear vision cameras , and the like are used in cities such as geneva and stockholm . examples of advanced solid waste treatment technologies that are suitable for the city are anaerobic digestion , ethanol production , biodrying , gasification , in - vessel composting , mechanical biological treatment , mechanical heat treatment , plasma arc waste disposal , pyrolysis , sewage treatment , and tunnel composting are also highly appropriate technologies for the city [ 19 , 20 ] . in the city of tshwane , the management of solid waste involves collection , transportation , processing or disposal , management , and monitoring of waste materials . the south african department of environmental affairs and tourism promotes the use of modern technologies and evaluation techniques that are necessary for the efficient management of waste although advanced technologies that are used for waste management and evaluation are poorly utilized in south african cities including the city of tshwane . globally , diverse methods have been used for improving efficiency in the collection and disposal of solid waste . the most commonly used methods are designed for ensuring efficiency in solid waste management and are outlined in the un - habitat 's third global report of 2010 . in the world 's cleanest cities , the following methods are used : integrated sustainable waste management , the enforcement of municipal bylaws , the promotion of primary health care services and environmental sanitation , the promotion of health education on proper waste management , financial sustainability , institutional framework , good governance , community based campaigns of awareness , the provision of incentives for good performance in the collection of solid waste , process flow diagrams , as well as monitoring and evaluation programmes designed for the assessment of municipal service delivery programmes [ 2225 ] . in this study , assessment of efficiency in waste management was made by using the classic structural time - based model constructed by tchobanoglous et al . as well as adherence to municipal bylaws . the city of tshwane uses the model for assessing overall efficiency in the collection of solid waste by municipal service providers . the model is suitable for assessing efficiency in the collection of solid waste from fixed containers that are used for depositing solid waste by businesses and ordinary residents . the model assesses overall efficiency as a function of time taken for the management of waste . the aim of this research is to identify and quantify factors that affect overall efficiency in the management of solid waste generated by businesses that operate in the city of tshwane . based on data collected from a random sample of n = 1,034 businesses operating in the city of tshwane , the research article aims to : assess the current state of solid waste management with regards to type of wastes and quantities of waste generated , identify key factors that affect efficiency in the management of solid waste , andassess the degree to which businesses adhere to norms and standards that are recommended for businesses in terms of solid waste disposal . assess the current state of solid waste management with regards to type of wastes and quantities of waste generated , identify key factors that affect efficiency in the management of solid waste , and assess the degree to which businesses adhere to norms and standards that are recommended for businesses in terms of solid waste disposal . data was collected in 2010 from a random sample of 1,034 businesses operating in the city of tshwane . managers and owners of the businesses as well as employees were asked a total of 89 questions related to the type of business they were operating , the type and volume of waste generated , how waste was collected , sorted out , disposed of and managed , the extent of cleanliness and sanitation at the workplace , their socioeconomic and demographic characteristics , as well as their personal opinion on the benefits of the proper management of waste . efficiency in solid waste management was assessed by using the model proposed by tchobanoglous et al . for estimating the median time required for the collection of solid waste from the businesses that took part in the study . the model measures efficiency in the collection of solid waste from fixed locations and containers based on the mathematical expression shown below : ( 1)e=1a+b . in ( 1 ) , a denotes an off - route factor , and b is a measure of off - route activity time by individuals collecting waste . in cases where a = b , the collection of solid waste becomes perfectly efficient . the larger the difference between a and b , the less efficient becomes the waste collection procedure . the time required per trip is given by the expression shown below : ( 2)t = t1+t2+y1a . in ( 2 ) , t is the time required for waste collection from a fixed site per trip , t1 is equal to pick up time of container at the site of collection , t2 is equal to on - site time per trip , y denotes the total haul time during waste collection , and x denotes the average round - trip haul distance per trip . since the relationship between y and x follows simple linear regression , we have ( 3)y=0+x . in ( 3 ) , 0 is the constant term in the simple linear regression of y on x , and is the regression coefficient in the simple linear regression of y on x. in cases where waste is collected from fixed sites , the time required to collect waste per trip follows a stationary model , and is expressed by the expression shown below : ( 4)t1=p+q+r . in ( 4 ) , p is the time taken to pick up a container that is full of solid waste ; q is the time taken to unload an empty container ; r is the time taken for driving from one container to the next container . the number of trips per day is given by the expression shown below : ( 5)n = y(1a)(t3+t4)t . in ( 5 ) , variable t is the time required for waste collection from a fixed site per trip ; t3 is the time required to drive from dispatch station to first container location to be served by the day ; t4 is the time required to drive from the last container location to be served by the day to the dispatch station . the time taken per trip is given by the expression shown below : ( 6)t5=t6ty . in ( 6 ) the number of trips made per week is given by the expression shown below : ( 7)t6=krq . in ( 7 ) , variable k is a measure of the volume of waste generated in a week in cubic meters per kg ; r is the average size of the container in cubic meters per kg ; q is the weighted average container utilization factor . since t = ( t1 + t2 + y)/(1 a ) as shown above in ( 2 ) efficiency can thus be measured by the following relationship : ( 9)e = y+t1+t2+btt=(t1+t2+y)+btt=(1a)t+btt=1a+b . values of e in the expression e = 1 a + b were calculated for each of the 1,034 businesses that took part in the study . businesses for which values of e fell below the median were used for identifying businesses in which efficiency in waste management was inadequate . businesses for which values of e were greater than or equal to the median were used for identifying businesses in which efficiency in waste management was deemed adequate . that is , ( 10)overall efficiency={inadequate if score is belowthe median of eadequate if score is greater thanor equal to the median of e. pearson 's chi - square tests of association were used for the screening of variables . this was done by performing two - by - two tests of associations between overall efficiency in the management of waste and the various socioeconomic , demographic , sanitary , environmental , and health - related variables on which data was gathered as part of the study . at the 5% level of significance , an association was deemed significant if the p value was below 5% . the dependent variable of study is a measure of overall efficiency in the management of waste . the variable has only 2 possible values ( inadequate , adequate ) . since the dependent variable of study is dichotomous , binary logistic regression analysis was used in order to identify key predictors of inefficiency in the management of waste . multilevel analysis was used in order to estimate the extent of variation with regards to efficiency in the management of waste by geographical zone and category of business enterprise . multilevel analysis is a statistical procedure that enables planners and policy makers to allocate resources that are needed for intervention based on the extent of variation observed at various hierarchical levels . in this study , the two hierarchical levels depending on which efficiency in waste management varies are geographical location and category of business . the degree of adherence to municipal bylaws and guidelines for the disposal of solid waste was measured by using a 2-point scale . the guidelines used for measuring adherence were the iso 14000 and iso 14031 guidelines for environmental management and performance monitoring in the management of waste and the environment [ 3032 ] . at each of the 1,034 businesses selected for the study , the degree of adherence to municipal bylaws and procedures recommended for solid waste management by businesses by the city of tshwane was graded based on iso 14000 and iso 14031 guidelines . that is , at each business enterprise , binary grades ( adequate , not adequate ) were allocated as a measure of compliance according to criteria stipulated in iso 14000 and iso 14031 guidelines . the binary variable created for assessing degree of adherence to iso guidelines or municipal bylaws was used as one of the predictor variables of study . category 1 of the binary variable represented inadequate adherence to iso guidelines or municipal bylaws . category 2 of the binary variable represented adequate adherence to iso guidelines or municipal bylaws . the purpose of conducting binary logistic regression analysis was to identify influential predictors of inefficiency in the management of waste among businesses operating in the city of tshwane . the use of binary logistic regression analysis was appropriate as the dependent variable of study had only 2 possible values ( 1 , 0 ) . in binary logistic regression analysis , odds ratios were used as an epidemiological measure of effect . at the 5% level of significance , influential predictors of inefficiency in waste management are characterized by estimated odds ratios that differ from 1 significantly , p - values that are smaller than 0.05 , and 95% confidence intervals of odds ratios that do not contain 1 . the adequacy of the fitted logistic regression model was assessed by using standard diagnostic procedures such as the classification table , the hosmer and lemeshow goodness - of - fit test , receiver operating characteristics ( roc ) plots , and sensitivity / specificity plots . table 1 shows a comparison between businesses that were efficient with regards to solid waste management with those that were not . it can be seen from the table that 857 of the 1,034 businesses ( 83% ) were efficient , while the remaining 177 businesses ( 17% ) were inefficient . the table shows that a significant percentage of businesses located in the central and western parts of the city were inefficient , whereas businesses located in the eastern and northern parts of the city were by and large efficient . the table shows that 76% of operators who managed businesses that were efficient with regards to waste management have acquired formal education at college level or better . in general , businesses that are inefficient in the management of waste are relatively younger , poor in personal hygiene and cleanliness of premises , and are by and large commercial . the majority of old businesses ( 6 years or more ) are efficient in waste management . businesses that are operated by owners are more efficient in comparison with businesses that are operated by employed managers . utilization of private contractors for waste removal and management , regular inspection of premises by municipal workers , familiarity with the south african white paper on waste management , source reduction of waste , good perception on the benefits of proper waste management , and adherence to waste management regulations recommended by the municipality are much more common among businesses that are efficient in waste management . two - by - two pearson chi - square tests of associations was used for performing a preliminary screening of influential factors that were significantly associated with inefficient management of waste . table 2 shows a list of 15 factors that are significantly associated with poor or less than satisfactory waste disposal at the 0.001 level of significance . in each of the tests , the outcome variable of study , y , was defined as follows : ( 11)overall efficiency={inadequate if score is belowthe median of eadequate if score is greater thanor equal to the median of e. at the 0.001 level of significance , significant associations are characterized by large observed chi - square values and p - values that are smaller than 0.001 . table 2 provides a list of 15 variables that are significantly associated with inefficient waste management . at the 0.001 level of significance , all 15 variables shown in table 2 are significantly associated with overall efficiency in the management of waste . it can be seen from the table that the top 5 significant variables are : lack of adherence to municipal bylaws and regulations , wrong perception on the potential benefits of proper waste management , failure of businesses to provide customers with enough trash cans , the status of the business operator ( owner or employee ) , and the frequency at which business premises are inspected by municipal sanitation and health workers , in a decreasing order of strength . results from binary logistic regression analysis are theoretically more reliable than results from pearson 's chi - square tests of association . this is because the measure of effect in binary logistic regression is the odds ratio , and not two - by - two significant associations . logistic regression analysis allows multivariate analysis involving several variables that are influential over waste disposal . it is also possible to assess the reliability of the fitted logistic regression model based on highly reliable diagnostic tests such as the classification table , the likelihood ratio test , the hosmer - lemeshow goodness - of - fit test , as well as receiver operating characteristic ( roc ) and sensitivity / specificity plots . at the 0.05 level of significance , influential predictor variables are characterized by estimated odds ratios that differ from 1 significantly , p - values that are smaller than 0.05 , and 95% confidence intervals of odds ratios that do not contain 1 . accordingly , it can be seen from table 3 that all 4 predictor variables are significant at the 0.05 level . the results show that efficiency in the proper management of solid waste is significantly influenced by 4 predictor variables . these 4 influential predictor variables are lack of adherence to municipal bylaws and regulations ( or = 9.17 ; 95% c.i . = ( 6.42 , 12.54 ) ) , wrong perception ( or = 8.81 ; 95% c.i . = ( 6.01 , 11.35 ) ) , failure to provide customers with enough trash cans ( or = 3.15 ; 95% c.i . = ( 1.46 , 5.87 ) ) , and the operation of businesses by employed managers ( or = 2.69 ; 95% c.i . = this shows that a business that is managed by an operator who fails to adhere to guidelines set out for waste management by the city of tshwane is 9.17 times as likely to be inefficient in the proper management of solid waste in comparison with a business that is managed by an operator who adheres to recommended guidelines . this shows that a business operator who has the wrong perception on the benefits of proper management of solid waste is 8.81 times as likely to be inefficient in comparison with another business operator with the correct perception on the benefits of proper waste management . the adjusted odds ratio of the variable failure to provide customers with enough trash cans is 3.15 . this shows that a business in which there are not enough trash cans for customers is 3.15 times as likely to be inefficient in the management of solid waste in comparison with a business in which enough trash cans are provided to customers . this shows that an outlet that is operated by someone who does not own the business being operated is 2.69 times as likely to beinefficient in the proper management of solid waste in comparison with an outlet that is operated by someone who actually owns the business . adjusted odds ratios are more reliable than unadjusted odds ratios in epidemiological studies of this kind . in this study , the estimated odds ratios were adjusted for two potential confounding variables ( level of education of business operator and the physical location of business ) . the adjusted odds ratios did not differ much from the unadjusted odds ratios , thereby showing that none of the variables used for adjustment was a confounding variable . the reliability of the fitted logistic regression model was assessed using standard goodness - of - fit tests suitable for binary logistic regression analysis . the classification table showed that the fitted model had an overall percentage of correct classification of 88.78% , a percentage sensitivity of 57.06% , and a percentage specificity of 95.33% . the hosmer - lemeshow goodness - of - fit test gave a p - value of 0.0701 , a figure which is greater than 0.05 , thereby showing that there was no reason to doubt the reliability of the fitted logistic regression model . figure 1 below shows a plot of sensitivity / specificity versus probability cut - off point . the magnitude of the area that lies under the roc plot is a measure of variation explained by the fitted logistic regression model . in this case , the area under the roc plot is 88.82% , a figure that is significantly above 75% . the large proportion of explained variation and the small proportion of unexplained variation show that the fitted model is highly reliable in explaining variability in waste disposal as a function of the explanatory variables used for logistic regression analysis . the likelihood ratio test is used for assessing the collective efficiency of the 8 predictor variables used for performing binary logistic regression analysis . at the 5% level of significance , a p - value that is smaller than 0.05 shows that the 8 predictor variables used for performing binary logistic regression analysis are jointly efficient . in this case , the p - value from the likelihood ratio test is equal to 0.000 , a figure that is smaller than 0.05 . this small p - value shows that the 8 predictor variables used for binary logistic regression analysis are collectively efficient in accounting for failure in the proper disposal of waste . multilevel analysis was used in order to estimate the extent of variation with regards to efficiency in the management of waste by geographical zone and category of business enterprise . table 1 provides frequency distributions for each of the 7 categories of business ( agricultural , commercial , construction , industrial , institutional , municipal , and processing and manufacturing ) as well as 5 geographical locations ( central , east , west , north , south ) of the city of tshwane that were considered in performing multilevel analysis . results obtained from multilevel analysis showed that there were significant differences among the 7 categories of waste . the results showed that 23.05% of the total variation in efficiency is due to differences among the 7 categories of waste produced by business enterprises operating in the city of tshwane . the results also showed that businesses within the same category of waste and geographical location were equally efficient in the management of solid waste . the key objective of research was to identify and quantify factors that affect efficiency in the management of solid waste by businesses that are operated in the city of tshwane . the study has shown that efficiency in the management of solid waste is significantly influenced by 4 key predictor variables of study . these 4 influential predictor variables are lack of adherence to municipal bylaws and regulations , wrong perception on the potential benefits of proper waste management , failure to provide customers with enough trash cans for waste disposal , and the practice of operating businesses by employed managers , in a decreasing order of importance . in the city of tshwane , municipal solid waste consists of everyday items such as product packaging , empty bottles and cans , grass clippings , furniture , clothing , left - over food , newspapers , appliances , paint , batteries , pieces of metals , and so forth . such solid waste is generated by businesses , households , schools , hospitals , and visitors travelling into the city on foot or by other modes of transport such as cars , train , taxi , or bus . the health department of the city of tshwane has a municipal bylaw that stipulates how solid waste should be packaged , sorted , collected , and disposed of by inhabitants of the city . the bylaw encourages inhabitants of the city to practice source reduction of solid waste , recycling , and composting ( collecting organic waste such as left - over food and garden refuse , storing these wastes under conditions that are designed to help them break down naturally , and then use the resulting compost as a natural fertilizer ) . according to the south african national department of environmental affairs and tourism , the disposal and combustion of municipal solid waste is conducted by the use of landfills , the conversion of non - recyclable waste materials into useable heat , electricity , or fuel , combustion , and transfer stations . although the use of such mechanisms is consistent with the municipal bylaw in the city of tshwane , the mechanisms have been poorly utilized mostly due to lack of infrastructural development and technical skills . the results are expected from a typical sub - saharan african country in which poverty , unemployment , and massive immigration into urban centres prevail . environmental hazards arising from the decomposition of solid waste under oversaturated conditions and dumping of solid waste in illegal landfills often cause sludge . such problems are particularly evident in suburbs of tshwane such as mamelodi and marabastad . in this regard , the city of tshwane can be viewed as a combination of clean white suburbs and dirty black townships . the other key environmental hazard is caused by arbitrary landfill sites that dot the peripheries of the city of tshwane . the study by snyman and vorster has found that composting and the pretreatment of municipal waste before landfilling are viable options for the city of tshwane . have found that composting and pretreatment of municipal waste before landfilling significantly reduce the volume of solid waste and contributes for overall environmental sanitation . at the moment , the city of tshwane does not have adequate capacity for large scale composting , and there is an acute need for addressing this shortcoming . the study has shown that a combination of technical and administrative solutions is required in order to improve efficiency in the management of solid waste in the city of tshwane . to separate waste generated at the various businesses , it is necessary to provide businesses with custom - made containers that are suitable . the frequency of collecting waste should be balanced with the volume of waste generated by the various businesses . studies conducted in various parts of the developed world have shown that there are economic benefits in outsourcing the collection and disposal of recyclable waste to the informal sector , and that sanitary landfills should be used for the final disposal of solid waste . in addition to enforcing the law with vigour , it is equally important to provide community based health education on environmental sanitation by collaborating with the department of health . awareness campaigns and socioeconomic incentives could be provided by civic society and nongovernmental organizations that have a vested interest in improving environmental sanitation and cleanliness . since most of the waste generated in the city of tshwane , the provision of incentives and education at the grass - roots level carries a clear socioeconomic merit . composting is a form of aerobic treatment , and is suitable for treating organic waste in the city of tshwane . according to barlaz , facilities used for storage and collection of waste must be compatible with each other . waste disposal and processing sites must be located strategically so that the cost of waste collection , disposal and processing becomes optimal . the city of tshwane needs to make the necessary initial investment available in order to benefit from composting in the long - run . extensive waste management research conducted in various parts of china has shown that educating rural as well as urban people on how to produce compost by using low technology has long - term economic benefits to big metropolitan municipalities such as tshwane . research conducted in nigeria has shown that strategic partnerships and collaboration among academic and research institutions and municipalities have the potential for enhancing overall efficiency in waste management , skills development , and the creation of employment opportunities in municipalities such as tshwane . one particular area of waste that stands to benefit out of such partnership is the management and processing of plastic and e - waste . the collection and recycling of plastic waste is characterized by serious challenges and difficulties in the city of tshwane . the city of tshwane has no coherent policy on the collection of e - waste . neither does it provide clear incentives to entrepreneurs who wish to collect , classify , and process e- and plastic waste . since e - waste could be hazardous , there is a dire need to build capacity in the classification of e - waste into one of two categories ( harmful or hazardous ) , and processing each category of waste by utilizing an appropriate form of technology . there is an acute need for providing incentives , enforcing municipal bylaws , the provision of health and sanitary education , and a comprehensive monitoring and evaluation programme for assessing the progress made in this regard regularly . a well - functioning integrated solid waste management system can only be realized in the city of tshwane by providing clear incentives for good practice and behaviour , and by severely penalizing irresponsible behaviour in the city . liu et al . have found that the provision of direct socioeconomic incentives , clear guidelines on the collection , disposal , and processing of e- and plastic waste , as well as a strict enforcement of municipal bylaws is required for improving overall efficiency in the management of e and plastic waste in the city of tshwane . the efficient management of solid waste produced by enterprises that conduct business in the various parts of the city of tshwane has numerous economic , sanitary , and health - related benefits to the inhabitants of the city . up until recently , emphasis has been placed on waste disposal , and not on management , recycling , and composting . poor management of waste has an adverse impact on the environment and public health , particularly in townships such as mamelodi , marabastad , soshanguve , and attridgeville . in these townships , waste is managed poorly , and landfills are inappropriately sited , designed , managed , and operated . until recently , the management of waste generated by businesses operating in the city has not been given due consideration . the waste management that took place focused mainly on waste disposal and was reactive in that it addressed needs as they occurred . the low priority that was historically accorded to waste management has resulted in waste impacting detrimentally on the south african environment and on human health . efficient waste disposal is a process that requires the full collaboration of all stakeholders on a community based collaborative approach . in addition to providing sanitary education and inspection services to the businesses , clear incentives must be provided to ensure maximum success . the enforcement of regulations , the provision of incentives , adequate logistical resources , additional manpower , financial rewards , public - private partnerships , and awareness campaigns are all essential . the treatment of waste produced by the businesses in the city of tshwane is similar to waste produced in a typical developing nation in the sense that treatment of this waste involves simply a reduction of its volume by use of methods such as baling or shredding although incineration and composting is practiced at a small scale . the emphasis remains on disposal of general waste by landfill without treatment as the lowest cost disposal option , as landfill airspace is still available in south africa . the lack of pretreatment of general waste before disposal is therefore currently not regarded as a problem in south africa . incineration of general waste and hazardous waste is not acceptable to many stakeholders due to the poor operation of many existing facilities and noncompliance with existing by - laws . incineration is not economically feasible in south africa since its warm climate limits the market for the energy derived from the incineration process . the majority of operating incinerators in south africa are used for the treatment of infectious medical waste . increasing general awareness about the benefits of proper waste disposal is a key requirement for success . the number of waste disposal sites is limited , and the disposal of waste is expensive . since there are not enough of these facilities , hazardous waste is often transported over long distances , resulting in increased risks of accidents and higher transport costs . some other helpful steps are to undertake an integrated plan in which waste is gathered and disposed of efficiently based on mutual collaboration among stakeholders , strengthening the technical , financial , administrative , and operating capacity of the institutions in the basic environmental sanitation sector , and encouraging health education and community promotion activities , which are basic to the success of waste collection and disposal , especially at taxi ranks and the streets at the central business district of pretoria , to provide clear incentives to businesses that improve the quality of waste collection and disposal based on generally accepted standards . technical cooperation among stakeholders must be directed toward the strengthening of institutions in the basic environmental sanitation sector and emphasis should be given to the following activities : operation and maintenance , community promotion , training , administration and management , the preparation of plans and studies helpful for efficient waste disposal , and the application of technologies that are helpful for efficient waste disposal . in - depth interviews conducted with some of the managers of the 1,034 businesses that took part in the study have revealed that the businesses suffer enormously during prolonged strike actions . waste material gets vandalized by scavengers as a result of delay in collection by service providers . it is too risky to leave waste uncollected during rainy seasons as waste could easily be mixed up with excreta that could be washed away by rain - water , ending up in wells and streams . the germs in the excreta could then easily contaminate drinking or washing water . in such situations failure to dispose of waste can have a significant effect on the health of communities . where refuse is not disposed of properly , it can lead to pollution of surface water , as rain washes refuse into rivers and streams . refuse disposed of in storm drains may cause blockages and encourage fly and mosquito breeding . all business premises operating in the city of tshwane must be inspected for environmental sanitation and cleanliness regularly with a view to encourage and reward good practice , and to penalize irresponsible behaviour . municipal bylaws on the collection , disposal and management of waste must be enforced with enough vigour and commitment . failure to do so can easily result in frustration among businesses that obey municipal guidelines and regulations on waste management . the study showed that 17% of the 1,034 businesses were not efficient enough with regards to the proper collection , disposal , and management of solid waste . the study has shown that efficiency in the management of solid waste is adversely affected by lack of adherence to municipal bylaws and regulations on proper waste management , wrong perception on the potential benefits of proper waste disposal , failure to provide customers with enough trash cans at business premises , and the operation of businesses by employed managers , in a decreasing order of importance . lack of adherence to municipal bylaws and regulations that are essential for proper waste management constitutes a key challenge in the city of tshwane . the presence of wrong perception on the potential benefits of waste disposal is also a well known hurdle . to rectify this issue , the second intervention is to provide incentives to businesses that manage solid waste properly in accordance with guidelines provided by the city of tshwane . regulatory and legislative actions must be taken against those who fail to respect municipal bylaws that are related to cleanliness and proper waste management . the efficient disposal of waste generated by businesses operating in the city has direct economic benefits to all inhabitants of the city . accordingly , waste should be gathered efficiently and disposed of in accordance with the waste collection and management plan produced by the city of tshwane . the third intervention is to actively promote an education campaign in all parts of the city of tshwane with a view to ensure the full collaboration of businesses conducting business in the city . based on findings of this particular study , the following recommendations are made to the city of tshwane in order to improve overall efficiency in the management of solid waste that is generated by businesses operating in the city.the city of tshwane must produce and implement an integrated plan for the management of solid waste in collaboration and partnership with the relevant stakeholders in the city so that each of the role players in the waste management chain can investment adequately in basic environmental sanitation.an initial infrastructural investment needs to be made by the city of tshwane in order to build adequate capacity for commercial composting . this should be done in collaboration with business enterprises so that they can share the financial burden at the initial stage , and benefit from compost - related business opportunities in the long-run.the city of tshwane must strive to increase awareness about the potential benefits of proper waste collection and disposal by promoting health education on environmental sanitation and techniques that are useful for collecting and sorting waste . incentives must be provided to businesses that do a good job in terms of the proper collection and disposal of solid waste . the city must also support research initiatives conducted by academic and research institutions in areas that are related to waste management , environmental sanitation , and personal hygiene by funding them partially or fully.the city of tshwane must improve the conditions of employment of municipal workers responsible for waste collection and disposal.the city of tshwane and gauteng department of health must provide technical assistance to businesses that do not have their own waste management plans so that such businesses can contribute for overall efficiency in environmental sanitation . the city of tshwane must produce and implement an integrated plan for the management of solid waste in collaboration and partnership with the relevant stakeholders in the city so that each of the role players in the waste management chain can investment adequately in basic environmental sanitation . an initial infrastructural investment needs to be made by the city of tshwane in order to build adequate capacity for commercial composting . this should be done in collaboration with business enterprises so that they can share the financial burden at the initial stage , and benefit from compost - related business opportunities in the long - run . the city of tshwane must strive to increase awareness about the potential benefits of proper waste collection and disposal by promoting health education on environmental sanitation and techniques that are useful for collecting and sorting waste . incentives must be provided to businesses that do a good job in terms of the proper collection and disposal of solid waste . the city must also support research initiatives conducted by academic and research institutions in areas that are related to waste management , environmental sanitation , and personal hygiene by funding them partially or fully . the city of tshwane must improve the conditions of employment of municipal workers responsible for waste collection and disposal . the city of tshwane and gauteng department of health must provide technical assistance to businesses that do not have their own waste management plans so that such businesses can contribute for overall efficiency in environmental sanitation .

objective . the objective was to investigate factors that affect the efficient management of solid waste produced by commercial businesses operating in the city of pretoria , south africa . methods . data was gathered from 1,034 businesses . efficiency in solid waste management was assessed by using a structural time - based model designed for evaluating efficiency as a function of the length of time required to manage waste . data analysis was performed using statistical procedures such as frequency tables , pearson 's chi - square tests of association , and binary logistic regression analysis . odds ratios estimated from logistic regression analysis were used for identifying key factors that affect efficiency in the proper disposal of waste . results . the study showed that 857 of the 1,034 businesses selected for the study ( 83% ) were found to be efficient enough with regards to the proper collection and disposal of solid waste . based on odds ratios estimated from binary logistic regression analysis , efficiency in the proper management of solid waste was significantly influenced by 4 predictor variables . these 4 influential predictor variables are lack of adherence to waste management regulations , wrong perception , failure to provide customers with enough trash cans , and operation of businesses by employed managers , in a decreasing order of importance .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

parkinson 's disease ( pd ) is a neurodegenerative condition characterised clinically as a movement disorder consisting of bradykinesia , rigidity and rest tremor , as a consequence of striatal dopamine depletion secondary to degeneration of the dopaminergic neurons of the substantia nigra . in addition , pathology in other regions results in cognitive deficits and a dementia in some cases , neuropsychiatric manifestations including depression and anxiety , sleep disturbances including rapid - eye movement sleep behavior disorder , and autonomic features ( kalia and lang , 2015 ) . the motor disorder of pd responds well to dopamine - replacement therapies such as levodopa or dopamine agonists . however , systemic administration of dopaminergic agents results in non - physiological release of dopamine in the striatum resulting over time in disabling motor dyskinesias , and off - target effects resulting in neuropsychiatric complications , including impulse control behaviours , which can be very severe in some patients . there remains therefore , a currently unmet need for a means of introducing dopamine to the striatum in a more physiological and targeted manner , and as such there is much interest in emerging cell - based regenerative treatments for pd ( jenner , 2003 ; barker et al . , 2015 ; kalia and lang , 2015 ) . a variety of sources of dopaminergic cells have been investigated for treating pd in this way , and in this review we discuss the basis of these , as well as their prospects for use in clinical practice . dopaminergic neurons can be obtained from several sources to serve as the basis for potential cell - based therapies . any neural tissue grafted must have the ability to produce dopamine , demonstrate axonal outgrowth , and form connections with the host striatum , without widespread migration of grafted cells or malignant transformation . fetal ventral mesencephalon ( fvm ) tissue contains progenitors for dopamine - producing neurons , and has been transplanted into the striatum of pd patients with good results in a number of patients ( kefalopoulou et al . , 2014 ; barker et al . , clinical efficacy and safety has been highly variable in trials of human fvm grafting , partly due to suboptimal patient selection , grafting technique , immunosuppressive regimes and trial design ( freed et al . , 2001 ; however , in appropriately selected patients ( using criteria including age less than 65 years and minimal pre - existing dyskinesia ) , this strategy seems to be effective and at the very least has shown an important proof - of - concept that dopaminergic neuron replacement for pd is a therapeutic option ( barker et al . , 2015 ) . although fetal dopaminergic cells have shown an important proof - of - principle , there are major logistical and ethical problems linked to their use which has led to the search for a better source of cells for grafting in pd . the generation of induced pluripotent stem cells ( ipscs ) through forced expression of pluripotency factors in adult human somatic cells led to much interest in these as a potential cell - based treatment for pd ( takahashi et al . , 2007 ) . nigral dopaminergic neurons can be generated from ipscs by exposure to specific factors that induce neuronal differentiation and midbrain patterning ( soldner et al . this approach potentially would mean that a patient - specific therapy could be generated for each individual ( autologous grafting ) , circumventing the need for the immunosuppression that is required when using allografts . comparison of the major approaches to cell - based therapies in parkinson 's disease an alternative approach to the use of ipsc - derived neurons is to generate dopaminergic neurons from embryonic stem ( es ) cells which could be used for allogeneic grafting ( thomson et al . , 1998 ) . like ipscs , these can be differentiated into neurons and directed to a midbrain lineage to produce authentic a9 dopaminergic neurons ( kriks et al . , 2011 ) . it has recently emerged that the markers that have been traditionally used to signify nigral dopaminergic neuronal fate fail to predict positive graft outcomes . this has now been achieved showing that midbrain patterning alone is not sufficient to produce high numbers of dopaminergic neurons , but rather neural progenitors must be specifically patterned to the caudal midbrain in order to achieve high yields of nigral dopaminergic neurons ( kirkeby et al . , 2017 ) . this finding reiterates the importance of protocol optimization prior to commencement of clinical trials of cell - based therapies that involve cellular reprogramming . a more recent development has been the direct conversion of adult somatic cells into induced neurons ( ins ) using viral vectors to transfer proneural transcription factors , bypassing the stem cell intermediate stage ( vierbuchen et al . , this approach could theoretically be used to generate patient - specific dopaminergic neuronal autografts , and human ins have been shown to survive transplantation into rodents , and maintain their phenotype ( pereira et al . , 2014 ) . however , the lack of highly efficient , consistent protocols for deriving functional dopamine - producing ins at the present time means that their utility is likely to be limited to in vitro disease - modelling , at least for the foreseeable future . in order for any of the above approaches to be adopted in a clinical setting , they need to not only be effective and capable of restoring striatal dopaminergic tone , but also commercially viable and ethically acceptable . furthermore , any cell - based therapy must be able to compete with current treatments such as pharmacological dopamine replacement and deep brain stimulation , and also emerging pharmaceutical treatments . as work towards disease - modifying therapies progresses , it may be that the optimal treatment approach involves a combination of pharmacological agents ( e.g. , neurotrophic factors or antioxidants ) or immunotherapies targeting alpha - synuclein to limit disease progression , and cell - based therapies to restore the dopaminergic motor function that has already been lost . clinical trials investigating these approaches must be initiated only on the basis of sound pre - clinical data , with flawed , premature trials likely to be detrimental to the whole field , especially in the case of cell - based therapies . furthermore , these treatments must be targeted to the population of patients that are most likely to benefit from them . there is clearly heterogeneity within the pd spectrum , with some patients experiencing a predominantly motor disorder , and others at increased risk of early cognitive impairment and dementia ( williams - gray et al . , 2007 ) . it is the former group that is likely to derive the most benefit from dopamine cell - based treatments , which do not target the cortical and subcortical cholinergic pathology , which is presumably more prominent in the latter group . in view of the discordance seen between the promising early trials of human fvm grafting and the two negative randomized - controlled trials , further investigation is necessary to determine which factors are critical for successful transplant outcomes ( freed et al . , 2001 ; olanow et al . , 2003 ) . an ongoing clinical trial for human fvm grafting ( transeuro ) , in which refined patient selection and an optimized grafting and immunosuppression protocol has been adopted ( based on an analysis of all available data from prior trials ) , is expected to be published in 2020 . in this trial , at least 3 fvms are grafted per side , with tissue being sited stereotactically via five to seven tracts into the posterior putamen . patients receive 12 months of standard triple agent immunotherapy , in the form of cyclosporine a , azathioprine and prednisolone an approach that bears a close resemblance to the early trials undertaken in sweden in the late 1980s/1990s . one of these patients grafted with human fvm during these early trials in sweden has recently come to post - mortem . histological analysis demonstrated survival of the graft , albeit with some intragraft lewy body pathology , 24 years post - transplantation ( li et al . , 2016 ) . whilst fvm grafts are clearly effective in a population of pd patients , the ethical considerations surrounding the use of fetal tissue , and the logistical challenge of accessing adequate tissue ( at least three fetal midbrains are required per grafted side of brain ) means that this approach will not be suitable for widespread clinical use . nevertheless , if the transeuro trial demonstrates clinical benefit , this will serve as an important stepping - stone for clinical trials using stem cell products . the important remaining question will then be whether to pursue autologous ipsc - derived grafts or allogeneic ipsc or es cell - derived grafts ( barker et al . , 2015 ) . ipscs are a means of generating patient - specific autologous grafts , theoretically meaning that they have a low risk of rejection , circumventing the need for immunosuppression . this is often cited as the major advantage of this approach over the use of allogeneic tissue , such as grafts derived from es cells ( barker et al . , 2015 ; stoker and barker , 2016 ) . however , generation of patient - specific grafts from ipscs on a large scale for use in healthcare brings about significant technical , regulatory and financial challenges . variability in the response of each individual cell line to differentiation protocols means that the product will differ between patients , meaning that each graft generated will necessarily be subject to regulatory approval , and the associated costs . additionally , it may not be possible to generate specific target cell types for every pluripotent cell line without time - consuming and expensive optimisation of the differentiation protocol for that particular cell line . the cost of generating autologous grafts via ipscs is therefore likely to be prohibitively high , meaning that this approach is unlikely to be practicable for treatment of common diseases for the foreseeable future ( table 1 ) . one potential avenue to reduce the regulatory and economic barriers to the use of ipsc - derived autografts , is the development of haplobanks consisting of graft products derived from a relatively small number of individuals with specific hla types , allowing hla - matched grafts to be available for the majority of the population . it has been estimated that hla - matched grafts could be generated for almost 95% of the uk population by obtaining cell lines from 150 individuals ( taylor et al . , 2012 ) . this is an appealing prospect , but in order to keep the required number of donor cell lines to relatively low levels , mismatch of up to two hla loci must be accepted . in this circumstance , a period of immunosuppression may therefore still be necessary , nullifying the main advantage of ipsc - derived grafts over allogeneic grafts . indeed , as the intended site of these grafts ( the central nervous system ) is a relatively immunologically privileged site , long courses of immunosuppression are unlikely to be necessary , regardless of whether grafts are autologous or allogeneic . six to twelve months of standard immunotherapy has been employed in fvm grafts to date , which seems sufficient to prevent graft rejection ( barker et al . , 2015 ) supported by the survival of the aforementioned fvm graft at 24 years ( though it must be noted that this patient had received 64 months of immunosuppression ) ( li et al . , 2016 ) . similarly , ins are unlikely to offer a commercially viable alternative even if efficient protocols for producing functional dopaminergic neurons are developed . in addition to the above challenges , another disadvantage of autologous grafts is the fact that , given that pd pathogenesis is increasingly understood to involve several genetic susceptibility factors , they will retain the individual 's inherent propensity to develop recurrent pd pathology . taking these considerations into account , es cells currently present the most promising approach for a commercially viable cell - based treatment for pd , especially also given some concerns over the stability of ipsc reprogramming . although a period of immunosuppression will be necessary with this approach , this is an acceptable cost to allow development of a product that is both clinically effective and commercially viable . furthermore , as mentioned above , this course of immunosuppression is likely to be limited to a period of months , restricting the burden of adverse effects . the ability to generate a standardized product from the most efficient es cell line means that neurons can be cryogenically stored , avoiding the need to navigate the regulatory environment for each individual , as would be the case with autologous grafts ( table 1 ) . clinical trials of es cell - derived grafts will be commencing in the next few years , with the american nystem trial due to commence in 2018/2019 , and the stem - pd trial in the united kingdom and sweden likely to begin in 2019/2020 . of course , ethical objections to the use of embryonic tissue will remain a potential barrier to use in some circumstances , but taking into account logistical and economic factors , es cell - derived treatments appear to be the most likely to fulfil the criteria for widespread clinical use . development of cell - based treatments for pd has been a long process , with progress being iterative . prematurely conducted trials in the past have cast doubt over this approach , but robustly designed studies are currently ongoing or are planned , to determine whether these treatments can offer a clinically useful therapy . human fvm grafting has served as a stepping stone to stem cell - based treatments , offering important proof - of - concept data . the significant economic and logistical challenges of using autologous tissue relating to variation in the original cell sample , response to differentiation protocol , and the final product , means that es cells probably offer the greatest hope of a useful therapeutic approach , at least in the short to medium term . clinical trials in pd of midbrain dopaminergic neurons derived from es cells ( usa , united kingdom / sweden ) and from ipscs ( japan / usa ) are planned to commence in the next few years , the results of these will be crucial in determining the future direction for the field of regenerative medicine in pd .

parkinson 's disease ( pd ) is a neurodegenerative condition which causes a characteristic movement disorder secondary to loss of dopaminergic neurons in the substanitia nigra . the motor disorder responds well to dopamine - replacement therapies , though these result in significant adverse effects due to non - physiological release of dopamine in the striatum , and off - target effects . cell - based regenerative treatments offer a potential means for targeted replacement of dopamine , in a physiological manner . dopaminergic neurons for cell - based therapies can be obtained from several sources . fetal ventral mesencephalon tissue contains dopaminergic neuron progenitors , and has been transplanted into the striatum of pd patients with good results in a number of cases . however , the ethical implications and logistical challenges of using fetal tissue mean that fetal ventral mesencephalon is unlikely to be used in a widespread clinical setting . induced pluripotent stem cells can be used to generate dopaminergic neurons for transplantation , providing a source of autologous tissue for grafting . this approach means that challenges associated with allografts , such as the potential for immune rejection , can be circumvented . however , the associated cost and difficulty in producing a standardized product from different cell lines means that , at present , this approach is not commercially viable as a cell - based therapy . dopaminergic neurons derived from embryonic stem cells offer the most promising basis for a cell - based therapy for parkinson 's disease , with trials due to commence in the next few years . though there are ethical considerations to take into account when using embryonic tissue , the possibility of producing a standardized , optimized cell product means that this approach can be both effective , and commercially viable .

Introduction Strategies for Cell-Based Therapies in PD Prospects for the Clinic Conclusions

panoramic radiography is a cost - effective , low - dose method used in dental radiology for evaluating oral health status in routine dental practice.1 this technique allows examination of the maxillary and mandibular arches and their supporting structures on a single image.23 the advantages of panoramic radiography are time - saving , broad anatomic coverage , and high patient acceptability.34 abnormalities such as root fragments , impacted teeth , neoplasms , and foreign bodies are often overlooked when they do not cause symptoms or clinical signs.5 panoramic radiography is often used in routine examinations of edentulous jaws to detect asymptomatic conditions such as root fragments , retained teeth , radiolucent lesions , and foreign bodies.67 thus it is a valuable diagnostic tool in prosthetic treatment planning . in addition , they provide the clinician with information about the sinus floor position in edentulous regions for implant placement . several studies have been carried out including the occurrence rate of these asymptomatic pathologies.2467 however , only a few studies have documented the rate of these radiographic findings requiring treatment.4567 consequently , the aim of this study was to report the frequency of significant radiographic findings , to discuss utility of panoramic radiographs and to obtain the rate of the conditions which treatment is necessary before conventional or implant supported prosthetic rehabilitation in edentulous patients . this retrospective study investigated 743 patients who applied to istanbul university department of dentomaxillofacial radiology between 2009 and 2011 . a retrospective analysis was carried out of using panoramic radiographs taken either due to patient complaints or prior to prosthetic denture treatment , using a panoramic machine ( kodak 8000 digital panoramic machine , carestream health , inc . , rochester , ny , usa ) with 60 - 85 kvp and 10 ma , with total filtration of 2.5 mm aluminum . the radiographs were evaluated by four oral radiology specialists and one oral surgery specialist for impacted teeth , retained root fragments , radiolucencies , radiopacities , foreign bodies , proximity of the maxillary sinus to the crest of the residual alveolar ridge , soft tissue calcifications , and mucous retention cysts . the maxilla and mandible were divided into three areasright and left posterior ( includes bilateral premolar and molar teeth regions ) and anterior ( includes incisors and canines region)-for evaluation of root fragments and radiolucent - radiopaque areas . the maxilla was divided into two areas , left and right , for evaluation of mucous retention cysts and proximity of the maxillary sinus to the crest of the residual alveolar ridge . the patients whose subantral residual bone height is 1 - 2 mm on panoramic radiography ( precise indication for lateral maxillary sinus lift procedures ) were included in the study . soft tissue calcifications ( stc ) the area number 1 ( stc1 ) indicates possible tonsilloliths , parotid calcifications , possible tonsilloliths and parotid calcifications ; the area number 2 ( stc2 ) indicates possible submandibular calcifications and lymph node calcifications ; and area number 3 ( stc3 ) indicates possible carotid calcifications . then , two different options of prosthetic rehabilitation were planned for each subject including conventional removable prosthesis and implant supported fixed prosthesis . the patients who required surgical treatment for each treatment modality were determined based on radiographic findings . out of 743 patients , 428 ( 57.6% ) were female and 315 ( 42.4% ) were male . the mean age of the patients was 59.42 ; minimum age was 16 and maximum age was 88 . a total of 331 significant radiographic findings were detected in 256 patients . among these 256 patients , the frequency of radiographic findings and the findings which required treatment before conventional or implant supported prosthetic treatment are summarized in table 1 . seventy - four patients had proximity of the maxillary sinus to the crest of the residual alveolar ridge . the frequency of the subjects with posterior atrophic maxilla , soft tissue calcifications and mucus retention cysts are shown in table 2 . seventy - one root fragments were detected in 60 ( 8% ) of the 743 patients . of the 60 patients who had root fragments , 50 ( 83% ) had one root fragment , nine ( 15% ) had two , and only one ( 2% ) patient had three root fragments . one were ( 8% ) residual cyst , 11 ( 92% ) were idiopathic bone cavity . nine ( 82% ) radiopacities had well - defined borders and two ( 18% ) had diffuse borders . three ( 19% ) were extruded root canal materials , 13 ( 81% ) were other foreign bodies including eleven ( 69% ) retained amalgam fragments and two ( 12.5% ) gunshot fragments . the distribution of the foreign bodies , root fragments and radiopaque - radiolucent conditions are shown in table 3 . a total of 36 ( 5% ) impacted teeth were found in 27 different patients . nineteen patients ( 70% ) had only one impacted tooth , seven ( 26% ) had two impacted teeth , and one ( 4% ) had three impacted teeth . one of the most important goals of panoramic imaging is to detect any underlying pathology of both maxilla and mandible before prosthetic treatment.8 moreover , many reports have concluded that due to the high percentage of significant radiographic findings , radiographic screening should be required in all edentulous patients.67 similarly , our study showed that most of significant findings are easily detected on the panoramic radiographs of edentulous jaws . the most important limitation of this study is that the treatment planning was performed by using radiographic findings . in fact , both clinical and radiological correlation is very important to assess effective treatment planning and 3-d evaluation by using cone - beam computed tomography ( cbct ) can be necessary for specific conditions . thus , it is reported that almost all of the findings on panoramic radiographs coincide with clinical findings.9 in the present study , our observations were in accordance with this hypothesis . additionally , we did not achieve cbct views due to comprehensive treatment planning for implant placement . moreover , several clinical conditions which require surgical treatment before application of conventional removable prosthesis in edentulous patients such as epulis fissuratum or alveolar ridge disruption were excluded . bohay et al.10 reported 68.3% range of one or more significant radiographic findings in 375 edentulous patients . in addition , they determined 8.3% of these patients required treatment before treatment with removable dentures . similarly , masood et al.4 suggested a few ( 3.8% ) of the positive radiographic findings required treatment before denture fabrication . our results revealed an important part of these findings did not require surgical intervention before conventional removable prosthodontic treatment . on the other hand , a significant amount of the radiographic findings in edentulous patients require treatment before implant supported prosthetic treatment . lyman and boucher11 reported only one impacted tooth which required extraction among 300 edentulous patients . by this conclusion , they have not suggested routine panoramic examination for every edentulous patient to avoid cumulative effects of radiation exposure . however , today 's implant supported prosthetic rehabilitation becomes the most preferred treatment option for edentulous patients.13 hence , radiographic examination should be based on the concept that the edentulous patient is a candidate for implant placement . retained root fragments and impacted teeth are the most frequent significant radiographic findings in edentulous patients.4712 previous research has shown that most root fragments are localized in the molar region of the maxilla.4714 in our study , retained root fragments represented the second most frequent pathology . the majority of these root fragments were localized in the premolar - molar region of the maxilla . the reasons for this finding could be morphology and number of roots , as they were located posteriorly , where it is difficult to perform an operation . in addition , extraction of these roots poses several risks of complications , such as nerve injury ( inferior alveolar , lingual , and mental nerves ) and displacement of the roots into the maxillary sinus.1516 in particular , dental surgery in older patients carries a high risk of these complications . impacted teeth are , of course , critically important in preoperative planning for dental prostheses and implants in edentulous jaws , and they affect patients ' oral health and function.17 as such , patients with impacted teeth have a variety of complaints , such as carious lesions , dentigerous cysts , tooth eruption abnormalities , pain , and infections . stathopoulos et al.18 retrospectively investigated 7782 impacted third molars in 6182 patients and reported that the pathologic conditions related to these teeth were lower than 2.77% . sumer et al.6 reported teeth impaction in 3.1% of 676 edentulous patients . in our study , we found 36 impacted teeth , representing a frequency of 3.6% . this result may be related to elective procedures recommended for impacted teeth in edentulous patients by specialists . today , recent studies suggested an implant placement protocol encroaching upon residual roots and impacted teeth.1920 this unconventional method has been proposed to assess minimal invasive surgical procedures in implant dentistry . panoramic radiographs have been used frequently for preoperative assessments of the maxillary sinus for implant placement . these assessments include the vertical dimension of the alveolar crest to the maxillary sinus.2122 in completely edentulous patients , the upper alveolar ridge should be related to the floor of the maxillary sinus because of bone resorption . in these circumstances , panoramic radiographs simply allow an evaluation of this relation by using a lower effective dose.23 in this radiographic study , we determined that 22.4% of all radiographic findings were in relation of the floor of their maxillary sinuses with alveolar ridge . therefore , open maxillary sinus augmentation was required before implant surgery for all subjects . when maxillary sinuses are imaged , some maxillary sinus pathologies such as mucosal cysts can be detected with panoramic radiography . sinus mucosal cysts were another frequent significant finding in our study , observed in 6.3% of all patients . as the prevalence of mucous cysts in radiographic studies has been reported as 2 - 13% , our finding was in accordance with the literature.624 it has been reported that a mucus retention cyst of the maxillary sinus is not a contraindication for sinus membrane elevation.25 feng et al.26 retrospectively evaluated the survival rate of 21 endosseous implants placed into the elevated maxillary sinus area in the presence of mucus retention cysts . they reported that all of the implants were functionally stable during the 27-months follow up period . nevertheless , other maxillary sinus pathologies ( acute or chronic infections ) accompany to positive radiological findings of maxillary sinuses should be evaluated carefully for implant surgery in posterior maxillary area.27 carotid area calcifications can be detected in panoramic radiographies , and its prevalence has been reported as 3 - 5% in the general dental population . however , in a study conducted with a younger population ( with a mean age of 32 - 35 ) , the incidence was found to be very low , in a range of 0.4 - 0.8%.28 in previous studies , the frequency of radiopaque findings which might be due to the inclusion of soft tissue calcifications was reported as 9.3 - 9.9% ; thus , our findings seem relatively low by comparison.67 in our study , calcifications were detected in the area considered as tonsillolith in 23 patients ( 3.1% ) , in the submandibular area and radiopaque findings considered as lymph node calcification in 30 patients ( 4% ) , and in the carotid area in 11 patients ( 1.5% ) . these additional panoramic findings did not affect the treatment planning of implant placement or prosthetic rehabilitation . nevertheless , it seems that panoramic radiographs may include critical important findings in the head and neck region . in conclusion , to achieve successful results in prosthetic dentistry , preprosthetic - presurgical phase of treatment planning should be made carefully . it is our opinion that due to the high frequency of significant radiographic findings , panoramic radiography should be analyzed , even in the absence of clinical symptoms . within the limitation of this study , patients candidates for implant placement can more frequently require additional surgical procedures to eliminate pathological conditions of edentulous jaws .

purposethe aim of this study was to determine the frequency of significant panoramic radiographic findings and eventual treatment requirements before conventional or implant supported prosthetic treatment in asymptomatic edentulous patients.materials and methodsa total of 743 asymptomatic edentulous patients were retrospectively evaluated using a digital panoramic system . we analyzed the radiographic findings , including impacted teeth , retained root fragments , foreign bodies , severe atrophy of the posterior maxillary alveolar bone , mucous retention cysts , soft tissue calcifications and radiopaque - radiolucent conditions.resultsfour-hundred-eighty-seven ( 65.6% ) patients had no radiographic finding . a total of 331 radiographic findings were detected in 256 ( 34% ) patients . in 52.9% ( n=175 ) of these conditions , surgical treatment was required before application of implant - supported fixed prosthesis . however , before application of conventional removable prosthesis surgical treatment was required for 6% ( n=20 ) of these conditions.conclusionthe edentulous patients who will have implant placement for implant - supported fixed prosthesis can frequently require additional surgical procedures to eliminate pathological conditions .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

spinal epidural lipomatosis ( sel ) is a rare disease that is characterized by pathologic overgrowth of lumbar or thoracic epidural fat tissue . although the etiology of sel is not known , sel has been frequently diagnosed in obese patient groups and exogenous steroid administration groups , so steroid metabolism is presumed to be related with sel . excessive epidural fat deposition in the spinal canal can contribute to various neurologic symptoms , such as back pain , radiculopathy , myelopathy , claudication and even cauda equina syndrome . in this case , we present a sel patient who had taken steroid hormone medicine for 20 years , after a suprasellar tumor resection . she presented with leg weakness and radiating pain on both buttock , posterior thigh & calf for 1 year . because pain and weakness in both legs was gradually aggravated during 4 months , she could not walk or stand when she was admitted . prior to admission , she underwent an operation for a suprasellar tumor resection in our hospital when she was 14 years old . at that time , the pathologic diagnosis was pilocytic astrocytoma . after the operation , panhypopituitarism occurred , so steroid hormone replacement therapy was started in 1993 . for a period of 19 years , exogenous steroid maintenance had been administrated ( median dose of prednisolon 7.5 mg ) . the neurologic examination revealed both legs weakness ( motor grade iv / iv ) and radiating pain on the l5 and s1 dermatomes . the straight leg raising test was negative , but the bilateral knee jerk and ankle jerk were slightly hyperreflexive . a magnetic resonance imaging ( mri ) study showed severe compression of the lumbar spinal cord by epidural fat tissue . at the dorsum of the spinal cord from the l1 to l5 levels , high signal lesions on t1- and t2-weighted images were checked . the longest length from the dorsum of the spinal cord to the ligamentum flavum was 11.4 mm on the l3 level and the median length was 9.2 mm at the l1-l5 levels . the engorged epidural vessels were positioned beneath the nerve root exit site , bilaterally ( fig . 2 ) . considering the long - term exogenous steroid administration , her neurologic symptoms and mr images , we could make the diagnosis of spinal epidural lipomatosis . because she complained of radiating pain on the bilateral l5 and s1 dermatomes , she had an operation to decompress the l5 and s1 nerve roots . in the operation field , fat tissue compressed the dorsum of the thecal sac and engorged epidural vessels were found on nerve root exit sites ( fig . we removed the epidural fat tissue and coagulated the engorged epidural vessels for nerve root decompression . the radiating pain in both legs was dramatically relieved and motor power was slightly improved . after 1 month , we did a follow - up mri . on the follow - up mri , the epidural fat tissue did not compress the thecal sac and the courses of nerve roots were not interrupted . spinal epidural lipomatosisis a rare disease characterized by overgrowth of epidural fat tissue , causing compression of the spinal neural components . after the first report , subsequent reports about this disease have been published , but the pathological mechanism of sel still remains unclear16 ) . there are many case reports about sel patients who were under long - term steroid therapy for curing ulcerative colitis , asthma , sarcoidosis , rheumatoid arthritis or renal disease3,8,10,12,15 ) . al - khawaja et al.2 ) reported that sel is classified in the idiopathic group and secondary group . in this review , they studied 111 patients , and both idiopathic and secondary groups are strongly male - predominant . in the idiopathic group , lumbar segments are more involved than thoracic segments and leg pain and back pain are the most frequent symptoms . relatively , in the secondary group ( steroid administration or endocrinopathy group ) , thoracic segments are more involved than lumbar segments and myelopathy is the main symptom . the symptoms of sel are dependent on the level of spinal canal compromise2,4 ) . in reported cases , the symptoms are gradual onset and similar to degenerative spinal stenosis . and the severity of symptoms are various from painful back pain to paraplegia . the diagnostic criterion of sel is greater than 6 mm thickness of epidural fat tissue . possible differential diagnoses include encapsulated spinal lipomas , spinal stenosis , and degenerative joint disease , which can also cause spinal compression and present with similar symptoms17 ) . conservative managements such as exogenous steroid tapering and weight loss are recommended in early sel patients while patients with severe symptoms or progressive neurologic deficits are indicated for operation1,7,9,13 ) . in a study by fogel et al.7 ) , seventy - seven percent of patients of the steroid group who underwent on decompressive laminectomy had symptom improvements . but in a study by fassett et al.6 ) , the mortality rate in these patients within 1 year after surgical decompression was 22% , because of concomitant medical problems and comorbidities . consequentially , we must make a treatment plan that considers various factors , such as neurologic severity , general health , steroid therapy and lifestyle . in patients who underwent an operation for suprasellar lesions such as pituitary adenoma , suprasellar meningioma , craniopharyngioma , and so forth , we can occasionally observe complications from corticosteroid hormone deficiency ; in which case , we start corticosteroid hormone replacement therapy without worrying about the sel . in our case , we reviewed the studies showing that long - term corticosteroid replacement therapy after neurosurgery can lead to spinal epidural lipomatosis .

spinal epidural lipomatosis ( sel ) is an abnormal localized accumulation of fat tissues in the epidural space . it is strongly related with steroid administration . the symptoms of sel are various and range from back pain to paraplegia . in severe cases , decompressive laminectomy is the choice of treatment . a 32-year - old woman who had been under long - term steroid administration after suprasellar tumor resection was admitted for both leg radiating pain and weakness . she was diagnosed with sel and had a decompressive laminectomy . during the operation , we found the nerve roots were compressed by epidural fat tissues and engorged vessels . after the operation , her radiating pain was relieved and motor weakness was improved .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

increased long - term survival following effective treatment of childhood lymphomas has placed greater emphasis on residual sequelae of therapy for lymphoma and the impact of these sequelae as the cause of further morbidity and mortality . following treatment of childhood hodgkin 's disease , cardiac pathology is second only to neoplasm as the cause of death in initial survivors . as the number of cancer survivors increases , so does the number of patients exposed to therapies toxic to the heart and lung , including radiation and chemotherapeutic modalities that employ anthracyclines . the literature is replete regarding effects of anthracyclines and radiation on the heart ; however , there is still debate regarding the detection of cardiac sequelae , their significance , and the relation between different treatment modalities and the development of cardiac sequelae . we hypothesized that protocols employing anthracyclines and radiation would adversely affect long - term cardiac function and that these effects would differ between survivors who received different treatment modalities . we therefore prospectively evaluated long term cardiac function in 45 survivors of childhood lymphomas , using clinical parameters , electrocardiography , and echocardiography and compared these parameters between lymphoma subtypes . the study included survivors of histology - diagnosed childhood lymphomas who had at least 5 years of followup from termination of therapy , and who were less than 18 years of age at treatment initiation . these criteria identified 45 survivors of 108 children treated for lymphoma at the pediatric hematology and oncology department of a tertiary care center during a nineteen - year period . all participants underwent evaluation which included an interview to assess functional class ( new york heart association ) , physical examination , 12-lead electrocardiography ( ecg ) , and echocardiography . data were taken from a single assessment at the last available follow - up . statistical analysis was performed using a commercially available package ( sigmastat 5.0 jandel scientific , san rafael , california ) . comparisons between the different lymphoma subgroups were made using one way anova or the tukey correction of this test where normality failed , and where relevant by the student 's t - test or the mann - whitney rank sum test where normality failed . characteristics of the study population including treatment duration and mean follow - up duration are presented in table 1 . the bl subgroup was divided between those treated in earlier years with protocols ( comp ) that did not include anthracyclines ( 7/12 patients ) , and those that were treated more recently ( 5/12 patients ) with protocols ( lmb , nci ) containing anthracyclines . these two subgroups did not differ significantly with regard to age at diagnoses ( 6.7 3.7 ; 8.30 5.1 years , resp . , p = .52 ) or age at follow - up ( 21.2 4.2 ; 16.1 5.8 years , p = .1 ) . the mean dose of doxorubicin ( adriamycin ) , for the group as a whole was 25 mg / m per treatment , leading to a cumulative dose of 150 mg / m or a total cumulative dose of 225250 mg . all participants underwent evaluation which included an interview to assess functional class ( new york heart association ( nyha ) ) , physical examination , 12-lead ecg , and echocardiography . cardiovascular physical examination , ecg , and echocardiography were performed by 2 senior staff pediatric cardiologists ( a. lorber and y. braver ) . analyses of ecg and echocardiography images were then undertaken in a blinded manner by different investigators ( m. friedberg and i. solt ) . stroke volume was calculated by multiplying the aortic valve area , measured from the 2-dimensional echocardiographic long axis view of the internal aortic diameter at valvular level , with the velocity time integral ( vti ) of aortic flow . cardiac index ( ci ) was then calculated by multiplying this value by heart rate , and dividing the product by body surface area . mitral regurgitation was graded according to the routine clinical gradation used in the lab as none , trivial , mild , moderate or severe . normal values were defined as being within 2 standard deviations of the mean normal value : for lv ejection fraction 66 4% , and lv fractional shortening 36 4% , lv mass index 70.4 gram / m for males ( 1095 percentile 48.5103 gram / m ) and 60.7 gram / m for females ( 1095 percentile 35.681 gram / m ) . early diastolic mitral inflow velocity ( e wave ) to late diastolic mitral inflow velocity ( a wave ) ratio is 1.7 0.4 to 2.5 0.9 . cardiac dimensions were defined as being within 2 standard deviations of the normal mean for body surface area . the nyha functional class was class i in 43 patients ( 96% ) and class ii in 2 patients ( 4% ) . these 2 patients did not have other comorbidities or notable toxic effects on follow - up . no events of near - syncope , syncope , or sudden death were noted . clinical features of the cohort as a whole and of the hodgkin 's disease subgroup are shown in table 3 . the percentage of survivors with a prolonged qtc interval by lymphoma subgroup is shown in figure 1(a ) . a prolonged qtc interval was not associated with sinoatrial or atrioventricular node dysfunction - conduction anomalies . incomplete right bundle branch block was recorded in 4 patients ( 9% , all diagnoses ) ; complete right bundle branch block was recorded in 2 patients . cardiac systolic and diastolic function was normal or low - normal for the group as a whole without significant differences between the subgroups ( table 3 ) . lv mass and shortening fraction did not correlate with mantle irradiation dose , qtc interval , or length of follow - up . mean lv mass was within normal limits ( 97 40 grams / m , mean s.d . ) . lv mass was significantly higher for males as compared to females ( all subjects , 112 grams versus 76 grams , resp . ; p < .01 ) . left ventricular end diastolic internal dimensions did not increase following relatively smaller shortening fraction values . cardiac index and mass by lymphoma subgroup are presented in figures 1(b ) and 1(c ) , respectively . the percentage of survivors with mitral regurgitation by subgroup is shown in figure 1(d ) . pulmonary valve insufficiency , more than the accepted physiological norm , was found in 1 survivor of nhnb . asymptomatic small pericardial effusions were found in 3 of the 45 patients ( 7% ) . no larger effusions or pericardial thickening was noted in any of the patients . a mitral inflow pattern consistent with constrictive or restrictive physiology ( elevated e wave velocity , elevated e / a ratio , and short deceleration time ) was not noted in any of the patients . selected electrocardiographic and echocardiographic parameters for the subset of bl survivors treated with anthracyclines versus those not treated with anthracyclines are presented in table 4 . cardiac abnormalities described after treatment for childhood lymphomas can involve almost any aspect of cardiac function and include pericarditis , pericardial effusions , pericardial fibrosis , pancarditis , myocardial fibrosis with functional impairment , valvular disease , conduction defects , and coronary artery disease . although sequelae may develop at variable time intervals following treatment , emphasis is now placed on the long - term sequelae of lymphoma therapy [ 7 , 8 ] , which are caused mainly by anthracyclines and radiation . in our study population , previous study has shown that an average cumulative dose of 450 mg / m of doxorubicin causes a 23% abnormality rate in echocardiographic findings during a 7-year follow - up period and that sequelae are rare at doses under 300 mg / m [ 10 , 11 ] . our study population received an average of 150 mg / m of doxorubicin , leading to a total dose of 225250 mg , which is less than the average toxic dose . the average follow - up duration for our population was 10.9 years , which is longer than that of many other studies , with relatively few cardiac sequelae from anthracyclines . however , these patients still warrant long - term cardiac follow - up , as the risk for cardiomyopathy continues to increase over time [ 12 , 13 ] . this vigilance is further justified by previous findings that patients may develop cardiac complications from anthracyclines , even when lower doses are used . studies performed 2 to 3 decades ago identified factors that augment the cardiotoxicity of anthracyclines . these include radiation of the mediastinum [ 14 , 15 ] , previous cardiac abnormalities , including involvement of the heart by the tumor [ 16 , 17 ] , uncontrolled hypertension [ 11 , 12 ] , and exposure to other chemotherapy modalities such as cyclophosphamide , dactinomycin , mitomycin , vincristine , bleomycin and methotrexate [ 13 , 18 , 19 ] . demographic factors include young age , female sex , black race and also trisomy 21 . among these , our study population was exposed to radiation of up to 4400 cgy ( but in most instances less than this ) and to polychemotherapy , including vincristine and bleomycin , as dictated by the various treatment protocols . more recently a pathophysiological role for the tyrosine kinase receptor , erbb2 , has been implicated in cardiomyocyte susceptibility to anthracyclines . again , the total dose of doxorubicin was probably the most important factor in preventing significant cardio toxicity among our population . these findings are consistent with other studies that found that modern protocol therapies using mopp / abvd and radiation hold low risk for cardiac toxicity [ 21 , 22 ] . . suggested that cardiac status following anthracyclines is described by a pattern consistent with a thin - walled , compliant left ventricle with reduced muscle mass performing under above - normal levels of wall stress . our results are consistent with this description and show left ventricular dimensions at the lower level of normal , with good compliance . it is surprising that no statistical differences in systolic function and left ventricular mass and thickness were found between the lymphoma type subgroups , in the light of the substantial differences in therapy that these groups received . although differences in left ventricular mass between bl patients who received anthracyclines and those who did not reach statistical significance , our data may correlate with the aforementioned findings that anthracyclines reduce ventricular mass and reduce left ventricular wall thickness . however , no differences were found between the various lymphoma subgroups , among whom hd patients were exposed both to anthracyclines as well as to radiation . indeed , these patients exhibited increased cardiac output in comparison to the other lymphoma subgroups . more importantly , cardiac index was at the low range of normal , or slightly below normal , for all groups . differences between males and females were significant regarding lv mass , a factor that contributes to the greater susceptibility of females to anthracyclines , and the greater prevalence of prolonged qtc interval among females . minimal mitral insufficiency , in the absence of valve deformity , is usually of little clinical significance . . detected an increase in the prevalence of mitral regurgitation among children who had received anthracyclines , 12% ( 4 of 34 ) of whom later developed left ventricular systolic dysfunction , concluding that mitral regurgitation might be an early marker of anthracycline - related cardiac dysfunction . our findings correlate with those of previous studies , where both qt and qt dispersion were prolonged following treatment with anthracyclines [ 27 , 28 ] . a prolonged qt interval may result from myocardial cell damage but does not correlate with decreased contractile function [ 29 , 30 ] . as dysrhythmias may occur years after termination of treatment and these are potentially life - threatening , patients should be evaluated at regular followup with a 12-lead ecg [ 8 , 31 ] . although no sudden death events were observed in our population , following our findings of a prolonged q - t interval in a substantial percentage of the population , it may be suggested that a 24-hour holter - ecg recording be part of the routine follow - up of these patients . coronary artery disease has been reported after radiation therapy to the mediastinum , but not after anthracycline therapy [ 1 , 32 ] . our results did not show resting ecg changes , and there was no premature mortality among our study group on a longer follow - up period . in the light of findings from other studies , we would suggest periodic ergometry in the long - term follow - up of patients who have undergone radiation therapy . additional well - described sequelae of radiation therapy to the mediastinum are pericardial effusion and constrictive pericarditis [ 34 , 35].we did not note these pathologies to any significant degree in our study population . the use of possible cardioprotective agents such as dexrazoxane may provide additional protection against long - term cardiac sequelae of anthracyclines , especially in girls [ 36 , 37 ] . these agents were not used in our study , and we can not comment further on their effects . . we did not compare the study group with a control group , as our primary objective was definition of cardiac status among survivors . however , we used well - established norms that are commonly and widely used as the basis for this definition . further comparisons between the different lymphoma subgroups , provided a comparative basis for the different treatment modalities , and specific comparison between burkitt lymphoma survivors who had been exposed to anthracyclines and those who had not strengthened this comparison . echocardiographic parameters such as ejection fraction and fractional shortening are limited by load dependency and constitute basic indicators of global ventricular function . although other echocardiographic methods are available for assessment of cardiac function , each has its specific limitations and in daily clinical practice many oncologists are more familiar with the traditional parameters used in this study . this study focused on long - term follow - up with data collected at the last available assessment , and we did not collect data on acute or subacute toxicity.in summary , in this cohort , relatively few long - term cardiac complications were seen in most patients following low - dose anthracycline therapy used in modern treatment protocols for childhood lymphoma . however , anthracycline cardio toxicity has previously been well established and in the current study , abnormalities were found in mitral valve regurgitation abnormalities , qt prolongation , low - normal cardiac index , and in 2 survivors functional capacity reduction leading to a compromised quality of life . these findings necessitate comprehensive and long - term cardiac follow - up of these patients . the study group is relatively small and the number of patients in subgroups is small . we did not compare the study group with a control group , as our primary objective was definition of cardiac status among survivors . however , we used well - established norms that are commonly and widely used as the basis for this definition . further comparisons between the different lymphoma subgroups , provided a comparative basis for the different treatment modalities , and specific comparison between burkitt lymphoma survivors who had been exposed to anthracyclines and those who had not strengthened this comparison . echocardiographic parameters such as ejection fraction and fractional shortening are limited by load dependency and constitute basic indicators of global ventricular function . although other echocardiographic methods are available for assessment of cardiac function , each has its specific limitations and in daily clinical practice many oncologists are more familiar with the traditional parameters used in this study . this study focused on long - term follow - up with data collected at the last available assessment , and we did not collect data on acute or subacute toxicity . in summary , in this cohort , relatively few long - term cardiac complications were seen in most patients following low - dose anthracycline therapy used in modern treatment protocols for childhood lymphoma . however , anthracycline cardio toxicity has previously been well established and in the current study , abnormalities were found in mitral valve regurgitation abnormalities , qt prolongation , low - normal cardiac index , and in 2 survivors functional capacity reduction leading to a compromised quality of life . these findings necessitate comprehensive and long - term cardiac follow - up of these patients .

objectives . we studied long - term effects of therapy for childhood lymphoma on cardiac function . design and patients . we prospectively evaluated 45 survivors of childhood lymphoma , using clinical parameters , electrocardiography and echocardiography . further comparisons were made between lymphoma subgroups and between males and females . results . mean age at diagnosis was 9.1 years . mean followup duration was 10.9 years . the nyha functional class was i in 43 patients and ii in 2 patients . a prolonged qtc interval ( > 0.44 msec ) was found in 8 patients . left ventricular ( lv ) systolic function and compliance were normal ( lv shortening fraction 40 5.6% ; cardiac index 2.84 1.13 l / min / m2 ; e / a wave ratio 2.5 1.3 ; mean s.d . ) , lv mass was normal ( 97 40 grams / m2 , mean s.d . ) . mitral regurgitation was observed in 7/45 patients ( 16% ) . asymptomatic pericardial effusions were found in 3/45 ( 7% ) patients . conclusions . long - term follow - up shows that most parameters of cardiac function are normal in survivors of childhood lymphoma . this is likely due to relatively low doses of anthracyclines in modern protocol modalities . abnormalities in mitral valve flow , qtc prolongation and in a small proportion of survivors , and functional capacity necessitate long - term cardiac follow - up of these patients .

1. Introduction 2. Patients and Methods 3. Results 4. Discussion