Datasets:

ronitHF

/

pubmed-10k-8.1.1

like 0

cancer vaccine targeting hepatocellular carcinoma ( hcc ) tumor antigens have been tested in clinical trials . however , cancer vaccines using tumor - antigen - derived peptides have not demonstrated adequate antitumor efficacy in clinical trials for advanced hcc . glypican-3 ( gpc3 ) , a carcinoembryonic antigen , is an ideal target for immunotherapy against hcc because it is overexpressed specifically in hcc ( 7281% ) and correlates with a poor prognosis . gpc3 forms a complex with wnt molecules and promotes the growth of hcc by stimulating canonical wnt signaling . we identified hla - a*24:02-restricted gpc3298306 ( eyilsleel ) and hla - a*02:01-restricted gpc3144 - 152 ( fvgefftdv ) peptides , both of which induce gpc3-reactive cytotoxic t - lymphocytes ( ctls ) without inducing autoimmunity . we recently reported the safety , immunological , and clinical responses of a gpc3-derived peptide vaccine in a phase i clinical trial of patients with advanced hcc . the results of that trial showed that gpc3 peptide - specific ctls increased in peripheral blood , and that many cd8-positive t cells infiltrated the tumors in some patients , demonstrating a correlation between the ctl response and overall survival following gpc3 peptide vaccination . based on these results , we conducted a trial in patients with advanced hcc to assess the clinical outcome and whether tumor - infiltrating lymphocytes with an antitumor effect increased . in all cases , liver biopsies were performed before and after gpc3 peptide vaccination according to the protocol . this trial was approved by the ethics committee of the national cancer center and registered with the university hospital medical information network clinical trials registry ( umin - ctr number 000005093 ) . the patient described herein was the first case examined pathologically using autopsy specimens . here , we present the clinical course and pathological study , including an autopsy , of a patient with advanced hcc who revealed remarkable tumor lysis immediately after the second vaccination in an ongoing clinical trial of a gpc3 peptide vaccine . a 62-year - old male had a history of asymptomatic chronic hepatitis c. in september 2009 , he was diagnosed with hcc . abdominal ct ( ct ) scans showed four lesions in the liver , and the patient was treated four times with hepatic artery chemoembolization . in december 2010 , ct scans revealed a new lesion indicative of a tumor thrombus extending into the inferior vena cava . . however , the sorafenib treatment was discontinued in january 2011 due to progressive multiple intrahepatic tumors . as no established therapeutic regimens exist for this condition , he was offered participation in a clinical trial of a gpc3 peptide vaccine for advanced hcc . the patient had a performance status of 0 , and child - pugh class b disease . the patient did not have active hbv infection or rapidly progressive tumor thrombus before enrollment , met the eligibility criteria , and was enrolled after providing informed consent . early - phase contrast - enhanced ct before treatment showed a maximum 68 51-mm tumor with multiple intrahepatic tumors and a 44 30-mm tumor invading the right atrium ( fig . pretreatment tumor markers were as follows : fetoprotein ( afp ) , 852 ng / ml and des - gamma - carboxy prothrombin ( dcp ) , 1346 mau / ml . a liver biopsy was performed 1 week prior to gpc3 peptide vaccination according to the protocol . in april 2011 , 3 mg of hla - a2-restricted gpc3144 - 152 peptide ( fvgefftdv ) ( american peptide co. ) emulsified with incomplete freund s adjuvant ( montanide isa-51vg ; seppic ) was injected intradermally as the vaccine following good manufacturing practice guidelines . the patient had a low - grade fever on day 6 following the first vaccination , and inflammatory and hepatic parameters were elevated on day 12 ( fig . therefore , he received the second vaccination on day 26 after the first vaccination . on day 9 after the second vaccination , the patient was admitted to our hospital with a high fever and general fatigue . on admission , the patient s c - reactive protein ( crp ) level ( 10.76 mg / dl ) and laboratory hepatic parameters were elevated . one day after hospitalization , aspartate aminotransferase and alanine aminotransferase and levels were elevated to 1,580 as seen by early - phase contrast - enhanced ct scan , most tumors in the liver were not contrast enhanced . in contrast , the size of the tumor thrombus in the right atrium increased to a maximum of 83 50 mm ( fig . levels of the tumor markers afp and dcp decreased temporarily to 634 ng / ml and 777 mau / ml , respectively . he was infused with a liver - supporting agent ( monoammonium glycyrrhizinate , glycine , and l - cysteine hydrochloride hydrate ) . we did not perform a liver biopsy when the hepatic parameters were elevated because they improved promptly . protocol treatment was discontinued due to progressive disease and he died 30 days after the second vaccination . based on the clinical course , we could not rule out the possibility that his condition had worsened as a result of the vaccine . therefore , an autopsy was performed to determine the main cause of death and the elevated hepatic parameters , and to evaluate the anti - tumor effect of vaccination figure 1 . ( a ) contrast - enhanced ct scan before vaccination shows a 68 51-mm tumor with multiple intrahepatic tumors ( arrow ) and a 44 30-mm tumor invading the right atrium ( arrowhead ) . ( b ) contrast - enhanced ct after the second vaccination showing multiple low - density areas in the liver , indicating extensive tumor necrosis ( arrow ) . by contrast , a tumor thrombus in the right atrium increased to a 83 50-mm tumor ( arrowhead ) . approximately 1 week after the first vaccination , the patient began reporting general fatigue and showed intermittent fever . inflammatory and hepatic parameters were elevated ( crp : pink line , ast : red line , t - bil : green line ) . the abnormal laboratory parameters improved after observation . on day 9 after the second vaccination , the patient was admitted to our hospital as an emergency due to fever and general fatigue , which were similar to his previous symptoms . inflammatory and hepatic parameters improved 1 week after hospitalization . however , his status gradually worsened , and he died on day 30 after the second vaccination . ex vivo ifn- enzyme - linked immunospot ( elispot ) assays against gpc3 in 5 10 peripheral blood mononuclear cells ( pbmcs ) were performed before and after vaccination . the spot number indicates the number of gpc3 peptide - specific cytotoxic t - lymphocytes ( ctls ) . the number of interferon ( ifn)- positive spots increased from 0 to 84 after the second vaccination . a 62-year - old male had a history of asymptomatic chronic hepatitis c. in september 2009 , he was diagnosed with hcc . abdominal ct ( ct ) scans showed four lesions in the liver , and the patient was treated four times with hepatic artery chemoembolization . in december 2010 , ct scans revealed a new lesion indicative of a tumor thrombus extending into the inferior vena cava . . however , the sorafenib treatment was discontinued in january 2011 due to progressive multiple intrahepatic tumors . as no established therapeutic regimens exist for this condition , he was offered participation in a clinical trial of a gpc3 peptide vaccine for advanced hcc . the patient had a performance status of 0 , and child - pugh class b disease . the patient did not have active hbv infection or rapidly progressive tumor thrombus before enrollment , met the eligibility criteria , and was enrolled after providing informed consent . early - phase contrast - enhanced ct before treatment showed a maximum 68 51-mm tumor with multiple intrahepatic tumors and a 44 30-mm tumor invading the right atrium ( fig . pretreatment tumor markers were as follows : fetoprotein ( afp ) , 852 ng / ml and des - gamma - carboxy prothrombin ( dcp ) , 1346 mau / ml . a liver biopsy was performed 1 week prior to gpc3 peptide vaccination according to the protocol . in april 2011 , 3 mg of hla - a2-restricted gpc3144 - 152 peptide ( fvgefftdv ) ( american peptide co. ) emulsified with incomplete freund s adjuvant ( montanide isa-51vg ; seppic ) was injected intradermally as the vaccine following good manufacturing practice guidelines . the patient had a low - grade fever on day 6 following the first vaccination , and inflammatory and hepatic parameters were elevated on day 12 ( fig . therefore , he received the second vaccination on day 26 after the first vaccination . on day 9 after the second vaccination , the patient was admitted to our hospital with a high fever and general fatigue . on admission , the patient s c - reactive protein ( crp ) level ( 10.76 mg / dl ) and laboratory hepatic parameters were elevated . one day after hospitalization , aspartate aminotransferase and alanine aminotransferase and levels were elevated to 1,580 iu / l and 1,112 as seen by early - phase contrast - enhanced ct scan , most tumors in the liver were not contrast enhanced . in contrast , the size of the tumor thrombus in the right atrium increased to a maximum of 83 50 mm ( fig . levels of the tumor markers afp and dcp decreased temporarily to 634 ng / ml and 777 mau / ml , respectively . he was infused with a liver - supporting agent ( monoammonium glycyrrhizinate , glycine , and l - cysteine hydrochloride hydrate ) . we did not perform a liver biopsy when the hepatic parameters were elevated because they improved promptly . protocol treatment was discontinued due to progressive disease and he died 30 days after the second vaccination . based on the clinical course , we could not rule out the possibility that his condition had worsened as a result of the vaccine . therefore , an autopsy was performed to determine the main cause of death and the elevated hepatic parameters , and to evaluate the anti - tumor effect of vaccination figure 1 . ( a ) contrast - enhanced ct scan before vaccination shows a 68 51-mm tumor with multiple intrahepatic tumors ( arrow ) and a 44 30-mm tumor invading the right atrium ( arrowhead ) . ( b ) contrast - enhanced ct after the second vaccination showing multiple low - density areas in the liver , indicating extensive tumor necrosis ( arrow ) . by contrast , a tumor thrombus in the right atrium increased to a 83 50-mm tumor ( arrowhead ) . approximately 1 week after the first vaccination , the patient began reporting general fatigue and showed intermittent fever . inflammatory and hepatic parameters were elevated ( crp : pink line , ast : red line , t - bil : green line ) . the abnormal laboratory parameters improved after observation . on day 9 after the second vaccination , the patient was admitted to our hospital as an emergency due to fever and general fatigue , which were similar to his previous symptoms . however , his status gradually worsened , and he died on day 30 after the second vaccination . ex vivo ifn- enzyme - linked immunospot ( elispot ) assays against gpc3 in 5 10 peripheral blood mononuclear cells ( pbmcs ) were performed before and after vaccination . the spot number indicates the number of gpc3 peptide - specific cytotoxic t - lymphocytes ( ctls ) . the number of interferon ( ifn)- positive spots increased from 0 to 84 after the second vaccination . generally , ctls specific for tumor antigens can not be detected directly ex vivo ; they can be detected only after expansion by repeated in vitro stimulation with the antigenic peptide in conjunction with appropriate antigen - presenting cells . this is attributed to the sensitivity of the assay and the low frequency of tumor - antigen - specific ctls . gpc3 peptide - specific ctls in pbmcs , which can be detected directly ex vivo without in vitro stimulation , can provide strong immunological evidence . the number of gpc3 peptide - specific ctls increased from 0 to 84 in 5 10 pbmcs after the second vaccination ( fig . this result led us to anticipate a good clinical response because the increased number of ctls and the specific ctl number correlated with the clinical response in a previous trial of the gpc3 peptide vaccine . immunohistochemical staining showed expression of gpc3 and hla class i in the cytoplasm and membranes of the carcinoma cells and a few cd8-positive t cells in the carcinoma tissue before vaccination ( fig . ( a ) pathological findings of liver biopsy specimens before vaccination . a microscopy image of a hematoxylin and eosin ( h&e)-stained section shows well - differentiated hepatocellular carcinoma ( hcc ) . immunohistochemical staining for gpc3 and hla class i showed positivity in the cytoplasm and membranes of carcinoma cells , respectively . ( b ) macroscopic findings of the liver and heart before formalin fixation at the time of autopsy . ( a ) microscopic images of h&e - stained sections showing central necrosis of carcinoma tissue , whereas a cirrhotic nodule adjacent to the carcinoma tissue was not necrotic . ( b ) magnified image of the area enclosed within the white box in ( a ) showing that cancer cells exhibited a morphology ( left ) different from that of cirrhotic cells ( right ) . ( c ) cd8-positive t cells ( brown ) infiltrated the carcinoma cells accompanied by necrosis . in contrast , no infiltration of cd8-positive t cells was detected within the cirrhotic nodule . ( d ) magnified image of the area enclosed within the red box in ( a ) showing necrosis and viable carcinoma cells . ( e ) positive immunohistochemical gpc3 staining was observed in only the cytoplasm of carcinoma cells . ( f ) cd8-positive t cells infiltrated the necrotic area and carcinoma tissue . a general autopsy ( with the exception of the brain ) was performed 2 h following death . macroscopic findings of the liver revealed multiple macro - nodular lesions with central necrosis mainly in the right lobe ( fig . as the tumor occupied most of the right atrium , the main cause of death was circulatory failure due to progressive tumor thrombus ( fig . 2b , right ) . a histological examination showed central necrosis in most of the tumor in the right lobe , and viable carcinoma cells remained around the necrotic tissue , whereas a cirrhotic nodule adjacent to the carcinoma tissue was not necrotic ( figs . 2c and 3a ) . there was infiltration of cd8-positive t cells ( brown ) in the residual carcinoma , but not within the cirrhotic area ( figs . 2c and 3a ) . we did not detect degeneration or necrosis of the hepatocytes in the non - tumor liver parenchyma of the left lobe . these findings suggest that the elevated hepatic parameters in our patient were due to an antitumor effect . we diagnosed that the cause of death was unlikely to be related to vaccine - induced liver injury . we focused on the necrotic area around the cirrhotic nodules , in which cd68-positive macrophages ( brown ) aggregated ( fig . cd8-positive t cells also infiltrated the marginal zone between the necrotic area and noncancerous cirrhotic nodule , suggesting that carcinoma cells were attacked by cd8-positive t cells , which may have resulted in necrosis ( fig . the histology of the tumor thrombus in the right atrium was similar to that of the intrahepatic tumor . however , viable tumor cells remained in half of the tumor thrombus and little infiltration of cd8-positive t cells was detected ( data not shown ) . cd8-positive t cells ( brown ) infiltrated only the carcinoma area , accompanied by necrosis . ( c ) cd68-positive macrophages ( brown ) aggregated in the necrotic area around the cirrhotic nodule . ( d ) cd8-positive t cells ( brown ) infiltrated the necrotic area but not the cirrhotic nodule . based on the image in ( d ) , most of the lymphocytes were cd8-positive t cells . generally , ctls specific for tumor antigens can not be detected directly ex vivo ; they can be detected only after expansion by repeated in vitro stimulation with the antigenic peptide in conjunction with appropriate antigen - presenting cells . this is attributed to the sensitivity of the assay and the low frequency of tumor - antigen - specific ctls . gpc3 peptide - specific ctls in pbmcs , which can be detected directly ex vivo without in vitro stimulation , can provide strong immunological evidence . the number of gpc3 peptide - specific ctls increased from 0 to 84 in 5 10 pbmcs after the second vaccination ( fig . this result led us to anticipate a good clinical response because the increased number of ctls and the specific ctl number correlated with the clinical response in a previous trial of the gpc3 peptide vaccine . immunohistochemical staining showed expression of gpc3 and hla class i in the cytoplasm and membranes of the carcinoma cells and a few cd8-positive t cells in the carcinoma tissue before vaccination ( fig . ( a ) pathological findings of liver biopsy specimens before vaccination . a microscopy image of a hematoxylin and eosin ( h&e)-stained section shows well - differentiated hepatocellular carcinoma ( hcc ) . immunohistochemical staining for gpc3 and hla class i showed positivity in the cytoplasm and membranes of carcinoma cells , respectively . ( b ) macroscopic findings of the liver and heart before formalin fixation at the time of autopsy . ( a ) microscopic images of h&e - stained sections showing central necrosis of carcinoma tissue , whereas a cirrhotic nodule adjacent to the carcinoma tissue was not necrotic . ( b ) magnified image of the area enclosed within the white box in ( a ) showing that cancer cells exhibited a morphology ( left ) different from that of cirrhotic cells ( right ) . ( c ) cd8-positive t cells ( brown ) infiltrated the carcinoma cells accompanied by necrosis . in contrast , no infiltration of cd8-positive t cells was detected within the cirrhotic nodule . ( d ) magnified image of the area enclosed within the red box in ( a ) showing necrosis and viable carcinoma cells . ( e ) positive immunohistochemical gpc3 staining was observed in only the cytoplasm of carcinoma cells . ( f ) cd8-positive t cells infiltrated the necrotic area and carcinoma tissue . a general autopsy ( with the exception of the brain ) was performed 2 h following death . macroscopic findings of the liver revealed multiple macro - nodular lesions with central necrosis mainly in the right lobe ( fig . as the tumor occupied most of the right atrium , the main cause of death was circulatory failure due to progressive tumor thrombus ( fig . 2b , right ) . a histological examination showed central necrosis in most of the tumor in the right lobe , and viable carcinoma cells remained around the necrotic tissue , whereas a cirrhotic nodule adjacent to the carcinoma tissue was not necrotic ( figs . 2c and 3a ) . there was infiltration of cd8-positive t cells ( brown ) in the residual carcinoma , but not within the cirrhotic area ( figs . 2c and 3a ) . we did not detect degeneration or necrosis of the hepatocytes in the non - tumor liver parenchyma of the left lobe . these findings suggest that the elevated hepatic parameters in our patient were due to an antitumor effect . we diagnosed that the cause of death was unlikely to be related to vaccine - induced liver injury . we focused on the necrotic area around the cirrhotic nodules , in which cd68-positive macrophages ( brown ) aggregated ( fig . cd8-positive t cells also infiltrated the marginal zone between the necrotic area and noncancerous cirrhotic nodule , suggesting that carcinoma cells were attacked by cd8-positive t cells , which may have resulted in necrosis ( fig . the histology of the tumor thrombus in the right atrium was similar to that of the intrahepatic tumor . however , viable tumor cells remained in half of the tumor thrombus and little infiltration of cd8-positive t cells was detected ( data not shown ) . cd8-positive t cells ( brown ) infiltrated only the carcinoma area , accompanied by necrosis . ( c ) cd68-positive macrophages ( brown ) aggregated in the necrotic area around the cirrhotic nodule . ( d ) cd8-positive t cells ( brown ) infiltrated the necrotic area but not the cirrhotic nodule . based on the image in ( d ) , most of the lymphocytes were cd8-positive t cells . to date , the time to ctl induction and subsequent tumor response has been prolonged in cancer vaccine trials . by contrast , no discrepancy regarding the time between ctl induction and tumor response was observed in our phase i trial of a gpc3 peptide vaccine . in this case , central necrosis of each intra - hepatic tumor was observed at the time of a strong immunological response against the gpc3 peptide , immediately after the second vaccination . a biopsy may be necessary to rule out vaccine - induced liver injury when the hepatic parameters are elevated . however , the clinical course and autopsy results suggested that the elevated hepatic parameters in our patient were due to an antitumor effect . therefore , a positive radiographic response following vaccination , suggesting tumor necrosis , could be evaluated as a treatment response . necrosis was found in the center of each tumor ; therefore , the central necrosis caused by ischemia , in addition to cd8-positive t cells attacking tumor cells , may have led to tumor necrosis . three findings support the hypothesis that tumor necrosis was caused by cd8-positive t cells , as follows : ( 1 ) the necrotic changes determined by ct after vaccination , accompanied by clinical laboratory data ; this was consistent with an immune response , although no tumor necrosis was evident on the ct before vaccination ; ( 2 ) no necrosis was evident in the left lobe ( no tumors ) of the autopsy liver specimen , but it was present in the right liver lobe ( tumors present ) ; and ( 3 ) cd8-positive t cells infiltrated residual viable tumor cells . the analyses used in this study may contribute to identifying the pathological state after vaccination . we detected infiltration of cd8-positive t cells into the hepatic tumors , but little infiltration of cd8-positive t cells into the tumor thrombus . this discrepancy may have been caused by the heterogeneity associated with immune - escape mechanisms in tumor cells . this case report of central necrosis in a patient with hcc might be regarded as spontaneous regression correlated with circulatory failure due to a massive tumor embolism . it was not known whether the tumor necrosis was induced by ctls , ischemia , or other factors . however , the infiltration of cd8-positive t cells into tumor cells supports immune - related necrosis . the rate of spontaneous partial regression among patients with hcc is 0.406% compared with the control arm of a randomized clinical trial . in contrast , three of 33 patients who received gpc3 peptide vaccination in the phase i trial had suspicious tumor necrosis on ct scans . in one report , massive infiltration of cd8-positive t cells in the remaining liver tumor and tumor necrosis were identified by histological examination of a biopsy specimen after vaccination . indeed , on - going clinical trials of the gpc3 peptide vaccine will provide additional information and further demonstrate the antitumor effect . histological results at the estimated time of a strong gpc3-specific ctl response suggest that gpc3 peptide vaccination may be a promising approach to treat hcc . an ex vivo ifn- enzyme - linked immunospot ( elispot ) assay was performed to evaluate the antigen - specific ctl response , as described previously . briefly , peripheral blood ( 30 ml ) was obtained from the patient before the first vaccination and 2 weeks after each vaccination and centrifuged on a ficoll non - cultured peripheral blood mononuclear cells ( pbmcs ) ( 5 10/well ) were added to plates in the presence of 10 g / ml peptide antigens and incubated for 20 h. the gpc3 antigen used was the hla - a2-restricted gpc3144152(fvgefftdv ) peptide . pbmcs with the hla - a2-restricted hiv1927 ( tlnawvkvv ) peptide ( proimmune ) were used as negative controls . immunohistochemical staining with monoclonal antibodies against gpc3 ( clone , 1g12 ; biomosaics ) , hla class i ( clone , emr8/5 ; hokudo ) , cd8 ( clone , 1a5 ; novocastra ) , cd45 ( cloned 2b11 and pd7/26 ; ventana ) , and cd68 ( clone , kp-1 ; ventana ) was performed according to the manufacturer s protocol . an ex vivo ifn- enzyme - linked immunospot ( elispot ) assay was performed to evaluate the antigen - specific ctl response , as described previously . briefly , peripheral blood ( 30 ml ) was obtained from the patient before the first vaccination and 2 weeks after each vaccination and centrifuged on a ficoll non - cultured peripheral blood mononuclear cells ( pbmcs ) ( 5 10/well ) were added to plates in the presence of 10 g / ml peptide antigens and incubated for 20 h. the gpc3 antigen used was the hla - a2-restricted gpc3144152(fvgefftdv ) peptide . pbmcs with the hla - a2-restricted hiv1927 ( tlnawvkvv ) peptide ( proimmune ) were used as negative controls . immunohistochemical staining with monoclonal antibodies against gpc3 ( clone , 1g12 ; biomosaics ) , hla class i ( clone , emr8/5 ; hokudo ) , cd8 ( clone , 1a5 ; novocastra ) , cd45 ( cloned 2b11 and pd7/26 ; ventana ) , and cd68 ( clone , kp-1 ; ventana ) was performed according to the manufacturer s protocol .

we recently reported the safety , immunological and clinical responses to a gpc3-derived peptide vaccine in a phase i clinical trial of patients with advanced hepatocellular carcinoma ( hcc ) . we conducted a subsequent trial in advanced hcc to assess the histopathological findings before and after vaccination with the gpc3 peptide . here , we present the clinical course and the pathological study including the autopsy of a patient with advanced hcc in the ongoing clinical trial . a 62-year old patient suffering from hcc refractory to sorafenib therapy received the gpc3 peptide vaccine . the patient had fever and remarkably impaired liver function twice after vaccination . contrast - enhanced ct after the second vaccination showed multiple low - density areas in the liver tumor , indicating tumor necrosis . in contrast , the tumor thrombus in the right atrium increased . the patient discontinued protocol treatment due to disease progression and died 30 days after the second vaccination . an autopsy was performed to determine the main cause of death and to evaluate the antitumor effect of the vaccination . a histological examination showed central necrosis in most of the intrahepatic tumor . the main cause of death was circulatory failure due to tumor thrombus , which occupied most of the right atrium . an immunohistochemical analysis revealed infiltration of cd8-positive t cells in the residual carcinoma , but not within the cirrhotic area . ex vivo ifn- enzyme - linked immunospot analysis revealed vaccine - induced immune - reactivity against the gpc3 peptide . a histopathological examination at the estimated time of a strong immunological response demonstrated a gpc3 peptide vaccination - induced cytotoxic t - lymphocyte response with an anti - tumor effect .

Introduction Patient presentation Results Immunological analysis and autopsy Discussion Materials and Methods Ex vivo interferon- (IFN-) enzyme-linked immunospot assay Immunohistochemical analysis

research into the use of cell therapy for cardiac regeneration has undergone explosive growth over the prior two decades in both pre - clinical models of infarct healing and in numerous clinical trials . while early studies sought to replace damaged myocardium with implantation of autologous satellite cells ( for a fascinating review of early cardiac regeneration research see yoon et al . ) , a variety of stem cells with differing origins and levels of pluripotency have been proposed and tested in recent years [ 2 , 3 ] . overwhelmingly , most studies have demonstrated a transient improvement in global cardiac function following cell implantation or homing . however , the fraction of cells that survive to later time points is typically below 1 % . the processes underlying the high rates of death amongst injected cells , and potential mechanisms by which to promote increased cell survival and differentiation remain poorly understood . a major barrier to elucidating these processes is the inability to serially examine cell fate decisions following implantation in a non - invasive and in vivo manner [ 57 ] . magnetic resonance imaging ( mri ) has become a reference standard modality for non - invasive imaging of soft tissue with superior contrast . when applied to imaging of the heart , cardiac mri ( cmr ) is emerging as a cutting edge modality capable of enabling multi - scale characterization of the heart from the cellular to the whole organ level [ 8 , 9 ] . significant effort has been invested over the past decade in the field of mri cell tracking , in particular following the labeling of cells with either t1 or t2 shortening contrast agents . however , results of such studies have been mixed , indicating that cell labeling provides inconsistent assessment of cell survival . recent advances in mr reporter gene technology have enabled in vivo imaging of cell survival , migration , and differentiation primarily in stationary organs and tumors ( for a full review see ref ) . application of mr reporter gene imaging to the heart could transform cardiac regeneration research by enabling direct correlation of injected cell survival with important therapeutic outcomes such as restoration of contractile function and perfusion . paradoxically , studies of cell based cardiac regeneration therapy now number in the thousands , yet studies utilizing mr reporter gene imaging of cell survival following intramyocardial transplantation number in the single digits ( fig . research into the field of cardiac regeneration with cell therapy has undergone explosive growth since 1990 as evidenced by the large number of publications ( blue columns ) . an emerging consensus view considers in vivo imaging of cell fate decisions as a key tool for improving future therapeutic strategies . mri cell tracking following cell labeling with exogenous contrast agents ( red columns ) has emerged over the prior decade as a potential method by which to monitor the survival and viability of injected cells . more recently , the use of mri reporter genes ( green columns ) has been explored for in vivo imaging of cell survival , proliferation , and differentiation . in the context of mr reporter gene cell tracking in the heart , only four studies have to date been published on imaging the survival of reporter gene expressing cells following intramyocardial injection suever plot of relevant publications . research into the field of cardiac regeneration with cell therapy has undergone explosive growth since 1990 as evidenced by the large number of publications ( blue columns ) . an emerging consensus view considers in vivo imaging of cell fate decisions as a key tool for improving future therapeutic strategies . mri cell tracking following cell labeling with exogenous contrast agents ( red columns ) has emerged over the prior decade as a potential method by which to monitor the survival and viability of injected cells . more recently , the use of mri reporter genes ( green columns ) has been explored for in vivo imaging of cell survival , proliferation , and differentiation . in the context of mr reporter gene cell tracking in the heart , only four studies have to date been published on imaging the survival of reporter gene expressing cells following intramyocardial injection in this review we seek to discuss existing methods for mri cell tracking and the results of early studies of mr reporter gene cell tracking in the heart . given the small number of studies performed to date , each study is discussed in detail in order to highlight the important contributions made to the nascent field , and further questions that have arisen as a result of such studies . finally , we will discuss how important findings from mr reporter gene studies in stationary organs and tumors can potentially lead to more dynamic cmr reporter gene imaging . mri cell tracking has historically relied upon labeling of cells with chemical agents that generate contrast via modulation of either t1 ( bright contrast ) or t2 ( dark contrast ) relaxation times , or through selective excitation and transfer of saturated magnetization ( false color contrast ) . for example , labeling of fibroblasts with gadolinium - dtpa , a t1-shortening contrast agent , has been used to track the recruitment of fibroblasts to ovarian carcinoma tumors , and to track macrophage migration to the forming scar after myocardial infarction in the mouse heart . the recruitment of gadolinium labeled cells can either be visualized as positive contrast on heavily t1-weighted images , or can be measured by quantifying changes in tissue t1-relaxation times between areas with and without labeled cells . a more widely used cell labeling technique has involved the use of a large variety of iron oxide nanoparticles with a range of sizes and relaxivities . once internalized , iron oxide nanoparticles de - phase the surrounding magnetic field , leading to significantly shortened t2 relaxation times in the vicinity of labeled cells . labeled cells can then be easily tracked as signal voids on t2 * weighted images , or more quantitatively as areas of reduced t2-relaxation on t2-maps . while detection of cells labeled with t1 or t2 shortening contrast agents can be accomplished using conventional pulse sequences , the use of such agents , and in particular t2 shortening agents , can fundamentally limit the ability to image underlying anatomy or to combine cell tracking with additional measures of contractile function and perfusion . in addition concerns of asymmetric distribution of label in dividing cells , eventual dilution of the cell label , altered cell function following labeling , and in the case of iron oxide nanoparticles retention of label in damaged tissue long after the death of labeled cells [ 16 , 17 ] , all remain significant barriers to mri cell tracking with conventional contrast agents . an alternative cell labeling strategy that has recently emerged is to label cells with a class of contrast agents that selectively generate contrast through a process termed chemical exchange saturation transfer ( cest ) [ 1820 ] . following rf irradiation at a given cest agent s resonant frequency , the exchange of saturated magnetization with surrounding bulk water leads to a reduction of the on - resonance water signal . in juxtaposition to conventional t1/t2 shortening contrast agents , the contrast generated by cest agents can be selectively turned on . as a result , multiple cell populations that are labeled with distinct cest agents can be visualized in a multi - spectral manner , as was recently performed by ferrauto et al . . since the contrast from such labeling approaches does not fundamentally disturb the underlying anatomical integrity , cest - mri could be combined with additional measures of cardiac structure and function . mri reporter genes can uniquely overcome several of the barriers to conventional cell labeling strategies . first , when initiated with proper genetic reprogramming , mr reporter gene expression will remain constant across successive cell divisions . second , since transcription of the reporter gene occurs immediately after division , asymmetric division of an exogenous cell label is removed as a limiting factor to cell tracking . finally , since production of the mr reporter gene product ceases upon cell death , the likelihood of detecting a false positive signal after cell death is significantly reduced . while such characteristics are highly favorable , it is important to note that many of the first generation of mr reporter genes typically demonstrate lower sensitivity when compared to conventional cell labeling strategies . a large number of mr reporter gene strategies , each employing a different reporter mechanism , have been proposed and tested over the past decade ( for a full review see ref ) . overwhelmingly , three unique strategies have emerged and characterize the majority of mr reporter gene research ( fig . 2 ) . in the first strategy , over - expression of iron regulatory elements such as ferritin and/or the transferrin receptor act to increase cellular iron content , thereby shortening t2 relaxation times and enabling detection of reporter gene expressing cells on t2/t2 * weighted images . this strategy has been used to examine migration of reporter gene expressing cells in the brain [ 21 , 22 ] , the recruitment of reporter gene expressing cells to tumors , the proliferation of cancer cells , and differentiation of endothelial cells in the growing mouse embryo . the second broad strategy that has been pursued utilizes the expression of artificial plasma - membrane peptides or antigens as reporters ( for a full review see ref ) , with subsequent targeting using either t1 or t2 modulating contrast agents ( fig . 2 ) . finally , the third major strategy has been to mimic the prior strategies with mechanisms that selectively generate cest contrast through either constitutive expression of cest reporter genes , or through expression of transgenic kinases for targeted cest contrast agents . these strategies have largely been used to image cancer cell survival and proliferation following implantation in the rodent brain . of the more than 30 mr reporter gene studies published to date , only four have focused on dynamic cell tracking in the heart [ 28 , 29 , 30 , 31 ] , and are discussed in greater detail below.fig . mri reporter gene studies have overwhelmingly used three common strategies for in vivo detection of cell fate decisions . a large number of studies have examined over - expression or enhancement of iron regulatory elements including ferritin ( responsible for iron storage ) and/or the transferrin receptor ( responsible for shuttling of iron into cells ) . other studies have used expression of reporter genes encoding for artificial plasma membrane peptides or antigens with properly targeted iron oxide nanoparticles ( t2/t2 * contrast ) or gadolinium ( t1 contrast ) contrast agents . finally , a series of studies has examined expression of a class of engineered artificial reporter peptides that can selectively generate contrast on mr images following excitation with radiofrequency energy applied at reporter specific offset frequencies and chemical exchange of saturated magnetization ( cest ) with surrounding bulk water . in theory , such techniques could be combined in a single cell by placing each reporter gene downstream from a specific promoter ( p ) of interest . ( fe = iron , tfr = transferrin receptor , feo = iron oxide nanoparticles , gd = gadolinium chelates , = offset frequency , p = promoter of interest , m = plasma membrane targeted peptide , f = iron regulatory element of interest , c = artificial cest reporter gene ) common mri reporter gene mechanisms . mri reporter gene studies have overwhelmingly used three common strategies for in vivo detection of cell fate decisions . a large number of studies have examined over - expression or enhancement of iron regulatory elements including ferritin ( responsible for iron storage ) and/or the transferrin receptor ( responsible for shuttling of iron into cells ) . other studies have used expression of reporter genes encoding for artificial plasma membrane peptides or antigens with properly targeted iron oxide nanoparticles ( t2/t2 * contrast ) or gadolinium ( t1 contrast ) contrast agents . finally , a series of studies has examined expression of a class of engineered artificial reporter peptides that can selectively generate contrast on mr images following excitation with radiofrequency energy applied at reporter specific offset frequencies and chemical exchange of saturated magnetization ( cest ) with surrounding bulk water . in theory , such techniques could be combined in a single cell by placing each reporter gene downstream from a specific promoter ( p ) of interest . ( fe = iron , tfr = transferrin receptor , feo = iron oxide nanoparticles , gd = gadolinium chelates , = offset frequency , p = promoter of interest , m = plasma membrane targeted peptide , f = iron regulatory element of interest , c = artificial cest reporter gene ) mr reporter gene imaging is an exciting new field that is undergoing initial application to cardiac imaging . to date , cmr studies of reporter gene expressing cells have focused on monitoring cell viability and proliferation following engraftment into the rodent heart after surgically induced myocardial infarction . broadly , these studies have sought to identify reporter gene expressing cells through generation of t2/t2 * contrast on gradient echo images of the heart . in one series of studies , contrast was generated through over - expression of iron regulatory elements in order to safely increase intracellular iron content [ 28 , 30 , 31 ] . in a separate study , a reporter gene encoding for a plasma membrane bound antigen was targeted with intravenously delivered , antibody conjugated iron oxide nanoparticles [ 29 ] . these early studies have demonstrated a consistent ability to visually identify viable cell populations , confirmed continued expression of mr reporter genes following proliferation , and have not demonstrated any alterations in cell function as a result of reporter gene expression . in an early study by naumova et al . [ 30 ] murine skeletal myoblast cells ( c2c12 cell line ) were transduced to over - express mouse ferritin heavy chain in combination with the hemagglutinin acid ( ha ) tag under the control of the constitutively active cytomegalovirus ( cmv ) promoter . prussian blue staining of isolated cells confirmed enhanced uptake and retention of iron in c2c12 cells which over - expressed ferritin . the over - expression of ferritin did not affect cell viability or rates of cell division , however exposure of cells to ferric citrate ( fc ) significantly reduced the rate of cell division irrespective of ferritin over - expression . furthermore , over - expression did not change the differentiation patterns of c2c12 cells , as both normal and ferritin over - expressing c2c12 cells differentiated into multi - nucleated myotubes . initial in vitro phantom studies revealed a 25 % reduction of t2 relaxation times in ferritin over - expressing c2c12 cells when compared to normal c2c12 cells . in order to examine the impact of exposure to an iron rich environment , as would be the case in vivo , the authors incubated ferritin over - expressing cells in fc supplemented medium for 48 hours prior to phantom imaging . exposure to fc prior to imaging led to a further 50 % reduction of t2 relaxation times . in order to examine the in vivo utility of ferritin over - expression for mr cell tracking , the authors transplanted either c2c12 cells or ferritin over - expressing c2c12 cells into the hearts of c3h mice following surgically induced myocardial infarction ( fig . 3 ) . while initial differences in graft tissue signal intensity were minimal following transplantation , by 3 weeks after implantation ferritin over - expressing c2c12 grafts had accumulated sufficient iron to generate strong signal hypo - intensities on t2 * weighted images . in comparison , ex vivo staining protocols confirmed that both c2c12 and ferritin over - expressing c2c12 cells had differentiated into skeletal myoblasts replete with sarcomeric proteins . in a subsequent follow up study naumova and colleagues demonstrated that ferritin over - expressing cells were detected most easily when using standard bright - blood t2 * weighted gradient echo imaging , as opposed to black - blood gradient echo or proton density weighted spin echo imaging protocols . assessment of the size of ferritin over - expressing c2c12 grafts at 4 weeks after transplantation by mri correlated strongly with graft size as assessed by histology.fig . 3imaging cell survival and proliferation using ferritin over - expression . over - expression of ferritin heavy chain in mouse skeletal myoblasts ( c2c12 cells ) was used as an mr reporter gene strategy to safely increase cellular iron content and shorten t2/t2 * relaxation times . following intramyocardial injection , c2c12 cells that over - express ferritin heavy chain began to accumulate iron concomitant with the process of proliferation . within three weeks , sufficient iron had accumulated in ferritin over - expressing cells to enable detection as areas of hypo - intense signal using standard cardiac mr gradient echo imaging sequences ( red arrow , c2c12 + ferritin ) . cells that did not over - express ferritin heavy chain demonstrated similar signal intensity with surrounding myocardial tissue ( red arrow , c2c12 ) . histological assessment of isolated tissue sections confirmed increased iron deposition in grafts of c2c12 cells that over - expressed ferritin . [ 30 ] , but is reprinted with permission from imaging cell survival and proliferation using ferritin over - expression . over - expression of ferritin heavy chain in mouse skeletal myoblasts ( c2c12 cells ) was used as an mr reporter gene strategy to safely increase cellular iron content and shorten t2/t2 * relaxation times . following intramyocardial injection , c2c12 cells that over - express ferritin heavy chain began to accumulate iron concomitant with the process of proliferation . within three weeks , sufficient iron had accumulated in ferritin over - expressing cells to enable detection as areas of hypo - intense signal using standard cardiac mr gradient echo imaging sequences ( red arrow , c2c12 + ferritin ) . cells that did not over - express ferritin heavy chain demonstrated similar signal intensity with surrounding myocardial tissue ( red arrow , c2c12 ) . histological assessment of isolated tissue sections confirmed increased iron deposition in grafts of c2c12 cells that over - expressed ferritin . [ 30 ] , but is reprinted with permission from in a similar study , over - expression of human ferritin heavy chain was used as a reporter gene for mr tracking of swine cardiac stem cells following implantation into the infarcted rat heart . first used a lenti - virus to induce over - expression of human ferritin heavy chain , and subsequently cultured transgenic cardiac stem cells to form cardiospheres . in agreement with the findings of naumova et al . [ 30 , 31 ] , the authors found that over - expression of ferritin heavy chain did not affect cell viability or proliferation . further , the authors demonstrated that over - expression of human ferritin heavy chain did not change the expression levels of important cell surface markers of multi - potency and cardiac lineage . for in vivo rat studies , animals either underwent surgically induced myocardial infarction or sham surgery , and received injections of either phosphate buffered saline ( pbs ) , normal cardiospheres , or ferritin over - expressing cardio - spheres targeted to border zone tissue . the presence of ferritin heavy chain over - expressing cardiospheres was visualized using standard t2 * -weighted imaging as early as 1 week after implantation , and remained constant for 4 weeks after implantation in all rats that received ferritin over - expressing cardiospheres regardless of myocardial infarction status . in animals that underwent myocardial infarction surgery , injection of cardiospheres improved lv ejection fraction at four weeks after mi , with no differences observed between ferritin heavy chain over - expressing and wild type cardiospheres . prussian blue staining of isolated tissue sections confirmed elevated iron deposits in ferritin heavy chain over - expressing cardiospheres 4 weeks following implantation . importantly , repeated assessment after in vivo experiments of viability , proliferation , and key cell surface markers demonstrated no difference between ferritin heavy chain over - expressing and wild type cardiospheres . these promising early results demonstrate the ability to track the survival and proliferation of cells implanted into the healing infarct using ferritin over - expression as an mri reporter gene strategy . in both studies , ferritin over - expressing cells appeared as clear regions of signal voids on bright blood t2 * -weighted gradient echo images , mimicking the effect of cell labeling with iron oxide nanoparticles . interestingly , despite relatively similar quantities of injected cells , the signal voids generated by injection of c2c12 cells [ 30 , 31 ] were more pronounced than those generated following injection of cardiospheres . these small differences raise the important point that future studies should aspire to create a system by which ferritin over - expression generates consistent t2 * contrast across a wide array of candidate cells for cardiac regeneration . importantly , sufficient accumulation of iron in ferritin over - expressing grafts occurred in both studies , within 3 weeks when using c2c12 cells [ 30 , 31 ] and 1 week when using cardiospheres . the period required for sufficient iron accumulation falls well within the likely time between clinical visits for patients of future cell therapy trials . further , naumova and colleagues noted that unlike cell labeling strategies , over - expression of ferritin was maintained during the time - course of cell division and replication , leading to a reliable and consistent signal from surviving engrafted tissue [ 30 , 31 ] . it is important to note that imaging in both studies was performed on clinical scanners that required specialized small animal inserts . as a result , the spatial resolution of acquired images was lower that what is typically acquired in pre - clinical cell tracking studies , raising the possibility that estimation of graft size and cell proliferation from mr images could have been influenced by partial volume effects . acquisition of image data at higher spatial resolutions using dedicated small animal mr scanners , or performing similar studies in the hearts of larger animals could mitigate such concerns and further demonstrate the utility of ferritin over - expression as an mri reporter gene method for cardiac cell tracking . in contrast to the previously described studies which sought to generate t2/t2 * contrast via increased ferritin expression and subsequent accumulation of intercellular iron , an alternative mechanism has been to adapt immuno - histochemical staining techniques for use with mri . [ 29 ] engineered embryonic stem cells that express ha and myc antigens on the cell surface ( fig . 4 ) . while neither of these antigens independently function as mr specific reporters , chung et al . covalently bound super - paramagnetic iron oxide ( spio ) nanoparticles to monocloncal antibodies against ha and myc . initial in vitro studies demonstrated significant loss of signal in embryonic stem cells expressing ha and myc antigens when co - cultured with targeted spio particles that was not observed in non - transduced cells . later , in vivo studies demonstrated no difference in signal intensity of transplanted cells on t2 * -weighted images prior to administration of antibody bound spio particles . studies performed in animals receiving myc and ha positive embryonic stem cells and ha or myc targeted spio particles demonstrated reduced signal intensity in areas of injected cells starting at 5 days after cell injection , which was confirmed by whole body bioluminescence imaging . repeated studies revealed increased binding of targeted spio particles between five and ten days after cell implantation as the embryonic stem cells proliferated and began to form teratoma ( fig . similar studies performed with either falsely targeted or untargeted spio particles demonstrated minimal signal loss on t2 * -weighted images . myocardial tissue regions identified as containing large fractions of ha and myc expressing embryonic stem cells at mri were confirmed using h&e staining of isolated tissue sections . the use of targeted spio particles can overcome concerns of limited sensitivity that have been raised surrounding ferritin based reporter gene methods . in addition , the authors injected the targeted spio particles between 8 - 12 hours prior to imaging . this advantage suggests that upon translation , such agents could be injected outside of the scanner room and patients could return hours later for an mr examination . importantly , chung et al . [ 29 ] used a cell line known to induce teratoma formation , and did not characterize whether expression of the reporter gene construct altered cellular gene expression . when applied to additional pluripotent cell types , it will be critical to confirm that expressions of the reporter gene construct does not alter processes of cell viability , proliferation , and differentiation . further , as the authors acknowledge , expression of ectopic antigens may trigger an immune response that could destroy implanted cells when implanted into immuno - competent hosts.fig . 4imaging embryonic stem cell proliferation using over - expression of a plasma membrane antigen with targeted mri . ( a ) embryonic stem cells ( esc ) were engineered to express hemagglutinin acid ( ha ) and myc antigens at the plasma membrane . when super - paramagnetic iron oxide nanoparticles were properly targeted to ha and myc antigens , robust t2 * contrast could be generated in areas of reporter gene expressing cells . ( b ) ha and myc expressing esc were implanted into the infarct zone of the mouse heart following myocardial infarction and imaged at multiple time points . t2 * -weighted mr imaging of the heart after intravenous administration of the targeted iron oxide nanoparticles demonstrated signal voids in the presence of proliferating and teratoma forming esc ( white arrows ) . reporter gene expressing cells were also detected using bioluminescence imaging , which confirmed increased density of reporter gene expressing cells during teratoma formation . ( c d ) following administration of either false targeted spio - his - mab ( c ) or untargeted spio nanoparticles ( d ) , no significant loss of signal is seen in the myocardium of hearts receiving transplantation of ha and myc expressing esc . the presence of a clear signal on bioluminescence imaging confirms the presence of the esc and further confirms the selective targeting of ha and myc antigens . this material was reproduced with permission from john wiley & sons , inc . and chung et al . [ 29 ] imaging embryonic stem cell proliferation using over - expression of a plasma membrane antigen with targeted mri . ( a ) embryonic stem cells ( esc ) were engineered to express hemagglutinin acid ( ha ) and myc antigens at the plasma membrane . when super - paramagnetic iron oxide nanoparticles were properly targeted to ha and myc antigens , robust t2 * contrast could be generated in areas of reporter gene expressing cells . ( b ) ha and myc expressing esc were implanted into the infarct zone of the mouse heart following myocardial infarction and imaged at multiple time points . t2 * -weighted mr imaging of the heart after intravenous administration of the targeted iron oxide nanoparticles demonstrated signal voids in the presence of proliferating and teratoma forming esc ( white arrows ) . reporter gene expressing cells were also detected using bioluminescence imaging , which confirmed increased density of reporter gene expressing cells during teratoma formation . ( c d ) following administration of either false targeted spio - his - mab ( c ) or untargeted spio nanoparticles ( d ) , no significant loss of signal is seen in the myocardium of hearts receiving transplantation of ha and myc expressing esc . the presence of a clear signal on bioluminescence imaging confirms the presence of the esc and further confirms the selective targeting of ha and myc antigens . this material was reproduced with permission from john wiley & sons , inc . and chung et al . in an early study by naumova et al . [ 30 ] murine skeletal myoblast cells ( c2c12 cell line ) were transduced to over - express mouse ferritin heavy chain in combination with the hemagglutinin acid ( ha ) tag under the control of the constitutively active cytomegalovirus ( cmv ) promoter . prussian blue staining of isolated cells confirmed enhanced uptake and retention of iron in c2c12 cells which over - expressed ferritin . the over - expression of ferritin did not affect cell viability or rates of cell division , however exposure of cells to ferric citrate ( fc ) significantly reduced the rate of cell division irrespective of ferritin over - expression . furthermore , over - expression did not change the differentiation patterns of c2c12 cells , as both normal and ferritin over - expressing c2c12 cells differentiated into multi - nucleated myotubes . initial in vitro phantom studies revealed a 25 % reduction of t2 relaxation times in ferritin over - expressing c2c12 cells when compared to normal c2c12 cells . in order to examine the impact of exposure to an iron rich environment , as would be the case in vivo , the authors incubated ferritin over - expressing cells in fc supplemented medium for 48 hours prior to phantom imaging . exposure to fc prior to imaging led to a further 50 % reduction of t2 relaxation times . in order to examine the in vivo utility of ferritin over - expression for mr cell tracking , the authors transplanted either c2c12 cells or ferritin over - expressing c2c12 cells into the hearts of c3h mice following surgically induced myocardial infarction ( fig . 3 ) . while initial differences in graft tissue signal intensity were minimal following transplantation , by 3 weeks after implantation ferritin over - expressing c2c12 grafts had accumulated sufficient iron to generate strong signal hypo - intensities on t2 * weighted images . in comparison , grafts composed of normal c2c12 cells demonstrated normal signal intensity on identically weighted images . ex vivo staining protocols confirmed that both c2c12 and ferritin over - expressing c2c12 cells had differentiated into skeletal myoblasts replete with sarcomeric proteins . in a subsequent follow up study naumova and colleagues demonstrated that ferritin over - expressing cells were detected most easily when using standard bright - blood t2 * weighted gradient echo imaging , as opposed to black - blood gradient echo or proton density weighted spin echo imaging protocols . assessment of the size of ferritin over - expressing c2c12 grafts at 4 weeks after transplantation by mri correlated strongly with graft size as assessed by histology.fig . 3imaging cell survival and proliferation using ferritin over - expression . over - expression of ferritin heavy chain in mouse skeletal myoblasts ( c2c12 cells ) was used as an mr reporter gene strategy to safely increase cellular iron content and shorten t2/t2 * relaxation times . following intramyocardial injection , c2c12 cells that over - express ferritin heavy chain began to accumulate iron concomitant with the process of proliferation . within three weeks , sufficient iron had accumulated in ferritin over - expressing cells to enable detection as areas of hypo - intense signal using standard cardiac mr gradient echo imaging sequences ( red arrow , c2c12 + ferritin ) . cells that did not over - express ferritin heavy chain demonstrated similar signal intensity with surrounding myocardial tissue ( red arrow , c2c12 ) . histological assessment of isolated tissue sections confirmed increased iron deposition in grafts of c2c12 cells that over - expressed ferritin . [ 30 ] , but is reprinted with permission from imaging cell survival and proliferation using ferritin over - expression . over - expression of ferritin heavy chain in mouse skeletal myoblasts ( c2c12 cells ) was used as an mr reporter gene strategy to safely increase cellular iron content and shorten t2/t2 * relaxation times . following intramyocardial injection , c2c12 cells that over - express ferritin heavy chain began to accumulate iron concomitant with the process of proliferation . within three weeks , sufficient iron had accumulated in ferritin over - expressing cells to enable detection as areas of hypo - intense signal using standard cardiac mr gradient echo imaging sequences ( red arrow , c2c12 + ferritin ) . cells that did not over - express ferritin heavy chain demonstrated similar signal intensity with surrounding myocardial tissue ( red arrow , c2c12 ) . histological assessment of isolated tissue sections confirmed increased iron deposition in grafts of c2c12 cells that over - expressed ferritin . [ 30 ] , but is reprinted with permission from in a similar study , over - expression of human ferritin heavy chain was used as a reporter gene for mr tracking of swine cardiac stem cells following implantation into the infarcted rat heart . first used a lenti - virus to induce over - expression of human ferritin heavy chain , and subsequently cultured transgenic cardiac stem cells to form cardiospheres . in agreement with the findings of naumova [ 30 , 31 ] , the authors found that over - expression of ferritin heavy chain did not affect cell viability or proliferation . further , the authors demonstrated that over - expression of human ferritin heavy chain did not change the expression levels of important cell surface markers of multi - potency and cardiac lineage . for in vivo rat studies , animals either underwent surgically induced myocardial infarction or sham surgery , and received injections of either phosphate buffered saline ( pbs ) , normal cardiospheres , or ferritin over - expressing cardio - spheres targeted to border zone tissue . the presence of ferritin heavy chain over - expressing cardiospheres was visualized using standard t2 * -weighted imaging as early as 1 week after implantation , and remained constant for 4 weeks after implantation in all rats that received ferritin over - expressing cardiospheres regardless of myocardial infarction status . in animals that underwent myocardial infarction surgery , injection of cardiospheres improved lv ejection fraction at four weeks after mi , with no differences observed between ferritin heavy chain over - expressing and wild type cardiospheres . prussian blue staining of isolated tissue sections confirmed elevated iron deposits in ferritin heavy chain over - expressing cardiospheres 4 weeks following implantation . importantly , repeated assessment after in vivo experiments of viability , proliferation , and key cell surface markers demonstrated no difference between ferritin heavy chain over - expressing and wild type cardiospheres . these promising early results demonstrate the ability to track the survival and proliferation of cells implanted into the healing infarct using ferritin over - expression as an mri reporter gene strategy . in both studies , ferritin over - expressing cells appeared as clear regions of signal voids on bright blood t2 * -weighted gradient echo images , mimicking the effect of cell labeling with iron oxide nanoparticles . interestingly , despite relatively similar quantities of injected cells , the signal voids generated by injection of c2c12 cells [ 30 , 31 ] were more pronounced than those generated following injection of cardiospheres . these small differences raise the important point that future studies should aspire to create a system by which ferritin over - expression generates consistent t2 * contrast across a wide array of candidate cells for cardiac regeneration . importantly , sufficient accumulation of iron in ferritin over - expressing grafts occurred in both studies , within 3 weeks when using c2c12 cells [ 30 , 31 ] and 1 week when using cardiospheres . the period required for sufficient iron accumulation falls well within the likely time between clinical visits for patients of future cell therapy trials . further , naumova and colleagues noted that unlike cell labeling strategies , over - expression of ferritin was maintained during the time - course of cell division and replication , leading to a reliable and consistent signal from surviving engrafted tissue [ 30 , 31 ] . it is important to note that imaging in both studies was performed on clinical scanners that required specialized small animal inserts . as a result , the spatial resolution of acquired images was lower that what is typically acquired in pre - clinical cell tracking studies , raising the possibility that estimation of graft size and cell proliferation from mr images could have been influenced by partial volume effects . acquisition of image data at higher spatial resolutions using dedicated small animal mr scanners , or performing similar studies in the hearts of larger animals could mitigate such concerns and further demonstrate the utility of ferritin over - expression as an mri reporter gene method for cardiac cell tracking . in contrast to the previously described studies which sought to generate t2/t2 * contrast via increased ferritin expression and subsequent accumulation of intercellular iron , an alternative mechanism has been to adapt immuno - histochemical staining techniques for use with mri . [ 29 ] engineered embryonic stem cells that express ha and myc antigens on the cell surface ( fig . 4 ) . while neither of these antigens independently function as mr specific reporters , chung et al . covalently bound super - paramagnetic iron oxide ( spio ) nanoparticles to monocloncal antibodies against ha and myc . initial in vitro studies demonstrated significant loss of signal in embryonic stem cells expressing ha and myc antigens when co - cultured with targeted spio particles that was not observed in non - transduced cells . later , in vivo studies demonstrated no difference in signal intensity of transplanted cells on t2 * -weighted images prior to administration of antibody bound spio particles . studies performed in animals receiving myc and ha positive embryonic stem cells and ha or myc targeted spio particles demonstrated reduced signal intensity in areas of injected cells starting at 5 days after cell injection , which was confirmed by whole body bioluminescence imaging . repeated studies revealed increased binding of targeted spio particles between five and ten days after cell implantation as the embryonic stem cells proliferated and began to form teratoma ( fig . similar studies performed with either falsely targeted or untargeted spio particles demonstrated minimal signal loss on t2 * -weighted images . myocardial tissue regions identified as containing large fractions of ha and myc expressing embryonic stem cells at mri were confirmed using h&e staining of isolated tissue sections . the use of targeted spio particles can overcome concerns of limited sensitivity that have been raised surrounding ferritin based reporter gene methods . in addition , the authors injected the targeted spio particles between 8 - 12 hours prior to imaging . this advantage suggests that upon translation , such agents could be injected outside of the scanner room and patients could return hours later for an mr examination . importantly , chung et al . [ 29 ] used a cell line known to induce teratoma formation , and did not characterize whether expression of the reporter gene construct altered cellular gene expression . when applied to additional pluripotent cell types , it will be critical to confirm that expressions of the reporter gene construct does not alter processes of cell viability , proliferation , and differentiation . further , as the authors acknowledge , expression of ectopic antigens may trigger an immune response that could destroy implanted cells when implanted into immuno - competent hosts.fig . 4imaging embryonic stem cell proliferation using over - expression of a plasma membrane antigen with targeted mri . ( a ) embryonic stem cells ( esc ) were engineered to express hemagglutinin acid ( ha ) and myc antigens at the plasma membrane . when super - paramagnetic iron oxide nanoparticles were properly targeted to ha and myc antigens , robust t2 * contrast could be generated in areas of reporter gene expressing cells . ( b ) ha and myc expressing esc were implanted into the infarct zone of the mouse heart following myocardial infarction and imaged at multiple time points . t2 * -weighted mr imaging of the heart after intravenous administration of the targeted iron oxide nanoparticles demonstrated signal voids in the presence of proliferating and teratoma forming esc ( white arrows ) . reporter gene expressing cells were also detected using bioluminescence imaging , which confirmed increased density of reporter gene expressing cells during teratoma formation . ( c d ) following administration of either false targeted spio - his - mab ( c ) or untargeted spio nanoparticles ( d ) , no significant loss of signal is seen in the myocardium of hearts receiving transplantation of ha and myc expressing esc . the presence of a clear signal on bioluminescence imaging confirms the presence of the esc and further confirms the selective targeting of ha and myc antigens . this material was reproduced with permission from john wiley & sons , inc . and chung et al . [ 29 ] imaging embryonic stem cell proliferation using over - expression of a plasma membrane antigen with targeted mri . ( a ) embryonic stem cells ( esc ) were engineered to express hemagglutinin acid ( ha ) and myc antigens at the plasma membrane . when super - paramagnetic iron oxide nanoparticles were properly targeted to ha and myc antigens , robust t2 * contrast could be generated in areas of reporter gene expressing cells . ( b ) ha and myc expressing esc were implanted into the infarct zone of the mouse heart following myocardial infarction and imaged at multiple time points . t2 * -weighted mr imaging of the heart after intravenous administration of the targeted iron oxide nanoparticles demonstrated signal voids in the presence of proliferating and teratoma forming esc ( white arrows ) . reporter gene expressing cells were also detected using bioluminescence imaging , which confirmed increased density of reporter gene expressing cells during teratoma formation . ( c d ) following administration of either false targeted spio - his - mab ( c ) or untargeted spio nanoparticles ( d ) , no significant loss of signal is seen in the myocardium of hearts receiving transplantation of ha and myc expressing esc . the presence of a clear signal on bioluminescence imaging confirms the presence of the esc and further confirms the selective targeting of ha and myc antigens . this material was reproduced with permission from john wiley & sons , inc . and chung et al . as the field of cardiac mri reporter gene based cell tracking continues to develop , there are several key objectives that must be part of the field s evolution . first , the need to genetically alter cells in order to express mr reporter genes remains a barrier to translation beyond pre - clinical models . although early mr reporter gene studies have demonstrated minimal impact on cell viability , proliferation , function , and differentiation , and newer site specific integration techniques for genetic modification of cells demonstrate superb safety profiles , thorough examination of the effects of mr reporter gene expression on cell function and proliferation must be performed in long term studies to exclude potentially negative outcomes . second , mr reporter gene cell tracking in the heart has only used constitutive expression of reporter genes . as the field of cell therapy seeks to promote differentiation of pluripotent cells into a variety of cells including cardiomyocytes and endothelial cells , it will be important to test the ability of mr reporter genes to enable visualization of cell differentiation along different lineages . finally , amongst the studies performed to date , all have used mr reporter genes that generate loss of signal on t2 * weighted images . ideally , various mr reporter gene strategies ( cest , iron regulatory elements , and/or plasma membrane antigens with targeted t1 and t2 * contrast agents ) could be combined to elucidate a more complete picture of molecular processes within cells , or to examine the differentiation of stem cells into a variety of terminal cell types by linking each reporter gene to cell type specific promoters . mr reporter gene imaging is an exciting and burgeoning field that can potentially enable a multi - scale understanding of how cell fate decisions impact subsequent disease and regenerative processes . however , as this field continues to evolve , the potential to elucidate multiple aspects of cell fate decisions within the framework of cardiac regeneration becomes increasingly possible . with further development , mr reporter gene imaging can someday be used to investigate multiple aspects of cell survival , proliferation , and differentiation in order to gain a deeper understanding of mechanisms by which to promote stem cell survival and regeneration of myocardial tissue .

research into cell therapy based cardiac repair and regeneration has experienced explosive growth over the last decade , however further progress is hindered by an inability to serially and non - invasively image cell survival and fate decisions following implantation . recent advances in magnetic resonance imaging ( mri ) reporter gene techniques have enabled in vivo imaging of cell survival , proliferation , migration , and differentiation , however this has mostly been performed in stationary tissues . a small series of recent studies has examined the possibility of using mri reporter genes to track the survival of cells injected into the heart following myocardial infarction . in this review , we seek to frame the emerging field of mri reporter gene based cardiac cell tracking within the larger framework of the needs of cardiac regeneration therapy and the more established field of mri cell tracking . while initial studies have demonstrated a promising ability to track the viability and proliferation of cells used for cell therapy , the ultimate goal of mr reporter gene imaging in the heart remains the ability to simultaneously correlate cell fate decisions with additional measures of structural and functional recovery .

Introduction Conventional MRI Cell Tracking MR Reporter Gene Strategies MR Reporter Gene Imaging of Survival and Proliferation Following Cell Engraftment Over-Expression of Ferritin as an MR Reporter Gene Targeting of Plasma Membrane Bound Reporter Antigens Taking the Next Steps Conclusion

olefin metathesis is a highly versatile tool for the generation of carbon carbon bonds , and a variety of applications have evolved around its implementation . the broad utility of olefin metathesis is a consequence of the exceptional selectivity , activity , and functional - group compatibility of select metathesis catalysts , highlighted by carbon carbon bond formation on a variety of complex substrates including small molecules , natural products , organic and inorganic materials , and even proteins . the use of metathesis in biological applications is an emerging field of research , in part , because of advances in the genetic and chemical incorporation of alkene - containing amino acids into peptides and proteins . carbon bonds with high fidelity for applications in peptide stapling , as surrogates of hydrogen bonding , and as methods for modifying peptides and proteins used to mimic physiologically relevant post - translational modifications . the application of metathesis for stabilizing peptide secondary structure and for performing selective protein modifications has implications for imparting greater metabolic stability , cellular permeability , and higher binding affinity toward biological targets . peptides used as inhibitors of hiv fusion and assembly , as modulators of signaling pathways involved in cancer , and as selective activators of enzymes involved in diabetes . despite the tremendous success of metathesis in peptide and peptidomimetic research , the ability to control olefin geometry in the product has been met with limited success . most metathesis catalysts exhibit minimal kinetic selectivity , and thus , the product distribution reflects the thermodynamic stability of each olefin isomer . in many cases , a mixture of e and z isomers this imposes challenges for examining the influence of alkene geometry on the stability and activity of diverse compounds . in pursuit of catalysts with greater control over olefin products , we uncovered a series of cyclometalated ruthenium catalysts that could achieve high conversions with exquisite z selectivity ( figure 1 ) . the origin of z selectivity for cyclometalated ruthenium catalysts involves approach of the olefin from a side - bound position ( i.e. , cis to the nhc ligand and trans to the chelating adamantyl ) and is favored through a combination of steric and electronic effects imposed by the nhc ligand . although catalysts 1 and 2 demonstrate excellent selectivity in olefin metathesis , their activity on complex substrates , including peptides , remained unexplored . to this end , we sought to initiate a comprehensive evaluation of z - selective metathesis on peptides using newly developed cyclometalated ruthenium catalysts . through the combined efforts of homodimerization , cross metathesis and ring - closing metathesis , we have developed guidelines for assessing the influence of amino acids and peptides on catalyst activity and selectivity . these principles were applied for carrying out z - selective metathesis on challenging substrates including peptides that comprise parallel -sheets and on stapling of -helical peptides . our goal for expanding the utility of z - selective ruthenium catalysts was to examine the influence of amino acids on the selectivity and activity of catalysts 1 and 2 . catalysts bearing n - adamantyl substituents and bidentate nitrato ligands were found to be critical for achieving high z selectivity , and we set out to determine whether such catalysts could be applied to substrates bearing multiple functionalities and with varying steric profiles . to benchmark the reactivities of catalysts 1 and 2 , we chose to investigate the homodimerization of protected amino acids modified with homoallyl functionality ( table 1 ) . our initial studies focused on the use of alanine 3 , as we anticipated that amino acids bearing unhindered and aliphatic side chains would provide an ideal platform for comparative studies . we began with a catalyst loading of 2.5 mol % in tetrahydrofuran ( thf ) at 40 c , and this afforded the homodimerization product 4 in 53% yield after 4 h using catalyst 1 and 58% yield in the presence of catalyst 2 ( entry 1 ) . gratifyingly , the z selectivity remained high ( 90% ) throughout the course of the reaction . catalyst loadings of 5 mol % afforded product 4 in 65% yield with 92% z selectivity in the presence of catalyst 2 ( entry 2 ) . increasing the concentration led to modest improvements in yields while maintaining high z selectivity ( entries 3 and 4 ) . ultimately , we found that using a catalyst loading of 7.5 mol % afforded product 4 in 76% yield with 94% z selectivity ( entry 6 ) , and these conditions proved to be optimal among the various reaction conditions explored . we next examined the solvent dependence of the activities of catalysts 1 and 2 in homodimerization , as this is an important consideration in view of the solubility profiles of many peptidic substrates ( table 2 ) . several polar and nonpolar solvents were investigated reflecting those most often used in peptide synthesis . coordinating solvents [ e.g. , acetonitrile ( mecn ) ] were less active in promoting z - selective metathesis as compared to noncoordinating solvents [ e.g. , dicholorethane ( dce ) ] ( entries 2 and 3 ) . polar solvents including dimethylformamide ( dmf ) , dimethyl sulfoxide ( dmso ) , and n - methylpyrrolidone ( nmp ) were tolerated by catalysts 1 and 2 , affording product 4 in yields ranging from 55% to 67% and 90% z selectivity ( entries 46 ) . protic solvents including methanol ( meoh ) , ethanol ( etoh ) , and aqueous tert - butanol ( t - buoh ) mixtures yielded highly enriched z - olefin products ( entries 79 ) . other polar solvents including nitromethane ( meno2 ) resulted in low conversions ( entry 10 ) , presumably by activating decomposition pathways of the cyclometalated ruthenium catalysts . it is worth noting that , across the variety of reaction conditions explored , the z selectivity remained consistently high . determined by h or c nmr spectroscopy . determined by h or c nmr spectroscopy . to probe the activities of catalysts 1 and 2 further , we investigated the homodimerization of other canonical amino acids ( table 3 ) . boc - protected amino acids bearing aliphatic or aromatic side chains were active in z - selective metathesis ( entries 14 ) . branched side chains from amino acids including valine ( 5a ) , isoleucine ( 5b ) , and leucine ( 5c ) afforded products 6a c in yields approaching 74% with 94% z selectivity ( entries 13 ) . aromatic side chains from amino acids including phenylalanine 5d afforded product 6d in 75% yield and 93% z selectivity in the presence of catalyst 2 ( entry 4 ) . exceptions include glycine and proline , as these are inactive in homodimerization ( entries 5 and 6 ) . homodimerization of tryptophan afforded product 6 g in 64% yield with 90% z selectivity ( entry 7 ) . in contrast , histidine was deemed incompatible with catalysts 1 and 2 ( entry 8) . unprotected alcohols from the side chains of serine 5i or threonine 5j were tolerated by catalysts 1 and 2 but required protection to reach acceptable conversions , providing products 6i and 6j in 72% and 73% yields , respectively ( entries 9 and 10 ) . homodimerization of tyrosine afforded product 6k in 64% yield and 87% z selectivity in the presence of catalyst 1 and 68% yield and 90% z selectivity using catalyst 2 ( entry 11 ) . in contrast to alcohols , side chains bearing thiols ( i.e. , cysteine ) or thioethers ( i.e. , methionine 5l ) generally led to catalyst deactivation ( entry 12 ) . protecting the side chain of cysteine could overcome catalyst inactivity and afford product 6 m in 55% yield and 87% z selectivity ( entry 13 ) . polar side chains bearing carboxylate ( 5n , o ) , carboxamide ( 5p , q ) , or amine ( 5r ) functionality required protection prior to homodimerization . in these cases , yields from 70% to 80% could be achieved with high z selectivity ( entries 1418 ) . side chains bearing a protected guanidinium functionality ( i.e. , arginine 5s ) were less active in homodimerization , affording product 6s in 34% and 33% yields using catalysts 1 and 2 , respectively . these findings reveal that the identity of the amino acid side chain can profoundly influence the activity of cyclometalated ruthenium catalysts . determined by h or c nmr spectroscopy . side chain protected with a trityl group . emboldened by the success of z - selective homodimerization of amino acids , we next evaluated the effects of varying the metathesis partner to achieve z - selective cross metathesis ( cm ) ( table 4 ) . for our studies , we chose cross partners that showed variable activity in homodimerization . in this way , we could begin to classify substrates on the basis of their propensity for achieving productive cm . we explored cm using homoallyl - modified alanine 3 and the similarly reactive substrate valine 5a as the cross partner . cross metathesis in the presence of an equimolar ratio of 3 to 5a afforded the desired heterocross product 7 in 41% yield with 90% z selectivity ( entry 1 ) . increasing the stoichiometry of 5a relative to 3 led to a modest increase in yield , providing product 7 in 48% yield with 91% z selectivity ( entry 2 ) . further increases in 5a afforded similar trends , with yields approaching 60% and 90% z selectivity ( entries 3 and 4 ) . to demonstrate the versatility of this method , we explored conditions in which 5a was used as the limiting reagent ( entries 57 ) . under these conditions , an incremental increase in the yield of product 7 was observed upon increasing the ratio of 3 to 5a . as in the case of excess 5a , modest improvements in the yield of 7 were achieved with increasing equivalents of 3 , demonstrating the statistical nature of cm using similar reactive substrates . given the modest conversions to product and high z selectivities , we can conclude that the products of cm are sparingly consumable using catalysts 1 and 2 , ensuring that the z selectivity can remain high throughout the course of the reaction . we next evaluated whether amino acids of differing reactivity profiles could be used for selective cm ( table 5 ) . in choosing the requisite cross partners , we focused on substrate 3 and homoallyl - modified arginine 5s , as they both showed relatively low reactivity in homodimerization . we began our studies using an equimolar ratio of 3 and 5s , and this afforded 8 in 46% yield and 93% z selectivity ( entry 1 ) . increasing the ratio of 5s to 3 led to slightly diminished yields and z selectivities ( entries 24 ) . by contrast , reversing the order such that 3 was in excess of 5s afforded 8 in yields of 47% and 58% using catalysts 1 and 2 , respectively ( entry 5 ) . further increasing the ratio of 3 to 5s could achieve the heterocross product 8 in improved yields and high z selectivities ( entries 6 and 7 ) . taken together , these findings reveal that the intrinsic reactivity differences between homoallyl - modified amino acids can be used for productive z - selective cross metathesis . the unique reactivity profiles of canonical amino acids in z - selective homodimerization and cm prompted investigation of a subset of non - natural amino acids that have shown promise in peptide and protein modification using olefin metathesis . allyl - protected amino acids including serine , cysteine , and selenocysteine have been shown to enhance the rate of metathesis when incorporated into peptides and proteins . studies by davis and co - workers ascribed the unique chemical reactivity of such amino acids through a chelation - assisted mechanism whereby precoordination of the heteroatom to ruthenium increases the effective concentrations of the alkylidene and alkene without detrimental chelation . moreover , softer nucleophiles such as sulfur and selenium were found to have an activating effect relative to oxygen for enhancing the rate of cm . these findings are intriguing considering that sulfur can have a deactivating effect on olefin metathesis , and our results suggest that sulfur - containing amino acids ( e.g. , compound 5l ) lead to catalyst inactivity . nonetheless , a wealth of information suggests that heteroatoms can modulate metathesis activity ; however , this phenomenon was unexplored using z - selective cyclometalated catalysts . to investigate the influence of allylic heteroatoms on the activities of catalysts 1 and 2 , we examined a series of allyl - protected amino acids in homodimerization ( table 6 ) . we chose allylglycine ( 9a ) and homoallylglycine ( 9b ) , as well as allyl - protected serine ( 9c ) and cysteine ( 9d ) , for our studies . in this sense , 9a d would reveal both the role of sterics ( i.e. , comparison of 9a and 9b ) and the effect of chelation by heteroatoms ( i.e. , comparison of 9b to 9c , d ) in facilitating metathesis . for these tests , we investigated homodimerization of 9a and compared its reactivity relative to that of substrate 9b . conversion of 9a to the dimerized product 10a was low using catalyst 1 or 2 , occurring in 45% yield and 90% z selectivity ( entry 1 ) . by comparison , dimerization of homoallylglycine 9b afforded product 10b in 59% yield and 90% z selectivity ( entry 2 ) . this corroborates our earlier findings that the steric environment around the alkene can influence the efficiency of z - selective metathesis . allyl - protected serine 9c afforded product 10c in 67% yield with 92% z selectivity ( entry 3 ) . by comparison , cysteine 9d was more active in homodimerization , leading to 71% yield and 93% z selectivity in the presence of catalyst 2 ( entry 4 ) . these results suggest that allylic heteroatoms can facilitate z - selective metathesis in the presence of cyclometalated ruthenium catalysts . determined by h or c nmr spectroscopy . the insights garnered from the homodimerization of substrates 9a d revealed that the identity of the alkene can influence the activities of catalysts 1 and 2 in z - selective metathesis . although these studies provide important insight for assessing the intrinsic reactivity of allyl - modified amino acids with cyclometalated ruthenium catalysts , the general utility of such catalysts could be further illuminated by their use in cm . as such , we examined catalysts 1 and 2 in cm using allyl - modified amino acids 9a d ( table 7 ) . to assess the relative activities of substrates 9a d in cm , we chose allyl acetate 11 as the cross partner , as we previously showed that 11 is highly active in z - selective cm . we explored a variety of conditions to test the generality of cm including the use of solvents that are compatible with native peptides and proteins . for our initial studies , we examined cm between allylglycine 9a and 11 under our previously optimized conditions , and this afforded the heterocross product 12a in 42% yield and 90% z selectivity . we next explored cm under aqueous conditions , including the use of additives shown to enhance the efficiency of cm on peptides and proteins . in the presence of aqueous tert - butanol , the heterocross product 12a was achieved in 38% yield with 90% z selectivity ( entry 2 ) . inclusion of salts such as licl or mgcl2 , which has been shown to be beneficial for enhancing methathesis on peptides , afforded product 12a in 31% yield but with diminished z selectivity ( entries 3 and 4 ) . these trends were also observed using homoallylglycine 9b as the cross partner ( entries 58 ) . to investigate whether amino acids bearing allylic heteroatoms influence the efficiency of z - selective cm , we exposed allylserine 9c and allylcysteine 9d to similar reaction conditions . synthesis of the heterocross product was improved , affording 12c in 63% yield with 92% z selectivity using catalyst 2 ( entry 9 ) . the use of aqueous conditions ( entry 10 ) or inclusion of additives ( entries 11 and 12 ) led to slightly diminished yields and z selectivity . by comparison , the use of allylcysteine 9d as the cross partner afforded the desired product 12d in 60% yield with 90% z selectivity ( entry 13 ) . as observed with substrates 9a c , a decrease in catalyst activity occurred under aqueous conditions and in the presence of salt additives ( entries 1416 ) . collectively , these results suggest that the activities of catalysts 1 and 2 are highly dependent on the reaction conditions . in general , the trends observed in cm with 9a d parallel those observed using nonchelated ruthenium catalysts ; however , the use of salts as additives appears to have a deactivating effect on the activity of cyclometalated ruthenium catalysts . these results lend support to the importance of the chelating ligand ( i.e. , bidentate versus mondentate ligand coordination ) in the activities and selectivities of catalysts 1 and 2 . determined by h or c nmr spectroscopy . reaction conditions : 1 mmol of 9a d in 1:1 h2o / t - buoh . reaction conditions : 1 mmol of 9a d in 1:1 h2o / t - buoh + 2 mm licl . reaction conditions : 1 mmol of 9a d in 1:1 h2o / t - buoh + 2 mm mgcl2 . investigation of both canonical and noncanonical amino acids in homodimerization and cross metathesis revealed that the choice of cross partner is critical to the success of ruthenium - catalyzed z - selective metathesis . in this regard , amino acid side chains bearing aliphatic , aromatic , or protected polar functionalities were highly active in metathesis . those amino acids that generally lead to lower conversion ( i.e. , arginine ) could undergo selective cross metathesis in the presence of a more highly reactive substrate . moreover , the steric environments around the olefin and allylic heteroatoms were shown to impact the efficiency of z - selective cm . whereas these observations apply generally to amino acids that are commonly used in olefin metathesis , we wanted to investigate whether cyclometalated ruthenium catalysts could be used in cm on more complex substrates , including peptides . in choosing the requisite cross partners , we took inspiration from peptides known to adopt defined -sheet secondary structures when tethered through a turn - promoting moiety or as part of a macrocycle . such structures hold promise in applications ranging from supramolecular chemistry to biology and offer challenging substrates for catalysts 1 and 2 . a wealth of information regarding the use of peptides and small molecules as -sheet mimics has revealed that both hydrogen bonding and amino acid side - chain pairing preferences can be used to dictate the stability of -sheet formation . to this end , we synthesized peptides 13 and 14 , which represent typical sequences found in parallel -sheets and whose structures are known to rely on the sequence of amino acids ( scheme 1 ) . for our studies , we used an excess of peptide 13 , as we had shown that less reactive amino acids , including arginine , could be used for selective cross metathesis in the presence of more highly active amino acids . under these conditions , conversion reached 60% for the desired peptide 15 with greater than 90% z selectivity . attempts to improve the yield of the heterocross product by conducting cm in solvents that promote hydrogen bonding and thereby preorganize the peptides to facilitate metathesis led to similar conversions . these results attest to the functional - group tolerability of cyclometalated ruthenium catalysts and point to further strategies aimed at accessing complex olefinic substrates bearing multiple functionalities . determined by analytical high - performance liquid chromatography mass spectrometry ( hplc - ms ) . our results regarding the activity of cyclometalated ruthenium catalysts in cross metathesis of amino acids and peptides revealed that the kinetic selectivities of catalysts 1 and 2 can be used to synthesize peptides highly enriched in z - olefins . although these studies provide a framework for promoting metathesis through judicious choice of the amino acid sequence , we observed that conversions in cm were optimal at relatively high concentrations ( 0.30.4 m ) , which , for many substrates , might be a limitation . we sought a more general strategy such that a variety of reaction conditions could be used to promote z - selective metathesis on a diverse collection of peptides . to this end , we investigated ring - closing metathesis ( rcm ) of olefinic amino acids for the synthesis of stapled peptides . such peptides hold promise as novel therapeutics by virtue of their enhanced -helicity ; proteolytic stability ; and ability to target intracellular proteins involved in cancer , infectious disease , and metabolism . as such , we set about to broaden the available catalysts used to synthesize this important class of peptides under conditions that would be amenable to comprehensive screening of catalyst activity in the presence of varying peptide sequences . traditional methods for the synthesis of stapled peptides by rcm have relied on the use of o - allyl serine or c-tetrasubstituted amino acids to install macrocyclic cross - links into synthetic peptides . most strategies incorporate non - natural amino acids at positions spanning one ( i , i + 4 ) or two ( i , i + 7 ) turns of a helix that serve to preorganize the reactive side chains on the same helical face . a wealth of knowledge derived from computational and experimental approaches has illuminated the minimal constraints necessary for achieving rcm on peptides using first- and second - generation or grubbs an unmet challenge in the synthesis of stapled peptides has been the ability to control olefin geometry in the product , as the use of noncyclometalated ruthenium catalysts typically gives rise to both e and z isomers that are often inseparable . this imposes challenges for examining the role of olefin geometry in the stability and biological activity of stapled peptides , which , to date , has not been thoroughly explored . to this end , we employed catalysts 1 and 2 in z - selective rcm for stapling -helical peptides that encompass the vast majority of peptides used for biological studies . as part of our ongoing effort to expand the utility of catalysts 1 and 2 , we chose to conduct rcm on resin - supported peptides . this would streamline the synthesis of peptides and offer a modular platform to test the activities of cyclometalated ruthenium catalysts . our goal was to compare the activities of z - selective catalysts with those of noncyclometalated ruthenium catalysts in rcm , and we focused our efforts on peptides with known biological activity . the sequence we chose is derived from an -helical peptide known to target the bcl-2 family of proteins involved in the regulation of apoptosis and whose activity is modulated by constraining the peptide through hydrocarbon stapling ( table 8) . the chemical features of peptide 16 consist of two stereochemically defined ,-disubstituted olefinic amino acids separated by one turn of a helix ( i.e. , olefins positioned at residues i and i + 4 ) that , upon ring closure , would generate a 21-membered macrocycle . loading capacities for resin : wang , 0.5 mmol / g ; tentagel , 0.25 mmol / g ; mbha , 0.5 mmol / g . amino acids were protected prior to rcm . determined by analytical hplc - ms . the stabilities and activities of catalysts 1 and 2 in the presence of resins were unexplored , and we examined commonly used resins for solid - phase peptide synthesis that varied based on composition and loading capacity . throughout our studies , we performed rcm in solvents that promote -helicity [ e.g. , dicholorethane ( dce ) ] at concentrations that favor macrocyclic ring closure . initial screening revealed that the choice of resin influenced the activities of catalysts 1 and 2 in rcm . conversions to the desired rcm product 17 were typically low on wang resin using 10 mol % catalyst at room temperature for 2 h ( entry 1 ) . resins bearing hydrophilic linkers proved beneficial , affording conversions approaching 40% under the same reaction conditions ( entry 2 ) . the use of mbha resin led to 60% conversion ( entry 3 ) , and we focused further optimization using this resin . we next explored the effects of reaction time and catalyst loading on rcm . prolonging the reaction led to modest improvements , generating product 17 in 70% conversion with greater than 90% z selectivity ( entry 4 ) , and subjecting the resin - bound peptide to successive rounds of catalyst resulted in conversions of 75% using two cycles of catalyst addition ( entry 5 ) . increasing the temperature to 40 c afforded 17 in 80% yield and with greater than 90% z selectivity ( entry 6 ) . to probe the generality of the method , we investigated peptides bearing olefinic amino acids spanning two turns ( i , i + 7 ) of a helix with varying amino acid sequences ( scheme 2 ) . to span the distance of two helical turns , we modified the n - terminal olefinic amino acid by increasing the tether length ( from five to eight carbon atoms ) and inverting the stereochemical configuration ( from s to r ) , both of which were predicted to facilitate rcm . under our optimized conditions , conversions of 85% for the desired rcm product 19 could be achieved after two cycles of catalyst addition with greater than 90% z selectivity . these results demonstrate that cyclometalated ruthenium catalysts can promote z - selective rcm on solid support for the synthesis of stapled peptides bearing all hydrocarbon cross - links . determined by analytical hplc - ms . we earlier demonstrated that aib - rich peptides bearing i , i + 3 l - serine o - allyl residues afford highly e - selective rcm products , in studies motivated , in part , by a theoretical prediction that suggested an rcm - derived 18-membered ring using these side chains would serve as a minimal constraint for the 310-helix . we were curious to see whether a z - selective catalyst could overcome any substrate bias favoring the e - olefin geometry . to this end , we studied the rcm conversions of pentapeptide boc - l - ser(al)-aib - aib - l - ser(al)-aib - ome ( 20 ) and heptapeptide boc - l - val - l - ser(al)-l - leu - aib - l - ser(al)-l - val - l - leu - ome ( 24 ) to macrocycles 21 and 25 , respectively , using second - generation catalysts 22 and 23 and z - selective catalyst 1 ( table 9 ) . as expected from our earlier studies , peptide 20 readily cyclized to the e macrocycle in the presence of 10 mol % 22 or 23 in dce held at 45 c for 10 h ( entries 1 and 2 ) . under similar reaction conditions , no macrocyclization was observed with catalyst 1 , even with a 3-fold increase in catalyst loading and extended reaction time ( entry 3 ) . the same behavior was observed for heptapeptide 24 , although , in this case , the z macrocycle did form with 22 or 23 to the extent of ca . 8% ( entries 4 and 5 ) . peptide 24 rapidly cyclized with the second - generation catalysts in refluxing dichloromethane , but it was unreactive toward catalyst 1 under identical conditions ( entry 6 ) . whereas most peptide side - chain rcm reactions produce e / z mixtures , the minimal i , i + 3 cross - link in these aib - containing systems seems reluctant to form the z - olefin , probably a consequence of the conformational restrictions imposed by the c-tetrasubstituted -amino residues . these results demonstrate that the i + 1 and i + 2 aib residues play a role in controlling the e - selective rcm behavior with catalysts 22 and 23 and this conformational bias can not be overcome by z - selective catalysts . these studies highlight the importance of peptide sequence and conformation in controlling olefin geometry in the macrocyclic product and point to further strategies aimed at understanding how these parameters affect the efficiency of z - selective rcm . in summary , we have reported the first examples of z - selective metathesis on peptides using cyclometalated ruthenium catalysts . by examining a broad range of canonical and noncanonical amino acids in cross metathesis , homodimerization , and ring - closing metathesis , we have gleaned important criteria for achieving high conversion while maintaining excellent z selectivity . the following insights based on our results are summarized : the side - chain identity of an amino acid can dictate the activities of catalysts 1 and 2 in cross metathesis and homodimerization . in general , amino acids bearing aliphatic or aromatic side chains ( e.g. , alanine , leucine , and phenylalanine ) are highly active in metathesis , with yields approaching 85% and 94% z selectivity . sterically hindered side chains ( e.g. , valine or isoleucine ) and amino acids bearing bulky protecting groups lead to lower conversions but without degradation of z selectivity . amino acids bearing carboxylate functionalities ( i.e. , glutamic acid and aspartic acid ) require protection , as substrates bearing acidic functionalities can lead to catalyst decomposition and diminished z selectivity . amino acids bearing thiols or thioethers generally deactivate cyclometalated ruthenium catalysts ; however , in some cases , the use of protecting groups can lead to productive turnovers . side chains bearing hydroxyl groups ( e.g. , serine or threonine ) are generally tolerated by catalysts 1 and 2 , whereas amino acids bearing heterocycles have variable activity . tryptophan is active in z - selective homodimerization and cross metathesis , whereas histidine is generally inactive . polar side chains bearing carboxamide ( i.e. , glutamine or asparagine ) or guanidinium ( i.e. , arginine ) functionalities are generally intolerant of cyclometalated ruthenium catalysts . protection of these side chains can restore catalyst activity , leading to products highly enriched in z - olefins . cross metathesis and homodimerzation of amino acids and peptides using z - selective ruthenium catalysts can be performed in a variety of solvents , provided that the acidity of the reaction medium is kept minimal . the use of solvents such as mecn , dmso , and dmf generally leads to lower conversions than the use of noncoordinating solvents ( e.g. , dce ) . the use of protic solvents ( e.g. , meoh , etoh , or h2o ) can lead to products enriched in z - olefins . prolonged reaction times in protic solvents can , in some cases , lead to decomposition of catalysts 1 and 2 . amino acids bearing allylic or homoallylic functionality are active in z - selective metathesis . in general , higher conversions in homodimerization and cm can be achieved using homoallylic functionalities , particularly for sterically hindered substrates . noncanonical amino acids containing allylic heteroatoms including those that could be incorporated into peptides and proteins are active in z - selective cross metathesis and follow trends similar to those of noncyclometalated ruthenium catalysts . the use of aqueous conditions in the presence of salts as additives appears to diminish the activities of catalysts 1 and 2 . cyclometalated ruthenium catalysts can be used to synthesize stapled peptides bearing hydrocarbon olefinic cross - links positioned at residues i , i + 4 or i , i + 7 . to probe the limits of these catalysts in peptide stapling , we exposed z - selective catalysts to aib - rich peptides bearing o - allyl serine cross - links positioned at residues i and i + 3 that predominantly give rise to highly e - selective macrocyclic products . in these cases , catalysts such as 1 failed to undergo z - selective rcm , suggesting that conformational restrictions imposed by substrates such as 20 can influence the activities of cyclometalated ruthenium catalysts 1 and 2 in rcm . notably , compounds 15 , 17 , and 19 represent the most complex substrates synthesized by cyclometalated ruthenium catalysts , and this bodes well for further studies aimed at applying z - selective metathesis on substrates bearing multiple functionalities . it is envisioned that the studies reported herein will serve as a guideline in choosing appropriate alkene cross partners or promoting rcm on peptides . we anticipate that cyclometalated ruthenium catalysts could access new structures and provide insight into the role of alkene geometry in the biological activities of stapled peptides . moreover , installation of z - alkenes into peptides and proteins could allow sites for further modifications . progress in the design and development of stereoselective ruthenium catalysts will continue to broaden the application of olefin metathesis in natural - product synthesis and in biology .

olefin metathesis has emerged as a promising strategy for modulating the stability and activity of biologically relevant compounds ; however , the ability to control olefin geometry in the product remains a challenge . recent advances in the design of cyclometalated ruthenium catalysts has led to new strategies for achieving such control with high fidelity and z selectivity , but the scope and limitations of these catalysts on substrates bearing multiple functionalities , including peptides , remained unexplored . herein , we report an assessment of various factors that contribute to both productive and nonproductive z - selective metathesis on peptides . the influence of sterics , side - chain identity , and preorganization through peptide secondary structure are explored by homodimerization , cross metathesis , and ring - closing metathesis . our results indicate that the amino acid side chain and identity of the olefin profoundly influence the activity of cyclometalated ruthenium catalysts in z - selective metathesis . the criteria set forth for achieving high conversion and z selectivity are highlighted by cross metathesis and ring - closing metathesis on diverse peptide substrates . the principles outlined in this report are important not only for expanding the scope of z - selective olefin metathesis to peptides but also for applying stereoselective olefin metathesis in general synthetic endeavors .

Introduction Results and Discussion Conclusions

ischemia - induced pathologic growth of new blood vessels and expansion of extracellular matrix ( ecm ) in association with the outgrowth of fibrovascular epiretinal membranes at the vitreoretinal interface is the pathological hallmark in proliferative diabetic retinopathy ( pdr ) and often leads to catastrophic loss of vision due to vitreous hemorrhage and/or traction retinal detachment . proliferative vitreoretinopathy ( pvr ) is a process of fibrocellular proliferation on either sides of the retina that may complicate rhegmatogenous retinal detachment . the formation and gradual contraction of epiretinal membranes causes a marked distortion of the retinal architecture and results in complex retinal detachments that are difficult to repair . angiogenesis , the growth of new vascular networks from preexisting ones , is under tight regulation by a dynamic balance between angiogenic stimulators and inhibitors . the biological process of fibrosis , typically associated with an abnormal accumulation of ecm , occurs in response to various stimuli in many biological systems . the key cellular mediator of fibrosis is the myofibroblast , a cell type differentiated from quiescent fibroblasts . these are contractile cells , characterized by the expression of -smooth muscle actin ( -sma ) , and their presence is a marker of progressive disease . previous studies have shown that -sma - expressing myofibroblasts are the principal cellular component of pdr and pvr epiretinal membranes [ 36 ] . inflammation , angiogenesis , and fibrosis are processes involved in the pathogenesis of proliferative vitreoretinal disorders , and the interplay between these events is under intense investigation [ 38 ] . a number of proinflammatory , proangiogenic , profibrogenic , and immunomodulating factors may be linked to the development and progression of proliferative vitreoretinal disorders , such as osteopontin ( opn ) , high - mobility group box-1 ( hmgb1 ) , connective tissue growth factor ( ctgf ) , and pigment epithelium - derived factor ( pedf ) . osteopontin is a phosphorylated acidic arginine - glycine - aspartate- ( rgd-)containing glycoprotein that exists both as an immobilized ecm component and as a soluble , multifunctional , proinflammatory cytokine that plays important roles in promoting inflammation [ 9 , 10 ] , tissue remodeling , fibrosis [ 9 , 1114 ] , and angiogenesis [ 1518 ] . many of these effects are mediated by the binding of opn to cd44 receptors and the surface integrin receptor v3 [ 15 , 16 , 19 ] . hmgb1 is a nonhistone dna - binding nuclear protein that is highly conserved during evolution . necrotic cell death can result in passive leakage of hmgb1 from the cell as the protein is then no longer bound to dna . in addition , hmgb1 can be actively secreted by different cell types , including activated monocytes and macrophages , mature dendritic cells , natural killer cells , and endothelial cells . extracellular hmgb1 functions as a proinflammatory cytokine [ 2023 ] and exhibits angiogenic [ 2427 ] and fibrogenic [ 2831 ] effects . ctgf is a cysteine - rich secretory protein that functions as a downstream mediator of transforming growth factor- action on connective tissue cells . it acts as a fibroblast chemoattractant and mitogen and also stimulates the production of ecm components in various fibroblast cultures [ 3234 ] . in addition , in vitro and in vivo studies demonstrated that ctgf exhibits angiogenic activities [ 35 , 36 ] . pedf is a 50 kda secreted glycoprotein that belongs to the noninhibitory serpin family group . pedf has been described as a natural inhibitor of both physiological and pathological angiogeneses with antioxidant , and anti - inflammatory effects . it has been demonstrated to function as a potent and broadly acting neurotrophic and neuroprotective factor that induces cell differentiation and protects neurons in the brain , eye , and spinal cord against a wide range of neurodegenerative insults [ 37 , 38 ] . in addition , pedf was recently shown to have antifibrogenic activity . to address mechanisms involved in the pathogenesis of proliferative vitreoretinal disorders and to identify molecular targets for treatment and/or preventive intervention , we measured the levels of opn , hmgb1 , ctgf , and pedf in the vitreous fluid from patients with pdr , pvr , and rhegmatogenous retinal detachment with no pvr ( rd ) . undiluted vitreous fluid samples ( 0.30.6 ml ) were obtained from 48 patients with pdr , 17 patients with pvr , and 30 patients with rd during pars plana vitrectomy . the indications for vitrectomy in patients with pdr were traction retinal detachment and/or nonclearing vitreous hemorrhage . in patients with pdr , the severity of retinal neovascular activity was graded clinically at the time of vitrectomy using previously published criteria . neovascularization was considered active if there were visible perfused new vessels on the retina or optic disc present within tractional epiretinal membranes . neovascularization was considered inactive ( involuted ) if only nonvascularized , white fibrotic epiretinal membranes were present . active pdr was present in 28 patients , and inactive pdr was present in 20 patients . vitreous samples were collected undiluted by manual suction into a syringe through the aspiration line of vitrectomy , before opening the infusion line . the samples were centrifuged ( 500 rpm for 10 min , 4c ) , and the supernatants were aliquoted and frozen at 80c until assay . the study was conducted according to the tenets of the declaration of helsinki , and informed consent was obtained from all patients . the study was approved by the research centre , college of medicine , king saud university . enzyme - linked immunosorbent assay ( elisa ) kit for human opn ( human osteopontin , duoset , cat no . an elisa kit for hmgb1 ( human high - mobility group box-1 , cat no . elisa kits for human ctgf ( human connective tissue growth factor , cat no : e0010h ) and human pedf ( human pigment epithelium - derived factor , cat no . csb - e08818h ) were purchased from uscn life science & tech co. , ltd . and cusabio biotech co. , ltd . the minimum detection limit of each elisa kit for opn , hmgb-1 , ctgf , and pedf are 2.5 , 200 , 15.6 , and 40 picograms / ml ( pg / ml ) , respectively . the elisa plate readings were done using fluostar omega - miroplate reader from bmg labtech , offenburg , germany . the quantification of human opn , hmgb-1 , ctgf and pedf in the vitreous fluid was determined using elisa kits according to the manufacturer 's instruction . for each elisa kit , the undiluted standard serves as the highest standard and calibrator diluents serve as the blank . depending upon the detection range for each elisa kit and the expression level of the particular molecule , vitreous samples were either directly used or diluted with calibrator diluents supplied with elisa kit . for the measurement of opn , 100 l of 1000-fold diluted vitreous samples were added into each of the elisa plate for the analysis . for the quantification of hmgb1 , 60 l of diluent buffer was added to each well of microtiter plate followed by the addition of 40 l of standard , positive control , and vitreous fluid . for the measurement of ctgf , and pedf , 100 l of 3-fold and 6-fold diluted vitreous were used , respectively , for elisa assay . as instructed in the kit manual , vitreous samples were incubated into each well of elisa plates . antibodies against opn , hmgb1 , ctgf and pedf conjugated to horseradish peroxidase were added to each well of the elisa plate . the reaction was stopped by the addition of 2n sulfuric acid , and optical density was read at 450 nm in microplate reader . each assay was performed in duplicate . using the 4-parameter fit logistic ( 4-pl ) curve equation , the concentration for each sample was calculated after multiplying with the dilution factors to get the actual reading for each sample . because of the large variances that we had in our data , we used the nonparametric mann - whitney test to compare means from two independent groups , and the nonparametric kruskal - wallis test was used for conducting analysis of variance ( anova ) to compare means from more than two independent groups . post - anova pairwise comparisons of means were conducted using the kruskal - wallis test . for three groups , exploratory logistic regression analysis , involving forcing entry into a logistic model the variables of interest , was conducted to identify the angiogenic and fibrogenic factors that had a significant association with the studied diseases . the mean level of each variable was used as the cut - off value for high versus low levels . spss version 15 and programs lr and 3s from bio - medical data processing version 2007 ( bmdp 2007 ) statistical software ( cork technology pack , model farm road , cord , ireland ) were used for the statistical analyses . opn , hmgb1 , and pedf were detected in all vitreous samples from patients with rd , pvr , and pdr . ctgf was detected in all vitreous samples from patients with pdr and pvr and in 11 ( 36.6% ) samples from rd patients . mean levels of opn , hmgb1 , ctgf , and pedf in vitreous samples from pdr patients were significantly higher than those in rd patients ( p < 0.001 ; p = 0.002 ; p < 0.001 ; p < 0.001 , resp . ; mean levels of ctgf and pedf in vitreous samples from pvr patients were significantly higher than those in rd patients ( p < 0.001 ; p = 0.004 , resp . ; mean levels of opn and hmgb1 from pvr patients were higher than those in rd patients , but the differences between the means were not statistically significant ( p = 0.425 ; p = 0.571 , resp . ; mann - whitney test ) ( table 1 ) . comparison of mean levels of angiogenesis and fibrogenesis regulatory factors among active pdr patients , inactive pdr patients , and rd patients was conducted using the kruskal - wallis test , and the results are shown in table 2 . mean levels differed significantly between the 3 groups for opn ( p < 0.001 ) , hmgb1 ( p = 0.002 ) , ctgf ( p < 0.001 ) , and pedf ( p < 0.001 ) . post - anova pairwise comparisons of means indicated that the mean opn level was significantly higher in patients with active pdr than in rd patients ( z = 4.11 ) . for hmgb1 , the mean levels were significantly higher in patients with active pdr and patients with inactive pdr than in rd patients ( z = 2.92 ; z = 2.97 , resp . ) . for ctgf , the mean levels were significantly higher in patients with active pdr and patients with inactive pdr than those in rd patients ( z = 6.24 ; z = 4.2 , resp . ) . for pedf , the mean levels were significantly higher in patients with active pdr and patients with inactive pdr than in rd patients ( z = 6.89 ; z = 3.59 , resp . ) . in addition , mean pedf level was significantly higher in patients with active pdr than in patients with inactive pdr ( z = 2.57 ) . when patients with pdr were divided into those with or without traction retinal detachment , the mean levels of angiogenesis and fibrogenesis regulatory factors differed significantly between pdr patients with traction retinal detachment , pdr patients without traction retinal detachment , and rd patients for opn ( p = 0.002 ) , hmgb1 ( p = 0.003 ) , ctgf ( p < 0.001 ) , and pedf ( p post - anova pairwise comparisons of means indicated that , for opn , the mean levels in pdr patients with or without traction retinal detachment were significantly higher than those in rd patients ( z = 5.18 ; z = 5.64 , resp . ) . for hmgb1 , the mean levels in pdr patients with or without traction retinal detachment were significantly higher than those for rd patients ( z = 2.53 ; z = 3.26 , resp . ) . for ctgf , the mean levels in pdr patients with or without traction retinal detachment were significantly higher than those in rd patients ( z = 4.72 ; z = 5.87 , resp . ) . for pedf , the mean levels in pdr patients with or without traction retinal detachment were significantly higher than those in rd patients ( z = 5.17 ; z = 5.62 , resp . ) . pdr was significantly associated with high levels of hmgb1 ( odds ratio = 7.39 ; 95% confidence interval = 2.1125.9 ) , ctgf ( odds ratio = 11.4 ; 95% confidence interval = 2.8745.3 ) , and pedf ( odds ratio = 7.70 ; 95% confidence interval = 1.7733.5 ) . active pdr was significantly associated with high levels of ctgf ( odds ratio = 8.29 ; 95% confidence interval = 2.4428.1 ) and pedf ( odds ratio = 7.66 ; 95% confidence interval = 2.0029.4 ) . pdr with traction retinal detachment was significantly associated with high levels of hmgb1 ( odds ratio = 5.07 ; 95% confidence interval = 1.3618.9 ) . none of the studied angiogenesis and fibrogenesis regulatory factors was significantly associated with pvr . in patients with pdr , there were significant correlations between the vitreous fluid levels of pedf and the levels of opn ( r = 0.544 , p = 0.0011 ) , hgmb1 ( r = 0.719 , p < 0.001 ) , and ctgf ( r = 0.715 , p < 0.001 ) . in addition , there were significant correlations between the vitreous fluid levels of ctgf and the levels of opn ( r = 0.490 , p = 0.002 ) and hmgb1 ( r = 0.369 , p = 0.027 ) ( table 4 ) . in patients with pvr , there were significant correlations between the vitreous fluid levels of opn and the levels of hgmb1 ( r = 0.484 , p = 0.049 ) and pedf ( r = 0.559 , p = 0.020 ) ( table 4 ) . in this study , we examined the levels of the angiogenic and fibrogenic factors opn , hmgb1 , and ctgf and the antiangiogenic and antifibrogenic pedf in the vitreous fluid from patients with pdr , pvr , and rd and their relationship with pdr clinical disease activity . we found upregulation of opn , hmgb1 , ctgf , and pedf in the vitreous from pdr patients with active neovascularization compared with patients with quiescent pdr , pvr , and rd . exploratory logistic regression analysis identified a significant association between pdr and high levels of hmgb1 , ctgf , and pedf , between active pdr and high levels of ctgf and pedf , and between pdr with traction retinal detachment and high levels of hmgb1 . furthermore , there were significant correlations between the levels of pedf and the levels of opn , hmgb1 , and ctgf in patients with pdr and between the levels of opn and the levels of hmgb1 and pedf in patients with pvr . in the present study , we report that opn was significantly upregulated in the vitreous fluid from patients with pdr and that opn levels were nonsignificantly elevated in the vitreous fluid from patients with pvr . in a previous study , kase et al . demonstrated increased levels of opn in the vitreous fluid from patients with diabetic retinopathy ; however , they studied only 11 cases . our subgroup analysis showed that opn levels in vitreous samples from active pdr cases were higher than those in quiescent cases . these results are in agreement with a previous report in which we demonstrated that opn was expressed by vascular endothelial cells and stromal cells in pdr fibrovascular epiretinal membranes and by -sma - expressing myofibroblasts in pvr epiretinal membranes and that there was a significant correlation between the level of vascularization in pdr epiretinal membranes and the expression of opn . taken together , these findings suggest a role for opn in the progression of pdr . in vitro and in vivo studies demonstrated that opn is an important angiogenic factor [ 1518 ] . in addition , opn is required for the activation , migration , proliferation , and differentiation of fibroblasts into -sma - expressing myofibroblasts [ 1113 ] and is upregulated in several fibrotic diseases [ 9 , 11 , 12 , 14 ] . our results are consistent with previous reports showing that the proinflammatory cytokine opn plays a role in the development of diabetic vascular complications [ 9 , 4345 ] . the proinflammatory cytokine hmgb1 [ 2023 ] exhibits angiogenic [ 2427 ] and fibrogenic [ 2831 ] effects . another interesting role of hmgb1 in neovascularization is its ability to attract endothelial progenitor cells to sites of tissue injury and tumors to improve neovascularization . several studies showed overexpression of hmgb1 in other fibrotic disorders [ 28 , 29 , 31 ] . in vitro studies demonstrated that hmgb1 stimulated the proliferation and migration of fibroblasts [ 28 , 30 ] . in addition , exposure of epithelial cells to hmgb1 resulted in the transition from an epithelial to myofibroblast - like phenotype , with a significant increase in the mesenchymal markers -sma and vimentin . recently , arimura et al . demonstrated that hmgb1 stimulated the migration of human retinal pigment epithelial cells . in the present study , we report that hmgb1 was significantly upregulated in the vitreous fluid from patients with pdr , particularly in patients with active neovascularization in agreement with our previous report . furthermore , exploratory logistic regression analysis demonstrated significant associations between high levels of hmgb1 and all pdr and pdr with traction retinal detachment . in addition , in this study , we demonstrated that pvr eyes had a 3-fold increase in the vitreous level of hmgb1 when compared with those with rd . these results are in agreement with a previous report in which we demonstrated that hmgb1 was expressed by -sma - positive myofibroblasts in pvr epiretinal membranes . in addition to its role in mediating inflammation , angiogenesis , and fibrogenesis , several studies demonstrated that extracellular hmgb1 can aggravate tissue damage in neuronal tissue after ischemia [ 4850 ] . recently , various studies suggested an important role for the proangiogenic [ 35 , 36 ] and profibrotic [ 3234 , 51 ] ctgf in the development of chronic diabetes - related end - organ complications , including diabetic nephropathy . in the present study , ctgf levels in the vitreous fluid from patients with pdr and pvr our observations are consistent with previous reports showing increased ctgf levels in the vitreous fluid from patients with pdr [ 5355 ] and pvr . however , levels of ctgf in the vitreous fluid from patients with pdr were 3-fold higher than those in patients with pvr and levels of ctgf were particularly high in pdr patients with active neovascularization . in addition , exploratory logistic regression analysis demonstrated significant associations between high levels of ctgf and all pdr and pdr with active neovascularization . our results are not in agreement with a previous report , in which kuiper et al . showed that ctgf levels in the vitreous fluid from patients with pdr were significantly associated with the degree of fibrosis . our results are in agreement with a previous report in which we demonstrated increased expression of ctgf in the retinas from subjects with diabetes and that ctgf was expressed by vascular endothelial cells and -sma - expressing myofibroblasts in pdr epiretinal membranes and by myofibroblasts in pvr epiretinal membranes . in addition , there was a significant correlation between the level of vascularization in pdr epiretinal membranes and the expression of ctgf . the activity of pedf is selective in that it targets only new vessel growth and spares the preexisting vasculature [ 37 , 38 , 56 ] . the results of different studies on pedf expression in the vitreous from patients with pdr are conflicting . several studies found significant decrease in vitreous pedf levels in patients with pdr [ 5759 ] . other studies found that pedf levels in patients with pdr were not different from those in the controls [ 60 , 61 ] . however , duh and associates demonstrated significant increase of pedf levels in the vitreous from patients with active pdr . we do not have an explanation for the differences ; however , differences maybe method related . in the present study , the levels of pedf in the vitreous from patients with pdr and pvr were significantly greater than those in patients with rd . in addition , pedf levels in the vitreous from patients with pdr were higher than those in patients with pvr . our subgroup analysis showed that pedf levels were significantly higher in the vitreous from patients with active pdr compared with patients with quiescent pdr . furthermore , exploratory logistic regression analysis demonstrated significant associations between high levels of pedf and all pdr and active pdr . similarly , studies of other angiogenic eye diseases demonstrated increased levels of pedf in the aqueous humor in patients with choroidal neovascularization and macular edema secondary to branch retinal vein occlusion . in the present study , we demonstrated that the vitreous fluids from patients with pdr and pvr express different regulators of angiogenesis and fibrogenesis . recently , lenga et al . showed that opn is required for the presence of hmgb1 in the focal adhesions of fibroblasts and for ctgf expression by fibroblasts in response to the proinflammatory cytokine transforming growth factor-1 . these findings suggest that hmgb1 , and ctgf serve to mediate the immune response attributed to opn and that the interaction between opn , hmgb1 , and ctgf modulates fibroblast functions . the significant positive correlations between pedf levels and the levels of opn , hmgb1 , and ctgf in the vitreous from patients with pdr in the present study echoed the findings of matsuoka et al . that both pedf and the angiogenic vegf have been strongly expressed temporally and spatially in the retina of diabetic rats . similarly , there was a significant positive correlation between the expression of vegf and pedf in patients with choroidal neovascularization . our findings suggest that increased levels of pedf in the vitreous of patients with pvr and pdr , particularly active pdr , may be a response to counteract the activity of the angiogenic and fibrogenic factors . in addition , our data suggest that a positive regulatory feedback loop may exist in pdr , such that increased opn , hmgb1 , and ctgf induced synthesis of pedf . in conclusion , our data suggest that the upregulation of opn , hmgb1 and ctgf contribute to the pathogenesis of proliferative vitreoretinal disorders and that increased levels of pedf may counteract the activity of angiogenic and fibrogenic factors during the progression of pdr and pvr . the opn / hmgb1/ctgf pathway maybe a novel therapeutic target to inhibit progression of pdr and pvr .

the aim of this study was to determine the levels of the angiogenic and fibrogenic factors osteopontin ( opn ) , high - mobility group box-1 ( hmgb1 ) , and connective tissue growth factor ( ctgf ) and the antiangiogenic and antifibrogenic pigment epithelium - derived factor ( pedf ) in the vitreous fluid from patients with proliferative diabetic retinopathy ( pdr ) , proliferative vitreoretinopathy ( pvr ) , and rhegmatogenous retinal detachment with no pvr ( rd ) . vitreous samples from 48 pdr , 17 pvr and 30 rd patients were studied by enzyme - linked immunosorbent assay . opn , hmgb1 , ctgf , and pedf levels were significantly higher in pdr patients than in rd patients ( p < 0.001 ; 0.002 ; < 0.001 ; < 0.001 , resp . ) . ctgf and pedf levels were significantly higher in pvr patients than in rd patients ( p < 0.001 ; 0.004 , resp . ) . exploratory logistic regression analysis identified significant associations between pdr and high levels of hmgb1 , ctgf and pedf , between pdr with active neovascularization and high levels of ctgf and pedf , and between pdr with traction retinal detachment and high levels of hmgb1 . in patients with pdr , there were significant correlations between the levels of pedf and the levels of opn ( r = 0.544 , p = 0.001 ) , hmgb1 ( r = 0.719 , p < 0.001 ) , and ctgf ( r = 0.715 , p < 0.001 ) . in patients with pvr , there were significant correlations between the levels of opn and the levels of hmgb1 ( r = 0.484 , p = 0.049 ) and pedf ( r = 0.559 , p = 0.02 ) . our findings suggest that opn , hmgb1 , and ctgf contribute to the pathogenesis of proliferative vitreoretinal disorders and that increased levels of pedf may be a response to counterbalance the activity of angiogenic and fibrogenic factors in pdr and pvr .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

denture stability is believed widely to be related to resistance against other forces like oblique and anterior - posterior forces . the patient s satisfaction is directly influenced by the amount of denture retention as it has been shown through several studies [ 24 ] . the need for correcting the patient s problems with faulty denture is an inevitable consequence of retention failure and residual ridge resorption . several different strategies have been introduced to overcome the problem , one of which is the use of dental implants . three distinct methods of prosthetic treatments based on implants in the lower jaw are : implant supported fixed prosthesis ( fp-1 , fp-2 , fp-3)removable implant supported overdentures ( rp-4)combined implant - tissue supported over - dentures ( rp-5 ) . implant supported fixed prosthesis ( fp-1 , fp-2 , fp-3 ) removable implant supported overdentures ( rp-4 ) combined implant - tissue supported over - dentures ( rp-5 ) . the third of the above mentioned methods has the advantage of reducing the number of implants with a more simplified prosthetic approach . intra - osseous implants are considered as acceptable abutments in conjunction to attachments for efficient retention of the overdentures . factors involved in choosing the type of attachment include available space , maintenance necessity , spare part availability and ease of change , force distribution to the soft tissue or implant and the level of retention . another important fact is the level of wear seen in attachments following the use of overdenture . the aim of this research was to compare the effects of three different attachments ; nobel biocare ball ( nbb ) , nobel biocare bar and clip ( nbbc ) and sterngold era red ( erar ) on the retention and resistance of implant - supported overdentures . this in vitro investigation was performed on a total of 15 samples divided into three groups of five . each group was designed to include the attachments with erar ( 0 degree era micro np abutment only , 1 mm cuff and micro era male - red overdenture 5 , sterngold , usa ) , the attachments with nbbc ( gold adapt & gold abutment bar and clip attachment , nobel biocare , sweden ) and attachments with nbb ( ball abutment titanium , branemark system , rp 1 mm and plastic cap , nobel biocare , sweden ) . all samples were tested for the retention and resistance of overdenture on vertical , oblique and anterior - posterior tensile force load . recordings were made after the first insertion of the overdenture ( sit . 1 ) and also following 100 times of insertion / removal process ( sit . a pair of implants , 3.7510 mm , ( mk iii , branemark system , nobel biocare , sweden ) was inserted at both sides of the midline at the symphysis region in a parallel position . a milling machine ( paraskop m , bremen , germany ) was employed to avoid any fault in the angulation of insertion ( fig 1-a ) . a framework of cobalt chromium alloy ( wiironit , bego , bremen , germany ) was fabricated to fit on the two implants and the model . metallic structure was used for its durability and stability in all stages of the experiment . four stainless steel bands were soldered to the framework , which was positioned at the anterior part of the overdenture close to the implants . the others were established on the midline in the buccal and lingual side of the ridge . the overdenture was attached to the testing machine through the hooks ( fig 1-b ) . a prototype of overdenture housing was then constructed over the metallic overdenture by use of a light cure acrylic resin ( vlmc , vita , badsackingen , germany ) ( fig 1-c ) . all overdenture housings were duplicated from the prototype and fabricated by use of a self cure acrylic resin ( orthocryl , dentaurum , ispringen , germany ) ( fig 1-d ) . therefore , an acrylic overdenture housing was made for each sample ( totally 15 ) . one part of the attachment was attached into the overdenture housing and the other part , the abutment , was screwed on the implant ( fig 1-e ) . after the confirmation of appropriate sitting of the overdenture and adaptation of attachments , a series of measurements were started for each sample . recordings were made at 51 mm / min speed similar to that of denture move at bite and mastication . vertical force was measured to assess the retention while oblique and anterior - posterior forces were evaluated for resistance testing . maximum dislodging force ( mdf ) was recorded at the point of complete detachment of the overdenture from the model . data were finally subjected to an analysis using one - way anova test as well as tukey s test . based on the results derived from the collected data , the clinical behavior of three different attachments tested were not similar during application of different forces . as the data was normally distributed , one - way anova test was performed to compare the differences among three attachments for their force tolerance . at the beginning ( sit . 1 ) , tukey s test revealed that there was significant differences between erar / nbb , erar / nbbc and nbbc / nbb for vertical and oblique tensile strengths ( p<0.001 ) . this result was reemphasized by one - way anova test ( p<0.001 ) . therefore , erar had the highest retention and oblique resistance and nbb had the least . for anterior posterior tensile strength , tukey s test showed significant differences between erar / nbbc and erar / nbb ( p<0.001 ) , while there was no significant difference between nbbc and nbb ( p=0.528 ) . so erar had the highest anterior - posterior resistance but nbbc and nbb had the same . figs 24 show mdf measured for these attachments under vertical , oblique and anterior - posterior tensile forces in both situations ( sit . 1 and 2 ) . 2 , these data were statistically significant in their differences among different attachments for vertical and oblique tensile strengths , using one - way anova test ( p<0.001 ) . however , tukey s test on nbbc / nbb showed no statistically significant difference for vertical ( p=0.198 ) and oblique tensile strengths ( p=0.462 ) . erar had the highest retention and oblique resistance , while nbbc and nbb had the same . a further kruskal - wallis test performed on three groups in anterior - posterior tensile strength showed significant differences ( p<0.01 ) . the paired t - test performed to evaluate the condition of the three attachments in two different situations ( sit . 1 and sit . this indicated that the insertion / removal of overdenture for 100 times caused the differences between sit . 1 and sit . 2 in all three groups ( erar , nbbc and nbb ) . over the past three decades the use of implant - tissue supported overdenture has raised considerably among dentists . it is mainly related to the rise in patient awareness and availability of attachments to the dentist . several force directions are considered as applied in the mouth during function of the overdenture with retention being the most critical issue . two important points of view are considered on the retention of prosthesis , including the patient s feeling and the dentist s assessment . the latter which is measured during maximum load force application was surveyed in this research . 1 , erar has the highest resistance against vertical , oblique and anterior - posterior tensile forces . this means that overdenture has a higher retention and resistance potential with a significant difference from the other two attachments . this difference could be due to the design of erar as being intra - radicular . this is explained further by a female segment on the abutment of the attachment in addition to high and parallel abutment walls ( 5 mm length ) . the nbb showed the least mdf against vertical , oblique and anterior - posterior tensile forces . this is concluded to be due to the extra - radicular design in addition to free movement of the male component inside the female component . retention and resistance of nbb was in the least level while erar was at the most with significant differences ( p<0.001 ) . anterior - posterior resistance of erar was also at the highest level as mentioned before , while no differences were established between nbbc and nbb ( p=0.528 ) . petropoulos has reported a roughly similar result on nbb and nbbc characteristics while results reported on erar were different from the result achieved in this research . this could be due to the use of sterngold era of intra - radicular type which was not the case in the earlier mentioned study . 2 ) showed a considerable reduction in retention and resistance of overdenture on attachments possibly due to constant wear ( p<0.01 ) . this difference was statistically significant even in several insertion/ removal tests which the level of mdf against vertical , oblique and anterior - posterior forces was higher in erar than the others ( p<0.001 ) . in sit . 2 , there were no differences in retention and oblique resistance of nbb and nbbc ( p=0.198 , p=0.462 ) , but the anterior - posterior resistance of nbb was more than nbbc ( p<0.01 ) . it could also be explained by the material the attachments were made of , resulting in a higher resistance to wear in nbb compared to nbbc . based on the results of this research , clinical behaviors of these attachments ( erar , nbbc , nbb ) have been well identified . therefore , the dentist can choose an appropriate attachment in implant - tissue supported overdentures according to the clinical situation . it is recommended to use erar attachment when a high amount of retention and resistance is necessary . for example , for a patient who has severe residual ridge resorption or used to remove and insert the denture frequently , erar attachment should be applied . nbb and nbbc attachments would be the choice when there is low demand of retention and resistance for overdenture . insertion and removal of overdenture gradually causes loss of retention and resistance due to the attachment s wear .

objective : retention and resistance of the implant - tissue supported overdenture may be affected by the type of attachment . the aim of this research was to compare the retention and resistance of nobel biocare ball ( nbb ) , nobel biocare bar and clip ( nbbc ) and sterngold era red ( erar ) attachments on an implant - tissue supported overdenture model.materials and methods : the attachment samples were divided into 3 groups of nbb , nbbc , and erar ( 5 samples in each group ) . two parallel nobel biocare branemark implants were placed symmetrically at the symphysis region of a mandibular test model . a metallic overdenture was fabricated precisely adapted to the model and attached to a zwick testing machine ( crosshead speed of 51 mm / min ) . dislodging tensile forces were applied in three vertical , oblique , anterior - posterior directions and two situations , at the beginning and after 100 times of insertion / removal of the overdenture , for each sample . the maximum dislodging force was measured . a one - way anova test was employed followed by tukey s test.results:erar was the most retentive and resistant in both situations . nbb and nbbc showed the same anterior - posterior resistance at the beginning . all test groups represented a large amount of retention and resistance loss after the insertion / removal of the overdenture , while nbbc showed a higher loss of anterior - posterior resistance than nb.conclusion:a highest level of retention and resistance was seen in erar . the retention and resistance were affected by the wear of attachments .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

snapping hip , also known as coxa saltans , is characterized by an audible snapping sound or sensation felt when the hip is in motion , and may be associated with pain1 ) . of different types , external snapping hip is accompanied by popping noise when the posterior border of the iliotibial band slides over the greater trochanter as the hip is flexed or extended , and confirmed a positive ober 's test2 ) . although snapping hip is usually painless , this syndrome may be painful when greater trochanteric bursitis is associated . for most cases , conservative and medical treatment showed good treatment response . when symptoms persist despite different conservative treatment , surgical intervention is considered . surgical treatment options are n - plasty with trochanteric bursectomy , z - plasty and others . although these invasive methods are effective in improving pain and snapping sound , skin incision leaves a large scar and the trendelenburg gait may follow as a complication3,4,5,6,7,8,9,10 ) . ilizaliturri et al.5 ) obtained comparable clinical results compared to open surgical techniques by performing arthroscopic iliotibial band release in 10 patients ( 11 cases ) . however , no literature has been reported on evaluating clinical results of arthroscopy for snapping hip . therefore , this study aimed to indentify benefits of arthroscopic treatment by evaluating clinical results of iliotibial band release and gluteal sling release performed arthroscopically and comparing the results with those of previous studies . this study was performed retrospectively by including 7 snapping hip patients who underwent arthroscopic iliotibial band release and gluteal sling release by a single surgeon from september 2011 to june 2013 . subjects were 2 men and 5 women , and 3 patients had snapping hip on both sides . the mean age at the time of surgery was 35 years ( range , 25 - 49 years ) , and the mean follow - up was 19 months ( range , 12 - 33 months ) . the surgical intervention was done for patients who were refractory to conservative treatment for at least 3 months . the average time period from snapping sound recognition to arthroscopic treatment was 3 years ( range , 2 - 10 years ) . repetitive pain over the greater trochanter with snapping sound was detected in all cases , and snapping sound was externally visible and audible in most cases . some patients complained of symptoms of pseudosubluxation appearing as a subjective feeling of impending hip dislocation . two patients ( 4 cases ) were unable to adduct both knees in 90 of hip flexion or cross one leg over the other among patients with external snapping hip on both sides . this study excluded patients with sequelae of childhood hip disease , prior hip fractures , a history of prior hip surgery . this study also excluded patients with other hip diseases confirmed by preoperative radiographic and physical exams , and patients who underwent simultaneous arthroscopic treatment for intra - articular pathologies due to femoroacetabular impingement syndrome or other causes . two arthroscopic portals were made on the superior and inferior aspects of the greater trochanter . a trocar was inserted through a 6 mm incision made at 1 cm below to the vastus lateralis ridge , and positioned between the greater trochanter and iliotibial band to secure a space between them by gently moving the trocar . the space was maintained by injecting about 40 ml of saline solution , and the second portal was made at 1 cm above the proximal greater trochanter by inserting the arthroscope and viewing inside ( fig . , a parallel incision was made to orientation of the iliotibial band , and then the iliotibial band was incised vertically before and after isolating it . subsequently , a criss - cross pattern of incised line was made , and a diamond - shaped defect was created by gradually cutting the incised line to four directions using the shaver and high frequency ablator . the release was performed until snapping symptom disappeared through adduction movement and flexion - extension exercise of the hip intra - operatively . the findings of thickening and hyperemia in the greater trochanteric bursa were observed in all cases . additional gluteal sling release was performed in insertion of the gluteus maximus in 2 patients with hip adduction difficulty ( fig . 2 ) . to reduce loading imposed to the iliotibial band and alleviate pain during ambulation , patients began ambulating using crutches on the first postoperative day without limitation of weight bearing . the subjects used a continuous passive motion ( cpm ) device for the first month postoperatively to prevent soft tissue adhesion around the trochanteric area and restore early range of motion in the hip . the patients were instructed to use the cpm device consistently at home after being discharged on the second postoperative day . they were instructed to ambulate using crutches for a month , and restricted from active abduction exercise over the first 6 postoperative weeks . the subjects were allowed to begin active abduction exercise after the 6 weeks , and physical activities and exercise at preoperative levels . to evaluate the degree of clinical improvement and hip function , the visual analog scale ( vas ) and modified harris hip score ( mhhs ) were measured preoperatively and at the last follow - up . the presence of hip abduction weakness and ambulation abnormality was examined by performing the trendelenburg test on the sixth postoperative week and third postoperative month . in addition , the presence of iliotibial band tear and complications such as surgical site infection was checked postoperatively , and the recurrence of limping and snapping sound was evaluated at final follow - up . this study was performed retrospectively by including 7 snapping hip patients who underwent arthroscopic iliotibial band release and gluteal sling release by a single surgeon from september 2011 to june 2013 . subjects were 2 men and 5 women , and 3 patients had snapping hip on both sides . the mean age at the time of surgery was 35 years ( range , 25 - 49 years ) , and the mean follow - up was 19 months ( range , 12 - 33 months ) . the surgical intervention was done for patients who were refractory to conservative treatment for at least 3 months . the average time period from snapping sound recognition to arthroscopic treatment was 3 years ( range , 2 - 10 years ) . repetitive pain over the greater trochanter with snapping sound was detected in all cases , and snapping sound was externally visible and audible in most cases . some patients complained of symptoms of pseudosubluxation appearing as a subjective feeling of impending hip dislocation . two patients ( 4 cases ) were unable to adduct both knees in 90 of hip flexion or cross one leg over the other among patients with external snapping hip on both sides . this study excluded patients with sequelae of childhood hip disease , prior hip fractures , a history of prior hip surgery . this study also excluded patients with other hip diseases confirmed by preoperative radiographic and physical exams , and patients who underwent simultaneous arthroscopic treatment for intra - articular pathologies due to femoroacetabular impingement syndrome or other causes . two arthroscopic portals were made on the superior and inferior aspects of the greater trochanter . a trocar was inserted through a 6 mm incision made at 1 cm below to the vastus lateralis ridge , and positioned between the greater trochanter and iliotibial band to secure a space between them by gently moving the trocar . the space was maintained by injecting about 40 ml of saline solution , and the second portal was made at 1 cm above the proximal greater trochanter by inserting the arthroscope and viewing inside ( fig . , a parallel incision was made to orientation of the iliotibial band , and then the iliotibial band was incised vertically before and after isolating it . subsequently , a criss - cross pattern of incised line was made , and a diamond - shaped defect was created by gradually cutting the incised line to four directions using the shaver and high frequency ablator . the release was performed until snapping symptom disappeared through adduction movement and flexion - extension exercise of the hip intra - operatively . the findings of thickening and hyperemia in the greater trochanteric bursa were observed in all cases . additional gluteal sling release was performed in insertion of the gluteus maximus in 2 patients with hip adduction difficulty ( fig . to reduce loading imposed to the iliotibial band and alleviate pain during ambulation , patients began ambulating using crutches on the first postoperative day without limitation of weight bearing . the subjects used a continuous passive motion ( cpm ) device for the first month postoperatively to prevent soft tissue adhesion around the trochanteric area and restore early range of motion in the hip . the patients were instructed to use the cpm device consistently at home after being discharged on the second postoperative day . they were instructed to ambulate using crutches for a month , and restricted from active abduction exercise over the first 6 postoperative weeks . the subjects were allowed to begin active abduction exercise after the 6 weeks , and physical activities and exercise at preoperative levels . to evaluate the degree of clinical improvement and hip function , the visual analog scale ( vas ) and modified harris hip score ( mhhs ) were measured preoperatively and at the last follow - up . the presence of hip abduction weakness and ambulation abnormality was examined by performing the trendelenburg test on the sixth postoperative week and third postoperative month . in addition , the presence of iliotibial band tear and complications such as surgical site infection was checked postoperatively , and the recurrence of limping and snapping sound was evaluated at final follow - up . the vas decreased from 6.8 ( range , 6 - 9 ) preoperatively to 0.2 ( range , 0 - 2 ) postoperatively , and the mhhs improved from 68.2 ( range , 43 - 73 ) to 94.8 ( range , 89 - 100 ) after surgery . of 7 patients , 6 were pain - free at final follow - up , but a patient complained of mild pain at about vas score of 2 . hip adduction angles improved from 40 and 30 , respectively , to 0in two patients with adduction difficulty . moreover , they were able to cross one leg over the other in a sitting position . all patients had a negative trendelenburg 's test on the sixth postoperative week , and no patient had limping at the last follow - up . all patients were satisfied with scar aesthetically , and there was no recurrence of snapping sound . external snapping hip commonly occurs due to contracture and tension of the iliotibial band , which results in a positive ober 's test . the ober 's test is performed to identify tightness of the illiotibial band , and can be indicative for adduction difficulty when putting legs down suddenly after knee flexion at 90 and hip abduction in a lateral position . however , snapping sound can rarely occur due to contracture and tension of multiple fibrous bands of the gluteus maximus . in this case , although snapping hip is usually painless , this syndrome may be painful when greater trochanteric bursitis is associated . the greater trochanteric bursa is located between the greater trochanter , belonging to insertion of the gluteus medius and origin of the vastus lateralis , and iliotibial band , and pain can be generated from inflammatory response caused by snapping12 ) . most patients with snapping hip show good results with stretching exercise , antiinflammatory analgesic use , or greater trochanteric bursa injection3,4,5,8,13,14 ) . however , patients may be unable to sit cross - legged or adduct both legs in a sitting position due to pain like those with adduction difficulty in this study . when pain and discomfort persist despite conservative treatment , although a wide range of surgical techniques have been reported in previous literature , open surgical approaches have been most commonly introduced3,4,9,15,16 ) . after ilizaliturri et al.5 ) have addressed the result of arthroscopic treatment , successive results have been continuously reported in international studies1,8 ) . although surgical management of external snapping hip showed relatively favorable results , snapping or pain persisted postoperatively in some cases requiring reoperation3,4,5,6,7,15)(table 1 ) . with an average of 19-month follow - up after arthroscopic surgery , snapping symptom although a patient ( 1 case ) complained of mild pain at about vas score of 2 , the patient had no physical limitations in activities of daily living . although specific hip arthroscopic instruments should be available to treat intra - articular pathologies , knee or shoulder - length arthroscopic tools can be used to treat snapping hip . compared to an open z - plasty release , arthroscopy has a disadvantage of expensive cost . although not happened in this study , a defect which was created during iliotibial band release and not reconstructed posteoperatively had a risk of abduction weakness or depression on the surface of the thigh1 ) . limitations of this study were the relatively small sample size and short follow - up period and a retrospective study design . since snapping hip improves with conservative management in most patients , only a few patients are eligible to receive surgical treatment and it is difficult to include a large number of subjects7 ) . however , the long - term follow - up is anticipated to be favorable in identifying relapse of symptoms and the risk of complications in order to prove the effectiveness of arthroscopic intervention . another limitation was that this study did not measure hip abductor muscle strength between the affected and healthy sides before and after the surgery . since the iliotibial band acts as a static stabilizer of the hip , a diamond - shaped release of the iliotibial band weakens abductor muscle strength of the affected side . as a result , therefore , measuring abductor muscle strength of both sides pre- and post - operatively is thought to be helpful in analyzing the effect of iliotibial band release on changes in abductor muscle strength . however , this study was able to measure changes in muscle strength indirectly by regularly examining ambulation impairment caused by weakened abductor muscle strength by performing the trendelenburg test on the sixth postoperative week and third postoperative month . patients with external snapping hip recalcitrant to conservative management underwent arthroscopic treatment . despite a short mean follow - up of 19 months , we anticipate the successful treatment of patients with adduction difficulty due to contracture and tension of the gluteus maximus .

purposethe purpose of this study was to evaluate the clinical outcome of arthroscopic treatment for recalcitrant external snapping hip.materials and methodsbetween september 2011 and june 2013 , we evaluated 7 patients ( 10 cases ) with snapping hip who were refractory to conservative treatments for at least 3 months . two patients ( 4 cases ) were impossible to adduct both knees in 90of hip flexion . surgery was done in lateral decubitus position , under spinal anesthesia . we made 2 arthroscopic portals to operate the patients , and used cross - cutting with flap resection technique to treat the lesion . we performed additional gluteal sling release in those 2 patients ( 4 cases ) with adduction difficulty . average follow - up length was 19 months ( range , 12 - 33 months ) . clinical improvement was evaluated with visual analog scale ( vas ) , modified harris hip score ( mhhs ) , and also investigated for presence of limping or other complications as well.resultsthe vas decreased from 6.8 ( range , 6 - 9 ) preoperatively to 0.2 ( range , 0 - 2 ) postoperatively , and the mhhs improved from 68.2 to 94.8 after surgery . none of the patients complained of post - operative wound problem or surgical complications.conclusionthe clinical outcome of arthroscopic treatment for recalcitrant external snapping hip was encouraging and all patients were also satisfied with the cosmetic results .

INTRODUCTION MATERIALS AND METHODS 1. Materials 2. Surgical Procedures 3. Postoperative Management 4. Clinical Evaluation RESULTS DISCUSSION CONCLUSION

colchicine is a widely used drug for treatment of familial mediterranean fever ( fmf ) . clinical manifestations of colchicine intoxication include abdominal cramps , diarrhea , myotoxicity , hemolytic anemia and ( pan)cytopenia . a 9-years - old female patient , receiving colchicine for four months with a dose of 1 mg / day for fmf , was admitted to a hospital with gastrointestinal disturbance four days ago . she was referred to our hospital with liver and kidney dysfunction . at the initial physical examination her laboratory results revealed : hemoglobin 13.6 g / dl ; leukocyte , 9.610/l ; thrombocyte 5710/l ; fibrinogen 157 mg / dl ( 230 - 500 ) ; pt 26.1 sec ; inr 2.3 ; aptt 43.8 sec ; ldh 5329 iu / l ; ferritin 2320 g / l ( 10 - 55 ) ; triglyceride 7.1 mmol / l ( 0.32 - 1.46 ) . the patient was taken to intensive care unit ; vitamin k and fresh frozen plasma were administered . on the second day of her hospitalization hemoglobin was 9.6 g / dl ; leukocyte was 2.310/l ; neutrophil was 0.7210/l and thrombocyte was 2410/l . on peripheral blood smear , loss of lobulation in neutrophils was detected ( pelger - hut anomaly ) . laboratory tests revealed ferritin 54,632 g / l , triglyceride 7.4 mmol / l , and fibrinogen 63 mg / dl , serum creatinine 3.2 mg / dl ( 0.4 - 1.4 ) , serum blood urea nitrogen 43 mg / dl ( 6 - 21 ) , serum sodium 131 meq / l ( 134 - 148 ) , potassium 5.2 meq / l ( 3 - 4.8 ) , calcium 8.1 mg / dl ( 7.9 - 9.9 ) , and inorganic phosphate 2.1 mg / dl ( 2.4 - 4.7 ) . at the bone marrow aspiration , many pelger - hut cells were observed . soluble cd25 level was 2840 u / ml ( 220 - 710 ) , and creatine kinase level was 18,959 when the history of colchicine intoxication was detailed , during fmf attack - free period of five days prior to admission to the hospital , it is learned that the patient was upset over a quarrel between her parents , and that she had taken approximately 30 pills of her drug ( total of 15 mg ; 0.5 mg / kg body weight ) , at which vomiting and diarrhea complaints were started . the patient was administered hlh-2004 protocol and plasma exchange is applied twice . on the second day of therapy , severe hypotension , renal failure and av complete block occurred . the patient was resistant to all therapies and had died at the fourth day of her hospitalization . in the colchicine intoxication , the most affected organs are those that have a rapid cell turnover . liver damage , renal failure , arrhythmias , neuromuscular disturbances , and bone marrow depression can be detected in the later stage . the worst predicted doses were classified regarding the risk of toxicity as sub - toxic ( < 0.5 mg / kg ) , toxic ( 0.5 - 0.8 mg / kg ) , and lethal ( > 0.8 mg / kg ) doses . however , cases with cardiogenic shock and death were also reported with doses less than 0.5 mg / kg . although our patient had taken a dose of 0.5 mg / kg body weight colchicine , the patient died due to severe myelosupression , hlh and multi - organ failure . pelger - hut anomaly is a state of limitation in segmentation of lobes in neutrophils . a pelger - hut - like change in granulocyte morphology may occur as an acquired condition in several diseases . this same finding may be produced by certain drugs such as colchicine . on the peripheral blood smear of our patient , pelger - hut cells were detected in myeloid series , and as the history of colchicine use was detailed , it is learned that the patient had taken lots of colchicine pills . on the examination of concurrently taken bone marrow , pelger - hut cells were also detected in the myeloid series as well as hemophagocytosis . for this reason , we suggest that hlh was not due to her disease . to our knowledge , this is the first reported case of a patient with hlh associated with colchicine intoxication . in conclusion , if patients with colchicine intoxication present with pelger - hut anomaly in addition with unexplained fever , cytopenia , organomegaly , and biochemical changes , hlh should be investigated for prompt diagnosis and treatment .

colchicine is frequently used in the treatment of familial mediterranean fever ( fmf ) . first symptoms of colchicine intoxication are gastrointestinal disturbances , such as abdominal cramps , diarrhea , pancytopenia and so on . herein , we report a female fmf patient with pancytopenia and hemophagocytic lymphohitiocytosis ( hlh ) , following colchicine intoxication for committing suicide . to our knowledge , this is the first reported case of a patient with hlh associated with colchicine intoxication .

Introduction Case Report Discussion and Conclusions

the study was a prospective , randomized , controlled clinical trial ( iranian clinical registration number 138811182370n6 ) , and conducted at two tertiary - care urban medical center . patients with end - stage renal disease from december 2009 to march 2010 were included in the study . inclusion criteria included age more than 18 , being dialyzed with central tunneled catheter , med comp ( only if placed in the internal jugular vein ) , with a maximum time of one month post catheterization , dialysis 3 times a week and having accepted to participate in the study . exclusion criteria were allergy to cefotaxime , antibiotic treatment within 2 weeks prior to enrollment , patients requiring a surrogate decision maker , catheters with blood flow rates less than 300 ml / min , or requiring frequent thrombolytic solution dwells in the catheter lumen because of malfunction . at the beginning of the study 38 patients were eligible to participate in the study , but 30 of them were consented ( 20.6% ) . enrolled patients were randomly assigned by using a block computerized randomization protocol into two groups of 15 patients . in intervention group , we used cefotaxime , at a concentration of 10 mg / ml as the experimental antibiotic lock solution . solutions were prepared by dissolving sterile cefotaxime sodium powder in normal saline for injection to reach a concentration of 10 mg / ml for cefotaxime . then mixture of 1.5 cc cefotaxime ( 10 mg / ml ) and 1.5 cc heparin solution ( 5,000 u / ml ) ( ce / hs ) , was prepared in a syringe using aseptic precautions to fill 1.6 ml in the venous and 1.4 ml in the arterial lumen of the catheter at the end of each dialysis session ( exact volume of each venous and arterial port so that cefotaxime would not inter the blood stream , preventing its systemic effect and microbial resistance ) . in control group we just filled 1.6 ml and 1.4 ml of standard heparin solution ( hs ; 5,000 u / ml ) in the venous and arterial lumens respectively . in both groups , the catheter exit - site was washed with antiseptic solution at the initiation and termination of each session , and covered by topical mupirocin and dry sterile gauze during dialysis intervals . antibiotic solutions were stored in the refrigerator and nurses were trained to instill the solution into each of the two ports of the hd catheter at the end of each dialysis session , and withdraw it immediately before the next dialysis session . all the included patients received dialysis three times a week with the same catheter and the same exit site care , and they all had the same duration of catheter insertion . enrolled patients were routinely monitored clinically for symptoms and signs of infection , during each session of dialysis . blood cultures were drawn if patients had fever , chills , rigors , sweats , change in mental status , or exit - site infection4 . other causes of infection were ruled out . the study protocol required peripheral and catheter blood cultures and an exit site swab to be collected , if clinically indicated . if the catheter was removed , the catheter tip was cultured . patients with positive blood culture results were treated with systemic antibiotics driven by type of organism and antibiotic susceptibility . blood stream infections were defined by the cdc ( centers for disease control ) criteria21 . definite blood stream infection was defined as the same organism from a semiquantitative culture of the catheter tip ( 15 colony - forming units / catheter segments ) or catheter blood sample versus peripheral blood sample in a symptomatic patient with no other apparent source of infection22 . if colony count of catheter were 5 times more than blood sample , blood stream infection were established720 . . statistical analysis was performed with independent sample t - test and chi - square tests . a hundred and fifty patients with end - stage renal disease were assessed for eligibility . the study was a prospective , randomized , controlled clinical trial ( iranian clinical registration number 138811182370n6 ) , and conducted at two tertiary - care urban medical center . patients with end - stage renal disease from december 2009 to march 2010 were included in the study . inclusion criteria included age more than 18 , being dialyzed with central tunneled catheter , med comp ( only if placed in the internal jugular vein ) , with a maximum time of one month post catheterization , dialysis 3 times a week and having accepted to participate in the study . exclusion criteria were allergy to cefotaxime , antibiotic treatment within 2 weeks prior to enrollment , patients requiring a surrogate decision maker , catheters with blood flow rates less than 300 ml / min , or requiring frequent thrombolytic solution dwells in the catheter lumen because of malfunction . at the beginning of the study 38 patients were eligible to participate in the study , but 30 of them were consented ( 20.6% ) . enrolled patients were randomly assigned by using a block computerized randomization protocol into two groups of 15 patients . in intervention group , we used cefotaxime , at a concentration of 10 mg / ml as the experimental antibiotic lock solution . solutions were prepared by dissolving sterile cefotaxime sodium powder in normal saline for injection to reach a concentration of 10 mg / ml for cefotaxime . then mixture of 1.5 cc cefotaxime ( 10 mg / ml ) and 1.5 cc heparin solution ( 5,000 u / ml ) ( ce / hs ) , was prepared in a syringe using aseptic precautions to fill 1.6 ml in the venous and 1.4 ml in the arterial lumen of the catheter at the end of each dialysis session ( exact volume of each venous and arterial port so that cefotaxime would not inter the blood stream , preventing its systemic effect and microbial resistance ) . in control group we just filled 1.6 ml and 1.4 ml of standard heparin solution ( hs ; 5,000 u / ml ) in the venous and arterial lumens respectively . in both groups , the catheter exit - site was washed with antiseptic solution at the initiation and termination of each session , and covered by topical mupirocin and dry sterile gauze during dialysis intervals . antibiotic solutions were stored in the refrigerator and nurses were trained to instill the solution into each of the two ports of the hd catheter at the end of each dialysis session , and withdraw it immediately before the next dialysis session . all the included patients received dialysis three times a week with the same catheter and the same exit site care , and they all had the same duration of catheter insertion . enrolled patients were routinely monitored clinically for symptoms and signs of infection , during each session of dialysis . blood cultures were drawn if patients had fever , chills , rigors , sweats , change in mental status , or exit - site infection4 . other causes of infection were ruled out . the study protocol required peripheral and catheter blood cultures and an exit site swab to be collected , if clinically indicated . if the catheter was removed , the catheter tip was cultured . patients with positive blood culture results were treated with systemic antibiotics driven by type of organism and antibiotic susceptibility . blood stream infections were defined by the cdc ( centers for disease control ) criteria21 . definite blood stream infection was defined as the same organism from a semiquantitative culture of the catheter tip ( 15 colony - forming units / catheter segments ) or catheter blood sample versus peripheral blood sample in a symptomatic patient with no other apparent source of infection22 . if colony count of catheter were 5 times more than blood sample , blood stream infection were established720 . . statistical analysis was performed with independent sample t - test and chi - square tests . a hundred and fifty patients with end - stage renal disease were assessed for eligibility . the study was a prospective , randomized , controlled clinical trial ( iranian clinical registration number 138811182370n6 ) , and conducted at two tertiary - care urban medical center . patients with end - stage renal disease from december 2009 to march 2010 were included in the study . inclusion criteria included age more than 18 , being dialyzed with central tunneled catheter , med comp ( only if placed in the internal jugular vein ) , with a maximum time of one month post catheterization , dialysis 3 times a week and having accepted to participate in the study . exclusion criteria were allergy to cefotaxime , antibiotic treatment within 2 weeks prior to enrollment , patients requiring a surrogate decision maker , catheters with blood flow rates less than 300 ml / min , or requiring frequent thrombolytic solution dwells in the catheter lumen because of malfunction . at the beginning of the study 38 patients were eligible to participate in the study , but 30 of them were consented ( 20.6% ) . enrolled patients were randomly assigned by using a block computerized randomization protocol into two groups of 15 patients . in intervention group , we used cefotaxime , at a concentration of 10 mg / ml as the experimental antibiotic lock solution . solutions were prepared by dissolving sterile cefotaxime sodium powder in normal saline for injection to reach a concentration of 10 mg / ml for cefotaxime . then mixture of 1.5 cc cefotaxime ( 10 mg / ml ) and 1.5 cc heparin solution ( 5,000 u / ml ) ( ce / hs ) , was prepared in a syringe using aseptic precautions to fill 1.6 ml in the venous and 1.4 ml in the arterial lumen of the catheter at the end of each dialysis session ( exact volume of each venous and arterial port so that cefotaxime would not inter the blood stream , preventing its systemic effect and microbial resistance ) . in control group we just filled 1.6 ml and 1.4 ml of standard heparin solution ( hs ; 5,000 u / ml ) in the venous and arterial lumens respectively . in both groups , the catheter exit - site was washed with antiseptic solution at the initiation and termination of each session , and covered by topical mupirocin and dry sterile gauze during dialysis intervals . antibiotic solutions were stored in the refrigerator and nurses were trained to instill the solution into each of the two ports of the hd catheter at the end of each dialysis session , and withdraw it immediately before the next dialysis session . all the included patients received dialysis three times a week with the same catheter and the same exit site care , and they all had the same duration of catheter insertion . enrolled patients were routinely monitored clinically for symptoms and signs of infection , during each session of dialysis . blood cultures were drawn if patients had fever , chills , rigors , sweats , change in mental status , or exit - site infection4 . other causes of infection were ruled out . the study protocol required peripheral and catheter blood cultures and an exit site swab to be collected , if clinically indicated . if the catheter was removed , the catheter tip was cultured . patients with positive blood culture results were treated with systemic antibiotics driven by type of organism and antibiotic susceptibility . blood stream infections were defined by the cdc ( centers for disease control ) criteria21 . definite blood stream infection was defined as the same organism from a semiquantitative culture of the catheter tip ( 15 colony - forming units / catheter segments ) or catheter blood sample versus peripheral blood sample in a symptomatic patient with no other apparent source of infection22 . if colony count of catheter were 5 times more than blood sample , blood stream infection were established720 . data were analyzed using spss software ( spss inc . , chicago , il ; ver.18 ) . statistical analysis was performed with independent sample t - test and chi - square tests . all patients were visited in the hd unit on every other daily basis , and clinical events were closely examined . baseline demographic and clinical data including , age , male - female ratio , weight , diabetes , hypertension , lab data ( complete blood count , serum ferritin and serum albumin ) did not have significant difference among two groups ( p > 0.05 ) ( table 1 ) . demographic and basic clinical characteristics of patients at the beginning of study exit site infection was occurred in neither of groups but eleven patients developed cri in the hs ( control ) group at the time of the first interim analysis , whereas no patient had cri in the ce / hs group . clinical examination and follow - up of the patients with infection infection rate per 1000 catheter - days was zero in the ce / hs group versus 6.84 in the hs group ( p < 0.001 ) . the bacteria isolated from peripheral and catheter blood were gram - negative bacilli in 64% , while 36% of them were grampositive cocci . among gram - positive cocci , infection - free survival rates at 180 days were 100% for the ( ce / hs ) group , and 56% for the hs group ( p < 0.001 , pearson chi - square value = 17.368 ) . cri results from migration of skin organisms along the catheter into the bloodstream or contamination and colonization of catheter lumens.23 all indwelling vascular catheters develop a biofilm on internal and external surfaces . subsequent colonization of this biofilm occurs in a high percentage of catheters and precedes bacteremia and septic symptoms.24 through reduction in cri rate , we can reach dramatic reduction in morbidity and mortality of hemodialysis patients . antibiotic lock is one of the methods which can help to prevent cri , but according to its importance and financial cost , prospective randomized clinical trials are necessary to confirm its efficacy . the aim of this study was to determine the efficacy of catheter restricted filling with cefotaxime and heparin in preventing tunneled catheter related infections ( cri ) in hemodialysis patients . patients with confirmed bacteremia may benefit from administration of intravenous antibiotics and instillation of the antibiotic - heparin lock between dialysis sessions without catheter removal . a lower concentration of the antibiotic - heparin lock was investigated for preventing gram - positive central venous catheter related infections in 57 neutropenic patients with cancer.25 antiseptic and antibiotic coatings on central venous catheters showed promising results in intensive care populations.2627 a 79% reduction in the rate of catheter - related blood stream infections ( relative risk [ rr ] 0.21 , 95% ci 0.03 - 0.95 ) was reported with use of chlorhexidine - silver sulfadiazine - coated catheters . application of these results to patients receiving chronic hemodialysis is limited as catheters used in intensive care unit are in situ for approximately one week , versus hemodialysis catheters which may be in situ for several weeks or even months.26 cefotaxime is active against most gram - negative bacilli ( except pseudomonas ) and gram - positive cocci ( except enterococcus ) and is also active against many penicillin - resistant pneumococci . this study suggested that infection rates per 1000 catheter - days were significantly lower in the ce / hs group versus hs ( control ) group ( 0.000 vs. 6.84/1000 catheter days ) . saxena showed a lower cri incidence in the ce / hs group versus hs ( control ) group in non - tunneled hd catheters ( 1.65 vs. 3.13/1000 catheter days ) . in tunneled hd catheters , rate of cri is less than non - tunneled hd catheters.4 furthermore , he showed a lower cri incidence in the ce / hs group versus hs ( control ) group ( 1.67 vs. 3.60/1000 catheter days ) in tcc.28 cri rates were significantly lower with the use of antibiotic locking solution ( alss ) . pooled data from several studies show that cri is 7.72 ( 95% confidence interval , 5.1 to 10.3 ) times less likely with als than with heparin.29 six of these studies used heparin , 5000 u / ml , as the control group , while the study by kim et al26 used 1000 u / ml . antibiotics tested include gentamicin,223031 gentamicin / citrate combination,32 cefotaxime,4 minocycline,22 cefazolin/ gentamicin combination26 and chlorhexidine.33 in this study , the choice of cefotaxime was based on its broad spectrum effect on gramnegative organisms in addition to being most effective amongst third generation cephalosporins against staphylococcus aureus . cefotaxime was preferred over gentamicin for locking tcc , which can be potentially ototoxic , specially in elderly patients who often have preexisting hearing disabilities.283435 the present study shows that catheter - restricted filling with a solution containing cefotaxime and heparin may significantly reduce the incidence of catheter - related infection among end stage renal disease patients . cefotaxime as an antibiotic lock solution appears to be effective and safe ; although there is some concern about the allergy to its leaked solution from lumens . therefore we excluded the patients who had allergy to cefotaxime . in order to omit biases in our study , all the patients had the same frequency of manipulation , they all received dialysis three times a week with the same catheter and they all had the same duration of catheter insertion . with the use of antibiotic lock method for reduction in cri rate , we may reach dramatic reduction in morbidity and mortality of hemodialysis patients . since this study was a small sample size and short - term follow - up study , and according to its importance and financial cost associated , there is a need for additional studies with long - term follow - up on larger population to evaluate the efficacy of cefotaxime lock protocol and its probable adverse effects and its correlation with using topical agents . mm , sa , bp , and aa selected and managed patients , fs referred eligible patients after catheter placement , ma was our statistician , rs , ahdj , and ns were the major contributors in writing the manuscript .

background : chronic hemodialysis patients frequently require vascular access through central venous catheters ( cvcs ) . the most significant complication of these catheters is infection . this risk can be lowered by the use of an antibiotic - heparin lock . this study focuses on hemodialysis patients using tunneled - cuffed catheters ( tcc ) , to assess the rate of catheter - related infections ( cri ) in catheter - restricted filling with cefotaxime and heparin in end stage renal disease patients.methods:a double - blind randomized study was conducted to compare 5000 u / ml heparin plus10 mg / ml cefotaxime ( ce / hs ) as catheter - lock solutions , with heparin ( 5000 u / ml ) alone . a total of 30 patients with end - stage renal disease and different etiologies , were enrolled for chronic hemodialysis with permanent catheters from december 2009 to march 2010 . these patients were randomly assigned to two groups of 15 members . blood samples were collected for culture , sensitivity , and colony count , from the catheter lumen and the peripheral vein . cri was considered as the end point.results:the rate of cri was significantly lower in the cefotaxime group versus control group ( p < 0.001 ) . no exit site infection was occurred in both groups . infection - free survival rates at 180 days were 100% for the ce / hs group , and 56% for the hs group.conclusions:antibiotic lock therapy using cefotaxime reduces the risk of cri in hemodialysis patients .

Methods None Study Design Catheter-Related Infection Statistical Analysis Results Discussion Conclusions Authors Contributions

mechanical aids fail to adequately remove plaque biofilm , for which chemical plaque control is often recommended as an adjunct to mechanical plaque control to help maintain gingival health . a number of chemical agents like phenolic compounds , bis - biguanides , pyrimidines , quaternary ammonium compounds , oxygenating agents , halogens , heavy metal salts which have antiseptic or antimicrobial action have been used , with variable success , to inhibit plaque formation and the development of gingivitis . chlorhexidine ( chx ) is the most studied and effective antiseptic for plaque inhibition and prevention of gingivitis when used twice daily as mouth rinse . chx besides its side effects including : brown discoloration of the teeth , some restorative materials and mucosa ; bitter taste and a slight increase in supragingival calculus formation is known as gold standard of antimicrobial rinses because of broad - spectrum activity and substantivity of 812 h. in order to overcome such side effects the world health organization advice researchers to investigate the possible use of natural products such as herb and plant extracts . a number of clinical studies have shown the effects of using mouthwashes extracted from herbs such as myrtus communis , qureucus infectoria , capparis spinosa , and cinnamon in the prevention of dental plaque accumulation and subsequent gingival inflammation . there is the minimum evidence that proves the efficacy of herbal mouth rinses and their ability to control plaque - induced gingivitis . thus , the aim of this study was to evaluate the clinical changes after the usage of herbal oral rinse and 0.12% chx . this randomized controlled clinical trial was carried out in the department of periodontology and implantology , m a rangoonwala college of dental sciences and research center , pune . the study population consisted of 152 individuals , who were systemically healthy , between 20 and 50 years of age and with moderate to severe plaque - induced gingivitis were enrolled in the study . they were equally distributed in the test ( n = 76 ) and the control group ( n = 76 ) . participants were excluded from the study if they suffered from nonplaque induced gingivitis or periodontitis , history of antibiotic use and use of any form of herbal products in the last 90 days , need for antibiotic premedication , patients using mouth rinse within the last 3 months , pregnant women , habit of smoking or any form of smokeless tobacco and with systemic diseases . patients were selected on the basis of inclusion and exclusion criteria and were randomly assigned using a coin toss to : group i ( test group ) : hiora herbal oral rinse that consists of piper betle ( nagavalli ) , bhibhitika ( terminalia bellerica ) , pilu ( salvadora persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satvagroup ii ( control group ) : peridex that consists of 0.12% chx . group i ( test group ) : hiora herbal oral rinse that consists of piper betle ( nagavalli ) , bhibhitika ( terminalia bellerica ) , pilu ( salvadora persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satva group ii ( control group ) : peridex that consists of 0.12% chx . the clinical examination included gingival index ( lo and silness , 1967 ) and plaque index ( silness and lo , 1964 ) which were recorded at baseline and postoperatively after 21 days . all the patients in group i and group ii were instructed to use the assigned mouth rinse 15 ml twice daily for 30 s in conjunction to their normal oral hygiene routine . participants from both the groups were advised to use the colgate medium bristle toothbrush and colgate total toothpaste . patients were recalled at weekly interval to check for the oral hygiene and the oral hygiene was reinforced in noncompliant patients . is done using independent sample t - test after confirming the underlying normality assumption . within group statistical comparison of all the parameters is done using paired sample t - test after confirming the underlying normality assumption of differences . the relative percentage change in both the parameters is calculated using following the formula : ( baseline - 21 days ) 100/(baseline ) . is done using independent sample t - test after confirming the underlying normality assumption . within group statistical comparison of all the parameters is done using paired sample t - test after confirming the underlying normality assumption of differences . the relative percentage change in both the parameters is calculated using following the formula : ( baseline - 21 days ) 100/(baseline ) . group i did not yield statistically significant results than group ii in the proportion of gingival index scores and plaque index scores of baseline parameters [ table 1 ] . intergroup comparison of baseline parameters when within group comparison of pretreatment and posttreatment scores was done , plaque index scores of posttreatment were statistically significant [ table 2 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . intragroup comparison of pre- and post - mouthwash treatment ( plaque index ) inter group comparison of relative percentage change in study parameters when within group comparison of pretreatment and posttreatment scores was done , gingival index scores of posttreatment were statistically significant [ table 4 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . when within group comparison of pretreatment and posttreatment scores was done , plaque index scores of posttreatment were statistically significant [ table 2 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . intragroup comparison of pre- and post - mouthwash treatment ( plaque index ) inter group comparison of relative percentage change in study parameters when within group comparison of pretreatment and posttreatment scores was done , gingival index scores of posttreatment were statistically significant [ table 4 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . the purpose of this study was to determine the comparative effects of herbal oral rinse ( hiora ) to 0.12% chx ( peridex ) on gingival health and plaque accumulation over time . hiora herbal oral rinse consists of p. betle ( nagavalli ) , bhibhitika ( t. bellerica ) , pilu ( s. persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satva . suggests that there are certain ingredients in herbal oral rinses that exhibit evidence of anti - inflammatory and anti - fungal therapeutics effects . it is a medicinal plant that has been used by many people in africa , south america , middle east and asia . s. persica contains a number of identified antimicrobials and prophylactic components including fluorides , alkaloids , sulfur compounds and volatile oils such as benzyl isothiocyanate . they alter the characteristics of the early plaque settlers streptococcus sanguinis , streptococcus mitis and actinomyces species and make them less adherent . the anionic components s. persica has an antimicrobial activity against streptococcus aureus , streptococcus mutans , streptococcus fecalis , lactobacillus , pseudomonas aeruginosa , and candida albicans . in this regards , almas et al . compared antimicrobial activity of eight commercially available mouth rinses and 50% miswak extract against seven microorganisms . they found that mouth rinses containing chx had the maximum antibacterial activity while miswak extract had low antibacterial activity . hydrochavicol in p. betle inhibits expression of pro - inflammatory cytokine , tumor necrosis factor- , disrupts the permeability barrier of the microbial membrane of s. mutans and actinomyces species and also has an astringent action . methyl salicylate in gandharpura taila , cineole in ela , thymol in yavani and menthol in peppermint satva impart a fragrant and refreshing effect . additional research conducted by scherer et al . demonstrated that herbal oral rinse reduced gingival bleeding after 3 months of use as compared to placebo . chlorhexidine is effective against an array of microorganisms including gram - positive and gram - negative organisms , fungi , yeast and viruses . the ability of an oral rinse to be retained in the oral cavity and maintain potency over an extended length of time has been debated . lang stated the substantivity of an antimicrobial agent needs sufficient contact time with a microorganism in order to inhibit or kill it . chx , with a substantivity of 12 h is considered to be highly effective ; whereas , the substantivity of herbal mouth rinse is unknown . hence , in the present study , comparison was made between herbal oral rinse ( hiora ) and 0.12% chx ( peridex ) to see their effectiveness . in this study , there was a statistically significant reduction in the proportion of gingival index scores and plaque index scores in the chx group . however , in a study done by chatterjee et al . , 2011 herbal oral rinse is equally effective in reducing periodontal indices as chx . however , there is not enough statistically significant evidence to suggest that herbal oral rinse had a greater effect in reducing gingival index scores . with the proliferation of herbal oral care products , it is important for clinicians to make evidence - based decisions when making product recommendations . research needs to be conducted to determine the substantivity of herbal mouth rinse as well as to determine its antimicrobial effects on gingivitis , plaque biofilm accumulation , and related bacteria . suggestions for future studies include : ( 1 ) expand study population to include broader disease status , and varied age group ( 2 ) extend study to 6 months ( 3 ) add stains and calculus indices . within the limitations of the study when herbal oral rinse was compared to 0.12% chx , 0.12% chx mouth rinse effectively reduced the clinical symptoms of plaque - induced gingivitis , and had a statistically significant effect on the reduction of plaque scores .

background : chlorhexidine ( chx ) is considered as a gold standard of antimicrobial rinses . various herbal oral rinses are available in the market . however , little is known of its effectiveness.aim:the aim of this study was to evaluate the clinical changes after the usage of herbal oral rinse and 0.12% chx.materials and methods : in a randomized clinical trial , 76 patients with dental plaque - induced gingivitis were assigned to group i ( herbal oral rinse - hiora ) and 76 patients with dental plaque - induced gingivitis to group ii ( 0.12% chlorhexidine - peridex ) . gingival index and plaque index scores were recorded at baseline and 21 days after scaling.results:intragroup comparison in both groups showed that plaque index and gingival index scores were statistically significant after 21 days as compared to baseline . intergroup comparison showed that plaque index scores and gingival index scores were statistically significant in group ii as compared to group i.conclusion:when herbal oral rinse was compared to 0.12% chx , 0.12% chx mouth rinse effectively reduced the clinical symptoms of plaque - induced gingivitis .

INTRODUCTION MATERIALS AND METHODS Statistical analysis RESULTS Plaque index scores Gingival index scores DISCUSSION CONCLUSION

the contributing causes of dn pathogenesis and progression are still poorly understood but chronic hyperglycemia and high blood pressure represent the main risk factors for disease onset . , high systemic blood pressure usually determines an increase of the intraglomerular pressure and glomerular filtration rate ( gfr ) which results in glomerular hyperfiltration . from the biochemical point of view , hyperglycemia per se sustains the accumulation of advanced glycation end products ( ages ) , altering the electronegativity of the cell ; additionally ages bind proteins of the extracellular matrix ( ecm ) inhibiting their degradation . ages accumulation can induce an increased production of reactive oxygen species ( ros ) and a transcriptional activation of different proinflammatory and profibrotic molecules , including tgf - beta [ 2 , 3 ] . the high glucose - mediated induction of tgf - beta and the central role of this growth factor in dn progression represent the few defining constants in the pathogenesis of dn . the earliest clinical signs of dn include a slight but persistent urinary excretion of albumin ( microalbuminuria ) and a temporary increase of the glomerular filtration rate ( gfr ) . these clinical signs , along with the presence of hyperglycemia , are often considered sufficient indicators of dn [ 5 , 6 ] . today , extensive evidence shows that dn is not the only type of renal damage that can be found in diabetic patients [ 7 , 8 ] and kidney biopsy , although highly invasive , remains the diagnostic gold standard . the histological hallmarks of dn include hyperproliferation of the mesangial cells , thickening of the glomerular basement membrane ( gbm ) , podocyte effacement , tubulointerstitial fibrosis , and nodular accumulations of ecm ( kimmelstiel - wilson lesions ) in the glomerulus . given the high prevalence of type 2 diabetes ( t2d ) and the diagnostic limitations currently associated with kidney biopsy , there is an impending need for new , accurate , and easily accessible biomarkers of disease . in this review we will try to outline a system biology overview on dn by recapitulating the main annotations obtained at different levels of molecular investigation . only those studies investigating human samples will be described ; the murine models of dn in fact , although undergoing albuminuria , mesangial expansion , and podocyte loss , do not develop severe glomerulosclerosis and tubulointerstitial fibrosis . also , as substantial differences exist in the etiology and prevalence of type 1 and type 2 dn , the articles discussed in this paper apply to dn secondary to type 2 diabetes ( t2dn ) . as an exception , works describing biomarkers of kidney damage in t1d that have been further validated in t2 dm and vice versa and those reporting potential prognostic biomarkers , because of their particular importance in predicting the progression of renal damage , have been also discussed in the present work . all the annotations discussed in this review are also listed in tables 1 , 2 , 3 , 4 , and 5 , categorized according to whether they summarize the genetic and transcriptomic signature of coding or noncoding rna molecules and the epigenetic proteomic and metabolomic markers , respectively . genetic variation is present under different forms in the human genome , ranging from single nucleotide polymorphisms ( snps ) to large , structural , chromosomal rearrangements . today we know that genetic variation infers disease susceptibility and collective effort aims at identifying the precise loci for dn susceptibility . different methodological strategies can be used to characterize the genetic risk for a disease , either targeted or genome - wide , according to whether a priori hypothesis of the candidate regions for disease susceptibility exists . in genome - wide association studies ( gwas ) , for instance , the whole genome is screened for new , previously uncharacterized single nucleotide polymorphisms ( snps ) . prior to the development of the modern high - throughput technologies such as chip - based microarray analysis and next - generation sequencing , the inheritance of disease susceptibility was investigated through genetic linkage in families . basically , individuals within the same families were sequenced for a collection of genetic snps in order to identify those snps segregating with the disease . this approach led to the identification of many variants responsible for disease susceptibility but it proved mostly suitable for the study of single gene disorders . for complex , common complications like t2d in fact , progression is very likely driven by multiple alleles simultaneously , each having a small correlation to disease progression if inherited individually . this implies that a big population needs to be genotyped in order to detect the common variants responsible for the increased genetic risk . in the field of dn , there is extensive evidence for genetic contribution to disease susceptibility . in 1989 , seaquist et al . showed that diabetic siblings of patients with dn were more at risk for developing dn compared to diabetic siblings of diabetic patients without proteinuria ; epidemiologic studies also indicate that the prevalence of dn varies among ethnic groups . these observations , along with the consideration that only a subset of patients with diabetes develops dn , drove the search for the genetic determinants of dn susceptibility . one of the most consistent annotations in the field is probably the genetic variation on chromosome 18 . in 2002 , a family - based linkage analysis performed in t2dn turkish families and affected sibling pairs of pima indians reported a strong evidence for the localization of a dn susceptibility locus mapping to chromosome 18q22.3 - 23 . researchers were not able to pinpoint the precise susceptibility gene but the same locus was also detected in a t2dn african american population . later studies on chromosome 18 led to the identification of a susceptibility marker within the carnosine dipeptidase 1 ( cndp1 ) gene , and it was also described how the shortest allelic form of the cndp1 gene was more common in the absence of nephropathy . the cndp1 gene encodes the secreted enzyme serum carnosinase that degrades carnosine , a protein controlling the formation of age molecules . as previously discussed similar results were obtained in a meta - analysis study when investigating a multiethnic population with t2d - esrd ; a recently published meta - analysis confirmed the association of the carnosinase d18s880 microsatellite polymorphism with dn susceptibility in a t2d caucasian population although no significant association with t1dn could be found . in a very recent candidate - gene driven study , palmer et al . performed a genotyping of several snps across 22 dn candidate genes in a large cohort of african americans with t2d and esrd . after adjustment for the apol1 g1/g2 alleles , known to be associated with nondiabetic esrd in this population , the most significant signals were observed downstream of the cndp1 gene , at chimerin 2 ( chn2 ) locus and within angiotensin ii receptor type 1 ( agtr1 ) gene . in another work , to investigate the impact of oxidative stress on disease initiation , the polymorphic variants of 7 genes involved in the antioxidant defense were evaluated : sod2 , p22 phox , cat , mpo , gstp1 , gstt1 , and gstm1 . despite the commonly recognized link between oxidative stress and diabetes , authors claim that no association could be found in caucasian t2d patients . in one of the first dn genome - wide genotyping studies , authors reported the engulfment and cell motility 1 ( elmo1 ) gene on chromosome 7p as a likely candidate for disease susceptibility in a japanese patients cohort with t2d . in a cellular system engineered to overexpress elmo1 , they furthermore observed increased expression of extracellular matrix ( ecm ) protein genes and decreased expression of matrix metalloproteinases . finally , recent data from a meta - analysis study suggests the elmo1 association with dn exclusively in the t2d asian subgroup . in a population of pima indians with t2d , the gwas of over 100,000 snps led to the identification of several loci with significant association for esrd susceptibility , with the strongest signal located in the intronic region of the of pvt1 gene . some of these findings were also replicated in an ethnically different population with t1d . in a gwas performed on a large cohort of african americans with t2d and esrd , five gene regions with evidence of association with dn were detected , nominally , sash1 , rps12 , auh , msrb3-hmga2 , and limk2-sfi1 . some of these snps however were later found to contribute to all - cause esrd . in order to establish a comprehensive , well - defined dna biobank for the genotyping of dn in t1d in particular , the first results of this genome - wide scan were reported by pezzolesi et al . in 2009 . authors claimed that although no snp achieved genome - wide significance , strong association was found near the 4.1 protein ezrin , radixin , and moesin [ ferm ] domain containing 3 ( frmd3 ) locus and near the cysteinyl - trna synthetase ( cars ) locus . further studies confirmed the 9q21.32 region ( upstream of frmd3 ) as a susceptibility locus for t2dn in several unrelated study populations [ 20 , 21 ] . despite all the effort currently invested into this field of research , at present it is still impossible to predict those diabetic patients with a higher risk for developing dn . indeed , in almost all the studies published so far on dn susceptibility , diagnosis was based almost exclusively on the presence of hyperglycemia and proteinuria ; therefore , it is not possible to exclude that the inconsistencies among the findings could be linked to a misclassification of the renal damage in the diabetic population . the transcriptome represents the part of genome that is transcribed and includes both coding and noncoding rna molecules . when studying the transcriptome , as for genetic studies , either targeted or genome - wide approaches can be used . rna - sequencing ( rna - seq ) , arrays , and quantitative pcr ( qpcr ) are the techniques employed routinely to assess rna expression . qpcr is very sensitive and even subtle changes can be detected precisely ; arrays on the other hand are very high - throughput but also less sensitive . rna - seq takes advantage of the recent next - generation sequencing platforms and it has rapidly become the method of choice for transcriptome profiling . the main advantages of rna - seq are its very high resolution ( down to a single nucleotide ) , its potential to detect novel transcripts , its ability to measure either primary transcripts or spliced mature mrnas . given the plethora of gene expression data available in the literature , only the research on dn kidney tissue or urine will be discussed . all the coding and noncoding rna markers cited in this paper the first transcriptomic signature of dn kidney was published in 2004 . using an array - based approach , baelde et al . the results of this genome - wide analysis indicated that 96 genes were upregulated in t2dn , including aquaporin 1 ( aqp1 ) , calpain 3 ( capn3 ) , hyaluronoglucosidase , and platelet / endothelial cell adhesion molecule ( pecam-1 ) . over 500 genes were downregulated , including bone morphogenetic protein 2 ( bmp2 ) , vascular endothelial growth factor ( vegf ) , fibroblast growth factor 1 ( igf-1 ) , insulin - like growth factor binding protein 2 ( igfbp-2 ) , and nephrin . in the same manuscript , authors confirmed reduced expression of vegf and nephrin in renal biopsy specimens from additional dn patients at both the protein and rna levels . to explain the existing inconsistencies between human and murine progressive dn , microdissected biopsies from controls , early and progressive t2dn patients underwent global gene expression profiling through microarray hybridization . preliminary results , later confirmed using qpcr , revealed an upregulation of jak-2 and a compromised expression of several members within the jak / stat signaling pathway which could not be detected in either db / db c57blks or diabetic stz - treated dba/2j mice . more recently , woroniecka et al . performed the transcriptome analysis on microdissected kidney biopsies from dn patients , healthy living transplant donors , and patients undergoing tumor nephrectomies ( analyzing the histologically normal kidney tissue ) . the microarray - derived expression profiles indicated that several podocyte - specific transcripts were downregulated , including plce1 , ptgds , nphs1 , nphs2 , synpo , pla2r1 , wt1 , clic5 , and podxl . glomerular transcripts showing upregulation included igh , c3 , col1a2 , cxcl6 , and col6a3 . in the tubular compartment instead , authors detected increased expression of different transcripts including igh , igl , col1a2 , and col3a1 . several reports analyzed the gene expression of both the glomerular and tubular compartments of t2dn kidney biopsies . among the mrna transcripts detected as enriched in the glomerular compartment of t2dn individuals are mrp8 , wnt1 , wnt2b , wnt4 , wnt6 , wnt16 , dkk3 , and lef1 , pkc , fsp1 , angptl2 , and ace . decreased expression for ace2 , vegf [ 64 , 106 ] , ctgf , nephrin , podocin , and wt1 tubule - rich renal biopsies from patients with t2dn , ihg-1 , il6 , ccl2 cd68 , and ccr5 were increased , while tlr4 was overexpressed in both glomeruli and tubules of microalbuminuric and overt dn . using biopsy material collected by the european renal cdna bank , the gene expression of tubulointerstitial mrna from human dn kidneys was compared to that of living donors , cadaveric donors , and patients with minimal change disease through a combined microarray profiling and qpcr validation approach . results indicated dysregulation of specific nf-b targets , highlighting the existence of an inflammatory signature characteristic of progressive dn . eight genes in particular were induced in t1dn and t2dn relative to controls : ccl5/rantes , cxcl10/ip10 , edn1 , vcam1 , hla - a , hla - b , ifnb1 , and b2 m . further work performed using the european renal cdna bank material highlighted additional mrna transcripts as dysregulated in t2dn kidney when compared to normal tissue . within the glomerular compartment in particular , nrp1 and nrp2 were significantly lower in t2dn , while smpdl3b was increased . within the tubulointerstitial compartment , upregulation of mmp7 and fgf-2 , of the unfolded protein response genes hspa5 , hyou1 , and xbp1 and of the apoptosis - related genes trail and opg , the expression of several transcripts was assessed on whole t2dn kidney tissue . upregulated mrnas included hdac2 , hdac4 , and hdac5 , b7 - 1 , stat1 , tnfaip8 and tipe2 , prkc - beta , vegf , uii and ut , pdgf - a and pdgf - b , lox1 , ldlr , and cd36 , jagged1/hes1 , and gremlin [ 45 , 46 ] . decreased transcription was detected for autophagy - related genes beclin 1 , lc3 [ 33 , 34 ] and atg7 , cxcl16 , abca1 , abcg1 , and apoe , timp3 , foxo1 and foxo3a , atg5 , and atg8 , ankrd56 and entpd8 , and nephrin . in other works the study design was developed to compare t2dn with other glomerulopathies . using a qpcr based approach , the tubulointerstitial compartment isolated from kidney biopsies of both dn patients , living donors , and minimal change disease patients was profiled specifically for the expression of 202 candidate genes involved in molecular pathways contributing to dn progression . results showed a decreased expression of vegf and egf , while collagens i and iv , fibronectin 1 , and vimentin as well as matrix metalloproteinases 2 , 7 , and 14 and tissue inhibitor of metalloproteinases 1 and 3 were increased . in another study , increased irs2 mrna was detected in dn patients compared to controls , while no significant changes irs2 expression were present in biopsies from patients with focal - segmental glomerulosclerosis or membranous nephropathy . low expression of robo2 mrna was present in dn compared to nephrosclerosis , focal - segmental glomerulosclerosis , membranous nephropathy , and control pretransplant biopsies . a strong specific induction of col8a1 and col8a2 mrnas expression was found in both glomerular and tubular compartments of biopsies from patients with t2dn versus control pretransplant biopsies , benign nephrosclerosis , and focal - segmental glomerulosclerosis . finally , increased ace expression was observed in t2dn biopsies compared to benign nephrosclerosis , minimal change nephrotic syndrome , and lupus nephritis . aiming to develop a diagnostic tool for early dn diagnosis , zheng et al . designed a pcr - array platform to detect expression changes in 88 genes simultaneously and employed it in a pilot study where the urinary sediment of dn patients was assayed . authors found that several mrnas were significantly increased in dn compared to healthy controls , in particular , notch3 , actn4 , cdh2 , ace , fat1 , col4a1 , synpo , and twist1 . increased mrna levels of podocalyxin , cd2-ap , nephrin , wt-1 , -actinin 4 podocin , and synaptopodin [ 28 , 29 ] were found in the dn group compared with controls . finally , in another work , authors claim that urinary expression of nephrin and podocin was useful for distinguishing diagnostic groups ( iga nephropathy , minimal change disease , and membranous nephropathy ) as well as predicting renal function decline . until a few years ago , the molecular profiling of dn was mainly focused on the characterization of mrna transcripts . over the last decade however , much interest has converged toward the profiling of noncoding rna ( ncrna ) molecules . the ability of ncrnas to modulate gene expression along with the discovery that they can be detected in biofluids and are fairly stable makes them ideal biomarker candidates . micrornas ( mirnas ) are probably the most studied ncrnas ; they are short , single - stranded , highly conserved , and tissue - specific . the partial match binding feature allows mirnas to bind hundreds of targets simultaneously ; accordingly the dysregulation of even one single mirna molecule can profoundly influence the gene expression profile of the surrounding environment . for a complete review on mirnas biogenesis and function refer to [ 107 , 108 ] . in the field of dn , the majority of mirna 's profiling studies was performed on cellular and animal models . more recently , with the surprising discovery that mirnas can be released and carried into the extracellular environment , different body fluids are being characterized in their mirna 's content . initially identified in a mice model of dn , mir-192 , along with mir-377 , mir-337 , and mir-129 , was later discovered as being enriched in human mesangial cells ( mcs ) exposed to high glucose . interestingly , when assessing mir-192 in human dn kidney , expression levels not only are reduced but also inversely correlate with severity of kidney disease , raising once again the issue about the appropriateness of the currently available animal models for dn . mir-21 has recently emerged as a marker for fibrosis in many complications [ 110 , 111 ] ; unsurprisingly , increased mir-21 expression was also detected in human t2dn kidney biopsies relative to healthy controls . except for the previously mentioned dn kidney profiling from krupa et al . , the array - based mirnome analysis of t2dn kidneys was recently published by huang et al . and uncovered mir-155 and mir-146a enrichment in these samples . these two are the only works describing the mirnome of human dn kidney ; noteworthy , the existence of strict renal biopsy policies in most nephrology clinics might be a limiting factor in terms of sample collection and availability . in parallel , the urgent need for novel biomarkers of diagnosis and progression shifted priority to the profiling of more accessible samples , such as biological fluids . using a qpcr based approach , argyropoulos et al . were the first to perform the urinary mirna profiling of t1d patients with and without proteinuria . results showed that mir-323b-5p , mir-221 - 3p , mir-524 - 5p , and mir-188 - 3p were underexpressed in albuminuric relative to nonalbuminuric patients , while mir-214 - 3p , mir-92b-5p , hsa - mir-765 , hsa - mir-429 , mir-373 - 5p , mir-1913 , and mir-638 were overexpressed . in a similar study performed on the rna content of urinary exosomes , authors showed that mir-130a and mir-145 were enriched in t1d patients with microalbuminuria compared to normoalbuminuric subjects , while mir-155 and mir-424 were reduced . in a work aimed to determine the urinary levels of all mir-29 family members ( mir-29a , mir-29b , and mir-29c ) , mir-29a was significantly increased in albuminuric t2dn patients compared to normoalbuminuric patients and it also correlated with the degree of albuminuria . in the work from szeto et al . , when comparing the urinary sediment of patients with either iga nephropathy , dn , or hypertensive nephrosclerosis , mir-15 was decreased in dn samples compared to other groups . similarly , in another work authors found that mir-192 levels were reduced in urinary sediment of dn patients compared to both healthy controls and patients with either minimal change nephropathy , focal glomerulosclerosis , membranous nephropathy , or other diagnosis groups . mirnas expression was also measured in venous blood from t2d han chinese patients with and without albuminuria . using a microarray - based approach , authors identified several differentially expressed mirnas in the different study population and confirmed mirna let-7a downregulation using qpcr . very interestingly , authors also observed how the distribution of a specific variant within let-7a ( rs1143770 ) was significantly higher in diabetic patients ( with and without albuminuria ) relative to control subjects . finally , dysregulation of a new class of noncoding rna molecules has emerged as being potentially involved in different complications , including kidney disease . among these noncoding rna molecules , recent effort aims to characterize the so - called long noncoding rnas ( lncrnas ) . this led to the initial assumption that lncrnas were not biologically relevant . today we know that lncrnas contain individual domains and structural motifs that allow them to specifically associate with dna , rna , and/or protein and thus regulate their function . as previously discussed , multiple experimental evidence , from different ethnic populations , suggested a link between diabetic kidney disease and genetic variants within the pvt1 locus [ 22 , 23 ] . pvt1 , whose increase is significant in mesangial cells stimulated with high glucose , can induce the expression of plasminogen activator inhibitor 1 ( pai-1 ) and transforming growth factor beta 1 ( tgf-1 ) . noteworthy , six different mirnas are encoded within the pvt1 gene ; therefore , authors investigated whether an alteration in pai-1 and tgf-1 gene expression was ascribable to the pvt1 lncrna transcript itself or whether it was the result of a mutation within the mirnas encoded in the pvt1 gene . results showed that both pvt1 lncrna and mir-1207 - 5p were induced by high glucose independently and they both contributed to ecm accumulation in the kidney . the term epigenetics refers to all those dynamic structural changes that , while not resulting from an alteration in the dna sequence , affect gene expression and can be inherited . epigenetic modifications , such as dna methylation , histone methylation , and histone acetylation , modify the accessibility of the chromatin and thus modulate transcription . they are responsible for the phenotypic differences within cell types and explain why the gene expression profile of an organism can change so profoundly during development . unlike genetics , epigenetics is highly susceptible to influences from the environment ; therefore , the understanding of its regulatory machinery offers an incredible opportunity for disease management . the study of epigenetics in diabetic kidney disease is still in its embryonic phase although increasing evidence indicates metabolic memory as a consequence of long - lasting epigenetic modifications contributing to dn progression . in 2007 geisel et al . analyzed the promoter methylation of the stress response protein p66shc , previously shown to increase susceptibility to oxidative stress and atherosclerosis . in peripheral blood mononuclear cells isolated from esrd patients and control subjects , authors demonstrated that increased p66shc expression in esrd group was linked to a significant reduction in the methylation of its promoter region . using an array based approach , the genome - wide promoter dna methylation of 192 t1d patients was analyzed searching for any possible association with dn . the analysis was conducted using dna extracted from peripheral blood cells as these include the t cell population responsible for islet beta cells destruction in t1d . importantly , among the several cpg islands showing correlation with dn development , results uncovered one in particular ( rs10081672 ) , located upstream of the unc13b gene . additionally , this region is in strong linkage disequilibrium with rs13293564 , a variant associated with dn susceptibility . importantly , depending on which allele is present in rs10081672 , a cpg site is either created or abrogated , thereby affecting transcription factor binding . in another work , the genome - wide dna methylation of diabetic patients with esrd and diabetic patients without nephropathy was compared with the aim to identify novel disease biomarkers for noninvasive diagnosis . patients ' saliva was employed as starting material for dna extraction while the study population included african americans and hispanic individuals . results highlighted differential methylation at two or more cpg sites in 187 genes between the two groups . interestingly , many of these genes are involved in inflammation , oxidative stress , ubiquitination , fibrosis , and drug metabolism , and some in particular are even known for their genetic association with dn , suggesting once again a very close connection between genetic dysregulation and epigenetic dysregulation in the pathogenesis of dn . a recent paper from hasegawa et al . demonstrated that sirt1 , a protein deacetylase that targets histones and transcription factors , is reduced in stz - treated mice . using a transgenic mouse model authors also elucidated the interaction between sirt1 expression and cpg methylation of cldn1 , a gene encoding for the protein claudin-1 . claudin-1 is a tight junction protein involved in cell - to - cell adhesion and authors suggest that its epigenetic - mediated induction is responsible for podocyte effacement and proteinuria . in support of this hypothesis authors also revealed the correlation between proteinuria and sirt1 expression in human dn kidney . finally , reddy et al . elegantly demonstrated the link between the protective effect of angiotensin ii receptor antagonist , losartan , and its ability to reverse specific epigenetic modifications in the glomeruli of diabetic db / db mice . all these experimental evidences show that epigenetics holds the potential to allow a temporary and reversible manipulation of the gene expression , conferring protection from disease progression . the proteome probably represents the most complete expression of the potentialities of a living organism since it focuses on the set of proteins , expressed by the genome , that regulate biological and metabolic cell function . the proteomics , formally defined as the massive and mass spectrometric - based analysis of the proteome , is a complex and interdisciplinary matter requiring expertise spanning from chemistry to biology and bioinformatics , in order to reveal the meaning of complex protein datasets of a biological sample in physiological and pathological conditions . unlike genomics studies , based on the analysis of biological samples that may be expanded artificially making complex studies from little starting material possible , proteomics requires a larger amount of starting sample that can be easily available in biological fluids rather than in the tissues or cells . for this reason , proteomic studies in nephrology are more oriented to the analysis of biological fluids and have led , in the last decade , to the identification of a number of putative biomarkers that are expected to enter shortly into the clinical practice . in the next paragraphs we will discuss the main application of proteomics to the identification of new potential biomarkers of dn in kidney tissues and biological fluids with a special emphasis on the new emerging potentialities of the post - translational modifications ( ptms ) screenings . glomerular damage plays a critical role in the onset of dn making this renal compartment a key target for proteomic investigation . however , only few proteomic studies have been carried out on isolated glomeruli since , in general , renal biopsy is rarely carried out on diabetics patients and the number of isolated glomeruli , when starting form biopsy material , is too scarce to produce homogeneous preparations of individual specimens and to extract adequate glomerular protein amounts for deep proteomic studies . recent methodological improvements have now permitted the extraction of intact and unmodified proteins from formalin fixed paraffin embedded ( ffpe ) samples thus making available the use of vast archive of kidney tissues for proteomic analysis . proteomic analysis of isolated glomeruli , obtained by laser capture microdissection ( lcm ) , allowed the identification of over 100 differentially expressed tissue proteins between dn and nondiabetic glomeruli . notably , the results of this study probably underestimates the differences of the glomerular proteome since it was carried out on ffpe tissues derived from autopsy cases undergoing postmortem proteolysis . however , among differently expressed proteins , nephronectin , a protein implicated in the assembly of extracellular matrix and nephrogenesis , was confirmed as differently expressed in dn tissue specimens using immunohistochemistry . a similar study reported increased expression of c3 and the membrane attack complex ( c5b-9 ) and a marked reduction of podocyte - associated proteins and antioxidant proteins in dn . even if these proof of concept studies demonstrate the usefulness of ffpe tissue proteomics , the potentialities of this approach are still prevented by the poor availability of tissue specimens that limits the identification of the key molecular events involved in the onset and progression of dn . biofluids encompass any liquid originating from inside the bodies of living organism . among the body fluids proteomics colleagues reported , in urine of t1d patients with dn , a panel of 65 urine biomarkers , mainly composed of collagen fragments , that was further validated in a multicentre independent cohort of t2 dm patients [ 124 , 125 ] . expanded the 65 peptides classifier to 273 and demonstrated its ability to predict the occurrence of the microalbuminuria in t1d and t2 dm normoalbuminuric patients [ 126 , 127 ] . these data were recently confirmed in another independent study that specifically identified subsets of urine biomarkers able to predict to the transition from normo- to microalbuminuria or from micro- to macroalbuminuria indicating that the appearance of collagen fragments in urine of t2 dm patients may have both diagnostic and prognostic values . lc / ms / ms analysis of 22 t1d normoalbuminuric patients developing microalbuminuria after 6 years median follow - up allowed identifying a set of potential predictive biomarkers that were further validated by elisa assay . of note , the introduction of these proteomic biomarkers ( thp , progranulin , alpha-1-glycoprotein , and clusterin ) into the baseline model that included diabetes duration , baseline albumin excretion rate ( aer ) , hba1c , cystatin c , and uric acid improved the prediction of renal function worsening from 84% to 89% . jin et al . used isobaric tags for relative and absolute quantification ( itraq ) and lc / ms / ms to quantify and identify a set of urinary proteins differentially excreted between normoalbuminuric and microalbuminuric t2 dm patients . three protein biomarkers , namely , alpha-1-antitrypsin , alpha-1-acid glycoprotein 1 , and prostate stem cell antigen , were included in a multiplex assay that was able to correctly classify normoalbuminuric and microalbuminuric t2 dm patients with about 92% accuracy . two mass peaks corresponding to b2-microglobulin and ubiquitin ribosomal fusion protein that were selectively and differently excreted in nephropathic diabetic patients . we further refined this study by selecting only diabetic patients with biopsy - proven kimmelstiel - wilson lesions and identifying both urinary b2-microglobulin and free ubiquitin as specific biomarkers of diabetic glomerulosclerosis over other nondiabetic kidney lesions . although the overall analysis of the urine proteome is up to now the most used way to search for disease - specific biomarkers , the future of this matter will be the analysis of well - purified proteins subfractions since it may provide more detailed information about simplified proteomes and potentially improve the knowledge of specific pathways . until few years ago , the most useful way to reduce the proteome complexity was the selective antibody - based depletion of the most abundant proteins . in the last few years , the enrichment of post - translationally modified proteins has begun a new strategy to highlight functionally interesting proteins . protein phosphorylation is a key player in the regulation of most cell pathways ; thus , phosphoproteome screening of urine samples may represent a precious source of information about deregulated cell processes in many kidney diseases including dn . however , up to now , urine phosphoproteome analysis has not been applied yet to soluble proteins in dn and other ckd probably because most of the historical collections of urine samples have not been prepared and stored in presence of phosphatases inhibitors that , preventing the liability of this ptms , may ensure more reproducible results . on the contrary , the analysis of the microvesicular fraction ( i.e. , exosomes ) that originates from renal epithelial cells and are released into urine may be , at the moment , more useful to study this kind of ptm as the presence of the exosomes ' membrane may preserve ptms by protecting their protein content from spontaneous degradation and dephosphorylation by proteases or phosphatases , respectively . have already published the first proteomic study on urine exosomes of dn patients demonstrating the potentiality of this microvesicular screening for identifying dn specific biomarkers . specifically , 3 over the 25 most significant differently expressed proteins , namely , voltage - dependent anion - selective channel protein 1 ( vdac1 ) , isoform 1 of histone - lysine n - methyltransferase mll3 , and alpha-1-microglobulin / bikunin precursor ( amb ) , were also validated . of note , mll3 , a specific tag for epigenetic transcriptional activation , was detected only in dn exosomes , thus emphasizing the potential importance of epigenetic mechanisms in the pathophysiology of dn . it is reasonable to think about the forthcoming application of the exosomes ' phosphoproteomics as a new way to identify specific deregulated patterns in kidney diseases . as for phosphoproteomics also , only one paper has applied this approach to the study of ckd identifying a number of urinary proteins involved in immune / stress response and many biological functions like homeostasis , platelet degranulation and coagulation , transport , and secretion . due to the importance of the glycoproteomics in cell - cell interaction and signalling cascades , it is reasonable that many further studies will be planned in the next year to understand , by screening this specific subset of proteins , the molecular mechanisms involved in damage progression of specific nephropathies including dn . interestingly , the usefulness of the glycoproteomics for the diagnosis of dn has been recently reported in plasma where thirteen significantly upregulated glycoproteins were described in dn patients compared to t2 dm patients without nephropathy . among these , increased plasma levels of glycated lumican , vasorin , and retinol binding protein-4 were validated by immunoblotting and showed potential specificity for dn . by using a different proteomic strategy , kim and coworkers reported that increased plasma levels of glycated pedf , apolipoprotein j precursor , hemopexin , immunoglobulin mu heavy chain , and immunoglobulin kappa chain correlated with poor glycaemic control in t2 dm patients while glycated prekallikrein and complement factor c4b3 correlated with microalbuminuria and other glycated proteins such as hemopexin precursor , serine proteinase inhibitor , alpha-1-antitrypsin , and haptoglobin - related protein were associated with dn . these studies confirmed the potentiality of the plasma glycoproteome for the identification of reliable biomarkers of dn and their importance is emphasized by the consideration that the overall analysis of serum / plasma proteome is challenging because the candidate biomarkers are generally present in trace amounts . of note , there is an alternative way to reduce the complexity of this biological fluid , namely , the prefractionation of the samples , achieved by several known strategies before the analysis , that allow removing the large background of nonrelevant and abundant proteins and may favour the discovery of potential candidate biomarkers . up to now only few studies have used this approach to analyse the serum [ 89 , 132 ] or plasma proteome of t2 dm patients . these studies have reported extracellular glutathione peroxidase ( egpx ) and apolipoprotein ( apoe ) as potential diagnostic biomarkers of dn and vitamin d - binding protein ( dbp ) as early biomarker of renal damage in t2 dm . overall many independent studies are showing an increasing number of new biomarkers that are potentially useful for both early diagnosis and monitoring of the disease and to understand ever more deeply its pathogenesis . metabolomics is a systematic evaluation of small molecules ( i.e. , metabolites ) that may provide fundamental biochemical insights into disease pathways , drug toxicity , and gene function . metabolomics profiling is generally carried out by nuclear magnetic resonance ( nmr ) and ms - based profiling each with advantage and limitations . two main strategies may be adopted for metabolomics analysis of biological samples : targeted and untargeted profiling . the targeted profiling focuses only on sets of few metabolites generally included in specific metabolic pathways while untargeted analysis provides a comprehensive evaluation of the metabolome without any a priori hypothesis on the metabolic pathways . targeted analysis is an essential tool for the investigation of biological mechanisms rather than for biomarkers discovery ; in fact it is a quantitative approach that allows quantification of each metabolite of an interested metabolic pathway through the use of isotope - labelled standards . untargeted approach is instead more suitable for biomarker discovery since the whole metabolic profile of cases and controls may allow identification of disease - correlated biomarkers . as obvious , the latter approach needs , as for proteomics , further data analysis through supervised statistical methods in order to construct disease - specific metabolomics classifier further sequenced by mass spectrometry . in the last years , the optimization of the separation techniques has allowed the selectively purification of specific class of metabolites such as phospholipids and fatty acids , leading to the development of new more focused untargeted analysis such as phospholipidomics . as for proteomics , most of the metabolomics studies have been carried out on biofluids , namely , urine and serum / plasma . urine metabolomics may offer direct insights into biochemical pathways linked to kidney dysfunction since a variety of metabolites are concentrated by the kidney and excreted in urine . used targeted analysis to investigate the urinary excretion of 94 metabolites in healthy subjects ( hs ) and t2 dm patients with ( dm+ckd ) or without ( dm - ckd ) ckd . thirteen metabolites differently excreted between t2 dm patients and hs were also useful to differentiate dm+ckd from dm - ckd . interestingly , 5 out 13 metabolites were differently excreted between dn and other ckd , thus being specifically associated with the diabetic kidney disease while 8/13 reflected metabolic changes shared by diabetic and nondiabetic ckd . most of the less excreted metabolites in dn group were water soluble organic anions and functional analysis correlated them with impaired mitochondrial function in dn . very recently , pena and colleagues carried out an untargeted analysis of urine and plasma metabolome by gc - ms and reported the possible usefulness of a set of metabolites to predict the development of dn on top of the traditional renal risk markers , namely , baseline urinary albumin excretion and baseline estimated glomerular filtration rate . in this prospective study , 24 normo- to microalbuminuria case / controls pairs and 21 micro- to macroalbuminuria case / controls pairs were enrolled . the metabolomic profiles of micro- to macroalbuminuria case / control pairs show significant differences while normo- to microalbuminuria pairs remained unchanged . specifically they reported two plasma metabolites ( butenoylcarnitine and histidine ) and three urine metabolites ( hexose , glutamine , and tyrosine ) significantly differentially excreted in microalbuminuric patients prone to develop macroalbuminuria . the area under receiving operating characteristic ( roc ) curve arising from the integration of these urine and plasma metabolites to a reference model based on baseline egfr and urine albumin excretion passed form 84% to 99% correct prediction . although these results appear impressive , as the authors suggest , they still need to be managed with care until a validation study on larger and independent cohorts will be set up . some of the identified metabolites may have direct link with the pathopysiology of diabetes and its chronic complications since , for example , butenoylcarnitine plasma accumulation has been related to the excessive yet incomplete mitochondrial oxidation of fatty acids , possibly attributable to a lower mitochondrial number and reduced oxidation capacity in t2d tissues while histidine , a modulator of inflammation and oxidative stress , may be correlated with impaired inflammation and oxidative stress in t2 dm and ckd patients . it is worth noting that both studies stressed the importance of mitochondria dysregulation in the pathogenesis of dn . urine metabolomics has been also applied to type 1 diabetic patients in order to identify predictive biomarkers of renal function worsening . metabolite profile of baseline 24 h urine samples of 52 type 1 diabetic patients ( 26 stable normoalbuminuric and 26 progressed toward microalbuminuria in 5.5 years ' follow - up ) was carried out by lc / ms and gc - ms . multivariate logistic regression analysis of gc - ms and lc / ms dataset showed 65% and 75% predictive power after cross - validation , respectively . twenty - one and 14 compounds showed a significant contribution to the logistic regression model based on gc - ms and lc / ms dataset , respectively . most of the identified gc - ms compounds were carboxylic compounds , acidic metabolites , and endogenous amino acids not showing a documented direct relation to dn while lc - ms dataset reveals specific compounds related to impaired fatty acids metabolism , detoxification system , and gut microbiome . serum and plasma metabolomics has been carried out of both whole samples and specific subfractions . marrachelli and coworkers performed both genomic and metabolomic screening of over 1500 caucasian t2 dm patients , characterized the serum metabolome profile of the microalbuminuric patients by nuclear magnetic resonance ( nmr ) , and correlated it with specific genotypes , thus reporting a potential predictive value of the genotype on the onset of microalbuminuria in t2 dm . furthermore , hirayama et al . reported , in t2 dm patients , 19 serum metabolites including creatinine , aspartic acid , -butyrobetaine , citrulline , symmetric dimethylarginine ( sdma ) , kynurenine , azelaic acid , and galactaric acid that were positively correlated with albuminuria and negatively with egfr . multiple logistic regression , carried out on identified metabolites , recognized 4 features , namely , aspartic acid , azelaic acid , galactaric acid , and symmetric dimethylarginine ( sdma ) as relevant for the model and allowed correct identification of dn patients with about 75% accuracy . zhang et al . carried out serum metabolomic profiling of 8 dn patients , 33 type 2 diabetes mellitus ( t2 dm ) patients , and 25 healthy volunteers in order to investigate the presence of dn biomarkers . importantly , they reported significant changes of leucine , dihydrosphingosine and phytoshpingosinewere specifically in the dn cohort , thus suggesting the perturbations of amino acid metabolism and phospholipid metabolism as key events in diabetic disease . other authors have instead investigated specific subfractions of the metabolome , namely , compounds linked to purine and pyrimidine metabolism , phospholipids , and fatty acids . xia et al . standardized an analytical method for analysis and quantification of purine and pyrimidine metabolites in dn patients and matched healthy controls . according to the well - established association of the purine and pyrimidine metabolic pathway with the development of the dn , they could assess that uric acid , xanthine , and adenosine were significantly increased in dn patients ( especially in those at stage v according to mogensen classification ) while inosine is reduced probably as a result of the adenosine deaminase inhibition that catalyzes inosine formation from adenosine . several phospholipids ( pls ) , significantly upregulated or downregulated in disease models , have been already recognized as potential biomarkers of t2 dm or dn [ 138 , 139 ] . comprehensive and quantitative analysis of plasma pls , such as phosphatidylethanolamine , phosphatidylglycerol , phosphatidylcholine , phosphatidylinositol , phosphatidylserine , sphingomyelin , and lysophosphatidylcholine , may selectively distinguish t2 dm from dn patients . targeted quantification of the phospholipids revealed proportional decrease of phosphatidylinositol and linear increase of sphingomyelin in dn patients . although the molecular pathogenetic mechanisms leading to impaired metabolism of phospholipids are not clear , the authors suggest that reduced phosphatidylinositol may reflect increased sorbitol pathway activation in t2 dm while increased sphingomyelin may depend on glucocorticoids - mediated sphingolipids metabolism . also plasma fatty acids ( fas ) may have a direct impact on the occurrence and development of diabetes since their abnormal accumulation in parenchymal cells of multiple tissues , called lipotoxicity , has been suggested as a trigger of t2 dm and its chronic complications . specific metabolomics screening of fas , namely , lipidomics , may contribute to the understanding of this disease . han and colleagues reported a standardized method based on gas chromatography - mass spectrometry ( cg - ms ) useful for the specific assessment of nonesterified and esterified fatty acids ( nefas and efas , resp . ) . lipidomics screening of 150 patients including diabetics with and without nephropathy showed high discrimination power on different stage of dn . disease progression was specifically correlated with plasma levels of arachidonic acid that is involved in the anabolism of prostaglandins , thus suggesting a key role of the inflammatory processes in the progression of dn . as genetic studies conducted so far are still inconclusive , it is difficult to envisage a common genetic basis for the development of dn . quite possibly a number of environmental factors contribute significantly toward the evolution of the diabetic patient to this specific complication . however , there is no doubt that , from the earliest stages of the disease , many molecular changes , observed at the transcriptomics , proteomics , and metabolomics level , anticipate the onset of a clinical phenotype and may allow us to reconstruct in detail the pathogenetic basis of kidney damage in t2 dm . although new omics challenges such as the analysis of the protein post - translational modifications and of multiprotein complexes , mimicking what naturally happen in intracellular behavior , will further broaden our understanding of the dn pathogenesis , we are already able to identify the common thread that unites all the disparate molecular changes described in the literature by performing bioinformatic - based analysis of genes , transcripts , proteins , and metabolites described so far . we can envisage that the selection of specific omic biomarkers and clinical phenotypes might lead to a better stratification of patient 's specific type of renal damage in t2 dm and might allow the identification of patients that progress or respond to a specific therapy . to accomplish this task and go forward , however , there is an urgent need to build up disease - specific platforms containing personal , clinical , and omics profiles that will allow the full potential application of systems biology analysis and the development of specific disease phenotype models . we can expect in the next future the development of new paradigms of renal damage in t2 dm that will contribute to defining of the road to the molecular medicine as a global , organized approach applicable to dn as well as to other relevant renal conditions .

diabetic nephropathy ( dn ) , a microvascular complication occurring in approximately 2040% of patients with type 2 diabetes mellitus ( t2 dm ) , is characterized by the progressive impairment of glomerular filtration and the development of kimmelstiel - wilson lesions leading to end - stage renal failure ( esrd ) . the causes and molecular mechanisms mediating the onset of t2 dm chronic complications are yet sketchy and it is not clear why disease progression occurs only in some patients . we performed a systematic analysis of the most relevant studies investigating genetic susceptibility and specific transcriptomic , epigenetic , proteomic , and metabolomic patterns in order to summarize the most significant traits associated with the disease onset and progression . the picture that emerges is complex and fascinating as it includes the regulation / dysregulation of numerous biological processes , converging toward the activation of inflammatory processes , oxidative stress , remodeling of cellular function and morphology , and disturbance of metabolic pathways . the growing interest in the characterization of protein post - translational modifications and the importance of handling large datasets using a systems biology approach are also discussed .

1. Introduction 2. Genetic Profiling of DN 3. Transcriptome Profiling of DN 4. Epigenetic Studies in DN 5. Proteomics Studies in DN 6. Metabolomics Studies on DN 7. Conclusion

in terms of phylogeny , aggression is among the oldest of evolved behavior patterns ( blanchard and blanchard , in press ) . exemplars of aggression have been reported in animals without a central nervous system ; in a host of invertebrates ; and in each of the seven classes of vertebrates , including the most primitive ; agnatha , hagfish and lampreys ( malmqvist , 1983 ) . there is an emerging consensus that one major function , i.e. adaptive consequence , of aggression , across animal species , is resource control ( e.g. wilson , 1971 ) , with the further provision that aggression typically occurs in the context of competition from conspecifics over such resources . term enhancement of access to resources that are important for that species ( blanchard and blanchard , 1984 ; moynihan , 1998 ) . resources and their distribution are also major factors in the development of species - typical social systems ( rubenstein , 2009 ) , of which within - species aggressive behaviors are one , important , component . some species such as mice are particularly opportunistic and may show rapid and dramatic changes in social structure in accord with habitat alterations ( bronson , 1979 ; gray and hurst , 1997 ) , a flexibility that may stem in part from their long - term status as human commensals , with its strong requirement of rapid adjustment to host - initiated changes ( blanchard et al . in press ) . however , the ecological conditions under which most mammalian species have evolved are less variable than those associated with human habitations and human geographic movements , and the social systems evolving in most habitats appear also to be more conservative and resistant to change than are those of mice . evaluation of the rate of change in evolved characteristics of animals in response to important alterations in ecological conditions constitutes a difficult field of study , but some estimates may be obtained when a fossil record is available that permits information on relatively specific ecological changes . for example , it has been estimated that reductions in selective behavioral responsivity to rattlesnakes and in resistance to the venom of these snakes by california ground squirrels both decline over periods measured in the tens of thousands of years after rattlesnakes have disappeared from the squirrels habitats ( coss et al . , 1993 ) . as this example suggests , when ecological changes make some of the existing characteristics of species less adaptive than previously , the replacement of these by more adaptive characteristics can be a lengthy and variable process ; moreover , maladaptive as well as adaptive aspects of the emerging behaviors may be relevant to the patterns that ultimately emerge . with complex behavior patterns such as those involved in social relationships an even longer time - frame might be needed than for venom resistance and other purely physiological adaptations . however , following long - term exposure to diverse situations , even closely related species would be expected to show behavioral differences based on what is most adaptive in their particular habitats : rubenstein ( 2009 , p. 243 ) gives the example of plains zebras ( equus burchelli ) , living in an environment in which close proximity of food and water allow female zebras to consistently form groups , in turn permitting males to vie for harems in this home range . in contrast , grevy 's zebra ( equus grevyi ) inhabit locales where food and water are widely dispersed and scarcer , such that females forage alone and must travel between feeding and watering areas . in this species males form territories along the traveling routes , gaining breeding access to females that pass through or linger within the territory . in both the harem and territorial social systems , zebra males attempt to control access to females in breeding condition , but the time - frame and the location of these efforts vary with the conditions under which these animals have evolved . some of these considerations may be relevant to a question that was raised at the very beginning of the scientific study of the evolution of behavior ( darwin , 1871 ) : what is the basis for the evolution of the lion 's mane ? is this related to the social systems of lions , which are unique among felids ? there are about 40 species of felids , all stemming from a split from other stem - line carnivores about 1015 million years ago ( mya ) . animals that can be identified with existing species emerged over a period from about 1012 mya ( for ocelots ) to very recently , possibly within historic times . felids range in size from the black - footed cat ( about 3 lbs ) to the siberian tiger , weighing about 200 more , and are world - wide in distribution , excepting only antarctica and most remote islands . felid social systems are relatively similar across species : adult animals tend to be solitary except for females and their young , and amicable adult encounters tend to be connected with reproduction . a great deal is known of the specifics of aggression in felids , due in large part to the work of paul leyhausen , who worked with domesticated cats and with other felid species in captivity , at the max planck institute for behavioral physiology , at wuppertal . large felids , of the genus panthera have also been the subjects of extensive field work , which has generally affirmed leyhausen 's conclusions about conservation of many aggressive behaviors and facial expressions across felid species . briefly , leyhausen ( 1978 ) described intraspecific aggression in these animals as a behavior that is capable of producing great damage , as all felids have weapon systems that have evolved to facilitate their roles as predators but are used also in within - species fighting . leyhausen also indicated that aggression in felids is more regulated by effective defenses than responsive to the submission signals that are quite effective in reducing intra - group fighting in many canid species , such as wolves and dogs . by selecting animals and arranging situations , leyhausen was able to polarize attack and defensive behaviors in domesticated cat subjects , or , alternatively , to maximize attack motivations for both combatants . in a highly polarized attack - defend situation , the attacker stands tall and advances directly toward the victim while emitting low growls . the defending animal crouches down , or , with a mixture of aggressive and fearful motives , may assume the classic halloween cat stance with arched back , and erected hairs . as the attacker approaches contact , the defending animal may assume a contorted posture , half on its back but facing the other cat , enabling both fore- and hindpaws to be drawn up and opposed to the oncoming attacker . both fore- and hindpaws may lash out at the attacker and disembowelment of the attacker is possible , particularly if it attempts to reach over to bite at the partly supine defender 's nape . however , when both animals are highly motivated to attack , a frontal approach is typically utilized by both , resulting in animals facing each other and delivering forepaw blows largely toward the head and neck of the other . cat social systems provide a strong enabling factor in the dangerousness of aggression in these animals . because of their solitary life - style , there is little reason for a felid under attack from a member of its own species to stay and receive bites and blows from the highly developed weapon systems that are characteristic of all felid species . the only context in which fighting may be strongly adaptive is mating , where flight , even if successful in avoiding injury , results in a substantial reduction in a male 's extended reproductive fitness . given that felids , particularly the larger ones such as tigers and leopards , kill large prey , it might be assumed that fighting over such prey would constitute a frequent occasion for fighting . however , the solitary life - style of these animals also acts to reduce conspecific encounters over prey . lions are a different story . first , with the exception of the domesticated cat , which is not yet a truly separate species as it still freely interbreeds to produce fertile offspring with its wild ancestors ( driscoll et al . , 2007 ) , the lion ( panthera leo ) is the most recent cat species to emerge . while the earliest lion - like cat may date to the late pliocene , cave paintings indicate that males had no manes ( barnett et al . , 2006 ) . modern maned lions appear to have descended from a single population that arose about 200 thousand years ago , possibly in africa , and spread throughout the northern hemisphere , replacing earlier lion - like cats in europe as recently as 1015,000 years ago ( yamaguchi et al . , 2004 ) . although yamaguchi et al . ( 2004 ) suggest , based on a comparative analysis of food abundance factors in living species , that the earlier holartic cave lion might have been group - living as are modern lions , there is no direct evidence that this was the case . thus this particular mode of sociality , highly unusual for felids , may have been characteristic of holarctic lions ( panthera leo spelaea ) or , it may have evolved , along with the male lion 's mane , only in modern lions . the classic hypothesis for a relationship between group - living and the development of manes is that manes reduce the dangers associated with fighting within lion groups ( darwin , 1871 ; ewer , 1968 ; schaller , 1972 ; blanchard and blanchard , 1984 ) . insofar as group - living is adaptive , serious injuries resulting from fighting within the group would be maladaptive for both the attacker and the injured animal , encouraging the latter to leave the group or reducing its ability to join in protecting the group from attack by outsiders . this is a particularly important consideration for lions , in that take - over of prides by nomadic lions entails infanticide by the new pride males ( loveridge et al . , 2006 ) providing an extremely direct and strong adaptive consequence for success or failure at take - over , which in turn reflects the strength and numbers of the male cohorts on each side of the battle . a recent proliferation of nature documentaries plus the development of youtube and other online sources has made videos of fighting in a variety of animals available . there are literally dozens of lion fighting videos online , and some of these provide clear footage of adult males fighting , with continuity , in nonenclosed areas that appear to be the animals natural habitats . although the films were certainly selected for dramatic impact , and it is sometimes difficult to ascertain whether any external provocation might have been involved , it seems highly unlikely that the animals actual fighting behaviors were trained or shaped . moreover , a variety of animals and videotaping sources appear to have been involved , substantially reducing the possibility that the clips present a systematically biased view of the actual behaviors involved in serious fights in lions . the form of both attack and defense in male lions appears to be highly consistent across these clips , particularly demonstrating the mutual frontal attack seen in other felids . the only time that an attacked male voluntarily exposes its back to an attacker is when it is fleeing . even then , as the pursuer comes close , the pursued animal typically turns toward it , presenting its own weapons . even a young cub , attacked and ultimately killed by an adult male , turns to face its attacker , flipping on its back in a move reminiscent of defensive domestic cats , as contact becomes imminent . this view of male lions manes as protective has recently been challenged by findings regarding wound locations on wild males , females , and young ; by studies measuring approaches to dummy male lions with varying mane characteristics ; and by observations of maneless lions in the tsavo area of kenya . with reference to the first of these , west and packer ( 2002 ) examined sites of lion - inflicted wounds on a large sample of lions , sorting them into four regions ; neck / shoulder , as delineated by the perimeter of the mane ; face ; trunk ; and legs . they found that wounds were fairly evenly distributed over all four regions in females and subadults , and over three , excluding the area covered by the mane , in adult males . moreover , females and subadults were equally likely to survive wounds to each body part . these figures are not easy to reconcile with those of schaller ( 1972 ) who describes three direct observations of lions killing lions ( p. 189 ) : of these , two involved bites to the nape of the neck , while the third was a bite to the lower back , severing the vertebral column . a fourth example , not witnessed but examined while the victim was still alive , albeit expiring , involved a pride male with multiple deep wounds , including a broken saggital crest , and a penetrating wound to the chest , with tatters of his mane scattered over a 3 10 meter area ( p. 48 ) . these examples do not indicate that other sites are not involved in attacks of one lion on another , but they do suggest that bites to the head and nape , if they reach these targets , are likely to be especially lethal . moreover , in 259 observations of aggressive acts between female lions and cubs at kills , about 75% involved slaps at the head and neck , suggesting that these are indeed targets , albeit of blows that appear less likely to leave wounds ( schaller , 1972 , p. 134 ) . it might also be noted that wound sites do not necessarily have the same meaning as do targets : if , as in domestic cats , female and subadult lions have behavioral defenses that serve to protect the neck and shoulder by interposing teeth and claws to the attacker , a lack of disproportionate wounds on these sites may simply reflect the success of such defenses . indeed , if the face ( one of the four areas measured ) had a relatively even share of wounds ( west and packer , 2002 ) even though it is much the smallest of the four areas evaluated , this may suggest that faces were wounded disproportionately to their area , perhaps in consequence of a facing defense that served to protect the neck and shoulders . our own observations of adult male lions suggest that facial wounds are very common ( see figure 1 ) . at any rate , the argument that a lion 's mane is protective applies to animals that have manes , i.e. adult males . if such protection were equally important for females and subadult males , and this was indeed the basis on which manes have evolved , then presumably females and subadult males would have manes as well . a second finding relates to approach and avoidance responses of wild lions to dummies set up to have long or short manes , and , light or dark manes . females approached the dark - maned model , and the long - maned model , proportionately more than did males ( west and packer , 2002 ) . female choice of both is consonant with findings that dark - maned males have higher testosterone levels than light - maned males , and that mane length ( and other aspects of quality ) reflect health as well as genetic differences . male avoidance of these particular dummies may well reflect the same factors , and is also consonant with a view that mane quality provides protection against attack , providing abundantly maned lions an advantage in agonistic situations . a particularly interesting factor in the relationship between lion manes and lion social systems is that there are two groups of lions in which males show much less abundant manes ; asian lions in the gir forest of india , and the tsavo lions of lowland kenya . due to human pressures on their habitat , the gir lions are basically a remnant population , albeit with relatively high genetic diversity ( sachdev et al . , 2005 ) but the tsavo lions are doing well , and lack of a mane does not appear to have had any effect upon their reproductive efficiency ( gnoske et al . , 2006 ) , or on their predatory capacity : two of these male lions were notorious for killing over 100 workers on the kenya - uganda railway , at the end of the 19 century ( patterson , 2004 ) . gir lions have substantially scantier manes than those in africa , with the exception of the tsavo region , while the tsavo lions are typically characterized as maneless . abundantly - maned male lions disproportionately overheat when the ambient temperature is high ( west and packer , 2002 ) , strongly suggesting that the relatively poor manes of lions in both areas constitutes a direct evolutionary response to the heat - based maladaptiveness of manes in these local climates . tsavo , lying between the upland plateau of kenya and the coast , is within three degrees of the equator and has no cool months of the year . the gir forest has year - round high levels of both heat and humidity , producing a climate where discomfort from heat and humidity is rated as high or extreme for 10 of the 12 months of the year ( bbc weather service ) . these climate factors , taken in conjunction with direct measures of overheating of lions with manes in hot weather , appear to provide a sufficient and direct explanation for the manelessness of tsavo and gir males . if lion manes arise because they serve as a permissive factor in the context of multi - male prides , what happens to multi - male prides when males do not have manes ? in particular , if mane reduction in these lions is an evolutionary response to long - term high heat and humidity in the environment , alterations in their social systems may be secondary to such male mane changes , i.e. represent an effect of mane changes on sociality . surveying 13 lion groups of known age and sexual composition in tsavo , kays and patterson ( 2002 ) reported that only 2 of the 13 groups had more than one male , and both of these were nomadic , male - only groups . the male - female prides surveyed had an average of more than seven females each , indicating that resource scarcity was not important in group size , and could not account for the presence of only a single male per group . these demographics constitute a very striking difference from lion prides in other areas of africa . schaller ( 1972 ; table ii ) notes that in 14 serengeti lion prides , there were between two and four adult males each , with no pride having only a single adult male . however , in the kays and patterson ( 2002 ) study , mane scores based on length , thickness , and color of hair were determined for males of four prides and three nomad groups . mean scores were somewhat higher for the pride males than for the nomad groups , with the latter containing a higher proportion of young males . however , these scores overlapped completely , ranging from 0 to 24 for the pride males and 0 to 24 for the nomad group males , suggesting that female choice based on male mane characteristics was not a major factor in the composition of prides . while this finding may seem somewhat at variance with west and packer 's ( 2002 ) finding that females tended to approach male dummies with darker / longer manes , it emphasizes that the motivations involved in such approaches are not clear . the appearance of a strange male in a female 's pride territory may well elicit approaches based on motivations other than sexual interest ( e.g. schaller , 1972 , p. 53 ) , including assessment of the risk posed to herself and her offspring . the gir lions show an even more deviant pattern of sociality , compared to those in most areas of africa . in the gir forest .. male and female lions lead separate lives and rarely associate with each other prides are composed of related females , their young , and subadult male offspring ( sunquist and sunquist , 2002 , p. 293 ) . thus in both tsavo and gir , the scantiness or lack of manes in male lions is associated with a particular change in sociality , in which adult males do not simultaneously associate with both females and each other . notably , the difference does not involve a reduction in association with females per se , as the tsavo lion prides typically include one male and several females , nor does it involve a lack of male associations , as both tsavo and gir males often associate in male - only groups . the crucial feature appears to be whether multiple males and females associate in relatively long - term relationships , i.e. prides . in the areas where they occur , smuts ( 1982 ) noted that prides without males in constant attendance failed to raise any cubs . as females are the primary hunters in most prides ( schaller , 1972 ) , this failure to rear cubs probably is not due to cub starvation in prides without males , but instead is the consequence of infanticide by nomadic males ( bertram , 1978 ; packer and pusey , 1983 ) . this suggests that multi - male , mixed - sex lion prides enhance reproductive success by protecting the pride from take - over and subsequent infanticide by other males . if this analysis is valid , the adaptiveness of male manes may be to allow males within prides to fight , while reducing the chance of lethal contact with the particularly vulnerable sites that are normally protected by the mane . there is some difference of opinion ( or observation ) about the levels of aggression by male lions in a courtship context , with some authorities reporting vigorous fighting ( guggisberg , 1961 ) while others ( schaller , 1972 ) do not . male fighting influences access to females in estrus , the male mane would have an obvious adaptive advantage in this context . however , fighting in contexts other than mating can also provide an arena for realization of the adaptiveness of manes in pride males . in particular , lions show little restraint of aggression when feeding , showing few inhibitions about slashing and biting fellow pride members : schaller ( 1972 ; p. 135 ) suggests that this is due to their lack of a true dominance hierarchy , related to the generally solitary life - styles of felids . there is no reason to believe that such disputes are less common , or potentially less damaging , in male male groups . however , if fighting within a nomadic multi - male group is sufficiently damaging as to injure or drive away group members , this has little or no immediate impact on the reproductive success of males in the group , although it might reduce the probability of future success in taking over a pride . in contrast , for a pride male to be injured or driven off makes the pride immediately and substantially more vulnerable , and the infanticide that typically follows a successful take - over may completely eliminate the progeny of the pride males ( packer et al . , 2009 ) . so , to go back to the question posed in the introduction to this article , is it male male fighting , or female choice , or both , that makes the lion 's mane adaptive ? in favor of a view that male male contests are made more adaptive by manes are findings that : ( 1)fatal injuries from lion fights often involve the head and nape.(a)there is some evidence for targeting of these sites.(b)lion fighting involves frontal confrontations such that damage in these areas might be expected in the absence of evolved targeting and(c)these areas are particularly vulnerable , in terms of immediate mortality in response to bites and blows.(2)when manes are reduced , likely by environmental factors , multi - male , mixed - sex prides are vanishingly rare . lion fighting involves frontal confrontations such that damage in these areas might be expected in the absence of evolved targeting and these areas are particularly vulnerable , in terms of immediate mortality in response to bites and blows . when manes are reduced , likely by environmental factors , multi - male , mixed - sex prides are vanishingly rare . the west and packer ( 2002 ) findings do suggest some female choice of more abundantly maned males , in that : ( 1)females approached heavily - maned dummies more than did males.(2)also , field studies indicate that female lions do exercise a substantial degree of mate choice , although it is not known if this reflects male mane characteristics.(3)mane quality is a sensitive index of health in lions . females approached heavily - maned dummies more than did males . also , field studies indicate that female lions do exercise a substantial degree of mate choice , although it is not known if this reflects male mane characteristics . putting these findings together , it seems most like that both is the best answer , but with the further provision that female choice appears to be based on a characteristic that is independently adaptive in terms of the social characteristics of most lions . that is , the mane honestly advertises the quality of a trait that is adaptive for males ( see johnstone , 1995 for a discussion of this view of sexual section ) . indeed , if the mane were selected simply on the basis of female choice , albeit with the result that male offspring with high levels of this trait would similarly prove attractive to females , this would raise a legitimate issue of why only female lions , of all the many felid species , show such a choice . the relationship between multi - male mixed - sex social groups and male manes might conceivably have arisen as a coincidence . however , the coincidence explanation is substantially challenged by findings that mane reductions in the gir and tsavo lions , that appear to be the result of persistent hot or hot and humid environments known to produce overheating in maned lions , are associated with a virtual elimination of multi - male prides . this may reflect nothing more than a human propensity to be intrigued by unique or unusual features of the natural world . the lion 's mane is a highly unusual , sexually dimorphic , male feature , arising about the time of puberty , found in a species that is more social than are its phylogenetic relatives , and in possession of weapons that may be lethally applied to others of its kind : the feature covers an area that is directly accessible in frontal confrontations , may be a particular target of attacks , and is highly vulnerable , as indexed by potential mortality when wounded . morris ( 1968 ) , in the naked ape raised the intriguing question of why humans have less , or shorter and thinner , hair on most body sites . perhaps an even more intriguing question is why humans , absolutely uniquely in the animal kingdom , have two sexually dimorphic hair patches that grow indefinitely . moreover , one of these patches , the beard , begins to grow during puberty , and is thickest in young adulthood and full maturity , tending to decline in old age . like the lion 's mane , male beards are widely assumed to be somewhat adaptive in the context of providing a visual aid to identification of gender at a distance ; in advertising social dominance ; or as sexually attractive to women ( barber , 1995 ) . as evidence for the latter is inconsistent ( feinman and gill , 1977 ; hatfield and sprecher , 1986 ) , and the accuracy and value of other presumed adaptive functions of beards are debatable ( barber , 1995 ) , the near - universal existence of male beards in humans , albeit variable in individual magnitude , remains something of a mystery . figure 1 provides a very good look at the facial and neck structures covered by beards , as well as some estimation of the degree of coverage they may confer . these areas are front and center in aggressive confrontations and may be especially vulnerable to blows when weapons are not used , or to blows from the blunt force weapons that have been available throughout much of hominid evolution . the glass chin phenomenon is well known in boxing , and direct blows to the front and sides of the neck as well as the area just under the nose can be particularly lethal . both are particular targets of attack in unarmed combat techniques ( schillingford , 2001 ) . this protective feature of human beards is also recognized in the technical and competition rules of the international amateur boxing association , which prohibit beards in boxing matches . in addition , based on extensive observations of encounters in young children , the child psychologist margaret manning has suggested ( personal communication ) that the head / face / neck area is a specific target of attack in young children . this is particularly interesting as combat training is unlikely to be involved in childrens preferences , and it may provide something of a functional or adaptive basis for the nonsexually dimorphic , evergrowing hair patch that covers the dorsal , side , and back sections of the head . notably , if left to grow , head hair also covers the back and sides of the neck , leaving the front of the neck , the most vulnerable aspect in frontal confrontations , exposed except in pubertal and postpubertal males . the many points where manes and beards show parallels also bring up the interesting question of why other mammalian species with potentially lethal weaponry fail to develop such protections . one answer , already mentioned , is that they may be much less necessary in species with solitary life - styles . another is that a structure such as the horns or antlers of ungulates may simultaneously serve as weapon , target site , and protection against this specialized form of intraspecific attack . indeed , such protective weaponry is much more common in gregarious than in solitary species of african bovids ( estes , 1992 ) . however , many other social species have weapons that are clearly capable of causing lethal conspecific damage , but have no notable structures to protect highly vulnerable sites . one possible reason for this omission may be that animals with both dangerous weapons and a long and consistent evolutionary history of sociality , such as most canids , tend to have a clearer within - group dominance structure than do lions , including behavior mechanisms ( submission ) that reduce intraspecific attack ( macdonald and sillero - zubiri , 2004 ) . humans do certainly have both dominance hierarchies and submissive behaviors , but these appear to vary widely across cultures and their existence and extent in precultural humans is difficult to estimate . while there appears to be a linear dominance hierarchy in male chimpanzees ( goldberg and wrangham , 1997 ) , this appears not to be so in bonobos ( paoli et al . , 2006 ) ; these having equal claim to the ancestral line from which humans split . perhaps lions and humans came to their need for protection against lethal intraspecific attack through slightly different routes ; lions with long - term lethal weapons but lately evolving a social life - style , whereas people are from a line with substantial , though not clearly delineated , sociality , but lately evolving the development and use of lethal weapons . both species may have encountered the combination of a social life - style and lethal weaponry too rapidly to evolve innately - organized social mechanisms that protect individuals from the damaging consequences of intra - group attack . this view implies that structural protections ; here , long , coarse , and abundant hair growth in relevant sites , may be more easily or rapidly evolved than are complex behavioral changes . however , it is only one of many potential questions following from the present analysis . it seems likely that a combination of experimental and ethological approaches may be necessary in order to gain a better understanding of the complex evolutionary interplay between sociality and other behavioral and structural characteristics of particular species . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

the function of manes in lions has been a topic of scientific interest since darwin ( 1871 ) suggested that it provides protection in intraspecific fights . recent experimental studies on wild lions have emphasized the role of female selection , but analyses of specific attack behaviors and targets , and the social consequences of manelessness for lions living in very hot climates suggest that male manes may indeed mitigate the outcomes of intraspecific male attack and thus serve a permissive function for multi - male + female groups , facilitating protection of prides against take - overs and infanticide by nomadic males . humans also have unusual structural protections for the head , face and neck , areas that are especially accessible during intraspecies attack , and highly vulnerable to damage . one of these , the beard , consists of coarse hairs that grow indefinitely , but only for males , and only during and following puberty ; suggesting that it , like the lion 's mane , may serve as protection in intraspecies male fights . such structural protections may reflect a specific combination of lethal weaponry and social life - style , particularly when these are developed so rapidly that they are not accompanied by the evolution of complex attack - inhibiting social behaviors .

Aggression, Social Systems and Evolution A Particular Case in Point: Felids Lion Social Systems Arguments Against the Mane as Protection Sociality in Maneless Lions Lions.and Men? Conflict of Interest Statement

proteomic studies typically use tandem mass spectrometry ( ms / ms ) employing collision - induced dissociation ( cid ) for identification ( and quantification ) of large numbers of peptides and proteins [ 1 , 2 ] . however , complete assignment of the product ions remains impossible because of limitations in our understanding of peptide dissociation pathways . low energy cid typically results in charge - directed cleavage of amide bonds in accordance with the mobile proton model [ 3 , 4 ] , which describes the intramolecular transfer of a proton from a basic moiety to a heteroatom along the peptide backbone . weakening of the peptide bond results and fragmentation ensues , generating diagnostic b- , y- , and a - ions . these product ions are then used to determine the amino acid sequences of the precursor peptides and hence elucidate identity of the proteins whence they derive . the structure of c - terminal y - ions is recognized to be that of a truncated peptide ( yn ) or protonated amino acid ( y1 ) . however , the structure of their b - ion counterparts is still the subject of much interest . more recently , b - ions have been shown to incorporate a c - terminal oxazolone ring . nucleophilic attack by the n - terminal amine on the electrophilic carbonyl carbon within this protonated oxazolone ring results in the formation of a fully macrocyclic intermediate from the linear oxazolone - terminating b - ion [ 68 ] , with the prevalence of macrocycle formation increasing with b - ion length [ 912 ] . we have previously demonstrated that cid of protonated linear yagfl - nh2 results in the formation of a heterogeneous b5 ion population with respect to drift time during analysis by traveling - wave ion mobility spectrometry - ms . this observation is consistent with the formation of a macrocyclic intermediate that is stable over the timescale of the ion mobility ( i m ) separation . many other more recent studies utilizing im - ms , infrared multiphoton dissociation ( irmpd ) spectroscopy , electron - transfer dissociation ( etd ) , hydrogen / deuterium ( h / d ) exchange , and theoretical calculations , often in combination , support the observation of multiple b - ion conformations / isomers , arising during cid [ 8 , 9 , 1418 ] . for example , direct spectroscopic evidence for the existence of a macrocyclic intermediate has been obtained from irmpd analysis of the b4 ion of leu - enkephalin and the b5 ion produced from g5r . once formed , this macrocyclic intermediate can ring open at various amide bonds , yielding non - native or scrambled peptide sequences , where previously internal amino acid residues become exposed at the termini . these rearranged species can then undergo secondary fragmentation events , which are particularly prevalent following cid using a qtof type collision cell , producing a product ion series not representative of the initial peptide sequence . macrocycle formation thus functions as a precursor to the formation of non - native , or scrambled , product ions . use of the common peptide fragmentation nomenclature [ 21 , 22 ] to describe such scrambled sequence ions is fraught with confusion ; consequently , we have recently proposed an extension to this nomenclature , enabling secondary product ions resulting from macrocycle formation to be easily assigned . a study by harrison showed that the abundance of product ions generated from these non - native sequences increases with elevated cid collision energies . these experiments and others ( e.g. , ) also demonstrate that sequence scrambling can be prevented through acetylation of the peptide n - terminus , a finding that supports the proposed mechanism of macrocycle intermediate formation . of concern when considering the propensity for occurrence of such complex fragmentation pathways is that facile sequence rearrangement and subsequent fragmentation can result in the production of abundant scrambled product ions and , hence , misassignment of the original peptide sequence . research into the frequency with which such scrambled sequences are observed and the potential consequences of this rearrangement for large scale ms / ms analyses has been conducted [ 12 , 25 , 26 ] . however , there remains a dearth of understanding regarding the extent to which such sequence scrambling occurs or , indeed , the multitude of factors which potentially influence the process . the majority of studies aimed at facilitating understanding of these rearrangement mechanisms primarily utilize synthetically generated conservative a number of investigations have been conducted to assess the effect of peptide size on sequence scrambling ; van stipdonk and coworkers reported that for the tetrapeptide yafg and permuted isomers , cid of the b3 ion does not result in the production of non - sequence ions , an observation rationalized by considering the extensive steric strain that would result following cyclization . however , they did observe product ions indicative of sequence scrambling for larger species , ranging from pentapeptides to decapeptide methyl esters . the increased size and associated degrees of freedom of these larger species may be expected to disfavor macrocycle formation , but the results are in accordance with our own observation for the scrambling of the b9 ion produced from the peptide neurokinin dmhdffvglm - nh2 . tirado and polfer have recently conducted a more extensive investigation to better understand the effect of b - ion length in the prevalence of macrocycle formation . however , size alone does not account for all the b - ion structures observed , with subtle differences in the sequence also playing a role . although small b2-ions generally prefer to adopt oxazolone structures , the inclusion of basic residues ( e.g. , histidine , arginine ) has been demonstrated to result in enhanced formation of diketopiperazine structures [ 29 , 30 ] . macrocycle formation of larger b - ions also appears to be disfavored in the present of proline , resulting preferentially in oxazolones . atik and yalcin conducted a detailed study to determine the effect of acidic side chains on peptide rearrangement pathways , but observed little dependence on the extent of sequence scrambling on the position of glutamic acid and aspartic acid side chains within the peptide structure . conversely , it has been reported by bythell et al . that the position of the basic amino acid histidine within permuted isomers of an alanine - rich hexapeptide sequence does influence the observed scrambling of the b5 ion generated upon cid . location of the histidine residue near the peptide n - terminus precluded cyclization , yet situation of this basic residue near the c - terminus of the initial b5 ion permitted observation of the scrambled products . the presence of arginine and lysine residues can also heavily influence observed peptide decomposition pathways , either because of the formation of salt bridging interactions [ 34 , 35 ] or through nucleophilic attacks [ 3537 ] . these factors might , therefore , be expected to influence the formation and subsequent ring opening of the b - ion macrocycle . interestingly , in contrast to other amino acids with nucleophilic side chains , the presence of an internal arginine residue appears to inhibit peptide scrambling . this effect has been attributed to the high gas - phase basicity of the arginine side chain , which sequesters the available proton , thereby preventing facile macrocycle formation . however , lack of formation of the macrocycle precursor is not the sole explanation for why a low abundance of ions derived from sequence scrambling may be observed from a particular precursor . two other possibilities exist , namely , failure for the macrocycle to ring open following formation or failure of the ring - opened linear intermediate to fragment further . in our present study , we address these possibilities through analysis of a selection of peptides produced by proteolysis of either bovine serum albumin ( bsa ) or enolase ( s. cerevisiae ) , using the proteases lys - n ( cleaving n - terminal to lysine residues ) and lys - c ( cleaving c - terminal to lysine residues ) , and demonstrate differences in the extent of scrambled product ions generated for some of the resultant peptides . formation of the more highly basic homoarginine residue by guanidination of n - terminal lysine residues was subsequently used to help elucidate the role of gas - phase basicity in peptide rearrangement . the proteins bovine serum albumin ( bsa ) and enolase from s. cerevisiae were obtained from sigma aldrich ( poole , uk ) and resuspended in 50 mm ammonium bicarbonate ( 10 pmol/l ) . each was then reduced with dithiothreitol ( 4 mm , 60c , 45 min ) and alkylated ( iodoacetamide , 14 mm , room temperature , dark , 1 h ) . the dtt concentration was increased to 7 mm and samples proteolyzed overnight with lys - n or lys - c proteases ( 2% [ w / w ] , 37c ) . an aliquot ( 100 pmol ) of each of the peptide digestion mixtures was dried by vacuum centrifugation and reconstituted in 10 l h2o . to this , ammonium hydroxide ( 7 m , 10 l ) and o - methylisourea ( 0.5 m in h2o , 5 l ) were added and the reaction mixtures left overnight at room temperature . each of the derivatized samples were again dried by vacuum centrifugation and reconstituted in 10 l h2o , prior to desalting using c18 ziptips ( millipore , watford , uk ) . peptide mixtures ( both derivatized and underivatized ) were diluted to a final concentration of 1 pmol/l using 50% ( v / v ) acetonitrile in water containing 0.1% ( v / v ) formic acid , and infused into a synapt hdms instrument ( waters , manchester , uk ) using gold - coated nanospray emitter tips ( proxeon , odense , denmark ) . the capillary voltage , cone voltage , and source temperature were set at 2.3 kv , 40 v , and 80c , respectively . the m / z of interest was mass selected by the quadrupole mass analyzer prior to being subjected to cid in the trap collision cell . the collision energy applied in this region was manually tuned to give optimal peptide fragmentation , such that the precursor ion abundance was ~10% that of the base peak . further analysis of the peptide fgeralk ( 1 pmol/l in 50% ( v / v ) acetonitrile in water containing 0.1% ( v / v ) formic acid was conducted by direct infusion nano - electrospray ionization ( nesi ) ( 5 l / min ) using an amazon ion trap ( bruker , bremen , germany ) . mass selection at m / z 410.7 corresponding to that of the peptide of interest was performed , followed by cid with the fragmentation amplitude set to 0.35 ev , with data collected between m / z 150 and 1800 . the proteins bovine serum albumin ( bsa ) and enolase from s. cerevisiae were obtained from sigma aldrich ( poole , uk ) and resuspended in 50 mm ammonium bicarbonate ( 10 pmol/l ) . each was then reduced with dithiothreitol ( 4 mm , 60c , 45 min ) and alkylated ( iodoacetamide , 14 mm , room temperature , dark , 1 h ) . the dtt concentration was increased to 7 mm and samples proteolyzed overnight with lys - n or lys - c proteases ( 2% [ w / w ] , 37c ) . an aliquot ( 100 pmol ) of each of the peptide digestion mixtures was dried by vacuum centrifugation and reconstituted in 10 l h2o . to this , ammonium hydroxide ( 7 m , 10 l ) and o - methylisourea ( 0.5 m in h2o , 5 l ) were added and the reaction mixtures left overnight at room temperature . each of the derivatized samples were again dried by vacuum centrifugation and reconstituted in 10 l h2o , prior to desalting using c18 ziptips ( millipore , watford , uk ) . peptide mixtures ( both derivatized and underivatized ) were diluted to a final concentration of 1 pmol/l using 50% ( v / v ) acetonitrile in water containing 0.1% ( v / v ) formic acid , and infused into a synapt hdms instrument ( waters , manchester , uk ) using gold - coated nanospray emitter tips ( proxeon , odense , denmark ) . the capillary voltage , cone voltage , and source temperature were set at 2.3 kv , 40 v , and 80c , respectively . the m / z of interest was mass selected by the quadrupole mass analyzer prior to being subjected to cid in the trap collision cell . the collision energy applied in this region was manually tuned to give optimal peptide fragmentation , such that the precursor ion abundance was ~10% that of the base peak . further analysis of the peptide fgeralk ( 1 pmol/l in 50% ( v / v ) acetonitrile in water containing 0.1% ( v / v ) formic acid was conducted by direct infusion nano - electrospray ionization ( nesi ) ( 5 l / min ) using an amazon ion trap ( bruker , bremen , germany ) . mass selection at m / z 410.7 corresponding to that of the peptide of interest was performed , followed by cid with the fragmentation amplitude set to 0.35 ev , with data collected between m / z 150 and 1800 . to study the effect of increasing the gas - phase basicity of the n - terminal residue on sequence scrambling , it was first necessary to identify those peptides produced by digestion with lys - n that exhibited evidence of significant rearrangement during cid . a selection of native lys - n peptides and their corresponding derivatized sequence , now with an n - terminal homoarginine residue , were isolated and subjected to cid in the trap collision cell of a synapt hdms instrument ( waters ) . as expected , increased collision energy was required to induce dissociation of the derivatized analogue because of reduced mobility of the proton now sequestered by the homoarginine residue . figure 1 compares the cid product ion spectra produced from analysis of the native and lysine - derivatized forms of the singly protonated peptide kgvlhav . the spectrum derived from the native peptide ion ( figure 1a ) contains several species attributable to scrambling of the original primary sequence . however , these rearranged product ions are not observed in the ms / ms spectrum of the derivatized peptide ( figure 1b ) . the b6 ion of the derivatized peptide ( k*gvlha ) does not appear to be generated during cid and , hence , the precursor to formation of many of the observed rearranged product ions is not present . however , there is an abundant peak at m / z 666.40 that corresponds to the b6+h2o ion ; such species have previously been shown by thorne et al . to have a linear structure analogous to that of an intact peptide . as the oxazolone moiety is required for the macrocyclic intermediate to form , scrambled species can not , consequently , be generated from this linear ion . moreover , the [ b53]b4 scrambled species in the native peptide product ion mass spectrum derived following rearrangement of the primary b5 product ion ( labeled according to the chawner et al . these differences can only be explained by the induced change in the n - terminal residue side chain . curiously , a number of product ions were observed from these lys - n - generated peptides that could not be assigned after consideration of either linear or b - ion rearranged product ions , and their likely identity has yet to be determined . the observation of unassigned product ions is in contrast to the typical ion trap cid spectra of lys - n peptides exemplified in taouatas et al . , but apparent in the few qtof cid spectra presented by rao et al . , suggesting that these ions may in part be an effect of the n - terminal basic residue on secondary fragmentation pathways occurring during beam - type cid.figure 1comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] peptide kgvlhav at m / z 723.45 , and ( b ) cid of [ m+h ] peptide k(guanidinyl)gvlhav at m / z 765.47 comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] peptide kgvlhav at m / z 723.45 , and ( b ) cid of [ m+h ] peptide k(guanidinyl)gvlhav at m / z 765.47 further examples of the enhanced formation of b(n-1)+h2o species following guanidination of the n - terminal lysine residue are shown in knvply ( figure 2a ) and klvtdlt ( figure 3a ) ; both decompose during cid to produce minor b(n-1)+h2o species corresponding to loss of the c - terminal amino acid , in addition to generating ion series that are indicative of sequence rearrangement . in each example following derivatization , the peptide ion containing the n - terminal homoarginine residue dissociates to produce a significantly more abundant b(n-1)+h2o species , with no sequence scrambled species being observed ( figures 2b and 3b ) . in the case of knvply ( figure 2 ) , the native peptide generates scrambled products from b5 ( including a pseudo c- terminal product ion designated [ b52]y3 ) , whereas the derivatized peptide yields the b5+h2o ( and b4+h2o ) product ion upon cid . likewise for klvtdlt ( figure 3 ) , formation of the b6+h2o and b5+h2o product ions upon n - terminal derivatization appear to preclude the generation of b5- and b6-derived scrambled products.figure 2comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] knvply at m / z 733.42 , and ( b ) cid of [ m+h ] derivatized peptide k(guanidinyl)nvply at m / z 775.45 . only those scrambled species with significant abundance ( ~10% ) are labeled ; y represents a product ion arising the pseudo c - terminal portion of the rearranged b - ionfigure 3comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] klvtdlt at m / z 789.47 , and ( b ) cid of [ m+h ] derivatized peptide k(guanidinyl)lvtdlt at m / z 831.49 . although a large number of scrambled species were present ( a ) , only those of significant abundance are labeled comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] knvply at m / z 733.42 , and ( b ) cid of [ m+h ] derivatized peptide k(guanidinyl)nvply at m / z 775.45 . only those scrambled species with significant abundance ( ~10% ) are labeled ; y represents a product ion arising the pseudo c - terminal portion of the rearranged b - ion comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] klvtdlt at m / z 789.47 , and ( b ) cid of [ m+h ] derivatized peptide k(guanidinyl)lvtdlt at m / z 831.49 . although a large number of scrambled species were present ( a ) , only those of significant abundance are labeled observation of enhanced b(n-1)+h2o ion formation is consistent with the findings reported by various groups [ 40 , 43 , 44 ] ; the c - terminal rearrangement required for the formation of such ions is promoted by the presence of a basic residue at the n - terminus . derivatization of the n - terminal lysine side chain to homoarginine enhances the gas - phase basicity of this residue , increasing the extent of rearrangement and thus permitting b(n-1)+h2o ion formation . the apparent inhibition of peptide sequence scrambling following derivatization may , therefore , simply be a result of ion current being directed away from the formation of oxazolone - terminated b - product ions , reducing the abundance of the precursors to sequence scrambled species . alternatively , the reduced complexity of the observed products of fragmentation following derivatization may result because of the presence of a homoarginine residue , analogous to the observation reported by molesworth and van stipdonk for arginine containing sequences . molesworth and van stipdonk concluded that inhibition of sequence scrambling for such peptides may be the result of either a reduced propensity for macrocycle formation via rearrangement of the initially formed oxazolone structure , or the prevention of direct generation of a cyclic b - ion structure on cid of the precursor ion . sequester a proton necessary for facile macrocycle formation or , alternatively , prevent head to tail cyclization of linear , oxazolone - terminated b - ions by permitting the formation of a structure stabilized by an intramolecular hydrogen bonding interaction . if such factors influence the prevalence of sequence scrambling , it may be expected that a similar effect would be observed following modification of the lysine side chain to homoarginine . consequently , it is possible that the inhibition of sequence scrambling may arise simply as a result of the absence of a precursor to macrocycle formation . however , the observation of b6 and b5 product ions from klvtdlt both prior to and following derivatization suggests that the homoarginine residue does indeed play a role in the inhibition of sequence rearrangement . to further test this hypothesis , the peptide sequences rgvlhav , rnvply , and rlvtdlt were synthesized ( jpt peptide technologies , berlin , germany ) and subjected to equivalent analysis by cid . the resultant product ion mass spectra are shown in figure 4 . as observed previously , extensive formation of b(n-1)+h2o species can be detected for each of these peptides and no product ions resulting from sequence scrambling are present . thus , it would appear that the presence of an arginine or homoarginine residue precludes sequence scrambling and the highly basic n - terminal residue promotes rearrangement at the c - terminus to give b(n-1)+h2o product ions.figure 4comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] rgvlhav at m / z 751.45 , ( b ) cid of [ m+h ] rnvply at m / z 761.43 , and ( c ) cid of [ m+h ] rlvtdlt at m / z 817.47 comparison of qtof ms / ms spectra resulting from ( a ) cid of [ m+h ] rgvlhav at m / z 751.45 , ( b ) cid of [ m+h ] rnvply at m / z 761.43 , and ( c ) cid of [ m+h ] rlvtdlt at m / z 817.47 as mobilization of the proton sequestered by the arginine side chain would normally be required for efficient cid , molesworth et al . instead proposed mobilization of an amide proton from a leucine residue , leading to b5 ion formation , in accordance with the model previously published by paizs and coworkers . this proposed fragmentation pathway proceeds via an iminol tautomer to generate a b5 ion following nucleophilic attack to yield a deprotonated oxazolone ring . each of the sequences in our present study also incorporates a leucine residue and , therefore , may potentially fragment via the same pathway once the mobile proton is sequestered by the homoarginine residue . to help determine whether inhibition of peptide scrambling for arginine ( or homoarginine ) containing sequences is related to the lack of a proton that can be mobilized upon activation , the doubly protonated peptide fgeralk was subjected to cid . figure 5a shows the product ion mass spectrum generated from this peptide using a qtof mass spectrometer , with an abundant ion observed at m / z 545.34 ( [ b63]b5 ) whose origin is attributable to ring opening of an intermediate macrocycle structure . the abundance with which this product ion is observed is somewhat surprising as scrambled species are typically minor components of ms / ms spectra . the mechanism by which this scrambled product ion is generated will be determined by the immediate precursor to the rearrangement process . the doubly charged , even electron precursor ion either fragments to give a singly charged ion pair originating from opposing termini of the peptide ( a singly charged b - ion and a singly charged y - ion ) or a doubly charged a6 fragment resulting from retention of two protons within the n - terminal product ion series.figure 5(a ) qtof ms / ms spectrum generated by cid of the [ m+2h ] peptide fgeralk . ( b ) quadrupole ion trap ( qit ) ms / ms spectrum generated by cid of the [ m+2h ] peptide fgeralk ( a ) qtof ms / ms spectrum generated by cid of the [ m+2h ] peptide fgeralk . ( b ) quadrupole ion trap ( qit ) ms / ms spectrum generated by cid of the [ m+2h ] peptide fgeralk as it is unlikely that the a6 product ion could fragment further to generate an ion of m / z 545.34 ( equivalent to [ b63]b5 ) , we hypothesize that ring opening of the macrocycle occurs preferentially c - terminal to glutamic acid promoted by the acidic side chain , as is frequently observed during cid of linear peptide ions ( scheme 1 ) . observation of the [ b63]b5 ion at such a level suggests that its formation is attributable to ring opening of the macrocycle intermediate between the e and r residues ( position 3 ) , generating the scrambled product ralfge , followed by subsequent loss of the now c - terminal glutamic acid residue . additional scrambling pathways in the qtof spectrum produced from fgeralk are not present at a detectable level , except for a [ b53]b4 product ion observed at m / z 432.24 , corresponding to the same charge remote cleavage of a macrocyclic intermediate , this time arising from the b5 product ion . if ring opening were initiated by a mobile proton , a more heterogeneous population of sequence scrambled product ions would be expected , with ring opening occurring at multiple sites . equivalent cid analysis of the fgeralk peptide using an amazon ion trap ( bruker , bremen , germany ) provides evidence to support this suggested fragmentation pathway ( figure 5b ) . the relative abundance of the [ b63]b5 product ion with respect to the y4 ion is much reduced in the qit spectrum in comparison to that observed following cid in the qtof . the y4 ion was selected for internal reference as the yield of this product ion should be relatively consistent under the conditions encountered during cid on the different instrument platforms . further inspection of the relative abundances of the peaks associated with the overlapping isotope patterns of the b6 ( m / z 674.36 ) and y6 ( m / z 673.39 ) ions in each spectrum shows that the b6 population is depleted during analysis in the multiple collision regime of the qtof collision cell ( figure 6a and b ) , whereas the singly charged a6 ion ( figure 5 ) is observed with significant abundance during each analysis . it has previously been demonstrated that n - terminal product ions are less stable toward secondary fragmentation events than their y - ion counterparts under such conditions and as a consequence are often under - represented in qtof ms / ms spectra compared with those obtained using a qit . during cid on a qtof instrument , peptide ions are subject to multiple collisions with the neutral buffer gas causing preferential secondary decomposition of b - ion species to lower members of the ion series . in this instance , it would appear that during analysis on the qtof platform , once initial decomposition has occurred , the b6 and b5 product ions undergo further activation , promoting rearrangement and secondary fragmentation leading to formation of the [ b63]b5 and [ b53]b4 species ; there is also an increase in the relative abundance of the smaller b4 ( and b5 ) ion(s ) , as might be expected following multiple dissociation events from larger species ( figure 5 ) . this observation is highlighted by analysis of the y6 ion isotope ratio observed from analysis on the qtof instrument at high and low collision energy . at lower collision energy ( figure 6a , collision energy set at 19.5 ev ) there is a distortion of the distribution of ion current , suggesting a contribution to this isotopic envelope from the b6 ion.scheme 1formation of the intense [ b63]b5 product ion following cid of the [ m+2h ] peptide fgeralk is dependent on glutamic acid - mediated cleavage of the b6 macrocyclefigure 6cid of [ m+2h ] fgeralk with the collision energy set at either ( a ) 19.5 ev or ( b ) 26 ev using a qtof instrument results in formation of a y6 ion at m / z 673.39 . distortion of the isotope distribution in ( a ) suggests a contribution from the b6 ion at m / z 674.36 . shown in the inset is the theoretical isotope distribution of the b6 ion which was modeled using the ms - isotope program within protein prospector . ( c ) equivalent cid analysis of [ m+2h ] fgeralk using a qit instrument results in formation of an abundant b6 ion at m / z 674.36 . slight calibration differences between the qtof and qit instruments used for analysis means there is a small discrepancy in the observed m / z . conversely , at higher collision energy ( figure 6b , collision energy set at 26 ev ) , there is no distortion of the isotope distribution , reflecting depletion of the b6 ion population through secondary fragmentation and formation of the [ b63]b5 scrambled product ion . this phenomenon is of reduced consequence during qit analysis as products of initial fragmentation are no longer resonant with the excitation voltage and are , therefore , not subject to multiple ion - neutral collisions . higher members of the b - ion series are thus often observed , and this is demonstrated in figure 6c where , in contrast to the qtof data , the b6 ion generated from fgeralk is observed with greater abundance than the y6 ion . generation of the scrambled [ b63]b5 species on the qit instrument may be expected to be enhanced by the longer trapping times associated with such analysis . however , it appears that as further activation of the b6/b5 product ions is avoided , so too is rearrangement of the peptide sequence . the a5 ion , although relatively abundant in the qtof data , was not present in the qit tandem mass spectrum . this observation is in line with the reduced population of b5 in the qit subsequently failing to yield adequately detectable levels of a5 as a result of elimination of co. as an aside , it is also interesting to note that the relative abundance of the y - ion series for this peptide differs following cid under the qit or qtof regimes , with y4>y5>y6 on the qit , whereas this order is reversed on the qtof . previous comparisons of y - ion abundance between qit and qtof instruments have failed to discern any significant bias , and we are currently at a loss to rationalize this observation . formation of the intense [ b63]b5 product ion following cid of the [ m+2h ] peptide fgeralk is dependent on glutamic acid - mediated cleavage of the b6 macrocycle cid of [ m+2h ] fgeralk with the collision energy set at either ( a ) 19.5 ev or ( b ) 26 ev using a qtof instrument results in formation of a y6 ion at m / z 673.39 . distortion of the isotope distribution in ( a ) suggests a contribution from the b6 ion at m / z 674.36 . shown in the inset is the theoretical isotope distribution of the b6 ion which was modeled using the ms - isotope program within protein prospector . ( c ) equivalent cid analysis of [ m+2h ] fgeralk using a qit instrument results in formation of an abundant b6 ion at m / z 674.36 . slight calibration differences between the qtof and qit instruments used for analysis means there is a small discrepancy in the observed m / z . tandem ms analysis has been used to demonstrate that increasing the gas - phase basicity of n - terminal basic groups through derivatization of the lysine side chain to give homoarginine results in enhanced formation of b(n-1)+h2o species via a c - terminal rearrangement . a subsequent reduction in the complexity of the products of cid is observed , with no fragments arising from scrambling of the initial peptide sequence detected . this apparent inhibition of scrambling for singly protonated peptides may simply be the result of ion current being directed away from standard b - ion fragments , which are the precursors to macrocycle formation , limiting the production ( and therefore detection ) of sequence scrambled species . however , further analysis of a doubly protonated arginine - containing peptide results in the observation of a product of sequence scrambling upon cid of the precursor ion . highly selective ring - opening of a macrocycle intermediate is promoted locally by the acidic side chain of a glutamic acid residue to give sequence rearrangement via a single decomposition pathway . observation of this highly selective fragmentation from a doubly charged precursor shows that formation of a macrocyclic intermediate ( from a singly protonated b - ion ) can occur even in the presence of a guanidine moiety . this suggests that the common depletion of rearrangement ion products in the presence of a strongly basic residue may be associated with one of two effects , namely ( 1 ) the diversion of n - terminal product ion current to b(n-1)+h2o species , depleting the population of macrocycle precursors , and ( 2 ) the disfavoring of macrocyclic cleavage by the presence of a proton - sequestering site , unless the presence of a glutamic acid residue promotes cleavage by local proton transfer . the presence of an arginine / homoarginine side chain within a peptide sequence will , therefore , in most cases preclude the formation of scrambled product ions , in accordance with previously published studies [ 38 , 49 ] . although the protease lys - n is not currently used extensively in ms - based proteomics , it is slowly gaining in popularity , in part because of its ability to bias fragmentation pathways towards n - terminally derived species and the beneficial effect that this has on electron - transfer - mediated ladder sequencing of peptides . the data presented here demonstrates that peptides with an n - terminal lysine residue are subject to relatively high levels of sequence rearrangement ( peptide scrambling ) during qtof - based cid . indeed , we have failed to account for a proportion of the product ions based on our current understanding of the dissociation mechanisms . we thus suggest that lys - n - generated peptides should be subject to routine guanidination prior to qtof analysis . alternatively , an arg - n protease ( that cleaves n - terminal to arginine residues ) would yield the same results , should one become available . not only do such peptides reduce the complexity of the cid spectrum for annotation ( automated or otherwise ) , but the resultant homoarginine - terminating peptides yield highly diagnostic b(n-1/n-2)+h2o ions of significant abundance . these two features together will improve confidence in sequence identity . exploitation of this highly efficient guanidination reaction will also likely benefit studies employing an orbitrap - based hcd regime and has already proven beneficial during electron - transfer dissociation , improving peptide identification .

bottom up proteomic studies typically use tandem mass spectrometry data to infer peptide ion sequence , enabling identification of the protein whence they derive . the majority of such studies employ collision - induced dissociation ( cid ) to induce fragmentation of the peptide structure giving diagnostic b- , y- , and a- ions . recently , rearrangement processes that result in scrambling of the original peptide sequence during cid have been reported for these ions . such processes have the potential to adversely affect ion accounting ( and thus scores from automated search algorithms ) in tandem mass spectra , and in extreme cases could lead to false peptide identification . here , analysis of peptide species produced by lys - n proteolysis of standard proteins is performed and sequences that exhibit such rearrangement processes identified . the effect of increasing the gas - phase basicity of the n - terminal lysine residue through derivatization to homoarginine toward such sequence scrambling is then assessed . the presence of a highly basic homoarginine ( or arginine ) residue at the n - terminus is found to disfavor / inhibit sequence scrambling with a coincident increase in the formation of b(n-1)+h2o product ions . finally , further analysis of a sequence produced by lys - c proteolysis provides evidence toward a potential mechanism for the apparent inhibition of sequence scrambling during resonance excitation cid.graphical abstract

Introduction Experimental Protein Digestion Guanidination of Lysine Residues nESI-MS Analysis Results and Discussion Conclusions

neuronal ceroid lipofuscinoses ( ncls ) are a group of progressive neurogenetic disorders . in 1998 , categorized the ncls into five major groups based primarily on age , clinical presentation , histological findings , and genetic loci ; infantile ncl ( incl ) , late infantile / early childhood ncl ( lincl ) , juvenile ncl ( jncl ) , adult ncl and variant , lincl ( vlincl ) . this classification is still widely used . within the last decade , mutations that cause ncl have been found in 14 human genes ( cln1 , cln2 , cln3 , cln4/dnajc5 , cln5 , cln6 , cln7/mfsd8 , cln8 , cln10/ctsd , cln11/grn , cln12/atp13a2 , cln13/ctsf , cln14/kctd7 , clcn6 , and sgsh ) . infantile ncl with cln1 mutation presents with motor disturbances ( ataxia , hypotonia , spasticity ) , visual impairment , seizures , dementia , and familial occurrence . late infantile with cln2 mutation manifests with onset between 2 and 4 years and symptoms of epilepsy , cognitive decline , ataxia , visual failure , and death in between 9 and 18 years . juvenile ncl , with cln3 mutation presents with progressive visual loss , speech and cognitive decline , epilepsy , behavioral disturbances and death in the 3 or 4 decade . however , they are already reclassified on the basis of newer molecular findings , which have provided a far more overlap for the different genetic variants that have previously suggested by the clinical phenotypes . we report three cases with atypical jncl and pertinent issues concerning diagnostic difficulties , ophthalmologic , neuroradiological , and laboratory findings are discussed . a 9-year - old pakistani boy born to non - consanguineous parents with a normal perinatal period and early development and at 4 years , he began to show regression in motor and cognitive skills . he was unsteady and needed support , when walking at 6 and became wheelchair bound at 7 years . he developed progressive visual loss and was unable to follow a bright red object at 7 years . ophthalmological examination revealed dystrophic appearance of retina , attenuation of retinal vessels with a pale disc . serial cranial magnetic resonance imaging ( mri ) showed diffuse white matter hyperintensity in t2-weighted but not in flair at 5 years and subsequently , cerebral and cerebellar atrophy at 7 years . electroretinogram ( erg ) was absent and visual evoked potential ( vep ) was normal . palmitoyl protein thioesterase ( ppt ) and tripeptidyl peptidase i ( tpp 1 ) enzyme activities were within normal range . skin and muscle biopsy for inclusion bodies were negative and blood film showed no vacuolated lymphocytes . however , ultra structural examination of lymphocytes showed rare , membrane bound , condensed storage material with fingerprint profiles . cln5 gene mutation was positive . at last follow - up at 11 years , he was wheelchair bound but could walk with support , had severe visual impairment and slow and slurred speech . he was the 6-year - old brother of case 1 and his early developments were normal except for speech . he babbled at 5 months , copied noises at 8 months and only spoke with recognizable word at 2 year 7 months ( his brother spoke at 18 months ) . he would play football ( his eldest brother never ran or jumped ) with other children and his expressive language had never been clear and had difficulty putting words together and had developed stammer . he was slow to learn and at 4 years , he began to have cognitive and motor regression . cranial mri findings were very similar to that demonstrated on his brother 's scan . at last follow - up ( 8 years ) , he had drooling saliva , he was wheel chair bound with deterioration in his speech , cognition , motor skills , and fully dependent for his needs . an 11-year-10-month - old caucasian boy with normal perinatal and neurodevelopmental history was referred to us with 3-year history of progressive visual loss and visual hallucinations . his symptoms started with difficulty in reading , worsening handwriting , and flashes of lights in both eyes ( be ) . he gave us a description and consistently drew figures , which he appeared to be seeing in front of his eyes . the figures had a red border with circles and lines criss - crossing the circles . the va at first presentation was 6/60 in be when he was 10 years . at last follow - up at 13 , va was 6/60 in right eye ( re ) and 3/60 in left eye ( le ) . however , electron microscopy ( em ) of buffy coat showed rare , membrane bound , electron dense , granular material associated with a lipid droplet in the cytoplasm of lymphocytes . ppt activity was low measuring 2.2 nmol / hr / mg protein and normal tpp - i . molecular genetic analysis of exon 1 - 9 of cln1 gene showed that he was heterozygote for p.cys96tyr and p.arg151x mutations . a diagnosis of milder form of incl ( cln1 ) was made . at his last neurology follow - up at 13 years he had developed behavioral and cognitive problems . he had not developed seizures or motor difficulties . a 9-year - old pakistani boy born to non - consanguineous parents with a normal perinatal period and early development and at 4 years , he began to show regression in motor and cognitive skills . he was unsteady and needed support , when walking at 6 and became wheelchair bound at 7 years . he developed progressive visual loss and was unable to follow a bright red object at 7 years . ophthalmological examination revealed dystrophic appearance of retina , attenuation of retinal vessels with a pale disc . serial cranial magnetic resonance imaging ( mri ) showed diffuse white matter hyperintensity in t2-weighted but not in flair at 5 years and subsequently , cerebral and cerebellar atrophy at 7 years . electroretinogram ( erg ) was absent and visual evoked potential ( vep ) was normal . palmitoyl protein thioesterase ( ppt ) and tripeptidyl peptidase i ( tpp 1 ) enzyme activities were within normal range . skin and muscle biopsy for inclusion bodies were negative and blood film showed no vacuolated lymphocytes . however , ultra structural examination of lymphocytes showed rare , membrane bound , condensed storage material with fingerprint profiles . cln5 gene mutation was positive . at last follow - up at 11 years , he was wheelchair bound but could walk with support , had severe visual impairment and slow and slurred speech . he was the 6-year - old brother of case 1 and his early developments were normal except for speech . he babbled at 5 months , copied noises at 8 months and only spoke with recognizable word at 2 year 7 months ( his brother spoke at 18 months ) . he would play football ( his eldest brother never ran or jumped ) with other children and his expressive language had never been clear and had difficulty putting words together and had developed stammer . he was slow to learn and at 4 years , he began to have cognitive and motor regression . cranial mri findings were very similar to that demonstrated on his brother 's scan . at last follow - up ( 8 years ) , he had drooling saliva , he was wheel chair bound with deterioration in his speech , cognition , motor skills , and fully dependent for his needs . an 11-year-10-month - old caucasian boy with normal perinatal and neurodevelopmental history was referred to us with 3-year history of progressive visual loss and visual hallucinations . his symptoms started with difficulty in reading , worsening handwriting , and flashes of lights in both eyes ( be ) . he gave us a description and consistently drew figures , which he appeared to be seeing in front of his eyes . the figures had a red border with circles and lines criss - crossing the circles . the va at first presentation was 6/60 in be when he was 10 years . at last follow - up at 13 , va was 6/60 in right eye ( re ) and 3/60 in left eye ( le ) . however , electron microscopy ( em ) of buffy coat showed rare , membrane bound , electron dense , granular material associated with a lipid droplet in the cytoplasm of lymphocytes . ppt activity was low measuring 2.2 nmol / hr / mg protein and normal tpp - i . molecular genetic analysis of exon 1 - 9 of cln1 gene showed that he was heterozygote for p.cys96tyr and p.arg151x mutations . a diagnosis of milder form of incl ( cln1 ) was made . at his last neurology follow - up at 13 years all our cases did not fit well with the typical clinicopathologic descriptions , therefore representing atypical variants of jncl or vlincl due to the late onset at 4 - 7 years and em showed fingerprints , thus , overlapping considerably with juvenile ncl . for case 1 and 2 , similarities to vlincl were age - at - onset , initial symptoms , and clinical progression . differences from classic lincl included slower clinical progression and different inclusion profile ( revealed fingerprint , not typical curvilinear inclusion body ) . in fact , cln2 encodes for ttp-1 enzyme , therefore , normal enzyme level excluded classic lincl ( cln2 ) . furthermore , these two cases had cln5 mutation which usually presents as vlincl and presented with typical phenotype of cln5 . all the cases of ncl caused by mutations in cln1 are associated with granular appearance . to sum up , case 1 and 2 had early juvenile form of ncl ( vlincl ) due to cln5 and case 3 had atypical jncl due to cln1 mutation , reflecting phenotypical - genotypical variation . however , delayed vep , normal erg and fundi were also unusual and were consistent with optic nerve neuropathy . visual loss in cln5 is usually due to retinal dystrophy . ophthalmologic examination early in the course of vlincl ( cln5 ) may reveal macular changes only ; gradually typical signs of pan - retinal degeneration develop : bull 's eye maculopathy , diffuse pigmentary degeneration , arteriolar attenuation , and optic atrophy . on contrast , case 3 ( cln1 ) showed normal erg , delayed vep and persistent normal fundi even at an advanced stage . normal disc may still correspond to an early stage of juvenile form of cln1 but was quite unexpected at this advanced stage ( 4 years duration with va 6/60 ) . patients with cln1 ( case 1 and 2 ) have cerebellar atrophy at the early stage , followed by brain atrophy that is more severe in the cerebellum . in contrast , patients with typical jncl ( cln3 ) have cerebral atrophy at the early stage . atypical jncl or vlincl should be considered in any patients who present with either psychomotor decline or progressive visual loss .

the diagnosis of juvenile neuronal ceroid lipofuscinosis ( jncl ) is usually based on age of onset , initial clinical symptoms , clinical progression , and pathologic findings . our cases manifested atypical clinical symptomatology and/or pathologic findings and therefore , represent variant forms of jncl . case 1 and 2 presented with slow developmental regression from the age of 4 years and became blind and wheelchair bound at around 8 years . pathologic finding of lymphocytes showed fingerprint inclusion which was consistent with jncl . mutational analysis was positive for cln5 which usually presents as variant late infantile ncl ( lincl ) and more common in finnish population . case 3 presented with progressive visual loss from the age of 8 years . clinical symptomatology and age of onset were similar to that of jncl but was found to have low palmitoyl protein thioesterase , granular inclusion body , and cln1 mutation , thus representing milder form of incl . these three cases demonstrated phenotypic - genotypic variations . pertinent issues relating diagnostic difficulties , ophthalmologic , neuroradiological , and laboratory aspects are discussed .

Introduction Case Reports Case 1 Case 2 Case 3 Discussion Conclusion

phenolic compounds are the most commonly studied of all secondary metabolites because of their significant concentration and their significant roles in plant tissues [ 1 , 2 ] . this highly diverse group of secondary metabolites widely is distributed in vegetable foods ( legumes , cereals , and fruits ) and beverages ( tea , cider , and wine ) , which are important constituents of the human diet . the rapid degradation of flavonoids during the extraction is a major drawback for the accurate quantification of this ubiquitous group of compounds . because of their importance as potent antioxidants molecules , quantification flavonoids in fruits , vegetable , and other crops are important . they become perishable mainly due to the enzymatic oxidation regulated by the enzyme polyphenol oxidase and light [ 5 , 6 ] . polyphenol oxidase is activated when the plant tissues are macerated and the enzymes get mixed with the substrate and the major parts of the native flavonoids are destroyed before quantification . the sustainability of the tea industry mainly relies on developing new tea ( camellia sinensis , l. ) cultivars incorporated with genetic resistance to biotic and abiotic stresses and capable of producing diverse tea products of desired character . the quality of tea product depends on the chemical composition of fresh tea leaves and the method of manufacture . the chemical composition of tea leaves is determined by the inherent genetic attributes of the accession and geoclimatic factors . currently about 600 germplasm accessions are being maintained in the field gene bank of the tea research institute of sri lanka ( tri ) and these accessions are not adequately evaluated for biochemical , agronomic , and molecular traits [ 11 , 12 ] . most of the earlier attempts concentrated on single metabolite variation of tea cultivars , and work on measurement of a broad range of metabolites is relatively limited . thus , metabolite profiling of representative accessions from the sri lankan tea germplasm by chemical analysis of tea leaves would immensely contribute to the success of a tea breeding programme . the polyphenols , particularly catechins ( flavan-3-ols ) and their oxidation products , which are eventually responsible for the quality of tea , are readily oxidized by polyphenol oxidase enzymes . the collection , handling , and storage of a large number of leaf samples for metabolite profiling thus require a sample preparation procedure that would minimize the oxidation of polyphenols and formation of artifacts . in this backdrop , this research has been carried out with the objective to optimize the sample preparation procedure to minimize the chemical deterioration that takes place in tea flush due to the inevitable delay in analysis . for this purpose , a comparative study has been conducted between the fresh leaves ( conventional procedures ) and freeze - dried leaves ( new sampling method ) , for quantification of some critical metabolites gallic acid , catechins , and methylxanthines , by employing two cultivars , one ( dt1 ) of which is known to yield high quality black tea and the other ( tri2025 ) poor quality black tea . caffeine , gallic acid , ( )-epicatechin , ( )-epigallocatechin , ( )-epigallocatechin gallate , and ( )-epicatechin gallate were purchased from sigma chemical co. ( st . louis , mo , usa ) . methanol , acetonitrile , acetic acid , and folin - ciocalteu 's phenol reagent were purchased from bdh , uk . standard reference material ( srm 3254 ) for green tea was obtained from the national institute of standards and testing ( nist ) , usa . a millipore milli - q water purification system was used to obtain high purity of water . two cultivars ( dt1 and tri2025 ) were selected for this study from ex situ field gene bank at the tea research institute of sri lanka , talawakelle ( latitude 654n , longitude 8042e ) . the plants were of same age and have been maintained under similar growth conditions recommended by the tea research institute of sri lanka . five grams of fresh two leaves and a bud was placed in 70% aqueous methanol ( 40 ml ) at boiling temperature for 10 min . the mixture was cooled to room temperature and homogenized for 3 min using a top - drive macerator ( ultra - turrax , usa ) . the homogenate was centrifuged ( 24.15 g for 15 min ) and the supernatant was decanted into a 50 ml volumetric flask . the residue was reextracted following the above extraction procedure with 70% aqueous methanol ( 10 ml ) at boiling temperature . the volume of the pooled extract was made up to 50 ml with 70% aqueous methanol . an aliquot ( 1.0 ml ) of the above methanol extract was transferred into a 200 ml volumetric flask and topped up with milli - q water . approximately 10 g of fresh two leaves and an active bud from each cultivar was harvested and brought to the laboratory in ice box at 4c . the plant material was immediately deep frozen at 80c for 6 h and then freeze - dried for 24 h ( labconco - freezone , usa ) . the freeze - dried flush was ground to a fine powder ( passed through 500 m mesh ) in a laboratory mill , sealed in triple laminated aluminum foil packages , and stored until use at room temperature . 0.2000 0.001 g freeze - dried tea sample was weighed into a centrifugation tube and extracted with 5.0 ml of 70% methanol / water extraction mixture , preheated to 70c for half an hour . heating of the test portions in the water bath was continued for 10 min with mixing on the vortex mixer at the beginning , after 5 min and at the end of 10 min . then the extraction tube was allowed to cool to room temperature and placed in a centrifuge at 1095 g for 10 min . the extraction steps were repeated on the residue , the extracts were combined , and the volume was made up to 10 ml with cold methanol / water extraction mixture and mixed . 1.0 ml of the sample extract was topped up to 5 ml with freshly prepared stabilizing solution containing 500 g ml of edta and 500 g ml ascorbic acid in 10% volume fraction of acetonitrile . the dry matter content was determined by loss in mass at 103c determined on a portion of the test sample in accordance with iso1573 method for both fresh flush leaves and freeze - dried flush . a series of gallic acid standard solutions was prepared with concentrations ranging from 10 to 50 g ml . the tpp in the standards and the extracts were determined in quadruplicate using folin - ciocalteu 's phenol reagent according to iso 14502 - 1 method using a spectrophotometer ( cary 50bio , varian , usa ) set at 765 nm . caffeine , ec , ecg , egc , egcg , gallic acid , and theobromine were quantified in duplicate in two trials of samples using iso 14502 - 2 method by hplc ( agilent 1260 hplc infinity system ) on a phenyl - bonded column using elution with uv detection at 278 nm . the hplc instrument consisted of agilent 1260 infinity hplc system with solvent delivery system , temperature - controlled column oven , autosampler , degasser unit , and a photodiode array detector and open lab / chemstation software system . luna-5 m phenyl - hexyl-4.6 250 mm column ( phenomenex inc . , usa ) with a guard column made of the same material ( security - guard , phenomenex inc . , a was 9% acetonitrile containing 2% acetic acid ( bdh hipersolv - hplc grade ) . solvent gradient was reset to 100% mobile phase a and allowed to equilibrate for 10 mins before the next injection . the elution was reset to 100% mobile phase a and allowed to equilibrate for 10 min before next injection . flow rate was set to 1.00 ml / min and column oven temperature was kept at 35 0.5c . once the flow rate of the mobile phase and temperature were stable , the column was conditioned with a blank gradient run . after each batch of analysis , the chromatographic system and column were thoroughly flushed with 50% aqueous acetonitrile and column sealing plugs were replaced if disconnected for storage . the individual catechins ( ec , ecg , egc , and egcg ) and gallic acid were identified by comparing retention times from sample chromatograms with those recorded for a variety of standards obtained under the same chromatographic conditions . the use of diode array detection allowed the uv profile of the catechin peaks to be scrutinized and peak purity to be assessed , which was particularly useful for the determination of the low levels of catechins in tea cultivars . alternatively , caffeine was used as a standard in conjunction with individual catechins considering the relative response factors ( rrfs ) established by an iso international interlaboratory test . data was collected using the data collection / integration system for all peaks in the extracts . standard reference material ( srm 3254 ) for green tea certified by nist , usa , was used for the validation of the analytical methodology . significant differences ( p < 0.01 ) were tested using two tailed paired t - test at 95% confidence level . least significant difference ( lsd ) was used as the mean separation technique . all these analyses were carried out with the statistical analysis software package ( sas version . 9.1 for windows , sas institute inc . one of the most important fractions in tea flush is the proteins , because they include the enzymes which are required for the metabolism in the tea plant and for black tea manufacture . polyphenol oxidase is an important enzyme available in tea , which is activated by light and is responsible for the oxidation of flavonols in the presence of atmospheric oxygen . in the conventional sample preparation methodology there is an inevitable delay in the analysis during which the tea flush is subjected to mechanical damage . this results in the formation of characteristic compounds of black tea [ 19 , 20 ] . though it is a positive reaction initiated in the rolling process of tea manufacturing , it hinders accurate and precise measurement of metabolites in the tea flush . further , the content of catechins is dependent upon other factors including particularly light since some of the important enzymes of the flavonoid biosynthetic pathway are activated by light . since the analysis of the batch of cultivars sampled has to be done on the same day , it was not possible to handle a large number of samples at a time . in contrast , the new method suppressed chemical deterioration starting from the point of harvest until usage . as described in figure 1 , the samples harvested from the field were immediately collected into and ice box at 4c whereby the chemical deterioration of the metabolites was minimized . prefreezing at 80c for 6 h to two weeks is a convenient first step in sample preparation prior to freeze - drying . freeze - drying is a preservation technique by which moisture is removed and the shelf - life is increased approximately up to one year . the dry matter content of the freeze - dried samples was eight times less than that of the fresh flush . therefore , substantially less amount of sample was required for analysis in the new method ( table 1 ) and convenient handling of many samples was possible at a time . also , freeze - dried leaf samples can be stored for a long time when packed in triple laminated aluminum sheets and it facilitates sampling at once and stored for metabolite analysis . thus , environmental influence on metabolite availability could be minimized specially when handling large number of samples . maximum recovery of the metabolites required a minimum of 70% methanol in the extractant which was sufficient to inactivate polyphenol oxidase . multiple extraction procedures of short durations ( 10 min ) at moderate temperature ( 70c ) in the new method were more favourable than those involving boiling temperature and long extraction times in a macerator as such conditions would lead to decomposition of catechins . efficient separation of caffeine , ( )-epicatechin ( ec ) , ( )-epigallocatechin ( egc ) , ( )-epigallocatechin gallate ( egcg ) , ( )-epicatechin gallate ( ecg ) , gallic acid , and theobromine in the tea extracts ( figure 2 ) was achieved in less than 25 min of a chromatographic run by the gradient elution with acetonitrile , water , and acetic acid . although the sensitivity of the analysis can be increased by threefold by using a shorter detection wavelength , the chance of interference by other components present in the tea extract is high . the folin - ciocalteu 's phenol reagent used for tpp analysis contains phosphotungstic acid as oxidants , which on reduction yield a blue colour with a broad maximum absorption at 765 nm . as this reagent reacts with a wide range of polyphenol compounds , it is often used to estimate the total polyphenol content in plant material rich in polyphenols , although the response can vary with the individual components depending on their chemical structures . however , the folin - ciocalteu 's reagent could simultaneously oxidize several nonphenolic organic compounds as well as some inorganic substances to give elevated apparent phenolic content . as it is based on the reduction properties of sample components the mean values of tpp , and the amounts of four catechins ( ec , ecg , egc , and egcg ) , caffeine , theobromine , and gallic acid recorded for the two cultivars , dt1 and tri2025 , corresponding to the two sampling procedures ( fresh leaves and freeze - dried leaves ) , are given in table 2 . the concentration of each metabolite varied with the cultivar . for both cultivars , dt1 and tri2025 , the contents of all the metabolites ( tpp , ec , ecg , egc , egcg , caffeine , theobromine , and gallic acid ) determined by employing new method were found to be higher than in the conventional method ; the difference was statistically significant ( p < 0.05 ) for each of the metabolites except for theobromine in cultivar dt1 . national institute of standards and testing ( nist ) certified srm 3254 quantified via these two methods confirms that the new method is accurate and precise for the determination of the major metabolites in tea . the freeze - dried sampling procedure recorded significantly higher amount of metabolites with small leaf quantity and facilitates storage of samples without chemical deterioration starting from the point of harvest until usage . hence , the method is more suitable for metabolite profiling of tea germplasm using high throughput analysis where large number of samples need to be handled .

chemical analysis of the sri lankan tea ( camellia sinensis , l. ) germplasm would immensely contribute to the success of the tea breeding programme . however , the polyphenols , particularly catechins ( flavan-3-ols ) , are readily prone to oxidation in the conventional method of sample preparation . therefore , optimization of the present sample preparation methodology for the profiling of metabolites is much important . two sample preparation methodologies were compared , fresh leaves ( as in the conventional procedures ) and freeze - dried leaves ( a new procedure ) , for quantification of major metabolites by employing two cultivars , one is known to be high quality black tea and the other low quality black tea . the amounts of major metabolites such as catechins , caffeine , gallic acid , and theobromine , recorded in the new sampling procedure via freeze - dried leaves , were significantly higher than those recorded in the conventional sample preparation procedure . additionally new method required less amount of leaf sample for analysis of major metabolites and facilitates storage of samples until analysis . the freeze - dried method would be useful for high throughput analysis of large number of samples in shorter period without chemical deterioration starting from the point of harvest until usage . hence , this method is more suitable for metabolite profiling of tea as well as other phenol rich plants .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

with the aggravation of environmental pollution , lung cancer is almost the most malignant tumor in the world with its high morbidity and mortality.1 the most common histologic subtype is non - small cell lung cancer ( nsclc ) , which accounts for 80% of all lung cancers.2 although much progress has been made in the treatment of lung cancer , early diagnosis is difficult and the majority of patients has progressed to an advanced stage when diagnosed . the median survival rate for these patients is only 811 months.3 in 2004 , a landmark discovery had been made in that somatic mutations in the epidermal growth factor receptor ( egfr ) were associated with sensitivity to egfr tyrosine kinase ( tk ) inhibitors ( tkis ) ( egfr - tki).4,5 in subsequent large - scale randomized clinical trials , the relationship between egfr mutation status and efficacy of the egfr - tki drug was clearly explained.68 based on these findings , egfr mutation status in the tk domain can determine the treatment of advanced nsclc . mutations associated with enhanced sensitivity to egfr - tkis are found in exons 1821 of the tk domain of egfr ; in particular , del e746-a750 in exon 19 and the l858r point mutation in exon 21 account for nearly 90% of all the mutations in egfr in lung cancer.7,9,10 nowadays , the detection of egfr mutation status in nsclc patients has become an expert consensus.11 different methodologies have been developed for molecular testing , such as the amplified refractory mutation system ( arms ) , high - resolution melting , dna direct sequencing , and next - generation sequencing ( ngs ) . dna direct sequencing is considered the gold standard for the assessment of egfr mutation status in nsclc ; however , it is time consuming and laborious . the arms method is widely used in the clinical testing ; however , the commercial assay kit for egfr is very expensive , and the experiment needs to be done under good experimental conditions with sophisticated real - time polymerase chain reaction ( pcr ) instruments.12 immunohistochemistry ( ihc ) is a well - established method that is widely applied in conventional pathological diagnosis . egfr mutation - specific rabbit monoclonal antibodies against e746-a750 deletion and l858r ( cell signaling technology , inc . , danvers , ma , usa ) have been applied in ihc application . this provides a simple and rapid screening method for assessing egfr mutation status.1315 a nanofluorescent material , fluorescent semiconductor nanocrystal quantum dots ( qds ) , have been widely used in labeling some molecules , such as streptavidin and antibodies , through carbodiimide chemistry , optionally using edac ( 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide ) . qd ( 605 nm)-labeled streptavidin emits bright red fluorescence with 605 nm as the maximum emission wavelength while being stimulated by an excitation light source < 580 nm , which is different from green background autofluorescence . those labeled materials can be successfully applied to biological imaging and ihc detection of gene mutations , such as with human epidermal growth factor receptor 2 ( her 2 ) amplification in breast cancer.16,17 moreover , multiple markers can be visualized on one cell for in vitro multiplexed imaging ; for example , clinically significant tumor biomarkers including her2 , egfr , progesterone receptor , estrogen receptor , and mammalian target of rapamycin can be detected quantitatively and simultaneously in breast cancer cells using multicolor qds.18 qd - based immunofluorescence histochemistry ( qds - ihc ) is an established method ; it has been validated in many published papers.17,19,20 the staining signal detected by qds - ihc is much stronger with a lower background when compared with ihc.20 based on the application of egfr mutation - specific antibodies , this study was designed to develop a qd - based immunofluorescent approach for egfr mutation detection , which is a simple , quick , and highly sensitive molecular method for diagnosing egfr mutation status in nsclc samples . fifty - five cases of formalin - fixed , paraffin - embedded ( ffpe ) nsclc specimens and ten cases of pleural effusion cell blocks from patients with lung adenocarcinoma were collected , which were provided by the central hospital of enshi autonomous prefecture and the hubei cancer hospital from january 2013august 2014 . the cohort consisted of 13 squamous cell carcinomas , 50 adenocarcinomas , and two adenosquamous carcinomas . for each case , the hematoxylin and eosin sections were reviewed by at least two pathologists ( ygq and hlc ) . this study was approved by the institutional ethics committee of the central hospital of enshi autonomous prefecture . nsclc tissue sections ( 4 m thick ) were deparaffinized in xylene and rehydrated in a graded ethanol series . qds - ihc was performed according to the manufacturer s instructions ( wuhan jiayuan quantum dots co. , ltd . , antigen retrieval was performed in ethylene diamine tetraacetic acid ( edta ) ( 10 mm ; ph 9.0 ) at 100c for 3 minutes , followed by cooling at room temperature for 30 minutes . for antibody bindings , sections were first incubated in 2% bovine serum albumin ( bsa ) buffer ( sigma - aldrich co. , st louis , mo , usa ) at 37c for 30 minutes , and then three primary antibodies ( total egfr monoclonal antibody [ d38b1 ] , egfr del e746-a750 mutation - specific monoclonal antibody [ 6b6 ] , and l858r mutation - specific monoclonal antibody [ 43b2 ] ; cell signaling technology , inc . ) were diluted separately at 1:100 and manually applied to the sections . after that , the slides were then washed three times with tris - buffered saline ( tbs ) with tween ( tbs - t ) ( 0.5% tween , 0.1 m tris - base , 0.9% nacl , and ph 7.6 ) for 5 minutes each time , and incubated in biotinylated goat antirabbit immunoglobulin g ( 1:300 dilution ; jackson immunoresearch inc . , finally , qd ( 605 nm)-labeled streptavidin ( 1:400 dilution in 2% bsa ; wuhan jiayuan quantum dots co. , ltd . ) was added to the sections and incubated at 37c for 30 minutes . after rinsing for three times , sections were sealed with 90% glycerine ( sigma - aldrich co. ) . during the process , negative control samples were performed in parallel , but the primary antibody was replaced with tbs buffer . after washing the sections with tbs , diluted primary antibodies ( 1:100 ) were applied to cover the specimen . after three washes in tbs for 3 minutes each , the slides were incubated for 30 minutes at room temperature with labeled polymer - horseradish peroxidase antirabbit secondary antibody ( envision kit ; dako denmark a / s , glostrup , denmark ) . the qd staining signals were detected using olympus bx51 fluorescence microscopy equipped with an olympus micro dp72 camera ( olympus corporation , tokyo , japan ) . the egfr - positive signal detected by qds - ihc was red , target - specific , bright , and photostable . the egfr - positive signal detected by traditional ihc was brown yellow or brown . immunostaining was evaluated by two different pathologists ( ygq and xdz ) using criteria based on published cutoffs . the intensity of cytoplasmic and/or membrane staining , as well as the percentage of positive cells , was recorded . staining intensity was scored from 0 to 3 + , as follows:21,22 0 if tumor cells had a complete absence of staining or faint staining intensity in < 10% ; 1 + if 10% of the tumor cells had faint staining ; 2 + if the tumor cells had moderate staining ; and 3 + if tumor cells had strong staining ( figure 1 ) . accordingly , we classified scores of 0 and 1 + as negative and scores of 2 + and 3 + as positive . to assess the sensitivity and specificity of qds - ihc , we compared these results with those of real - time quantitative pcr . extraction of genomic dna from ffpe nsclc tissue sections was performed using cobas sample preparation kits ( hoffman - la roche ltd . , the dna quality and purity were assessed using varioskan flash ( thermo fisher scientific , waltham , ma , usa).23 arms is a highly sensitive method ; it is a real - time pcr - based test . the amoydx egfr mutation test kit ( amoy diagnostics co. , ltd . , xiamen , people s republic of china ) has been widely used in the clinical laboratory . the assay was carried out according to the manufacturer s protocol for the kit with the lightcycler 480 ii real - time pcr system ( hoffman - la roche ltd . ) . upon completion , the results were analyzed according to the criteria defined by the manufacturer s instructions . statistical analysis was performed using the statistical software spss version 17.0 ( ibm corporation , armonk , ny , usa ) . cohen s kappa was used to determine intraobserver agreement and the agreement between qds - ihc , ihc , and arms . a kappa value between 0.81 and 1.0 was defined as a nearly perfect agreement , between 0.41 and 0.80 as a moderate agreement , between 0.21 and 0.40 as a fair agreement , and between 0.00 and 0.20 as a slight agreement . all tests were two - sided , and a p - value of < 0.05 was considered statistically significant . fifty - five cases of formalin - fixed , paraffin - embedded ( ffpe ) nsclc specimens and ten cases of pleural effusion cell blocks from patients with lung adenocarcinoma were collected , which were provided by the central hospital of enshi autonomous prefecture and the hubei cancer hospital from january 2013august 2014 . the cohort consisted of 13 squamous cell carcinomas , 50 adenocarcinomas , and two adenosquamous carcinomas . for each case , the hematoxylin and eosin sections were reviewed by at least two pathologists ( ygq and hlc ) . this study was approved by the institutional ethics committee of the central hospital of enshi autonomous prefecture . nsclc tissue sections ( 4 m thick ) were deparaffinized in xylene and rehydrated in a graded ethanol series . qds - ihc was performed according to the manufacturer s instructions ( wuhan jiayuan quantum dots co. , ltd . , antigen retrieval was performed in ethylene diamine tetraacetic acid ( edta ) ( 10 mm ; ph 9.0 ) at 100c for 3 minutes , followed by cooling at room temperature for 30 minutes . for antibody bindings , sections were first incubated in 2% bovine serum albumin ( bsa ) buffer ( sigma - aldrich co. , st louis , mo , usa ) at 37c for 30 minutes , and then three primary antibodies ( total egfr monoclonal antibody [ d38b1 ] , egfr del e746-a750 mutation - specific monoclonal antibody [ 6b6 ] , and l858r mutation - specific monoclonal antibody [ 43b2 ] ; cell signaling technology , inc . ) were diluted separately at 1:100 and manually applied to the sections . specimens were incubated at 4c overnight with those three primary antibodies , respectively . after that , the slides were then washed three times with tris - buffered saline ( tbs ) with tween ( tbs - t ) ( 0.5% tween , 0.1 m tris - base , 0.9% nacl , and ph 7.6 ) for 5 minutes each time , and incubated in biotinylated goat antirabbit immunoglobulin g ( 1:300 dilution ; jackson immunoresearch inc . , finally , qd ( 605 nm)-labeled streptavidin ( 1:400 dilution in 2% bsa ; wuhan jiayuan quantum dots co. , ltd . ) was added to the sections and incubated at 37c for 30 minutes . after rinsing for three times , sections were sealed with 90% glycerine ( sigma - aldrich co. ) . during the process , negative control samples were performed in parallel , but the primary antibody was replaced with tbs buffer . resected tumor specimens were stained simultaneously using these three antibodies according to the manufacturer s instructions . after washing the sections with tbs , diluted primary antibodies ( 1:100 ) were applied to cover the specimen . after three washes in tbs for 3 minutes each , the slides were incubated for 30 minutes at room temperature with labeled polymer - horseradish peroxidase antirabbit secondary antibody ( envision kit ; dako denmark a / s , glostrup , denmark ) . following three washes in tbs the qd staining signals were detected using olympus bx51 fluorescence microscopy equipped with an olympus micro dp72 camera ( olympus corporation , tokyo , japan ) . the egfr - positive signal detected by qds - ihc was red , target - specific , bright , and photostable . the egfr - positive signal detected by traditional ihc was brown yellow or brown . immunostaining was evaluated by two different pathologists ( ygq and xdz ) using criteria based on published cutoffs . the intensity of cytoplasmic and/or membrane staining , as well as the percentage of positive cells , was recorded . staining intensity was scored from 0 to 3 + , as follows:21,22 0 if tumor cells had a complete absence of staining or faint staining intensity in < 10% ; 1 + if 10% of the tumor cells had faint staining ; 2 + if the tumor cells had moderate staining ; and 3 + if tumor cells had strong staining ( figure 1 ) . accordingly , we classified scores of 0 and 1 + as negative and scores of 2 + and 3 + as positive . to assess the sensitivity and specificity of qds - ihc , we compared these results with those of real - time quantitative pcr . extraction of genomic dna from ffpe nsclc tissue sections was performed using cobas sample preparation kits ( hoffman - la roche ltd . , the dna quality and purity were assessed using varioskan flash ( thermo fisher scientific , waltham , ma , usa).23 arms is a highly sensitive method ; it is a real - time pcr - based test . the amoydx egfr mutation test kit ( amoy diagnostics co. , ltd . , xiamen , people s republic of china ) has been widely used in the clinical laboratory . the assay was carried out according to the manufacturer s protocol for the kit with the lightcycler 480 ii real - time pcr system ( hoffman - la roche ltd . ) . upon completion , the results were analyzed according to the criteria defined by the manufacturer s instructions . statistical analysis was performed using the statistical software spss version 17.0 ( ibm corporation , armonk , ny , usa ) . cohen s kappa was used to determine intraobserver agreement and the agreement between qds - ihc , ihc , and arms . a kappa value between 0.81 and 1.0 was defined as a nearly perfect agreement , between 0.41 and 0.80 as a moderate agreement , between 0.21 and 0.40 as a fair agreement , and between 0.00 and 0.20 as a slight agreement . all tests were two - sided , and a p - value of < 0.05 was considered statistically significant . tissue sections from small biopsies , pleural effusion cell blocks , and surgery were successfully stained by egfr mutation - specific antibodies , and these antibodies showed distinct immunoreactivity ( red signals ) for the tumor cells , as presented in figure 1 . a positive signal of the total egfr protein detected by qds - ihc and ihc was moderate to strong in all 65 samples , which was regarded as the positive control ( figure 2 ) . the positive rates for the egfr mutation detected by qds - ihc and ihc were 40.0% ( 26/65 ) and 36.9% ( 24/65 ) , respectively . in the qds - ihc method , 12 ( 46.2% ) patients showed e746-a750-specific staining and 14 ( 53.8% ) patients were l858r mutant - specific ( table 1 ) . figure 2 shows the representative images of the same surgical case of cancer , which carried the l858r mutation and total egfr . the cancer cells were strongly stained by the total egfr antibody ( figures 2a and b ) ; moreover , the cancer cells were positively stained for the anti - l858r antibody ( figures 2c and d ) and negative for the del e746-a750 deletion . simultaneously , egfr mutations were also detected by qds - ihc and ihc using mutation - specific antibodies at the pleural effusion cell blocks ( figures 3a d ) and small biopsies ( figures 4a d ) . egfr mutations detected by qds - ihc and ihc exhibited significant difference between squamous cell carcinoma and adenocarcinoma ( p<0.05 ) . in all the 65 nsclc specimens , the mutation rates for egfr detected by adx - arms was 46.15% ( 30/65 ) , 52.00% ( 26/50 ) for adenocarcinoma , 15.38% ( 2/13 ) for squamous cell carcinoma , and 100% ( 2/2 ) for adenosquamous carcinoma . a significant difference in egfr mutations was observed between adenocarcinoma and squamous cell carcinoma ( p=0.018 ) . adx - arms could detect eleven cases of exon 19 deletion , 14 cases of exon 21 l858r mutations , two cases of exon 20 point mutations ( s768i ) , and one case of exon 20 insertion . both exon changes such as exon 19 deletion and exon 20 t790 m mutations , or exon 18 g719x and exon 20 s768i mutations could be detected simultaneously in the same case ( table 1 ) . thirty - five wild - type egfrs were also noted , and there were two invalid results , mainly due to the fact that there was little tissue available ; as such , the concentration of extracted dna was very low ( 2.54 ng/l and 2.04 ng/l ) . we then compared the mutation status between adx - arms and immunostaining - based egfr . of the 26 patients with positive qds - ihc staining , all of the egfr mutations ( exon 19 deletion and exon 21 l858r mutation ) were detected by adx - arms ; however , adx - arms could detect four cases of exon 18 or exon 20 changes . if the adx - arms results were true , the sensitivity of qds - ihc in detecting egfr mutations , as compared with adx - arms , was 86.7% ( 26/30 ) ; the specific for both antibodies was 100.0% ( 26/26 ) . two cases with the exon 21 l858r point mutation , as identified by qds - ihc , were negatively stained by ihc using the egfr mutation - specific antibody . ihc sensitivity was relatively low ( 80.0% ; 24/30 ) and the specificity was 92.31% ( 24/26 ) . when detecting egfr mutations , qds - ihc and adx - arms demonstrated perfect consistency ( = 0.882 ; p<0.01 ) . excellent agreement was observed between ihc and adx - arms when detecting egfr mutations ( = 0.826 ; p<0.01 ) . tissue sections from small biopsies , pleural effusion cell blocks , and surgery were successfully stained by egfr mutation - specific antibodies , and these antibodies showed distinct immunoreactivity ( red signals ) for the tumor cells , as presented in figure 1 . a positive signal of the total egfr protein detected by qds - ihc and ihc was moderate to strong in all 65 samples , which was regarded as the positive control ( figure 2 ) . the positive rates for the egfr mutation detected by qds - ihc and ihc were 40.0% ( 26/65 ) and 36.9% ( 24/65 ) , respectively . in the qds - ihc method , 12 ( 46.2% ) patients showed e746-a750-specific staining and 14 ( 53.8% ) patients were l858r mutant - specific ( table 1 ) . figure 2 shows the representative images of the same surgical case of cancer , which carried the l858r mutation and total egfr . the cancer cells were strongly stained by the total egfr antibody ( figures 2a and b ) ; moreover , the cancer cells were positively stained for the anti - l858r antibody ( figures 2c and d ) and negative for the del e746-a750 deletion . simultaneously , egfr mutations were also detected by qds - ihc and ihc using mutation - specific antibodies at the pleural effusion cell blocks ( figures 3a d ) and small biopsies ( figures 4a d ) . egfr mutations detected by qds - ihc and ihc exhibited significant difference between squamous cell carcinoma and adenocarcinoma ( p<0.05 ) . in all the 65 nsclc specimens , the mutation rates for egfr detected by adx - arms was 46.15% ( 30/65 ) , 52.00% ( 26/50 ) for adenocarcinoma , 15.38% ( 2/13 ) for squamous cell carcinoma , and 100% ( 2/2 ) for adenosquamous carcinoma . a significant difference in egfr mutations was observed between adenocarcinoma and squamous cell carcinoma ( p=0.018 ) . adx - arms could detect eleven cases of exon 19 deletion , 14 cases of exon 21 l858r mutations , two cases of exon 20 point mutations ( s768i ) , and one case of exon 20 insertion . both exon changes such as exon 19 deletion and exon 20 t790 m mutations , or exon 18 g719x and exon 20 s768i mutations could be detected simultaneously in the same case ( table 1 ) . thirty - five wild - type egfrs were also noted , and there were two invalid results , mainly due to the fact that there was little tissue available ; as such , the concentration of extracted dna was very low ( 2.54 ng/l and 2.04 ng/l ) . we then compared the mutation status between adx - arms and immunostaining - based egfr . of the 26 patients with positive qds - ihc staining , all of the egfr mutations ( exon 19 deletion and exon 21 l858r mutation ) were detected by adx - arms ; however , adx - arms could detect four cases of exon 18 or exon 20 changes . if the adx - arms results were true , the sensitivity of qds - ihc in detecting egfr mutations , as compared with adx - arms , was 86.7% ( 26/30 ) ; the specific for both antibodies was 100.0% ( 26/26 ) . two cases with the exon 21 l858r point mutation , as identified by qds - ihc , were negatively stained by ihc using the egfr mutation - specific antibody . ihc sensitivity was relatively low ( 80.0% ; 24/30 ) and the specificity was 92.31% ( 24/26 ) . when detecting egfr mutations , qds - ihc and adx - arms demonstrated perfect consistency ( = 0.882 ; p<0.01 ) . excellent agreement was observed between ihc and adx - arms when detecting egfr mutations ( = 0.826 ; p<0.01 ) . the superior optical and electronic properties of qds over conventional organic dyes , such as high brightness , high photostability , continuous absorption , narrow emission bandwidth , and the ability to simultaneously excite multiple fluorescent colors , make them attractive labels for the development of qds - ihc imaging for multiplexing cancer biomarker detection on ffpe tissues.24,25 in our study , we confirmed that qds - ihc is a simple and standardized method for detecting egfr mutations , and it has high sensitivity and specificity when compared with real - time pcr . in addition , the development of specific antibodies against egfr mutation proteins might be useful for the diagnosis and treatment of lung cancer . in general , patients with advanced nsclc ( stage iiib ) do not benefit from surgery alone and are best managed by initial chemotherapy , chemotherapy plus radiation therapy , or radiation therapy alone . egfr mutation status plays a critical role in the therapeutic decision making for these patients . nowadays , egfr - tkis have been recommended as a first - line therapy in nsclc patients with activating mutations of egfr , including gefitinib , erlotinib , afatinib , and so on . several clinical studies have recently shown that egfr - tkis are superior to chemotherapy in nsclc patients with an egfr - activating mutation.26,27 therefore , it is highly important to evaluate the egfr mutation status in advanced nsclc patients , especially before any clinical therapy decision is undertaken . exon 19 del e746-a750 and exon 21 l858r point mutations represent the majority of egfr mutations.27,28 analysis of egfr mutations has become an important tool for targeted therapy in lung cancer , and recently , many efforts have been made to find a more specific and sensitive method ( including arms and ngs ) to detect them.29,30 when compared with conventional dna direct sequencing , targeted ngs provides a more accurate and clinically useful molecular classification method for lung adenocarcinoma.30 however , these techniques are relatively expensive for routine use in clinical laboratories , and they depend on the quality of the samples . the goal of our study was to evaluate the accuracy and sensitivity of qds - ihc in detecting egfr mutations in nsclc when compared with traditional ihc and arms . our results showed that egfr mutations in 40.0% ( 26/65 ) of nsclc patients were detected by qds - ihc , 12 ( 46.2% ) cases showed e746-a750-specific staining , and 14 ( 53.8% ) patients were l858r mutant - specific . we observed nearly perfect consistency between the positive immunostaining results of qds - ihc and adx - arms when detecting egfr mutations status . the sensitivity of qds - ihc when detecting egfr mutations , as compared with adx - arms , was 86.7% ( 26/30 ) ; both demonstrated antibody specificity of 100.0% ( 26/26 ) . however , ihc sensitivity was relatively low ( 80.0% ; 24/30 ) and the specificity was 92.31% ( 24/26 ) . despite the small number of cases in our study , we also identified that qds - ihc combined with egfr mutation - specific antibodies to detect an egfr mutation has a high specificity and sensitivity in nsclc patients . furthermore , when compared with adx - arms and traditional ihc , qds - ihc for egfr mutation detection can be performed on very small biopsy specimens and pleural effusion cell blocks . this is especially the case in instances when the number of tumor cells of these precious biopsy samples could not reach dna or rna extraction requirements . according to our knowledge , this was the first report on the detection of egfr mutations using qds - ihc in nsclc patients . our study also showed that these methods could precisely detect egfr exon 19 deletion or exon 21 l858r mutation status ; adx - arms had the best sensitivity , which could also detect exon 18 point mutation and exon 20 insertion . nevertheless , adx - arms was more expensive and required strict conditions for routine use in clinical laboratories , which is difficult to carry out and popularize in a basic hospital setting . lung adenocarcinoma showed higher egfr mutations than squamous cell carcinoma ; this mutation was identified by three methods , and it was found that adenocarcinoma exhibits different biological behaviors and requires a different therapeutic strategy . in the present study , we found that qds exhibit excellent photostability , a broad excitation spectrum , and a long fluorescence lifetime.20,31 qds - ihc could accurately detect egfr mutation protein localization in nsclc . taken together , the qds - ihc technique achieves levels of sensitivity and specificity that are sufficient for detecting egfr mutation signals in ffpe surgery , biopsy , and cell block specimens , while minimizing costs and optimizing therapeutic options . combining this method with adx - arms

backgroundepidermal growth factor receptor ( egfr ) mutation status plays an important role in therapeutic decision making for non - small cell lung cancer ( nsclc ) patients . since egfr mutation - specific antibodies ( e746-a750del and l858r ) have been developed , egfr mutation detection by immunohistochemistry ( ihc ) is a suitable screening test . on this basis , we want to establish a new screening test , quantum dots immunofluorescence histochemistry ( qds - ihc ) , to assess egfr gene mutation in nsclc tissues , and we compared it to traditional ihc and amplification refractory mutation system ( arms).materials and methodsegfr gene mutations were detected by qds - ihc , ihc , and adx - arms in 65 cases of nsclc composed of 55 formalin - fixed , paraffin - embedded specimens and ten pleural effusion cell blocks , including 13 squamous cell carcinomas , two adenosquamous carcinomas , and 50 adenocarcinomas.resultspositive rates of egfr gene mutations detected by qds - ihc , ihc , and adx - arms were 40.0% , 36.9% , and 46.2% , respectively , in 65 cases of nsclc patients . the sensitivity of qds - ihc when detecting egfr mutations , as compared to adx - arms , was 86.7% ( 26/30 ) ; the specificity for both antibodies was 100.0% ( 26/26 ) . ihc sensitivity was 80.0% ( 24/30 ) and the specificity was 92.31% ( 24/26 ) . when detecting egfr mutations , qds - ihc and adx - arms had perfect consistency ( = 0.882 ; p<0.01 ) . excellent agreement was observed between ihc and adx - arms when detecting egfr mutations ( = 0.826 ; p<0.01).conclusionqds - ihc is a simple and standardized method to detect egfr mutations with its high sensitivity and specificity , as compared with real - time polymerase chain reaction . in addition , the development of specific antibodies against egfr mutation proteins might be useful for the diagnosis and treatment of lung cancer .

Introduction Materials and methods Patients and samples QD immunofluorescence histochemistry staining Immunohistochemistry to detect EGFR mutation QDs-IHC and IHC scoring DNA extraction from NSCLC FFPE tissues and cell blocks Detection of EGFR mutations in exon 1821 by ARMS Statistical analysis Results EGFR mutation detected by QDs-IHC and IHC using mutation-specific antibodies in NSCLC EGFR mutation detected by ADx-ARMS Comparison of EGFR mutation detection by QDs-IHC, IHC, and ADx-ARMS Discussion Conclusion

we compared bona - fide human induced pluripotent stem cells ( ipsc ) derived from umbilical cord blood ( cb ) and neonatal keratinocytes ( k ) . as a consequence of both incomplete erasure of tissue - specific methylation and aberrant de novo methylation , cb - ipsc and k - ipsc are distinct in genome - wide dna methylation profiles and differentiation potential . extended passage of some ipsc clones in culture did n't improve their epigenetic resemblance to esc , implying that some human ipsc retain a residual epigenetic memory of their tissue of origin .

Supplementary Material

to investigate the anti - ulcerogenic properties of the chloroform extract of flemingia strobilifera root in rats . other anti - ulcer related activities of the extract such as the effects on free radicals and antimicrobial activity were also evaluated . chloroform extract of flemingia strobilifera root was found to be safe up to 300 mg / kg body weight when administrated orally in female wistar rats . pretreatment with chloroform extract of flemingia strobilifera root reduced the characteristic lesions in a dose dependent manner ( p<0.001 ) when compared with the control . pretreatment with chloroform extract of flemingia strobilifera root at a dose of 15 and 30 mg / kg body wt . increased the gastric mucosal glutathione level , total protein content significantly ( p<0.001 ) as compared to control group . whereas there is significant ( p<0.05 , p<0.001 ) reduction in gastric mucosal malonaldehyde levels when compared to control . free radical scavenging activity of chloroform extract of flemingia strobilifera root was observed in the concentration range tested , the ic50 value was calculated . antimicrobial activity of the chloroform extract of flemingia strobilifera root exhibited activity against both gram positive and negative bacteria at concentration of 10 mg / ml . the root extract of flemingia strobilifera possess antiulcerogenic properties could justify folklore uses of the plant in peptic ulcer diseases .

purpose : to investigate the anti - ulcerogenic properties of the chloroform extract of flemingia strobilifera root in rats.methods:anti-ulcer effect was evaluated by water immersion induced ulcer in rats . other anti - ulcer related activities of the extract such as the effects on free radicals and antimicrobial activity were also evaluated.results:chloroform extract of flemingia strobilifera root was found to be safe up to 300 mg / kg body weight when administrated orally in female wistar rats . water immersion stress produced characteristic lesions in the glandular portion of the rat stomach . pretreatment with chloroform extract of flemingia strobilifera root reduced the characteristic lesions in a dose dependent manner ( p<0.001 ) when compared with the control . pretreatment with chloroform extract of flemingia strobilifera root at a dose of 15 and 30 mg / kg body wt . increased the gastric mucosal glutathione level , total protein content significantly ( p<0.001 ) as compared to control group . whereas there is significant ( p<0.05 , p<0.001 ) reduction in gastric mucosal malonaldehyde levels when compared to control . free radical scavenging activity of chloroform extract of flemingia strobilifera root was observed in the concentration range tested , the ic50 value was calculated . antimicrobial activity of the chloroform extract of flemingia strobilifera root exhibited activity against both gram positive and negative bacteria at concentration of 10 mg / ml.conclusion : the root extract of flemingia strobilifera possess antiulcerogenic properties could justify folklore uses of the plant in peptic ulcer diseases .

PURPOSE: METHODS: RESULTS: CONCLUSION:

lead is a soft , pliable , bluish - grey metal resistant to corrosion , that exists in both organic and inorganic forms . this metal does not conduct electricity and it owns antiradiation properties . lead poisoning in children is an important health problem , accounting for 0.6% of the global burden of the disease according to the world health organization . according to the national health and nutrition examination survey data , from 2007 to 2010 , approximately 535,000 children aged 1 to 5 years , meaning 2.6% , presented blood lead level above 5 g / dl . even though lead is everywhere the ways of contamination include ingestion , inhalation , prenatal exposure , and dermal exposure , but the most important and frequent ones are ingestion and inhalation . the half - life of lead is between 30 and 40 days in men , while in children and pregnant women it can be longer . it binds to the sulfhydryl group of proteins leading to toxicity for multiple enzyme systems . the clinical presentation of lead poisoning involves nervous , hematologic , and renal systems impairment , but it can also lead to gastrointestinal disorders ( anorexia , vomiting , constipation , abdominal pain ) , hypertension , and fertility impairment . neurological symptoms include ataxia , stupor , coma , convulsions , hyperirritability , reduced iq , shortened attention span , increased antisocial behavior , reduced educational attainment , and even death . impairment of the hematological system may involve either disruption of heme synthesis or hemolysis , leading to anemia with its specific clinical signs , like weakness and fatigue . the effects of lead on the renal system consist in proximal tubular function impairment leading to aminoaciduria , glycosuria , and hyperphosphaturia , interstitial nephritis in chronic exposure , and also impairment of calcium metabolism by interfering with activation of vitamin d 1,2-dihydroxy cholecalciferol . the diagnosis is established on the blood lead level , higher than 40 g / dl for occupational and 30 g / dl for nonoccupational exposure . primary and secondary preventions should be the first steps in the management of lead poisoning as public health problem . if a patient is found with high blood lead level , the test must be repeated before considering any therapy . chelating agents are recommended only if the level is above 45 g / dl , and the type will be chosen according to the blood level and symptoms . the available agents nowadays include : 2,3 dimercaptosuccinic acid ( dmsa ) , dimercaprol , ethylene diamine tetra - acetic acid ( cana2edta ) , d - penicillamine . in certain cases , the management can also include supportive therapy , like airway protection in acute encephalopathy or antiepileptic drugs in case of seizures . we present a case report of lead poisoning in a 16-year - old girl with the aim of highlighting the difficulty in diagnosing this condition , and the fact that even though occupational exposure is the main cause of lead poisoning in adults by inhalation , it can also be present in children in certain circumstances , as in our case . the informed consent was given by the patient 's father ( legal guardian ) for publication of this case report . we present the case of a 16-year - old girl , admitted to our clinic with severe abdominal pain , loss of appetite , nausea , and vomiting . the anamnesis revealed that the girl comes from a family of potters , and that she also participated in the process of pottery , her father being diagnosed with lead poisoning 2 years before . the patient 's personal history underlined that approximately 1 year ago she presented with severe abdominal pain , being diagnosed with acute appendicitis and she underwent appendectomy , but the pain persisted , thus due to family history of lead poisoning , the suspicion of saturnine colic rose , and she was diagnosed with lead poisoning ( urinary lead : 219 g / l ) , but she received only symptomatic treatment . approximately 3 weeks before admission to our clinic , she was admitted to the regional hospital with another episode of saturnine colic ( blood lead : 113.2 g / dl ) , and chelation therapy with edta ( 4 days before the admission in our clinic ) was initiated , with a dose of 2 tablets daily , one in the morning and one in the evening associated with calcium supplements . the clinical examination performed at the time of admission revealed the following pathological elements : influenced general status , ailing face , jaundice of the sclera , blue pigmentation of the nails , painful abdomen at palpation , and weight : 45 kg . the laboratory test performed upon admission revealed hypochromic anemia ( hemoglobin ( hb ) : 10.9 g / dl , hematocrit ( htc ) : 31.6% , medium cellular volume ( mcv ) : 77.6 fl ) , increased level of liver transaminases ( alanine - aminotransferase ( alat ) : 158.9 u / l , aspartate - aminotransferase ( asat ) : 63 u / l , gamma - glutamyl - transferase ( ggt ) : 128 u / l ) , conjugated hyperbilirubinemia ( direct bilirubin ( dbi ) : 1.432 mg / dl ) , hyponatremia ( na : 132 mmol / l ) , and hypopotassemia ( k : 2.85 mmol / l ) . the systolic arterial pressure was 156 mm hg , and the diastolic was 96 mm hg . the blood lead level was 66.28 g / dl , the urinary one was 419.7 g / l ( normal < 50 g / l ) and the value of delta - aminolevulinic acid was 7.66 mg / l ( normal we also performed abdominal ultrasound which revealed a disappearance of the delimitation between the cortical and medullar parts in both kidneys . we requested consultation from an occupational healthcare specialist , who recommended the continuation of chelation therapy with edta , increasing the dose at 4 tablets / day . we also required a neurological consultation , and the specialist established the diagnosis of behavioral disorders with depressive elements , and recommended psychotherapy . based on all these clinical and laboratory findings , we established the diagnosis of lead poisoning . hydration in order to favor lead elimination , approximately 3 liters per 24 hours initially , and we decreased progressively the quantity once she ceased to vomit , and she was able to consume liquids . we associated diuretics , initially furosemide by vein , but the values of the arterial pressure persisted above the upper limit , therefore we were forced to introduce also an angiotensin - converting enzyme inhibitor , with the remission of arterial hypertension . regarding the liver function , we administered amino acids intravenously , associated with liver protectors by mouth . we also administered vitamins of the b complex in order to improve the neurological impairment . the evolution was slightly favorable , in the first 3 days after the admission , the patient continued to present severe abdominal pain , vomiting , and she also complained of pain in the lumbar area . all the laboratory parameters presented normalization of the values after approximately 10 days of treatment . on the 6th day of admission the blood level was 45.57 g / dl , and the urinary one was 836.4 after 14 days of admission , the patient was discharged without any complaints , and we recommended no further exposure to lead , avoiding the contact and the working in the pottery process . the long - term outcome of this case depends on further exposure to this heavy metal . nevertheless , we intend to repeat the blood lead levels after 12 and 24 months , assessing also the renal ( urea , creatinine , urinary exam ) and hepatic functions ( asat , alat , ggt , bilirubin ) . we present the case of a 16-year - old girl , admitted to our clinic with severe abdominal pain , loss of appetite , nausea , and vomiting . the anamnesis revealed that the girl comes from a family of potters , and that she also participated in the process of pottery , her father being diagnosed with lead poisoning 2 years before . the patient 's personal history underlined that approximately 1 year ago she presented with severe abdominal pain , being diagnosed with acute appendicitis and she underwent appendectomy , but the pain persisted , thus due to family history of lead poisoning , the suspicion of saturnine colic rose , and she was diagnosed with lead poisoning ( urinary lead : 219 g / l ) , but she received only symptomatic treatment . approximately 3 weeks before admission to our clinic , she was admitted to the regional hospital with another episode of saturnine colic ( blood lead : 113.2 g / dl ) , and chelation therapy with edta ( 4 days before the admission in our clinic ) was initiated , with a dose of 2 tablets daily , one in the morning and one in the evening associated with calcium supplements . the clinical examination performed at the time of admission revealed the following pathological elements : influenced general status , ailing face , jaundice of the sclera , blue pigmentation of the nails , painful abdomen at palpation , and weight : 45 kg . the laboratory test performed upon admission revealed hypochromic anemia ( hemoglobin ( hb ) : 10.9 g / dl , hematocrit ( htc ) : 31.6% , medium cellular volume ( mcv ) : 77.6 fl ) , increased level of liver transaminases ( alanine - aminotransferase ( alat ) : 158.9 u / l , aspartate - aminotransferase ( asat ) : 63 u / l , gamma - glutamyl - transferase ( ggt ) : 128 u / l ) , conjugated hyperbilirubinemia ( direct bilirubin ( dbi ) : 1.432 mg / dl ) , hyponatremia ( na : 132 mmol / l ) , and hypopotassemia ( k : 2.85 mmol / l ) . the systolic arterial pressure was 156 mm hg , and the diastolic was 96 mm hg . the blood lead level was 66.28 g / dl , the urinary one was 419.7 g / l ( normal < 50 g / l ) and the value of delta - aminolevulinic acid was 7.66 mg / we also performed abdominal ultrasound which revealed a disappearance of the delimitation between the cortical and medullar parts in both kidneys . we requested consultation from an occupational healthcare specialist , who recommended the continuation of chelation therapy with edta , increasing the dose at 4 tablets / day . we also required a neurological consultation , and the specialist established the diagnosis of behavioral disorders with depressive elements , and recommended psychotherapy . based on all these clinical and laboratory findings , we established the diagnosis of lead poisoning . hydration in order to favor lead elimination , approximately 3 liters per 24 hours initially , and we decreased progressively the quantity once she ceased to vomit , and she was able to consume liquids . we associated diuretics , initially furosemide by vein , but the values of the arterial pressure persisted above the upper limit , therefore we were forced to introduce also an angiotensin - converting enzyme inhibitor , with the remission of arterial hypertension . regarding the liver function , we administered amino acids intravenously , associated with liver protectors by mouth . we also administered vitamins of the b complex in order to improve the neurological impairment . the evolution was slightly favorable , in the first 3 days after the admission , the patient continued to present severe abdominal pain , vomiting , and she also complained of pain in the lumbar area . all the laboratory parameters presented normalization of the values after approximately 10 days of treatment . on the 6th day of admission the blood level was 45.57 g / dl , and the urinary one was 836.4 after 14 days of admission , the patient was discharged without any complaints , and we recommended no further exposure to lead , avoiding the contact and the working in the pottery process . the long - term outcome of this case depends on further exposure to this heavy metal . nevertheless , we intend to repeat the blood lead levels after 12 and 24 months , assessing also the renal ( urea , creatinine , urinary exam ) and hepatic functions ( asat , alat , ggt , bilirubin ) . lead poisoning is a severe condition with potential multiorgan damage and even death if lead is present in large amounts in the blood , representing a major health problem . in children , there is no safe lead level , although according to the world health organization , this problem represents approximately 0.6% of the global burden of disease . the former is more common in children due to their tendency of chewing everything , while the latter is more frequent in occupationally exposed adults . in the case presented here , lead entered the blood by inhalation as occupational risk due to the fact that our teenager patient had helped her parents in the pottery process . other occupations with an increased risk for lead toxicity can be battery manufacturing and recycling plants , demolition , remodeling , and renovation projects , rubber and plastic industries , ammunition and manufacturing , automotive/ radiator repair , lead soldering and welding , painting , plumbing , and so on . there are certain storages of lead in the organism , such as bones , teeth , hair , and nails , where it is bound tightly and it does not seem to be harmful since it is not available to other tissues . however in children , only 70% of the absorbed lead will end up in the bones , in comparison with adults in whom 94% will deposit there , fact that can be responsible for the more expressed clinical effects of this condition in small ages . according to lamas and collaborators , it seems that the deposit of active metals , like cadmium and lead , represents a major risk factor for cardiovascular disease . therefore , chelation therapy with edetate disodium can provide important benefits for those with atherosclerotic cardiovascular disorders . it seems that this metal is also incriminated for reducing the bioavailability of nitric oxide , and therefore promoting oxidative stress and inflammation . a recent study assessed the relationship between blood lead levels and childhood asthma , 2 conditions frequently encountered in small children , both related to environmental factors . the study concluded that even though blood lead levels are not significantly associated with asthma diagnosis , the elevated blood levels of this metal lead to a more severe form of asthma in children , being related to eosinophilia and elevated immunoglobulin e levels . the toxicity of blood lead levels on the nervous system is a major concern for children 's normal development . according to the data of the agency for toxic substances and disease registry ( atsdr ) , blood lead level in children , it seems that a blood lead level of 70 to 80 g / dl or greater represents a serious risk . the neurological sequelae of lead poisoning include reduced iq , shortened attention span , increased antisocial behavior , and reduced educational attainment . it was proved that an average increase of blood lead level of 10 g / dl in children will lead to an iq decline between 1.9 to 3.2 points . other sequelae of chronic lead exposure consist in interstitial nephritis , reduction of sperm concentration , total sperm counts , and total sperm motility . on a study performed on 769 american adolescents , fadrowski found that decreased kidney function is positively correlated to a blood lead level less than 10 g / dl , therefore the us government recommends repeated blood lead level testing at 12 and 24 months . we also intend to repeat the blood lead level in our patient at 12 and 24 months . a study performed in developing countries showed that in many latin american countries , lead - glazed ceramics represent a major source of exposure for those who live there . even though the most common cause of lead poisoning in adults is represented by occupational exposure , in our case we detected elevated blood lead levels in a teenage girl after occupational exposure due to the fact that the patient supported the family pottery business . the pottery - making process involves ceramic glazes and decorative paints , which both contain lead . therefore , these hand - made traditional products can represent a real danger not only for potters , but also for those using these products . the diagnosis establishment of this condition can represent a challenge for every physician , especially for a pediatrician due to the fact that the initial symptoms are nonspecific , such as abdominal pain , anorexia , or irritability , suggesting a gastrointestinal pathology . prevention of lead exposure is the most important step in lead poisoning management due to the fact that the neurocognitive damages induced by lead toxicity are irreversible , and also because in children , this metal is much more easily stored than in adults and it impairs the function of multiple organs , such as kidneys , bones , blood , and the brain . for example , in the united states , in 1988 , control disease center ( cdc ) childhood lead poisoning prevention program was created which provided local governments lead poisoning programs . these programs include public health education , policy development , screening protocols , and case management guidelines . we think that it would be of great importance for the potters to benefit at least from public health education about lead toxicity and screening programs for lead poisoning . the screening for lead poisoning would be an important diagnostic tool for the family members involved in the pottery process , diminishing the rate of unreported cases , and also due to the cluster occurrence of this condition . due to the multiple system involvement therefore , the patient submitted to chelation therapy must be closely monitored , because even the elimination of this heavy metal itself can impair the renal function . even though lead is a toxic metal that is easily stored in the body , its removal being almost impossible , chelation therapy remains the standard treatment of lead poisoning . lead toxicity is a life - threatening condition because of its severe acute and chronic complications . in children , there is no safe blood lead level , prevention methods are , therefore , very important in order to avoid toxic multiorganic effects of this metal . even though the diagnosis represents a challenge in case of children mostly due to its rare incidence in teenagers , a physician must always include this possibility in the differential diagnosis for cases with suggestive symptoms .

abstractbackground : lead is a toxic element of the environment which leads to major complications once it enters the blood stream , affecting multiple organs and systems of the body.methods:we present the case of a 16-year - old girl , diagnosed with lead poisoning after occupational exposure due to the fact that the girl was actively involved in the family 's pottery business.history revealed that the girl participated in the process of pottery , her father was also diagnosed with lead poisoning 2 years before . the patient 's personal history underlined that approximately 1 year ago she presented with severe abdominal pain , being diagnosed with acute appendicitis and she underwent appendectomy , but the pain persisted , thus due to family history of lead poisoning , the suspicion of saturnine colic rose , and she was diagnosed with lead poisoning . the main symptoms and signs were severe abdominal pain , vomiting , and arterial hypertension . the clinical evolution was favorable under symptomatic treatment and chelation therapy.results:lead toxicity is a life - threatening condition because of its severe acute and chronic complications . in children , there is no safe blood lead level , prevention methods are , therefore , very important in order to avoid toxic multiorganic effects of this metal.conclusion:even though the diagnosis of lead poisoning remains difficult in children , it must also be taken into consideration by the clinician facing a child with gastrointestinal or neurological involvement .

Introduction Case report Presenting concerns Clinical findings Diagnostic focus and assessment Therapeutic focus and assessment Follow-up and outcome Discussion Conclusions

atypical haemolytic uraemic syndrome ( ahus ) is an orphan disease , with an incidence of 25 cases per million [ 1 , 2 ] . ahus is characterized by haemolytic microangiopathic anaemia , thrombocytopaenia and acute renal failure ( arf ) , with signs or symptoms of thrombotic microangiopathy ( tma ) in other organs . it is due to uncontrolled activation of the alternative pathway of the complement system , caused by genetic mutation in complement genes ( > 60% of patients ) , anti - fh antibodies ( 56% of patients ) and other mutations not related to the complement system recently described , as dkge gene mutation or methylmalonic aciduria . approximately one - third of patients remain without identified mutation [ 35 ] . clinical manifestation of ahus can be triggered by other complement - amplifying conditions ( infection , pregnancy , organ transplant , malignant hypertension and systemic lupus erythematosus ) that can increase the risk of misdiagnosis . onset of symptoms can be sudden and present as the full triad described above . however , clinical disease manifestation can also progress more slowly with mild anaemia , progressive renal insufficiency and oscillating thrombocytopaenia . the kidney is the most frequent organ involved , although manifestations can occur in the brain ( 1020% of cases ) , heart , lungs and gastrointestinal tract . diagnosis of ahus relies on exclusion ; no evidence of shigatoxin - hus , no criteria for thrombotic thrombocytopaenic purpura ( normal adamts13 activity ) and no medical history indicating other causes of tma ( e.g. malignancy , drug use , etc . ) . plasma exchange ( pe ) has been the standard first - line therapy , with variable efficacy . published studies have shown that up to 40% of patients die or progress to end - stage renal disease ( esrd ) during the first episode . eculizumab , a monoclonal antibody directed against c5 that blocks the cleavage of c5 into c5a and c5b , has demonstrated better efficacy and tolerability in the treatment of ahus . we report a case of ahus with long evolution , subclinical haemolytic signs , progressive rf and neurological impairment resistant to pe , which showed a full reversal of neurological lesions after initiation of eculizumab therapy . . family history : her sister had been diagnosed with membranoproliferative glomerulonephritis ( mpgn ) at age 14 . over the disease course , she had anaemia , increased lactate dehydrogenase ( ldh ) and decline in c3 . epilepsy was diagnosed and well controlled , but she developed neurological impairment with progressive mental retardation . magnetic resonance imaging ( mri ) revealed ischaemic lesions in small vessels and progressive renal failure developed over 11 years . she started peritoneal dialysis in 2010 and suffered further neurological impairment and died due to a respiratory infection in august , 2012 . our 27-year - old patient was diagnosed with arf , anaemia and thrombocytopaenia aged 1 year . she recovered spontaneously without sequalae , and no new episodes of anaemia , thrombocytopaenia , ldh and bilirubin increase nor renal impairment was observed during 14 years . at age 15 , she presented with hyperuricaemia , non - nephrotic proteinuria ( 2 g/24 h ) , arterial hypertension [ blood pressure ( bp ) 160/90 mmhg ] and anaemia [ haemoglobin ( hb ) 11.5 g / dl ] , without thrombocytopaenia or schistocytes in peripheral blood . serum creatinine ( scr ) was 88.4 mol / l , and creatinine clearance ( clcr ) was 96 ml / min . renal biopsy showed focal proliferative glomerulonephritis , affecting 28% of glomeruli , with mesangial matrix and cellularity proliferation , and focal hyaline material deposits , conditioning sclerosis in one of the glomeruli . on immunofluorescence , there were intense igm and weak cq deposits ( figure 1a ) . her scr was stable , and no evidence of tma was found ( normal platelet count , no schistocytes , normal bilirubin ) other than a slight and maintained increase in ldh possibly indicating ongoing haemolysis . she also required angiotensin - converting enzyme inhibitors for proteinuria treatment . when she was 26 , arterial hypertension , proteinuria and anaemia worsened , and serum creatinine increased to 176.8 mol / l , with poor response to antiproteinuric therapy . five months later , she had a hypertensive emergency ( bp 216/120 mmhg ) , with hypertonic hypertensive retinopathy on funduscopy , kidney failure ( scr 366.86 mol / l ) , haemolytic microangiopathic anaemia ( hb 6.7 g / dl , ldh 350 ui / l , haptoglobin < 5 mg / dl and schistocytes ) and severe thrombocytopaenia ( 22 109/l ) . coombs test and autoimmunity were negative , complement component c3 was normal ( 85 mg / dl ) and adamts13 activity was 83% . a misdiagnosis of tma secondary to hypertensive emergency in the context of uncontrolled glomerulopathy was made . a kidney biopsy showed advanced tma , with acute and subacute lesions over chronic vascular involvement ( figure 1b and figure 2 ) . the patient remained hypertensive on dialysis , requiring seven drugs to control bp ( table 1 ) . three months later , she presented with mild neurological symptoms ( decreased intellectual performance , a self - limited episode of loss of consciousness ) and a new episode of tma with c3 consumption ( 68 mg / dl ) . an mri was performed , showing several high - intensity subcortical white matter lesions in the frontal lobes , with the appearance of hypoxic - ischaemic or inflammatory lesions . mild cerebral atrophy was also present ( figure 3a ) . despite a neurological evaluation , no other aetiology than tma genetic investigation showed no mutation in fh , fi and mcp genes , but she is homozygotic for a risk haplotype ( h3 ) . based on the patient 's past history , the patient 's sister bad evolution and the presence of a new episode of tma while on dialysis , with better bp control , we reconsider our previous diagnosis of tma secondary to malignant hypertension to ahus being the primary cause and probably also in the sister . after seven sessions without response and persistent haemolytic signs ( marked thrombocytopaenia , anaemia , increased ldh and schistocytes in peripheral blood sample ) , eculizumab was initiated ( 900 mg / week , during 4 weeks followed by 1200 mg/14 days ) . after the third dose , a repeat mri revealed improvement of the cerebral lesions ( figure 3b ) . after 18 months of eculizumab therapy , the patient is still requiring dialysis , but signs of haemolysis and neurological symptoms are completely absent . anaemia is controlled ( hb 12.5 g / dl ) with a lower esa requirement ( darbepoetin 30 g / weekly ) . bp has improved after 2 months of eculizumab and normal bp is maintained with four antihypertensive drugs . table 1.changes in biochemical parameters and treatmentperiod200111 ( clinical stability)dec 2011apr 2012 ( clinical worsening)may 2012 ( hospital admission)jun 2012 ( start dialysis)aug 2012 ( dialysis , stability)oct 2012 ( dialysis , neurological disorders)jun 2014 ( dialysis , stability)scr ( mol / l)88.4176.8366.86750proteinuria ( g/24 h)1.032.212.71n.d.n.d.n.d.n.d.bp ( mmhg)140/85160/90216/120190/100145/80170/110140/80hb ( g / dl)12 19 0.56.78 0.510.69.512.5platelets ( cells/10 l)256 40231 40224 3022 1521549 20157 20ldh ui / l ( normal range : 125243)265 10300 20377500354363216haptoglobin ( mg / dl)<512579schistocytes ( per hpf)absentabsent2/hpf2/hpfabsentabsentabsenttreatment darbepoetin80 20 g / month80 g/15d80 g/15d150 g / week10 g/15d150 g / week30 g / week aceiramipril 10 mg / bidramipril 10 mg / bid arbsirbesartan 300 mg / dirbesartan 300 mg / d other antihypertensiveamlodipine 5 mg / dhydrochlorotiazide ( hctz ) 25 mg / damlodipine 5 mg / dhctz 25 mg / ddoxazosin 4 mg / bidmethyldopa 500 mg / bidamlodipine 5 mg / dtorasemide 5 mg / ddoxazosin 4 mg / bidmethyldopa 500 mg / bidnebivolol 5 mg / dbarnidipine 10 mg / bidfurosemide 80 mg / dhctz 25 mg / ddoxazosin 4 mg / bidlabetalol 100 mg / bidhydralazine 50 mg / tidbarnidipine 10 mg / bidlabetalol 100 mg / bidhydralazine 50 mg / tidaliskiren 150 mg / dbarnidipine 10 mg / bidfurosemide 40 mg / ddoxazosin 4 mg / bidatenolol 25 mg / bidbarnidipine 10 mg / bidfurosemide 40 mg / ddoxazosin 4 mg / bidatenolol 25 mg / bid pe5 sessions7 sessions eculizumab900 mg / week1200 mg/14dn.d . , not documented ; d , day ; bid , twice a day ; tid , three times a day . focal proliferative glomerulonephritis , with mesangial matrix and cellular proliferation , and focal hyaline material deposits . signs of acute thrombotic microangiopathy with endoluminal collapse , endothelial and myointimal proliferation . fig . 3.evolution of mri before ( a ) and after ( b ) . ( a ) mri before eculizumab therapy . , not documented ; d , day ; bid , twice a day ; tid , three times a day . focal proliferative glomerulonephritis , with mesangial matrix and cellular proliferation , and focal hyaline material deposits . evolution of mri before ( a ) and after ( b ) . ( a ) mri before eculizumab therapy . apart from the efficacy of eculizumab for controlling neurological manifestations of ahus , the present case highlights the difficulties in diagnosing ahus when signs of the disease are mild ( anaemia with subclinical haemolytic signs , gradual impairment of renal function and the absence of thrombocytopaenia ) and progress slowly . usually , ahus has an abrupt onset , with a complete clinical picture that helps the differential diagnosis . the lack of thrombocytopaenia , schistocytes and worsening anaemia until the last episode of kidney failure made diagnosis difficult . slow disease development has been described in 20% of patients , with proteinuria , elevated bp and progressive renal failure . in relapsing / remitting disease our patient was initially diagnosed with focal glomerulosclerosis with igm deposits and non - nephrotic proteinuria ( but she had a previous episode of arf , probably due to tma episode ) . her sister was diagnosed with mpgn . mpgn and ahus may sometimes look similar on a biopsy and partially recovered tma could possibly mimic chronic glomerulonephritis . the association between them has been made as both are diseases related to aberrant complement activation . proteinuria could be explained by endothelial dysfunction caused by tma , but nephrotic syndrome itself can trigger ahus by inducing endothelial injury in patients with genetic mutations [ 13 , 14 ] . moreover , alternative pathway dysregulation can manifest only as low - grade proteinuria and chronic kidney disease [ 13 , 15 ] . vasculitis can trigger ahus by intensive complement activation or by endothelial damage in a patient with a genetic predisposition . in our case , glomerulonephritis was not the initial event ; she had a prior episode of arf . it is possible that partially recovered tma episodes mimic chronic glomerulonephritis on biopsy , as in the present case . the non - classical presentation in both sisters made diagnosis of ahus as a primary disease complex . the biopsy findings were in addition not entirely conclusive for a diagnosis of ahus , as the biopsy showed focal proliferative glomerulonephritis . the importance of risk polymorphisms in the development of ahus is increasingly being recognized , and a lack of identified complement mutations is observed in 2530% of patients [ 3 , 17 ] . the similar evolution in the two sisters , and the good response to eculizumab in our patient , suggests a complement system disturbance , despite the absence of identified mutations . the evolution of the two patients supports the evidence that prognosis for ahus with no identified mutation is as poor as in patients with identified complement factor mutations , in the absence of adequate therapy . the prognosis for patients with ahus before eculizumab was poor , with up to 40% of patients dying or progressing to esrd during the first episode . renal function recovery has been described with eculizumab even after 6 months of dialysis . in our case , kidney function did not improve despite treatment , probably due to the long - term nature of the organ damage causing irreversible damage and the delay in starting eculizumab therapy . in our patient , neurological damage progressed despite cessation of clinical haemolysis and esrd . therefore , the presence of extrarenal symptoms is critical when deciding to maintain anti - c5 therapy , regardless of renal replacement therapy requirement . damage to extrarenal organs can progress in patients without renal function [ 21 , 22 ] . this indicates subclinical activity , showing that an increase in platelet count is not always a reliable marker of recovery , highlighting the need for other biomarkers of disease activity . in the present case , rapid neurological recovery after eculizumab has been described previously , and it is maintained over time [ 20 , 22 , 24 , 25 ] . in conclusion , nephrologists should be aware of the possibility of ahus with a slow , low - grade chronic evolution that can be difficult to diagnose . our case suggests that neurological involvement can be reversed with eculizumab that is becoming the standard of care in ahus therapy , even in patients with ahus on dialysis .

atypical haemolytic uraemic syndrome ( ahus ) is a rare disease characterized by haemolytic microangiopathic anaemia , thrombocytopaenia and acute onset of renal failure , in the absence of escherichia coli infection . renal damage usually progresses to end - stage renal disease ( esrd ) , sometimes being accompanied by signs of extrarenal thrombotic microangiopathy ( tma ) . we report a case of full neurological and haematological recovery after eculizumab treatment in a patient with esrd secondary to chronic ahus refractory to plasmatherapy while she was under dialysis . it highlights the use of eculizumab for controlling extrarenal manifestations of ahus in this population .

Background Case report Discussion Conflict of interest statement

severe accidental hypothermia is a condition associated with significant morbidity and mortality . in the years 20092012 the polish national statistics department reported 1836 deaths due to excessive exposure to natural cold . the severe accidental hypothermia center ( clhg centrum leczenia hipotermii glebokiej ) was set up in krakow in 2013 ( darocha , 2015 ) . it is a unit functioning within the structure of the cardiac surgery clinic , established in order to improve the effectiveness of the treatment of patients in the advanced stages of severe hypothermia . the coordination of rescue operations ( over an area of 32,950 square km ) was entrusted to a group of doctors ( 4 coordinators ) , who support the decision - making and organization of the operational process from the time of obtaining the information about the incident until reaching clhg . on december 29 , 2014 at 19:15 , the rescuer on duty at the mountain rescue service ( gopr ) received information about a group of tourists who had lost their way in the top regions of babia gora mount , at the height of about 1620 meters above sea level . air temperature was between 6 and 8c ( windchill factor below 0c ) , the wind was w - wnw with gusts up to over a few dozen km per hour , and the falling snow significantly reduced visibility . the mountain rescue service search party on duty ( two people ) left immediately to conduct the search . later they were joined by others , so that 19 mountain rescue service members eventually took part in the operation . at 19:30 , in accordance with the protocol , the member of the mountain rescue notified the severe accidental hypothermia center ( clhg ) about the search operation . at 20:55 two men were conscious and in stage i of hypothermia , while the third one , sitting in the snow , was confused , agitated , and aggressive towards the rescuers who suspected the ii / iii stage of hypothermia according to the swiss staging system . information about this situation was passed on by phone to the clhg coordinator by the gopr rescuers . the victims were covered with metalized foil , put in thermal sleeping bags and in akia emergency rescue sleds . external warming by means of heating pads was started , and continuous heart rate monitoring using an aed was implemented . at 22:08 the mountain rescue service ( gopr ) rescuers started the difficult transport of the victims downhill , in the direction of the meeting place agreed upon with the teams of emergency medical services who were to take further care of the victims . on the basis of the information received by phone , the clhg coordinator started the procedure that is in place for patients in severe hypothermia , with the option of extracorporeal warming . he notified the team on duty at the cardiac surgery clinic of the john paul ii hospital in krakow , and an operating theater , as well as ecmo equipment were booked . due to poor atmospheric conditions ( bad weather ) , it was not possible to use an emergency helicopter . the clhg coordinator and the dispatch center in krakow arranged ambulance transport with a doctor for the patient suspected to have ii / iii stage hypothermia . transport was to take place from the scene of the incident directly to the john paul ii hospital . the decision was made to supply the ambulance with extra equipment ( i.e. , a device for mechanical chest compression and a low - temperature thermometer , both of which were taken from another emergency service ambulance working in the vicinity ) . ht , the coordinator for extracorporeal treatment of severe hypothermia patients took the medical history of the victim from his family . information about the lack of allergies and chronic illnesses and the medication taken was obtained . at 23:05 the rescuers reached the place where the emergency medical rescue team were waiting . after being carried into the warmed ambulance and having the monitoring devices connected , at 23:11 the patient suspected of hypothermia ( ht ) the patient was intubated , intravenous access was obtained and the transfusion of warm infusion fluids was implemented . the clhg coordinator advised the team managing the transport not to undertake advanced cardiovascular life support ( acls ) procedures there and told them to start transporting the patient to hospital as quickly as possible . at 23:26 the team set off with the jpii hospital as their destination . thanks to the continuous cooperation with the medical rescue team , the coordinator was able to evaluate the course of the acls procedures undertaken during transport . at 23:35 there was a brief period of agonal cardiac rhythm with pea ( pulseless electrical activity ) ( fig . the team covered 98 km by land . throughout the journey , the clgh coordinator had current information about the location of the emergency medical rescue team and the expected time of arrival at the destination hospital . the patient had asystole and anisocoria ( the left pupil was larger than the right one ) . with the emergency rescue team , and in urgent mode , he was taken to the already prepared operating theater , where he arrived at 1:15 . after cannulation of the femoral artery and femoral vein , arteriovenous extracorporeal membrane oxygenation ( ecmo ) was started at 1:35 . 200 j defibrillation was attempted , achieving the return of spontaneous circulation , but due to the persisting symptoms of cardiogenic shock , ecmo was continued until the morning hours of 1:01:2015 ( duration of ecmo therapy32 hours ) . the duration of circulatory arrest , from the time of diagnosis to administering extracorporeal circulation was 150 minutes . arterial blood gas values , blood glucose , hemoglobin and blood chemistry levels the patient regained consciousness and was extubated on january 2 , 2015 , and left the icu on january 7 , 2015 in a good neurological status ( glasgow coma scale 15 , cerebral performance category 1 ) , without anisocoria . at the time of leaving the hospital , the echocardiogram showed that the patient had a normal left ventricular ejection fraction ( ef-65% ) . prognosis in circulatory arrest in the course of accidental hypothermia is surprisingly good , despite even long periods of hypoperfusion ( dunne , 2014 ) . such treatment results are possible mainly owing to the cold protection of the brain , maintaining continuous organ perfusion obtained by means of manual or mechanical chest compression , and using extracorporeal warming ( brown et al . , 2012 ; dunne et al . , 2014 ; meyer et al , 2014 ; paal and brown , 2014 ; zafren et al . , 2014 ) . the guidelines proposed by gordon et al . ( 2015 ) suggest to start immediate continuous cardiopulmonary resuscitation ( cpr ) , to minimize interruptions and apply mechanical chest compressions as soon as possible , in circulatory arrest due to primary severe hypothermia . delayed or intermittent cpr may be considered only when continuous cpr is impossible , particularly during difficult evacuations . in the described case , the decision was made to supply the ambulance with extra equipment ( i.e. , a device for mechanical chest compression and a low - temperature thermometer , both of which were taken from another emergency service ambulance working in the vicinity ) . mechanical compression does not have a survival advantage over manual compression , but manual compression can not be done safely or effectively in a moving ambulance . the fourth element , which can significantly impact the prognosis is the appropriate organization of the rescue operation . good coordination , planning , foresight , and acting in accordance with the agreed procedures in the rescue scheme , makes it possible to shorten the time of reaching the destination hospital and effective treatment ( gordon et al . , 2014 ) . the case described here is an example of optimal management on the part of the coordinator and provides proof that the system that had been elaborated works in an effective way . notifying the coordinator of a search operation is one of the more important elements of the procedures in the rescue scheme under discussion . according to the algorithm that is in place , mountain rescue services ( 6 units of mountain rescue services covering the area of 17 680 km ) are obliged to give notification of rescue operations , especially ones conducted in conditions when there is a risk of the occurrence of hypothermia . thanks to this , it is possible to start preparations early . what is equally significant is the regular exchange of information between the coordinator and the units conducting the search and rescue medical operations . in the case described here , the coordinator had complete information about the victim transmitted to him by mountain rescuers , and was given all the parameters of the acls procedures undertaken during the ambulance transport . the immediate provision of the device for mechanical chest compression , which was taken aboard the ambulance transporting the patients as extra equipment , proved how excellent the planning and foresight of the operation was . on the basis of the information gathered , we have created a regularly updated map of the equipment at the disposal of hospitals and medical emergency services , so that coordinators can use them as required . cooperation with the dispatch center in krakow , which has agreed to the procedures in the rescue scheme elaborated by the clhg , is a very important aspect of such operations . in the case described here , on the basis of the information obtained , the coordinator made the decision that there was a high likelihood of circulatory arrest occurring , and therefore made arrangements for the device to be waiting for the patient at the place where he was taken over from the mountain rescuers . general knowledge about the procedures and treatment in managing such cases can therefore be incomplete and out of date . we confirmed that in our recent survey among 42 ers in poland providing emergency healthcare for the population of 5,305,000 ( kosinski et al . , 2015 ) . we believe that in the case being described , this element ( role of coordinator ) could also have influenced the outcome . it is , however , worth noticing that thanks to continuous information campaigns and regular training , the procedures in the rescue scheme that were developed are more and more universally recognized and used . knowledge of the principles of proceeding in hypothermia must be generally known , especially in the mountain rescue community . the recommendations and guidelines elaborated by icar and erc are therefore invaluable because they provide the basis for developing local protocols ( soar et al . , 2010 ; durrer et al . , the case described here confirms that it is possible to achieve full recovery of neurological functions in patients with circulatory arrest in the course of severe hypothermia , even after resuscitation procedures taking a few hours . at the same time , we have proven the effectiveness of the system that had been elaborated , thanks to which patients are referred to specialized hypothermia centers by means of a precisely pre - arranged route and set procedures . for obvious reasons , it is not possible to develop an ideal system , one in which all the possibilities can be foreseen . in another mountain rescue operation supervised by a clhg coordinator , some delays were unavoidable , and resuscitation procedures before introducing ecmo support in the destination hospital took 5 hours and 45 minutes ( own , unpublished data ) . however , similarly to the case fully described in that article , a full recovery of neurological functions was achieved . the element that could have been improved in this case was the delayed measurement of core temperature . neither the mountain rescuers , nor the emergency medical rescue team had appropriate equipment to perform this . core temperature ( tc ) measurement is the only diagnostic tool to assess the severity of hypothermia accurately . early tc measurement can significantly influence the course of rescue and medical proceedings and is by all means recommended ( strapazzon et al . , , the optimal thermometer should be minimally invasive , easy to handle , and independent of environmental conditions . epitympanic temperatures were comparable to invasive tc measurements in cases of deep hypothermia , however there is no clear evidence for the reliability of epitympanic tc at low ambient temperatures . every new case of hypothermia provides a topic for discussion to us and an incentive to introduce modifications raising the effectiveness of the system that had been introduced . its basic elements will always be the knowledge of the team comprising the rescue units , the cooperation of the units taking part in the operation , and good coordination of activities . good coordination , planning , predicting possible problems , and acting in accordance with the agreed procedures in the scheme , make it possible to shorten the time of reaching the destination hospital and implement effective treatment . the severe accidental hypothermia center was set up in krakow in 2013 in order to improve the effectiveness of the treatment of patients in the advanced stages of severe hypothermia .

abstractdarocha , tomasz , sylweriusz kosinski , maciej moskwa , anna jarosz , dorota sobczyk , robert galazkowski , marcin slowik , and rafal drwila . the role of hypothermia coordinator : a case of hypothermic cardiac arrest treated with ecmo . high alt biol med 16:352 - 355 , 2015.we present a description of emergency medical rescue procedures in a patient suffering from severe hypothermia who was found in the babia gora mountain range ( poland ) . after diagnosing the symptoms of ii / iii stage hypothermia according to the swiss staging system , the mountain rescue service notified the coordinator from the severe accidental hypothermia center ( clhg ) coordinator in krakow and then kept in constant touch with him . in accordance with the protocol for managing such situations , the coordinator started the procedure for patients in severe hypothermia with the option of extracorporeal warming and secured access to a device for continuous mechanical chest compression . after reaching the hospital , extracorporeal warming with ecmo support in the arteriovenuous configuration was started . the total duration of circulatory arrest was 150 minutes . the rescue procedures were supervised by the coordinator , who was on 24-hour duty and was reached by means of an alarm phone . the task of the coordinator is to consult the management of hypothermia cases , use his knowledge and experience to help in the diagnosis and treatment . and if the need arises refer the patient for ecmo at clhg . good coordination , planning , predicting possible problems , and acting in accordance with the agreed procedures in the scheme , make it possible to shorten the time of reaching the destination hospital and implement effective treatment .

Introduction Case Report Discussion Conclusion Author Disclosure Statement

involutional entropion is a common condition in asian countries , including japan.1 one cause of involutional entropion is weakening of the capsulopalpebral fascia ( cpf).2 the aged , thin , membranous nature of the cpf limits the results of correction by the original jones procedures alone , so we added the modified hotz procedure to the entropion repair . our modified hotz procedure binds the dermis to the tarsus and corrects the ciliary orientation . to determine the efficiency of the additional hotz procedure , we compared the recurrence rates and operation times in corrections performed with and without this additional procedure . from april 2010 to december 2011 , one surgeon performed lower - lid surgeries using jones cpf - tightening procedure with the addition of the modified hotz procedure ( ciliary - everted suture ) . fifteen patients ( six male and nine female ) underwent this combined procedure for a total of 21 eyes ( six right eye only , three left eye only , six both eyes ) . from january 2010 to september 2010 , the same surgeon performed the jones procedure alone on eight patients ( four male and four female ) for nine eyes ( six right eye only , one left eye only , one both eyes ) . after injection of 1% xylocaine with 0.01% epinephrine , the lower - eyelid skin pinch is cramped . a horizontal skin incision is made 5 mm below the eyelash line , and the orbicularis under the skin is exposed . the layer of the orbicularis is identified by 4 - 0 silk - suture traction . the portion of the orbicularis over the tarsus is removed , and the layer between the orbicularis and the septum - cpf complex is separated . prior to dissection of the posterior cpf layer , the cpf complex is cut at tarsal height , and the conjunctiva is visible at the bottom layer of the lower eyelid . between the cpf and conjunctiva , a sparse red tissue layer resembling the mller muscle sometimes exists this is thought to be the posterior layer of the cpf . without puncturing the conjunctiva , next , the orbital fat layer beneath the septum is identified , and the layer is dissected inferiorly approximately 78 mm from the tarsus ( figure 1b ) . the anterior cpf layer exists just under the fat layer . after the exposure of the anterior layer , an advancement of approximately 5 mm ( tarsus - cpf tightening ) is performed with three mattress sutures of 6 - 0 polysorb ( figure 1c and d ) . after the jones procedure with cpf is completed , the modified hotz procedure ( ciliary - everted suture ) is performed between the tarsus and solid dermis tissue ( figure 1e ) . the ciliary directions are shown to be corrected after the operation ( figure 1f ) . figure 2 shows the cpf advancement on the tarsus ( green line ) and the hotz rotation suture ( blue line ) . the average age of two groups was 76.4 years , with an age range of 6685 years . the cases in which the jones procedure alone was used ( average age 76.0 years , nine eyes total ) reported three recurrences , which corresponds to a recurrence rate of over 30% at a follow - up duration of at least 6 months . the recurrent cases required an eyelid margin split or a lateral tarsal split for additional correction . the cases in which the combination method was used ( average age 76.7 years , 21 eyes total ) reported two cases of complications ( one recurrence and one ectropion ) , which corresponds to a recurrence rate of 5% . the one instance of recurrence occurred 9 months after surgery and required an eyelid margin split and an additional hotz procedure for correction . the instance of ectropion presented with severe horizontal laxity before surgery that developed into ectropion 3 months after surgery . although the direction of the cilia was corrected , this eyelid required a lateral tarsal strip ( lts ) . the jones procedure used an eyelid pinch and required an average of 22.6 minutes to complete ; the combined method required an average of 33.4 minutes to complete . the jones procedure was first reported in 1963.3 however , this procedure was not popular in japan until it was disseminated by kakizaki et al.4 the jones procedure tightens the cpf by plication , thus reinforcing the vertical traction power of the lower - lid ligaments . however , the cpf often presents as a thin and membranous structure in aged patients and is not strong enough to correct the lower - lid direction permanently . kakizaki recommended an anterior posterior double - layer advancement by means of this weakness.5 another study has reported rates of recurrence of 7%15% after cpf plication.6,7 the jones procedure in our hospital resulted in a higher recurrence rate of 30% , indicating that this an unreliable procedure . the surgical videos showed that the former case had a slightly thin cpf and the latter one had a slightly thick cpf . however , the direction of the cilia at the end of the surgeries was not different between these cases . thus , cpf thickness is not an appropriate tool for making decisions about additional procedures . the vertical laxity is corrected by the jones procedure , and the horizontal laxity is corrected by the lts.8 however , the lts is not an easy technique , and the operation is painful and bloody . the wheeler procedure is a more popular technique for horizontal plication of the eyelid orbicularis.9 however , the utility of this procedure is also decreased by the aging process , and the experimental recurrence rate is high.10 moreover , the original jones procedure removes the orbicularis situated over the tarsus and is incompatible with the wheeler procedure . previous studies , including our own , report recurrence rates of less than 10% in congenital entropion patients.11,12 jones et al introduced a modified procedure 10 years after the establishment of the original technique . his modified method tied skin cpf skin.13 in 1974 , schaefer recommended connecting the lid skin to the tarsus by taking a bite through the lower edge of the skin muscle.14 we selected dermis just under the side of the cilia to tarsus suture , which is a relatively solid tissue - binding site . this combination method results in a significantly higher success rate than when the jones procedure alone is used . the p - value was 0.034 , as calculated by the chi - square test for independence . a 5% recurrence rate is a much more desirable result compared to the 30% recurrence rate resulting from application of the simple procedure . the additional hotz procedure requires only 10 additional minutes in surgery , making it one of the best choices among the procedures discussed here . we will now perform this combined procedure for all involutional entropion cases , following a half - year transitional phase . because no technique achieved a zero rate of recurrence , additional steps taken to correct the cases of recurrence are outlined . when the cilia are located too close to the eyelid margin , we perform the margin split procedure . when the lower eyelid exhibits too much laxity and requires horizontal correction to increase its strength , we add lts to the lateral orbital periosteum . subsequent to this procedure , we perform ciliary electrolysis or the wojno ciliary removal procedure.15 it is essential to have a variety of additional techniques available to correct issues of recurrence in the treatment of entropion .

purposeinvolutional entropion is a common condition in asian countries , including japan . one cause of involutional entropion is weakening of the capsulopalpebral fascia ( cpf ) . the aged , thin , membranous nature of the cpf limits the results of correction by the original jones procedure ( cpf tightening ) alone , so we added the modified hotz procedure to the entropion repair . we then compared the recurrence rates and operation times in corrections performed with and without this additional procedure.casesfrom april 2010 to december 2011 , one surgeon performed lower - lid surgery using the jones procedure with the addition of the modified hotz procedure . fifteen patients ( a total of 21 eyes ) underwent this combined procedure . previously , the same surgeon performed the jones procedure alone for eight patients ( a total of nine eyes).resultsthe average age of the two groups was 76.4 years , with an age range of 6685 years . all cases reported acceptable ciliary orientation at the end of the surgery . however , patients who underwent the jones procedure alone ( nine eyes total ) reported three cases of recurrence after at least 6 months of follow - up . patients who underwent the combined procedure reported two complications : one recurrence and one ectropion . the recurrence rate was 5% . the jones procedure using eyelid pinch required an average of 22.6 minutes to complete ; the combined method required 33.4 minutes to complete.conclusionthe combined method resulted in a significantly higher success rate than the jones procedure alone ( p < 0.05 ) . the 5% failure rate of the combined method was found to be superior to the 30% recurrence rate of the jones procedure . as a result , the hotz procedure enhanced the results of the entropion correction and required only 10 additional minutes of surgery . we now perform this combined procedure for all cases .

Purpose Cases Surgery Results Conclusion

pulmonary embolus ( pe ) refers to obstruction of the pulmonary artery or one of its branches by material ( e.g. , thrombus , tumor , air , or fat ) that originated elsewhere in the body . despite the high - incidence of pulmonary embolism , its diagnosis continues to be difficult primarily because of the nonspecific nature of the presenting signs and symptoms . the most common sources of pulmonary embolism are the pelvic veins or deep veins of the thigh . hemodynamically unstable pe results in hypotension , which by definition is systolic blood pressure < 90 mmhg for a period > 15 min or that requiring vasopressors or inotropic support and not explained by other causes including sepsis , arrhythmia , left ventricular dysfunction from acute myocardial ischemia or infarction , or hypovolemia . hemodynamically stable pe is defined as pe that does not meet the definition of hemodynamically unstable pe . majority of the cases of pulmonary embolism can be managed with medical therapy alone . for more than 30 years , thrombolytic agents have been used to dissolve or reduce the embolus and improve the circulation . however , embolectomy is indicated in patients with hemodynamically unstable pe in whom thrombolytic therapy is contraindicated . it is also a therapeutic option in those who fail thrombolysis and surgical intervention may be indicated in certain instances . currently , only few indications for surgical embolectomy have been described which include contraindications to thrombolytic therapy , presence of persistent thrombi in the right heart or pulmonary arteries , or deteriorating hemodynamic status . we report two cases of acute massive pe , which was managed successfully with surgical embolectomy . electrocardiogram ( ecg ) showed sinus tachycardia , right axis deviation , and right bundle branch block . routine investigations were normal with erythrocyte sedimentation rate ( esr ) 90 mm 1 h westergren . two - dimensional ( 2d ) echocardiography revealed dilated right atrium / right ventricular ( ra / rv ) , severe tricuspid regurgitation ( tr ) with pulmonary artery systolic pressure of 70 mmhg , and clot in rv apex and right pulmonary artery ( rpa ) [ figure 1a and b ] . the patient was subjected to surgical embolectomy with rv and rpa clot extraction [ figures 2a , b and 3 ] . ( a ) two - dimensional echo apical four chamber view shows clot in right ventricular apex and ( b ) : two - dimensional echo short axis shows thrombus in the right pulmonary artery ( a ) extraction of the right ventricular clot . ( b ) extraction of the thrombus in right pulmonary artery right ventricular and right pulmonary artery thrombus a 65-five - year - old male patient presented with acute onset of dyspnea on the 15 postoperative day for traumatic rupture of urinary bladder . he is a k / c / o hypertension with chronic obstructive pulmonary disease . on examination , routine investigation revealed hemoglobin of 12 g% , esr - 70 mm 1 h westergren . 2d echocardiography revealed dilatation of ra , rv , rpa ostium , and ra fuzzy hypoechoic lesion [ figure 4 ] . computed tomography pulmonary angiogram revealed pulmonary thrombus in proximal rpa and normal main pulmonary artery [ figure 5 ] . in view of recent surgery for traumatic rupture of urinary bladder and clot in ra , thrombolysis was not considered , and the patient was subjected to surgical embolectomy [ figure 6 ] . two - dimensional echo short axis shows thrombus in the ostium of right pulmonary artery computed tomography pulmonary angiography shows thrombus in the right pulmonary artery extraction of thrombus in the right pulmonary artery massive pe is defined as rv dysfunction or a systolic blood pressure < 90 mmhg or a drop in systolic blood pressure of 40 mmhg from baseline for a period > 15 min . in patients with massive pe , 50% patients die within 30 min , 70% die within 1 h , and more than 85% die within 6 h of the onset of symptoms . clinically , diagnosis is difficult due to the nonspecific nature of the symptoms and signs of pe and investigations including routine blood , arterial blood gas measurement , electrocardiography , and chest radiography , however all lack specificity ; thereby limiting their utility in reaching a definitive diagnosis . the differential diagnosis for pe is many which include pneumothorax , pleuritis , pneumomediastinum , pericarditis , acute myocardial infarction , aortic dissection , esophageal rupture , lung cancer , rib fractures , and metastatic deposits . the most common sources of pulmonary emboli are the pelvic veins or deep veins of the thigh . pulmonary arterial obstruction by clot causes platelets to release vasoactive agents such as serotonin , which may lead to further elevation of pulmonary vascular resistance . this redistribution of blood flow increases alveolar dead space with a resultant ventilation / perfusion mismatch that impairs gas exchange . right ventricular after load increases , tension rises in rv wall and may lead to dilatation , dysfunction , and ischemia of right ventricle . in the absence of absolute contraindications , thrombolysis is the indicated treatment for patients with acute massive pe , who present with shock and is reported to achieve good outcomes . in those patients whose condition worsens despite thrombolysis , surgical intervention should be strongly considered . currently , only a few indications for surgical embolectomy have been described which include contraindications to thrombolytic therapy , presence of persistent thrombi in the right heart or pulmonary arteries , or deteriorating hemodynamic status . early surgical intervention may be associated with a survival benefit in such situations . in one nonrandomized case series of patients with massive pe complicated by shock the main predictor of mortality in patients undergoing surgical pulmonary embolectomy is preoperative cardiac arrest requiring resuscitation . patients with hemodynamic collapse prior to surgery have an operative mortality ranging from 43% to 84% . massive pe requires immediate therapy to restore pulmonary arterial flow . in the absence of treatment , anticoagulation is the standard of care for pe , with the addition of thrombolysis or surgical embolectomy when the clot burden and clinical presentation warrant more aggressive treatment . surgical embolectomy in hemodynamic instability due to acute pe is reserved for patients in whom thrombolysis ( systemic or catheter - directed ) is contraindicated , and is an option in those in whom thrombolysis has failed . however , surgical embolectomy may show favorable outcomes in cases such as echocardiographic evidence of an embolus trapped within a patent foramen ovale , or present in the ra , or right ventricle . surgical embolectomy , therefore , should not simply be considered as a treatment of last resort , but may warrant earlier consideration in certain conditions .

acute massive pulmonary embolism is a life - threatening emergency that must be promptly diagnosed and managed . over the last several years , the use of computed tomography scanning has improved the clinician 's ability to diagnose acute pulmonary embolism . we report two cases of acute massive pulmonary embolism who presented with sudden onset of dyspnea and underwent successful open pulmonary embolectomy . the first case presented with acute onset of dyspnea of 2 days duration , in view of hemodynamic deterioration and two - dimensional echocardiography , it revealed clot in right ventricular ( rv ) apex and right pulmonary artery ; the patient underwent cardiopulmonary bypass and open pulmonary embolectomy with rv clot extraction . the second case presented with a sudden onset of dyspnea on the 15th postoperative day for traumatic rupture of urinary bladder , in view of recent surgery , the patient was subjected to surgical embolectomy . following surgical intervention , both the patients made a prompt recovery .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

the symptoms of malaria include fever and anemia , and most of the deaths are caused by the parasite plasmodium falciparum . the merozoite form of the parasite invades red cells , grows to form ring- , trophozoite- and schizont stages , and after rupture of the infected red cell new merozoites are released that are ready to enter uninfected red cells . merozoite invasion is a process that takes only a few minutes , but it involves several complex receptor - ligand interactions . initial attachment of the merozoite is mediated by merozoite surface proteins such as msp1 and msp2 , and is followed by reorientation of the merozoite where apical membrane antigen 1 ( ama1 ) is of importance [ 4 , 5 ] . other ligands such as erythrocyte - binding antigens ( ebas ) , for example , eba140 , eba175 , and eba181 and p. falciparum reticulocyte - binding homologues ( pfrhs ) , including pfrh1 , pfrh2 , pfrh4 , and pfrh5 have also shown to be involved in the invasion process [ 69 ] , even though the exact function of each antigen is not known . genetic polymorphisms exist for many of the above - mentioned ligands , and based on some genes like msp2 , parasites can be grouped into two major allelic types : 3d7 and fc27 . serine repeat antigens ( seras ) are proteases that take part in forming a protein complex that is associated with the merozoite surface [ 1012 ] , and entry into the red blood cell is finally completed by an actin - myosin motor movement [ 13 , 14 ] . individuals who live in malaria endemic areas eventually develop immunity , but only slowly and after repeated exposure [ 15 , 16 ] . women have a greater risk of succumbing to malaria , and the fetus is also at risk . it is known that antibodies are important in the defence against malaria , and it has been shown that passive transfer of antibodies from immune donors to individuals with p. falciparum infection reduces parasitemia and clears clinical symptoms [ 1821 ] . however , exactly which specific antibodies are protective against future disease are not yet defined , and how they should be measured is even less clear . this information is urgently needed to be able to develop a functioning vaccine , something that has so far failed . we will here discuss the pros and cons for different methods available such as elisa , invasion inhibition assays ( iias ) , antibody - dependent cellular inhibition ( adci ) , and affinity , and we compare it to measurements of antibodies in other diseases and how the overall evaluation of immunity or vaccine status of malaria could possibly be improved . when antibodies directed against different p. falciparum antigens have been measured , elisa has usually been the method of choice . in this static method , proteins are coated to a plate and levels of antibodies in plasma from patients with ( or without ) malaria can be estimated . when recombinant proteins are used , only antibodies directed against specific antigens are analyzed . in real life , the antigen of choice is located together with several other antigens , for example , on the merozoite surface , and there might be interaction or competition between binding of different antibodies , something that is not accounted for in an elisa . it has , for example , been shown for msp1 that there are blocking antibodies that can compete with the binding of cleavage - inhibiting antibodies for epitopes on the merozoite [ 22 , 23 ] , and there are also other studies that have demonstrated that mixing of different antibodies can influence the outcome of the assay . this kind of studies indicates that we should more look at using assays where the function of antibodies is studied , but the reason for why elisas are continued to be used to such a major extent is probably that they are very easy , fast , and robust to perform compared to functional assays . when recombinant proteins are applied in elisas , the result might depend on which part of an antigen that is selected for use in the assay . for msp1 , it has been shown that antibodies against msp1 - 19 were associated with some protection , while antibodies against msp1 block-1 were not . however , even when the same subdomain has been used such as in studies of eba175 , contradictory results have been achieved for whether there was a protective effect of antibodies or not [ 26 , 27 ] . when red cells burst due to egress of merozoites , a lot of debris will be left in the blood stream that needs to be removed , and many of the antibodies might help in doing this but this does not mean that the antibodies will protect from future disease . if only elisas are used , it is difficult to discern which antibodies are functionally important . in general , higher levels of antibodies are found in elisas in older individuals in endemic areas , while lower levels of antibodies are seen in younger individuals in the same areas . this was recently shown for the ebas for example and it has been shown earlier for other antigens as well [ 7 , 26 , 27 , 29 , 30 ] . however , even though an individual has high levels of antibodies , they can still develop malaria , and an individual with relatively low levels of antibodies can be fully protected from clinical and severe malaria [ 25 , 3152 ] . in vaccine trials , antibodies measured by elisa have been shown to often be short - lived , and most patients will still get malaria in spite of presence of antigen - specific antibodies . from a population perspective , elisas can be used to make an overall estimation of how much exposure there has been to malaria , but for each individual it is not possible to make an exact determination of the immune status . the only thing that can for sure be concluded from a positive response in elisa is that the individual has at some stage during his / her lifetime been exposed to malaria . when elisas against different antigens are combined , more information can possibly be acquired about the level of immunity in investigations of the breadth of antibodies , but the question of whether it is just a measure of exposure will still remain . a way of improving the elisas would be to more often use standardized controls , allowing for the measurement of exact amounts of specific antibodies instead of titers . in conclusion , elisas are easy and robust to perform , and they can clearly give us information about whether or not an individual has ever been exposed to malaria . with combinations of different antigens and standardization of the assays , more information can possibly be provided . however , elisas do not tell us anything about the function of the antibodies , and on an individual level , elisas will not give us complete information about immunity . one assay that has been used to try and better determine the function of antibodies in plasma is growth inhibition assay or invasion inhibition assay ( iia ) . antibodies directed against merozoite antigens are thought to function by directly inhibiting invasion of new red cells , which will then stop further multiplication of parasites , or through adci . by adding immune plasma , which contains antibodies to growing parasites , the inhibitory function of the antibodies can be evaluated in comparison to parasites where no plasma has been added . the downside of iias compared to elisas is that they are much more labor intensive , but on the other hand all proteins are expressed in their native environment and many both known and unknown potential interacting factors are included in the assay . there have been several studies that have shown invasion inhibitory activity of antibodies from human plasma , both when total igg has been used and when malaria - antigen - specific fractions have been used [ 22 , 5458 ] . some studies have shown increasing invasion inhibition with age while others have shown more invasion inhibition in children [ 56 , 60 ] . this kind of contradictory results might be explained by different functions in the antibodies repertoire being important during development of immunity , compared to when immunity is already established , but it might also mean that the assay is not yet fully optimized to show who is immune or not . one attempt to improve the iia is by adding monocytes ( adci ) . when adci has been employed , some antigens like msp3 and glurp [ 61 , 62 ] have shown an inhibitory effect only when monocytes were included in the iia . however , with adci there seems to be a major variability in the assay that can be seen from day to day even using the same donor of monocytes , making it difficult to standardize the assay . if this assay could be improved and standardized , it might add very valuable information about different antibodies . another attempt to try and improve iia is to use knockout lines of parasites . here , a single antigen can be studied in its natural environment and with the correctly folded protein , and a comparison can be made between the wild - type and the knockout parasites . this has been used , for example , for the ebas , where it was shown that antibodies against eba175 was responsible for a major part of the inhibitory activity in some individual plasma samples , while other samples seemed not to have any functional antibodies against this protein at all . this kind of results is important for selection of potential vaccine candidates , especially for ruling out those antibodies that have no effect . some antigens have been difficult to knock out , in which case other reagents might have to be added to the assay such as blocking agents , to find out which antibodies are causing the inhibitory effect . in conclusion , iias are labor intensive but can provide important information especially for comparisons between knockout and wild - type parasites , where the function of a single potential vaccine candidate antigen can be evaluated . another way of looking at antibodies against merozoite antigens is to study the affinity / avidity of antibodies . some studies have tried to use elisa with added nh4scn to evaluate affinity , but the results for this have been inconsistent [ 64 , 65 ] . a new way of investigating affinity for vaccine trials has opened up with methods like surface plasmon resonance ( spr ) [ 66 , 67 ] , where affinity of antibodies can be estimated under flow , something that ought to be more similar to the physiological situation compared to static assays . with this method , association and dissociation of antibodies binding to their target antigens this method has before mainly been used with monoclonal antibodies in malaria research , but it has recently been applied also to polyclonal antibodies . it has , for example , been shown that affinity of antibodies against ama1 increased with age , and the presence of high affinity antibodies in plasma against msp2 - 3d7 was associated with protection against malaria . in this study , most plasma samples showed a relatively rapid on - rate , indicating that whether the concentration of antibodies in the samples is high or low , the antibodies will still bind quite fast to their antigens . this is important for considering whether an antibody will function in inhibiting merozoite invasion or not , since invasion is a process that takes only a couple of minutes . the dissociation rate ( which is concentration independent ) might therefore be more important for whether an antibody will function or not . in the referred study , monoclonal antibodies were also used and it could be seen that some bound with so low dissociation rates , that a value for the dissociation rate could not be obtained . however , investigations of affinity of antibodies in malaria are yet a very new field which needs a lot more studies to be able to make firm conclusions , and standardized protocols needs to be in place to facilitate interpretation of the results . in other infectious diseases , such as bacterial diseases [ 69 , 70 ] , toxoplasma , or hiv , studies of affinity of polyclonal antibodies in malaria is a new field that could add a lot of information both about how immunity is formed and for vaccine trials , and more work in this area is needed . when different assays are used to evaluate antibodies against malaria , the methods often show results that do not correlate with each other . for example , spr has been shown to correlate with elisa for ama1 , which binds with relatively high affinity , but not for msp2 , which binds with lower affinity . when iia has been compared to elisa , some people have shown correlations while others have not seen any correlations [ 36 , 73 ] . this is probably because iia is a functional assay , while elisa only estimates the levels of antibodies . an example of the lack of major correlations between methods ( iia and elisa ) is shown in figure 1 . this illustrates the difficulties in estimating immunity against malaria . for vaccine trials , one has to be careful with interpretation of results , as the results could vary a lot depending on which method is used . in other fields such as hiv , international consortia have established common standards to be used in immunological assays , and this might be applicable for elisas , but more challenging for the functional methods yet available in malaria . none of the methods described here are good enough on their own to give a complete picture of an individual 's immune status . elisas are good at giving us information about whether any immune response at all is mounted against a potential vaccine candidate , and from a population perspective when many samples need to be analyzed , elisas are easy to perform . however , if we want to know something about the function of a specific antibody , iia with the usage of knockout and wild - type parasites should be the way forward . even though these assays are more cumbersome to perform , they will add valuable information . affinity of antibodies has so far been very scarcely studied in malaria research compared to many other diseases , and expansion of this field should add important information both for knowledge about immunity and for vaccine trials . more studies are needed that employ different methods together in the same patient cohorts to get a more full picture of which functions of antibodies are important during different stages of development of immunity against malaria . in conclusion , which method should be used depends on what we want to know about the antibodies . if we only want to know whether antibodies are formed or not , elisas can be used , but if we want to know something about the function of the antibodies , more elaborate assays such as iia have to be applied . to get the full picture about immunity status in an individual , the methods available have to be developed more and probably combined to a bigger extent , but with new methods such as those available for affinity measurements there is hope that this situation can be improved .

immunity against malaria develops slowly and only after repeated exposure to the parasite . many of those that die of the disease are children under five years of age . antibodies are an important part of immunity , but which antibodies that are protective and how these should be measured are still unclear . we discuss the pros and cons of elisa , invasion inhibition assays / adci , and measurement of affinity of antibodies and what can be done to improve these assays , thereby increasing the knowledge about the immune status of an individual , and to perform better evaluation of vaccine trials .

1. Introduction 2. ELISA 3. Growth Inhibition Assay/Invasion Inhibition Assay 4. Affinity 5. Comparing Different Ways of Measuring Antibodies 6. Which Method Should We Use to Measure Antibodies against Malaria?

ocular cysticercosis is caused by the growth of the larval form of taenia solium within ocular tissues.1,2 the cysts may be located in descending order of frequency in the subretinal space ( 35% ) , vitreous ( 22% ) , conjunctiva ( 22% ) , anterior segment ( 5% ) and orbit ( 1%).3 intraocular cysticercosis usually presents with reduced vision and ocular inflammation . it is believed that the larva reaches the subretinal space through the posterior ciliary arteries.3 - 6 as the cyst develops , it may cause exudative retinal detachment.6 as long as the cyst remains viable , it evokes little or no inflammatory response . once the cyst starts degenerating , an antigen , which may be a metabolic by - product or toxin , leaks from the cyst and induces an inflammatory reaction , manifesting as vitritis , uveitis and sometimes endophthalmitis.3 - 6 most often , the characteristic intraocular cyst can be visualized by indirect ophthalmoscopy or detected by b - scan ultrasound in the presence of hazy media.3 b - scan ultrasonography will show a curvilinear echo corresponding to the cyst wall together with an eccentric hyperechoic dot suggestive of the scolex . a - scan analysis reveals two high amplitude echoes representing the anterior and posterior walls of the cyst . mahendradas et al7 highlighted the features of intraocular cysticercus cyst employing spectral domain oct ; they clearly delineated the hyper - reflective wall of the subretinal cyst with a more hyper - reflective portion within its wall suggestive of the scolex / larva . cns involvement can be observed in approximately 90% of patients with ocular cysticercosis and mri is superior to computed tomography ( ct ) in detecting lesions of neurocysticercosis ( ncc).8 in addition , mri better illustrates cystic lesions in the base of the brain , cerebrospinal fluid ( csf ) spaces as in ventricular ncc and cisternal ncc , and also with intramedullary lesions.9 the scolex may be more readily apparent on mri than on ct . on mri , contents of live cysts ( vesicular stage ) are isointense relative to csf on t1- and t2-weighted images.10 treatment of ocular cysticercosis is mandatory since it has been reported that 80% of untreated cases result in severe ocular damage.3 antihelminthic drugs such as praziquantel or albendazole are effective in central nervous system and skin cysticercosis . . surgical removal of the cyst can also be performed through transretinal or trans - scleral routes.11 systemic corticosteroid coverage is required before and after surgical removal of the cysticercus.3

a 31-year - old man of asian descent presented with loss of vision in his right eye from 6 months earlier . best corrected visual acuity ( bcva ) was limited to light perception in the right eye and was 6/6 , n6 in the left one . slit lamp examination revealed normal anterior segments bilaterally . intraocular pressure was 8 and 14 mmhg in the right and left eyes , respectively . fundus examination in the right eye showed a large subretinal cysticercus cyst , accompanied by total retinal detachment ( rd ) , severe extensive subretinal fibrosis and membranes ( fig . 1a).b - scan ultrasound ( alcon ultrascan , alcon laboratories , fort worth , texas , usa ) images illustrated total rd with a hyperechoic area within the cystic cavity suggestive of cysticercus scolex ( fig . 1b ) . spectral domain optical coherence tomography ( oct ) ( topcon 3d oct-2000 , topcon medical systems , oakland , new jersey , usa ) demonstrated a highly reflective cyst wall and a more hyper - reflective dome - shaped structure within the wall suggestive of the scolex ( fig . 1c ) . the posterior extent of the cyst could not be visualized due to its large size . t1-weighted contrast - enhanced magnetic resonance imaging ( mri ) of the brain demonstrated a ring - shaped enhancing lesion in the left cerebellar hemisphere with perilesional brain edema suggestive of neurocysticercosis ( fig . 1d ) . the patient was referred to a neurophysician and received a three month course of oral albendazole and steroids . eventually , he was recommended for follow - up care .

DISCUSSION

the online version of this article ( doi:10.1007/s13555 - 015 - 0088-z ) contains supplementary material , which is available to authorized users . dermoscopy is a valuable noninvasive technique that increases diagnostic accuracy in melanoma and non - melanoma skin cancer [ 1 , 2 ] . recently , its use as an aid in the monitoring of topical treatment response has also been described [ 24 ] . basal cell carcinoma ( bcc ) is the most frequent type of skin cancer in humans . surgical excision is still considered the gold - standard of treatment . however , a number of topical therapies are now available for the treatment of different types of basal cell carcinoma . despite the fact that bcc is associated with a low mortality and very rarely gives rise to metastatic disease , delays in its correct diagnosis and treatment prolong patient morbidity and increase the cost of care . dermoscopy has also shown to be useful in the assessment of early recurrence or tumor persistence . dermoscopic criteria such as pigmented structures , ulceration and arborizing vessels have been suggested to predict the presence of residual disease ( residual disease - associated dermoscopic criteria ) [ 4 , 5 ] . this case report exemplifies the usefulness of dermoscopy in the assessment of residual disease after incomplete surgical excision and also in the monitoring of topical treatment response . an otherwise healthy , 92-year - old woman was seen for the evaluation and treatment of a long - standing nodular lesion on the tip of her nose . the lesion was characterized as a solitary , 5 mm , smooth , nodular , pearly tumor with telangiectasia ( fig . 1 ) . dermoscopy confirmed the diagnosis of nodular bcc because of the presence of telangiectasia and arborizing vessels ( fig . 2 ) . the wound healed by secondary intention with daily topical application of a pirfenidone gel ( fig . 3 ) ( kitoscell - q , cell therapy and technology , s.a . de c.v . , mexico ) . histopathologic examination revealed a neoformation arising from the epidermis proliferating into the papillary and reticular dermis . it was constituted by an epithelial tumor with basaloid - appearing cells disposed in palisade at the periphery of the tumor nests . the tumoral nests were surrounded by a lymphocytic inflammatory infiltrate and a fibromyxoid stroma with stromal retraction artifact in certain areas . the tumor extended into the deep margins where tumoral nests were smaller , with angular shapes and interspersed by a more fibrous stroma . histology confirmed the diagnosis of infiltrating nodular bcc and remains of tumoral cells within the wound bed and deep margins ( fig . six weeks after the incomplete surgical excision , the esthetic result was acceptable ( fig . however , dermoscopy confirmed the persistence of the tumor characterized by a large arborizing vessel ( fig . for this reason and due to the ease of at - home application , daily topical treatment with 5% imiquimod cream for 8 weeks was started ( fig . clinically and dermoscopically the patient revealed an appropriate response to the topical treatment characterized mainly by erythema and mild ulceration ( fig . four weeks after the end of treatment , the clinical esthetic result was acceptable ( fig . 9 ) . at 12 months after the end of treatment dermoscopy confirmed the absence of any signs of recurrence ( fig . the patient was last seen 23 months after the end of treatment without any signs of recurrence and dermoscopy confirmed the eradication residual disease ( fig . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 , as revised in 2013 . 1the lesion on the nose was characterized as a solitary , 5 mm , smooth , nodular , pearly tumor with telangiectasiafig . 2dermoscopy confirmed the diagnosis of nodular basal cell carcinoma because of the presence of telangiectasia and arborizing vesselsfig . 3wound healed by secondary intention with daily topical application of a pirfenidone gelfig . 4 a ( 10 , 20 ) and b ( 40 ) . histology confirmed the diagnosis of infiltrating nodular basal cell carcinoma and remains of tumoral cells within the wound bed and deep marginsfig . 6dermoscopy confirmed the persistence of the tumor characterized by a large arborizing vesselfig . 7 a , b daily topical treatment with 5% imiquimod cream was startedfig . 8 a f clinically and dermoscopically the patient revealed an appropriate response to the topical treatment characterized mainly by erythema and mild ulcerationfig . 9four weeks after the end of 5% imiquimod treatment the clinical esthetic result was acceptablefig . dermoscopy shows no signs of tumor recurrence and confirms eradication of residual disease the lesion on the nose was characterized as a solitary , 5 mm , smooth , nodular , pearly tumor with telangiectasia dermoscopy confirmed the diagnosis of nodular basal cell carcinoma because of the presence of telangiectasia and arborizing vessels wound healed by secondary intention with daily topical application of a pirfenidone gel a ( 10 , 20 ) and b ( 40 ) . histology confirmed the diagnosis of infiltrating nodular basal cell carcinoma and remains of tumoral cells within the wound bed and deep margins six weeks after the incomplete surgical excision the esthetic result was acceptable dermoscopy confirmed the persistence of the tumor characterized by a large arborizing vessel a , b daily topical treatment with 5% imiquimod cream was started a f clinically and dermoscopically the patient revealed an appropriate response to the topical treatment characterized mainly by erythema and mild ulceration four weeks after the end of 5% imiquimod treatment the clinical esthetic result was acceptable one year later the patient had no signs of recurrence confirmed by dermoscopy clinical and dermoscopic appearance 23 months after the end of treatment . basal cell carcinoma is the most frequent cancer of the skin and its incidence is increasing worldwide . surgery , including mohs micrographic surgery , is considered the gold standard of treatment and the most effective in terms of recurrence rates . incomplete excision has been associated with various recurrence rates ranging from 26% to 67% and 50% of recurrences occur within the next 612 months . certain anatomic locations such as the nose and inner canthus , as well as certain histologic subtypes such as infiltrative and multifocal , have been associated as predictive factors for incomplete excision . in cases where the surgical intervention is unable to completely remove the tumor , adjuvant therapy such as a second surgical procedure , radiotherapy , photodynamic therapy and topical immunotherapy are used . imiquimod is a toll - like receptor-7/8 ( tlr-7/8 ) agonist that acts as a topical immune response modifier and has been reported as a non - surgical alternative for the treatment of bcc , particularly for the superficial subtype [ 7 , 8 ] . topical imiquimod 5% cream promotes a th-1 immune response aimed at enhancing the removal of neoplastic cells . recently , imiquimod 5% cream has been described as a novel alternative to reduce deregulated hedgehog ( hh)/gli signal , independent of tlr signaling . small molecule targeting of hh signaling by inhibiting the essential pathway effector smoothened has proven exceptionally efficient for the treatment of advanced and metastatic basal cell carcinoma . however , severe side effects , limited response rates , and rapid development of drug resistance may limit the therapeutic success of smo antagonists . this reflects the need for the identification of alternative and additional strategies repressing oncogenic hh signaling . imiquimod 5% may be one of such alternatives as a topical , safe and relatively easy to use drug for the treatment of different bcc subtypes as adjuvant or neoadjuvant therapy . our case report exemplifies that dermoscopy is a valuable diagnostic aid that also serves to assess tumor recurrence / residual disease and to monitor topical treatment response . it also adds further evidence to the use of imiquimod as an important topical neoadjuvant or adjuvant therapy for the treatment of bcc and residual disease in cases with incomplete surgical excision [ 10 , 11 ] . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 , as revised in 2013 . this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made .

introductiona relatively novel application for dermoscopy is its use in the monitoring of topical treatment response for non - melanoma skin cancer . basal cell carcinoma ( bcc ) is the most frequent type of skin cancer in humans . surgical excision is still considered the gold - standard of treatment . however , a number of topical therapies are now available for the treatment of different types of basal cell carcinoma.case reportthis case report exemplifies the usefulness of dermoscopy in the monitoring of residual disease after incomplete surgical excision and also in the monitoring of topical treatment response . imiquimod 5% cream acts as a topical immune response modifier promoting a th-1 immune response enhancing the removal of neoplastic cells and has proven to reduce deregulated hedgehog ( hh)/gli signal strength independent of toll - like receptor signaling , which makes it a valuable adjuvant topical therapy for the treatment of basal cell carcinoma.conclusionimiquimod 5% cream is a valuable adjuvant therapy for the treatment of incompletely excised bcc . this case report adds further evidence to the usefulness of dermoscopy in the assessment and monitoring of treatment outcome.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 015 - 0088-z ) contains supplementary material , which is available to authorized users .

Electronic supplementary material Introduction Case Report Discussion Conclusion Electronic supplementary material Disclosures Compliance with ethics guidelines Open Access

the lens samples were removed from the manufacturer packaging , placed front ( convex ) surface down on a clean glass slide , cross - sectioned with a razor blade and mounted onto a lens holder for sem imaging with a hitachi model s-3400n sem at an iso 17025 accredited laboratory . the images were recorded at an acceleration voltage of 10 kv under variable pressure ( 3050 mpa ) operating mode and using a back - scattered electron detection . one 500 magnification image of each cross - section was obtained to show the entire width of the sample and the general location of the pigment particles . a 500 magnification ( and in some cases a 2,000 magnification ) image was taken in a top - down or bottom - up view . to measure the depth of the pigment particles , the uncertainty of dimensional sem measurements is about 10 per cent ( providing an estimated level of confidence of 95%).21 three to 12 lenses per lens brand were tested for each of the following seven lens types : camax color ( cc ) ; 1-day acuvue define ( 1dad ) ; one - day delight max 2 ( dm2 ) ; seed eye coffret uv ( eco ) ; freshlook one - day color ( flc ) ; naturelle daily disposable ( nat ) ; and ticon cosmetic daily ring black ( tc ) contact lenses ( table 1 ) . lens brands , manufacturers , region available , variants and powers tested listed in alphabetical order atomic force microscopic images were acquired for the seven lens types in fluid phase with a dimension icon afm from bruker nano under contact mode using sharp nitride lever probes ( snl-10 ) with a spring constant of 0.06 newton per metre . the area of lens under afm imaging and the afm tip were kept hydrated with a droplet of standard lens packing solution . within each lens brand , multiple lenses from each power tested rms roughness and peak - to - peak values were obtained by analysing three 20 m 20 m regions ( front curve , back curve , pigmented and non - pigmented ) of these images . four replicates of rms and peak - to - peak measurements were selected for each area within each lens at a given location or pigment status . thus , a total of 12 measurements were recorded for each lens at a given location or pigment area . data from rms and peak - to - peak responses were determined to be log - normally distributed . these responses were analysed separately using a generalised linear mixed model with a log - normal distribution . location ( front versus back curve ) , pigment area ( pigmented versus non - pigmented ) and lens brand were included as fixed effects . all two - way and three - way interactions between location , pigment and brand were also included as fixed effects . replicates nested within lens number and area number were modelled as random effects within each brand . least squares mean values and their corresponding 95% confidence intervals were estimated for each brand , location and pigment combination . results from the sem image analyses were used to determine the appropriate pair - wise comparisons between lens brands . pair - wise comparisons were made for each lens brand for pigment versus no pigment on the lens surfaces . in this study , since the analysis was completed on the log - scale , the afm estimates and their interval bounds were exponentiated to provide model - based estimates on the original , untransformed scale . since multiple comparisons were considered , a simulation adjustment for alpha was completed to control the the lens samples were removed from the manufacturer packaging , placed front ( convex ) surface down on a clean glass slide , cross - sectioned with a razor blade and mounted onto a lens holder for sem imaging with a hitachi model s-3400n sem at an iso 17025 accredited laboratory . the images were recorded at an acceleration voltage of 10 kv under variable pressure ( 3050 mpa ) operating mode and using a back - scattered electron detection . one 500 magnification image of each cross - section was obtained to show the entire width of the sample and the general location of the pigment particles . a 500 magnification ( and in some cases a 2,000 magnification ) image was taken in a top - down or bottom - up view . to measure the depth of the pigment particles , the uncertainty of dimensional sem measurements is about 10 per cent ( providing an estimated level of confidence of 95%).21 three to 12 lenses per lens brand were tested for each of the following seven lens types : camax color ( cc ) ; 1-day acuvue define ( 1dad ) ; one - day delight max 2 ( dm2 ) ; seed eye coffret uv ( eco ) ; freshlook one - day color ( flc ) ; naturelle daily disposable ( nat ) ; and ticon cosmetic daily ring black ( tc ) contact lenses ( table 1 ) . lens brands , manufacturers , region available , variants and powers tested listed in alphabetical order atomic force microscopic images were acquired for the seven lens types in fluid phase with a dimension icon afm from bruker nano under contact mode using sharp nitride lever probes ( snl-10 ) with a spring constant of 0.06 newton per metre . the area of lens under afm imaging and the afm tip were kept hydrated with a droplet of standard lens packing solution . within each lens brand , rms roughness and peak - to - peak values were obtained by analysing three 20 m 20 m regions ( front curve , back curve , pigmented and non - pigmented ) of these images . four replicates of rms and peak - to - peak measurements were selected for each area within each lens at a given location or pigment status . thus , a total of 12 measurements were recorded for each lens at a given location or pigment area . data from rms and peak - to - peak responses were determined to be log - normally distributed . these responses were analysed separately using a generalised linear mixed model with a log - normal distribution . location ( front versus back curve ) , pigment area ( pigmented versus non - pigmented ) and lens brand were included as fixed effects . all two - way and three - way interactions between location , pigment and brand were also included as fixed effects . replicates nested within lens number and area number were modelled as random effects within each brand . least squares mean values and their corresponding 95% confidence intervals were estimated for each brand , location and pigment combination . results from the sem image analyses were used to determine the appropriate pair - wise comparisons between lens brands . pair - wise comparisons were made for each lens brand for pigment versus no pigment on the lens surfaces . in this study , since the analysis was completed on the log - scale , the afm estimates and their interval bounds were exponentiated to provide model - based estimates on the original , untransformed scale . since multiple comparisons were considered , a simulation adjustment for alpha was completed to control the cc , dm2 , eco and tc lenses were found to have pigments on the back surface ( concave side ) of the contact lens , while the pigments for nat and flc were found on the front surface ( convex side ) of the contact lens . the pigment particles were visible on the lens surface in top - down / bottom - up views , as well as in cross - sectional view appearing to extend from an average depth of 1.3 m to 3.5 m up to and including the lens surface for a depth range of 0.0 to 4.3m . the pigment particles for the 1dad were buried below the front surface of the lens at an average depth of 8.1 m with a range of 7.6 to 9.1 m ( table 2 ) . depth range for pigments from the lens surface when imaged by scanning electron microscope ( sem ) for each lens type 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable figures 1 7 show the cross - sectional depths at 2,000 magnification for each of the lens types . the images show no pigment particles on the top of the 1dad lenses , while a particle layer is on the surface of all other lenses tested . these results were used to determine the statistical comparisons to be completed for the afm findings ( surface pigmented lenses versus non - surface pigmented lenses ) . cross - sectional view at 2,000 magnification showing pigment enclosed within the lens matrix ( lm ) below the front lens surface ( a ) and an image of the lens front surface at 500 magnification showing no pigment particles ( b ) . 1dad : 1-day acuvue define . scanning electron microscopic ( sem ) images of cc . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the front surface ( fs ) of the lens ( a ) and an image of the lens front surface at 2,000 magnification showing visible pigment particles ( b ) . flc : freshlook one - day color . scanning electron microscopic ( sem ) images of nat . cross - sectional view at 2,000 magnification showing pigment on the front surface ( fs ) of the lens ( a ) and an image of the lens front surface at 2,000 magnification showing visible pigment particles ( b ) . the results of the afm analysis indicated that 1dad lenses had a statistically significantly lower rms value in the pigmented area than cc , dm2 , eco , tc , flc and nat contact lenses . table 3 displays the measures for each lens type by curve / print aspect combinations . table 4 and figure 8 summarise the statistical findings and graphically show the mean roughness values for each lens type in the different lens areas . figure 9 shows representative afm images of the pigmented areas for each lens type . atomic force microscopic average and range sd ( and range ) for root mean square ( rms ) and peak - to - peak values for the front and back surfaces , pigmented and non - pigmented areas 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . average root mean square ( rms ) roughness values determined by atomic force microscopy on the non - pigmented area of the front lens surface ( non - pig fs ) and back lens surface ( non - pig bs ) as well as the pigmented area of the front ( pig fs ) and back lens surfaces ( pig bs ) . pigment location was determined by scanning electron microscopy ( np : no pigment on the lens surface , bs : back surface pigment , fs : front surface pigment ) . 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . atomic force microscopic images of pigmented areas for 1dad ( a ) , tc ( b ) , cc ( c ) , dm2 ( d ) , eco ( e ) , nat ( f ) , and flc ( g ) . 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . statistical analysis of atomic force microscopy root mean square ( rms ) values for lenses found to have surface pigment versus the lens with pigments enclosed within the lens matrix 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . p - values are all versus 1dad additionally , 1dad lenses had roughness values that were more consistent between the pigmented and non - pigmented areas compared to the other lens types measured . rms roughness values for 1dad ranged from three to 18 nm , while rms values for the other lens tested ranged from two to 188 nm . cc , dm2 , eco and tc lenses were found to have pigments on the back surface ( concave side ) of the contact lens , while the pigments for nat and flc were found on the front surface ( convex side ) of the contact lens . the pigment particles were visible on the lens surface in top - down / bottom - up views , as well as in cross - sectional view appearing to extend from an average depth of 1.3 m to 3.5 m up to and including the lens surface for a depth range of 0.0 to 4.3m . the pigment particles for the 1dad were buried below the front surface of the lens at an average depth of 8.1 m with a range of 7.6 to 9.1 m ( table 2 ) . depth range for pigments from the lens surface when imaged by scanning electron microscope ( sem ) for each lens type 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable figures 1 7 show the cross - sectional depths at 2,000 magnification for each of the lens types . the images show no pigment particles on the top of the 1dad lenses , while a particle layer is on the surface of all other lenses tested . these results were used to determine the statistical comparisons to be completed for the afm findings ( surface pigmented lenses versus non - surface pigmented lenses ) . cross - sectional view at 2,000 magnification showing pigment enclosed within the lens matrix ( lm ) below the front lens surface ( a ) and an image of the lens front surface at 500 magnification showing no pigment particles ( b ) . 1dad : 1-day acuvue define . scanning electron microscopic ( sem ) images of cc . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the back surface ( bs ) of the lens ( a ) and an image of the lens back surface at 2,000 magnification showing visible pigment particles ( b ) . cross - sectional view at 2,000 magnification showing pigment on the front surface ( fs ) of the lens ( a ) and an image of the lens front surface at 2,000 magnification showing visible pigment particles ( b ) . flc : freshlook one - day color . scanning electron microscopic ( sem ) images of nat . cross - sectional view at 2,000 magnification showing pigment on the front surface ( fs ) of the lens ( a ) and an image of the lens front surface at 2,000 magnification showing visible pigment particles ( b ) . the results of the afm analysis indicated that 1dad lenses had a statistically significantly lower rms value in the pigmented area than cc , dm2 , eco , tc , flc and nat contact lenses . table 3 displays the measures for each lens type by curve / print aspect combinations . table 4 and figure 8 summarise the statistical findings and graphically show the mean roughness values for each lens type in the different lens areas . figure 9 shows representative afm images of the pigmented areas for each lens type . atomic force microscopic average and range sd ( and range ) for root mean square ( rms ) and peak - to - peak values for the front and back surfaces , pigmented and non - pigmented areas 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . average root mean square ( rms ) roughness values determined by atomic force microscopy on the non - pigmented area of the front lens surface ( non - pig fs ) and back lens surface ( non - pig bs ) as well as the pigmented area of the front ( pig fs ) and back lens surfaces ( pig bs ) . pigment location was determined by scanning electron microscopy ( np : no pigment on the lens surface , bs : back surface pigment , fs : front surface pigment ) . 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . atomic force microscopic images of pigmented areas for 1dad ( a ) , tc ( b ) , cc ( c ) , dm2 ( d ) , eco ( e ) , nat ( f ) , and flc ( g ) . 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . statistical analysis of atomic force microscopy root mean square ( rms ) values for lenses found to have surface pigment versus the lens with pigments enclosed within the lens matrix 1dad : 1-day acuvue define , cc : camax color , dm2 : one - day delight max 2 , eco : eye coffret , tc : ticon cosmetic ring black , flc : freshlook one - day color , nat : naturelle daily disposable . p - values are all versus 1dad additionally , 1dad lenses had roughness values that were more consistent between the pigmented and non - pigmented areas compared to the other lens types measured . rms roughness values for 1dad ranged from three to 18 nm , while rms values for the other lens tested ranged from two to 188 nm . the sem imaging results showed , both at the lens surface and throughout the depth of the lens , that the limbal ring pigment used for 1dad was enclosed within the lens matrix , and therefore would not be in direct contact with the ocular surface when worn . for the other lens types evaluated , each lens was found to have pigment at the surface level , some on the front surface and some on the back . the differences in pigment location are likely to be due to differences in the manufacturing processes . the testing methodology used for this analysis with afm measured the samples from similar locations , which resulted in a consistent comparison among the lenses tested . afm analysis showed 1dad lenses had lower roughness values ( that is , a smoother surface ) than the other limbal ring lenses tested within the pigmented area of the lens . additionally , 1dad had a more consistent roughness profile regardless of the curvature or pigmented side than any of the other limbal ring contact lenses tested . differences in surface roughness between the pigmented and non - pigmented areas are likely the result of pigment location ( due to the fact that this can be visualised at a low magnification ) but surface roughness of the non - pigmented areas can be related to manufacturing methods as well as material properties of the bulk material.22,23 although there are no thresholds of acceptable or non - acceptable rms roughness for contact lenses , values in the range of one to 11 nm for cast - moulded contact lenses can be considered normal and smooth . biomaterials research evaluating the effect of surface roughness and surface wettability on bacterial attachment to glass has suggested even nanoscale levels of roughness can impact bacterial adherence . mitik - dineva and colleagues23 found changes in surface wettability had no impact on bacterial attachment but the roughness of the material was found to play a role . although mitik - dineva and colleagues conducted their research using glass plates , later work published by giraldez and yebra - pimentel11 would suggest surface roughness is also a factor for bacterial adhesion with contact lenses . additional research is needed to determine to what effect pigment on the surface of a contact lens may have on product performance , including the adhesion of bacteria and the levels of bacteria that may be considered to be clinically relevant . it is important for eye - care providers to understand potential differences between limbal ring contact lenses , when determining what to prescribe for their patients , beyond the consumer - desired eye - enhancement effects . with the growing market and consumer interest in limbal ring lenses , pigment location and surface roughness although there has been some recent research reporting potential clinical implications with limbal ring contact lenses that have pigment on the surface of the lens , the clinical effects of pigment location of these lenses needs to be evaluated further .

backgroundlimbal ring ( also known as circle ) contact lenses are becoming increasingly popular , especially in asian markets because of their eye - enhancing effects . the pigment particles that give the eye - enhancing effects of these lenses can be found on the front or back surface of the contact lens or enclosed within the lens matrix . the purpose of this research was to evaluate the pigment location and surface roughness of seven types of circle contact lenses.methodsscanning electron microscopic ( sem ) analysis was performed using a variable pressure hitachi s3400n instrument to discern the placement of lens pigments . atomic force microscopy ( dimension icon afm from bruker nano ) was used to determine the surface roughness of the pigmented regions of the contact lenses . atomic force microscopic analysis was performed in fluid phase under contact mode using a sharp nitride lever probe ( snl-10 ) with a spring constant of 0.06 n / m . root mean square ( rms ) roughness values were analysed using a generalised linear mixed model with a log - normal distribution . least square means and their corresponding 95% confidence intervals were estimated for each brand , location and pigment combination.resultssem cross - sectional images at 500 and 2,000 magnification showed pigment on the surface of six of the seven lens types tested . the mean depth of pigment for 1-day acuvue define ( 1dad ) lenses was 8.1 m below the surface of the lens , while the remaining lens types tested had pigment particles on the front or back surface . results of the atomic force microscopic analysis indicated that 1dad lenses had significantly lower root mean square roughness values in the pigmented area of the lens than the other lens types tested.conclusionssem and afm analysis revealed pigment on the surface of the lens for all types tested with the exception of 1dad . further research is required to determine if the difference in pigment location influences on - eye performance .

Methods SEM image analysis AFM image analysis Results SEM AFM Discussion

patient informed consent was not required for this retrospective analysis , though radiological examination - related informed consents were obtained from all patients before pet / ct and ct were performed . the inclusion criteria for this study were as follows : 1 ) pathologically confirmed malignant tumor in the periorbital region - we defined the periorbital region as the upper and lower eyelid and their appendages , in addition to the lacrimal glands , 2 ) both pet / ct and ct performed in each patient , with the interval between the two studies being less than one month . based on these criteria , 15 cases of periorbital malignant tumors were retrieved from the samsung medical center orbital cancer data registry for the period spanning 1996 to 2007 . the eyelid was the most commonly involved primary tumor site ( 11 cases , 73.3% ) ; other sites of involvement included the conjunctiva and lacrimal gland . pathological diagnoses included six sebaceous carcinomas ( 40.4% ) , four malignant melanomas ( 26.6% ) , two adenocarcinomas ( 13.3% ) , two adenoid cystic carcinomas ( 13.3% ) , and one squamous cell carcinoma ( 6.8% ) . surgical treatment alone was performed in 11 cases ( 73.4% ) , surgery with adjuvant radiotherapy in two cases ( 13.3% ) , and radiotherapy alone in two cases ( 13.3% ) . the median follow - up duration was 17.9 months ( range 3 - 52 months ) . eleven patients ( 73.4% ) have survived without evidence of disease , whereas two patients are still alive with disease , and two patients have died of disease . a total of 18 pet / ct and ct scans were performed in 15 cases . most of the scans were performed during the follow - up period ( 12 scans , 66.7% ) , and in some cases ( 6 scans , 33.3% ) , the scans were done as part of the initial diagnostic work - up . the reference standards for pet / ct and ct were surgical pathology ( n = 7 ) from dissected lymph node specimens and data from radiological follow - up ( n = 11 , duration 10 - 52 months , mean 20.5 months ) . radiological follow - up included two or more subsequent imaging studies ( ct , mri , or bone scans ) for suspected lesions during the follow - up period . ct scans ( lightspeed ultra or ultra 16 , ge , milwaukee , wi ) were performed using the following parameters : 160 mas , 120 kev , section width of 3.75 mm , and table feed of 8.75 mm per rotation . for contrast enhancement , 90 ml of an iodinated contrast agent ( ultravist 300 , schering , berlin ) was injected intravenously at 3 ml / sec using an automated injector . as for pet / ct scans , all patients fasted for at least six hours prior to the examinations , which were performed using a discovery ls pet / ct scanner ( ge healthcare , milwaukee , wi ) . whole body ct scanning was performed using a continuous spiral technique with an 8-slice helical ct with a gantry rotation speed of 0.8 sec . the ct scan data were collected using the following parameters : 80 mas , 140 kev , section width of 5 mm , and table feed of 5 mm per rotation . no intravenous or oral contrast agents were used . following the ct scan , and after the intravenous injection of 370 mbq f - fdg , an emission scan was performed from the thigh to the head at 5 minutes per frame , for a total of 45 minutes . the attenuation - corrected f - fdg pet images from the ct data were reconstructed with an ordered subset expectation maximization algorithm ( 28 subsets , 2 iterations ) . the images were displayed in a 128128 matrix ( pixel size = 4.294.29 mm , with a slice thickness of 4.25 mm ) . the separate ct and pet scan data were accurately co - registered using commercial software ( entegra , elgems , haifa , israel ) . the standardized uptake values ( suvs ) were acquired using the attenuation - corrected images , the amount of injected f - fdg , the body weight of each patient , and the cross - calibration factors between the f - fdg pet and the dose calibrator . for analysis , regional lymph nodes were divided into lymph node levels ( intra - parotid and peri - parotid lymph node groups , levels i , iia , iib , iii ) based on the ajcc staging manual ( 6th edition , 2002 ) . the peri - parotid lymph node group was defined to encompass the pre - auricular lymph nodes and the infra - parotid lymph nodes . pathological data were available in 23 dissected node levels , and radiological follow - up examination was used in 20 node levels . as a result , a total of 43 node levels were assessed with ct and pet / ct scans in the present study . a radiologist specializing in head and neck imaging reviewed the ct scans , and a nuclear medicine physician reviewed the pet / ct scans . the criteria for abnormal lymph nodes on ct included spherical or conglomerated shape , enlarged size ( > 1.5 cm at levels i and ii , > 1 cm at level iii ) , or enhancement pattern of contrast media . regarding the pet / ct scans , the nuclear medicine physician first reviewed the images to evaluate for any abnormal fdg uptake in the salivary glands and neck nodes by using the maximal uptake values with intensity higher than that of surrounding tissues . the interpretation was then revised based on the anatomical information provided by the combined pet / ct images . treatment planning was addressed in the multidisciplinary head and neck tumor conference along with the results of imaging studies . to compare the diagnostic accuracy of both imaging studies for regional metastasis , pathological data in the cases of surgery ( n = 7 ) or the follow - up results of radiological evaluation ( n = 11 ) were used as a reference standard . image findings were confirmed by radiological follow - up alone for eleven scans , with a mean follow - up duration of 20.5 months ( range 10 - 52 months ) . we compared the sensitivity ( sn ) , specificity ( sp ) , positive predictive value ( ppv ) , negative predictive value ( npv ) , and diagnostic accuracy ( da ) in predicting regional lymph node metastasis on level - by - level analysis and n staging . statistical differences between the imaging modalities were analyzed employing the mcnemar test , and 95% confidence levels were determined using wilson 's method . the impact of pet / ct on patient care was also assessed with regard to changes in the extent of surgery or in treatment planning . patient informed consent was not required for this retrospective analysis , though radiological examination - related informed consents were obtained from all patients before pet / ct and ct were performed . the inclusion criteria for this study were as follows : 1 ) pathologically confirmed malignant tumor in the periorbital region - we defined the periorbital region as the upper and lower eyelid and their appendages , in addition to the lacrimal glands , 2 ) both pet / ct and ct performed in each patient , with the interval between the two studies being less than one month . based on these criteria , 15 cases of periorbital malignant tumors were retrieved from the samsung medical center orbital cancer data registry for the period spanning 1996 to 2007 . the eyelid was the most commonly involved primary tumor site ( 11 cases , 73.3% ) ; other sites of involvement included the conjunctiva and lacrimal gland . pathological diagnoses included six sebaceous carcinomas ( 40.4% ) , four malignant melanomas ( 26.6% ) , two adenocarcinomas ( 13.3% ) , two adenoid cystic carcinomas ( 13.3% ) , and one squamous cell carcinoma ( 6.8% ) . surgical treatment alone was performed in 11 cases ( 73.4% ) , surgery with adjuvant radiotherapy in two cases ( 13.3% ) , and radiotherapy alone in two cases ( 13.3% ) . the median follow - up duration was 17.9 months ( range 3 - 52 months ) . eleven patients ( 73.4% ) have survived without evidence of disease , whereas two patients are still alive with disease , and two patients have died of disease . a total of 18 pet / ct and ct scans were performed in 15 cases . most of the scans were performed during the follow - up period ( 12 scans , 66.7% ) , and in some cases ( 6 scans , 33.3% ) , the scans were done as part of the initial diagnostic work - up . the reference standards for pet / ct and ct were surgical pathology ( n = 7 ) from dissected lymph node specimens and data from radiological follow - up ( n = 11 , duration 10 - 52 months , mean 20.5 months ) . radiological follow - up included two or more subsequent imaging studies ( ct , mri , or bone scans ) for suspected lesions during the follow - up period . ct scans ( lightspeed ultra or ultra 16 , ge , milwaukee , wi ) were performed using the following parameters : 160 mas , 120 kev , section width of 3.75 mm , and table feed of 8.75 mm per rotation . for contrast enhancement , 90 ml of an iodinated contrast agent ( ultravist 300 , schering , berlin ) was injected intravenously at 3 ml / sec using an automated injector . as for pet / ct scans , all patients fasted for at least six hours prior to the examinations , which were performed using a discovery ls pet / ct scanner ( ge healthcare , milwaukee , wi ) . whole body ct scanning was performed using a continuous spiral technique with an 8-slice helical ct with a gantry rotation speed of 0.8 sec . the ct scan data were collected using the following parameters : 80 mas , 140 kev , section width of 5 mm , and table feed of 5 mm per rotation . no intravenous or oral contrast agents were used . following the ct scan , and after the intravenous injection of 370 mbq f - fdg , an emission scan was performed from the thigh to the head at 5 minutes per frame , for a total of 45 minutes . the attenuation - corrected f - fdg pet images from the ct data were reconstructed with an ordered subset expectation maximization algorithm ( 28 subsets , 2 iterations ) . the images were displayed in a 128128 matrix ( pixel size = 4.294.29 mm , with a slice thickness of 4.25 mm ) . the separate ct and pet scan data were accurately co - registered using commercial software ( entegra , elgems , haifa , israel ) . the standardized uptake values ( suvs ) were acquired using the attenuation - corrected images , the amount of injected f - fdg , the body weight of each patient , and the cross - calibration factors between the f - fdg pet and the dose calibrator . for analysis , regional lymph nodes were divided into lymph node levels ( intra - parotid and peri - parotid lymph node groups , levels i , iia , iib , iii ) based on the ajcc staging manual ( 6th edition , 2002 ) . the peri - parotid lymph node group was defined to encompass the pre - auricular lymph nodes and the infra - parotid lymph nodes . pathological data were available in 23 dissected node levels , and radiological follow - up examination was used in 20 node levels . as a result , a total of 43 node levels were assessed with ct and pet / ct scans in the present study . a radiologist specializing in head and neck imaging reviewed the ct scans , and a nuclear medicine physician reviewed the pet / ct scans . the criteria for abnormal lymph nodes on ct included spherical or conglomerated shape , enlarged size ( > 1.5 cm at levels i and ii , > 1 cm at level iii ) , or enhancement pattern of contrast media . regarding the pet / ct scans , the nuclear medicine physician first reviewed the images to evaluate for any abnormal fdg uptake in the salivary glands and neck nodes by using the maximal uptake values with intensity higher than that of surrounding tissues . the interpretation was then revised based on the anatomical information provided by the combined pet / ct images . treatment planning was addressed in the multidisciplinary head and neck tumor conference along with the results of imaging studies . to compare the diagnostic accuracy of both imaging studies for regional metastasis , pathological data in the cases of surgery ( n = 7 ) or the follow - up results of radiological evaluation ( n = 11 ) were used as a reference standard . image findings were confirmed by radiological follow - up alone for eleven scans , with a mean follow - up duration of 20.5 months ( range 10 - 52 months ) . we compared the sensitivity ( sn ) , specificity ( sp ) , positive predictive value ( ppv ) , negative predictive value ( npv ) , and diagnostic accuracy ( da ) in predicting regional lymph node metastasis on level - by - level analysis and n staging . statistical differences between the imaging modalities were analyzed employing the mcnemar test , and 95% confidence levels were determined using wilson 's method . the impact of pet / ct on patient care was also assessed with regard to changes in the extent of surgery or in treatment planning . primary tumor evaluation information was only available in five of 18 scans ; the tumors were diagnosed correctly using pet / ct scans for the initial work - up in four cases and in one recurrent case . suvs in the primary tumors ranged from 2.9 to 7.5 ( median 4 ) . in our series , the maximum suv ranged from 2.2 to 8.1 ( mean 5.3 ) for lymph node metastases from sebaceous carcinoma , and from 2.0 to 38.7 from malignant melanoma . one patient with adenocarcinoma lymphatic metastasis showed fdg uptake in lymph nodes with maximum suv = 18.7 . on the lymph node level - by - level analysis , a total of 43 node levels were assessed with ct and pet / ct ( table 2 ) . there were 14 malignant node levels , with seven intra - parotid lymph nodes , three peri - parotid lymph nodes , one level i lymph node group , and three level iia lymph node groups . interestingly , metastasis to the cervical node levels ( i , ii , iii ) was always coincident with metastasis to peri- or intra - parotid nodes . ct had an sn of 57% , sp of 97% , ppv of 89% , npv of 82% , and da of 84% . for pet / ct , corresponding values were 100% , 97% , 93% , 100% , and 98% , respectively . of note , the difference in the sensitivity value between ct and pet / ct was statistically significant , with a p value of 0.03 . in the prediction of n staging according to the ajcc staging manual ( 6th edition , 2002 ) , pet / ct showed 100% accuracy ( 95% confidence interval : 82.4 - 100% ) , while ct showed 83% accuracy ( 95% confidence interval : 60.7 - 94.1% , p = 0.01 ) . the extent of the surgical field for regional lymph nodes was changed in the case of three pet / ct scans ( 3/18 , 16.6% ) . in two of the three cases , intra - parotid metastatic lymph nodes were detected on pet / ct , but not on ct . a 65-year - old male patient underwent eyelid and orbit exenteration secondary to biopsy - proven sebaceous carcinoma in the upper eyelid extending to the levator muscle and bulbar conjunctiva . after 16 months , a small node was detected in the ipsilateral parotid area during a follow - up visit . contrast - enhanced ct scan showed no abnormal mass lesion in the parotid area ( fig . pet / ct revealed a high glucose uptake lesion with an suv of 4.7 at the same site ; lymph node metastasis was strongly suspected . a parotidectomy was performed , and metastatic sebaceous carcinoma was diagnosed in an intra - parotid lymph node . another 67-year - old female patient was suspected of having recurrent sebaceous carcinoma in the parotid area . intra - parotid and peri - parotid metastatic lymph nodes were equally detected on ct and pet / ct , but the level ii lymph node was diagnosed as containing malignancy only on pet / ct . as a result , the surgical extent was expanded into the level ii area ; a metastatic lymph node was demonstrated pathologically . another 56-year - old male patient who had undergone orbital exenteration for sebaceous carcinoma in the upper eyelid was suspected of having regional recurrence in the ipsilateral parotid area ( fig . a 0.8 cm sized lymph node was detected just behind the angle of the mandible , but the contrast enhancement was not definite , and the lymph node maintained an oval shape , so a radiologist diagnosed it as an insignificant lymph node . however , pet / ct showed an asymmetrical lesion with an suv of 2.2 , suggesting metastasis . as a result , the extent of surgery was changed to include the above lymph node group , which proved to have metastasis on pathology . three patients in this study had distant metastases that were first detected by pet / ct . the pathology of the primary tumors included an adenocarcinoma in the upper eyelid , a melanoma in the conjunctiva , and an adenoid cystic carcinoma in the upper eyelid . pet / ct during the follow - up period detected distant metastases in the brain , pancreas , liver , stomach , or cervical spine , so treatment plans were changed to palliative care , including palliative chemotherapy or radiotherapy . in one case ( case no . 1 in table 1 ) , a malignant lymph node was suspected in the peri - parotid region on ct , contradictory to the pet / ct findings , which suggested a benign lymph node . surgical treatment was withheld until after confirmation using fine needle aspiration biopsy , and the patient still shows no evidence of disease in that area after 18 months of follow - up . as shown in table 3 , pet / ct affected treatment by correctly modifying the surgical extent or treatment decision in seven cases ( 38.8% ) . primary tumor evaluation information was only available in five of 18 scans ; the tumors were diagnosed correctly using pet / ct scans for the initial work - up in four cases and in one recurrent case . suvs in the primary tumors ranged from 2.9 to 7.5 ( median 4 ) . in our series , the maximum suv ranged from 2.2 to 8.1 ( mean 5.3 ) for lymph node metastases from sebaceous carcinoma , and from 2.0 to 38.7 from malignant melanoma . one patient with adenocarcinoma lymphatic metastasis showed fdg uptake in lymph nodes with maximum suv = 18.7 . on the lymph node level - by - level analysis , a total of 43 node levels were assessed with ct and pet / ct ( table 2 ) . there were 14 malignant node levels , with seven intra - parotid lymph nodes , three peri - parotid lymph nodes , one level i lymph node group , and three level iia lymph node groups . interestingly , metastasis to the cervical node levels ( i , ii , iii ) was always coincident with metastasis to peri- or intra - parotid nodes . ct had an sn of 57% , sp of 97% , ppv of 89% , npv of 82% , and da of 84% . for pet / ct , corresponding values were 100% , 97% , 93% , 100% , and 98% , respectively . of note , the difference in the sensitivity value between ct and pet / ct was statistically significant , with a p value of 0.03 . in the prediction of n staging according to the ajcc staging manual ( 6th edition , 2002 ) , pet / ct showed 100% accuracy ( 95% confidence interval : 82.4 - 100% ) , while ct showed 83% accuracy ( 95% confidence interval : 60.7 - 94.1% , p = 0.01 ) . the extent of the surgical field for regional lymph nodes was changed in the case of three pet / ct scans ( 3/18 , 16.6% ) . in two of the three cases , intra - parotid metastatic lymph nodes were detected on pet / ct , but not on ct . a 65-year - old male patient underwent eyelid and orbit exenteration secondary to biopsy - proven sebaceous carcinoma in the upper eyelid extending to the levator muscle and bulbar conjunctiva . after 16 months , a small node was detected in the ipsilateral parotid area during a follow - up visit . contrast - enhanced ct scan showed no abnormal mass lesion in the parotid area ( fig . pet / ct revealed a high glucose uptake lesion with an suv of 4.7 at the same site ; lymph node metastasis was strongly suspected . a parotidectomy was performed , and metastatic sebaceous carcinoma was diagnosed in an intra - parotid lymph node . another 67-year - old female patient was suspected of having recurrent sebaceous carcinoma in the parotid area . intra - parotid and peri - parotid metastatic lymph nodes were equally detected on ct and pet / ct , but the level ii lymph node was diagnosed as containing malignancy only on pet / ct . as a result , the surgical extent was expanded into the level ii area ; a metastatic lymph node was demonstrated pathologically . another 56-year - old male patient who had undergone orbital exenteration for sebaceous carcinoma in the upper eyelid was suspected of having regional recurrence in the ipsilateral parotid area ( fig . a 0.8 cm sized lymph node was detected just behind the angle of the mandible , but the contrast enhancement was not definite , and the lymph node maintained an oval shape , so a radiologist diagnosed it as an insignificant lymph node . however , pet / ct showed an asymmetrical lesion with an suv of 2.2 , suggesting metastasis . as a result , the extent of surgery was changed to include the above lymph node group , which proved to have metastasis on pathology . three patients in this study had distant metastases that were first detected by pet / ct . the pathology of the primary tumors included an adenocarcinoma in the upper eyelid , a melanoma in the conjunctiva , and an adenoid cystic carcinoma in the upper eyelid . pet / ct during the follow - up period detected distant metastases in the brain , pancreas , liver , stomach , or cervical spine , so treatment plans were changed to palliative care , including palliative chemotherapy or radiotherapy . in one case ( case no . 1 in table 1 ) , a malignant lymph node was suspected in the peri - parotid region on ct , contradictory to the pet / ct findings , which suggested a benign lymph node . surgical treatment was withheld until after confirmation using fine needle aspiration biopsy , and the patient still shows no evidence of disease in that area after 18 months of follow - up . as shown in table 3 , pet / ct affected treatment by correctly modifying the surgical extent or treatment decision in seven cases ( 38.8% ) . basal cell carcinoma and squamous cell carcinoma are the most common malignancies arising in the periorbital region , with malignant melanoma and sebaceous carcinoma occurring less frequently ( 2 ) . as in most solid tumors , regional metastases from periorbital malignancies spread through the lymphatic system , so careful evaluation of the regional lymph nodes is important . in this study , we included the three conjunctival melanomas for analysis , because they showed frequent metastasis to regional lymph nodes and distant sites , similar to other periorbital cancers . in a previous case study ( 6 ) , our group observed no direct tumor drainage to the submandibular lymph nodes - even from primary tumors located on the medial portion of the eyelid - without initial metastasis to the lymph nodes around the parotid gland ( first echelon lymph node ) ; this is concordant with the results of the present study . ct , with its high sensitivity ( 93% ) ( 17 ) , has been the mainstay imaging modality for diagnosing periorbital malignancies . however , the sensitivity of ct in the present study was as low as 57% . this is attributable to false negative lesions at peri - parotid and intra - parotid sites . some of these lesions were interpreted as inflammatory hyperplasia or infected cysts due to the absence of distinct features of malignant parotid tumors , such as lobular or irregular contour of the mass or ill - defined tumor margin . according to recent reports ( 18 , 19 ) , the higher sensitivity and diagnostic accuracy of pet / ct endows it with many advantages over ct alone in managing malignancies around the salivary gland , especially high - grade types . the present study also showed that pet / ct was effective in detecting lymphatic spread to the parotid region and cervical nodes in the setting of periorbital malignancies . among the 15 subjects enrolled in this study , seven had true regional lymph node metastasis ( 46.7% ) . the duration between the treatment of the primary tumor and the detection of regional recurrence ranged from 11 months to 240 months . on standard follow - up , the metastatic sites were diverse , including brain , cervical spine , pancreas , and lung . distant metastasis was detected in the cervical spine in one patient using pet / ct as an initial evaluation , and palliative treatment instead of curative surgery was implemented as a result . the higher sensitivity of pet / ct vindicated it as a useful screening method in the evaluation of regional lymph node metastasis , particularly in the follow - up setting . pet / ct had a higher npv ( 100% ) than did ct alone ( 82.4% ) , although this difference was not statistically significant . prediction of n stage was also more reliable with pet / ct than with ct alone . therefore , pet / ct can provide more accurate information about prognosis through revision of n staging of periorbital malignancies . in practice , how much diagnostic methods affect treatment decision - making is of great concern for clinicians . in this study , pet / ct had a positive impact on patient care by correctly modifying the treatment plan in approximately 40% of the patients . errors in interpretation of abnormal lymph node fdg uptake may be instigated in cases of larygopharyngeal inflammation . first , asymmetrical abnormal lymph node uptake strongly suggests metastasis , because inflammation frequently causes bilateral fdg uptake . malignant tumors in the periorbital area have lymph nodes around the parotid area as the first - echelon nodal group ( 6 ) . thus , without abnormal uptake in the lymph nodes around the parotid area , the increase of fdg uptake in the upper cervical lymph nodes , which commonly occurs in laryngo - pharyngitis , may be demarcated from the lymph node metastasis of periorbital malignancy . in addition , an suv of 2.0 in lymph nodes can be used as a cut - off value in determining the presence of metastasis , based on our results . first , this was a retrospective analysis with a small number of cases . prospective study with a larger number of cases is needed to fully assess the role of pet / ct in the management of lymph node metastasis in the setting of periorbital malignancies . second , heterogeneity of the neoplasms in the present study prompted the question of the radiographic equivalence of different tumors on pet / ct . characteristics of fdg uptake may vary among different pathologies , and it would be premature to claim that pet / ct is equally effective in all periorbital malignancies . third , our data does not answer the question of when to perform pet / ct in the setting of periorbital malignancies , though our results showed that pet / ct provided more accurate information about nodal status when lymphatic metastases were suspected . nevertheless , this study showed that pet / ct could provide more accurate diagnostic information regarding lymph node status . furthermore , it was more reliable in predicting n staging in the setting of periorbital malignancies than was ct alone .

objectivethe aim of this study was to assess the clinical role of 18f - fdg pet / ct for the evaluation of lymph node metastasis in periorbital malignancies , compared with ct alone.materials and methodswe analyzed eighteen pet / ct and ct scans in 15 patients with biopsy - proven periorbital malignancies . we compared the diagnostic capabilities of pet / ct and ct with regard to nodal metastasis by level - by - level analysis and by n staging prediction . the reference standards were surgical pathology ( n = 7 ) from dissected lymph node specimens and the results from radiological follow - up ( n = 11 , mean 20.5 months ; range 10 - 52 months ) . moreover , any changes in patient care as prompted by pet / ct were recorded and compared with treatment planning for ct alone.resultspet/ct had a sensitivity of 100% , while ct had a sensitivity of 57% ( p = 0.03 ) for nodal metastasis by level - by - level analysis . pet / ct had a specificity of 97% , positive predictive value of 93% , negative predictive value of 100% , and diagnostic accuracy of 98% , while the ct values for these same parameters were 97% , 89% , 82% , and 84% , respectively . pet / ct correctly predicted n staging with an accuracy of 100% , while ct was only 83% accurate ( p = 0.01 ) . regarding the impact on patient care , the extent of surgery for regional lymph nodes and the treatment decision were modified by pet / ct in 39% of patients.conclusionpet/ct could provide useful information in the management of regional lymph node metastases in patients with periorbital malignancies .

MATERIALS AND METHODS Subjects Contrast-Enhanced CT and Data Analysis RESULTS Diagnostic Values for Regional Lymph Node Metastasis Impact of PET/CT on Patient Care DISCUSSION

extra - hepatic hepatoid carcinomas are a rare group of aggressive tumors with clinical and pathologic features that closely resemble hepatocellular carcinoma ( hcc ) . they may arise in many areas outside of the liver including lungs , bladder , kidneys , uterus and ovaries , but most commonly in the stomach ( young et al . hepatoid carcinoma of the ovary ( hco ) is reported mainly in post - menopausal women with unilateral or bilateral ovarian masses and elevated serum alpha - fetoprotein ( afp ) . microscopically , these tumors demonstrate cells arranged predominantly in sheets and contain moderate to abundant amount of eosinophilic cytoplasm with pleomorphic nuclei ( lefkowitch , 1988 ) . these tumors must be distinguished from metastatic hcc and other afp - producing ovarian tumors including hepatoid yolk sac tumors ( hysts ) , sertoli leydig cell tumors , and dysgerminomas ( matsuta et al . , 1991 ) . a 73 year - old gravida 3 , para 2 was initially referred to her hematologist for anemia that was diagnosed during a prior hospital admission for legionella pneumonia . studies were consistent with a diagnosis of anemia of chronic disease and physical examination revealed a sizeable pelvic mass . the patient reported 60 lb weight loss and transient postmenopausal bleeding over the last year . ct of the abdomen and pelvis demonstrated a large pelvic mass with cystic and necrotic components measuring at least 18 cm by 17 cm with an additional 7 cm mass along the anterior peritoneal surface . marked bladder compression and left - sided hydronephrosis were also present . surgical exploration revealed a large , lobulated , necrotic mass originating from the left ovary ( fig . the mass was densely adherent to the uterus and anterior abdominal wall , and had eroded into a portion of small bowel . optimal cytoreductive surgery was performed including a total abdominal hysterectomy , bilateral salpingo - oophorectomy , and partial small bowel resection with reanastamosis . once a final histologic diagnosis was made , serum afp was obtained and was markedly elevated at 2396 ng / ml ( normal range 09 ) seven weeks after optimal cytoreduction . ct of the abdomen and pelvis at this time demonstrated new growth of a 4.7 cm nodular mass in the right upper quadrant separate from the liver and a 5.1 cm mass in the left side of the pelvis . afp values rapidly decreased with initiation of chemotherapy ( 273 27 6 4 3 ) . the patient completed six cycles of carboplatin ( auc of 6 , every 3 weeks ) and dose - dense paclitaxel ( 80 mg / m , every week ) with appropriate dose reductions secondary to development of severe anemia and thrombocytopenia . she is currently doing well with no evidence of recurrence 26 months after surgery . pathologic exam showed a 24 16.5 13 cm lobulated mass with tumor present on the outer surface . cut section showed a tan yellow , solid and cystic tumor which completely replaced the left ovary and fallopian tube . microscopically , the tumor showed extensive patchy tumor necrosis with nests and sheets of polygonal cells , most with clear cytoplasm and some showing granular eosinophilic cytoplasm ( fig . numerous pas positive and alpha - fetoprotein ( afp ) positive hyaline globules were scattered through the tumor ( fig . the tumor did not display the sinusoidal vascular pattern sometimes seen in both hco and hepatocellular carcinoma . immunohistochemical studies were diffusely strong positive for afp , keratin ae1/ae3 , arginase , and sall-4 , focally strong positive for heppar1 ; focally positive for cea and inhibin , and plap showed rare positive cells . negative staining was observed for calretinin , ema , oct4 , ck 7 , ck 20 , cd 30 , cd99 , and cd117 . primary hepatoid carcinoma of the ovary is a rare tumor that now has been reported in the literature thirty - two times since it was initially characterized in 1987 by ishikura and scully . the age range for patients is 35 to 78 years old with an average age of 56 . the tumor was bilateral in seven ( 22% ) of the reported cases and more than 75% of patients presented with stage iii or iv disease . rapid progression is also characteristic with a one and a two year survival rate of 83% and 53% respectively . the patient presented here has one of the largest reported hco tumors to date measuring 25 cm in its greatest dimension ( table 1 ) . sall-4 is regarded as a marker for germ cell tumors and is negative in hcc , but has been found in hepatoid carcinomas from other sites ( ushiku et al . , 2010 ) . keratins ae1/ae3 were positive in this case , consistent with an epithelial origin for the tumor . however , ck 7 and ck 20 , keratins often found in ovarian surface epithelial tumors , were negative . hcc is also usually negative for ck7 and ck20 , which are sometimes used together to help identify carcinomas of unknown primary . previous reported hco cases varied when tested for ck7 and ck 20 : 4 were ck7 positive , ck20 negative ; three were ck7 negative , ck20 negative ; and one was ck7 negative , ck20 positive ( table 2 ) . this tumor 's unique pathologic appearance must be distinguished namely from hysts and metastatic hcc . hysts tend to occur in a younger age group ( average age of 22 years ) , exhibit gonadal dysgenesis , and possess cellular uniformity with a lack of the giant bizzare cells with abundant cytoplasm ( trivedi et al . , 1998 ) . hcc must be excluded clinically and radiographically , as there is not yet any consistent pattern of ancillary lab studies to effectively rule it out . additional studies will be required to see if sall-4 will be a useful differential marker for hcc versus hco . ishikura and scully initially believed the tumor variant to be of surface epithelial origin and this view is supported by four reported cases of combined hcos admixed with surface epithelial carcinomas- two serous , one mucinous , one endometrioid ( ishikura and scully , 1987 , scurry et al . . additional support for this relationship is offered by the fact that hcos and surface epithelial tumors tend to occur in the same age group . an afp - producing serous papillary carcinoma in a 74 year - old woman has also been reported , although no hepatoid differentiation was present . cancer antigen 125 ( ca 125 ) is a non - specific marker that is usually seen in the serum and tumor tissue of patients with serous and endometrioid carcinomas yet serum ca 125 was elevated in 17 of 20 ( 85% ) cases and staining was positive in 5 of 11 ( 45% ) of the reported hco cases . furthermore , the abdominal cavity implants were serous papillary carcinoma following chemoradiation in case 1 of ishikura and scully 's case series of hcos ( ishikura and scully , 1987 , scurry et al . , 1996 ) . the embryologic connection of the yolk sac to the primitive gut is the origin of the hepatobiliary primordium so it seems possible to have hepatoid cells in yolk sac tumors . however , it is counterintuitive to accept that surface coelomic epithelium behaves like liver when there is no obvious embryologic connection . an unlikely explanation would be surface coelomic tumors whose differentiation regressed back to germ cell origins that were then redirected toward hepatoid features ( lefkowitch , 1988 ) . only one case report to date has documented a hco admixed with a sex cord stromal tumor of sertoli - type ( d'antonio et al . , 2010 ) . the best approach to treatment of this aggressive variant most regimens reported in the literature are platinum and taxane based therapy similar to those recommended for common epithelial ovarian tumors . the patient we presented in this case responded very well to carboplatin and dose - dense paclitaxel . of the 6 patients that were treated with carboplatin and paclitaxel , 5 reported survival outcomes and none were deceased at time of case publication : 100% 1 year survival rate ( range 1328 months ) . in one report , second - line treatment with sorafenib was initiated given its success as a first - line medication in the treatment of hcc , which pathologically resembles hco . however , the tyrosine kinase inhibitor proved ineffective as afp levels increased and a new tumor metastasis was noted in the liver prior to discontinuation of the medication ( pandey and truica , 2011 ) . a few cases have included intraperitoneal chemotherapy and radiation as well , but there is insufficient data to effectively compare and recommend treatment options . neither the histogenesis nor a consistent immunohistochemical profile of hco has been established , however afp staining is consistently positive with only one reported exception . both afp and ca125 appear to have prognostic value and can be used to follow response to treatment and screen for recurrence . treatment regimens have varied , but optimal cytoreductive surgery followed by a platinum and taxane based chemotherapy regimen has demonstrated outcomes similar to that seen with other ovarian carcinomas .

primary hepatoid carcinoma of the ovary ( hco ) is a rare aggressive tumor that typically presents at an advanced stage in postmenopausal women with unilateral or bilateral ovarian masses and elevated afp and ca125 . we report a case of hco in a 73 year - old woman who presented with abdominal distention , weight loss , and a large lower abdominal mass . postoperative serum afp was markedly elevated and trended down with initiation of chemotherapy . review of the literature revealed thirty - two reported cases with no consensus on histogenesis or consistent immunohistochemical profile other than positive afp staining in all but one case . although the optimal treatment has not yet been determined , tumor debulking surgery followed by a platinum and taxane based chemotherapy regimen has shown promise . both serum afp and ca125 appear to have prognostic value and can be used to follow response to treatment and screen for recurrence .

Introduction Case presentation Pathology Discussion Conclusion

langerhans cell histiocytosis ( lch ) is a rare neoplastic disease of antigen - presenting cells , with an incidence rate of 4.05.4/1 million individuals . the most frequent sites of occurrence are skin , bone , central nervous system ( cns ) . computed tomography ( ct ) , magnetic resonance imaging ( mri ) , ultrasonic scan ( uss ) are mainly for the individual part , while multiple systems involvement need the whole body imaging . we present an unusual case of lch of the primary thyroid gland , which was confirmed by fine needle aspiration cytology . in addition to the thyroid gland , 18f - fluorodeoxyglucose ( 18f - fdg ) positron emission tomography ( pet)/ct discovered multiple organs involvement such as pituitary stalk , maxillofacial skin lesion , lungs , and skull . a 35-year - old man complained with painless progressive asymmetric enlargement of the bilateral thyroid lobes for a year . in the recent 3-month no hereditary syndromes , family history of cancer , and personal history were disclosed . there was no additional past medical or surgical history . blood tests revealed a normal full blood count , electrolytes , urea , creatinine , calcium , and phosphate levels . thyroid function tests reported a thyroid stimulating hormone level of 0.97 ( normal range 0.34.6 uiu / ml ) , free t4 of 21.78 ( normal range 6.624.8 pmol / l ) , thyroglobulin antibodies of 53.20 ( normal range < 30 u / ml ) , thyroid peroxidase antibody of 64.00 ( normal range 0.1610 iu / ml ) . in addition , serum calcitonin was recorded at < 1.0 ( normal range < 11.8 ng / l ) and urine catecholamine levels were within normal range . water pressure test revealed explicitly for central diabetes insipidus , and desmopressin acetate was given for 1-month . uss of the neck , conducted at the referring hospital , reported an enlarged ( 3.1 cm and 2.8 cm in diameter ) bilateral thyroid lobes [ figure 1 ] . subsequently , a needle biopsy from the thyroid mass revealed features of langerhans cell with the tumor cells staining positive for cd1a , s-100 , negative for cytokeratin [ figure 2 ] . 18fdg pet / ct was performed for further evaluation of lch in the whole body [ figure 4 ] . the maximum projection image of the pet revealed increased uptake in thyroid gland ( standardized uptake value [ suvmax ] = 9.4 ) [ figure 4a ] , pituitary stalk ( suvmax = 4.9 ) [ figure 4b ] , and maxillofacial skin lesion ( suvmax = 4.9 ) [ figure 4c ] , which corresponded well to bilateral thyroid nodule , the thicking of pituitary stalk , and skin lesion on the ct . however , ct showed the left lung nodule [ figure 4d ] and the skull destruction [ figure 4e ] without 18fdg uptake . ( a ) an ultrasonic scan ( uss ) of the neck , conducted at the referring hospital , reported multiple keyed acoustic area , basic clear boundary in both thyroid lobes [ b : 3.1 , and a : 2.8 cm in diameter ] . ( b ) an uss of the neck , conducted at the referring hospital , reported multiple keyed acoustic area , basic clear boundary in both thyroid lobes [ b : 3.1 and a : 2.8 cm in diameter ] ( a ) h and e staining [ a : h and e 100 ; b : h and e 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for cytokeratin ( ck ) [ f : 100 ] . ( b ) h and e staining [ a : h and e 100 ; b : h and e 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for ck [ f : 100 ] . ( c ) h and e staining [ a : h and e 100 ; b : h and e 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for ck [ f : 100 ] . ( d ) h and e staining [ a : h and e 100 ; b : h and e 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for ck [ f : 100 ] . ( e ) h and e staining [ a : h and e , 100 ; b : h and e , 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for ck [ f : 100 ] . ( f ) : h and e staining [ a : h and e 100 ; b : h and e 400 ] and immunostaining ( cd1a , langerin and s-100 ) of lesions from the thyroid gland lesions . the lesions from the thyroid gland exhibited positive expression patterns for cd1a [ c : 100 ] , langerin [ d : 100 ] and s-100 [ e : 100 ] , and negative for ck [ f : 100 ] ( a ) magnetic resonance imaging ( mri ) sections of the head revealing pituitary stalk enlargement . ( b ) mri sections of head revealing pituitary stalk enlargement ( a ) 18f - fluorodeoxyglucose positron emission tomography / computed tomography ( 18fdg pet / ct ) revealed increased uptake in the thyroid gland and maxillofacial skin , in addition to the left lung and skull . ( b ) 18fdg pet / ct revealed increased uptake in the thyroid gland and maxillofacial skin , in addition to the left lung and skull . ( c ) 18fdg pet / ct revealed increased uptake in the thyroid gland and maxillofacial skin , in addition to the left lung and skull . ( d ) 18fdg pet / ct revealed increased uptake in the thyroid gland and maxillofacial skin , in addition to the left lung and skull . ( e ) 18fdg pet / ct revealed increased uptake in the thyroid gland and maxillofacial skin , in addition to the left lung and skull langerhans cell histiocytosis is a type of histiocytic disorders , which was first reported in 1893 . the age of onset of lch from infant to adult and it frequently occur in childhood . final diagnosis of lch is made by histopathology and immunohistochemistry , and there are no specificities only depending on the clinical features or radiologic findings of lch . the radiologic imaging may provide some characteristics , such as punched - out lesion or beveled edge in skull , symmetric flattening of vertebral body , lytic lesion with sclerotic rim and surrounding areas of sclerosis more common in iliac bone , diaphyseal or metaphyseal of long bones involved in children . otherwise , approximately 70% of patients will also show thickening of the pituitary stalk on mr images . the mechanism of fdg uptake by malignant tissue or metastatic lesions is due to the enhanced rate of glucose utilization by neoplastic cells . lch as a type of histiocytic disorders , most of the lesions display a high level of fdg uptake . the lesions of lch can range from a single system involvement to a multisystem disease . it may present as a neoplasm , skin rash , lytic bone lesion , emphysematous bullae , interstitial lung disease or present with multiple affected organ systems within the human body . the most common clinical cns manifestation of lch is diabetes . in this case , the patient underwent a whole - body pet / ct , which was positive for suspicious lesions , pet revealed increased fdg uptake not only in thyroid nodule , but also in the pituitary stalk and maxillofacial skin . in the region of these areas , the intense fdg activity on pet corresponded well to ct and the fusion images . we also found that the left lung nodule has slighter metabolic ( suvmax 0.5 ) and the skull destruction even nonmetabolic in pet . it has been reported that pet may showed false - negative in some small bone lesions , such as skull and cerebrum involvement . hence , it was suggested that combined multiple analysis methods would improve sensitivity and specificity of the whole body lch . positron emission tomography / computed tomography is a useful tool to rule out the presence of other organ infiltration . as the intent by our case , it also provides a reference basis of classification , staging , treatment plan , and evaluation therapy effect . fdg pet / ct not only provides the characteristics of lesions in ct scan , but also finding the lesions activity fdg uptake . previous reports of lch in fdg pet / ct imaging mostly shows bone , lung , lymph node or skin invasion . few cases of the primary thyroid lch showed in fdg pet / ct have been reported . in the patient of this case , the thyroid involved lch was the first symptoms , and clinical considered as thyroid cancer . whole - body pet / ct was performed to evaluate the involvement of disease and make an individualized treatment plan after the biopsy pathology . fdg pet / ct showed bilateral involvement of multiple low - density nodules , the boundary of nodules are clear and some breakthrough thyroid capsule . fdg uptake was significantly increased in the nodules ; which were mostly higher than primary thyroid cancer in addition to low - differentiated cancer and medullary carcinoma . in ct , these nodules had rare calcification and the density mostly lower than primary thyroid cancer . however , to confirm all these characteristic performances , needs more patients data accumulation . in summary , we recommend the use of pet / ct as a meaningful noninvasive tool to evaluation scope of lch lesions involving .

langerhans cell histiocytosis ( lch ) is a rare clonal proliferative disease , with an incidence rate of 4.05.4/1 million individuals . lch encompasses a spectrum of disorders with diverse clinical presentations ranging from a single organ to multiple organ involvement . lch rarely involves the thyroid gland . we presented a case with lch of thyroid gland . the patient had painless progressive neck enlargement and then diabetes insipidus . ultrasonic scan and magnetic resonance imaging scan revealed nodular goiter and pituitary stalk enlargement , respectively . histopathological analysis revealed features of histiocytoid cells . 18f - fluorodeoxyglucose ( 18f - fdg ) positron emission tomography / computed tomography ( pet / ct ) was performed in order to rule out the presence of whole body infiltration . 18f - fdg pet / ct also demonstrated increased uptake in the thickening pituitary stalk and maxillofacial skin lesion , in addition to the bilateral thyroid nodules , ct showed the left lung nodule and the skull destruction without 18f - fdg uptake . this report emphasizes the role of 18f - fdg pet / ct in multiple organs involvement of patients with lch .

INTRODUCTION CASE REPORT DISCUSSION

major depressive disorder ( mdd ) is the most common mood disorder with a significant effect on the progression of medical conditions.1 factors accompanying depression , such as patients ' failure to look after their health , inability to adapt to their environment , social dissociation , chronic stresses of life , cigarette smoking , reduced physical activity , inappropriate nutrition and poor compliance with medical advice , make depression one of the risk factors of noncommunicable diseases.2 in addition to the effect of depression on lifestyle , the direct effect of depression on metabolic factors has been shown in many studies.3 recently , a relationship has been observed between depression and serum levels of lipoproteins and apolipoproteins ( apo ) , which are known risk factors of obesity and cardiovascular diseases.4 one theory of this relationship suggests a disturbance in function of the serotonergic system . in addition , metabolic changes in patients with mdd are due to genetic changes in the coding of serum lipoproteins.5 other theories describe changes in interleukin 2 , number of total tcells , melatonin and other cytokines in depressed patients.6 - 8 despite these studies , controversy exists about the relationship between depression and the lipid profile . studies have shown different results for the level of apo a one of the highdensity lipoprotein cholesterol ( hdlc ) subgroups , and of apo b the major protein of lowdensity lipoprotein cholesterol ( ldlc ) , in patients with mdd.4,9,10 sevincok and sarandol showed that the serum level of apo a in depressed patients was lower than that in control group.4,9 another study showed no significant difference in the serum levels of apolipoproteins between depressed patients and the control group.11 the lack of evidence and controversial results of previous studies led us design this study to compare the serum levels of apolipoproteins in depressed patients and normal individuals . a population of 153 patients with mdd ( 63 women , 90 men , aged 2147 years ) in 2007 were included in this case control study . all the patients were diagnosed with mdd according to the structured clinical interview ( scidi ) for diagnostic and statistical manual of mental disorders , fourth edition ( dsmiv ) . relatives of hospitalized patients and hospital university staff comprised the control group ( 78 women , 69 men , aged 1847 years ) . patients with an axis i or ii disorder in addition to their depression , patients with mdd with psychotic features , bipolar disorder , cyclothymia , dysthymia , anxiety disorder and patients at significant risk of suicide were excluded from the study via the structured clinical interview for dsmiv . exclusion criteria for both case and control groups included the presence of organic diseases such as hypertension , diabetes , cardiovascular , adrenal , hepatic and thyroid diseases documented by physical examination and laboratory tests ; history of antilipid and blocker consumption ; and menopause in women . laboratory tests , including complete blood count , serum electrolyte assay , liver function tests , thyroid function tests , urine analyses and electrocardiography , were performed for all participants to screen for major health problems . in addition , after explanation of the study , informed consent was obtained from all participants . the study protocol was approved by the ethical committee of the isfahan university of medical sciences . all participants completed a selfadministered questionnaire to determine demographic characteristics such as age , gender , socioeconomic status ( occupation , marital status and educational level ) , smoking status , drug history , family history of depression , physical activity and diet . subjects were considered to be current smokers if they reported smoking at least one cigarette a day during the past year . anthropometric characteristics ( height and weight ) were measured with the subjects wearing thin clothes . body mass index ( bmi ) was calculated by dividing a participant 's weight by their height squared ( kg / m ) . regular physical activity was defined as exercise of at least 15 minutes ' duration at least twice each week.13 participants provided details of their dietary habits by completing a food frequency questionnaire ( ffq).14 this instrument was designed according to the whoffq , with some changes . the validity of this questionnaire was confirmed before its use by the medical education development center affiliated to isfahan university of medical sciences.15 the ffq was used to access the consumption of different food groups such as meat , oils , cereals , vegetables and fruits . eligible participants also completed a 17item hamilton rating scale for depression ( hamd ) , which is the most commonly used observerrated depressive symptom rating scale . the original scale has 21 items but , as hamilton has suggested , only the initial 17 items were scored in this study because the last 4 items rarely occur and deal only with aspects of illness . items with quantifiable severity were ranked on a scale of 04 and those measuring symptoms that are difficult to assess reliably were ranked on a scale of 02 . the range of the 17item scale was 050 , with 14 considered to be the cutoff point of this scale ; higher scores indicated more severe depression . according to hamd , patients were classified into 3 groups of mild mdd ( score 1518 ) , moderate mdd ( score 1922 ) and severe mdd ( score 23).16,17 a blood sample was taken after 1214 hours ' fasting through the antecubital vein . all the blood sampling procedures were performed in the central laboratory of the isfahan cardiovascular research centre . serum triglyceride ( tg ) , total cholesterol ( tc ) , hdlc , ldlc and apo a and b were measured for each patient . tc and tg levels were measured within 24 h by an enzymatic method using an elan 2000 autoanalyze . ldlc was calculated by the friedewald formula,18 but in cases with tg400 mg / dl , it was measured directly . apo a and b were measured by immunoturbidimetry using pars azmoon kits accredited by bioactiva diagnostica ( germany ) . continuous variables were expressed as mean sd and a ttest was used to compare the means between the two groups . qualitative variables were expressed as frequency and a test used to compare frequencies between the two groups . a pearson correlation test was used to evaluate the correlation of depression with apo a and apo b. to study the association of depression and apo a and b ( apo a and b , separately ) , multiple linear regression models were used . apo a and b were entered as dependent variables , and the group ( case vs. control ) , smoking status ( smokers vs. nonsmokers ) , bmi , tc , ldlc and hdlc were entered as independent variables . the enter approach was selected for regression model , and for each apo a and b a unique model was created . data were analyzed by spss version 15.0 ( spss inc , chicago , illinois , usa ) . patients with an axis i or ii disorder in addition to their depression , patients with mdd with psychotic features , bipolar disorder , cyclothymia , dysthymia , anxiety disorder and patients at significant risk of suicide were excluded from the study via the structured clinical interview for dsmiv . exclusion criteria for both case and control groups included the presence of organic diseases such as hypertension , diabetes , cardiovascular , adrenal , hepatic and thyroid diseases documented by physical examination and laboratory tests ; history of antilipid and blocker consumption ; and menopause in women . laboratory tests , including complete blood count , serum electrolyte assay , liver function tests , thyroid function tests , urine analyses and electrocardiography , were performed for all participants to screen for major health problems . in addition , after explanation of the study , informed consent was obtained from all participants . the study protocol was approved by the ethical committee of the isfahan university of medical sciences . all participants completed a selfadministered questionnaire to determine demographic characteristics such as age , gender , socioeconomic status ( occupation , marital status and educational level ) , smoking status , drug history , family history of depression , physical activity and diet . subjects were considered to be current smokers if they reported smoking at least one cigarette a day during the past year . anthropometric characteristics ( height and weight ) were measured with the subjects wearing thin clothes . body mass index ( bmi ) was calculated by dividing a participant 's weight by their height squared ( kg / m ) . regular physical activity was defined as exercise of at least 15 minutes ' duration at least twice each week.13 participants provided details of their dietary habits by completing a food frequency questionnaire ( ffq).14 this instrument was designed according to the whoffq , with some changes . the validity of this questionnaire was confirmed before its use by the medical education development center affiliated to isfahan university of medical sciences.15 the ffq was used to access the consumption of different food groups such as meat , oils , cereals , vegetables and fruits . eligible participants also completed a 17item hamilton rating scale for depression ( hamd ) , which is the most commonly used observerrated depressive symptom rating scale . the original scale has 21 items but , as hamilton has suggested , only the initial 17 items were scored in this study because the last 4 items rarely occur and deal only with aspects of illness . items with quantifiable severity were ranked on a scale of 04 and those measuring symptoms that are difficult to assess reliably were ranked on a scale of 02 . the range of the 17item scale was 050 , with 14 considered to be the cutoff point of this scale ; higher scores indicated more severe depression . according to hamd , patients were classified into 3 groups of mild mdd ( score 1518 ) , moderate mdd ( score 1922 ) and severe mdd ( score 23).16,17 a blood sample was taken after 1214 hours ' fasting through the antecubital vein . all the blood sampling procedures were performed in the central laboratory of the isfahan cardiovascular research centre . serum triglyceride ( tg ) , total cholesterol ( tc ) , hdlc , ldlc and apo a and b were measured for each patient . tc and tg levels were measured within 24 h by an enzymatic method using an elan 2000 autoanalyze . ldlc was calculated by the friedewald formula,18 but in cases with tg400 mg / dl , it was measured directly . apo a and b were measured by immunoturbidimetry using pars azmoon kits accredited by bioactiva diagnostica ( germany ) . continuous variables were expressed as mean sd and a ttest was used to compare the means between the two groups . qualitative variables were expressed as frequency and a test used to compare frequencies between the two groups . a pearson correlation test was used to evaluate the correlation of depression with apo a and apo b. to study the association of depression and apo a and b ( apo a and b , separately ) , multiple linear regression models were used . apo a and b were entered as dependent variables , and the group ( case vs. control ) , smoking status ( smokers vs. nonsmokers ) , bmi , tc , ldlc and hdlc were entered as independent variables . the enter approach was selected for regression model , and for each apo a and b a unique model was created . data were analyzed by spss version 15.0 ( spss inc , chicago , illinois , usa ) . the baseline variables sex , age , marital state and occupation were similar in case and control groups . the mean age of participants was 31.2110.41 years in the group with mdd vs. 32.008.21 years in the control group . depressed patients were significantly more likely to have a family history of depression and a past history of smoking ( p<0.05 ) . fiftyfour patients were mildly depressed ( 35.3% ) , 69 were moderately depressed ( 45.1% ) and 30 were severely depressed ( 19.6% ) . there were no statistically significant differences between the two groups in bmi and physical activity . consumption of different groups of foods , which was assessed by the ffq , showed no significant statistical difference between the two groups . concentrations of all serum lipids and apo a and b differed significantly between the two groups . tc , ldlc and apo b were higher , while hdlc and apo a were lower , in the case group than in controls ( table 1 ) . linear regression analysis showed that serum apo a levels were negatively ( p<0.01 ) and serum apo b levels were positively ( p<0.05 ) predicted by depression . serum tc levels predicted negatively ( p<0.05 ) and hdlc levels predicted positively ( p<0.01 ) the serum apo a levels . smoking status and bmi did not significantly predict the apo a and b levels ( table 2 ) . the correlation between depression severity according to hamd and serum levels of the apolipoproteins indicated an inverse relationship between depression severity and serum apo a levels ( r = 0.453 , p<0.01 ) and a direct relationship between depression severity and serum apo b levels ( r = 0.521 , p<0.05 ) . our findings showed a significant correlation between serum levels of apolipoproteins and depression so that the serum level of hdlc and apo a were lower , while ldlc and apo b ( atherogenic lipoproteins ) were higher , in patients with mdd than those in the control group . in addition , severity of depression correlated with an increment in serum apo b level and a decrement in serum apo a level . sarandol et al . investigated the oxidation of apo bcontaining lipoproteins and the serum paraoxonase and arylesterase activities in mdd . their case group included patients with mdd who had not received antidepressant drugs for at least 3 weeks . higher tc , hdlc , ldlc and apo b , and lower apo a , levels were found in the case group . the patients were treated with a standard dosage of antidepressant drugs for 6 weeks , which did not alter the serum levels of lipid profiles.4 however , there is some evidence that antidepressant agents may affect serum lipid profile levels.9 thus , we excluded patients who had taken antidepressant drugs during the past 6 months . our results , except those for hdlc , were in line with those of sarandol et al . association between serum hdlc and ldlc levels as predictors of coronary heart disease ( chd ) and mdd is one of the fields which has been investigated.19 few studies have shown an inverse association between them.2 a metaanalysis on the association of cholesterol and depression showed that tc and depression were inversely related.21 on the other hand , some studies , such as that of chen et al . , demonstrated lower hdlc and higher ldlc and tc levels in patients with mdd.22 similarly , nakao and yano showed significant direct association between hypercholesterolemia and patients with mdd in japanese men.23 since apo a is known to be a major fraction of hdlc and apo b is known to be a major fraction of ldlc , our results were in accordance with the results of these studies . depression is associated with chd that is , depressed patients are more prone to develop chd.24,25 because of this association , the relationship between depression and other risk factors of chd such as serum apolipoprotein levels is an important subject that should examined more closely . one hypothesis suggests that genetic factors associated with depression may contribute to a change in serum lipid levels.26 a second theory proposes that cholesterol may be an important factor in reducing the possibility of correction of metabolic defects . as a result of these defects , segmental cerebral hypoxia , which may associated with depression , could occur.27 altered lipid profile levels through changes in serotonergic systems might also lead to mdd.28 this study has some limitations . owing to the crosssectional design of the study , the cause and effect relationship and mechanisms of the association between depression and lipid profile could not be determined . also , some of our data were based on selfreported questionnaires , which are less reliable sources of information than direct measurement . also , as previously mentioned , although our case and control groups had no differences in socioeconomic status , some of the control group comprised university hospital staff . the results of the study demonstrated lower serum levels of apo a and hdlc and higher serum levels of apo b and ldlc in depressed patients than in the control group . thus in depressed patients , biochemical problems should be considered and evaluated together with psychological interventions . given the relationship between apolipoproteins and depression , checking the lipid profile as predicting factors of chd to prevent the appearance of extra cardiovascular risk factors seems necessary .

objective : to investigate the relation between major depressive disorder and metabolic risk factors of coronary heart disease.introduction:little evidence is available indicating a relationship between major depressive disorder and metabolic risk factors of coronary heart disease such as lipoprotein and apolipoprotein.methods:this case control study included 153 patients with major depressive disorder who fulfilled the criteria of the diagnostic and statistical manual of mental disorders , fourth edition ( dsmiv ) , and 147 healthy individuals . all participants completed a demographic questionnaire and hamilton rating scale for depression . anthropometric characteristics were recorded . blood samples were taken and total cholesterol , high and lowdensity lipoproteins and apolipoproteins a and b were measured . to analyze the data , ttest , 2 test , pearson correlation test and linear regression were applied.results:depression was a negative predictor of apolipoprotein a ( = 0.328 , p<0.01 ) and positive predictor of apolipoprotein b ( = 0.290 , p<0.05 ) . apolipoprotein a was inversely predicted by total cholesterol ( = 0.269 , p<0.05 ) and positively predicted by highdensity lipoprotein ( = 0.401 , p<0.01 ) . also , lowdensity lipoprotein was a predictor of apolipoprotein b ( = 0.340 , p<0.01 ) . the severity of depression was correlated with the increment in serum apolipoprotein b levels and the decrement in serum apolipoprotein a level.conclusion:in view of the relationship between apolipoproteins a and b and depression , it would seem that screening of these metabolic risk factors besides psychological interventions is necessary in depressed patients .

INTRODUCTION METHODS Exclusion Criteria Measurements Statistical Analysis RESULTS DISCUSSION CONCLUSION

osteoporosis is defined as a skeletal disorder characterized by compromised bone strength predisposing to an increased risk of fractures associated with chronic pain , disability , and mortality 1 . osteoporosis is caused by a disturbance of the number or activity of osteoclasts , resulting in inappropriately high bone resorption , which exceeds the capacity of osteoblasts . bone strength is an integration of bone density and bone quality , and bone mineral density ( bmd ) accounts for approximately 70% of bone strength 1,2 . osteoporosis has become a significant public health problem throughout the world , and the identification of risk factors related to osteoporosis is important to predict and prevent this disease . estrogen maintains a balance between osteoclastic and osteoblastic activity , and bone remodeling increases when estrogen levels decline 3 . hormone levels are the main determinants of bone density ; however , other factors such as smoking , excessive alcohol consumption , lean body mass , low levels of physical activity , and the presence of other medical conditions , including chronic renal disease , hyperparathyroidism , hyperthyroidism , and diseases requiring systemic corticosteroid use , also increase the risk of osteoporosis 4 - 6 . a variety of neoplasms without bone metastasis are also known to be related to osteoporosis by producing circulating bone resorption stimulatory factors , leading to bone destruction and hypercalcemia 7 - 12 . in patients with gynecologic cancers , reduced spinal bmd has been reported in patients with cervical cancer 13,14 , but no significant differences were found in spinal or femoral bmd between patients with endometrial cancer and controls 15 . we hypothesized that hormone - dependent tumor , at least endometrial cancer , may preserve the bmd , contrary to cervical cancer . the aims of the present study were to compare the bone turn - over markers , bmd , and frequency of osteoporosis or osteopenia at the lumbar spine and femur between patients with cervical or endometrial cancer and controls . furthermore , we compared the bone turn - over markers and bmd base on their cancer stages . in this cross - sectional study , patients aged 45 - 57 years who first visited 3 university hospitals ( kosin university , wonkwang university , and inje university ) and were diagnosed with cervical or endometrial cancer without bone metastasis between january 2008 and december 2013 were included in the study . cervical cancer was diagnosed by papanicolaou smear and colposcopically directed biopsy , and endometrial cancer was initially diagnosed by dilatation and curettage of the uterus . technetium-99m - labeled diphosphonate bone scans or 18f - fluorodeoxyglucose positron emission tomography / computed tomography were performed on all cancer patients for confirmation of bone metastasis . all participants received dual - energy x - ray absorptiometry ( dxa ) at the time of diagnosis before any cancer treatment . study subjects who had not reached menopause or who received menopausal hormone therapy were excluded . postmenopausal women aged 48 - 59 years who visited the university hospitals as part of a group check - up for work and lacked specific health problems served as normal controls . all control women underwent a careful physical examination and a thorough review of medical history , and the subjects who had history of current treatment with drugs known to alter bone or calcium metabolism were excluded . finally , 218 patients with cervical cancer , 85 patients with endometrial cancer , and 259 healthy controls were enrolled in this study . bmd data of the lumbar spine and femur and laboratory data of bone turnover markers were collected for all participants . bmd was measured in grams per square centimeter at the first lumbar spine vertebrae ( l1),l2 , l3 , l4 and the femur , using dxa ( lunar radiation corp , madison , wi , usa ) . we used the t - score of total lumber spine , total hip , or femoral neck as single measurement for the diagnosis of osteoporosis . bmd values were categorized into three groups according to the criteria of the world health organization 16 and official positions 2013 of international society for clinical densitometry 17 as normal , osteopenic , or osteoporotic relative to the mean and standard deviation of young women . osteoporosis group was classified as women whose t - score of the total lumbar spine , total hip , or femur neck was -2.5 or less . normal group was composed with the women whose t - score of the total lumbar spine , proximal hip , and femur neck were over -1.5 . body mass index ( bmi ) was calculated by dividing bodyweight ( kg ) by the square of body height ( m ) . blood samples were collected from all participants in tubes without anticoagulants , and sera were obtained by centrifugation or determination of bone turn - over markers . all statistical analyses were performed using spss version 19.0 ( spssinc . , chicago , il , usa ) . for comparisons of demographic and anthropometric characteristics , serum and urine biochemical markers , and t -scores of basal bmd between patients with cervical cancer , those with endometrial cancer , and healthy controls , student 's t - test was performed . for comparison of these parameters in cancer patients categorized according to cancer stage , the student 's t - test was used . the frequencies of osteoporosis , osteopenia , and normal bmd according to basal bone mass were compared between the cancer groups and the healthy control group using the test . the analysis between relatively normal bmd and decreased bmd according to the existence of cancer was carried out with logistic regression test . in this cross - sectional study , patients aged 45 - 57 years who first visited 3 university hospitals ( kosin university , wonkwang university , and inje university ) and were diagnosed with cervical or endometrial cancer without bone metastasis between january 2008 and december 2013 were included in the study . cervical cancer was diagnosed by papanicolaou smear and colposcopically directed biopsy , and endometrial cancer was initially diagnosed by dilatation and curettage of the uterus . technetium-99m - labeled diphosphonate bone scans or 18f - fluorodeoxyglucose positron emission tomography / computed tomography were performed on all cancer patients for confirmation of bone metastasis . all participants received dual - energy x - ray absorptiometry ( dxa ) at the time of diagnosis before any cancer treatment . study subjects who had not reached menopause or who received menopausal hormone therapy were excluded . postmenopausal women aged 48 - 59 years who visited the university hospitals as part of a group check - up for work and lacked specific health problems served as normal controls . all control women underwent a careful physical examination and a thorough review of medical history , and the subjects who had history of current treatment with drugs known to alter bone or calcium metabolism were excluded . finally , 218 patients with cervical cancer , 85 patients with endometrial cancer , and 259 healthy controls were enrolled in this study . bmd data of the lumbar spine and femur and laboratory data of bone turnover markers were collected for all participants . bmd was measured in grams per square centimeter at the first lumbar spine vertebrae ( l1),l2 , l3 , l4 and the femur , using dxa ( lunar radiation corp , madison , wi , usa ) . we used the t - score of total lumber spine , total hip , or femoral neck as single measurement for the diagnosis of osteoporosis . bmd values were categorized into three groups according to the criteria of the world health organization 16 and official positions 2013 of international society for clinical densitometry 17 as normal , osteopenic , or osteoporotic relative to the mean and standard deviation of young women . osteoporosis group was classified as women whose t - score of the total lumbar spine , total hip , or femur neck was -2.5 or less . normal group was composed with the women whose t - score of the total lumbar spine , proximal hip , and femur neck were over -1.5 . body mass index ( bmi ) was calculated by dividing bodyweight ( kg ) by the square of body height ( m ) . blood samples were collected from all participants in tubes without anticoagulants , and sera were obtained by centrifugation or determination of bone turn - over markers . all statistical analyses were performed using spss version 19.0 ( spssinc . , chicago , il , usa ) . for comparisons of demographic and anthropometric characteristics , serum and urine biochemical markers , and t -scores of basal bmd between patients with cervical cancer , those with endometrial cancer , and healthy controls , student 's t - test was performed . for comparison of these parameters in cancer patients categorized according to cancer stage , the student 's t - test was used . the frequencies of osteoporosis , osteopenia , and normal bmd according to basal bone mass were compared between the cancer groups and the healthy control group using the test . the analysis between relatively normal bmd and decreased bmd according to the existence of cancer was carried out with logistic regression test . all patients who were diagnosed with cervical cancer underwent type i or ii hysterectomy and pelvic lymphadenectomy . the distribution of the international federation of gynecology and obstetrics ( figo ) stage in the cervical cancer patients was ib , 122 ( 55.96% ) and iia , 96 ( 44.04% ) . of these 218 patients , 178 had squamous cell carcinoma , 27 had adenocarcinoma , 9 had adenosquamous carcinoma , and four had other types of cancer . patients with endometrial cancer were initially diagnosed by dilatation and curettage of the uterus , and were pathologically proven after staging operations including pelvic lymph node ( ln ) dissection or para - aortic ln dissection . the distribution of surgical figo stage was ia , 67 ( 78.82% ) ; ib , 9 ( 10.59% ) ; iia , 8 ( 9.41% ) ; and iib , one ( 1.18% ) . of these patients , 68 had endometrioid adenocarcinoma , 12 had squamous cell carcinoma , and five had papillary serous adenocarcinoma . age , bmi , parity , and time since menopause did not differ significantly between the three groups ( table 1 ) . serum ca concentration was significantly high in the cervical cancer group compared to that of healthy control group ( 9.51 0.01vs 9.44 0.01 , p = 0.000 ) . on the other hands , urine dpl concentration was significantly low in the endometrial cancer group in comparison with healthy control group ( 8.08 0.76 vs 8.45 0.05 , p = 0.000 ) ( table 2 ) . for each t - scores of l1 , l2 , l3 , l4 , femur neck ( fn ) , femur trochanter ( ft ) , the t - scores of basal bmd at l2 and l4 were significantly lower in patients with cervical cancer ( -0.62 0.07 vs -0.44 0.06 , p = 0.038 in l2 ; -0.65 0.08 vs -0.15 0.06 , p = 0.000 in l4 ) compared to those in the healthy control group . endometrial cancer group did not showed significant difference in t - scores compared with the healthy control group ( table 3 ) . additionally , the incidence of osteoporosis according to the basal status of bone mass was significantly higher in patients with cervical cancer ( 18.81% ) compared to that of healthy control ( 10.81% ) . the incidence of osteopenia was also significantly higher in cervical cancer group ( 38.99% ) compared with the control group ( 36.29% ) ( p = 0.16 ) . endometrial cancer showed the higher incidence of osteoporosis ( 16.47% ) and lower incidence of osteopenia ( 28.24% ) , but there was no statistical significance ( p = 0.228 ) . the dichotomization of the t - score according to the decreased ( t - score < -1.5 ) or relatively normal ( t - score -1.5 ) indicate more distinct results that cervical cancer group had higher risk of bone loss ( p = 0.020 ) in comparison with the endometrial cancer group ( p = 0.701 ) ( table 4 ) . no significant differences in clinical , laboratory , or bmd data were observed among patients with cervical cancer divided according to cancer stage ( table 5 ) . as the long term survival has become longer and prognosis has been improved in gynecologic cancers , the quality of life in cancer survivors is important , these days . to support the quality of life , bone health is essential , especially in older women . quality of life is increasingly important for long - term survivors of gynecologic cancers , and osteoporosis is one of the major quality - of - life issues among gynecologic cancer survivors . this study reveals that cervical cancer has higher risk of impaired bone health per se , and for the treatment of cervical cancer , osteoporotic aspect should be considered . cervical cancer ranks as the third most common cancer in women , and it is the second most frequent cause of cancer death among women 18 . there are numerous risk factors for cervical cancer including young age at first intercourse , multiple sexual partners , cigarette smoking , race , high parity , low socioeconomic status , and chronic immune suppression , whereas the association with oral contraceptive use is controversial . many of these risk factors are linked to sexual activity , and not to hormone status . in the present study , t - scores of basal bmd in l2 and l4 were significantly lower in patients with cervical cancer compared to those in controls , and the incidence of osteoporosis and osteopenia were significantly higher in patients with cervical cancer compared to that in controls . the association between cervical cancer and bmd of the lumbar spine has been addressed in a few studies . cho and colleagues 13 compared spinal bmd data measured by dual - photon absorptiometry ( dpa ) in 85patients with cervical cancer to the data in 148 control women and reported that the mean lumbar bmd in women with cervical cancer was 12.8% lower than that in the controls after adjusting for age and menopause duration . this was the first study that examined the association between cervical cancer and bmd ; however , it was limited by the fact that they used dpa , which was found to be less accurate than dxa for the measurement of bmd . hung and colleagues 14 reported that premenopausal patients with cervical cancer without bone metastases had significantly lower bmd ( 0.95 0.03 g / cm ) compared to that in controls(1.08 0.02 g / cm ) in the lumbar spine ( l2 - 4 ) . by contrast , lee and colleagues 19 reported that the spinal bmd inpatients was not statistically lower compared to that in controls , which is in disagreement with other studies including ours . several factors are related to the activation of osteoclasts by tumor cells including parathyroid hormone - like peptide 7 - 9 , transforming growth factor 10,osteoclast activating factor 11 , and prostaglandins 12,20 , and these osteolytic factors may contribute to the development of cancer - induced bone loss ( cibl ) . in patients with cancer , greater osteoclastic activity , markedly reduced osteoblastic surface , osteoid surface , and osteoid volume have been noted by quantitative histochemical studies of the bone 11,21 . in arat model , tumor - bearing rats showed a reduction in the volume of trabecular bone and an increase in the number of osteoclasts , which was presumably mediated by a humoral factor that activates existing osteoclasts and induces monocytes to differentiate into osteoclasts 22.biochemical markers of bone metabolism are indicators of both the formation and resorption of bone 23 . biochemical bone turnover markers provide clinically useful information about the normal and pathologic processes that reflect bone cell activity in the skeleton , and they can provide valuable insight into interactions between bone remodeling and tumors . in the present study , ca concentration in serum was higher in cervical cancer group . it can be explained by the possibility of higher bone resorption process in cervical cancer in contrast with endometrial cancer of healthy women . other significant biochemical marker , urine dpl , was lower in patients with endometrial cancer than in controls . dpl is one of two pyridinium cross - links that provide structural stiffness to type i collagen found in bones 24 , and it is used as a bone turnover marker along with other bone markers . it can be assumed that endometrial cancer , as the hormone - dependent tumor , may have high bone resorption like other several cancers , however , osteoblastic action may also be increased in the response with hormone . there are many bone turnover markers such as carboxy - terminal collagen crosslinks ( ctx ) , urine n- terminal collagen crosslinks ( ntx ) , amino pro - peptide of type 1 collagen ( p1np ) , and bone specific alkaline phosphatase ( bsap)6 . further study with these biomarkers in gynecologic cancer may give the clue for the diagnosis and management of cancer patients . if the reduced bone mass in the lumbar spine observed in the present study was related to the bone - resorbing factors , we would expect to see hypercalcemia in patients with cervical cancer , but all the patients in our study were normocalcemic . first , calcium reflux from bone may have been too subtle to be detected by the technique used . another explanation is that some cases of malignancy may have been associated with elevated levels of bone - resorbing material seven in the absence of hypercalcemia because of regulatory mechanisms that maintain normocalcemia , as proposed by henderson and colleagues 25 . in the femur neck and trochanter , we found no differences of bmd between patients with cervical cancer and controls , which are inconsistent with the results reported by lee and colleagues 19 , who showed that total femoral bmd in patients with cervical cancer was significantly lower compared to that in controls . endometrial carcinoma is the most common malignancy of the female genital tract in the usa . most of the risk factors for the development of endometrial cancer , such as nulliparity , late menopause , and unopposed estrogen therapy , are related to prolonged , unopposed estrogen stimulation of the endometrium , and several medical conditions leading to long - term estrogen exposure , such as polycystic ovary syndrome and functioning ovarian tumors , are associated with an increased risk for endometrial cancer 26 . to the best of our knowledge , lee and colleagues 15 retrospectively analyzed the bmd of the spine and femur using dxa in 31 patients with endometrial cancer without bone metastases and 61 controls who were treated with surgery for benign disease in korea . these authors reported no differences in the bmd of the spine or femur between patients with endometrial cancer and controls . in the present study , there were no significant differences of basal bmd in the lumbar spine and femur between patients with endometrial cancer and controls , and the levels of biochemical bone markers did not differ significantly between the two groups . osteoporosis is strongly related to the decline of endogenous estrogen level . on the other hand , high levels of endogenous estrogen are related to endometrial cancer , which can lead to increased bmd . previous studies have reported decreased risks of endometrial cancer among women with pre - existing bone pathologies such as low bmd , fracture , and osteoporosis 27-29.in a swedish cohort , a significantly reduced risk of hip fracture was observed in patients with endometrial cancer ( standardized incidence ratio ( sir ) 0.6 ; 95% confidence interval(ci ) 0.5 - 0.8 ) 27 . they reported that women diagnosed with osteoporosis in all age groups were at decreased risk of endometrial cancer ( sir 0.61 ; 95% ci 0.46 - 0.79 ) 29 . in the present study , neither bmd nor bone turnover markers were different between patients with endometrial cancer and controls . we hypothesized that bmd values at the lumbar spine and femur were not different between these groups because bone mass in patients with endometrial cancer may have reached a balance between the negative effect of cibl and the positive effect of high endogenous estrogen levels related to endometrial cancer . cancer - treatment - induced bone loss ( ctibl ) may cause bone fragility and an increased susceptibility to fractures , and bone loss occurs more rapidly and tends to be more severe in patients with ctibl than in those with normal age - related bone loss ; therefore , prevention , early diagnosis , and treatment of ctibl are essential to decrease the risk of fracture 30.ctibl is most common in patients with breast or prostate cancer who receive chemotherapy , hormone therapy , or surgical castration , as these can cause hypogonadism and induce bone loss . in women with gynecological malignancies , concurrent chemo - radiation therapy ( ccrt ) , particularly in patients with cervical cancer , has been observed to reduce bmd 31,32 . nishio and colleagues 31 reported that ccrt for cervical cancer significantly increases bone resorption marker levels and reduces bmd of the lumbar spine , particularly in patients with cervical cancer who have received ccrt . hwang and colleagues 32 reported that the lowest t -scores for bmd were significantly lower in the women with cervical cancer treated with ccrt compared with the control women , and the serum total alp level was also significantly higher in women with cervical cancer treated with ccrt . in the present study , the t - scores of the basal bmds of all lumbar vertebrae were not significantly different between patients with cervical cancer and controls in l2 and l4 , not in femur . hwang and colleagues 32 reported that the bmds of all vertebrae except l4 were not significantly different between patients with cervical cancer treated with ccrt and controls . although this study shows the bmd status before the treatment such as surgery and ccrt , lumbar spine in patients diagnosed with cervical cancer should be evaluated because the risk of bone loss is high due to cancer itself and further treatment . in those patients , anti - osteoporotic treatment such as ca supplementation or bisphosphonate although our study had a larger sample size compared to those in other studies that examined bmd in patients with gynecologic cancer , the limitations of this study mainly stem from its retrospective study design . the inclusion of confounding risk factors for bmd such as smoking , alcohol , dietary differences , vitamin d levels , and physical activity may have provided a clearer association between gynecologic cancer and osteoporosis . especially , serum 25 hydroxy - cholecalciferol as vitamin d may be altered in patients in cancer . further study considering those limitation scan provide us the more distinct relationship between cancer and bone health . in summary , women with invasive cervical cancer have a lower bone mass density and are at increased risk of osteoporosis in the lumbar spine before anticancer treatment . there were no differences in bmd at any site between patients with endometrial cancer and controls . further prospective large scale trials are needed to clarify the association between the gynecologic cancers and bone mass density .

objective : to evaluate the bone mineral density ( bmd ) in the lumbar spine and femur in postmenopausal women with cervical cancer and endometrial cancer without bone metastasis in comparison with that in healthy control postmenopausal women , and to assess the loss of bmd according to the cancer stage.materials and methods : we analyzed the bmd of the lumbar spine and femur using dual - energy x - ray absorptiometry ( dxa ) in 218 patients with cervical cancer , 85 patients with endometrial cancer , and 259 healthy controls . the serum levels of calcium ( ca ) , phosphorus ( p ) , osteocalcin ( osc ) , and total alkaline phosphatase ( alp ) , and urine deoxypyridinoline(dpl ) were measured in all participants.results : age , body mass index , parity , and time since menopause were not significantly different between the three groups . serum ca level was higher in the cervical cancer group ( p = 0.000 ) , however , urine dpl was lower in endometrial cancer group ( p = 0.000 ) . the t - scores of basal bmd at the second and fourth lumbar vertebra ( l2 , l4 ) were significantly lower in patients with cervical cancer ( p = 0.038 , 0.000 , respectively ) compared to those in the healthy control groups . additionally , the incidence of osteoporosis and osteopenia basal status of bone mass was significantly higher in patients with cervical cancer compared to that in controls ( p = 0.016 ) . no differences in basal bmd of the lumbar spine and femur were observed between patients with cervical cancer according to their stages.conclusion : our results suggest that postmenopausal women with cervical cancer have a lower bmd and are at increased risk of osteoporosis in the lumbar spine before receiving anticancer treatment compared with postmenopausal women with endometrial cancer .

Introduction Methods Subjects Measurements of BMD and body mass index Measurement of serum calcium (Ca), phosphorus (P), osteocalcin (OSC), and total alkaline phosphatase (ALP), and urine deoxypyridinoline (DPL) Statistical analyses Results Discussion

respiratory distress continues to account for significant mortality and morbidity in the neonatal intensive care unit . at birth , respiratory distress syndrome ( rds ) in premature infants is caused by a structural immaturity of lungs and the insufficient production of surfactant and its incidence is inversely related to gestational age . the problems concerning to the respiratory system prolonge the hospitalization period in the premature infants . endothelin ( et ) is a peptide of 21 amino acids in chain with two disulfide bonds with three distinct isoforms : et-1 , et-2 , and et-3 . endothelin causes isolated contraction of pulmonary veins , vascular smooth muscle mitogenesis , myocardial cell hypertrophy , positive innotropic and chronotropic effects , bronchoconstriction , mucous secretion , cellular proliferation , and inflammatory reactions . hypoxia , stress , antidiuretic hormone , and the secretion of some mediators stimulate its synthesis . clinical investigations have shown increased plasma concentrations of et-1 during rds and in case of pulmonary hypertension of other origins . but it is unclear whether et-1 is actually responsible for the pulmonary hypertension , or the increased et-1 plasma concentration is a result of the pulmonary hypertension that originated otherwise [ 58 ] . also transforming growth factor beta ( tgf- ) is a family of three isoforms that regulate cell growth and differentiation , extracellular matrix sythesis cytokines production , and vascular neogenesis . the increase in tgf- precedes the development of pulmonary hypertension which increases circulating et-1 levels in animals . tgf- induces et-1 gene expression and et-1 peptide synthesis in bovine pulmonary artery endothelial cells [ 10 , 11 ] . the cells responsible for increased et-1 sythesis during hypoxia are unclear , and short - term effects of hypoxia raise plasma et-1 levels in animal models ; whether chronic hypoxia would lead to different results is unknown . experimental studies have suggested that et-1 plays an important role in pulmonary vascular reactivity in neonatal rds . there is also an elevation of et-1 in tracheal aspirates from these infants . tgf- showed the strongest stimulatory effect on et-1 and gene transcription in vascular smooth muscular cells . there are few studies measuring et-1 and no study measuring tgf- by enzyme immunoassay with a very small number of human premature newborns suggesting that et-1 is elevated in rds . the purpose of this present study is to evaluate the serum levels of et-1 and tgf- in the newborns with respiratory distress ( diagnosis as rds , as transient tachypnea ( rds-2 ) , and as meconium aspiration syndrome ( mas ) ) , to investigate the meaningfulness of the repetitive values of et-1 in the followup of these diseases , and to determine the reflection of serum et-1 level on the mortality at the first six hours after birth . in this study , newborns with respiratory distress hospitalized into the newborn intensive care unit were included . the study group was evaluated by 100 newborns , 62 diagnosed as rds , 24 as rds-2 , and 14 as mas within the last six months . moreover , a control group was evaluated with 20 healthy newborns . for the study , written permits were taken from the parents of each newborn , as well as an approval of the regional ethics comittee . the gestational age of the newborns was determined according to the new ballard score . according to the gestational age , newborns younger than 38 weeks were classified as premature and newborns between 3842 weeks as mature . after a detailed physical examination , the newborns were investigated with respect to their blood gases , complete blood count , full blood biochemistry , and c - reactive protein levels , and their culture samples were taken . moreover , first blood samples were obtained from all premature and mature sick or healthy newborns in the first six hours after birth . the serum was collected into polypropylene tube and centrifuged immediately and was stored at 70c . in addition , repetitive blood samples were obtained at the third , 7th , 14th , and 28th day from the patients whom oxygen supply continued . these serums were also stored at 70c . then , the samples were resolved and they were studied with elisa method in the immunology laboratory . plasma tgf- level was determined by capture elisa according to the instructions of r & d systems using monoclonal antihuman tgf- , r & d systems , inc ( usa ) . in brief , 100 l of the capture antibody was transferred to an elisa plate and incubated overnight at room temperature . after removal of the buffer , the plates were blocked by adding 300 l of pbs containing 5% tween 20 , 5% sucrose , and 0.05% nan3 to each well and incubated at room temperature for a minimum of 1 hour . 100 l of blood plasma sample per well was added , the elisa plate was covered with an adhesive strip and incubated 2 hours at room temperature . 100 l of streptavidin hrp ( r & d systems , catalog # dy998 , 1/200 in appropriate diluent ) was added to each well ; the plate was covered and incubated for 20 minutes at room temperature . after subsequent addition of substrate solution and stop solution ( both from r & d systems , inc ) , the optical density of each well was determined within 30 minutes , using a microplate reader set to 450 nm . et-1 was determined by an enzyme immunoassay ( quantiglo human et-1 , r & d systems , inc , minneapolis , minn , usa ) . the minimum detectable dose of et-1 was 0.16 pg / ml , with intra- and interassay coefficients of variation of 2.5 and 5% , respectively . moreover , in the differential diagnosis the meaningfulness of the et-1 and tgf- values was investigated using the scheffe and tukey post hoc tests , in the followup , the differences of the et-1 levels were investigated using the kruskal - wallis variance analysis . in all of the results the newborns comprimising the study group had a gestational age between 2842 weeks . from all of the patients 62 ( 62% ) newborns of 24 newborns with rds-2 diagnosis 16 ( 67% ) were mature and of 14 newborns with mas diagnosis 11 ( 79% ) were mature . in the control group , only 11 ( 55% ) newborns were mature ( table 1 ) . male predominance with a percentage of 61% was determined in the group with rds , and weight results were considerably lower due to prematurity ( 1367 368 g ) . plasma endothelin-1 and tgf- concentrations of the mature newborns in the control group were measured as 0.77 0.56 pg / ml and 0.25 0.41 pg / ml , respectively , and did not show a significant difference according to the gestational age ( p > .05 ) ( figure 1 ) . plasma endothelin-1 and tgf- concentrations of the newborns with different diagnosis measured in the first six hours of life are summarized in figure 2 . in the description of the effectiveness of the treatment and in the early determination of the prognosis plasma et-1 and tgf- concentrations in newborns with mas diagnosis were determined as 5.70 5.87 pg / ml and 3.75 1.94 pg / ml , and with rds diagnosis were determined as 3.37 1.59 pg / ml and 2.05 0.98 pg / ml . according to the control group , plasma et-1 and tgf- concentrations of the newborns with respiratory distress were determined to be statistically higher ( p < .05 ) . with the oxygen supply , it was observed that plasma et-1 concentrations of the newborns obtained in the first six hours of life are desposed to decrease regularly in the following days ( figure 3 ) . in the same way , plasma et-1 concentrations obtained in the first six hours and repetitive plasma et-1 concentrations in the following days were statistically higher in the newborns who died later compared to the survivors ( p < .05 ) ( figure 4 ) . respiratory distress is a major problem in the newborns and different reasons cause this problem . among those , the most frequent ones are rds ; a problem of premature newborns , and the others are rds-2 and mas ; a problem of mature newborns . in this study , diseases causing respiratory distress after birth in the early period were evaluated , and rds was the most frequent ( 62% ) . endothelin-1 and tgf- levels , the vascular factor , and material of respiratory distress were investigated . in the control and patient groups ' plasma , et-1 and tgf- concentrations were statistically different . the highest value was obtained in the newborns with mas and the others were ordered as rds , rds-2 , and the healthy newborns . kaapa et al in a similar study found that plasma et-1 concentrations were not correlated with the pulmonary pressure but that high plasma concentrations of et-1 reflected severe pulmonary damage . in another study , there was a significantly higher et-1 concentration in newborns with pulmonary hypertension than healthy newborns or newborns with rds . in contrast of our study , kuo et al determined the highest values of plasma et-1 concentrations in the first six hours of life in the newborns diagnosed as rds , and the newborns diagnosed as mas had a second highest values of et-1 concentrations . like our study , kojima et al found out that plasma et-1 concentrations in newborns with rds were higher compared to the newborns with rds-2 . a study of benjamin et al demonstrated that infants with and without rds had similar umbilical cord et-1 concentrations , whereas et-1 concentrations were higher in rds than in control newborns 1840 hours after birth . the increased vascular resistance in rds may be related to high plasma et-1 concentrations . in an experimental model of rds in the newborn lamb , the et-1 concentration was increased after induction of rds concomitant with the development of pulmonary hypertension , from an early time point onwards . increased et-1 concentration during rds appeared to be reached in the early phase of pulmonary hypertension development . also increased circulating levels of et-1 were correlated with the severity of pulmonary hypertension . whereas , tgf- is secreted from the alveolar macrophages in the lungs , and in case of damage it is responsible to the organization of the fibrosis growth , inflammatory response , and the recovery of the tissue . for this reason , the tgf- studies were realized in the patients with bronchopulmonary displasia , where fibrosis was dominated [ 23 , 24 ] . in our study , according to the results of plasma et-1 levels , the first highest levels of tgf- were in newborns with mas and the second were in newborns with rds . starting from the moment of the diagnosis , it was observed that et-1 concentrations of the patients who received surfactant and mechanic ventilator supply were decreased . kuo et al and niu et al emphasized those plasma et-1 concentrations of the newborns with and without bronchopulmonar dysplasia did not show any difference . the endothelium modulates vascular tone by releasing endothelium - derivated vasodilatators , including nitric oxide , prostacyclin , bradykinin , and vasoconstrictors such as et-1 and angiotensin ii , in response to a number of biochemical and physical stimuli . recent studies have suggested that an imbalance between nitric oxide and et-1 may contribute to changes in vascular tone observed in these diseases . a number of vasculopathies associated with an impaired bioavailability of nitric oxide have been found to be linked to enhanced sythesis of et-1 . in our study , plasma et-1 concentrations might have a best indicator of the prognosis in the first six hours of life , but tgf- concentrations did not have the same effect . because it was a significant difference between the survivors and dead newborns , in whom et-1 concentrations were higher in the first six hours of life . these newborns presented severe damage in the lungs , starting from the first hour . we did not see any other study emphasizing this subject in the literature . as a result , it was decided that , in the differentiating diagnosis of the rds , rds-2 , and mas , which are a significant problem of premature and mature newborns , the investigation of et-1 and tgf- concentrations is meaningful , but that in wider groups , it is required to determine the borderline values . it was observed that the et-1 levels investigated in the first six hours are more useful in determining the prognosis , and the et-1 concentrations investigated in the following days are more meaningful presenting clinical recovery . in the determination of prognosis , tgf- concentration invesitigated in the first six hours does not seem meaningful . since the results are still contradictory , it was emphasized that it is required to carry out new researches . plasma et-1 concentrations of the healthy premature and mature newborns were 0.79 0.44 and 0.77 0.56 pg / ml , respectively . also tgf- concentrations in this group were 0.17 0.37 and 0.25 0.41 pg / ml , respectively , and was not significantly different ( p > .05 ) . et-1 concentrations according to diagnosis in the sick newborns at the sixth hour after birth were 3.37 1.59 pg / ml in rds , 1.60 0.66 pg / ml in rds-2 , 5.70 5.87 pg / ml in mas , and 0.78 0.50 pg / ml in healthy group . only the concentrations of et-1 in rds and mas groups were significantly different ( p < .05 ) . also plasma tgf- concentrations were 2.05 0.98 pg / ml in rds , 1.59 0.66 pg / ml in rds-2 , 3.75 1.94 pg / ml in mas and 0.22 0.39 pg / ml in healthy group . only the difference in rds and mas group was significant ( p < .05 ) . changes of the plasma et-1 ( pg / ml ) concentrations during the oxygen treatment days in the different dignostic newborns tended to decrease . the plasma et-1 concentrations in the sixth hour of life were decreased at third day as 2.801.49 pg / ml in rds , 1.28 0.84 pg / ml in rds-2 , and 3.69 2.13 pg / ml in mas group . et-1 concentrations in the newborns who died were 4.44 1.26 pg / ml in rds and 11.60 8.97 pg / ml in mas groups ( p < .05 ) and in those who survived were 2.42 1.19 pg / ml in rds and 3.41 1.31 pg / ml ( p < et-1 concentrations in the newborns who died were 3.70 1.31 pg / ml in rds and 7.30 0.00 pg / ml in mas group ( p < .05 ) and in those who survived were 2.04 1.20 pg / ml in rds and 2.77 0.73 pg / ml ( p < .05 ) at the third day of life . et-1 concentrations in the newborns who died were 3.42 1.27 pg / ml in rds and 7.00 0.00 pg / ml in mas group ( p < .05 ) and in those who survived were 1.82 1.15 pg / ml in rds and 1.60 0.00 pg / ml ( p < .05 ) at the seventh day of life . et-1 concentrations in the newborns who died were 3.03 0.95 pg / ml and in those who survived were 1.60 1.35 pg / ml in rds ( p < .05 ) at the 14th day of life .

the purpose of this present study was to evaluate the serum levels of et-1 and tgf- in the newborns with respiratory distress . in this study , newborns with respiratory distress hospitalized into the newborn intensive care unit were included . the highest values of et-1 and tgf- were obtained from newborns with diagnosis as meconium aspiration syndrome ( 5.70 5.87 pg / ml and 3.75 1.94 pg / ml , resp ) in the sample obtained in the first six hours after birth , and these are statistically different from control group ( p < .05 ) . also , same results were obtained for newborns with respiratory distress syndrome ( 3.37 1.59 pg / ml and 2.05 0.98 pg / ml , resp ) . after oxygen treatment , et-1 values obtained in the first six hours of life were decreased regularly in the following days ( p < .05 ) . in the differentiating diagnosis of the respiratory distress of newborns , the investigation of et-1 and tgf- levels is meaningful . the et-1 levels investigated in the first six hours is more useful in determining the prognosis , and repeating et-1 levels in the following days is more meaningful to determine clinical response .

INTRODUCTION MATERIALS AND METHOD RESULTS DISCUSSION Figures and Tables

thyroid cancer is the 10th commonest cause of cancer in russian women , and the age - specific incidence of thyroid cancer has been on the rise . while most thyroid cancers have a good prognosis , those that show tracheal invasion often show poor survival because of extensive resection or tumor recurrence . surgical intervention is the key point of treatment , and appropriate surgical planning is essential to get a promising prognosis , postsurgical quality of life , and social rehabilitation of a patient . despite an increasing role of nonadjuvant radiotherapy and/or chemotherapy in the treatment of thyroid cancer , the surgical approach is still used when recurrence is treated after radiotherapy / chemoradiotherapy or in the case of combined treatment of patients with thyroid papillary carcinoma invading the trachea . the extensive resection that may be necessary for locally invasive thyroid cancer has led some surgeons to attempt to conservatively approach these tumors using peeling or shaving techniques aiming at preserving function [ 2 , 3 ] . such conservative approaches rely on the administration of postoperative radioactive iodine with / without external beam radiotherapy to manage a microscopic disease . many patients with locally advanced thyroid cancer tend to be older patients with more poorly differentiated histologic variants . tumors in such patients can be nonradioactive iodine avid , and the response to radioactive iodine therapy can be disappointing . recently , the importance of sparing surgery has also increased in clinical head and neck oncology . it fully applies , for instance , to the treatment of patients with laryngeal cancer . better functional and cosmetic result for a patient should also be an objective . in this report , we present a patient with advanced thyroid papillary carcinoma involving the trachea , who has previously undergone total thyroidectomy followed by radioactive iodine therapy in 2012 . the first one was a window resection of the trachea followed by an open tracheostomy , and the formed knitted tini - based mesh endograft ( ktnme ) , as reported by muhamedov et al . the second stage was the reconstruction of the large tracheal defect with the harvested endograft and the skin draping over the wound . the patient presented here is a 54-year - old female who was referred and admitted to the hospital of the tomsk cancer research institute on april 2 , 2014 ( clinical case # b273xx ) . the patient underwent total thyroidectomy for papillary thyroid cancer ( type t4nxm0 ) in june 2012 when the cancer directly involved the tracheal wall , followed by radioactive iodine therapy in the vladivostok central clinical hospital in july 2012 . apparently , she was considered with no evidence of disease until december 2013 when the mass in her trachea that she noticed had been gradually increasing in size within the recent months , and the histological findings verified well - differentiated papillary carcinoma recurrence . there were objectively no remarkable signs except for a neck incisional scar and the subcutaneous , rounded , newly grown palpatory mass detected ( about 1.5 cm in diameter ) . she had other symptoms such as dyspnea at rest , hoarseness , and minor hemoptysis . fiberoptic endoscopy and magnetic resonance imaging ( mri ) revealed a circumferential stenosis on the right side below the vocal cord , invading the lumen of the trachea . a submucosal mass from the 2nd to the 5th tracheal ring with an irregular surface penetrating the mucosa with signs of ulceration and erosion was noted ( fig 1 ) . according to the above findings , the case was classified as t4n0m0 , and a double - stage surgical treatment was scheduled ( fig 2 ) . the first stage was performed on april 15 , 2014 . to involve the platysma muscle , the u - shaped incision was made alongside the postoperative scar ( fig 3a ) . subcutaneous fat was removed with electrocautery to aid in exposure and to prevent later fat necrosis . dissection proceeded through the platysma until the midline raphe between the strap muscles was identified ( fig 3b ) . the sternocleidomastoid muscle was thus separated , retracted laterally , and preserved . by tracing , the right recurrent laryngeal nerve was assessed to be intact and half of the trachea ( 5.5 2.3 cm ) was dissected including 5 cartilaginous rings together with the left recurrent laryngeal nerve . the tumor was removed together with the invaded paratracheal tissue bilaterally ( fig 3c ) . the medial edges of the sternocleidomastoid muscle were sutured to a rectangular tracheal opening . to avoid tracheal stenosis , the anterior side of the defect was open , and a stent tube was kept in place . for muscle - flap prefabrication , the prepared ktnme , as described by muhamedov et al . the cut edges of the tracheal opening were circumferentially overedged to the skin with a few absorbable sutures to facilitate cannulation . after the airway was confirmed intact based on co2 return and bilateral breath sounds , the tracheostomy tube was secured to the skin with 40 sutures ( fig 3e ) . to avoid the risk of subcutaneous emphysema and subsequent pneumomediastinum , the skin was not tightly closed . a sponge soaked with iodine between the skin and the flange was placed for 24 h to deflect infection and anxiety about minor oozing of the skin edge . the patient was extubated after 7 days , and there was no granulation tissue or stenosis of the tracheal lumen 3 weeks thereafter ( fig 4 ) . the reconstructive stage was performed on may 19 , 2014 . the o - shaped incision around the formed tracheotomy having the gap 1.5 cm from the right edge was made . a cellulocutaneous flap was separated and overturned so that the epidermis overlapped the tracheostomy lumen ( fig 5a ) . the harvested ktnme after prefabrication was separated with the pedicle flap of the medial edge of the sternocleidomastoid muscle ( fig 5b ) , placed over the trachea , and sutured to the trachea ( fig 5c ) . the remaining defect in the anterior part of trachea was closed without any special procedure . the sliding skin flap was swung over the wound followed by aesthetic wound closure to achieve optimal cosmetic results with minimal scarring ( fig 5d ) . postoperative bronchoscopy revealed a pink - coated part in the tracheal mucosa with no stenosis ( fig 5e ) . the patient was discharged on june 3 , 2014 , and referred back home to be supervised by a local hospital , where she was socially rehabilitated in full . the patient remains alive and without any evidence of recurrence or complaints well over 24 months after surgery . she continued her job 2 months after discharge and calls us every 6 months to confirm her health status and current matters . the possibility to perform a sparing surgery depends on several factors , including the availability of adequate material for the tracheal replacement after lesion [ 7 , 8 ] . however , functional outcomes of such a kind of the treatment do not always satisfy both patients and clinicians given that a large portion of the trachea is to be resected in locally advanced thyroid papillary carcinoma invading the trachea . some surgical methods , on account of the improvement , standardization , and more widespread use of reconstructive surgery with microvascular flaps , for the management of tracheal invasion by thyroid carcinoma have been reported in the literature , so far with no consensus on the best approach . the development of techniques and the selection of an optimal material for the tracheal reconstruction remains the urgent aim of modern head and neck surgical oncology . the brief overview of published articles on tracheal sparing surgery studies reflects , in fact , that there are no commercially produced implants for a wide clinical practice in cases of extensive lesions of the trachea . since it is a mobile organ when breathing , swallowing , speaking , eating etc . , it is critical to raise standards regarding the material selection for the replacement . to succeed , clinicians should make their unconventional choice of what approach to use and how to perform the correct reconstruction . as a rule , the structures involved in cases of invasive thyroid papillary carcinoma are mostly the trachea , larynx , laryngeal nerve , and other surrounding sites . since a regional spread , increased incidence of local recurrence and distant metastasis are common ways of invasion to the surrounding structures , it is crucial to control local invasion , which makes treatment relatively difficult . the management of locally invasive , well - differentiated papillary carcinoma of the thyroid is disputable . palliative surgery had been the most common surgical procedure used for the treatment of patients with thyroid carcinoma invading the trachea for many years . however , the shaving - off procedure was reported to be often inadequate , and the postoperative survival rate was much worse in patients undergoing partial resection than in those undergoing total resection . for adequate surgery , as in our case , accurate preoperative examination of the tracheal invasion including bronchoscopy , ct , and mri is required to clarify the involvement of adjacent organs . the generally accepted technique for the reconstruction of circular tracheal lesions is to form the end - to - end primary anastomosis between the proximal and distal margins of the defect . however , this is feasible for small ( less than 3 rings ) circular defects , and a larger area of invasion may limit the feasibility of partial tracheal resection because it may lead to kinking or stenosis of the trachea after repair . contraindications include extensive involvement of the trachea , such that 6 or more tracheal rings need to be resected or simultaneous invasion of the esophagus occurs . moreover , in cancer patients , the upward trend in postoperative complications is probable , including a failure of the anastomosis or scar stenosis due to a previous treatment and the weak reparative ability of the tissue . in case of extensive tracheal defects ( more than 5 cm ) , the most reliable method is reconstructive surgery , which involves a layerwise restoration of the tracheal wall . such an approach assumes a fusion of the framework and a thin flap , which adequately replaces the frame function of the trachea without narrowing the lumen . there are several similar studies that aimed at exploring tracheal reconstruction considering the frame function , but they are strictly experimental and still not applicable in cases of large defects of the trachea . it should be pointed out that applying the implant in large defects of the trachea has to be done without any contact with the lumen when there are signs of a primary inflammation . it is suggested to ensure strict adherence to the criteria , otherwise the inflammatory process that occurs in situ eventually affects the consistency of the graft and leads to granulation tissue growth and a failure of the whole reconstruction stage . in summary , in order to succeed in a complex sparing surgery , the obvious procedure is to use the prefabricated endograft covered with a thin - walled lining by the adjacent tissues , as we did . this technique implies 2 stages of reconstruction , which do not contravene the modern concept of sparing surgery as repeated corrective treatments to restore the lumen are necessary . a two - stage surgical treatment has been applied before in cases of large tracheal lesion defects : first , after resection of the tumor , the tracheal wall and skin are sutured for the development of a persistent tracheocutaneous fistula trough. second , delayed closure of the tracheal defect was performed . unfortunately , compared to our method , this technique involves long - term treatment and is also not always aesthetically satisfactory because of the need for harvesting a local flap . in the case described herein , we demonstrated that the prefabricated ktnme is a useful and simple technique of sparing surgery for the tracheal reconstruction after excessive window resection in a patient with advanced thyroid papillary carcinoma invading the trachea . the offered method of a two - stage sparing treatment leads a long palliative period associated with a good quality of life . besides the ktnme applied can adequately restore the frame function of the trachea without postoperative aggravation . as a consequence of the successful application , the ktnme is shown to provide a superior reconstruction and stability for the tracheal grafting during the implantation procedure and thereafter . the surgery was performed in accordance with the ethical principles outlined in the declaration of helsinki . its protocol was approved by the ethical committee of the tomsk cancer research institute , and informed consent was obtained from the patient before the upcoming intervention . the authors declare that there are no conflicts of interests regarding the publication of this paper .

published reports on salvage treatment for trachea reconstruction after total thyroidectomy or partial tracheotomy are available , some of them using structures of the trachea itself , auricular cartilage , a musculocutaneous flap , or other methods . in our report , we emphasize the importance of a search for a new material and approach for sparing surgery . the purpose of this article is to describe a case of a successful sparing surgery in a patient with advanced thyroid papillary carcinoma invading the trachea . after total thyroidectomy in 2012 , partial resection of the trachea was performed in 2014 . the lesion defect was 5.5 2.3 cm in size , located between 4 ( 2nd6th ) tracheal cartilaginous rings and involving about a semicircumference . it was reconstructed with the aid of the knitted tini - based mesh endograft , which has been prefabricated in the sternocleidomastoid muscle and further covered with the skin draped over the wound . the tracheostoma was fully closed 6 weeks after the surgery . there were neither side effects nor complications . this kind of tracheal surgery for extensive lesions demonstrates good functional and cosmetic outcomes .

Introduction Case Presentation Discussion Conclusions Statement of Ethics Disclosure Statement

the history of cross - cultural exchanges between the people of india and their colonial rulers provides a fascinating insight into how these encounters shaped medicine and medical education in india . given the backdrop of colonialism and hegemony , the confluence of the east and the west was turbulent . in the 16 century , it was the portuguese who first introduced western medicine into india . in 1600 , the medical officers who arrived along with the east india company 's first fleet of ships also brought western medicine in india . initially , medical departments , with surgeons , were setup to provide medical relief to the troops and employees of the east india company . in 1775 , these were essentially constituted by staff of the commander - in - chief of the british indian army in each presidency . medical departments were setup in bengal , madras , and bombay presidencies in 1785 , and these looked after both military personnel and british civilians . the mutiny of 1857 led to the dissolution of the east india company and the british government was established in india . several organized services such as the indian medical service , the central and provincial medical services , and the subordinate medical services were initiated to provide medical services and improve public health . a public health commissioner and a statistical officer were also appointed to the government of india . in 1869 , the medical departments in the three presidencies were amalgamated into the indian medical service . a competitive examination was conducted in london to recruit people into the indian medical service . the european officers of the indian medical service headed the military and civil medical operations in the three presidencies . however , they needed trained assistants and supporting staff such as apothecaries , compounders , and dressers in their work . appointing european doctors had large financial implications . this prompted the british government to look toward establishing a system of medical education in india to recruit local staff . in 1822 , european texts in anatomy , medicine , and surgery were translated into the local languages for the benefit of students . though dissection was not performed , clinical experience in different hospitals and dispensaries was mandatory . john tyler , an orientalist , was the first superintendent of the native medical institution . classes on unani medicine were held at the calcutta madrasa , while the sanskrit college conducted classes in ayurvedic medicine . successful native graduates were absorbed into government jobs . in 1826 , to offer indians the opportunity to learn and practice western medicine , an indian medical school was started in southern bombay with surgeon john mclennan as the superintendent . , the anglicists managed to overturn several cultural educational policies started by the vernacularists and orientalists . charles trevelyan , an ardent westernizer , chastised the british policy of educating europeans in the languages and cultures of the east and recommended that the asiatics ought to be educated in the sciences of the west . in 1833 , lord william bentinck appointed a committee to look into the state of medical education in bengal and the teaching of indigenous systems of medicine . in 1834 , the report , submitted by the committee led by dr . john grant , criticized the medical training and assessment conducted by the native medical institution . the report recommended that the state should found a medical college for the education of natives . the various branches of medical science should be taught to students , as in europe . the trainees should be able to read and write in english , bengali , and hindustani , and must be proficient in arithmetic . in february 1835 , thomas macaulay composed a powerful minute recommending that the government withhold further grants to institutions , conferring instruction in the native languages . the termination of official patronage to indigenous systems of medicine sealed the fate of the students of the two leading oriental institutions in calcutta . the classes held at the madrasa and the sanskrit college were discontinued in 1835 . in their place , a new medical college was established to train indian students in strict accordance with the mode adopted in europe through the medium of the english language . calcutta medical college was established in 1835 and it ushered in a new beginning to medical education in india . youths between 14 and 20 years of age were trained in the principles and practices of medical science using methods of the west . they were to be trained for a period not less than 4 years and not more than 6 years , after which they had to appear in a final examination . native doctors , and allowed to enter public service with an initial pay of rs . 30 a month . in bombay , sir robert grant became the governor and was deeply moved by the vast number of indians who died due to lack of proper medical care . he envisaged the idea of training indians in western medicine and as he tried to expedite his agenda for a more systematically planned medical college , he met with strong opposition . to quell this opposition and also to encourage a spirit of scientific inquiry , the medical and physical society of bombay was formed in 1835 . charles morehead studied the reasons which led to the abolishment of the previous medical school . in 1837 , the society concluded that establishment of a medical school was necessary for the education of the indians of the presidency in medical science to the extent of qualifying indians to become useful and safe practitioners of medicine . dr . charles morehead wrote that in gifting medical science to the people of india , there was a scope not merely for the operations of successful imitation but also for the adaptations of original genius . the college was not designed in imitation of the medical college in calcutta which intended to produce government servants . the college in bombay was designed to produce independent medical practitioners from the natives of india . in march 1838 , a generous grant by philanthropist sir jamsetjee jeejebhoy made way for building a new general hospital . the east india company endorsed the proposal to setup a medical college on july 18 , 1838 . the foundation stone of the grant medical college was laid in bombay in march 1843 with an aim to impart the benefits of medical instruction to the natives of western india through a systematic system . the general hospital which was opened in 1845 is now known as the sir jj hospital . the first - batch students who entered grant medical college were between the ages of 16 and 20 years . indians could undertake a course to qualify as doctors as assistant surgeons or they could undertake shorter courses to allow them to practice as medical subordinates ( sub - assistant surgeons , hospital assistants , and sanitary inspectors ) for british government services . afford better means of instruction in medicine and surgery to the indo - british and native youths , entering the medical branch of the service in the presidency . different courses were conducted for the medical apprentices of the apothecary branch and for pupils of the native branch of the military sub - medical department to be appointed as dressers later . later , midwifery , physiology , ophthalmology , and chemistry were added , and the course was extended to 3 years . eventually , medical colleges were started in other provinces too , with the purpose of producing a cadre of doctors who could be recruited into the subordinate medical services . in 1840 , the portuguese started the medicine and pharmacy licenciates , now known as goa medical college . university - affiliated medical education became the norm in the 1850s , after the opening of the first three indian universities in madras , bombay , and calcutta . madras medical college was the first in india to open its doors to women students in 1875 . even so , in 1877 , among the 8000 medical practitioners , only 450 were trained in western medicine . while nationalism provided a fertile soil for the revival of ayurveda and other indigenous branches of medicine , the demand for swaraj or home rule entailed that india needed to be projected as a progressive , modern , and scientific nation . therefore , the revivalist efforts during this period placed importance on establishing the scientific and progressive credentials of ayurveda . a proliferation of books on ayurveda in english , sanskrit , and vernacular languages tried to transform the hitherto relatively inaccessible knowledge into social knowledge as well as a shared system of knowledge among the practitioners . ayurvedic practitioners organized themselves and founded the all india ayurvedic congress . the themes central to the discourses at these conferences were british orientalism , the synthesis of medical systems , and the institutionalization of ayurveda . m. m. gananath sen , an ayurvedic practitioner from bengal , founded a college for the study of ayurveda and a pharmaceutical concern for manufacturing ayurvedic medicine . the bright spots for medicine during colonial times were the initiation of public health measures , vaccination , and the elevation of tropical diseases to a special area of study . a number of epidemiological and research studies were conducted on cholera , plague , malaria , tuberculosis , and leprosy . british india was a cauldron of several systems of medicine which intermingled with each other . long before the east india company entered the subcontinent , an exchange of knowledge and ideas had occurred between the indian systems of medicine and their foreign counterparts such as the arabs and chinese . the vaidyas and the hakims from the ayurvedic and unani systems of medicine complemented and borrowed from each other . the practitioners of these systems collaborated and learned from each other , and there is hardly any account of animosity between them . however , the interaction between the practitioners of indigenous and western medicine was anything but smooth . there was a clash of cultures where the east was seen as weak against the powerful knowledge of the west . both groups tried to differentiate their own set of ideas from those of the other . in the east , medicine was largely pluralistic and there was awareness and acceptance of alternative traditions . medicine was not viewed simply as a biological phenomenon and emphasis was given to a patient 's societal standing , environment , and relation with the therapist . as colonial arteries hardened , claims of the western superiority and scientific authority isolated western medicine . allopathic practitioners saw themselves as modernizers and often treated their indigenous counterparts with contempt for their inferior knowledge . while western medicine was accorded the status of official medicine , the state turned discriminatory and hostile toward the other systems . the rising tides of nationalism also posed to be an obstacle in a healthy exchange of ideas . the intrusion of western medicine was resented by the practitioners of indigenous medicine , and they stoutly defended their traditions . these practitioners also tried to avoid humiliation by acquainting themselves with the new techniques of diagnosis . in the 1920s , benaras hindu university developed a course which had both ayurveda and western medicine . the principal 's argument was when these are once installed , the students will see how ridiculous ayurvedic medicine is and it will die a natural death . if it were opposed , it would occupy a martyr 's place and be much more likely to continue . as panikkar points out , they were inclined to borrow , but they could not create a dialogue between the two epistemics . graduates of the government indian medical school were considered enabled to bring to bear on the problems of health and ill - health not only the expert knowledge of their own systems but , as far as practicable , the best that is in other systems also . these graduates sought to distance themselves from the graduates of madras ayurvedic college because the latter were seen as purists and therefore not attuned to modern methods . b class practitioners , against the a class accorded to medical graduates . the denial of registration to practitioners of indigenous systems of medicine by the madras medical registration act of 1914 was seen as gross discrimination . according to roger jeffery , indigenous practitioners who served about eighty percent of the people of the land were being treated as untouchables of the profession by the allopathic practitioners who considered themselves as age - old practices were followed blindly by their proponents with absolutely no scope for questioning and scientific scrutiny . this absence of openness to criticism and scientific rigor still is a cause for concern about scientific communities . however , pushed to a defensive position , knowing that western medicine was here to stay , there were several voices of reason , asking for cooperation and synthesis between the two systems of medicine . c. g. mahadeva argued , there can not be water - tight compartments between the two systems of medicine . an anonymous article in the june 1928 issue of the journal of ayurveda or the hindu system of medicine argued , medical education in india should be so devised that it should take into account not only the present - day medical education but also medical knowledge of the past while ayurveda can not move on in [ an ] old groove , allopathy should not be accepted in toto for india . while we should absorb the pathology of the seed of disease from allopathy , we must give the pathology of the soil in disease to modern medicine . the two angles are at present different but should be harmonized . in this period , when indigenous medical traditions were marginalized , the local doctors tried to secure a space within the newly created professional structure to attain a privileged social status . practitioners of indian systems of medicine are treated as second - class doctors in india even today . along the way , we have often ignored non - western concepts of disease , and discarded alternative ways of providing succor to humanity . however , even today , traditional medicine seems to dominate the primary levels of health care while western medicine is more popular as we move up the social ladder . having said this , much needs to be done to improve the quality and duration of training given to students of indigenous systems of medicine , including emphasizing the need for periodic curriculum review and improvement , adoption of scientific rigor and the spirit of inquiry . medical education in post - independent india faces significant challenges . these include the rapid , asymmetric rise in the number of medical schools , the questionable validity of student selection policies , a curriculum that is far removed from national health care requirements , and declining quality of teaching in medical schools . six decades after independence , educationists have still been unable to convincingly shrug off the colonial yoke . strangely , the curriculum followed by medical trainees has not been fundamentally altered since the days of the raj . the shrivastav committee advocated reorientation of medical education by national priorities and needs . in 1986 , the bajaj committee called for the establishment of an educational commission for health sciences . it also noted that medical school faculty , though efficient in their clinical specialties , were deficient as educators . it is commonplace to hear of faculty having been lured with exorbitant salaries or to hear of imposters being produced as faculty before inspecting teams from the medical council of india . much before the british stepped into india , residential universities in takshashila and nalanda provided organized institutionalized training in medicine . students were trained in both theoretical and practical aspects under the guidance of a guru or a preceptor . the unique feature of these universities is the presence of tutorial cells where a teacher took a fixed number of students under him / her and bestowed personal attention on them . student ratio in these gurukul systems closely corresponds to what is recommended by modern medical educators . in the blind race to produce a mass assembly line of medical graduates , that traditional concept of apprenticeship has been lost . only recently , there has been a resurgence of interest in faculty development and medical education . training and refresher courses in medical education have now been made mandatory for medical teachers . several efforts are being made to revamp the curriculum to make it relevant to the indian context . simultaneously , some efforts have been taken by the state to support the indian systems of medicine . in 1995 , this was renamed as the department of ayurveda , yoga and naturopathy , unani , siddha , and homeopathy in november 2003 . this was done to promote indigenous systems , upgrade their standards , ensure quality control and standardization of drugs , and improve educational standards and research in these areas . medical students who are taught in tertiary hospitals do not feel at home when they are asked to practice in rural areas . forced and compulsory postings to fulfill the dearth of medical personnel in rural areas are resented by fresh graduates . on the other hand , from colonial times , the state has been apathetic to the practitioners of indigenous medicine who serve rural populations . lack of societal respect and support forces them to practice allopathic methods , which is beyond their expertise , often with disastrous consequences . the focus of the indian systems of medicine has always been on health promotion and prevention , rather than the curative focus of the west . had a dialog been successfully initiated between these two systems , symbiotic growth might well have led to better health for our people . the abject lack of communication and learning between the western system of medicine on the one hand and indigenous systems of medicine on the other hand has not worked well for the country . medical education in india needs to transform to be meaningful for our own people . for this , the health agenda need to be accorded importance in governance . absence of a clear vision , a concerted effort by all stakeholders , and a strong political leadership in the area of medical education are the significant causes for the slow progress toward this metamorphosis . the prime task that lies ahead for india is to work out a national medical curriculum which caters to our country 's needs . it is also important to streamline the process of faculty development in the country and make it effective so that what is taught in workshops can be transferred into the workplace . the indigenous branches need to strengthen their research , improve the structure of their curricula , and standardize the regulation of their education system . eventually , a symbiotic relationship will have to be developed between the two systems of medicine , but before that , a lot of groundwork will need to be done in each system individually . merely mimicking the west , without paying heed to local priorities of course , there is always something that can be learned from any tradition , but it can only be to mutual benefit if done in a respectful manner . in the words of mahatma gandhi , i do not want my house to be walled in on all sides and my windows to be stuffed . i want the cultures of all the lands to be blown about my house as freely as possible .

the cross - cultural exchanges between the people of india and their colonial rulers provides a fascinating insight into how these encounters shaped medicine and medical education in india . this article traces the history of how indian medicine was transformed in the backdrop of colonialism and hegemony . it goes on to show how six decades after independence , we have have still been unable to convincingly shrug off the colonial yoke . india needs to work out a national medical curriculum which caters to our country 's needs . a symbiotic relationship needs to be developed between the indigenous and allopathic systems of medicine .

Evolution of Medical Education in India: The Impact of Colonialism India's Initiation to Western Medicine The Clash of the Cultures Medical Education: The Postindependence Era Financial support and sponsorship Conflicts of interest

in the recent past , even many historians of medicine and science have endorsed the widespread belief that the exodus of central european scientists and physicians during the nazi period could readily be described in terms of a linear equation of the subtractions and additions of intellect . this common interpretation has simplistically viewed the massive exodus of academics , intellectuals , and scientists after 1933 as an enrichment primarily of the north american and british medical and academic communities ( see medawar & pyke , 2001 or cornwell , 2003 , for example ) . although such a perspective is not entirely wrong when a rather quantitative meta - perspective is taken , it becomes less compelling when the individual biographies of the respective physicians and scientists themselves are taken into account and are placed in their contingent work environments . this includes their work situations , skill sets , along with the personal and psychological resources of each migr neuroscientist ( cf . this contribution introduces some of those local and cultural factors which implicated the arrival , acceptance , and integration of many german - speaking migrs doctors and brain researchers into canada , following their exile between 1933 and 1945 , which have largely gone unnoticed by the relevant scholarship on twentieth - century history of neuroscience . when tracing their career paths into the 1960s , during which the scientific research landscapes in canadian biomedicine gradually came to change with the creation of the medical research council ( mrc ) , the complex cultural modes and scientific interchanges associated with the forced migration process become fairly obvious ( mrc , 2000 ) . as the main title ( learning soft skills the hard way ) of this article implies , the integration of german - speaking migrs neuroscientists can not simply be perceived in terms of a supplementation of longstanding north american scientific traditions but needs to be viewed as a very complex process of acculturation on multiple levels of the social and cultural organization of contemporary canadian and american research landscapes . it is further more of a seemingly modern interest in the cultural makeup of science to analyze and understand the process of forced migration in the neuroscientific field while mapping the often drastic changes that took place to the career patterns of this particular group of medical professionals ( zeidman , 2014 ) . based on the existing historical evidence , the traditional views on the forced migration process in the neurosciences and psychiatry need to be significantly readjusted and refined . although most core facts about the exodus of medical researchers during the period of nazism in germany are already known ( cf . 191261 ) , a major incentive to revise some of the standard approaches stems from the historiographical problem of emigration - induced change , which has been researched from multiple perspectives in the humanities and social sciences . not only did scholars draw on individual and collective biographies but they also measured substantial impact parameters , using bibliometric methods , membership issues in academic associations , and statistics regarding the leading positions in scholarly societies , which were particularly applied to the hard sciences , such as physics and chemistry , as well as sociology and political science in the soft sciences ( juette , 1990 ; soellner , 1996 ) . the impulses for such a revised research strategy came from relatively new approaches to the historiography of the cultural context of science ( galison , graubard , & mendelsohn , 2001 ; schmidgen , geimer , & dierig , 2004 ; erikson , 2005 ) and problems of the transfer of knowledge ( argote , 1999 ; jankrift & steger , 2004 ; ash & soellner , 2006 ) . in applying those new perspectives to the research networks and the communication structures of migr neuroscientists , this article aims to provide additional perspectives towards the social background and cultural implications of the case of forced migration in the neuroscience field ( cf . an earlier process - oriented perspective developed in the 1990s by a group of scholars at the berliner wissenschaftskolleg has opened promising paths for the study of [ the ] intellectual and cultural change occurring through the forced migration of european scientific migrs ( ash & soellner , 1996 , pp . a number of american and german historians and philosophers of science ( fischer , 1996 ) have provided useful models through their scholarship on emigration - induced scientific change . these included the relevant social accounts of the historical developments , social reception , and reintegration of german - speaking migr scientists . as such , refugee - neuroscientists , like all their compatriots in exile , found themselves in the foreign environment of north america , where they had to continue their daily life , support their partners and families , become relicensed and obtain professional acceptance . they had to learn the social and cultural codes , psychological mentality , and likewise soft working skills 187197 ) when being barred from clinical work , having to close labs in order to pursue better paid jobs for their subsistence , or changing their personal research interests so as to fit more closely with the acceptable clinical and scientific paradigms of the often hands - on , capitalist , and technophile north american society . many of the migr neuroscientists , just to name the neuropathologist karl stern ( 19061975 ) , and his colleagues from the former group of kurt goldstein ( 18781965 ) , adhmar gelb ( 18871936 ) , victor franz ( 18831950 ) , and walther riese ( 18901976 ) in frankfurt am main , were influenced by interpretations of holistic neurology and the experimental culture of the weimar period , which they at first sought to continue in their american exile ( stahnisch & pow , 2015 ) . what emanates as the central problem for migr neuroscientists such as stern and goldstein , was not only personal acculturation but also the readjustment of their research and clinical activities . they had to search for new work places and integration into the preexisting canadian and us working groups , research programs , and academic milieus , which they often literally encountered as a new world . continuous comparisons of the similarities and differences with their former european experiences were permanently present ( sachs , 1998 ) , a process through which they noticeably stood out due to their critique and reproaches of the differences , shortfalls , and exaggerations of life in their new host countries . for example , the goldstein collaborator from berlin max bielschowsky ( 18691940 ) wrote back from his own exile abroad : i am as well as a man with my past could be in a very strange country [ auf fremdem boden ] . all the friendliness and kind offers of support by my [ new ] colleagues , however , will never really substitute for what i had to leave behind [ in germany ] . i am as well as a man with my past could be in a very strange country [ auf fremdem boden ] . you know how much i love my home country [ meine heimat ] . all the friendliness and kind offers of support by my [ new ] colleagues , however , will never really substitute for what i had to leave behind [ in germany ] . the members of the goldstein group certainly proved to be no exception to that rule , no matter what their influential contributions to neurology , psychiatry , experimental psychology , or matters of the philosophy of science and medicine had been . this loose network of people included the earlier collaborators from frankfurt am main and berlin , karl stern who had joined the allan memorial institute of psychiatric research at mcgill university in montreal , canada ) , walther riese who immigrated to richmond , virginia , in the united states , frieda fromm - reichmann ( 18891957 ) who received a position as a psychiatrist at the chestnut lodge mental asylum in maryland in the united states and who independently immigrated to other destinations in north america . goldstein s nearest friend and colleague adhmar gelb ( 18871936 ) had lost his chair at the university of halle and was just about to leave germany in 1936 for a position at kansas state university in manhattan , kansas , when he succumbed , at the age of 49 , to a tuberculosis infection , which he had contracted in his continuous work with severe clinical patients ( danzer , 2006 , p. 23f ) . the case of goldstein s collaborator stern in montreal , a former pupil of brain oncologist walther spielmeyer ( 18791935 ) in munich , can be presented here as an important change from an accomplished neuropathologist back in germany , who later became a well - accepted clinical psychiatrist and fervent academic teacher later in canada . at first glance , the conditions for a transfer of concepts and methods were ideal in stern s case ( goldblatt , 1992 , pp . 279282 ) , who was born in a small town in bavaria near the czech border ( bullemer , 2003 ) . karl - stern - strae in his honor and has commemorated his expulsion from germany . after he had passed most of his medical education at the charit hospital and medical school in berlin , stern graduated with an md in 1930 from the university of frankfurt / m . between 1930 and 1931 , he worked together with goldstein as a resident physician in psychiatry at the frankfurt neurological institute ( stahnisch , 2008 ) . karl - stern - strae in his honor and has commemorated his expulsion from germany . between 1932 and 1933 , he had a rockefeller fellowship in the department of neuropathology at the german research institute for psychiatry ( deutsche forschungsanstalt fuer psychiatrie : dfa ) in munich to collaborate with the neurohistologist spielmeyer , one of the world - leading specialists at the time for brain - tumor diagnoses which provided the basis for fruitful scientific publications ( stern , 1939 ) . here , he had procured a position , in which , apart from the pathological analysis of the brains in idiocy and circulatory disturbances , he mainly acted as spielmeyer s teaching assistant . yet , this implied an enormous effort to live up to the high standards of spielmeyer s expertise in this area . ( this is all the more crucial , as one of the members of the leading spanish school rafael lorente de no [ 19021990 ] and po del rio hortega [ 18821945 ] and oskar [ 18701959 ] and ccile vogt [ 18751962 ] in berlin he was also expected to introduce graduate students and visiting researchers into the various histological methods and the vast array of laboratory applications in use by spielmeyer so that for a large part of the day , stern had to wander from microscope to microscope in order to instruct the guests in munich , stern clearly worked at the cutting - edge of neuroscience research and medical education at large . when goldstein decided to leave frankfurt am main in 1930 for berlin ( kreft , 1997 , pp . 131144 ) , he asked stern to join him again as a consultant in one of his psychiatry wards . since stern had by that time received a great reputation for being a proficient neurohistologist himself , he was also expected to do the brain autopsies in the moabit prosectur . it seems that stern , with his broad interests and knowledge basis , squared very well with goldstein s holistic neurological assumptions which integrated philosophy , social psychiatry , and neuroscientific innovations alike . holist neurology sat at the center of what nazi ideology later rejected as weak jewish medicine , while stern himself did not hesitate at all to follow his mentor to the german capital : the hours were from six to eight but frequently we worked until well after midnight . there i found myself in a strange and extraordinary world , entirely different from anything i have ever seen before . there were mothers with children who had just left a home destroyed by an alcoholic . these were drunkards , morphine and cocaine addicts , the hopeless , the destitute , those who had cynically and rebelliously isolated themselves , bound to a life of increasing solitude and destruction , and those who had succumbed to the deficiency of a loveless world . it was that fringe of life where human existence is ultimately atomized and surrounds itself with a void , a space of negation . it would take a whole book to describe all this so that the reader would be able to re - experience it . [ that means that i never recovered the undergraduate s boundless admiration for science and for the absolute sacredness of research . [ ] although i had more scientific training later , i never forget those experiences in moabit . they seemed to have put the abstract scientific aspect of medicine into its proper place . it is just one side of a profound and complex development that with many of us science and art in medicine are no longer integrated . as science in general , ( stern , 1951 , p. 85f ) the hours were from six to eight but frequently we worked until well after midnight . there i found myself in a strange and extraordinary world , entirely different from anything i have ever seen before . there were mothers with children who had just left a home destroyed by an alcoholic . these were drunkards , morphine and cocaine addicts , the hopeless , the destitute , those who had cynically and rebelliously isolated themselves , bound to a life of increasing solitude and destruction , and those who had succumbed to the deficiency of a loveless world . it was that fringe of life where human existence is ultimately atomized and surrounds itself with a void , a space of negation . it would take a whole book to describe all this so that the reader would be able to re - experience it . [ that means that i never recovered the undergraduate s boundless admiration for science and for the absolute sacredness of research . [ ] although i had more scientific training later , i never forget those experiences in moabit . they seemed to have put the abstract scientific aspect of medicine into its proper place . it is just one side of a profound and complex development that with many of us science and art in medicine are no longer integrated . as science in general , ( stern , 1951 , p. 85f ) moabit was then one of the few academic hospitals with different services in neurology , psychiatry , and pathology that similarly related to each other as in the huge neurological institute , which goldstein directed in frankfurt before . however , just as everything was set for goldstein s clinic to develop into one of the major centers of german neurology , the catastrophe began . as soon as the nazis had seized power , goldstein was incarcerated and only released after agreeing to leave germany forever . through switzerland , where he cofounded the emergency society for german scholars in exile ( notgemeinschaft deutscher wissenschaftler i m ausland ) together with the budapest pathologist philip schwarz ( 18941962 ) and the mainz novelist carl zuckmayer ( 18961977 ) , he sought refuge in amsterdam , finishing his seminal publication deraufbau des organismus [ the architecture of the organism ] ( harrington , 1991 , pp . stern stayed in germany until 1935 , before he left for london and eventually reached new york . here a tight networking between contemporary international scientists comes into play , as his mentor from munich days , walther spielmeyer , had met the montreal neurosurgeon wilder penfield ( 18911976 ) , previously familiar with stern s work , on penfield s lecture tour to north and south america in 1931 ( weber , 2000 , p. 240f ) . also , stern s new acquaintance with a canadian neurophysiologist at queen square who had supposedly been herbert h. hyland ( 19001977 ) from toronto and who was in london exactly during this time helped likewise so that stern could leave for montreal , where he immediately began to work in a mental hospital then on the outskirts of the city ( hspital de ntre dame ) . spielmeyer had already gotten in contact with penfield through letter communication by otfrid foerster ( 18731941 ) . he was later invited by the montreal neurosurgeon to visit the neurological institute of mcgill university on his lecture tour to north america . also a transatlantic contact endured between goldstein and franz alexander ( 18911964 ) , since both had frequently been encountered at the joint seminars of the neurological institute with the psychoanalytical institute in frankfurt am main ( see laier , 1994 , pp . as penfield was to inaugurate a psychiatric department to complete his neurological institute , he recommended stern to the biological psychiatrist d. ewen cameron ( 19011967 ) as the designated director . shortly after the allan memorial institute ( ami ) had opened , in 1943 , stern was explicitly working for the latter s geriatric unit together with the czech - born and german - trained physician vojtech albert kral ( 19031988 ) ( see fig . 1 ) . he further taught the students courses as a research assistant , and later as an assistant professor for psychiatry ( hogan , 2007 , pp . however , as stern admits in his autobiography the pillar of fire , his interests in neuro - oncology and the cognitive defects in clinical psychiatry went further than the narrow program , as well as the the routine culture at the montreal neurological institute ( mni ) and the royal victoria hospital . in fact , stern came into a preexisting interdisciplinary hospital setting , which was soon conceptually and also locally separated between its main players , the mni and ami . the mni mainly fulfilled penfield s specific needs , that is , the different departments of epileptology , neurosurgery , neurology , and neuropathology were service institutions for an extended research program for the mapping of the human cortex . not regarding the personally problematic relationship between renowned professor cameron , and the migr psychiatrist stern on his staff , stern also left montreal at the end of the 1950s to assume a leading role in clinical psychiatry in ottawa . between 1951 and 1975 , he continued to work as a clinical psychiatrist at the university of ottawa , yet no longer being a laboratory brain researcher . for more than a decade , he also served as the head of the psychiatry department and promoted an integrative clinical approach that also encompassed psychoanalytical therapy options ( stahnisch & pow , 2015 , p. 246).figure 1 . karl stern ( first person right of d. ewan cameron in the center ) at the allan memorial institute ( ami ) , circa 1946 . theodore i. sourkes , mcgill university , montreal , canada . reproduced by permission of dr . spielmeyer had already gotten in contact with penfield through letter communication by otfrid foerster ( 18731941 ) . he was later invited by the montreal neurosurgeon to visit the neurological institute of mcgill university on his lecture tour to north america . also a transatlantic contact endured between goldstein and franz alexander ( 18911964 ) , since both had frequently been encountered at the joint seminars of the neurological institute with the psychoanalytical institute in frankfurt am main ( see laier , 1994 , pp . karl stern ( first person right of d. ewan cameron in the center ) at the allan memorial institute ( ami ) , circa 1946 . conditions for the transfer of ideas and methods were ideal in the case of karl stern , although his biography can not really be regarded as a success story in terms of theory change in the neurosciences . on the one hand , goldstein s group , to which he belonged in the early 1930s , was about to transfer moabit hospital into one of the country s major centers for neuroscientific research , but the machtergreifung of the nazis diminished all their plans . it represents in a nutshell many other areas of medical science that stood in opposition to the ideals of nazism and could not continue as traditions in germany . with a view to the cultural picture of science , holist neurology ceased to exist , when the goldstein group continued its work in spheres of clinical and experimental psychology . on the other hand , stern himself came into a preexisting interdisciplinary hospital setting at the mni , which was highly organized , although not in a broad and holistic fashion as many german centers . it rather fulfilled penfield s and later cameron s specific research needs ( feindel , 1991 , p. 821f ) . this story is far from complete , however , if it is not considered in terms of personal success and institutional change . numerous oral history accounts underline stern s noteworthy talent as an academic teacher , who seemed to have interested a whole new generation of montreal medical students in the histological study of the brain ( feindel , 1984 , pp . it also informs us about the necessity of broad education and training , often forgotten by a disciplinary tunnel vision on scientific excellence disrespecting a solid training base as the source for future innovations . the view on the cultural picture of science thus shows that stern s life and work was doubly prevented from blossoming into a full biomedical career in the beginning years by national socialist - politics and then as a coworker to cameron s program . his case can thus be seen as a conversion from a basic neuroscientific researcher into a fervent clinician and influential university teacher . thus , stern s case counts in favor of the assumption that emigration - induced scientific change must be separated from general scientific change at various levels from the individual to the cultural , although in this example this would have to be done in a narrow if not to say negative sense . in contrast with the first example and despite the emigration of a mind with its methods , no thorough induction of scientific change can be identified in stern s case , but contrafactually might have well been , if the facilities at moabit hospital had not been resolved by nazi officials . similar to stern s individual fate in canada , the goldstein group fell apart and the research of its members took on a very different direction . goldstein himself entered a private practice of neurology and psychiatry , after he had arrived in new york city in 1935 , dispersing his own work between an appointment as clinical teacher of psychopathology at columbia and further running a small neurophysiological laboratory at montefiore hospital . although he stayed in close letter exchanges with other diaspora members of this former group , they all now went their own ways , such as the neuropathologist walther riese ( stahnisch & pow , 2014 , pp . riese also left holist neurology and ventured into theoretical neuropsychology , and later medical history . goldstein s former clinical psychologist , adhmar gelb , had died in 1936 , after losing his chair at the university of halle and not living up to travel to the united states , where he was to assume a professorship in experimental psychology offered to him by kansas university . the decline of the school was further reflected in stern s fate in canada , who rather supplemented the neuropathological expertise at montreal s mni and ami , before deciding to continue his work later as a clinical psychiatrist in ottawa . university archives of the university of ottawa , on ( fonds 43 nb-3056 , karl stern , human resources files ; fonds 6 nb-9656.8 ) , passim . university archives of the university of ottawa , on ( fonds 43 nb-3056 , karl stern , human resources files ; fonds 6 nb-9656.8 ) , passim . with a view to the cultural perspective of scientific and clinical practice , it is certainly possible to see the cases of stern , goldstein , and riese not simply as additional biographies related to the forced migration wave from germany . instead , their histories tell us more about the actual production processes of knowledge in medicine and neuroscience . on the one hand , goldstein s group was clearly about to transfer moabit hospital into an important center for neuroscientific research in germany , but the machtergreifung of the nazis diminished all their plans . on the other hand , all of these migr neuroscientists came into preexisting clinical and research settings with their specific interplay of conceptual , personal , and research relations , in which , taking up a word of stern s ( 1951 , p. 77 ) , methods [ had already ] become mentalities . that is , they had to cope with the local north american research cultures and mostly had to abandon their own holistic ideas to more applied forms of neurology and patient testing , however , still influencing local practices : in stern s case , a strong emphasis on psychoanalytical psychopathology , in goldstein s example , a thorough way of clinical observation and history taking , and riese served as an important role model in his faculty , combining in - depth neuropathological knowledge with clinical alertness and a wide range of historical and interdisciplinary scholarship . so in their local settings , there still survived a bit of holist patina , which impressed faculty colleagues and strongly influenced their students . and stern was also very influential in his relation to the younger faculty members at the ami , for example , as the later psychiatrist and psycho - immunologist dr . edrita fried ( b. 1934 ) , associate in stern s service , has stated ( sourkes & pinard , 1995 , p. 151 ) . the instances of scientific and knowledge changes that can be extracted from this case example both apply to laboratory and clinical practice as well as to the emergence of new kinds of interdisciplinarity : the reconstruction of differing neuroscientific research styles or cultures hence shows the necessity to go beyond the more classical perspectives of the history of ideas , of institutional historiography , or the writing of individual scientists biographies and to take the communication and teaching networks of the migrs into account as well . this holds for the cultural patterns inscribed into thought and practice , national identities , and international contacts during the constitutional phase of the emerging neurosciences ( rosen , 1944 , p. 39 ) . the role of the stranger in creating innovative fields and disciplines in new cultural environments is of pivotal importance . just as the social need for comparison in the immigrant individual becomes a vital property for adaptation in the new cultural surrounding , the ability to criticize and relate to preexisting research traditions assumes ample input from local cultural values , readily shaped interpretations of new observations , or clinical skills . an important , though quite dated source in related medical historiography is rosen ( 1944 , p. 39 ) . thus , it becomes possible to study the interdisciplinary exchanges in a rather in - depth manner as these continued in both collaborative clinical and theoretical work despite the disrupted and dispersed local contexts along the american east coast , mediated by letter exchanges , phone calls , and the still very dense railway system in the 1950s . the role of the stranger in creating innovative fields and disciplines in new cultural environments is of pivotal importance . just as the social need for comparison in the immigrant individual becomes a vital property for adaptation in the new cultural surrounding , the ability to criticize and relate to preexisting research traditions assumes ample input from local cultural values , readily shaped interpretations of new observations , or clinical skills . an important , though quite dated source in related medical historiography is rosen ( 1944 , p. 39 ) . with respect to the north american medical context in the 1930s , and apart from the philanthropic endeavors of the emergency committee for displaced physicians ( zimmerman , 2006 ) , and the assumed responsibility of the rockefeller foundation for its former fellows and awardees , there had to be either a substantial need for research expansion or some perceived deficiency in scientific competences and clinical care , before the knowledge of the migrs could come into play ( pearle , 1984 ) . until that was the case and even in times of the transition into migrs resumption of professional work , they relied heavily on scientific colleagues , politicians , business men , and even family members to facilitate their reintegration process in their new host countries . in fact , landing in the united states outside of the contemporary population quotas for german , austrian , czech , and polish immigrants or without sufficient proof of having been a university teacher in the country of origin was only possible through the individual affidavit of american citizens who declared to sustain migrs in times of financial hardship ( davie & koenig , 1949 , pp . beyond migrs positive experiences , the failures , backlashes , and even hostilities that many of the migrs neuroscientists had to face in their private and working lives , deserve further scrutiny . this was particularly the case during the early years following their arrival in a generally anti - german and often even outright anti - semitic climate before the war , which led to their exclusion from the professional job market , cultural misunderstandings as to their former positions , along with insufficient language proficiency that created many disturbances among their academic peers ( stortz , 2003 , pp . in addition , there was also a widespread mood of resignation among many of the german - speaking migrs , particularly during the first three years of the war , when the blitzkrieg brought many european countries under nazi occupation and when family members had been imprisoned or even interned in penitentiaries and concentration camps . for some , they simply had not received any news from their loved ones on the other side of the atlantic . like many other contemporary immigrant groups , german - speaking migrs also used to stay together in similar neighborhoods of major north american cities , such as the lower east side in new york city , clayton neighborhood of st . their constant devaluations of american culture were proverbial , with ongoing exchanges about their former experiences from previous lives in central europe . in their kaffeekraentzchen , salons , and gespraechsrunden , which often became known as the group meetings of the beiunskys ( bien de chez nous ) ( sachs , 1998 ) , there was no separation by profession between scientists , artists , and writers , of course , serving the basic functions for moral and practical support in continued interdisciplinary exchanges ( grob , 1983 ) . by applying a network - oriented approach to such historical processes , the classical perspectives confined to certain types of gains and losses in differing neuroscientific research styles such a network approach may indeed be seen as a reformulation of what harvard historian of science thomas s. kuhn ( 19221996 ) had once called a disciplinary matrix ( kuhn , 1977 ) , that is , the commitment and involvement of individual scientists to the shared conceptual resources , values , instruments , techniques , and practices of their respective community . thus , in the field of the neurosciences , the actions of the main players and mediators of such a matrix may be feasibly reconstructed with regard to varying organizational and contextual points ( meyer , 2001 , p. 93 ) . regarding such specific scholarly networks in relation to others , it has to be born in mind that their forms and characteristics varied markedly due to their intrinsic composition through the academics , economists , politicians , and nonprofessional actors involved . however , their results may in the end be quite equivalent , as most academic , clinical , or organizational positions were acquired via personal relations , academic references , and the reputation of the teaching or research institutions at the time . this leads also back to the central question on the elements that have triggered and fostered the theory - change in the neurosciences under various cultural , social , and institutional conditions . exemplary are the official as well as unofficial networks within the german research society , the kaiser wilhelm society , and the early german research institution for psychiatry that played major roles in the support , placement , and connection of the migr neuroscientists from central europe in the united states and canada ( hammerstein , 2000 , pp . here , it is important to methodologically integrate the status of collective biographies , scientific networks , and interdisciplinary endeavors into this particular historical analysis of knowledge change in the neurosciences . in this respect , it will have to be kept in mind that not only highly skilled individual researchers had to leave central european universities during the nazi period , but also often whole research schools were forcefully expelled from the german - speaking countries . as an example , i want to draw the attention to the case of clinical neurologist and psychiatrist robert weil ( see fig . 2 ) , who belonged to a group of german - educated neuroscientists of the provinces of the former austrian - hungarian double - monarchy . he was born into a jewish family in a rural part of bohemia , yet in his adolescence he converted to lutheran protestantism . weil was one of many clinical and social psychiatrists during the 1930s , who displayed a profound research interest in various areas of psychiatry , ranging from nosology , psychoanalysis well over to the neuro- and histopathology of the brain . he had graduated from the german university of prague in 1933 and pursued postgraduate studies in neurology and psychiatry at the vienna medical school . he then worked as an army psychiatrist between 1935 and 1938 in prague and in bohemia , before he fled together with his family for the united kingdom and later to canada , following the annexation and the ceding of parts of czechoslovakia to germany ( baglole , 2002 , p. 64 ) . with many other migr medical scientists , after the passage to canada , weil shared the fate of many migrs of being transported to one of the more remote areas of saskatchewan in the prairies , where he was allowed to practice medicine as a general practitioner between the years of 1939 and 1942 . until 1944 he interned in neurosurgery at the saskatoon city hospital and eventually during the war years , weil managed to work with the saskatchewan mental health service until 1949 . predominantly practiced under poor conditions in mental hospitals , and in which he regarded university psychiatric teaching to be uncommon as a subject of study in canadian universities . letter of robert weil , halifax , ns , to the psychiatrist dr . charles a. roberts ( 19181996 ) in ottawa , dating june-7 , 1986 : in 1942 i joined the mental health services of saskatchewan , my first position [ in canada ] being a junior psychiatrist in the sask . clarence [ m. ] hincks [ 18851965 ] who visited our hospital almost yearly . on one of these visits he was accompanied by dr . both sat in on our conferences and also gave us the opportunity to meet and get to know them in personal conversations . both clarence and jack were always welcommed [ ! ] [ sic ] visitors who brought us all kind of informations [ ! ] [ sic ] about the psychiatric activities , developments etc from all the provinces . they also shared with us their visions and plans for the improvements in the care for the mentally ill . ; citation taken from his typographed letter from the folders on the robert weil correspondence ( ms 2 - 750 , call # 2003 - 47 , box 8 , file 15 , p. 1 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . in comparison , neurology and psychiatry at the charles university of prague weil s alma mater had previously risen to international recognition under arnold pick ( 18511924 ) and ladislav hakovec ( 18661944 ) , who expanded compulsory university training in neuropsychiatry , psychopathology , and areas of social psychiatry to all medical graduates.figure 2 . robert weil ( a very rare portrait photograph , c. 1984 ) from the program invitation to his funeral ceremony in 2002 ( robert weil correspondence , ms 2 - 750 , call # 2003 - 47 , box 6 , file 1 ) . dalhousie university archives & special collections , killam memorial library , halifax , canada . reproduced by permission of dalhousie university archives & special collections , killam memorial library , halifax , canada . charles a. roberts ( 19181996 ) in ottawa , dating june-7 , 1986 : in 1942 i joined the mental health services of saskatchewan , my first position [ in canada ] being a junior psychiatrist in the sask . mental hospital in battleford . clarence [ m. ] hincks [ 18851965 ] who visited our hospital almost yearly . on one of these visits he was accompanied by dr . both sat in on our conferences and also gave us the opportunity to meet and get to know them in personal conversations . both clarence and jack were always welcommed [ ! ] [ sic ] visitors who brought us all kind of informations [ ! ] [ sic ] about the psychiatric activities , developments etc from all the provinces . they also shared with us their visions and plans for the improvements in the care for the mentally ill . ; citation taken from his typographed letter from the folders on the robert weil correspondence ( ms 2 - 750 , call # 2003 - 47 , box 8 , file 15 , p. 1 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . robert weil ( a very rare portrait photograph , c. 1984 ) from the program invitation to his funeral ceremony in 2002 ( robert weil correspondence , ms 2 - 750 , call # 2003 - 47 , box 6 , file 1 ) . dalhousie university archives & special collections , killam memorial library , halifax , canada . reproduced by permission of dalhousie university archives & special collections , killam memorial library , halifax , canada . consequently , in this institution and later by his colleagues of the saskatchewan mental hospital at battleford , it was realized that weil was a broadly trained psychiatrist and neurologist , who had a lot of experiences in field psychiatry , due to his earlier appointment in the medical service of the czech army . his biography thus represents one of numerous examples , in which a neuroscientist arriving from central - europe found poor clinical and mental health conditions in north america in comparison with those he was acquainted with in the german - speaking context . for weil s perception of the canadian context of psychiatry and mental health see reports ; notes & articles on interdisciplinary research ; materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , box 2 , file 5 ; box 5 , file 3 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . as weil perceived it , the subject of mental health was quite uncommon at canadian universities and not very well established as a serviceable system in the rural areas of the country . at this critical juncture of his career , his broad knowledge in psychiatry , his engagement in setting up a wider mental health system , and his social contacts with leading members of the saskatchewan health service and the canadian psychiatric community earned him such recognition that weil was hired as the first assistant professor of psychiatry by dalhousie university in nova scotia . he even managed to get this post against the stern reluctance of the officers of the medical society of nova scotia and their earlier policy , lasting between 1910 and 1930 , not to accept aliens and jewish - born doctors from other countries ( hincks , 1947 , pp . weil stayed at dalhousie university from 1950 to 1975 and then retired at the level of an associate professor . as a member of its core faculty , he exerted a strong influence on the hiring policy of that university and the organizational restructuring of its services in psychiatry , neurology , and neuropathology , in which he promoted a it is remarkable , and yet typical of many other migr neuroscientists , that weil displayed a thoroughly scientistic attitude to a variety of perspectives on psychiatry . although strongly influenced by experiencing his and his wife s expulsion from their home country as well as the general political events , which he academically discussed and heavily criticized in many of his papers and articles . he believed in a unifying and quite cathartic effect of science on its digression in ideology and technocracy . in a way , a general outlook of science and the humanist attitude in psychiatry served for him as residuum non destructum in times of personal despair and general political worries after his immigration to canada : this discrepancy between our knowledge and our behavior makes it so difficult today to orient oneself in this chaos of our enigmatic world . man now stands confused before his own creation complicated by so many technical devices which he is unable to control . and in his confusion and his insecurity he is always more tempted to reach for a gun than for an instrument of peace . war appears to be still a better and safer alternative to a peaceful adjustment of our environment to our needs and a better adaptation of mankind to the material world which presents itself to us.as you see , there are two main problems we have to face in modern time . firstly , we have to utilize our knowledge for practical application that is a matter of economics and politics and therefore outside of my realm.the second large problem of mankind is a psychological one . it is the problem of the adjustment of individuals and groups to the environment which is set for him the moment he is born . it is also the problem of redirecting our mental potentialities to a healthier attitude towards the material world which surrounds us & towards our fellowmen . from weil s address to the cpa in 1953 ; citation taken from his manuscript typography from the folders on the robert weil correspondence ( ms 2 - 750 , call # 2003 - 47 , box 6 , file 15 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . for weil s perception of the canadian context of psychiatry and mental health see group for the advancement of psychiatry . reports ; notes & articles on interdisciplinary research ; materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , box 2 , file 5 ; box 5 , file 3 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . this discrepancy between our knowledge and our behavior makes it so difficult today to orient oneself in this chaos of our enigmatic world . man now stands confused before his own creation complicated by so many technical devices which he is unable to control . and in his confusion and his insecurity he is always more tempted to reach for a gun than for an instrument of peace . war appears to be still a better and safer alternative to a peaceful adjustment of our environment to our needs and a better adaptation of mankind to the material world which presents itself to us . as you see , there are two main problems we have to face in modern time . firstly , we have to utilize our knowledge for practical application that is a matter of economics and politics and therefore outside of my realm . it is the problem of the adjustment of individuals and groups to the environment which is set for him the moment he is born . it is also the problem of redirecting our mental potentialities to a healthier attitude towards the material world which surrounds us & towards our fellowmen . from weil s address to the cpa in 1953 ; citation taken from his manuscript typography from the folders on the robert weil correspondence ( ms 2 - 750 , call # 2003 - 47 , box 6 , file 15 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . from weil s address to the cpa in 1953 ; citation taken from his manuscript typography from the folders on the robert weil correspondence ( ms 2 - 750 , call # 2003 - 47 , box 6 , file 15 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . his work thoroughly introduced german ideas of social psychiatry and interdisciplinary teaching and research , while helping to establish a more effective level of education and patient care in the canadian public mental health system ( dowbiggin , 2003 ) . his stronger engagement with mental health issues can be seen as an individual example of change from his primary interest in somatic neurology and neuropathology . neither in the czech army nor in the canadian health system could his interests be fully met ( dalhousie university , 2002 , p. 1 ) . what this example shows , however , is definitely not that canadian social psychiatry and the development of dalhousie s facilities in the neurosciences could not have emerged without robert weil . it makes plausible that under his supervision and tutelage , the historical course taken would have had a different velocity and would have ventured into new directions ( weil & demay , 1947 ; weil , 1960 ) . the course of these events certainly appears to be a mixture of institutional circumstances and biographical factors , as this highly intellectual man , who not only reflected in numerous sociological and philosophical articles on the cultural background of the neurosciences but also shaped and reshaped the research outlook of areas of biological psychiatry and bench neuroscience at his university , proved himself to be an effective and pragmatic science organizer , who integrated these ideas into the institutional setting of his medical school . dalhousie , at that time , experienced an increase from two to eight professorships in neurology , psychiatry , neuropathology , and neuroanatomy , while he was an active faculty member . elective programme ; materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , 1 p. , box 5 , file 3 ; box 6 , file 11 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . elective programme ; materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , 1 p. , box 5 , file 3 ; box 6 , file 11 ) in the dalhousie university archives & special collections , killam memorial library , halifax , ns . the central points addressed by weil also strongly influenced a development in canada , which gerald grob has characterized as the emphasis on the prevention and on the provision of care and treatment in the community for us psychiatry ( grob , 1983 , p. 232 ) . the mental health problem from large hospitalization numbers was perceived as highly demanding also by the psychiatrists of the canadian and american psychiatric clinics and asylums thus bearing widespread implications for the mental health system . it is important to see that migr doctors exerted a strong impact on the canadian and us mental health systems , which was , however , preceded by reevaluations going on in various parts of europe , mainly in areas of the former austro - hungarian empire , in italy , switzerland , and germany . these particular refugee scientists and medical doctors must have been well trained to arrive at a tenacity of solving problems and overcoming all sorts of constraints and obstacles in their clinical or laboratory research , as was the case with many migr neuroscientists , who had been trained in some of the leading centers in central europe . from a social history viewpoint , the emigration of scientists and scholars after 1933 can even be understood as a spectacular case of forced international elite - circulation , but that circulation did not happen automatically . instead , before we may take scientific change into account , we need to question who got the opportunity to continue or begin scientific work , and thus at least a potential position to participate in changes of research trends in his or her host country ? very likely , those individuals had to have the necessary aptitude to convince greater audiences , as well as the social and basic linguistic competences to negotiate budgets with administrative officers . that the requirement of such soft skills is far from trivial would become fairly obvious in the case of many migr neuroscientists , who often needed to pass medical exams before being allowed to practice again . they had to find jobs in research institutes or medical faculties , and were to serve in low - paid or nonsalaried voluntary positions , etc . for example , other research import products from migr neurologists and psychiatrists such as the neurorehabilitative approach of the holist neurologist kurt goldstein from frankfurt and berlin , the psychiatric genetics and epidemiology of the berlin psychiatrist franz josef kallmann ( 18971965 ) , or the introduction of the psychopharmacological chlorpromazine therapy chlorpromazine therapy had been introduced by the psychiatrist and biochemist heinz lehmann , who had promoted the development in the french - speaking literature also among the english - speaking north american research communities in psychiatry and neurology.for a long time stood in the cultural shadow of dominant psychoanalytical theories . in american psychiatry , the clinical psychoanalysts influenced both the state hospital system as well as the large psychiatric hospitals of the veterans administration between the 1940s and the 1960s , before these major approaches further developed into some important research traditions in the field of modern neuroscience . personal interview with mni neurologist fred andermann , may 26 , 2007 , in the faculty club of mcgill university in montreal , pq . moreover , heinz lehmann at the allan memorial institute , the psychiatry department at mcgill , contributed the first research publications on chlorpromazine in english in 1953 and , three years later , on the antidepressant imipramine ( anonymous , 1993 , pp . lehmann represented one of those german - speaking migr physicians with whom weil upheld continuous letter exchanges after their mutual emigration to canada . for example , letter on august 19 , 1953 by robert weil to heinz edgar lehmann about the issue of clinical hypnosis and their mutual work on the canadian special commission on hypnosis and hypnoanalysis . materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , box 2 , file 5 ; box 5 , file 3 ) in the dalhousie university archives . chlorpromazine therapy had been introduced by the psychiatrist and biochemist heinz lehmann , who had promoted the development in the french - speaking literature also among the english - speaking north american research communities in psychiatry and neurology . personal interview with mni neurologist fred andermann , may 26 , 2007 , in the faculty club of mcgill university in montreal , pq . for example , letter on august 19 , 1953 by robert weil to heinz edgar lehmann about the issue of clinical hypnosis and their mutual work on the canadian special commission on hypnosis and hypnoanalysis . materials from the folders of the robert weil collection ( ms 2 - 750 , call # 2003 - 47 , accession report , box 2 , file 5 ; box 5 , file 3 ) in the dalhousie university archives . when looking more closely at the contributions of individual migr neuroscientists , such as heinz lehmann at mcgill university , the role and influence of the process of reintegration of the exiled neuroscientists in canada and the united states becomes more comprehensible . the vital function served by north america was that of a safe haven for the expelled scientists and intellectuals , a harbor for ideas , epistemologies , and innovative experiments , and a refuge for europe s cast - off intelligentsia during the rise of the nazi tyranny , holocaust , and second world war . despite a certain amount of attention paid to these homeless intellectuals in recent publications ( weindling , 1989 ; deichmann , 1996 ; israel , 2004 ) , their impact on and relation to american science and medical culture has not yet been fully explored . for many , coming to north america was like : parachuting from europe into the new world of north american psychiatry at the very brink of wwii with nothing in my backpack other than kraepelin s and bleuler s guides to the diagnosis of the major psychoses , manic - depressive disorder , and schizophrenia . we had only two theories to explain the rest of the psychiatric illnesses , the neuroses and personality disorders : freud s psychoanalysis and pavlov s and skinner s findings on conditioning and learning . personal file ( professor h. lehmann ) , collections of the university archives , mcgill university , montreal , canada . parachuting from europe into the new world of north american psychiatry at the very brink of wwii with nothing in my backpack other than kraepelin s and bleuler s guides to the diagnosis of the major psychoses , manic - depressive disorder , and schizophrenia . we had only two theories to explain the rest of the psychiatric illnesses , the neuroses and personality disorders : freud s psychoanalysis and pavlov s and skinner s findings on conditioning and learning . personal file ( professor h. lehmann ) , collections of the university archives , mcgill university , montreal , canada . personal file ( professor h. lehmann ) , collections of the university archives , mcgill university , montreal , canada . faced not only with expulsion from academic working circles but also prohibited from pursuing their career ( a berufsverbot ) , many of the neuroscientists looked at , here , searched to escape the situation in the german - speaking countries and to establish a new professional life elsewhere . this was also the case in the clinical neurologist and psychiatrist lehmann , who had been born as the son of a jewish physician in berlin ( see fig . he had himself studied medicine in marburg , as well as at the psychiatric centers of freiburg in germany and vienna in austria . between 1935 and 1937 , he pursued postgraduate research while being a staff - attending physician ( assistenzarzt ) at the martin luther stift and at the jewish hospital of berlin . in 1937 , after he had been barred to continue his medical work as a hospital physician even for his jewish patients , he managed to immigrate to canada on a tourist visa . immediately after his arrival in montreal in quebec , he was offered the position of a hospital physician at the verdun protestant hospital , which became the main clinical center of the psychiatric research divisions of mcgill university s allan memorial institute ( ami ) . rising fast through the academic ranks , in 1947 , he even became its clinical chief , which was rather a parallel reflection of the research interests of the somatic psychiatrist cameron at the ami . yet , other than in the example of karl stern , lehmann could benefit strongly from the support of the scientific and clinical milieu of the ami with its contemporary biological research programs ( sourkes & pinard , 1995 , pp . at the same time , lehmann managed to turn his solid education in french language from his berlin high school times into a large medical asset ( lehmann , 1983 , pp . 145154 ) . shortly after chlorpromazine had been developed by the psychiatrists and neurochemists , jean delay ( 19071987 ) and pierre deniker ( 19171998 ) in france in 1952 after world war ii , lehmann introduced the drug among the english - speaking clinical neuroscientists in north america lehmann now redirected his own psychiatric research solely from a psychopharmaceutical perspective and particularly towards the treatment of schizophrenic patients . one could even go so far as to view his work at mcgill university as a stepping stone for his additional activities in psychiatry and public mental health in the provincial comit de la sant mentale de quebc , as an american fellow of the collegium internationale neuro - psychopharmacologium , along with being a canadian representative and expert for the world health organization in new york.figure 3 . osler library of the history of medicine , mcgill university , montreal , quebec , canada . reproduced by permission of the osler library of the history of medicine , mcgill university , montreal , quebec , canada . osler library of the history of medicine , mcgill university , montreal , quebec , canada . reproduced by permission of the osler library of the history of medicine , mcgill university , montreal , quebec , canada . a defining feature for the biographical differences between stern and lehmann had openly been their diverging socialization in the medical research landscape in germany before their forced migration to canada . of course , they both had excellent language proficiency in french , which they could further perfect while working in the french - canadian surroundings of montreal . however , both migr neuroscientists used these soft skills in quite different ways : while stern primarily related to the francophone scientific community of quebec and aligned through his scientific connections particularly with the psychoanalytically schooled psychiatrists of france and quebec , lehmann emerged as a decisive bridge - builder between the new biological tradition of psychopharmacology in france and french - speaking switzerland with their developed pharmaceutical and chemical industries . lehmann was an important gatekeeper , who could introduce these impulses and initiatives into the english - speaking world of north american psychiatry ( stip , 2015 , p. s5 ) . another instructive example of a successful , though slightly changing career in the clinical neurosciences , is the professional silberberg - couple from breslau , where the female pathologist ruth silberberg ( 19061997 ) had to work four years without salary while her husband , the neurohistologist martin silberberg ( 18951969 ) , had to change from one low - paid and short - term position to the next one , first working in halifax , nova scotia , in canada , then in new york city and st . louis in the united states . in his letter exchange with his mentor , the american physician leo loeb ( 18691959 ) , martin silberberg respectively wrote on august 4 , 1938 , on the occasion of a job opening at the middlesex university in massachusetts : dear dr . loeb , i am sick and tired of moving around , unless it means a definitive step forward . letter of martin silberberg ( st . louis ) to leo loeb ( staying at woodshole ) on april-4 , 1938 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . i am sick and tired of moving around , unless it means a definitive step forward . herefore [ ! ] letter of martin silberberg ( st . louis ) to leo loeb ( staying at woodshole ) on april-4 , 1938 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . letter of martin silberberg ( st . louis ) to leo loeb ( staying at woodshole ) on april-4 , 1938 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . and also the move of the sternbergs to the rockefeller institute in new york did not prove to be a great relaxation of their tense living circumstances : dear doctor loeb , nothing has been heard of promotion or raises of salaries , since dr . [ it is the policy of the school to exploit everybody and to make use of everybody s plight . the school has the highest percentage of jewish [ ! ] students , who are glad to pay fees that are about 30% higher than yale s or harvard s . on the other hand , the salaries paid to the faculty are ridiculous . but , what can we do , if the difficulties to obtain a fairly decent position are unsurmountable [ ! ] ? [ william c. ] von glahn [ 19001961 ] lets us have our own ways in research . letter of martin silberberg ( nyc ) to leo loeb ( st . louis ) on dec-2 , 1943 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . it is the policy of the school to exploit everybody and to make use of everybody s plight . students , who are glad to pay fees that are about 30% higher than yale s or harvard s . on the other hand , but , what can we do , if the difficulties to obtain a fairly decent position are unsurmountable [ ! ] ? [ william c. ] von glahn [ 19001961 ] lets us have our own ways in research . letter of martin silberberg ( nyc ) to leo loeb ( st . louis ) on dec-2 , 1943 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . letter of martin silberberg ( nyc ) to leo loeb ( st . louis ) on dec-2 , 1943 ; archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) . this is only one out of many examples that serves to illustrate that the north american context was bursting with all kinds of pragmatic problems , which the newly arriving migr neuroscientists had to master before they could resume their research and clinical work . originality in their scientific work certainly was an important factor to enter major research groups and to gain acceptance in the scientific communities in canada and the united states . nevertheless , innovative ideas and the mastering of methods , which were not then accepted in their new host countries , proved to be an ambiguous advantage for the migrs researchers . an abundant amount of methodological originality , and thus difference in clinical or research style , could easily lead to incommensurable scientific views to those held by the local research community ( as in the cases of holist neurology , the shock therapies in brain psychiatry , or the use of the new psychopharmaceutical drugs , which had yet not been introduced in north america ) . this made it even harder to find good integration into day - to - day - research work in normal science and implies that some narratives will clearly fall into areas of traditional science studies and historical epistemology , as they are current since the works of thomas s. kuhn ( 1962 ) , georges canguilhem ( 1966 ) , robert k. merton ( 1973 ) . this made it even harder to find good integration into day - to - day - research work in normal science and implies that some narratives will clearly fall into areas of traditional science studies and historical epistemology , as they are current since the works of thomas s. kuhn ( 1962 ) , georges canguilhem ( 1966 ) , robert k. merton ( 1973 ) . important in this context is that discussions on migr scientists and physicians had long centered on a preselected group of outstanding individuals , whereas less attention was paid to those more marginal in their field . it is therefore of great importance for further advancement in the historiography of forced migration to draw specific attention to such rather hidden biographies of normal scientists and to cases of unsuccessful adaptation in their specific contexts . this will serve the development of a better understanding with regard of the broad transformations and the knowledge transfer in the field of neuroscience . the application of such a perspective will further enable us to also answer such questions as to why it was that the mental health system in canada and parts of the united states appeared so underdeveloped in comparison with the contemporary state of psychiatry and public health in central europe . what were the factors that made new research initiatives possible and applicable in the north american contexts ? and which factors enabled german - speaking migrs in particular to overcome everyday problems , research constraints , and cultural differences to contribute to the research traditions of brain psychiatry and clinical neuroscience ? although this had not been an attractive situation , it was possible to find one individual among the migrs neuroscientists . an extraordinary pathologist ruth silberberg , a breslau - trained developmental brain scientist , who fled with her husband , the neurohistologist martin silberberg , first to halifax and eventually settled in st . ruth accepted invitations through the german pathological society and individual university institutes to give guest lectures and seminars in germany during the late 1950s and early 1960s . it was only at the time of martin s death that she decided to accept an adjunct professorship at the university of zurich where she frequently taught during the summer break . see in archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) , no page number . ruth silberberg intriguingly represents an migr researcher who had an important voice in both medical communities one that was strongly heard in her own field of pathology as well as in clinical education ( cf . see in archives and rare books collection of the becker library , washington university school of medicine ( fc0002 , leo loeb , correspondence r - s , box 5 , folder : silberberg , martin and ruth ) , no page number . as mentioned in the introduction of this article , a more or less unquestioned belief in the historiography of science and medicine at large suggests that the process of forced migration in twentieth - century medicine and natural science can be specifically viewed as a process leading to a brain gain of the receiving countries ( such as the united states and canada in north america ) ( quirke & gaudillre , 2008 , p. 442 ) . the related view has nearly gone uncontested , namely that it made no difference for a biomedical researcher to substitute frankfurt am main for ottawa , ontario , breslau for halifax , nova scotia ; or berlin for montreal , quebec , as the respective sites for their research programs and clinical activities . this assumption had some plausibility when compared with the careers of migr professionals in the arts , in politics , or in the legal sphere ( strauss & roeder , 1983 ) . at a second glance , however , the above position of international universality is also not compelling when it is compared with other immigrant groups in the arts and film actors of the hollywood entertainment industry . in these seemingly unrelated fields , a transfer of knowledge and people could not take place without having to face greater cultural problems ( taylor , 1983 , pp . the historical analysis of the group of migr neuroscientists thus presents itself as a most interesting test case for newer approaches in the historiography of science that have interpreted the evolution and aberrations of the biomedical enterprise on grounds of their entanglement with culture . using historiography as a detailed description of research , laboratory practices , and clinical care approaches allows for a more adequate view of the underlying historical processes , particularly an integration of various communities of neurologists , psychiatrists , and brain investigators into preexisting american research cultures . in order to come to terms with the cultural differences , which german - speaking migr neuroscientists experienced when they adapted to north american research and clinical institutions , scientific foundations , and structure of politically influenced forms of research organization , their experiences in the biomedical field at the end of the weimar republic and the beginning of the nazi period in germany 7387 ) . when considering the transfer of such multifaceted patterns of clinical and basic research , laboratory practices , and interdisciplinary linkages with mental asylums , as well as anthropological research institutions , especially the more hidden biographies and local research cultures in the context of the forced migration wave of german - speaking neuroscientists to canada and the united states , left numerous traces of the setbacks and challenges , which they encountered when they tried to recommence their careers in the north american scientific and clinical milieus . with respect to the case examples discussed in this article , we have seen that the appropriation of new laboratory practices and clinical concepts in the research communities also supported new forms of interdisciplinarity working relations that became so decisive for the neurosciences today . nevertheless , when looking at the personal experiences , group mentalities , and even the soft skills learned the hard way , it has likewise become tangible how the research programs of migr neuroscientists reflected their foregoing experiences in the medical and health care cultures from the late wilhelminian empire to the onset of nazism and fascism in central europe , as well as the problems and setbacks they encountered , when making the very demanding transition to north america and its preexisting research cultures .

abstractthis article is a historiographical exploration of the special forms of knowledge generation and knowledge transmission that occur along local cultural boundaries in the modern neurosciences . following the inauguration of the so - called law on the re - establishment of a professional civil service in nazi germany on april 7 , 1933 , hundreds of jewish and oppositional neurologists , neuropathologists , and psychiatrists were forced out of their academic positions , having to leave their home countries and local knowledge economies and traditions for canada and the united states . a closer analysis of their living and working conditions will create an understanding of some of the elements and factors that determined the international forced migration waves of physicians and clinical neuroscientists in the twentieth century from a historiographical perspective . while i am particularly looking here at new case examples regarding the forced migration during the national socialist period in germany , the analysis follows german - speaking migr neurologists and psychiatrists who found refuge and settled in canada . these individuals form an understudied group of refugee medical professionals , despite the fact that the subsegments of refugee neurologists and clinical psychoanalysts in the united states , for example , have been a fairly well - investigated population , as the works of grob ( 1983 ) , lunbeck ( 1995 ) , or ash and soellner ( 1996 ) have shown . this article is primarily an exploration of the adjustment and acculturation processes of several highly versatile and well - rounded german - speaking physicians , who had received their prior education in neurology , psychiatry , and basic brain research . they were forced out of their academic home institutions and had to leave their clinical research fields as well as their disciplinary self - understanding behind on the other side of the atlantic .

Introduction Situating a cultural view in the historiography of forced migration in the neurosciences From neuropathology to psychoanalytic psychiatry and medical education: The case example of Karl Stern From clinical neurology and psychiatry to public mental health: The case example of Robert Weil From brain psychiatry to clinical neurochemistry: The case example of Heinz Lehmann Discussion

the participants were examined between january and march 2012 , and all of them gave informed consent for participation . the study comprised patients and control participants between 25 and 65 years of age who were divided into : group one ( 2535 years ) , group two ( 3645 year ) , group three ( 4655 years ) , and group four ( 5665 years ) . the diagnosis of periodontal disease was established according to the clinical parameters of the periodontal disease index ( pdi ) , also known as ramfjord index . for the pdi assessment , six teeth were evaluated : the upper left central , first premolar and right first molar ; and the lower right central , first premolar , and left first molar were measured . examination method was applied by using university of michigan 0 probe with william 's markings at 1 , 2 , 3 , 5 , 7 , 8 , 9 , and 10 mm . each sextant was designed as either healthy ( score 0 ) ; mild to moderate gingivitis , but changes not extending all around the tooth ( score 1 ) ; mild to moderate gingivitis extending all around the tooth ( score 2 ) ; severe gingivitis ( marked redness , bleeding tendency , and ulceration ) ( score 3 ) ; a probing depth less than 3 mm ( score 4 ) ; a pocket depth from 3 to 6 mm ( score 5 ) ; or a pocket depth exceeding 6 mm ( score 6 ) , according to the scores recorded at the index teeth . cp was defined as oral health status with a pdi score of 5 and 6 . oral health status with pdi scores between 0 and 4 genomic dna was extracted from buccal swabs using the protocol of isohelix buccal dna isolation kit , which contained solution ls ( lysis buffer ) , solution pk ( proteinase k ) 1 ml , solution ct ( capture buffer ) , and solution te ( tris - edta ) , ( rehydration buffer ) ( 24 ) . agarose gel electrophoresis was applied to examine the integrity of the genomic dna ( 25 ) . about 0.75 m of each forward and reverse primers were added to a reaction mixture containing 1x ( 1.5 mm mgcl2)2 gotaq reaction buffer , pcr nucleotide mix 0.2 mm each dntp , 1.25 l of gotaq dna polymerase ( 5 u/l ) , and nuclease - free water to final volume 50 l . the pcr program was performed for 35 cycles and consisted of an initial denaturation for 2 min at 95c , 35 sec at 95c for denaturation , 52c for 35 sec for annealing , and 72c for 35 sec for extension , followed by a final extension for 7 min at 72c ( 26 ) . agarose gel electrophoresis was applied to the pcr products ( 25 ) , then pcr products were purified using the protocol of the qiaquick purification kit to remove excess salts , pcr primers , and dntps ( 27 ) . main characteristics of vdr gene polymorphisms and primers sequencesa from naito et al . after purification of the pcr products , dna cycle sequencing was performed using of bigdye terminator v1.1 cycle sequencing protocol ; 0.75 m of forward apai and bsmi , and 0.75 m of reverse foki primers were prepared . in the reaction mixture , 6.6 l of nuclease - free water was placed , followed by 4 l of ready reaction premix , 2 l of bigdye terminator v1.1 , sequencing buffer ( 5x ) and 6.4 l of apai , bsmi , and foki . the pcr program was performed for 25 cycles and consisted of an initial denaturation for 1 min at 96c , 10 sec at 96c for denaturation , 50c for 5 sec for annealing , and 60c for 4 min for extension . sanger sequencing method was applied for capillary electrophoresis ; the run was performed on applied biosystem ( 3500xl genetic analyzer ) . all statistical analyses were performed using the spss for windows , version 15.0 ( spss inc . , frequency differences of apai , bsmi , and foki polymorphisms and departure from hardy weinberg equilibrium were tested by pearson 's chi - square test which was also used to quantify the association between cp and these polymorphisms . the level of significance ( p value ) less than 0.05 was considered statistically significant for all analyses . in total , 196 male and female libyan citizens from many governmental and private dental clinics in tripoli participated in the study . the participants were examined between january and march 2012 , and all of them gave informed consent for participation . the study comprised patients and control participants between 25 and 65 years of age who were divided into : group one ( 2535 years ) , group two ( 3645 year ) , group three ( 4655 years ) , and group four ( 5665 years ) . the diagnosis of periodontal disease was established according to the clinical parameters of the periodontal disease index ( pdi ) , also known as ramfjord index . for the pdi assessment , six teeth were evaluated : the upper left central , first premolar and right first molar ; and the lower right central , first premolar , and left first molar were measured . examination method was applied by using university of michigan 0 probe with william 's markings at 1 , 2 , 3 , 5 , 7 , 8 , 9 , and 10 mm . each sextant was designed as either healthy ( score 0 ) ; mild to moderate gingivitis , but changes not extending all around the tooth ( score 1 ) ; mild to moderate gingivitis extending all around the tooth ( score 2 ) ; severe gingivitis ( marked redness , bleeding tendency , and ulceration ) ( score 3 ) ; a probing depth less than 3 mm ( score 4 ) ; a pocket depth from 3 to 6 mm ( score 5 ) ; or a pocket depth exceeding 6 mm ( score 6 ) , according to the scores recorded at the index teeth . cp was defined as oral health status with a pdi score of 5 and 6 . oral health status with pdi scores between 0 and 4 genomic dna was extracted from buccal swabs using the protocol of isohelix buccal dna isolation kit , which contained solution ls ( lysis buffer ) , solution pk ( proteinase k ) 1 ml , solution ct ( capture buffer ) , and solution te ( tris - edta ) , ( rehydration buffer ) ( 24 ) . agarose gel electrophoresis was applied to examine the integrity of the genomic dna ( 25 ) . about 0.75 m of each forward and reverse primers were added to a reaction mixture containing 1x ( 1.5 mm mgcl2)2 gotaq reaction buffer , pcr nucleotide mix 0.2 mm each dntp , 1.25 l of gotaq dna polymerase ( 5 u/l ) , and nuclease - free water to final volume 50 l . the pcr program was performed for 35 cycles and consisted of an initial denaturation for 2 min at 95c , 35 sec at 95c for denaturation , 52c for 35 sec for annealing , and 72c for 35 sec for extension , followed by a final extension for 7 min at 72c ( 26 ) . agarose gel electrophoresis was applied to the pcr products ( 25 ) , then pcr products were purified using the protocol of the qiaquick purification kit to remove excess salts , pcr primers , and dntps ( 27 ) . after purification of the pcr products , dna cycle sequencing was performed using of bigdye terminator v1.1 cycle sequencing protocol ; 0.75 m of forward apai and bsmi , and 0.75 m of reverse foki primers were prepared . in the reaction mixture , 6.6 l of nuclease - free water was placed , followed by 4 l of ready reaction premix , 2 l of bigdye terminator v1.1 , sequencing buffer ( 5x ) and 6.4 l of apai , bsmi , and foki . the pcr program was performed for 25 cycles and consisted of an initial denaturation for 1 min at 96c , 10 sec at 96c for denaturation , 50c for 5 sec for annealing , and 60c for 4 min for extension . sanger sequencing method was applied for capillary electrophoresis ; the run was performed on applied biosystem ( 3500xl genetic analyzer ) . all statistical analyses were performed using the spss for windows , version 15.0 ( spss inc . , frequency differences of apai , bsmi , and foki polymorphisms and departure from hardy weinberg equilibrium were tested by pearson 's chi - square test which was also used to quantify the association between cp and these polymorphisms . the level of significance ( p value ) less than 0.05 was considered statistically significant for all analyses . the distribution of the participants according to age groups between group one ( 2535 years ) and group four ( 5665 years ) was 15.5 , 23.7 , 30.9 , and 29.9% , respectively . according to pdi , 99 participants ( 50.0% ) were diagnosed with cp and 97 participants ( 49.5% ) were diagnosed as healthy controls . the distribution of the pdi scores between 0 and 6 was 1.0 , 2.6 , 4.6 , 11.2 , 26.5 , 32.7 , and 21.4% , respectively . cross - tabulation statistical test , which is based on pearson 's chi - square test , was used to analyze the frequency distribution , in order to find relationship between cp and both sex and age , as well as to find an association between cp and apai , bsmi , and foki vdr snps . statistically significant association between cp and both sex ( p=0.000 ) and age ( p=0.001 ) was detected ( table 2 ) . association between chronic periodontitis and age and sex the level of significance ( p<0.05 ) . the flanking regions by apai , bsmi , and foki primers were analyzed ; the lengths of the pcr products were 156 , 106 , and 146 bases , respectively . figure 1a shows a part of the sequence of the region flanked by apai primer including g / t snp rs#7975232 . in this study , the variant , c / t rs#731236 snp was detected in the region flanked by apai primers ( fig . figure 1c shows part of the sequence of the region flanked by bsmi primers including a / g snp rs#1544410 . figure 1d shows part of the sequence of the region flanked by foki primers including a / g snp rs#2228570 . ( a ) apai g / t snp ( highlighted in black , ambiguity code : k ) . ( b ) apai c / t snp ( highlighted in black , ambiguity code : y ) . ( c ) bsmi a / g snp ( highlighted in black , ambiguity code : r ) . ( d ) foki a / g snp ( highlighted in black , ambiguity code : r ) . the analysis of genotypic and allelic frequencies of the analyzed polymorphisms showed that a significant association p = 0.022 and p=0.023 , respectively , was foundbetween cp and apai c / t snp rs#731236 , whereas no statistically significant associations were observed in genotypic frequencies between cp and apai g / t rs#7975232 ( p=0.939 ) , bsmi a / g rs#1544410 ( p=0.466 ) , and foki a / g rs#2228570 ( p=0.239 ) snps . tables 37 show the numbers of the pcr products ( varied between 93 and 122 samples ) that have been successfully sequenced and read for the analyzed snps . genotypic frequencies of vitamin d receptor gene apai g / t rs#7975232 snp the level of significance ( p<0.05 ) . genotypic frequencies of vitamin d receptor gene apai c / t rs#731236 snp the level of significance ( p<0.05 ) . allelic frequencies of vitamin d receptor gene apai c / t rs#731236 snp the level of significance ( p<0.05 ) . genotypic frequencies of vitamin d receptor gene bsmi a / g rs#1544410 snp the level of significance ( p<0.05 ) . genotypic frequencies of vitamin d receptor gene foki a / g rs#2228570 snp the level of significance ( p<0.05 ) . cp is frequently seen among family members and across different generations within a family , suggesting a genetic basis for the susceptibility to periodontal disease ( 1 ) . in addition , studies of twins suggest a genetic contribution to cp in general , but the effects of bacterial transmission and environmental influences make it difficult to explain a complex interaction ( 1 , 29 ) . for instance , snps of interleukin ( il- ) 1 , il-1 , located in different regions of cytokine genes have also been shown to affect the risk of the disease in several populations ( 30 , 31 ) . because cp is a multifactorial disease ( gene environment interaction ) , several genetic factors may play a role in the disease development by alteration of the structural component of the periodontal tissues , whereas other genetic factors play a role in regulation of inflammatory response ; many gene products interact with each other with environmental factors and the mechanism in which this interaction can increase the risk of cp is incompletely interpreted ( 32 ) . a finding by naito et al . ( 17 ) suggests that the chemical reactions involving bone mineral density - mediated effects are essential for the development of cp , but the effect of the vdr gene polymorphisms in total on cp have not been confirmed ( 2 ) . our results showed a significant association between cp and newly detected apai c / t snp # rs731236 , which is located in intron 8 of the vdr gene . this finding suggests an essential parameter that generally has not been considered on the prevention of diseases related to bone mineral density such as cp . in the present study no significant association was found between cp and apai g / t snp rs#7975232 , bsmi a / g snp rs#1544410 , and foki a / g snp rs#2228570 . our findings agreed with studies on brazilian , turkish , japanese , and chinese populations by de souza et al . ( 6 ) , gunes et al . ( 11 ) , naito et al . ( 34 ) , respectively , whereas other studies showed significant association between these vdr gene polymorphisms and the periodontal disease ( 19 , 35 ) . to our knowledge , the present study is the first study to examine the association between cp and vdr gene polymorphisms in north africa . in this study our results showed a significant association between cp and age , which agrees with a study on by amarasena et al . it is suggested that as the length of time increases , the chronic plaque accumulation increases , followed by increase in periodontal tissues destruction ( 1 ) . the causes of these sex differences have not been explained clearly , but suggest that men have poorer oral hygiene , less positive thinking toward oral health and dental - visit interaction , which agrees with a study by nazish et al . on the other hand , women still have varied periodontal problems due to hormonal disturbance in various decades of life . in addition , not enough studies have been done in developing countries which might have different results as compared to developed countries ( 38 ) . other studies of hormonal effect on periodontal diseases suggested that estrogen hormone in females can affect tooth retention by preventing the alveolar bone resorption ( 3941 ) . 17-estradiol , the primary female sex hormone , may also play a role in promoting periodontal regeneration in an experimental periodontitis model ( 42 ) . therefore , diagnostic periodontal risk assessments like vdr polymorphisms may be useful in the detection of the individuals susceptible for cp . more genetic studies in the future , including analysis of vdr haplotype alleles , are necessary in the prediction of the disease . clearly , studies with enough funding , larger sample size , and in more geographic regions in the country will be beneficial due to the importance of the vdr gene and its relation to the cp and many other human diseases . in the present study , we investigated apai c / t snp rs#731236 that confirmed the importance of the vdr gene in the libyan population . instead of restriction enzyme technique , which was performed in previous studies , we used the sequencing method which is more advanced , more expensive , and capable of revealing more snps in the vdr gene .

backgroundchronic periodontitis ( cp ) is a common oral disease characterized by inflammation in the supporting tissue of the teeth the periodontium , periodontal attachment loss , and alveolar bone loss . the disease has a microbial etiology ; however , recent findings suggest that the genetic factors , such as vitamin d receptor ( vdr ) gene polymorphisms , have also been included.aiminvestigation of the relationship between vdr gene polymorphisms and cp among libyans.materials and methodsin this study , we examined 196 unrelated libyans between the ages of 25 and 65 years , including 99 patients and 97 controls . an oral examination based on ramfjord index was performed at different dental clinics in tripoli and information were collected using a self - reported questionnaire . dna was extracted from buccal swabs ; the vdr apai , bsmi , and foki polymorphisms were genotyped using polymerase chain reaction and were sequenced using sanger method.resultsa significant difference in the newly detected apai snp c / t rs#731236 was found ( p=0.022 ) , whereas no significant differences were found in apai snp g / t rs#7975232 , bsmi snp a / g rs#1544410 , and foki snp a / g rs#2228570 between patients and controls ( p=0.939 , 0.466 , 0.239 ) , respectively.conclusionvdr apai snp c / t rs#731236 may be related to the risk of cp in the libyan population .

Materials and methods Participants Genotype determination Statistical analysis Results Discussion Conclusions Conflict of interest and funding

acne vulgaris is a very common chronic inflammatory disease of the pilosebaceous glands , which may occur with comedones , papules , pustule forms , cysts , nodules , and scarring in different area of the body , especially face . without proper treatment , it can cause scarring and hyperpigmentation . the prevalence of acne is very different in various countries ; ranging from 0 to over 90% . according to the estimates of the us census bureau international data base ( 2004 ) , among 68 million iranians , approximately its importance should not be ignored because the disease can cause many psychological and social effects for the patient such as low self - esteem , social withdrawal , depression , anxiety , and embarrassment . four main factors involving in the pathogenesis of acne are the production of sebum , severe keratinized ( horny ) of the pilosebaceous duct , disruption of microbial flora , particularly propionate acne bacteria and inflammation . no topical drug has been found to be effective on all these factors , and there is no treatment for complete and permanent improvement of acne . therefore , it seems logical to investigate for simple , uncomplicated and yet effective treatment . chemical peeling was used in different communities for centuries . currently , the most commonly used superficial peelings are glycolic acid , tri - chlorine acetic acid , salicylic acid , pyruvic acid , resorcinol , and solid carbon dioxide . pyruvic acid ( ch3-co - cooh ) is -kato acid with properties such as keratolytic , antimicrobial , the ability to stimulate collagen building , and formation of elastic fibers . pyruvic acid efficacy is known for the treatment of many skin diseases such as acne , superficial scars , photo - damage , and pigment disorders . this study was designed to assess the effect of adding 50% pyruvic acid compared to 30% salicylic acid on the treatment of acne . in a prospective one - blinded clinical trial , 86 patients were selected who referred to al - zahra hospital dermatology clinic and isfahan skin research center within the second 6 months of 2010 ( project no . the inclusion criteria were as follows : ( 1 ) age of 1540 years , ( 2 ) the existence of mild to moderate acne on the face skin ( not more than five pustule forms and no cysts , nodules , and colloidal deep scar observed in the affected area ) , ( 3 ) no history of drug allergy , and ( 4 ) no use of isotretinoin ( at least 6 months before the baseline ) . while the exclusion criteria were as follows : ( 1 ) drug allergy , ( 2 ) recurrent facial herpes simplex , ( 3 ) history of topical or systemic antibiotic therapy , ( 4 ) pregnancy and lactation , and ( 5 ) lack of cooperation or access to the patient . the method , benefits , and side effects of this method have been described for the patients before entering the study , and written informed consents were obtained from them . the patients randomly allocated in one of the two groups under study . in the first group , 43 patients as the control group underwent the routine treatment of acne ( containing erythromycin topical solution 4% made by pak - darou company , triclocarban soap made by golmar company , and fat - free sunscreen with specific pathogen - free thirty made by dr . jila company ) were used twice a day at home . an alcohol - based solution of 30% salicylic acid ( merck , germany ) was applied in the clinic for them every 2 weeks . in the second group , 43 patients as the case group underwent the routine treatment of acne twice a day at home . a 50% hydroalcoholic solution of pyruvic acid ( merck , germany ) was applied for them in the clinic for every 2 weeks . the number of comedones , papules , and pustule forms were counted by a physician for each patient before the treatment ( first visit ) and then at week 2 , 4 , 6 , and 8 ( second to fifth visit ) . the severity of acne on the face of each patient was changed to quantitative data by using the acne severity index ( asi ) and recorded in the data collection list . asi was calculated as follows : asi = ( 0.25 comedones ) + papules + ( 2 pustules ) . the asi was proposed 100% in the first visit regardless of the severity of acne lesions and the percentage decrease in the next visits was considered as the recovery percentage . the followings were considered : improved more than 75% = excellent , improved 5075% = good response , improved 2550% = moderate response , and improved < 25% = poor response . the patients were instructed how to use drugs at home ( avoid direct contact with sunlight , use sunscreen before leaving home , and renewed once every 2 h ) . the procedure was as follows in the case of peeling ( pyruvic acid or salicylic acid ) : at first , the patient 's skin was cleaned ( by impregnated cotton with 70% ethanol)in the next step , the standard solution of pyruvic acid 50% or salicylic acid 30% was applied on the patient 's face with a cotton applicator . so that , the forehead , the sides of the face , cheeks , chin , and nose were impregnatedafter 35 min , the effect of the used solution was returned to neutral with 10% sodium bicarbonate solution in waterthe treatment was continued once every 2 weeks for 8 weeks . at first , the patient 's skin was cleaned ( by impregnated cotton with 70% ethanol ) in the next step , the standard solution of pyruvic acid 50% or salicylic acid 30% was applied on the patient 's face with a cotton applicator . so that , the forehead , the sides of the face , cheeks , chin , and nose were impregnated after 35 min , the effect of the used solution was returned to neutral with 10% sodium bicarbonate solution in water the treatment was continued once every 2 weeks for 8 weeks . patient characteristics , side effects ( itching , erythema , burning , and scaling ) , and patient satisfaction ( excellent , good , fair , poor ) were recorded using a checklist . chi - square test was used to compare the qualitative variables between the two groups . the repeated measurement anova method was used to show the differences between the various stages of the treatment in each group and also between the two groups . in a prospective one - blinded clinical trial , 86 patients were selected who referred to al - zahra hospital dermatology clinic and isfahan skin research center within the second 6 months of 2010 ( project no . the inclusion criteria were as follows : ( 1 ) age of 1540 years , ( 2 ) the existence of mild to moderate acne on the face skin ( not more than five pustule forms and no cysts , nodules , and colloidal deep scar observed in the affected area ) , ( 3 ) no history of drug allergy , and ( 4 ) no use of isotretinoin ( at least 6 months before the baseline ) . while the exclusion criteria were as follows : ( 1 ) drug allergy , ( 2 ) recurrent facial herpes simplex , ( 3 ) history of topical or systemic antibiotic therapy , ( 4 ) pregnancy and lactation , and ( 5 ) lack of cooperation or access to the patient . the method , benefits , and side effects of this method have been described for the patients before entering the study , and written informed consents were obtained from them . the patients randomly allocated in one of the two groups under study . in the first group , 43 patients as the control group underwent the routine treatment of acne ( containing erythromycin topical solution 4% made by pak - darou company , triclocarban soap made by golmar company , and fat - free sunscreen with specific pathogen - free thirty made by dr . an alcohol - based solution of 30% salicylic acid ( merck , germany ) was applied in the clinic for them every 2 weeks . in the second group , 43 patients as the case group underwent the routine treatment of acne twice a day at home . a 50% hydroalcoholic solution of pyruvic acid ( merck , germany ) was applied for them in the clinic for every 2 weeks . the number of comedones , papules , and pustule forms were counted by a physician for each patient before the treatment ( first visit ) and then at week 2 , 4 , 6 , and 8 ( second to fifth visit ) . the severity of acne on the face of each patient was changed to quantitative data by using the acne severity index ( asi ) and recorded in the data collection list . asi was calculated as follows : asi = ( 0.25 comedones ) + papules + ( 2 pustules ) . the asi was proposed 100% in the first visit regardless of the severity of acne lesions and the percentage decrease in the next visits was considered as the recovery percentage . the followings were considered : improved more than 75% = excellent , improved 5075% = good response , improved 2550% = moderate response , and improved < 25% = poor response . the patients were instructed how to use drugs at home ( avoid direct contact with sunlight , use sunscreen before leaving home , and renewed once every 2 h ) . the procedure was as follows in the case of peeling ( pyruvic acid or salicylic acid ) : at first , the patient 's skin was cleaned ( by impregnated cotton with 70% ethanol)in the next step , the standard solution of pyruvic acid 50% or salicylic acid 30% was applied on the patient 's face with a cotton applicator . so that , the forehead , the sides of the face , cheeks , chin , and nose were impregnatedafter 35 min , the effect of the used solution was returned to neutral with 10% sodium bicarbonate solution in waterthe treatment was continued once every 2 weeks for 8 weeks . at first , the patient 's skin was cleaned ( by impregnated cotton with 70% ethanol ) in the next step , the standard solution of pyruvic acid 50% or salicylic acid 30% was applied on the patient 's face with a cotton applicator . so that , the forehead , the sides of the face , cheeks , chin , and nose were impregnated after 35 min , the effect of the used solution was returned to neutral with 10% sodium bicarbonate solution in water the treatment was continued once every 2 weeks for 8 weeks . patient characteristics , side effects ( itching , erythema , burning , and scaling ) , and patient satisfaction ( excellent , good , fair , poor ) were recorded using a checklist . chi - square test was used to compare the qualitative variables between the two groups . the repeated measurement anova method was used to show the differences between the various stages of the treatment in each group and also between the two groups . among 86 patients entered the study , 43 patients ( group 1 ) received pyruvic acid and 43 patients ( group 2 ) received salicylic acid . in group 1 , there were forty women ( 93.02% ) and three men ( 6.98% ) and in group 2 , 39 women ( 90.7% ) and four men ( 9.3% ) were enrolled . the mean age in group 1 was 25.07 6 years and in group 2 , it was 23.05 5.7 years . twenty patients in group 1 ( pyruvic acid ) and 27 patients in group 2 ( salicylic acid completed the 8-week treatment period ) . the reasons for not continuing the treatment by the excluded patients from the study were described in the following categories : family problems ( five patients in group 1 and one patient in group 2 ) , distance to the clinic ( six patients in group 1 and eight patients in group 2 ) , not satisfied with the treatment ( three patients in group 1 and two patients in group 2 ) , and unknown causes ( four patients in group 1 and five patients in group 2 ) [ figure 1 ] . among the people who had completed the study , the average number of the comedones , papules , and pustule forms in each session were calculated separately in the two groups [ table 1 ] . mean and standard deviation of the number of the comedones , papules , and pustule forms in final patients in both groups for each session in both groups , the comparison between the numbers of comedones was observed that during the course of treatment , the number of lesions has been downward , which was statistically significant ( p < 0.001 ) . however , changes in the number of pustule forms did neither increase nor decrease . comparing between the two treatments groups , the effect of two drugs in the change of noninflammatory and inflammatory lesions of acne after reviewing the changes , during the course of treatment , the results showed that the reduction in the number of comedones in the second visit than the first one ( p = 0.002 ) and in the third visit than the second one ( p = 0.019 ) was statistically significant . however , the decrease was not statistically significant in comparison between the fourth and third visits ( p = 0.097 ) and between the fifth and fourth visits ( p = 0.567 ) . reduction the number of papules between the second and the first visits ( p = 0.021 ) , the third and the second visits ( p = 0.019 ) and the fourth and third visits ( p = 0.020 ) was statistically significant . however , this drop compared to the fifth and fourth visits was not statistically significant ( p = 0.137 ) . reduction of the number of pustules was only statistically significant between the second and first visits ( p = 0.010 ) . asi was calculated for each patient at every session , and the percentage changes were obtained over several sessions . comparing these responses in both groups are shown in table 2 . severe lesion was defined as an increase in the percentage of asi . at the end of treatment , the mean percentage of changes in asi was compared in the two groups where the results are given in table 3 . as it can be seen in this table , in both groups between each visit , compared with the previous visits , the average rate of decline in this index was only statistically significant in the second to the first visit ( p < 0.001 ) . moreover , in both groups , the comparison between the values of these averages showed that its decline during the course of treatment was statistically significant ( p < 0.001 ) . by comparing between the two groups , the reduction in the average of asi index had no statistically significant difference and no difference was found in the effect of the two treatments . changes in the recovery rate of patients comparison of changes in the acne severity index between groups the complications due to the peeling with these two treatments were as follows : scaling - regarding the percentage , there were no significant difference between two groups of patients with this complication in the first to fourth sessions . however , in the fifth session , the rate of this complication was significantly lower in the patients treated with salicylic acid ( p = 0.015)redness - there was no significant difference between the two groups during the various sessions in terms of the percentage of the patients with this conditionburning - this complication was occurred in more than 85% of patients in both groups at all of the sessions after using the drug . there was no significant difference between the two groups during the various sessions regarding the number of patients with this conditionitching - in pyruvic acid group , three patients after the first session and one patient after the fourth session faced with this condition . in the salicylic acid group , there was only one patient with this complication in the second session . there was no significant difference between the two groups during the various sessions regarding the number of patients with this complication . scaling - regarding the percentage , there were no significant difference between two groups of patients with this complication in the first to fourth sessions . however , in the fifth session , the rate of this complication was significantly lower in the patients treated with salicylic acid ( p = 0.015 ) redness - there was no significant difference between the two groups during the various sessions in terms of the percentage of the patients with this condition burning - this complication was occurred in more than 85% of patients in both groups at all of the sessions after using the drug . there was no significant difference between the two groups during the various sessions regarding the number of patients with this condition itching - in pyruvic acid group , three patients after the first session and one patient after the fourth session faced with this condition . in the salicylic acid group , there was only one patient with this complication in the second session . there was no significant difference between the two groups during the various sessions regarding the number of patients with this complication . hyperpigmentation occurred in three patients of pyruvic acid group , two of them withdrew the study . in one patient , who continued the treatment , the symptom was resolved after 2 weeks . the patients , who completed the 8-week treatment , finally were asked about their degree of satisfaction . there were no significant difference in patient satisfaction between two treatment groups ( p = 0.62 ) . about 19 patient in pyruvic acid and 17 patients in salicylic acid treated groups reported excellent or good [ table 4 ] . pyruvic acid 50% and salicylic acid peels have several cosmetic indications including skin rejuvenations and the treatment of moderate acne scars . few studies have been performed about the effect of pyruvic acid on acne . in 2002 , a study including forty patients with mild to moderate acne was conducted by cotellessa et al . in italy . after applying pyruvic acid 4050% , 16 patients ( 40% ) had complete remission , twenty patients ( 50% ) had partial improvement , and in four patients ( 10% ) had no recovery was observed . the transient erythema and mild scaling was evident in all patients . in 2004 , another study with forty patients was performed by pacifico et al . in italy with similar results and no side effects were observed in their study as well . in 2006 , a study by tosson et al . took place in egypt . in response to pyruvic acid 4050% , among thirty patients with acne , 33.3% had very good response ( complete healing ) , 20% had a good response ( more than 75% healing ) , and 36.7% had a moderate response ( 5075% improvement ) . in their study , a clear relation was observed between acne severity and the response to pyruvic acid . the patients with mild acne had revealed much better response to the treatment than the other patients . mild scaling after each peeling session with pyruvic acid lasted for 710 days , and it did not interfere with social activities of the patients . another study has been conducted by berardesca et al . on twenty patients with photo - damage , superficial scars , and melasma in 2006 . after applying pyruvic acid 50% , significant reduction was observed in the degree of skin pigmentation in patients with melasma . in addition to this , there was a significant increase in skin elasticity in all patients . no cases of hyperpigmentation or erythema after the inflammation ( proximal interphalangeal ) were observed . in iran , no study has been performed on the effect of pyruvic acid on acne . in previous studies mentioned above the effects of pyruvic acid 50% were compared with salicylic acid 30% . on the other hand , there were vague hints in studies conducted in other countries . for example , the criteria to classify acne in mild , moderate and severe were not clearly described in the studies conducted in italy . in a study took place in egypt , the canadian association of general surgeons has been used as the measuring scale for determining the severity of acne . in this scoring , the value of all different skin lesions is the same and the number of the lesions are not important . there were statistically significant reductions in number of comedones and papules during the treatment in pyruvic acid - treated patients in our study in contrast to the number of pustules . findings regarding an inverse relationship between acne severity and response to pyruvic acid . in our study , in both groups , the more the peeling sessions , the less the reduction in number of lesions was . significant reduction in facial sebum secretion is reported following both 50% pyruvic acid and 30% salicylic acid peels , which could be a contributing mechanism in the efficacy of these agents in acne improvement . the most common side effects of pyruvic acid and salicylic acid peeling were burning , redness , and scaling . in each session , the burning occurred in 85100% of the patients which was resolved immediately by using sodium bicarbonate 10% as it was mentioned in tosson et al . 's study . unlike the study conducted by cotellessa et al . , the scaling and redness did not occur in all patients treated with pyruvic acid . it can be concluded from this study that the efficacy of adding pyruvic acid 50% and salicylic acid 30% to common treatment of mild to moderate acne is similar in terms of reducing the number of inflammatory and noninflammatory acne lesions . side effects of both peelings were also similar , except for the scaling in the fifth session that was significantly lower in the patients treated with salicylic acid frequent peeling sessions that resulted in lower cooperation of the patients and withdrawal from the study was the most important limitation . further clinical trials with less peeling sessions and more follow - up periods are recommended to evaluate the best effective interval of subsequent peelings and duration of acne improvement after the therapeutic plan . fj contributed in the conception of the work , analysis and interpretation of data for the work , drafting and critical revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.gf contributed in the conception and design of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.ss contributed in the conception of the work , acquisition of data , drafting the work , approval of the final version of the manuscript , and agreed for all aspects of the work.smh contributed in the design of the work , analysis of data , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . fj contributed in the conception of the work , analysis and interpretation of data for the work , drafting and critical revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . gf contributed in the conception and design of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . ss contributed in the conception of the work , acquisition of data , drafting the work , approval of the final version of the manuscript , and agreed for all aspects of the work . smh contributed in the design of the work , analysis of data , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .

background : acne vulgaris is a chronic inflammatory disease of the pilosebaceous follicles and one of the most common skin diseases . the peeling method has been recently found to be effective for acne treatment . this study aimed to compare the efficacy of pyruvic acid 50% and salicylic acid 30% peeling in the treatment of mild to moderate acne.materials and methods : in a prospective single - blinded clinical trial , 86 patients with acne were randomly assigned into two groups . in both groups , the routine treatment of acne ( topical solution of erythromycin 4% , triclorocarban soap , and sunscreen ) were used twice a day for 8 weeks . in addition , salicylic acid 30% for the control group and pyruvic acid 50% for the case group were used . in both groups , acne severity index ( asi ) was calculated before and at week 2 , 4 , 6 , and 8 of the treatment . patient satisfaction was assessed at the end of the treatment . side effects were recorded using a checklist.results:in both groups , the reduction in the number of comedones , papules , and asi were statistically significant ( p < 0.001 ) in the course of treatment . however , it was not significant regarding the number of pustules ( p = 0.09 ) . none of the number of comedone , papules , pustules , and asi was statistically different between study groups . both treatment groups had similar side effects except for scaling in the fifth session , which was significantly lower in salicylic acid treated patients ( p = 0.015).conclusion : both pyruvic acid 50% and salicylic acid 30% are effective in the improvement of mild to moderate acne with no significant difference in efficacy and side effects .

INTRODUCTION MATERIALS AND METHODS Study design and participants Procedures and variable assessment Statistical analysis RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest AUTHORS CONTRIBUTION

hermansky and pudlak reported in 1959 two cases of unrelated albinos with lifelong bleeding tendency and peculiar pigmented reticular cells in the bone marrow as well as in lymph nodes and liver biopsies . one albino was female and the other was male , both were 33 years old . after her death , autopsy revealed horseshoe kidney with large amount of pigment in reticuloendothelial cells and in the walls of small blood vessels . hermansky - pudlak syndrome ( hps ) is an autosomal recessive disorder that is caused by different genetic mutations . this syndrome is characterized by oculocutaneous albinism , platelets storage - pool deficiency , and lysosomal accumulation of ceroid lipofuscin . these patients have decreased skin and hair pigmentation and transillumination of the iris with markedly decreased visual acuity . patients with hps have easy bruisability , secondary to the absence of platelet dense bodies , which trigger platelet aggregation . ceroid lipofuscin is an amorphous lipid protein complex , and its accumulation in tissues is believed to be responsible for pulmonary fibrosis and granulomatous colitis . this ceroid lipofuscin also accumulates in the kidney , giving it a dark appearance when examined during an autopsy or kidney biopsy [ 4 , 5 ] . although no specific renal disease has been attributed to hps , compromised renal function in these patients has been reported [ 1 , 4 ] . renal insufficiency has been thought to occur due to the ceroid lipofuscin deposition in the kidney . gahl et al . reported a series of 49 patients with hsp , of which 9 had ckd ; however , no kidney biopsies where performed and there is no information about the proteinuria and hypertension in any of the above reports . to our knowledge , we report the first pediatric renal pathology case of hps associated with ckd , tubular pathology , focal segmental glomerulosclerosis ( fsgs ) , and hypertension . the patient is a 15-year - old male born in puerto rico to nonconsanguineous parents of puerto rican descent . he moved to the usa when he was 2 years old at which time the diagnosis of hps was made by hematologist who saw him because of easy bruisability and prolonged bleeding time . genetic testing was done , and he was found to be homozygous for the 16 bp duplication in the hps1 gene , which is denoted c.1472_87dup 16 on the cdna level . he had no known family history in parents , grandparents , and immediate relatives of renal failure , albinism , or known hps , although paternal grandmother had hypertension . our service was consulted secondary to persistent hypertension detected during a hospitalization for asthma - like symptoms , when he was 8 years old . physical examination at that time showed an active child , with global developmental delay , albino , obese ( with body mass index > 95th for age ) with normal cardiovascular and respiratory exam . he had no fever , heart rate was 96 beats per minute , and blood pressure in the right arm was 149/93 mmhg , left arm 127/78 mmhg , right leg 154/64 mmhg , and left leg 151/77 mmhg in sitting position . serum chemistries showed sodium of 135 mg / dl , potassium of 3.8 mg / dl , blood urea nitrogen of 16 mg / dl , and creatinine of 1 mg / dl . renal ultrasound showed both kidneys to be normal in position and without evidence of hydronephrosis . the right kidney measured 8.4 cm , and left kidney measured 9.7 cm . doppler examination demonstrated patency of renal veins , with resistance indices 0.5 ( right renal artery ) and 0.6 ( left renal artery ) . his hypertension workup included normal serum / urine catecholamines , thyroid function tests , and normal brain imaging ( mri head ) . to control hypertension , , patient 's blood pressure was < 90 percentile for age , gender , and height . lvh subsequently resolved as documented on follow - up echo at age of 9 years . at 12 years of age , calcium channel blocker was stopped , secondary to gingival hyperplasia , and an angiotensin receptor blocker ( arb ) was started . at that time , patient did not have proteinuria . his serum creatinine remained stable ( ranged from 1 to 1.3 mg / dl ) , and serum potassium ranged from 3.8 to 4.6 mg / dl . in this time period , , he had a gastric , duodenum , and colonic biopsies done , which showed mild acute - chronic inflammation ( there were no bleeding complications ) . during his routine follow - up visit at age 14 years , 30 mg / dl of protein without hematuria was noted on the dipstix , but measured urine protein / creatinine ratio ( upc ) of this sample was 0.2 . he was seen in the renal clinic every 36 months , and since then his first morning upc ranged from 0.2 to 0.38 . a reliable 24-hour urine collection was not possible to obtain due to his developmental delay . when he was 15 years old , his blood pressure was still controlled with arb , his serum creatinine was elevated at 1.4 mg / dl , and proteinuria became fixed , that is , 1st morning upc was 0.38 and 0.5 . first morning urinalysis showed ph of 6 , yellow color , specific gravity 1.020 , 100 mg / dl protein , no blood , and no glucose , and microscopic examination showed 03 red blood cells per high - power field and 05 white blood cells per high - power field , without casts , indicative of functional renal concentrating and acidifying abilities . he had no edema and no hematuria , and his serum albumin was 4.2 g / dl . his serologies for hepatitis b / c and lupus ; complement 3 and 4 , antinuclear antibodies , and vasculitis ; antineutrophil cytoplasmic antibodies ( anca ) were all negative . kidney biopsy was performed due to persistent proteinuria and compromised renal function , with estimated gfr 70 ml / min/1.73 m by schwartz formula . the hematology service was consulted prior to biopsy and coagulation studies : prothrombin time ( pt ) was 10.5 seconds ( normal 9.512 seconds ) and partial thromboplastin time was 26.9 seconds ( normal 26.233.8 seconds ) . immediately after the kidney biopsy , a small perinephric hematoma was observed by ultrasonographic evaluation but no gross hematuria was seen and there were no other complications during and after the procedure . tissue for light microscopy was evaluated at 10 section levels with h&e , pas , and trichrome staining . there were total 19 glomeruli in two renal biopsy cores of tan - red cylindrical tissue each core up to 1.2 cm and 1.9 cm . there were three sclerotic glomeruli , including one with segmental hyalinosis ; one of the four additional enlarged glomeruli per level of section had perihilar segmental sclerosis . mild interstitial fibrosis with associated tubular atrophy , and no significant interstitial inflammation was present . acute tubular injury with variable tubular ectasia , variable hypertrophic tubular epithelial cells with marked cytoplasmic vacuolization , fuchsinophilic and pas - negative waxy dull brown - yellow spherule cytoplasmic inclusions were present . no arteriosclerosis was present , and no vascular inflammatory lesions were present , figures 1(a)1(c ) . on immunofluorescent examination , up to 3 enlarged glomeruli per level of section had irregular coarse granular capillary wall and mesangial staining with antisera specific for c3 . the glomeruli had no staining with antisera specific for igg , iga , igm , c1q , kappa light chains , or lambda light chains . electron microscopy ( figure 2 ) revealed no capillary wall or mesangial immune complex - type electron - dense deposits . although original description of hps originated in prague , the majority of literature reports describing this syndrome have come from puerto rico . when hermansky and pudlak reported for the first time in 1959 two cases of albinism and prolonged bleeding time , renal insufficiency was described in one patient with horseshoe kidney . tagboto et al . reported a patient with hps with iga nephropathy and anca - positive glomerulonephritis . the kidney tissue showed a dark - brown pigmentation , and the tubular injury was similar to what we found in our case . ceroid - like lipofuscin material has been found in the urine of hps patients with renal involvement , and the deposition of this material in other tissues ( lungs , colon ) has been blamed for cellular dysfunction and subsequently fibrosis , although , if this is the cause , the exact mechanism has not been described . the mechanism of injury of renal tubular cells by lipofuscin accumulation is not completely understood . hps is a rare , autosomal recessive disorder which affects multiple cytoplasmic organelles : melanosomes , platelet dense granules , and lysosomes . hps can be caused by mutation in several genes : hps1 ( common among population of the northwestern part of puerto rico ) , hps3 , hps4 , hps5 , and hps6 . hps2 , which includes immunodeficiency in its phenotype , is caused by a mutation in the ap3b1 gene . hps is characterized by defect in the coat - protein complexes resulting in abnormal function of lysosomes , melanosomes , and platelet dense granules as hps - gene products are part of distinct protein complexes : the adaptor complex ap-3 and various blocs ( biogenesis of lysosome - related organelles complex ) [ 1416 ] . although there is no data to support it , it is plausible to hypothesize that podocytes of hps subjects may demonstrate molecular defects in proteins analogous to dysbindin ( part of bloc-1 , found in axonal synapses ) involved in lysosomal trafficking . the hps phenotype is heterogenic , and it was reported that hps observed in an isolated swiss alps village [ 17 , 18 ] usually shows a relatively mild clinical course with normal life expectancy and the lack of clinical manifestations of ceroid storage . our patient presents yet another phenotype with htn and constellation of renal lesions that include evidence of tubular injury and fsgs . patients with hps have mild prolonged bleeding time secondary to functionally impaired platelets , but platelet numbers are normal . our patient had had a gastric and colonic biopsy in the past , as well as a tooth removal without significant bleeding . slow rise in serum creatinine from 1 mg / dl at age 8 y to 1.4 mg / dl at age 16 y might be clinically important in our case description , indicative of slow progression despite multiple risk factors : obesity , htn , fsgs , and presence of tubular fuchsinophilic cytoplasmic inclusions with mild interstitial fibrosis on renal biopsy . to the best of our knowledge , there are no previous reports of pediatric hps patients with described renal pathology . the animal model of hps is the fawn - hooded rat ( fh ) and pale ear mouse [ 19 , 20 ] . the fh rat has an inherited platelet storage - pool deficiency and a widespread impairment of serotonin storage , susceptibility to systemic and pulmonary hypertension , but does not have mutations in the gene homologous to hps1 . the fh rat has a genetic predisposition to develop chronic renal failure , fsgs , htn , and proteinuria . the progression of sclerosis results in premature death from end - stage kidney disease in these rats . but the precise cause of the spontaneous development of systemic hypertension in fh rats is not well understood . hps1 is homologous with the pale ear mouse ( ep mutation ) . in that mouse , there is lysosomal accumulation of beta - galactosidase and em showed large multilamellar granules in proximal tubules with the accumulation of lipofuscin material in the tubules . in the last decade , verani reported 14 biopsies of obese adults with fsgs . in that report , glomerulomegaly was reported in patients with fsgs associated with obesity , as well as lack or hyperplasia of glomerular epithelial cells . in that report , patients with fsgs associated with obesity had higher cholesterol and atherosclerosis . our patient had normal cholesterol and no atherosclerosis on biopsy . no tubular lesions , as in the case of our patient , had been reported in fsgs associated with obesity . in a previous case of hps , tubular atrophy and accumulation of a ceroid - like material in tubular epithelial cells were reported . our patient had increased bmi and hypertension with lvh since initial presentation at age 8 years . we can speculate that htn was secondary to obesity at 8 years of age but it would be uncommon clinical scenario to encounter the child at this age with htn significant enough to cause lvh due to obesity alone . our patient did not have evidence of renal artery stenosis or endocrine causes of hypertension , and his blood pressure was controlled with monotherapy . the effects on the kidney secondary to obesity in animals and humans include structural and functional changes , such as increased gfr , increased renal blood flow , and renal hypertrophy [ 21 , 22 ] . some of the changes in the renal tissue of our patient might be consistent with fsgs associated with obesity , and the tubular changes may contribute to the renal insufficiency . although it is not our intention to draw any association between hps and fsgs , we can speculate that obese patients with hps and hypertension may be at risk of unrecognized fsgs . however , it is possible that the sclerosis of the glomeruli observed in our case is secondary to the tubular damage . to the best of our knowledge , this is the first pediatric case of hps associated with ckd and defined renal pathology . further studies are needed to determine the cause of renal insufficiency in patients with hps .

we report a child with hermansky - pudlak syndrome ( hps ) and chronic kidney disease ( stage ii ) with histological diagnosis of focal segmental glomerulosclerosis ( fsgs ) . a 15-year - old male of puerto rico ancestry with history of hps , hypertension ( htn ) , asthma , obesity , and chronic kidney disease ( ckd ) stage ii presented with new - onset proteinuria without edema . his blood pressure had been controlled , serum creatinine had been 0.91.4 mg / dl , and first morning urine protein / creatinine ratio ( upc ) ranged from 0.2 to 0.38 . due to persistent nonorthostatic proteinuria with ckd , renal biopsy was performed and fsgs ( not otherwise specified ) with chronic diffuse tubulopathy ( tubular cytoplasmic droplets ) and acute tubular injury was reported . ceroid - like material is known to infiltrate tissues ( i.e. , lungs , colon , and kidney ) in hps , but the reason for the renal insufficiency is unknown . nonspecific kidney disease and in one adult case iga nephropathy with anca - positive glomerulonephritis have previously been reported in patients with hermansky - pudlak syndrome . to our knowledge , we report the first pediatric renal pathology case of hps associated with ckd . this paper discusses presentation and management of renal disease in hps .

1. Introduction 2. Case Report 3. Pathology 4. Discussion

a 60-year - old gentleman presented to our institution with pain and dimness of vision in both eyes . on evaluation , his best corrected visual acuity ( bcva ) was 20/80 in right eye ( re ) and 20/120 in left eye ( le ) . his cup - to - disc ratio was 0.6 re and 0.85 le with loss of the neural rim . he was prescribed betoxolol 0.5% in both eyes ( be ) and recommended elective cataract extraction for the le . keratometry measurements were 43.75 diopter ( d ) 180 and 40.00 90 os with 3.75 d of against the rule astigmatism . the calculated intraocular lens ( iol ) power was 23.50 d. the patient had used topical ofloxacin 3 mg / ml six times , 1 day prior to surgery , and thrice on the day of surgery at 1-hour intervals . povidone iodine 5% was used half an hour before surgery and just before the commencement of surgery . ocular adnexa was cleaned using 10% povidone iodine , the patient was draped and speculum was applied . a manual sutureless cataract extraction ( mscs ) with lri was planned for the le . through a 6-mm temporal sclerocorneal tunnel , a nasal 6-mm lri was performed using a 550-m steel knife prior to wound construction . on the first postoperative day , his bcva le was 20/60 , and the anterior segment was unremarkable except for mild iritis . on the 15 postoperative day , he presented emergently with pain and redness in the operated eye . on examination , anterior segment examination revealed circumcorneal congestion , iris nodule , a 1.5-mm hypopyon , and a corneal exudate at the site of the prior lri [ fig . 1 ] . b - scan ultrasonography revealed minimal vitreous exudates . on presentation at 15 post - op day with endothelial nodule at the site of limbal relaxing incision , hypopyon and iris nodule vitreous was aspirated and sent for analysis . intravitreal vancomycin 1 mg / ml and amikacin 400 g/0.1ml were administered . based on the clinical picture of corneal exudate , iris nodules , and hypopyon with minimal posterior segment involvement , a clinical diagnosis of nocardial endophthalmitis was made . the patient was treated with topical gatifloxacin and amikacin hourly , prednisolone acetate every 6 hours , and oral gatifloxacin . the isolate was sensitive to amikacin , gatifloxacin , moxifloxacin , ciprofloxacin , ofloxacin , and chloramphenicol . the inflammation worsened , exudates from the iris extended into the capsular bag and fresh exudates appeared at the sclerocorneal wound site . a subsequent ultrasound revealed increased vitreous opacities . on the 18th postoperative day , the patient underwent core vitrectomy with anterior chamber washout and capsular bag removal with iol explantation . his symptoms improved , iris and endothelial nodules resolved , hypopyon decreased and exudate at the lri site resolved [ fig . 2 ] . he was discharged after a 1-week course on a regimen of oral gatifloxacin and topical amikacin , ciprofloxacin , and a cycloplegic . four weeks later , the patient 's vision was 20/2000 and his examination revealed 2 + white blood cells ( wbcs ) in the anterior chamber , no hypopyon , and vitreous opacities . lri preserves the perfect optical qualities of the cornea and is an excellent option for low - to - moderate degrees of astigmatism in a planned single bioptic procedure . lri produces lesser effect than corneal relaxing incision ( cri ) , thus precise alignment of the axis is not as critical . have shown that lri performed during phacoemulsification surgery is a safe , effective , and stable procedure to reduce pre - existing corneal astigmatism . we are unaware of any prior report of a postoperative endophthalmitis associated with an lri performed at the time of cataract surgery . in this patient , as the lri was of partial thickness and cornea was not perforated , it appears that bacteria may be able to penetrate the cornea at the site of the lri . this patient presented with iris nodules and hypopyon , a classic presentation of nocardial endophthalmitis . the endothelial exudates were at the lri site while the wound was clear , thereby indicating the lri as the probable site of entry for the organism . the rate of postoperative endophthalmitis after cataract surgery in this population is 0.064% and norcardial infections account for 16.4% of these cases . norcardia endophthalmitis is more evident in emaciated and immunocompromised individuals and associated with poor prognosis . mscs is practiced widely in india and constitutes about 62% of the total 69,479 cataract procedures done at our institute in 2008 . the endophthalmitis rate with the mscs group was 0.03% and was lesser than the 0.05% infection rate with the phacoemulsification group ( unpublished data ) . have proved that poorly constructed wounds with a short corneal valve have a higher risk of developing endophthalmitis . in this patient , the scleral and corneal valves were 2 mm and 1.5 mm , respectively . in spite of making a larger incision in the mscs group , the infection rates are probably comparable due to the wider sclerocorneal tunnel covered well with conjunctiva at the end of surgery . lalitha et al . from the same population reported nil endophthalmitis in the 4275 cases who underwent mscs technique in the total group of 36,072 cataract procedures where the overall endophthalmitis rate was 0.05% . in our experience , the mscs technique per se has not been found to be a significant risk factor for endophthalmitis compared to phacoemulsification . in summary

limbal relaxing incisions ( lris ) are considered a relatively safe procedure with rapid stabilization and absence of infectious complications . do we need to readdress this last impression ? we report a case of nocardia endophthalmitis associated with an exudate at the site of an lri in a patient who underwent routine cataract surgery . this case , to the best of our knowledge , is the first report of its kind , stressing the need for a cautious approach to the adoption of this method of astigmatic correction .

Case Report Discussion

patients and clinicians can use it to plan for end of life decisions , such as setting treatment priorities . all of these uses presuppose that an accurate measure of prognosis exists . in this paper , we describe and report on the accuracy of the multimorbidity ( mm ) index . alemi and colleagues16 developed the mm index to account for the prognosis of patients with multiple diagnoses . charlson and colleagues were among the first group of investigators to do so.7 these authors developed an index that predicted mortality from 22 broad disease categories , including one category for all heart diseases , another for aids , and still another for all cancers . deyo et al.,8 romano et al.,9 manitoba et al.,10 and dhoores et al.11 attempted to improve on the initial charlson index by modifying the broad categories and dropping or adding new categories . elixhauser and colleagues12 continued these modifications by creating a list of 30 broad categories of comorbidities , and van walraven et al . organized these categories into an index.13 in contrast to existing approaches , the mm index does not classify diagnoses into broad disease categories . instead , it scores the underlying disease . in existing methods , diagnoses with widely varying hazard ratios secondary malignancies category that are used in variants of the elixhauser index . in a recent study of the prognosis of heart failure patients,14 patients who also had a secondary malignant neoplasm of brain and spinal cord had an odds ratio of mortality equal to 17.28 . in comparison , those who had another variant of a secondary malignancy ( i.e. , a secondary neuroendocrine tumor of distant lymph nodes ) only had an odds ratio of mortality equal to 2.43 . this example illustrates that the same category , secondary malignancies , includes diagnoses that have a nearly ninefold difference in mortality , and that grouping all secondary malignancies into one category overly simplifies the differences within this category . one would anticipate that the accuracy of prognostication could be improved by considering the 28 types of secondary malignancies separately rather than together as one category , which is a feature of the mm index . in this paper , we review the design of the mm index , compare its performance to other prognostic indices , and describe how the index can be used within an electronic health record ( ehr ) . the paper also includes code for constructing the mm index in different data sets or for incorporating the method into ehrs . the key feature of the mm index is that it is built from thousands of diagnoses , without classifying these diagnoses into categories . in order to effectively model the relationship between thousands of diagnoses and mortality , one assumes that the impact of each disease on mortality is independent from other diseases . this assumption is also made in traditional statistical approaches that use linear logistic regression . even though the assumption is obviously false , numerous studies have shown that the naive bayes produces predictions that are as accurate as more complicated models that assume interactions among diseases.1526 in this approach , the overall probability of mortality is calculated as follows : patient 's mm score patient'sdiagnosesldiagnosiswhere ldiagnosis indicates the likelihood ratio associated with the diagnostic code in the training data set . the likelihood associated with each diagnosis is calculated using the following formula from the portion of the data set aside for training of the model : ldiagnosis = prevalenc of diagnosis among patientsprevalenc of diagnosis among alive patients = p(dx|dead)p(dx|alive ) . the likelihood ratio associated with each diagnosis can be interpreted as the number of times the diagnosis increases the odds of mortality . a likelihood ratio of 2 indicates that the diagnosis doubles the risk of mortality , while a likelihood ratio of 0.5 indicates that the odds of mortality is reduced by half . these likelihood ratios were estimated from data within the united states department of veterans affairs ( veterans affairs ) medical records and are publicly available for heart failure1 and for nursing home patients.2 to facilitate the estimation of these ratios for other populations , the standard query language ( sql ) code that we had used is provided in the appendix a. one problem with the method used to estimate the likelihood ratios is that it is affected by co - occurring diagnoses . thus , hypertension may receive higher likelihood of mortality if it tends to occur with more serious diseases such as heart failure or shock . procedures to remove confounding are available in several published papers.27 we recommend the use of stratified covariate balancing ( see r package stratifiedbalancing ) in removing confounding as this approach is not parametric and can be done within ehrs using sql.31 applying methods of removing confounding to the estimation of survival of patients with co - occurring diagnoses remains an active area of research . to derive the mm index , it is important to recognize that a large number of parameters are estimated . there are in excess of 14,000 international classification of diseases ( icd ) codes , and within most populations 3,0005,000 unique diagnoses occur . there are a number of ways to estimate the sample size that would be needed for such a large number of determinations . some investigators have suggested that the power of the investigation depends on the ratio of the number of subjects to the number of variables , using heuristics such as 10 times32,33,34 or 20 times35 the number of subjects compared to the number of variables in the model ( i.e. , in order to estimate 5,000 parameters , 100,000 subjects would be needed ) . in most of the analyses reported here , the total sample size exceeds 30 times the number of variables , suggesting the estimated model has sufficient power to detect the needed parameters . others posit that the most important consideration is the accuracy of local estimates , such as the likelihood ratio associated with each diagnosis.36,37 to calculate those likelihood ratios , a sample size formula for a two - sample t - test can be applied to calculate the required sample size for one diagnosis . in multivariate analysis , the impact of a single diagnosis is evaluated within the context of many others . in these situations , a correction factor associated with the percent of variation explained by the covariates is added to inflate the variance and improve the power.38,39 in selecting one of these two approaches , one may consider the intended use of the study findings . if an overall index score is of interest , then heuristics that use the ratio of the number of subjects to the number of estimates may be most appropriate . however , if individual likelihood ratios associated with each of the respective diagnoses are of concern , then a more localized estimation of the individual likelihood ratios is needed . many investigators and clinicians may wish to estimate the probability of mortality at different time intervals ( e.g. , 6 months , 12 months , or 5 years ) . by using prior odds of mortality , one can transform the mm index to estimate the probability of mortality within a specific period . according to the bayes formula , the posterior odds of mortality are calculated as follows : posterior odds = prior odds*mm indexprobability of mortality = posterior odds1+posterior odds many common diseases are associated with no patient mortality , and there are also rare diseases where every patient dies . in both of these situations , alemi40,41 proposed using the following formulas : ldiagnosis={if all survive1/(n+1)if none surviven+1where n indicates the number of patients with the diagnosis . other adjustments have been reported in the literature , including adding a fraction of a case to either the denominator or the numerator to avoid division by zero . the adjustment used here has the advantage that it is proportional to the number of patients with the diagnosis ( i.e. , a higher likelihood ratio is assigned when all patients die from diseases that are more frequent ) . for example , if all 100 patients with a disease died , then the assigned likelihood ratio is 101 . this assigned likelihood ratio ( i.e. , 11 ) is higher than if all 10 patients with a disease had died . although the mm index is derived from a large data repository , there are several diagnoses that are rare and have insufficient observations to estimate a likelihood ratio . in a minority of cases ( e.g. , when a patient presented with a diagnosis that was not seen in at least 29 cases in the training set ) , then the likelihood ratio associated with a broader diagnostic category is used to score the patient . a typical international classification of disease , revision 9 ( icd-9 ) diagnosis is represented as a five - digit number consisting of three initial digits , a period , and two additional digits . the first three digits represent a disease category . each additional digit after the period represents further refinements . if the patient s diagnosis is rare , then one could use the likelihood ratio for a broader category of the diagnosis that repeats more often ( e.g. , by dropping the last digit in the diagnosis code ) . appendix a includes the sql code that can be used to estimate the likelihood ratios associated with three- , four- , and five - digit codes from data in ehrs . to date , the mm index has been evaluated using diagnoses coded with icd-9 . in the international classification of diseases , revision 10 ( icd-10 ) , a sixth digit was added to further clarify the disease categories . the procedures described in this paper and the computer code provided in appendix a can be used to estimate the prognosis of each code within icd-10 . because icd-10 has tenfold more codes than icd-9 , reliable estimates for this version can not be made until tenfold larger data are available . even when the data are available , many disease codes in icd-10 are unlikely to occur with sufficient frequency so that the prognosis for these codes can be estimated reliably . when icd-10 codes can not be estimated reliably , investigators should combine data and rely on higher order codes in icd-9 , using the procedures explained earlier for estimating rare diseases . if icd-10 codes can be estimated reliably , then these codes should be used instead of icd-9 . by using this method , the best description of the patient would be used . when the estimate is not available , a less precise description would be used . because mm index scores each diagnosis , this leads to a model with thousands of independent variables . since clinicians have a difficult time tracking thousands of variables , a solution is needed that would allow the scoring of each diagnosis but would classify the respective diagnoses into a smaller set of dimensions that are easier to manage . similarly , when evaluating the comparative effectiveness of treatments , there is a need to have sub - indices that indicate the relative severity of different diseases within body systems . the propensity scoring then adjusts for risks introduced by the different body systems and not just the overall mortality risk . the multidimensional multiple morbidity ( mmm ) index was created to address this scenario by breaking the overall mm index into distinct subcategories . the first application of utility theory to prognosis modeling can be traced to the work of gustafson and colleagues.42 later applications have included testing of preferential independence assumptions of additive or multiplicative utility models.43 in this approach , each attribute describes a set of comorbidities , typically within the same body system . the overall mmm score is then organized using the following formulas : mmm=1-i(1=kiui)where : ui is the maximum relative severity of disease in the i category of disease . these scores are scaled to range from 0 to 1 , with 1 indicating the score for the worst disease in the category . these scores are made proportional to the hazard rate associated with each disease and are estimated from the data.ki is the largest probability of mortality associated with the unconfounded impact of diseases within the i category . these scores are scaled to range from 0 to 1 , with 1 indicating the score for the worst disease in the category . these scores are made proportional to the hazard rate associated with each disease and are estimated from the data . ki is the largest probability of mortality associated with the unconfounded impact of diseases within the i category . table 1 shows examples of how the mmm index is organized from a progression in three body systems . three body systems are shown in table 1 , and more are available through the first author.44 the columns in the table show the various body systems ( e.g. , diseases in the circulatory system ) . each row in table 1 corresponds to a particular level of severity . 1st [ hospitalization for ] 459.2 , ruptured abdominal aortic aneurysm . it is assigned a score of 0.4 , while 2 [ hospitalization for ] 785.51 , cardiogenic shock is assigned a score of 1 . in essence , the utility scores list the diagnoses within the system ( from relatively benign to the most serious ) in the order of their hazard rate . this parameter k is the maximum unconfounded probability of mortality within each body system . in this scoring of the body system , each disease is initially rated based on its associated utility score . then within each body system , the health care literature is replete with studies that report the use of physiological markers as prognostic indicators . in this section , alemi and colleagues examined the prognosis of patients with hiv / aids by using an mm index45 in 1999 and found that the index was more predictive of patients survival than an index developed from an average of physiological indicators , such as cd4 t lymphocytes counts . subsequent analyses by other investigators also demonstrated that the index was accurate in predicting hiv / aids prognosis for patients who died in six months and who were eligible for hospice care.46 this early attempt at constructing an mm index did not take into account all diagnoses and was limited to specific diagnoses that followed a diagnosis of hiv / aids . in 2013 , a comprehensive mm index was used to predict 12-month mortality for diabetes patients.47 this index correctly predicted the mortality of 89.9 percent of cases . in as yet unpublished data,48 the performance of the diabetes mm index was compared to the accuracy of hemoglobin a1c levels for 468,867 diabetic patients . a number of investigators have shown how tight control of , or high levels of , hemoglobin a1c might affect prognosis.49,50,51,52,53 figure 1 shows that the sensitivity and specificity of the mm index was superior to prognostic indicators based on hba1c levels alone . the area under an roc curve for predicting 6-month mortality for hba1c levels was 0.652 ; in contrast the roc for the mm index was 0.812 . the mm index was therefore 1.25 times more accurate than the widely used hba1c levels . in 2015 , the mm index was used to predict the 6-month mortality of 140,699 nursing home residents.54 the cross - validated accuracy of the mm index was compared to a common measure of daily functional activity , the barthel index.55,56 the cross - validated roc for the mm index was 0.838 . also in 2015 , the mm index was compared to the ejection fraction for 602,050 unique heart failure patients across 130 veterans affairs medical centers.57 the cross - validated roc for the mm index was 0.784 . in contrast , the cross - validated roc for the ejection fraction was only 0.533 , which was barely above a random chance event . ejection fraction was not predictive of long - term mortality rates . in a study of patients in intensive care , we compared the accuracy of the mm index to 13 physiological markers.58 these markers included the following : ( 1 ) sodium , ( 2 ) blood urea nitrogen , ( 3 ) creatinine , ( 4 ) glucose , ( 5 ) albumin , ( 6 ) bilirubin , ( 7 ) white blood cell count , ( 8) hematocrit , ( 9 ) pao2 , ( 10 ) paco2 , ( 11 ) ph , ( 12 ) egfr , and ( 13 ) lactic acid . we examined the 6-month and 12-month mortality of 442,692 unique patients seen in 87 medical intensive care units of veterans affairs medical centers between 2003 and 2013 . the mm index , relying solely on diagnostic codes , yielded an roc of 0.84 . in contrast , the logistic regression based on the combined impact of 13 physiological markers yielded a roc of 0.65 . these studies collectively show that the mm index is more accurate in predicting 6-month or 12-month mortality compared to select physiological makers . this section compares the mm index and its variants to the charlson index and other diagnoses - based indices . in 2002 , the mmm index was used to predict mortality from childhood diseases.59 the source of data was the 2006 kid s inpatient database of the healthcare cost and utilization project of the agency for healthcare research and quality . this database contained data on pediatric ( children 20 years of age and younger ) discharges from 3,739 community , nonrehabilitation hospitals in 38 states . the accuracy of the mmm index was compared to all patient refined diagnosis - related groups,60 the all payer severity - adjusted diagnosis - related groups,61 and a simple count of diagnoses.62 the mmm index explained 32 percent of the variation in mortality , as measured by percent of deviance explained in mortality . it was fivefold more accurate than all patient refined diagnosis - related groups and threefold more accurate than all payer severity - adjusted diagnosis - related groups . this study demonstrated that prognostic information can be significantly improved by scoring each diagnosis separately . in 2015 , the mm index was directly compared to the charlson and elixhauser variants by predicting the 6-month mortality of heart failure patients.63 in this study , the prognosis of 602,050 unique heart failure patients across 130 veterans affairs medical centers was studied . the mm index was more accurate than the quan variant of the charlson index,64 with an roc of 0.656 . it was also more accurate than the enhanced65 deyo variant66 of the charlson index , with an roc of 0.677 . it was more accurate than the von walraven variant of the elixhauser index,67 with an roc of 0.639 . it was also more accurate than chronological age with an roc of 0.649 , illustrating the importance of illness over age . figure 2 compares the performance of these indices against each other . in all of these comparisons , not only was the cross - validated improvement in accuracy achieved by the mm index statistically significant , but the magnitude of the improvement was large enough to potentially explain away small or medium treatment effects . in the study of intensive care patients ( discussed above in the comparison of the mm index to physiological markers ) , we also compared the performance of the mm index to comorbidity categories within the elixhauser list , immunosuppressant medication use , and age . in contrast , the roc for immunosuppressant medication use was 0.59 ; for age it was 0.60 ; for elixhauser comorbidities it was 0.69 ; and for all combined variables ( including physiological markers ) it was 0.80 . as in previous studies , these differences were all cross - validated and statistically significant . the fact that the mm index , which scores each diagnosis , was more accurate than the elixhauser s categories of comorbidities suggests that grouping diagnoses into broad diagnostic categories reduces the accuracy of predictions . to illustrate the application of the mm index to specific cases , we use a case from a recent analysis of the prognosis of nursing home residents . the resident was 81 years old with 10 diagnoses during the last hospital admission ( see table 1 ) . the likelihood ratio of each diagnosis was looked up in the online table from the george mason university dataverse.68 for one diagnosis , chronic airway obstruction , not copd , and not elsewhere classified , the table does not provide any information and therefore this diagnosis was ignored and scored with a likelihood ratio of 1 . the mm score , the product of all likelihood ratios , was calculated as 45.07 . in this database , the prior odds was multiplied by the product of the likelihood ratios to obtain the posterior odds . the posterior odds can be expressed as a probability by dividing the posterior odds by one plus the odds . this patient s diagnoses has resulted in a probability of 0.88 for dying in the next six months . likelihood ratios above 1 indicate diagnoses that increased the odds of mortality . based on these data , the main reason for the high estimate of mortality pertained to the following : ( 1 ) lung cancer , ( 2 ) anorexia , and ( 3 ) cachexia . each more than doubled the risk of mortality . kidney disease also contributed to the high probability of mortality , but to a lesser extent . the following example can also demonstrate how the mmm variant of the mm index can be used . a patient presents with the worst disease in the circulatory system ( i.e. , second hospitalization for cardiogenic shock ) and has two diseases within the digestive system ( i.e. , first hospitalization with perforation of intestine and first hospitalization for malignant neoplasm of stomach , not otherwise specified ) . for simplicity , assume that this patient has no other diseases within other body systems . the maximum progression within circulatory disease is 1 , and the maximum progression within digestive diseases is 0.2 ( the maximum of 0.1 and 0.2 ) . for all other categories , there is no progression and they are scored 0 . the overall probability of death for the patient is then calculated as follows : mmm=1-(1 - 1.00.74)(1 - 0.200.81)=0.78 note that in this method of scoring , any diagnosis with elevated risk , no matter how benign , always increases the probability of mortality . to facilitate the use of the mm index in different ehr systems , appendix a contains an sql code that will facilitate the estimation of the parameters of the index for a specific cohort of patients within a data warehouse . while we have experience with icd-9 codes , a similar sql can be run for icd-10 , thereby allowing the ehr to adjust for changes in the coding procedures . in addition , a similar sql code can be run for procedures , exposure to medications , and categorized physiological measures , as well as decades of age , thereby allowing the prognostic index to reflect more than diagnoses . this paper reviews the recent methodological research on the performance and application of the mm index . one finding of this review was that mm index had higher roc than various physiological measures of prognosis , including ejection fraction for heart failure , hba1c levels for diabetic patients , and 13 physiological measures for patients in intensive care units . clinicians may prefer relying on physiological measures for any of the following reasons : many are concerned with coding errors in reporting patient diagnoses.69 however , given the accuracy of the results reported in this paper , coding errors are not extensive enough to significantly reduce the accuracy of diagnosis - based indices.some clinicians are concerned with reports that diagnoses in administrative data are less accurate than physiological markers when predicting prognosis , e.g. , brinkman et al.70 these studies do not contradict the data presented in this paper . as reviewed , when diagnoses are not grouped into broad categories , the results are radically different and worse than when each diagnosis is scored.some clinicians prefer to use physiological markers because they often use these markers in patient management . clearly , abnormal physiological markers raise the chances of mortality , but physiological markers are often transient and return to normal with good care . there is no reason to believe that these variations affect long - term mortality six months later . many are concerned with coding errors in reporting patient diagnoses.69 however , given the accuracy of the results reported in this paper , coding errors are not extensive enough to significantly reduce the accuracy of diagnosis - based indices . some clinicians are concerned with reports that diagnoses in administrative data are less accurate than physiological markers when predicting prognosis , e.g. , brinkman et al.70 these studies do not contradict the data presented in this paper . as reviewed , when diagnoses are not grouped into broad categories , the results are radically different and worse than when each diagnosis is scored . some clinicians prefer to use physiological markers because they often use these markers in patient management . clearly , abnormal physiological markers raise the chances of mortality , but physiological markers are often transient and return to normal with good care . there is no reason to believe that these variations affect long - term mortality six months later . a major conclusion of this paper was that mm index is more accurate than existing diagnosis - based indices , such as variants of charlson and elixhauser indices . to the best of our knowledge , the mm index is the first index that scores each disease separately rather than grouping similar diagnostic codes into broad categories . the observed improved accuracy of the mm index may be due to this feature of its scoring . the comprehensive inclusion of thousands of comorbidities in the mm index makes its use within clinical settings more difficult . to address use in clinical settings , the mmm variant still scores each disease but classifies these diseases by body system after scoring and selects the maximum ( worst ) score within each body system . this organization of diagnoses in various body systems allows clinicians to think through the prognosis of their patients more intuitively and without access to a computer . the mmm index is also helpful for conducting a propensity - matched comparative effectiveness study , where cases and controls must have similar scores across different body systems . matching on scores ranges in the body systems may be more practical than matching on separate diagnoses within the body system . use of the mm index is more practical now that many clinics have access to ehrs . these computers have access to the patients diagnostic history , can score patient s prognosis , and can explain the top two or three reasons for the predicted prognosis . then , the use of mm index in a clinical setting will be akin to use of any laboratory test , where the results are available but details of how the results were obtained are masked . the appendix to this paper ( as well as cielo repository ) provides an sql code that can be used to estimate the parameters of the mm index from data within warehouses or ehr systems . this code allows investigators to estimate the parameters of the mm index for the population that they are working with . there are a number of ways that the mm index can be further improved , including the examination of interaction among diseases and removal of confounding in estimates of likelihood ratios . in addition , the mm index may be improved if medications , physiological markers , or procedures were used to predict prognosis . the use of the mm index , as well as other prognostic indices , is fraught with difficulties when personalizing data for one patient . no patient is the average patient , since patients are likely to experience a combination of comorbidities that may radically differ from the average patient . furthermore , a discussion of mortality with patients may be understood differently if it is framed in terms of survival as opposed to mortality . probabilities may be misunderstood , and patients may prefer to know expected survival days as opposed to the probability of mortality in six months . obviously , any discussion of prognosis with patients requires empathetic communication on the part of clinicians . these and other limitations continue to frustrate efforts to make data on prognostic information available to patients and their families . additional research is needed to clarify how to best communicate prognostic information to individual patients . the mm and mmm indices can be used easily in policy analysis , decision support , and program evaluation . in these uses , the index enables assessment of comparative effectiveness of treatment . because these indices are more accurate than existing comprehensive diagnosis - based indices , we recommend their use despite the complexity of the underlying scoring procedures .

background : the multimorbidity ( mm ) index predicts the prognosis of patients from their diagnostic history . in contrast to existing approaches with broad diagnostic categories , it treats each diagnosis as a separate independent variable using individual international classification of disease , revision 9 ( icd-9 ) codes.objective:this paper describes the mm index , reviews the published data on its accuracy , and provides procedures for implementing the index within electronic health record ( ehr ) systems . methods : the mm index was tested on various patient populations by using data from the united states department of veterans affairs data warehouse and claims data within the healthcare cost and utilization project of the agency for health care research and quality.results:in cross - validated studies , the mm index outperformed prognostic indices based on physiological markers , such as cd4 cell counts in hiv / aids , hbalc levels in diabetes , ejection fractions in heart failure , or the 13 physiological markers commonly used for patients in intensive care units . when predicting the prognosis of nursing home patients by using the cross - validated area under a receiver operating characteristic ( roc ) curve , the mm index was 15 percent outperformed the quan variant of the charlson index , 27 percent more accurate than the deyo variant of the charlson index , and 22 percent more accurate than the von walraven variant of the elixhauser index . for patients in intensive care units , the mm index was 13 percent outperformed the cross - validated area under roc associated with elixhauser s categories . the mm index also demonstrated greater accuracy than a number of commercially available measures of illness severity ; including a fivefold greater accuracy than the all patient refined diagnosis - related groups and a threefold greater accuracy than all payer severity - adjusted diagnosis - related groups.conclusion:the mm index is statistically more accurate than many existing measures of prognosis . the magnitude of improvement is large and may lead to a clinically meaningful difference in patient care . given the large improvements in accuracy , the use of the mm index for policy and comparative effectiveness analysis is recommended .

Introduction Derivation of the Multimorbidity Index Sample Size Needed to Construct the MM Index Use of MM Index Adjustments for Diseases with No Mortality or Mortality in All Cases Adjustment for Rare Diseases Adjustment for the International Classification of Diseases, Revision 10 (ICD-10) Multidimensional Variant of the MM Index Accuracy of the MM Index Compared to Physiological Markers Accuracy of MM Indices Compared to Other Diagnoses-Based Indices Methods for Using the MM Index Derivation of the MM Index from Data in an Electronic Health Record (EHR) Conclusion

the choroid is a vessel - rich structure located between the lamina fusca of the sclera and the retinal pigment epithelium . choroidal thickness ( ct ) is thought to indicate the amount of choroidal vascularization and varies by age , sex , axial length ( axl ) , refractive status , and circadian rhythm.1,2 the choroid is reported to play a role in many vision - threatening diseases such as choroidal neovascularization , polypoidal choroidal vasculopathy , central serous chorioretinopathy , and chorioretinal atrophy associated with high myopia.36 thus , choroidal structural alterations are increasingly evaluated in scientific studies to understand the pathophysiology of these critical diseases . phacoemulsification surgery is the most frequently performed eye surgery , especially at advanced ages , and is generally associated with good visual outcomes . however , cataract surgery is known to have adverse effects on the retina , such as progression in diabetic retinopathy and pseudophakic cystoid macular edema , and the pathogenesis of such conditions is not yet clarified.7,8 also , epidemiological studies show that cataract surgery is associated with the onset of age - related macular degeneration ( amd ) , although the association is still controversial.9 the development of amd may be induced after cataract surgery due to reasons such as inflammatory reactions associated with cataract surgery , increased free radicals after surgery , the release of growth factors and prostaglandins , and increased light exposure during surgery.1014 amd is a serious disease , threatening vision due to neovascularizations arising from the choroid . an increment in the retinal thickness was reported after cataract surgery even in healthy eyes with no detected morphological impairment using spectral domain optical coherence tomography ( sd - oct).15 given the close link between the retina and choroid , affected change in ct might also be expected after cataract surgery . evaluation of choroid has been restricted to ultrasonography and angiography previously , while the choroid can be examined in detail with sd - oct . sd - oct provides detailed histological sectional images of the retina in vivo and provides useful information for the diagnosis , evaluation of the treatment options , and follow - up of several retinal diseases.16 the present study aims to examine the possible alterations in the ct after uncomplicated phacoemulsification surgery using sd - oct and to investigate the potential mechanisms that may cause such changes . this prospective study was conducted at the department of ophthalmology , faculty of medicine , bozok university , yozgat , turkey . the study was approved by the bozok university ethical committee and was performed in accordance with the ethical principles described in the declaration of helsinki . all subjects enrolled in the study agreed to participate , met the inclusion criteria , and signed an informed consent agreement before any procedures were performed . patients with diabetes mellitus , hypertension , dyslipidemia , any known systemic diseases , uveitis , glaucoma , retinal vein / branch occlusion , or other vascular and inflammatory retinal diseases , and previous eye surgery were excluded from the study due to the effect on ct . cataract hardness of the patients was evaluated and standardized based on the lens opacities classification system ( locs ) iii staging system,17 and patients with severe cataracts that might prevent a reliable sd - oct measurement and poor fixation were excluded from the study . , fort worth , tx , usa ) was used in all surgeries , and same hydrophobic acrylic intraocular lens ( acriva ud 613 ; vsy biotechnology , istanbul , turkey ) was implanted in all cases . the patients were administered topical moxifloxacin for 1 week and topical prednisolone for 4 weeks after the surgery . all patients underwent a detailed ophthalmologic examination including visual acuity measurement , anterior segment biomicroscopy , dilated fundus examination , and intraocular pressure ( iop ) measurement ( applanation tonometry ) preoperatively and 1 month postoperatively . furthermore , axl measurement using optical biometry ( lenstar ls 900 ; haag - streit ag , koeniz , switzerland ) was performed in all cases , preoperatively . sd - oct measurements were obtained in the morning ( between 9 am and 11 am ) in order to avoid the effect of diurnal fluctuations . changes in the ct after surgery and correlation of this change with age , axl , ept , preoperative iop , and iop change were evaluated . choroidal imaging was performed using rtvue-100 sd - oct system ( optovue inc , fremont , ca , usa ) . the depth resolution of the system is 5 m in tissue . for ct measurement , the patient s head and chin were properly positioned , then the patient was asked to maintain fixation on the internal fixation light , and a reverse image was obtained from the retina . the image was automatically inverted so that the chorioretinal interface was adjacent to the zero delay . the retina cross - line was used as the scanning pattern ; this mode provides two orthogonally oriented 6 mm lines consisting of 1024 a - scans , perpendicular to each other . sections passing through the fovea vertically and 1.5 and 3.0 mm nasal and temporal to the fovea were used for the measurements . the choroidal margins were taken as the distance between the outer margin of hyperreflective retinal pigment epithelium and the internal side of the sclera . only images with a signal strength 45 were taken . ct measurements were performed manually by two different physicians ( sab and hab ) , who were unaware of each other . these measurements were averaged ; the difference between the measurements of the physicians was 10% of the average . chicago , il , usa ) . the test was used to make comparisons between the categorical data . the shapiro since the data were distributed normally , the paired - samples t - test was used for the comparison between preoperative and postoperative measurements . potential parameters that might be associated with ct were evaluated using pearson s correlation analysis and regression analysis . evaluations were made at a 95% confidence interval , and a p - value < 0.05 was considered statistically significant . choroidal imaging was performed using rtvue-100 sd - oct system ( optovue inc , fremont , ca , usa ) . the depth resolution of the system is 5 m in tissue . for ct measurement , the patient s head and chin were properly positioned , then the patient was asked to maintain fixation on the internal fixation light , and a reverse image was obtained from the retina . the image was automatically inverted so that the chorioretinal interface was adjacent to the zero delay . the retina cross - line was used as the scanning pattern ; this mode provides two orthogonally oriented 6 mm lines consisting of 1024 a - scans , perpendicular to each other . sections passing through the fovea vertically and 1.5 and 3.0 mm nasal and temporal to the fovea were used for the measurements . the choroidal margins were taken as the distance between the outer margin of hyperreflective retinal pigment epithelium and the internal side of the sclera . only images with a signal strength 45 were taken . ct measurements were performed manually by two different physicians ( sab and hab ) , who were unaware of each other . these measurements were averaged ; the difference between the measurements of the physicians was 10% of the average . all data were analyzed using spss software ( version 16.0 , spss inc . , chicago , il , usa ) . the test was used to make comparisons between the categorical data . the shapiro wilk test was used to determine whether the data were distributed normally . since the data were distributed normally , the paired - samples t - test was used for the comparison between preoperative and postoperative measurements . potential parameters that might be associated with ct were evaluated using pearson s correlation analysis and regression analysis . evaluations were made at a 95% confidence interval , and a p - value < 0.05 was considered statistically significant . thirty - eight eyes of 38 patients ( 20 women and 18 men ) were included . there was only one patient with grade iv cataract hardness ; the rest of the patients had grade ii the mean duration of the operation was 14.783.47 minutes , and the mean ept was 6.373.47 seconds . the mean subfoveal ct was 247.1064.92 m before surgery ( figure 1 ) and 267.8474.1 m at 1 month postoperative follow - up ( p=0.002 ; figure 2 ) . a significant increase in the ct was observed in all regions ( p<0.05 for all ) ; such an increase was especially evident in the nasal and subfoveal regions . the iop was significantly lower at the 1-month follow - up evaluation than preoperatively ( 16.144.94 mmhg vs 13.914.86 mmhg ; p<0.001 ) . when the potential factors affecting the change in the ct were analyzed , the change in the ct was correlated with a change in iop for all sectors ; no significant correlation was observed between ct changes and age , axl , ept , or preoperative iop levels ( tables 2 and 3 ) . it has been suggested that cataract surgery may be associated with the onset of amd . the beaver dam and blue mountains groups reported an increased incidence of amd with cataract surgery.18,19 in contrast , in the age - related eye disease study , there was no significant increase in the incidence of amd after cataract surgery.20 although the fundoscopic appearance of the retina does not change with phacoemulsification in most eyes undergoing cataract surgery , subclinical changes in the macula and choroid have been reported after phacoemulsification surgery , as indicated by sd - oct sectional imaging of the retina.21 the effects of such subclinical changes are not yet fully understood . sd - oct imagery highlights the importance of ct changes in diseases of the choroid and retina , such as diabetic retinopathy , amd , and central serous chorioretinopathy.5,6,22,23 pierru et al24 examined the subfoveal ct after cataract surgery ; they reported that the ct began to increase postoperatively on day 7 and reached its highest value 1 month postoperatively . the follow - up exam at 3 months showed a decrease in ct.24 noda et al21 reported that subfoveal ct increased as indicated in the follow - up examination 1 month after surgery ; however , subfoveal ct did not return to preoperative values as indicated in the 6-month follow - up examination . another study evaluating the ct after cataract surgery found no significant changes in ct values 1 week and 1 month after surgery;25 however , the study was conducted with a limited number of participants ( 14 patients ) . in the present study we administered anti - inflammatory ( prednisolone ) eye drops to our patients for 1 month following surgery . anti - inflammatory therapies are known to reduce postoperative inflammation and suppress the inflammatory response in the retina.26 anti - inflammatory therapies may also reduce the postoperative choroidal response . we administered postoperative anti - inflammatory therapy to all of our patients as part of our standard treatment protocol in this study to evaluate the actual postoperative choroidal response . the mechanism through which cataract surgery increases inflammation in the retina and choroid has yet to be fully explained . it has been suggested that the ct may increase due to proinflammatory cytokines and prostaglandins that are believed to increase after cataract surgery.27,28 it is known that surgical trauma induces aqueous humor prostaglandin release and that these prostaglandins impair the blood aqueous barrier is impaired , other inflammatory mediators , such as endotoxin , cytokines , and immune complexes , accumulate in the aqueous humor . these inflammatory mediators pass through the vitreous to the retina , leading to an impaired inner and outer blood retinal barrier.29 the inflammatory response in the anterior segment , which develops secondary to cataract surgery , may thereby also cause inflammatory cascades in the posterior segment . however , these mechanisms can not explain why the increased choroidal blood supply continues for up to 6 months after cataract surgery . another mechanism suggested for inflammation induced by surgical trauma is increased gene expression that simultaneously induces inflammatory response in all structures of the eye . in a mouse model , extracapsular lens extraction was found to increase protein secretion in the retina and choroid through proinflammatory gene expression . an increase was observed in the expression of genes related to chemokines such as ccl-2 and sdf-1 , which can impair the blood retinal barrier in the retina , retinal pigment epithelium , and choroid in operated eyes , as well as growth factors such as fibroblast growth factors and vascular endothelial growth factors . the same study also established that il-1 , a proinflammatory cytokine , increased in the ganglion cell layer , inner nuclear layer , and choroid in operated eyes.28 another animal study involving monkeys showed that cataract surgery destroyed the outer blood retinal barrier and increased macular thickness.29 it has been shown that even uncomplicated phacoemulsification has effects on retina , in general as temporary thickening of the central retina . this effect could be attributed to factors such as ultrasound power used during surgery or the intraoperative iop fluctuations caused by surge or the intraoperative photostress due to microscope light.30 when we evaluated our data on the correlation between ept and ct , we did not find any correlation . though the cataract hardness of the patients in our study ranged from grade ii to iv based on locs iii , patients with severe cataracts that might prevent a reliable sd - oct measurement were excluded , and there was only one patient with grade iv cataract hardness . since the patients expecting high ultrasonic energy due to hard cataracts were excluded , our patient group was homogeneous in terms of cataract hardness , and this might prevent detection of any possible correlation between ept and ct . on the other hand , ching et al31 showed thicker preoperative retinal thickness than those in the early postoperative period , and the authors suggested that possible measurement errors in preoperative evaluation might be the reason of their results . so , all these factors might also have an influence on ct , and while interpreting our results , these factors should also be kept in mind . iop decreases after cataract surgery.32 to understand the reasons for iop decrease after phacoemulsification , many factors should be taken into account . by removing the thick lens , blockage of aqueous outflow with lens is prevented , the angle of anterior chamber opens , aqueous outflow improves , and consequently iop decreases . a study by ohsugi et al33 with 100 patients reported a negative correlation between change in ct and change in iop in the postoperative early period , supporting the present study ; however , they did not establish any correlation between ct change and iop for many regions in subsequent periods . although their recent report showed a significant correlation between change in ct and change in iop in the early postoperative period , we believe that this is worth confirming in a further study . also , in our study , the same experienced surgeon performed all surgeries and the same intraocular lens was implanted in all cases , whereas in the study by ohsugi et al,33 seven surgeons performed the surgeries and uniformity of intraocular lens was not mentioned , so these might have limited standardization of the surgical technique in their preliminary report . the increase in ct may be due to increased ocular perfusion pressure caused by reduced iop in the early period after cataract surgery . the driving force for ocular blood flow is the ocular perfusion pressure , defined as ocular arterial pressure minus iop.34 animal studies showed that induction of ocular hypertension resulted in decreased blood flow through the choroid , while retinal blood flow remained at normal levels , suggesting a marked difference in autoregulatory capacity between the choroidal and retinal vascular beds.35 it was also demonstrated that in vivo subfoveal ct as measured by enhanced depth imaging - oct was significantly associated with ocular perfusion pressure , suggesting that subfoveal ct may be indirectly indicative of subfoveal ocular perfusion status.36 since there is an inverse relation between iop and ocular perfusion pressure , the increase in ct may be due to increased ocular perfusion pressure caused by reduced iop in the early period after cataract surgery in our study . in the future , ct relationship may be understood upon evaluation of changes in ct after glaucoma surgery , which greatly influences iop . in this study , we did not find any correlation between the axl and age with ct ; however , the included subjects were older patients within nearly the same age range , and the patients having myopic fundus were not included in the study . thus , these might have limited our results on the correlation between the axl and age with ct . cataract surgery causes an increase in ct , which is correlated with a change in iop in the early stages . this is especially important for understanding the pathogenesis of diseases associated with choroidal changes , such as cystoid macular edema , which increase in prevalence following cataract surgery .

purposethe aim of the study was to analyze the effects of uneventful phacoemulsification surgery on choroidal thickness ( ct ) using spectral domain optical coherence tomography ( sd - oct).methodsin this prospective study , 38 eyes of 38 patients having phacoemulsification surgery were included . all patients underwent detailed ophthalmologic examination , including preoperative axial length ( axl ) measurement with optical biometry and intraocular pressure ( iop ) measurement preoperatively and 1 month postoperatively . the ct was measured perpendicularly at the fovea and 1.5 mm temporal , 3.0 mm temporal , 1.5 mm nasal , and 3.0 mm nasal using sd - oct preoperatively and 1 month postoperatively . changes in the ct after surgery and correlation of this change with age , axl , preoperative iop , and iop change were evaluated.resultsthere was a statistically significant increase in the ct at all regions evaluated . this increment was more prominent in the nasal and subfoveal regions . the iop decreased significantly 1 month after surgery ( 16.144.94 mmhg vs 13.914.86 mmhg ; p<0.001 ) . the change in iop was correlated with the ct changes at all regions , whereas age , axl , and preoperative iop had no significant correlations with the changes in ct.conclusionphacoemulsification surgery may cause significant increase in ct , which is correlated with surgery - induced iop change in the short term . long - term follow - up of eyes having phacoemulsification surgery may provide further insight into the effects of cataract surgery on the choroid .

Introduction Methods Image acquisition and processing Statistical analysis Results Discussion Conclusion

while augmentation cystoplasty has seen its indications decrease with the advent of onabotulinum toxin a and neuromodulation , there remains a role for this procedure in the 21st century ( 1 ) . analysis from the nationwide inpatient sample ( nis ) reveals that augmentation cystoplasty appears to be widely used in the surgical management of neurogenic bladder in patients with spina bifida ( 2 ) . data from the pediatric health information system ( phis ) database demonstrates no change in augmentation rates between 1999 and 2004 , finding 665 patients who underwent augmentation cystoplasty over this 5-year period ( 3 ) . a recent study by uc san francisco demonstrated a decrease in the number of augmentations by 25% in the 2000s ( 4 ) . institutional case series have examined complications of bladder reconstruction , suggesting it continues to have notable morbidity . retrospectively analyzed 25 pediatric patients who underwent augmentation cystoplasty ( 5 ) and bladder substitution ( 6 ) between 1999 and 2007 , finding major complications including lower urinary tract calculi ( 39% ) , stricture or insufficiency of the continent vesicostomy ( 28% ) , and intestinal obstruction ( 9% ) ( 5 ) . approximately one - third of patients who have undergone enterocystoplasty experience postoperative complications ( 6 , 7 ) . these morbidities are secondary to a multitude of factors including surgical technique , inherent properties of the bowel segment , and patient compliance with maintenance regimens ( 8) . we sought to determine , on a national scale , the readmission rates at 30 , 60 and 90 days after initial surgery , whether they have improved over the 7-year period , and to determine the influence of hospital and patient - specific variables with estimated costs of readmission . this was a retrospective cohort analysis of the phis , a national administrative database containing combined hospitalization data from 43 tertiary care pediatric hospitals in the united states . this study was reviewed and approved by the uc san diego human research protections program institutional review board ( irb ) with an informed consent waiver . patients were followed across multiple hospital admissions to the same phis hospital using unique numerical patient identifiers . patient privacy and confidentiality are protected and this study conforms to the ethical guidelines of the 1975 declaration of helsinki . inpatient data , emergency room visits , observation , and ambulatory surgery / medicine visits are all included . some hospitals contribute varying amounts of data , for example , only inpatient visits versus inpatient , ambulatory , emergency room , and observation visits . each participating institution and an independent data management group review the data for accuracy each quarter . data is only accepted into phis if classified errors occur in less than 2% of the quarterly data . thirty - seven of the 43 hospitals had complete inpatient information during the study period and were included in the analysis . we identified patients 0 - 17 years of age , from 2004 - 2010 , undergoing bladder reconstruction using icd-9 procedure codes : 56.51 ( formation cutaneous uretero - ileostomy ) , 57.87 ( reconstruction of urinary bladder ) , and 57.88 ( other anastomosis of bladder ) ; patients undergoing repair of bladder exstrophy ( icd9 57.86 ) were excluded . descriptive statistics were used to characterize patient demographics , prevalence of surgeries , and readmission rates . surgery prevalence was examined using linear regression and readmission rates were compared using the chi test . total charges were compared between those who required readmission and those who did not , using the mann - whitney u - test . costs are recorded in the phis database using a cost - to - charges ratio ( rcc - based ) for each hospital , which standardizes costs nationally taking into account variability in pricing and costs regionally . although the rcc method is a good approximation for true costs , these costs are estimates and as such are only used in this analysis to compare between groups , rather than reporting them as a true exact cost amount . ninety - day readmission rates were compared between hospitals after adjusting for hospital volume of augmentation surgery ( number of readmits / total number of augment surgeries ) . gee ( generalized estimating equation ) regression was used to evaluate the influence of independent variables on 90-day readmission risk while adjusting for patient clustering within hospitals . covariates entered into the original model included age , gender , race , insurance ( public / private ) , complex chronic condition ( which comprises a broad array of icd 9 codes for congenital anomalies ) ( 9 ) , length of stay ( < = 7 , > 7 days ) , year of surgery , days admitted prior to surgery to accommodate for bowel preps ( 0 or 1 ) and all 2-term interactions . only variables that remained significant in multivariate analysis remained in the final models . significance for testing was set a priori at p < 0.05 , and stata ver . this was a retrospective cohort analysis of the phis , a national administrative database containing combined hospitalization data from 43 tertiary care pediatric hospitals in the united states . this study was reviewed and approved by the uc san diego human research protections program institutional review board ( irb ) with an informed consent waiver . patients were followed across multiple hospital admissions to the same phis hospital using unique numerical patient identifiers . patient privacy and confidentiality are protected and this study conforms to the ethical guidelines of the 1975 declaration of helsinki . inpatient data , emergency room visits , observation , and ambulatory surgery / medicine visits are all included . some hospitals contribute varying amounts of data , for example , only inpatient visits versus inpatient , ambulatory , emergency room , and observation visits . each participating institution and an independent data management group review the data for accuracy each quarter . data is only accepted into phis if classified errors occur in less than 2% of the quarterly data . thirty - seven of the 43 hospitals had complete inpatient information during the study period and were included in the analysis . we identified patients 0 - 17 years of age , from 2004 - 2010 , undergoing bladder reconstruction using icd-9 procedure codes : 56.51 ( formation cutaneous uretero - ileostomy ) , 57.87 ( reconstruction of urinary bladder ) , and 57.88 ( other anastomosis of bladder ) ; patients undergoing repair of bladder exstrophy ( icd9 57.86 ) were excluded . descriptive statistics were used to characterize patient demographics , prevalence of surgeries , and readmission rates . surgery prevalence was examined using linear regression and readmission rates were compared using the chi test . total charges were compared between those who required readmission and those who did not , using the mann - whitney u - test . costs are recorded in the phis database using a cost - to - charges ratio ( rcc - based ) for each hospital , which standardizes costs nationally taking into account variability in pricing and costs regionally . although the rcc method is a good approximation for true costs , these costs are estimates and as such are only used in this analysis to compare between groups , rather than reporting them as a true exact cost amount . ninety - day readmission rates were compared between hospitals after adjusting for hospital volume of augmentation surgery ( number of readmits / total number of augment surgeries ) . gee ( generalized estimating equation ) regression was used to evaluate the influence of independent variables on 90-day readmission risk while adjusting for patient clustering within hospitals . covariates entered into the original model included age , gender , race , insurance ( public / private ) , complex chronic condition ( which comprises a broad array of icd 9 codes for congenital anomalies ) ( 9 ) , length of stay ( < = 7 , > 7 days ) , year of surgery , days admitted prior to surgery to accommodate for bowel preps ( 0 or 1 ) and all 2-term interactions . only variables that remained significant in multivariate analysis remained in the final models . significance for testing was set a priori at p < 0.05 , and stata ver . , there has been no change in the prevalence of bladder reconstruction surgeries ( r : 0.191 , coefficient : -4.71 , 95% ci : -15.9 to 6.4 , p = 0.327 ; figure 1 ) . there was no change in 30-day ( ranging from 14% to 20% p = 0.272 ) , 60-day ( 19% to 24% , p = 0.788 ) or 90-day readmission rates over time ( 23% to 27% , p = 0.924 ) ( table 2 ) . despite surgical volume adjustment , the majority of hospitals had similar 90-day readmission rates ( figure 2 ) . from a total of 37 hospitals , two had significantly higher readmission rates / volume and three had significantly lower readmission rates / volume than the mean . the median cost for those patients requiring readmission was 1.76-fold higher than that of patients who were not readmitted based on rcc ( p < 0.001 ) . 2 hospitals had significantly higher readmission rate than the mean ( * ) , and 3 had significantly lower readmission rates ( ^ ) . on multivariate analysis , a significant interaction was seen between gender and complex chronic condition ( ccc ) and as such , additional models were generated after splitting by gender : initial los > 7 days had 2-fold higher odds of readmission than < = 7 ( males or 1.647 , p = 0.001 ; females or 2.18 , p < 0.001 ) . within males , having a ccc was significantly associated with 90-day readmission ( or 1.898 , p = 0.001 ) ; ccc was not an independent predictor in females ( p = 0.147 ) . between 2004 and 2010 , there was no significant change in the prevalence in bladder reconstruction in the pediatric population , nor was there any change in the rate of readmission of these post - surgical patients at 30 , 60 , or 90 days . a recent study by schlomer et al . shows a 25% decrease in bladder augmentation over the last decade ( 4 ) . however , the critical issue of this study is the need for early postoperative readmission , which has been stable and alarmingly high . beyond the direct morbidity to the patient , there is also a tremendous cost to the health care system with a 1.7-fold increase over patients who are not readmitted . the 90-day admission rate of 23 - 27% is comparable to the 30% readmission rate seen following either adult kidney or liver transplantation , which speaks to the severity of the condition and surgery ( 10 , 11 ) . following urinary diversion in adults , the 90-day readmission rate has also been reported to be near 30% as well ( 12 ) . when counseling families and practitioners , the significant likelihood of readmission should not be underestimated . single institutional studies have been able to identify long - term morbidity following reconstruction . in adults , welk et al . reported the rate of additional urological surgery after adult enterocystoplasty , finding 40% of patients required subsequent urological surgery in 243 patients , with a median follow up of 7.8 years ( 13 ) . similar to adults , there is impressive morbidity after total bladder substitution in the pediatric population . defoor et al . retrospectively analyzed a population of 26 patients , median age 8.9 years , with median follow up of 8 years , who underwent neobladder creation , finding complications including reservoir stones ( 8 patients ) , febrile urinary tract infections ( 8 patients ) , metabolic acidosis ( 6 patients ) , small bowel obstruction ( 4 patients ) , bladder perforation ( 4 patients ) , and pelvic lymphocele ( 1 patient ) ( 14 ) . although the short- to long - term complications following pediatric bladder augmentation / reconstruction have been enumerated , the likelihood of early readmission following initial surgery has not been studied from a population - based perspective . despite including 37 phis hospitals nationwide in our analysis with a diverse volume of bladder augmentation caseloads , our analysis found no appreciable difference in postoperative readmission rates among hospitals . this could be secondary to several reasons , including the consistency of pediatric urologists at the majority of phis hospitals , the essential high morbidity of the surgery itself and its predisposing condition , or even the likelihood that an increased presence of patients with cccs at high volume centers may dilute the otherwise improved outcomes in the overall patient population . there has been recent discussion within the adult genitourinary surgical community focusing on the regionalization of radical prostatectomy to high volume centers , secondary to the belief this would provide patients with improved outcomes . analysis compiled from the nis concluded that low volume institutions experienced inferior outcomes relative to the highest volume centers , irrespective of approach for radical prostatectomy , supposedly demonstrating the importance of accounting for hospital volume when examining the benefit of a surgical technique ( 15 ) . however , in the present study cohort when adjusted for hospital volume , there is a similar readmission rate among all institutions . in 2011 , berry et al . used the phis database to characterize hospital readmissions between 2003 and 2008 , finding 21.8% of patients experienced at least 1 readmission within 365 days of a prior admission ; 2.9% experienced 4 or more readmissions within 365 days , accounting for 18.8% of overall admissions ( 16 ) . of this 2.9% , 28.5% ( 2633 ) were re - hospitalized for a problem in the same organ system across all admissions during the interval . a retrospective analysis examined readmission among 1,083 patients hospitalized between 2006 and 2008 who were part of a structured , pediatric complex - care clinical program within 4 children s hospitals . notably , almost half ( 47.1% ) of all complex - care clinical program patient admissions were related primarily to a surgical operation or major procedure ( 17 ) . in our analysis , multivariate regression found males with cccs were at increased risk of postoperative readmission ; this is supported by previous data which has already identified the use of cccs in models describing pediatric readmission rates ( 18 , 19 ) . somewhat surprising was our finding that ccc was an independent predictor of readmission in males but not females . this could be secondary to a yet unidentified gap in the care of male patients . however , 83.5% of our cohort had a ccc , with 50% reporting a neuromuscular condition . as a result , the attempted use of cccs for determining readmission risk is not ideal but was an attempt to find some way of quantifying risk . we attempted to find other predictors of readmission including specific conditions such as obesity but only initial los > 7 days during the initial surgery yielded a 2-fold increase in likelihood of readmission . rice - townsend et al . utilized a retrospective analysis of the phis database to identify disease severity among patients as the primary factor associated with readmission after treatment of appendicitis ( 20 ) . this factor was highly variable across hospital populations and significantly altered ranking of performance - based outliers . one of the limitations of our study is the inability to account for disease severity , going back to the lack of unified , descriptive data that is needed to better stratify and describe the cohort of pediatric patients undergoing bladder reconstruction . additional limitations include a lack of readmission data in situations where pediatric patients were re - hospitalized in non - phis hospitals or patients were readmitted to a different phis hospital . patients may have been readmitted for other reasons outside of the initial bladder reconstruction , thus overestimating our readmission rates . the lack of sufficient finite data to characterize the reasons for readmission is a significant drawback in administrative databases , but we believe that a definite trend is seen in this study . the ability to generalize our results might also be limited to freestanding children s hospitals and does not represent the national norm , although it is estimated that 25% of children s hospitalizations occur within children s hospitals ( national statistics on children , healthcare cost and utilization project , agency for healthcare research and quality , http://www.hcupnet.ahrq.gov/ ( accessed march 30 , 2013 ) . children treated at children s hospitals have a higher prevalence of cccs than children at other hospitals , and this could potentially affect our results ( 21 ) . in addition , our use of icd-9 coding to identify patients for inclusion is always subject to the quality of initial data collection and may unintentionally lead to inclusion of inappropriate or exclusion of appropriate patients . with health care reform initiatives looming , the future of medicine will likely include bundled payments for inpatient surgical and outpatient post - hospitalization care , ensuring accountability for patient outcomes and inpatient utilization among care providers ( 22 - 24 ) . pediatric bladder reconstruction is a significant endeavor with an essential likelihood for future admission at substantial cost . as evidenced in this study , readmission rates after pediatric bladder reconstruction have not improved over time . single institutional studies have been able to identify long - term morbidity following reconstruction . in adults , welk et al . reported the rate of additional urological surgery after adult enterocystoplasty , finding 40% of patients required subsequent urological surgery in 243 patients , with a median follow up of 7.8 years ( 13 ) . similar to adults , there is impressive morbidity after total bladder substitution in the pediatric population . defoor et al . retrospectively analyzed a population of 26 patients , median age 8.9 years , with median follow up of 8 years , who underwent neobladder creation , finding complications including reservoir stones ( 8 patients ) , febrile urinary tract infections ( 8 patients ) , metabolic acidosis ( 6 patients ) , small bowel obstruction ( 4 patients ) , bladder perforation ( 4 patients ) , and pelvic lymphocele ( 1 patient ) ( 14 ) . although the short- to long - term complications following pediatric bladder augmentation / reconstruction have been enumerated , the likelihood of early readmission following initial surgery has not been studied from a population - based perspective . despite including 37 phis hospitals nationwide in our analysis with a diverse volume of bladder augmentation caseloads , our analysis found no appreciable difference in postoperative readmission rates among hospitals . this could be secondary to several reasons , including the consistency of pediatric urologists at the majority of phis hospitals , the essential high morbidity of the surgery itself and its predisposing condition , or even the likelihood that an increased presence of patients with cccs at high volume centers may dilute the otherwise improved outcomes in the overall patient population . there has been recent discussion within the adult genitourinary surgical community focusing on the regionalization of radical prostatectomy to high volume centers , secondary to the belief this would provide patients with improved outcomes . analysis compiled from the nis concluded that low volume institutions experienced inferior outcomes relative to the highest volume centers , irrespective of approach for radical prostatectomy , supposedly demonstrating the importance of accounting for hospital volume when examining the benefit of a surgical technique ( 15 ) . however , in the present study cohort when adjusted for hospital volume , there is a similar readmission rate among all institutions . in 2011 , berry et al . used the phis database to characterize hospital readmissions between 2003 and 2008 , finding 21.8% of patients experienced at least 1 readmission within 365 days of a prior admission ; 2.9% experienced 4 or more readmissions within 365 days , accounting for 18.8% of overall admissions ( 16 ) . of this 2.9% , 28.5% ( 2633 ) were re - hospitalized for a problem in the same organ system across all admissions during the interval . a retrospective analysis examined readmission among 1,083 patients hospitalized between 2006 and 2008 who were part of a structured , pediatric complex - care clinical program within 4 children s hospitals . notably , almost half ( 47.1% ) of all complex - care clinical program patient admissions were related primarily to a surgical operation or major procedure ( 17 ) . in our analysis , multivariate regression found males with cccs were at increased risk of postoperative readmission ; this is supported by previous data which has already identified the use of cccs in models describing pediatric readmission rates ( 18 , 19 ) . somewhat surprising was our finding that ccc was an independent predictor of readmission in males but not females . this could be secondary to a yet unidentified gap in the care of male patients . however , 83.5% of our cohort had a ccc , with 50% reporting a neuromuscular condition . as a result , the attempted use of cccs for determining readmission risk is not ideal but was an attempt to find some way of quantifying risk . we attempted to find other predictors of readmission including specific conditions such as obesity but only initial los > 7 days during the initial surgery yielded a 2-fold increase in likelihood of readmission . rice - townsend et al . utilized a retrospective analysis of the phis database to identify disease severity among patients as the primary factor associated with readmission after treatment of appendicitis ( 20 ) . this factor was highly variable across hospital populations and significantly altered ranking of performance - based outliers . one of the limitations of our study is the inability to account for disease severity , going back to the lack of unified , descriptive data that is needed to better stratify and describe the cohort of pediatric patients undergoing bladder reconstruction . additional limitations include a lack of readmission data in situations where pediatric patients were re - hospitalized in non - phis hospitals or patients were readmitted to a different phis hospital patients may have been readmitted for other reasons outside of the initial bladder reconstruction , thus overestimating our readmission rates . the lack of sufficient finite data to characterize the reasons for readmission is a significant drawback in administrative databases , but we believe that a definite trend is seen in this study . the ability to generalize our results might also be limited to freestanding children s hospitals and does not represent the national norm , although it is estimated that 25% of children s hospitalizations occur within children s hospitals ( national statistics on children , healthcare cost and utilization project , agency for healthcare research and quality , http://www.hcupnet.ahrq.gov/ ( accessed march 30 , 2013 ) . children treated at children s hospitals have a higher prevalence of cccs than children at other hospitals , and this could potentially affect our results ( 21 ) . in addition , our use of icd-9 coding to identify patients for inclusion is always subject to the quality of initial data collection and may unintentionally lead to inclusion of inappropriate or exclusion of appropriate patients . with health care reform initiatives looming , the future of medicine will likely include bundled payments for inpatient surgical and outpatient post - hospitalization care , ensuring accountability for patient outcomes and inpatient utilization among care providers ( 22 - 24 ) . pediatric bladder reconstruction is a significant endeavor with an essential likelihood for future admission at substantial cost . as evidenced in this study ,

background : bladder reconstruction in the pediatric population is challenging for many reasons , including perioperative complications and readmissions.objectives:on a national scale , determine readmission rates at 30 , 60 and 90 days after bladder reconstruction in a pediatric population over a 7-year period , evaluating the influence of hospital and patient - specific variables.patients and methods : using the pediatric health information system database , we identified patients 0 - 17 years of age , from 2004 - 2010 , undergoing bladder reconstruction using icd-9 procedure codes . descriptive statistics characterized demographics , prevalence of surgeries , and readmission rates . surgery prevalence over time was examined using linear regression . readmission rates were compared using the chi2 test . regression was used to evaluate the influence of variables on readmission risk.results:we identified 1,985 patients for inclusion , of which 52.7% were female . median age was 9 years . there has been no change in the prevalence of bladder reconstruction surgeries ( p = 0.327 ) . there was no change in 30-day ( p = 0.272 ) , 60-day ( p = 0.788 ) or 90-day readmission rates ( p = 0.924 ) . despite surgical volume adjustment , 90-day readmission rates did not significantly vary among the majority of hospitals . initial los > 7 days ( p < 0.001 ) and complex chronic condition males ( p < 0.001 ) were significantly associated with 90-day readmission.conclusions:no improvement in readmission rates after pediatric bladder reconstruction was observed during the study period . nearly all centers have a similar readmission rate despite volume adjustment .

1. Background 2. Objectives 3. Patients and Methods 3.1. Pediatric Health Information System 3.2. Data Collection and Analysis 4. Results 5. Discussion 5.1. Readmission Rates 5.2. Complex Chronic Conditions

the prevalence of nephrolithiasis is 5% to 20%and varies with age , sex , race , and area of residence . nephrolithiasis is usually asymptomatic but the attacks can be painful and morbid , requiring an emergency medical visit and surgery . the focus on nephrolithiasis has shifted from these direct hazards to its effects , such as vascular events . nephrolithiasis and systemic diseases have been linked in several epidemiological studies , including coronary heart disease ( chd ) , hypertension , diabetes , atherosclerosis , and metabolic syndrome . ferraro et al demonstrated an association between kidney stones and an up to 1.48-fold higher risk of chd in prospective cohorts of women . atherosclerosis is the risk factor for chd and stroke , patients with nephrolithiasis might have a high stroke risk . domingos et al reported that patients with nephrolithiasis did not have a higher incidence of stroke than those without nephrolithiasis did . however , in their questionnaire - based study , adjustment for major confounders of stroke , such as hypertension , diabetes , and hyperlipidemia , was challenging in the absence of formal medical documentation . thus , a nationwide population database was used to assess the association of nephrolithiasis with stroke risks in a cohort study with a 13-year follow - up . the national health insurance ( nhi ) program was launched in taiwan on march 1 , 1995 , and covered > 99% of taiwan 's residents and was contracted with 97% of clinics and hospitals by the end of 2010 . this study utilized the longitudinal health insurance database 2000 ( lhid2000 ) claims data established by the national health research institute ( nhri ) , department of health , taiwan . lhid2000 contains the medical claims data of 1 million randomly sampled beneficiaries from among the enrollees of the nhi program between 1996 and 2010 . no statistically significant differences in the distribution of sex , age , or healthcare costs between cohorts in the lhid2000 and the enrollees were reported by the nhri . the international classification of diseases revision ninth clinical modification ( icd-9-cm ) was used for the diagnoses . the study was approved by the institutional review board of china medical university and hospital ( cmuh104-rec2115 ) . a retrospective cohort study was conducted to determine the association between renal stone ( rs ) ( icd-9-cm 592.0 : calculus of kidney , icd-9-cm 592.1 : calculus of ureter , icd-9-cm 592.9 : urinary calculus , icd-9-cm 594.1 : other calculus in bladder ) and stroke ( icd-9-cm 430 : subarachnoid hemorrhage , icd-9-cm 431 : intracerebral hemorrhage , icd-9-cm 432 : other and unspecified intracranial hemorrhage , icd-9-cm 433 : occlusion and stenosis of precerebral arteries , icd-9-cm 434 : occlusion of cerebral arteries , icd-9-cm 435 : transient cerebral ischemia , icd-9-cm 436 acute , but ill - defined , cerebrovascular disease , icd-9-cm 437 other and ill - defined cerebrovascular disease , icd-9-cm 438 : late effects of cerebrovascular disease ) . the claims data between1998 and 2010 were used to identify patients aged 20 years with a first diagnosis of rs . a comparison cohort was randomly selected from among the patients without rss during the same period , frequency matched 1:4 for age ( every 5 years ) , sex , comorbidities ( diabetes , hyperlipidemia , hypertension , coronary artery disease [ cad ] , congestive heart failure [ chf ] , and atrial fibrillation ) , and index year . patients with a stroke history and with missing information for age or sex were excluded from the data analysis . a follow - up for stroke occurrence was performed until the date of follow - up loss , withdrawal from the insurance system , or end of 2010 , whichever occurred first . the baseline comorbidities were diabetes ( icd-9-cm 250 ) , hyperlipidemia ( icd-9-cm 272 ) , hypertension ( icd-9-cm 401 to 405 ) , cad ( icd-9-cm 410 to 414 ) , chf ( icd-9-cm 398.91 , 402 , 404.01 , 404.03 , 404.10 , 404.11 , 404.13 , and 404.9 ) , and atrial fibrillation ( icd-9-cm 427.31 ) . surgical procedures for rs removal were based on icd-9-op codes ( 55.01 : nephrotomy , 55.03 : percutaneous nephrostomy without fragmentation , 55.04 : percutaneous nephrostomy with fragmentation , 56.0 : transurethral removal of obstruction from ureter and renal pelvis , 57.0 : transurethral clearance of bladder , 59.95 : ultrasonic fragmentation of urinary stones , 98.51 : extracorporeal shockwave lithotripsy of the kidney , ureter , and/or bladder ) . orthopedic surgeries of lower limbs were based on icd-9 op codes ( icd-9-cm 81.51 : total hip replacement , 81.52 : partial hip replacement , 81.53 : revision of hip replacement , 81.54 : total knee replacement ) . the distribution of demographic status and comorbidities , including age , sex , diabetes , hyperlipidemia , hypertension , cad , and chf were compared between the rs and non - rs cohorts . hazard ratios ( hrs ) and adjusted hrs ( ahrs ) were computed for stroke as a measure of the relative risk through the cox proportional hazards regression model . in addition , the cox model was used to estimate stroke hrs associated with the frequency of medical visits for stone removal and was compared with the patients with rss who received conservative medication . the stroke - free survival probability during the follow - up period was estimated using the kaplan meier method , and the difference in frequency of stone removal among patients with rss was examined using a log rank test . statistical analyses were performed using sas ( version 9.2 ; sas institute , cary , nc ) . the national health insurance ( nhi ) program was launched in taiwan on march 1 , 1995 , and covered > 99% of taiwan 's residents and was contracted with 97% of clinics and hospitals by the end of 2010 . this study utilized the longitudinal health insurance database 2000 ( lhid2000 ) claims data established by the national health research institute ( nhri ) , department of health , taiwan . lhid2000 contains the medical claims data of 1 million randomly sampled beneficiaries from among the enrollees of the nhi program between 1996 and 2010 . no statistically significant differences in the distribution of sex , age , or healthcare costs between cohorts in the lhid2000 and the enrollees were reported by the nhri . the international classification of diseases revision ninth clinical modification ( icd-9-cm ) was used for the diagnoses . the study was approved by the institutional review board of china medical university and hospital ( cmuh104-rec2115 ) . a retrospective cohort study was conducted to determine the association between renal stone ( rs ) ( icd-9-cm 592.0 : calculus of kidney , icd-9-cm 592.1 : calculus of ureter , icd-9-cm 592.9 : urinary calculus , icd-9-cm 594.1 : other calculus in bladder ) and stroke ( icd-9-cm 430 : subarachnoid hemorrhage , icd-9-cm 431 : intracerebral hemorrhage , icd-9-cm 432 : other and unspecified intracranial hemorrhage , icd-9-cm 433 : occlusion and stenosis of precerebral arteries , icd-9-cm 434 : occlusion of cerebral arteries , icd-9-cm 435 : transient cerebral ischemia , icd-9-cm 436 acute , but ill - defined , cerebrovascular disease , icd-9-cm 437 other and ill - defined cerebrovascular disease , icd-9-cm 438 : late effects of cerebrovascular disease ) . the claims data between1998 and 2010 were used to identify patients aged 20 years with a first diagnosis of rs . a comparison cohort was randomly selected from among the patients without rss during the same period , frequency matched 1:4 for age ( every 5 years ) , sex , comorbidities ( diabetes , hyperlipidemia , hypertension , coronary artery disease [ cad ] , congestive heart failure [ chf ] , and atrial fibrillation ) , and index year . patients with a stroke history and with missing information for age or sex were excluded from the data analysis . a follow - up for stroke occurrence was performed until the date of follow - up loss , withdrawal from the insurance system , or end of 2010 , whichever occurred first . the baseline comorbidities were diabetes ( icd-9-cm 250 ) , hyperlipidemia ( icd-9-cm 272 ) , hypertension ( icd-9-cm 401 to 405 ) , cad ( icd-9-cm 410 to 414 ) , chf ( icd-9-cm 398.91 , 402 , 404.01 , 404.03 , 404.10 , 404.11 , 404.13 , and 404.9 ) , and atrial fibrillation ( icd-9-cm 427.31 ) . surgical procedures for rs removal were based on icd-9-op codes ( 55.01 : nephrotomy , 55.03 : percutaneous nephrostomy without fragmentation , 55.04 : percutaneous nephrostomy with fragmentation , 56.0 : transurethral removal of obstruction from ureter and renal pelvis , 57.0 : transurethral clearance of bladder , 59.95 : ultrasonic fragmentation of urinary stones , 98.51 : extracorporeal shockwave lithotripsy of the kidney , ureter , and/or bladder ) . orthopedic surgeries of lower limbs were based on icd-9 op codes ( icd-9-cm 81.51 : total hip replacement , 81.52 : partial hip replacement , 81.53 : revision of hip replacement , 81.54 : total knee replacement ) . the distribution of demographic status and comorbidities , including age , sex , diabetes , hyperlipidemia , hypertension , cad , and chf were compared between the rs and non - rs cohorts . hazard ratios ( hrs ) and adjusted hrs ( ahrs ) were computed for stroke as a measure of the relative risk through the cox proportional hazards regression model . in addition , the cox model was used to estimate stroke hrs associated with the frequency of medical visits for stone removal and was compared with the patients with rss who received conservative medication . the stroke - free survival probability during the follow - up period was estimated using the kaplan meier method , and the difference in frequency of stone removal among patients with rss was examined using a log rank test . statistical analyses were performed using sas ( version 9.2 ; sas institute , cary , nc ) . in total , 53,659 patients with newly diagnosed rss and 236,107 patients without rss ( non - rs , comparison cohort ) between 1998 and 2010 were identified ( table 1 ) . the numbers of patients with follow - up loss were 1790 patients ( 3.34% ) in rs cohort and 7048 patients ( 3.29% ) in non - rs cohort . the median duration of follow - up was 6.78 years in the rs cohort ( 0.00313.0 years ) and 6.62 years in the non - rs cohort ( 0.00313.0 years ) . because the rs and non - rs groups were matched with respect to predefined conditions ( age , sex , diabetes mellitus , hypertension , hyperlipidemia , cad , chf , and atrial fibrillation ) , no statistically significant difference between the 2 cohorts with regard to these variables was observed . baseline characteristics between renal stone group and nonrenal stone group in 1998 to 2010 the mean ages of the rs and non - rs cohorts were 47.714.9 and 48.1 14.1 years , respectively . the 2 cohorts showed male predominance ( 65.9% in rs cohort ; 65.8% in non - rs cohort ) . the overall incidence of stroke was higher in the rs cohort compared with the non - rs cohort ( 6.64 vs 6.27 per 1000 person - years , table 2 ) . the relative stroke risk for the rs cohort was 1.06-fold higher than that for the non - rs cohort ( 95% ci = 1.011.11 ) . because the incidence of stroke varied with age and sex , we examined the effects of these variables on stroke in the 2 cohorts . the sex - specific analysis showed that women with rs had a higher stroke incidence than women without rss ( irr = 1.12 , 95% ci = 1.031.21 ) . ci = 1.051.23 ) more prone to stroke than were women in the non - rs group , after adjustment for confounders . the age - specific incidence analysis shows that the rs cohort had a higher hr than the non - rs cohort in the youngest age group did ( 2034 years , hr = 1.47 , 95% ci = 1.101.96 ) , followed by the middle - aged adults group ( 3549 years , hr = 1.12 , 95% ci = 1.001.25 ) . no statistically significant difference of stroke events between the 2 groups was observed for patients aged 50 . hazard ratios and 95% confidence interval of stroke associated with renal stone in cox 's regression analysis we examined the association of nephrolithiasis and stroke type . patients with rss had a significantly higher risk of ischemic stroke ( hr = 1.07 , 95% ci = 1.031.23 ) , particularly women ( hr = 1.13 , 95% ci = 1.031.23 ) , and the younger age group ( 2034 years , hr = 1.45 , 95% ci = 1.012.10 ; 3549 years , hr = 1.19 , 95% ci = 1.041.35 , table 3 ) . hazard ratios and 95% confidence interval of stroke associated with renal stone in cox 's regression analysis in addition , we evaluated whether the risk of stroke increased with the severity of rss . the rss severity was stratified using the data on medical visits for rss and surgical procedures for stone removal . for surgical procedures , compared with the control group , a severity - dependent stroke risk was noted with rs severity stratifications : 1 to 2 surgical procedures , ahr = 0.94 , 95% ci = 0.881.01 ; 34 medical visits , ahr = 8.29 , 95% ci = 6.5010.6 ; > 4 surgical procedures , ahr = 42.5 , 95% ci = 33.853.4 ; p for trend < 0.0001 ( table 4 ) . the risk of stroke among stone patients frequency for medical visits of stones removal in cox proportional hazard regression further , in our study population , we analyzed incidences of deep venous thromboembolism and orthopedic surgeries of lower limbs , which were also risk factors of stroke . among 2343 stroke patients in the rs cohort , there were 25 patients ( 1.07% ) who had deep venous thromboembolism , whereas among 8730 stroke patients in the non - rs cohort , 67 patients ( 0.77% ) had deep venous thromboembolism ( p = 0.16 ) . among 2343 stroke patients in the renal stone cohort , 44 patients ( 1.88 % ) had received orthopedic surgery of lower limbs , whereas among 8730 stroke patients , 174 patients ( 1.99 % ) had received orthopedic surgery of lower limbs ( p = 0.72 ) . a kaplan meier analysis showed that , during the 13-year study period , the overall stroke rate was 54.2% higher for patients with rss who have undergone > 4 surgical procedures for stone removal than for those who did not undergo surgery ( p < 0.0001 , figure 1 ) . previous studies have shown an association between nephrolithiasis and systemic diseases , such as chd , hypertension , and diabetes . the present population - based study enrolling a large number of patients with nephrolithiasis and matched controls from the nhird revealed that nephrolithiasis is associated with an increased risk of ischemic stroke . the patients with rss were predominantly men , consistent with previous studies , indicating that the nhird rs patient population is valid and representative . despite the male predominance in the rs cohort , women with nephrolithiasis had a significantly increased stroke risk . appelros et al reported that men have a higher stroke risk than women . because of the adjustment for the major comorbidities that increase stroke risk in the enrolled population , nephrolithiasis was a significant risk factor of stroke , particularly in women . the sex - specific difference that women with nephrolithiasis are prone to stroke is challenging to explain . however , several studies have reported the sex - specific difference that women with nephrolithiasis have an increased risk of adverse renal outcomes , cardiovascular disease , and hypertension . these observations , along with those of the present study emphasize the strong association of nephrolithiasis with vascular diseases and additional studies to understand the mechanism and validate the effects of nephrolithiasis on associated vascular diseases are warranted . several explanations account for the positive association of nephrolithiasis with stroke in patients > 50 years . first , elderly patients have a high likelihood of being bedridden , immobile , or functionally weak because of traumatic fracture , dementia , or medical illness . second , elderly patients may have a high competing risk between death and stroke than do patients < 50 years . however , the high risk of stroke in the relatively low cardiovascular risk young population with nephrolithiasis emphasizes that the causality of nephrolithiasis is stroke development . this is the first study that determined the association between the severities of nephrolithiasis and stroke . patients who received > 4 surgeries had up to 42.5-fold risk of stroke compared with those treated through conservative medication . thus , stroke risks are significantly apparent in patients with symptomatic nephrolithiasis , emphasizing that nephrolithiasis is linked causally to stroke development . first , the patients with a history of stroke were excluded because a previous stroke is a major predictor for recurrent stroke . extensive matching with 8 confounding variables was defined in selecting the controls to ascertain the association of nephrolithiasis with stroke . second , the follow - up period of 13 years enabled comprehensive evaluation of the time - dependent effects of nephrolithiasis on stroke development . third , an nhi monitoring and auditing system was implemented to supervise insurance claims to prevent over diagnosis and medical resource wastage . based on the accurate diagnosis of the disease of interest and confounding variables , the association between nephrolithiasis and stroke was clearly demonstrated . the limitations of our study include the lack of definite patient information on blood pressure , levels of serum glucose , cad severity , and serum lipids levels . moreover , nhird does not provide information on the lifestyle and personal health behaviors , including smoking , drinking , exercise habits , and obesity ; these variables are known to be related to stroke . however , because nhi covers > 99% of taiwan 's residents , this study generalizes the trend that nephrolithiasis is associated with stroke . in conclusion , a history of renal stones is associated with a significantly increased stroke risk , particularly in women and young patients . the 42.5-fold higher risk of stroke in patients with symptomatic nephrolithiasis requires surgical treatment . the findings can prompt clinical awareness and suggests lifestyle modification to facilitate early prevention of stroke in patients with nephrolithiasis , particularly in women , young population , and those with symptomatic nephrolithiasis patients .

abstractnephrolithiasis is highly prevalent and has been associated with vascular diseases such as cardiovascular events . few studies have comprehensively associated renal stones with stroke.this study explored whether patients with renal stones were at a higher stroke risk than those without renal stones . a national insurance claim dataset of 22 million enrollees in taiwan was used to identify 53,659 patients with renal stones , and 214,107 were selected as age- , sex- , and comorbidity - matched controls for a 13-year follow-up.the relative stroke risk for the rs cohort was 1.06-fold higher than that for the non - rs group ( 95% confidence interval [ ci ] = 1.011.11 ) . age - specific analysis revealed that the adjusted stroke risk for the rs cohort increased as age decreased , with the highest risk of 1.47-fold ( 95% ci = 1.101.96 ) in patients aged 20 to 34 years , followed by a 1.12-fold risk ( 95% ci = 1.001.25 ) in patients aged 35 to 50 years . sex - specific analysis clarified that women in the rs group had a 1.12-fold stroke risk compared with women in the non - rs group ( 95% ci = 1.031.21 ) . patients who had undergone > 4 surgeries had up to 42.5-fold higher risk of stroke ( 95% ci = 33.853.4).the study utilized the national database and demonstrated that patients , particularly women and the younger population , with nephrolithiasis have an increased risk of ischemic stroke development . patients treated with medication or through surgery for rss showed steady and higher risks of stroke than those without surgical or medical intervention .

INTRODUCTION METHODS Data Source Study Patients Outcome Measurements and Comorbidity Statistical Analyses RESULTS DISCUSSION

epidemiologic studies of the link between particulate matter ( pm ) concentrations and mortality rates have yielded a range of estimates , leading to disagreement about the magnitude of the relationship and the strength of the causal connection . previous meta - analyses of this literature have provided pooled effect estimates , but have not addressed between - study variability that may be associated with analytical models , pollution patterns , and exposed populations . to determine whether study - specific factors can explain some of the variability in the time - series studies on mortality from particulate matter [ less than / equal to ] 10 microm in aerodynamic diameter ( pm(10 ) ) , we applied an empirical bayes meta - analysis . we estimate that mortality rates increase on average by 0.7% per 10 microg / m(3 ) increase in pm(10 ) concentrations , with greater effects at sites with higher ratios of particulate matter [ less than / equal to ] 2.5 microm in aerodynamic diameter ( pm(2.5))/pm(10 ) . this finding did not change with the inclusion of a number of potential confounders and effect modifiers , although there is some evidence that pm effects are influenced by climate , housing characteristics , demographics , and the presence of sulfur dioxide and ozone . although further analysis would be needed to determine which factors causally influence the relationship between pm(10 ) and mortality , these findings can help guide future epidemiologic investigations and policy decisions.imagesfigure 1

Images

chronic hepatitis b virus ( hbv ) infection is a significant public health threat . approximately 3 - 4 billion people worldwide have been infected with hbv . the natural course of chronic hbv infection is variable , ranging from an inactive hbsag carrier state to a progressive chronic hepatitis which may eventually lead to cirrhosis and hepatocellular carcinoma ( hcc ) . previous research has shown that patients with persistent hbeag - positive state and high dna viral load ( > 10 copy / ml ) are at higher risk of hcc than the hbeag negative individuals with low dna viral load [ 1 , 2 ] . in order to have a better understanding of this phenomenon , we obtained hbsag - positive serum samples from clinical laboratory center of the first people 's hospital of yunnan province , kunming , yunnan , china , from february to august , 2005 . we also followed up a chronically hbv - infected patient who was hbeag positive with high hbv dna load ( 10 copy / ml ) for almost 3 years and studied the evolution of her hbv strains . by sequencing and phylogenetic analysis , we found mutations occurred within the genomes of hbv through time - course evolution . combined with clinical data , whether and how these hbv variants might contribute to viral persistence of infection or liver pathogenesis still needs to be further studied a 31-year - old female with chronic hbv infection was followed up at the first people 's hospital of yunnan province , kunming , yunnan , china . the subject was admitted in the hospital because of allergic purpura in may , 2005 and was diagnosed with chronic infection based on the fact of having been hbsag positive for at least 7 years . her serum samples were collected at three time points after admission : 602 ( 1 day ) , 6022 ( 6 months ) , and 6023 ( two years and seven moths ) and stored at 80c until time of analysis . serological markers of hbv , alt , ast , bil , alb , and glo were analyzed at each time point . the patient was seronegative for antibodies to hav , hcv , hev , and hiv and did not have a history of alcohol abuse , drug abuse , or hepatotoxin exposure . hbv dna was extracted from serum by proteinase k digestion , followed by phenol / chloroform extraction . viral dna load was determined using hbv dna pcr - fluorescence quantitation kit ( kehua bio - tech . the primers used were forward primer : 5ctttttcacctctgcctaatca3 ; reverse primer : 5agaggtgaaaaagttgcatggt3. amplification was performed in a 96-well cycler ( bio - rad , usa ) , and 25 l pcr mixture containing 2.5 mm mgcl2 , 200 m dntp , 400 nm of each primer , and 2 u of ex taq polymerase ( takara bio - tech . the pcr reaction was performed using the following cycles : 94c predenature for 5 min , 30 cycles of 94c for 1 min , 56c for 1 min , 72c for 2 min ; 72c for 10 min as a final extension step . then full - length amplicons were purified using a gel extraction kit ( huashun bio - engineering co. ltd . , the pcr products were purified and cloned in vector pmd18-t ( takara bio - tech . white colonies were picked , correct recombinants were confirmed by pcr , and the double - restriction endonuclease digestion with ecori and hind iii . dna sequencing analysis of the correct recombinants was performed with bigdye terminator v3.1 and 3130 genetic analyzer ( applied biosystems ) ( 7 pairs of sequencing primers can be obtained on request ) . for each time point , 8 - 9 recombinants were randomly selected and sequenced . fourteen hbv complete genomes available in genbank ( genotypes a , b and e to h ) were applied to phylogenetic analysis . additionally , 50 published sequences of genotype c were also used in this study for alignment analysis ( genbank accession numbers can be obtained upon request ) . the whole genome sequences were assembled by bioedit sequence alignment editor software , version 7.0.5.2 . phylogenetic and molecular evolutionary analysis of nucleotide differences within and between the isolate sequences were carried out by mega program , version 3.1 . bootstrap re - sampling and reconstruction were carried out for 1,000 times to confirm the reliability of phylogenetic trees . as showed in table 1 , hbsag and hbeag were positive at all three time points and titers changed during the course of analysis . alt levels showed a tendency of elevation , and at the 3rd time point the level was more than 2 times of the upper limit of normal . while no quantification could be obtained from the 1st time point due to the lack of serum , viral dna load was found to decrease from 10 to 10 copy / ml at the last two time points . 26 sequences were analyzed ( genbank accession number : dq377159 - 377165 , eu306713 - 306714 , eu306722306729 , eu439005 , eu439008439014 and eu439025 ) . the divergence of these 26 sequences was found to be 01.4% . when compared to the 64 complete hbv genome sequences published in the genbank , all 26 sequences were determined to be genotype c and c2 subgroup with a bootstrap value of 100% ( data not shown ) . when compared with the 50 known and complete sequences of genotype c , we found that there were 13 specific nucleotides in all sequenced clones of this patient ( data not shown ) . further analysis of the nucleotide sequence at all three time points indicated that nucleotides t361a , c934a , c2351t / a2353 t , and c2444 t were the mutation been kept in for at least two years ' evolution . these mutations caused nonsense mutation of pres1 and precore / core gene ( t361a and c2444 t , resp . ) , missense mutation of precore / core and pol gene ( c2351t / a2353 t and c934a , resp . ) . nucleotides c339 t and t770c were the new and major mutation at the 3rd time point , and these mutations caused hbsag p62l and polymerase ( pol ) v560a mutation , respectively ( figure 1 ) . premature stop codons of s gene ( g.200c > t , g.565t > a , g.361t > a , g.455c > t , and g.304_305cc > tt ) increased during the course(1/9 versus 3/9 versus 6/8 ) ( figure 2 ) . a1762t / g1764a double mutation existed in all clones , and g1896a existed in 4 clones obtained from all time points . performing alignment showed that over the 2-year period , deletions across overlapping region of polymerase / pres1 ( g.2447_489del 1256 ) or pres1/pres2 ( g.3018_3202del 183 , and g.3144_56del 126 ) , and pre - s1 initiation codon mutations ( g.2846_2865del 18 ) with or without internal deletions mutations ( g.3024_3193del 168 ) were prevalent ( 22/26 , in 85% of the clones ) ( figure 2 ) . all the defective genomes shared sequences from nucleotide position 489 to position 2447 , and common to all genomes is the presence of the complete x gene and the complete c orf . four paires of donor / acceptor were found in the spliced genomes , besides the frequently reported donor sites 2447 and 3018 and the acceptor sites 489 , two new 5-splice donors ( nt3144 and 3024 ) and three new 3-splice acceptors ( nt56 , 3193 and 3202 ) were detected at the 3rd time . up until now , details of the mechanism accounted for the hbv evolution remained unknown . in this study , we followed up a chronically hbv - infected patient and discovered that complex and diverse quasispecies existed in this patient for over two - year disease evolution . based on the alignment and phylogenetic analyses , the divergence and the 13 specific nucleotides of the 26 clones , as well as the phylogenic analysis thus , these results reflect the real evolution process of homogeneous hbv strains in this patient . in the process of evolution , some mutations in this patient were kept in for at least 2 years , and other new mutations emerged at the 3rd time point . these mutations resulted in amino acids substitutions and some caused premature stop codon of the coding regions . among these mutants , the t361a nonsense mutation in the small s region , which resulted in a 69aa truncated hbsag lacking the entire a determinant region ( aa124147 ) , was first detected at the 2nd time point in one clone . at the 3rd time point , however , half of the sequenced clones were found to have this mutation . this mutant has been reported in the occult hbv - infected patients with seronegative for hbsag , and in one case hbv dna was absent from the serum after the two - year [ 7 , 8 ] . in our case , after two - year followup , the hbsag was still at a high level and could be detected by routine immunoassay - based diagnosis . in addition , hbv dna was at a high load despite a slightly decreased level ( 2.4 10 versus 2.5 10 copy / ml ) , and the alt level showed an elevating trend over the study period . in the meanwhile , new point mutations such as c339 t and t770c were detected at the 3rd time point ; the former occurred in the hydrophilic region of hbsag and the latter was previously discovered in a hcc patient ( genbank number ay206393 ) . we speculated that these mutants might afford hbv variants a distinct survival advantage by allowing the mutant virus to escape from the immune system . in addition , these mutations could further transactivate certain oncogenes which in turn rendered the acceleration of the liver damage [ 913 ] . in this patient the deletion region is in the span of hepatocellular - binding site ( aa520 ) and led to aa111 deletion in pres1 . this deletion mutant was previously reported in different clinical cases and genotypes [ 1417 ] . for example , this 18 bp deletion was detected in a heart transplant patient while it was not found with the donor . in our case , retrospective study showed that the son of this patient , though infected with hbv via mother - to - infant transmission , carried none of these mutant strains in the sequenced clones . this phenomenon may imply that host immune pressure was the primary cause of aa111 deletion in pres1 . in addition , this mutant seemed to have reduced from the 1st time point to the 3rd time point ( 7/9 versus 7/9 versus 2/8 ) and had a tendency to be substituted by large fragments deletion located in the pres region at the 3rd time point ( figure 2 ) . whether it was a precursor of large fragment deletion mutation or just an isolated event happened under the immune pressure still needed to be carefully studied . the other prominent variation at the 3rd time point was the defective genomes caused by the large fragment deletion focused on the overlapping regions of polymerase / pres1 and pres1/pres2 . up until now , there have been at least 15 types of spliced hbv dna reported in the literature ( figure 3 ) [ 20 , 21 ] , which consisted of seven 5-splice donors and six 3-splice accepters . in our case , four types of spliced hbv dna were found at the 3rd time point , the donor site and the receptor site of these splicers followed the gt - at rules . among them , the 2447/489 donor / acceptor splicer existed as described in previous reports and produced a presumptive hbv spliced protein ( hbsp ) . in addition , positions 3144 and 3024 as the 5-donor sites and positions 3202 , 3193 , and 56 as the 3-acceptor sites were first reported in our study . during a subsequence screening , we also detected defective genomes in patients with hepatocirrhosis and chb ( genbank accesson numbers : eu439017 , eu306668 , eu306669 , eu330986 , eu306676 , eu306670 ) . though these defective genomes were different in structure , they all shared sequences from nucleotides position 489 to position 2447 . this region contains all known signals required for conventional replication ( dr1 and dr2 ) , synthesis , and processing of pregenomic / c - mrna , prec mrna , and x mrna , and pregenomic rna encapsidation . in contrast , all lacked the complete pre - s1 and , or pre - s2 orfs . many surveys noted that spliced hbv dna and pre - s deletion were more frequently detected in patients with severe liver disease [ 2426 ] and often existed during the process of anti - hbe seroconversion and subsequent loss of hbsag [ 2729 ] . however , in this case with our subsequent screening , all the patients with defective genomes were hbeag positive and with high hbv dna load ( 10 copy / ml ) . based on these findings , we deduced that these defective genomes ( with intact x gene and all signals required for viral life cycle ) might contribute to persistent hbv replication in the patient . other mutations such as c934a , c2351t / a2353 t , c2444 t , a1762t / g1764a , and g1896a were scattered in the whole genomes . in the present study , all clones of the mother from three time points had double mutations of nucleotide a1762t / g1764a in basal core promoter ( bcp ) , four of which were also coupled with g1896a . however , we did not observe any hbeag / anti - hbeag seroconversion at the three time points , nor did we detect the impact of bcp mutation on hbv dna load [ 30 , 31 ] . in addition , multisequences alignment has showed that genotype c had a tendency for higher prevalence of the bcp mutation ( 41 versus 35 , 53.9% ) ( genbank accesson number can be obtained on request ) . combined with the clinic results ( table 1 ) , whether the bcp and precore mutations in this patient were related to infection with genotype c , or whether the patient was seroconverting to anti - hbeag or may develop severe disease [ 32 , 33 ] are questions that still need to be followedup . in conclusion , our data showed that viral quasispecies are very closely related to genomes but exist in an environment of mutation , selection , and competition , and thus lead to a dynamic and changing population . during this progress , some mutations were kept in and became the dominant strains , some new mutations emerged , and these strains may play important roles in the persistence of infection or the progression of disease .

mutations in full - length hbv isolates obtained from a chronic hbv - infected patient were evaluated at three time points : 1 day , 6 months , and 31 months . while 5 nucleotides variation , and an 18 bp deletion of pres1 have been kept in during at least the first two years , c339 t mutation occurring in the hydrophilic region of hbsag and t770c that caused polymerase v560a substitution were the new point mutations found existing in sequenced clones of the 3rd time point . internal deletion of coding region obviously appeared in the 3rd time point . the splicers included two new 5-splice donors and three new 3-splice acceptors besides the reported donors and acceptors and may have produced presumptive hbv - spliced proteins or truncated pres proteins . alt , hbeag and viral dna load varied during the follow - up years . these data demonstrated the diversity of genomes in hbv - infected patient during evolution . combined with clinical data , the hbv variants discovered in this patient may contribute to viral persistence of infection or liver pathogenesis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

hepatocellular carcinoma ( hcc ) is one of the most lethal malignancies , and surgical resection improves the survival rates for patients . however , the prognosis after surgical resection of hcc remains poor because of high recurrence rates . using biomarkers to identify patients presenting with a higher risk of poor prognosis may reduce mortality after curative hepatectomy . although there are many reports on histologic parameters for predicting hcc prognosis , molecular markers for hcc recurrence and prognosis could provide additional information . cancer cells frequently express genes that are specifically or preferentially expressed in male germ cells under normal conditions . atpase family aaa domain - containing 2 ( atad2 ) is one such , and works as an important cofactor for myc - dependent transcription . through myc and e2f transcription factors , atad2 increases the expression of proliferation - related and anti - apoptotic genes in many different types of cancer , including breast carcinoma , non - small cell lung carcinoma , and prostate carcinoma [ 5 - 8 ] . , atad2 has been identified as a candidate driver gene located within the amplified 8q24 locus . huang et al . reported that a novel highly up - regulated exon - exon junction was detected in atad2 gene by rna - seq and the gene was highly expressed in hcc tissues . a recent study found that the high expression of atad2 in hcc was an independent predictor of shortened overall survival . however , the prognostic significance of atad2 protein expression in hcc is unclear . in the present study , we evaluated atad2 protein expression by immunohistochemistry to elucidate the prognostic role of atad2 in 182 hcc patients with long - term follow - up . hcc tissue samples were collected from 182 patients who were treated with surgical resection between july 2000 and may 2006 at samsung medical center ( seoul , korea ) . inclusion criteria were histologically confirmed hcc and curative resection of tumor without preoperative or postoperative adjuvant therapy . we defined curative resection as complete resection of all tumor nodules with clear microscopic resection margins and no residual tumors as indicated by a computed tomography scan one month after surgery . microvascular invasion was considered present when at least one or more endothelial cells or the tunica media of the vessel surrounded a neoplastic cell group . tumor stage was determined by both the american joint committee on cancer ( ajcc ) staging system and barcelona clinic liver cancer ( bclc ) staging classification . using 2 years as the cut off , all hcc patients were followed by monitoring serum -fetoprotein levels and three phase dynamic computed tomography scans or magnetic resonance imaging every three months after surgery . the follow - up period for recurrence was at least 18 months , and the median follow - up period was 120.0 months ( range , 14.0 to 151.4 months ) for survivors . recurrence - free survival ( rfs ) was defined as from the date of resection until the detection of tumor recurrence . we chose disease - specific death ( hcc - related death ) as the clinical endpoint for survival analysis , defined as : ( 1 ) tumor occupying more than 80% of the liver , ( 2 ) portal venous tumor thrombus proximal to the second bifurcation , ( 3 ) obstructive jaundice due to the tumor , ( 4 ) distant metastases , or ( 5 ) variceal hemorrhage with portal venous tumor thrombus proximal to the first bifurcation . disease - specific survival ( dss ) was defined from the date of resection to the date of hcc - related death . histologic sections were examined by two pathologists and representative tumor regions were marked in the formalin - fixed paraffin - embedded blocks . two tissue cores measuring 2.0 mm in diameter were punched from the marked areas of each block and arranged into new paraffin blocks . as controls , two cores of normal liver tissue from 12 patients with metastatic colon carcinoma of the liver were included in each array block . antigen retrieval was performed with 0.01 mol / l citrate buffer at ph 6.0 for 30 minutes in a pressure cooker . sections were incubated with a rabbit polyclonal antibody to atad2 ( 1:100 , nbp1 - 84122 , novus biologicals , littleton , co ) for 60 minutes at room temperature . the positive control ( human normal testis ) showed intense nuclear atad2 expression in spermatogenic cells of seminiferous tubules . no immunoreactivity was observed in tissue sections used as negative control where the primary antibody was replaced by preimmune rabbit serum . in order to validate the concordance between tissue microarrays and whole tumor sections , we observed atad2 expression for 40 corresponding whole tumor sections randomly chosen from the 182 cases . and h.w.h . ) who were blinded to the clinical details , and any discrepancies were resolved by consensus . a nearly homogeneous nuclear immunostaining with moderate staining intensity was observed . for determining atad2 expression , the proportion of stained tumor cells was determined semi - quantitatively and each sample was scored on a scale of 0 - 4 ( 0 , < 5% ; 1 , 5%-25% ; 2 , 26%-50% ; 3 , 51%-75% ; 4 , > 75% ) . duplicate tissue cores for each tumor showed high levels of homogeneity for proportion of stained cells . the association of atad2 expression with clinicopathologic features was examined by the chi - square test or fisher exact test . univariate and multivariate analyses of risks for tumor recurrence were performed using the logistic regression model . cumulative survival rates were calculated by the kaplan - meier method and analyzed by the log - rank test . the cox proportional hazards regression model was used to assess the association of survival time regressed upon multiple clinicopathologic variables . variables that were statistically significant in the univariate analysis were included in the multivariate analysis . hcc tissue samples were collected from 182 patients who were treated with surgical resection between july 2000 and may 2006 at samsung medical center ( seoul , korea ) . inclusion criteria were histologically confirmed hcc and curative resection of tumor without preoperative or postoperative adjuvant therapy . we defined curative resection as complete resection of all tumor nodules with clear microscopic resection margins and no residual tumors as indicated by a computed tomography scan one month after surgery . microvascular invasion was considered present when at least one or more endothelial cells or the tunica media of the vessel surrounded a neoplastic cell group . tumor stage was determined by both the american joint committee on cancer ( ajcc ) staging system and barcelona clinic liver cancer ( bclc ) staging classification . using 2 years as the cut off , all hcc patients were followed by monitoring serum -fetoprotein levels and three phase dynamic computed tomography scans or magnetic resonance imaging every three months after surgery . the follow - up period for recurrence was at least 18 months , and the median follow - up period was 120.0 months ( range , 14.0 to 151.4 months ) for survivors . recurrence - free survival ( rfs ) was defined as from the date of resection until the detection of tumor recurrence . we chose disease - specific death ( hcc - related death ) as the clinical endpoint for survival analysis , defined as : ( 1 ) tumor occupying more than 80% of the liver , ( 2 ) portal venous tumor thrombus proximal to the second bifurcation , ( 3 ) obstructive jaundice due to the tumor , ( 4 ) distant metastases , or ( 5 ) variceal hemorrhage with portal venous tumor thrombus proximal to the first bifurcation . disease - specific survival ( dss ) was defined from the date of resection to the date of hcc - related death . histologic sections were examined by two pathologists and representative tumor regions were marked in the formalin - fixed paraffin - embedded blocks . two tissue cores measuring 2.0 mm in diameter were punched from the marked areas of each block and arranged into new paraffin blocks . as controls , two cores of normal liver tissue from 12 patients with metastatic colon carcinoma of the liver were included in each array block . antigen retrieval was performed with 0.01 mol / l citrate buffer at ph 6.0 for 30 minutes in a pressure cooker . sections were incubated with a rabbit polyclonal antibody to atad2 ( 1:100 , nbp1 - 84122 , novus biologicals , littleton , co ) for 60 minutes at room temperature . the positive control ( human normal testis ) showed intense nuclear atad2 expression in spermatogenic cells of seminiferous tubules . no immunoreactivity was observed in tissue sections used as negative control where the primary antibody was replaced by preimmune rabbit serum . in order to validate the concordance between tissue microarrays and whole tumor sections , we observed atad2 expression for 40 corresponding whole tumor sections randomly chosen from the 182 cases . all sections were scored by two independent pathologists ( c .- k.p . and h.w.h . ) who were blinded to the clinical details , and any discrepancies were resolved by consensus . a nearly homogeneous nuclear immunostaining with moderate staining intensity was observed . for determining atad2 expression , the proportion of stained tumor cells was determined semi - quantitatively and each sample was scored on a scale of 0 - 4 ( 0 , < 5% ; 1 , 5%-25% ; 2 , 26%-50% ; 3 , 51%-75% ; 4 , > 75% ) . duplicate tissue cores for each tumor showed high levels of homogeneity for proportion of stained cells . when there were differences between duplicate tissue cores the association of atad2 expression with clinicopathologic features was examined by the chi - square test or fisher exact test . univariate and multivariate analyses of risks for tumor recurrence were performed using the logistic regression model . cumulative survival rates were calculated by the kaplan - meier method and analyzed by the log - rank test . the cox proportional hazards regression model was used to assess the association of survival time regressed upon multiple clinicopathologic variables . variables that were statistically significant in the univariate analysis were included in the multivariate analysis . the mean age of the 182 hcc patents was 52.4 years ( range , 17 to 76 years ) , and 82.4% of the patients were male . chronic hepatitis b virus infection was detected in 141 patients ( 77.5% ) and chronic hepatitis c virus infection in 16 patients ( 8.8% ) . the mean tumor size was 5.3 cm , and 109 of the 182 tumors ( 59.9% ) were 5 cm in size . tumor recurrence was detected in 132 patients ( 72.5% ) , early recurrence in 108 patients ( 59.3% ) , and late recurrence in 24 patients ( 13.2% ) . fifteen of the 91 deaths in this study were due to non - hcc causes . nine of the 15 deaths were due to hepatic failure , five due to non - hepatic causes , and one due to unknown cause . immunoreactivity for atad2 was observed only in the nuclei of tumor cells with moderate staining intensity . we regarded the atad2 as positive when 5% of tumor cells showed nuclear immunoreactivity ( fig . atad2 expression was significantly associated with larger tumor size ( p=0.001 ) , higher edmondson grade ( p=0.015 ) , microvascular invasion ( p < 0.001 ) , intrahepatic metastasis ( p atad2 expression was associated with the early recurrence ( p < 0.001 ) , but not with the late recurrence ( p=0.619 ) ( table 1 ) . in univariate analyses , early recurrence was significantly associated with larger tumor size ( p=0.019 ) , microvascular invasion ( p < 0.001 ) , intrahepatic metastasis ( p < 0.001 ) , higher ajcc t - stage ( p < 0.001 ) , lower albumin level ( p=0.041 ) , viral etiology ( p=0.004 ) , and atad2 expression ( p < 0.001 ) . as ajcc t - stage and bclc stage were associated with vascular invasion , we did not make multiple analyses with these variables to avoid potential bias . an evaluation of the association of serum -fetoprotein level with early recurrence was not performed due to missing data ( n=175 ) . in multivariate analyses , microvascular invasion ( p=0.003 ) , intrahepatic metastasis ( p=0.003 ) , and viral etiology ( p=0.029 ) were independent predictors of early recurrence . atad2 expression tended to be independent predictor of early recurrence ( p=0.059 ) ( table 2 ) . the rfs and dss rates for 182 hcc patients were 36.1% and 75.5% at 3 years , 32.1% and 66.7% at 5 years , 27.5% and 61.1% at 7 years , and 26.6% and 55.2% at 9 years , respectively . on univariate analyses , larger tumor size , microvascular invasion , major portal vein invasion , intrahepatic metastasis , higher ajcc t - stage , higher bclc stage , and lower albumin level showed unfavorable influences on both rfs and dss . the 5-year rfs rate of the atad2-positive group was significantly lower than that of the atad2-negative group ( 23.1% vs. 48.6% ) ( fig . the mean rfs of atad2-positive group was 37.6 months and the atad2-negative group was 74.0 months . subgroup analysis among patients with tumor size 5.0 cm ( n=109 ) , patients at bclc stage 0 or a ( n=92 ) , and patients with -fetoprotein 20 ng / ml ( n=61 ) , the atad2-positive groups ( n=61 , n=50 , and n=30 , respectively ) also unfavorably influenced rfs ( p=0.008 , p=0.009 , and p=0.013 , respectively ) ( fig . the 5-year dss rate of the atad2-positive group was significantly lower than that of the atad2-negative group ( 57.8% vs. 83.4% ) ( fig . the mean dss of atad2-positive group was 88.1 months and of atad2-negative group , 123.3 months . multivariate analyses indicated that intrahepatic metastasis and lower albumin level were found to be independent predictors of both shorter rfs and shorter dss . atad2 expression ( p=0.002 ) was an independent predictor of shorter rfs , but not of dss ( p=0.109 ) . atad2-positive patients were more likely to suffer from recurrence than atad2-negative patients ( hazard ratio , 1.857 ) ( table 4 ) . the mean age of the 182 hcc patents was 52.4 years ( range , 17 to 76 years ) , and 82.4% of the patients were male . chronic hepatitis b virus infection was detected in 141 patients ( 77.5% ) and chronic hepatitis c virus infection in 16 patients ( 8.8% ) . the mean tumor size was 5.3 cm , and 109 of the 182 tumors ( 59.9% ) were 5 cm in size . tumor recurrence was detected in 132 patients ( 72.5% ) , early recurrence in 108 patients ( 59.3% ) , and late recurrence in 24 patients ( 13.2% ) . fifteen of the 91 deaths in this study were due to non - hcc causes . nine of the 15 deaths were due to hepatic failure , five due to non - hepatic causes , and one due to unknown cause . immunoreactivity for atad2 was observed only in the nuclei of tumor cells with moderate staining intensity . we regarded the atad2 as positive when 5% of tumor cells showed nuclear immunoreactivity ( fig . atad2 expression was significantly associated with larger tumor size ( p=0.001 ) , higher edmondson grade ( p=0.015 ) , microvascular invasion ( p < 0.001 ) , intrahepatic metastasis ( p < 0.001 ) , higher ajcc t - stage ( p atad2 expression was associated with the early recurrence ( p < 0.001 ) , but not with the late recurrence ( p=0.619 ) ( table 1 ) . in univariate analyses , early recurrence was significantly associated with larger tumor size ( p=0.019 ) , microvascular invasion ( p < 0.001 ) , intrahepatic metastasis ( p < 0.001 ) , higher ajcc t - stage ( p < 0.001 ) , lower albumin level ( p=0.041 ) , viral etiology ( p=0.004 ) , and atad2 expression ( p < 0.001 ) . as ajcc t - stage and bclc stage were associated with vascular invasion , we did not make multiple analyses with these variables to avoid potential bias . an evaluation of the association of serum -fetoprotein level with early recurrence was not performed due to missing data ( n=175 ) . in multivariate analyses , microvascular invasion ( p=0.003 ) , intrahepatic metastasis ( p=0.003 ) , and viral etiology ( p=0.029 ) were independent predictors of early recurrence . atad2 expression tended to be independent predictor of early recurrence ( p=0.059 ) ( table 2 ) . the rfs and dss rates for 182 hcc patients were 36.1% and 75.5% at 3 years , 32.1% and 66.7% at 5 years , 27.5% and 61.1% at 7 years , and 26.6% and 55.2% at 9 years , respectively . on univariate analyses , larger tumor size , microvascular invasion , major portal vein invasion , intrahepatic metastasis , higher ajcc t - stage , higher bclc stage , and lower albumin level showed unfavorable influences on both rfs and dss . the 5-year rfs rate of the atad2-positive group was significantly lower than that of the atad2-negative group ( 23.1% vs. 48.6% ) ( fig . the mean rfs of atad2-positive group was 37.6 months and the atad2-negative group was 74.0 months . subgroup analysis among patients with tumor size 5.0 cm ( n=109 ) , patients at bclc stage 0 or a ( n=92 ) , and patients with -fetoprotein 20 ng / ml ( n=61 ) , the atad2-positive groups ( n=61 , n=50 , and n=30 , respectively ) also unfavorably influenced rfs ( p=0.008 , p=0.009 , and p=0.013 , respectively ) ( fig . the 5-year dss rate of the atad2-positive group was significantly lower than that of the atad2-negative group ( 57.8% vs. 83.4% ) ( fig . the mean dss of atad2-positive group was 88.1 months and of atad2-negative group , 123.3 months . multivariate analyses indicated that intrahepatic metastasis and lower albumin level were found to be independent predictors of both shorter rfs and shorter dss . atad2 expression ( p=0.002 ) was an independent predictor of shorter rfs , but not of dss ( p=0.109 ) . atad2-positive patients were more likely to suffer from recurrence than atad2-negative patients ( hazard ratio , 1.857 ) ( table 4 ) . atad2 contributes to the development of aggressive cancer through the enhancement of myc - dependent transcription . atad2 expression is high in several human cancers , including breast carcinoma , colon carcinoma , lung carcinoma , stomach carcinoma , and uterine carcinoma . high atad2 expression is a strong predictor of rapid mortality in lung and breast cancers . atad2 depletion by rna interference knockdown reduced huh7 and hcclm3 cell proliferation and led to a g1 phase cell cycle arrest . in hcc cells , atad2 regulates cell migration / invasion via the regulation of apc and/or ctnna1 expression . in this study , we evaluated the prognostic significance of atad2 protein expression in hcc and demonstrated that atad2 expression is significantly associated with larger tumor size , higher edmondson grade , microvascular invasion , intrahepatic metastasis , higher ajcc t - stage , and higher bclc stage . moreover , atad2 expression is an independent predictor of shorter rfs and tended to predict early recurrence . in the present study , early stage hcc patients with tumor size 5.0 cm or patients at bclc stage 0 or a have favorable outcomes in both rfs and dss ( table 3 ) , but 75 of 109 ( 68.8% ) with tumor size 5.0 cm and 59 of 92 ( 64.1% ) bclc stage 0 or a developed tumor recurrence . we found within these populations , atad2 positivity unfavorably influenced rfs ( p=0.008 and p=0.009 , respectively ) . identification of patients with poor prognosis in early stage hcc is critical to the optimization of personalized treatment . thus , our findings support the possible importance of atad2 expression in hcc in detecting a phenotype that can predict recurrence risk in early stage hcc . serum -fetoprotein is widely used to screen , mainly for hcc , and is an important predictor of patient survival following tumor resection . preoperative high serum -fetoprotein level ( > 60 ng / ml ) could be a risk factor for recurrence after resection in patients with liver cirrhosis . however , there is no effective marker for monitoring recurrence for patients with normal serum -fetoprotein level ( 20 ng / ml ) after hepatectomy . in this study , tumor recurrence was detected in 40 of 61 patients ( 65.6% ) with normal serum -fetoprotein level . we found that within patients with normal serum -fetoprotein level , the atad2-positive group still had significantly poorer rfs than the atad2-negative group ( p=0.013 ) . thus , our study revealed the potential use of atad2 in predicting recurrence risk in the patient group in which serum -fetoprotein levels were not prognostically predictive . our findings indicate that atad2 protein may be a novel potential predictor of rfs in hcc patients after curative resection , and atad2 may have prognostic value in hcc patients with early stage hcc or normal serum -fetoprotein level . further study is needed to examine the roles of atad2 protein expression in the development and progression of hcc .

purposecancer cells frequently express genes that are specifically or preferentially expressed in male germ cells under normal conditions . the atpase family aaa domain - containing 2 ( atad2 ) is one such and works as an important cofactor for myc - dependent transcription . in hepatocellular carcinoma ( hcc ) , atad2 has been identified as a candidate driver gene located within the amplified 8q24 locus . however , the prognostic significance of atad2 protein expression in hcc remains uncertain.materials and methodswe investigated atad2 protein expression by immunohistochemistry in tumor tissue from 182 hcc patients who underwent curative resection . associations of atad2 expression with clinicopathologic variables or prognosis of hcc patients were analyzed.resultsatad2 expression was observed in 119 ( 65.4% ) of the 182 hccs and tended to be independent predictor of early recurrence ( p=0.059 ) . atad2 expression showed an unfavorable influence on recurrence - free survival ( rfs ) ( p < 0.001 ) . subgroup analysis among patients with tumor size 5.0 cm ( n=109 ) , patients at barcelona clinic liver cancer stage 0 or a ( n=92 ) , and patients with -fetoprotein 20 ng / ml ( n=61 ) , the atad2-positive groups unfavorably influenced rfs ( p=0.008 , p=0.009 , and p=0.013 , respectively ) . in addition , atad2 expression was an independent predictor of shorter rfs ( p=0.002 ) . atad2 expression showed an unfavorable influence on disease - specific survival ( p=0.001 ) , but was not an independent predictor of shorter disease - specific survival ( p=0.109).conclusionatad2 protein expression may be a potential predictor of rfs in hcc patients after curative resection and atad2 may have prognostic value in patients with early stage hcc or normal serum -fetoprotein level .

Introduction Materials and Methods 1. Tissue samples 2. Immunohistochemical analysis 3. Statistical analysis Results 1. Patient characteristics 2. ATAD2 protein expression in HCC 3. Prediction of early recurrence in HCC 4. Association between ATAD2 expression and prognosis of HCC patients Discussion Conclusion

subjective tinnitus , a phantom sound , is often described as a ringing , hissing , or buzzing sensation . in the united states , an estimated 50 million adults have experienced tinnitus occasionally and 16 million experience it chronically . patients with chronic tinnitus often suffer from sleep disturbance , depression , and anxiety , conditions that negatively impact the quality of life . since tinnitus often persists even after sectioning the auditory nerve and since tinnitus masking profiles differ from external sounds , aberrant neural activity in the central nervous system ( cns ) rather than the cochlea is believed to play a major role in its development and maintenance [ 68 ] . on the basis of previous electrophysiological and neuroimaging studies [ 9 , 10 ] , tinnitus is believed to be generated by aberrant neural activity in the central auditory pathway by a variety of mechanisms such as increased spontaneous activity , increased neural synchrony , altered tonotopy , aberrant neural connectivity between auditory and nonauditory structures , aberrant attentional , or gating mechanisms . the fact that some patients are constantly aware of their tinnitus and find it extremely disturbing suggests that attentional or emotional neural networks may contribute to the severity of tinnitus distress . since subjective tinnitus is an endogenous ongoing process , resting - state functional magnetic resonance imaging ( fmri ) has proved to be a useful noninvasive technique for determining how structurally segregated and functionally specialized cerebral centers are interconnected as reflected by low - frequency ( 0.010.1 hz ) fluctuations in blood - oxygenation - level dependent ( bold ) signals [ 1315 ] . previous studies have employed resting - state fmri to examine multiple whole - brain networks such as the attention network and default mode network ( dmn ) to study the neural mechanisms of tinnitus . kim et al . found increased functional connectivity between the resting - state attention network and an auditory network suggesting that this network might contribute to the perception or salience of tinnitus . burton et al . proposed that tinnitus associated with hearing loss was the result of usage - induced changes in the organization of sensory networks and interference with the ventral and dorsal attention networks and executive control of attention ( eca ) networks . because of its persistent nature , some have proposed that tinnitus generators become integrated with the dmn [ 18 , 19 ] . also identified tinnitus - specific alterations in the connectivity encompassing the dmn and dorsal attention network . therefore , the above studies suggest that the attention network as well as the dmn may play a pivotal role in the neurological pathophysiology of tinnitus . moreover , our group found that chronic tinnitus patients with normal hearing out to the extended high frequencies exhibited aberrant amplitude of low - frequency fluctuations ( alff ) in specific dmn regions including the middle temporal gyrus ( mtg ) and angular gyrus ; the magnitude of the alff alterations was correlated with tinnitus severity . one limitation of previous tinnitus studies is that they mainly measured the interregional synchronization between distinct brain areas or correlations between resting - state connectivity networks while few have focused on investigating abnormal intraregional activity in specific brain regions . regional homogeneity ( reho ) analysis , a robust algorithm that quantifies the local synchronization within neighboring voxels during resting state , can be used to identify aberrant local neural activity coherence across the whole brain compared with the functional connectivity analyses . altered reho values may relate to disequilibrium of spontaneous neural activity within and between corresponding brain regions . indeed , aberrant reho values , indicative of disrupted local functionality , have been linked to several neurological impairments such as alzheimer 's disease , parkinson 's disease , schizophrenia , and hepatic encephalopathy [ 2326 ] . therefore , reho measurement is a potentially powerful tool to detect aberrant resting - state brain activity which complements information provided by functional connectivity analysis . in this study , we explored the intra- and interregional synchronization of multiple cerebral networks by combining reho and functional connectivity analyses to gain additional insights regarding aberrant neural activity in chronic tinnitus patients with normal hearing thresholds . we speculated that ( 1 ) abnormal reho and functional connectivity would be detected within tinnitus - related networks such as the attention network and dmn and ( 2 ) these abnormalities in the resting - state networks would be correlated with specific tinnitus characteristics such as tinnitus distress . thirty chronic tinnitus patients and 30 healthy subjects without tinnitus were recruited through newspaper advertisements and community health screenings from september 2011 to september 2013 . one of the tinnitus patients was subsequently excluded from the study because of the exceeded limits for head motion during mr scanning . the tinnitus patients and healthy subjects were group - matched with respect to age , sex , and education . twelve patients reported predominantly left - sided tinnitus , 6 reported predominantly right - sided tinnitus , and 11 described their tinnitus as bilateral or originating within the head . the severity of tinnitus and related distress were assessed by the iowa version of the tinnitus handicap questionnaires ( thq ) . all the participants had no hearing loss in any of 10 measured audiometric frequencies ranging from 250 hz to 16 khz ( hearing thresholds < 25 db ) none of the participants had symptoms of depression or anxiety based on the self - rating depression scale ( sds ) and self - rating anxiety scale ( sas ) ( overall scores < 50 ) [ 28 , 29 ] . participants were excluded if they reported suffering from hyperacusis , meniere 's diseases , or pulsatile tinnitus or if they had a past history of heavy smoking , alcoholism , stroke , head injury , parkinson 's disease , alzheimer 's disease , major depression , epilepsy , or other neurological or psychiatric illness , major medical illness ( e.g. , anemia , thyroid dysfunction , and cancer ) , mri contraindications , and severe visual impairment . table 1 summarizes the characteristics of the chronic tinnitus patients and healthy subjects . this study was approved from the research ethics committee of the affiliated zhongda hospital of southeast university . mri data were acquired using a 3.0-tesla trio scanner ( siemens , erlangen , germany ) . the earplugs ( hearos ultimate softness series , usa ) were used to attenuate scanner noise by approximately 32 db . subjects were instructed to keep their eyes closed without falling asleep , not to think of anything in particular , and to avoid any head motion during the scan . structural images were obtained using a t1-weighted 3d spoiled gradient - echo sequence ( repetition time = 1900 ms ; echo time = 2.48 ms ; thickness = 1 mm ; gap = 0 mm ; acquisition matrix = 256 256 ; slices = 176 ; flip angle = 90 ; field of view = 250 mm 250 mm ) . functional images were acquired using a gradient - echo planar sequence ( repetition time = 2000 ms ; echo time = 25 ms ; thickness = 4 mm ; gap = 0 mm ; acquisition matrix = 64 64 ; slices = 36 ; flip angle = 90 ; field of view = 240 mm 240 mm ) . briefly , the unified segmentation model was used to segment cerebral tissues into gray matter ( gm ) , white matter ( wm ) , and cerebrospinal fluid ( csf ) . functional data were preprocessed with the toolbox data processing assistant for resting - state fmri programs through statistical parametric mapping ( spm8 ; http://www.fil.ion.ucl.ac.uk/spm/ ) and resting - state fmri data analysis toolkit ( rest1.8 ; http://www.restfmri.net/ ) . the first 10 volumes were discarded and the remaining 230 consecutive volumes were used for data analysis . afterwards , the procedures were carried out as follows : slice - timing adjustment , realignment for head - motion correction , spatially normalized into the stereotactic space of the montreal neurological institute ( mni ) ( resampling voxel size = 3 3 3 mm ) and smoothed using a gaussian kernel of 4 mm full width at half - maximum ( fwhm ) , detrending , and filtering ( 0.010.08 hz ) . the participants who had a head motion more than 2.0 mm displacement or a 2.0 rotation in the x , y , or z directions were excluded from this study . briefly , kendall 's coefficient of concordance ( kcc ) was computed to measure the local synchronization of a given voxel with 26 nearest neighboring voxels in a voxelwise way , and the reho value was assigned to the central voxel . individual reho maps were divided by the global mean value within the whole brain mask for normalization . then , the normalized reho maps were spatially smoothed with a gaussian kernel of 4 mm fwhm . a two - sample t - test was performed on the group reho maps in a voxel - by - voxel way to explore the reho differences between two groups . a threshold was corrected p < 0.01 , with a monte carlo simulation for multiple comparisons ( http://afni.nimh.nih.gov/pub/dist/doc/manual/alphasim.pdf/ ) . age , sex , education , and gm volume were included as nuisance covariates , to control for the possible influences of these four factors on the results . four areas based on the increased reho findings were defined as regions of interest ( roi ) , including the bilateral anterior insular cortex ( ai ) , the left inferior frontal gyrus ( ifg ) , and the right supramarginal gyrus ( smg ) . then , pearson 's correlation coefficients were computed between the mean signal change of each roi and the time series of each voxel . finally , the correlation coefficients were converted into z values using fisher z - transform to improve the normality . six parameters of head motion and average time courses of global , wm , and csf signals were removed by linear regression analysis . the individual z values were entered into random effect one - sample t - tests to identify the brain regions exhibiting significant connectivity to each roi at a threshold of p < 0.01 ( alphasim correction ) . two - sample t - tests were performed to explore the differences of the functional connectivity of each roi between tinnitus patients and controls . a mask was created for two - sample t - tests by combining the regions exhibiting significant connectivity to each roi . the brain connectivity graphs were visualized using the brainnet viewer ( http://www.nitrc.org/projects/bnv/ ) . between - group t - test and -test were used to compare demographic and clinical data ( p < 0.05 was considered to be significant ) . to investigate the relationship between fmri data and clinical characteristic of tinnitus patients , the regions showing significant increased reho or functional connectivity between tinnitus patients and healthy controls were extracted . mean reho or z values within these clusters were correlated against each clinical characteristic of tinnitus patients using pearson 's correlation analysis by spss software ( version 18.0 ; spss , chicago , il , usa ) . partial correlations were calculated after correction for age , sex , education , and gm volume . table 2 compares the brain volumes of the chronic tinnitus patients and healthy controls . the gm , wm , and brain parenchyma volumes in subjects with tinnitus were not significantly different from healthy controls . compared to the healthy controls , chronic tinnitus patients had significantly increased reho values in the bilateral ai , left ifg , and right smg . in contrast , decreased reho values in tinnitus patients were observed in the left cuneus ( figure 1(a ) and table 3 ) . based on increased reho values in tinnitus patients , we defined four rois for our connectivity analysis : left ai , right ai , left ifg , and right smg . tinnitus patients compared to controls showed significantly greater connectivity between the seed region in left ai and the left mfg , right inferior temporal gyrus ( itg ) , and right precuneus ( figures 1(b ) and 2(c ) and table 4 ) . relative to controls , tinnitus patients showed significantly greater connectivity between the seed region in right ai and the right mfg , right superior temporal gyrus ( stg ) , left precuneus , and left posterior cingulate cortex ( pcc ) . tinnitus patients relative to controls also demonstrated significantly increased connectivity between the seed region in left ifg and the right mfg , right itg , and right anterior cingulate cortex ( acc ) . finally , tinnitus patients compared to controls exhibited significantly greater connectivity between the seed region in the right smg and the left ifg and right orbitofrontal cortex ( ofc ) . in the tinnitus patients , there were no significant correlations between abnormal reho values and any of the tinnitus characteristics . however , the change in functional connectivity between the left ai and the left mfg was positively correlated with the thq score ( r = 0.459 , p = 0.012 ) ( figure 2 ) . in addition , the increased functional connectivity between the right ai and the right mfg was also positively correlated with the thq score ( r = 0.479 , p = 0.009 ) . none of the other regions of increased functional connectivity were significantly correlated with thq scores . moreover , none of the regions of increased functional connectivity were correlated with sds or sas scores or tinnitus duration . this present study investigated for the first time altered intra- and interregional synchronization of several cerebral networks related to tinnitus by combining resting - state reho , a measure of local synchrony , and seed - based functional connectivity analyses . we detected abnormal reho and functional connectivity within specific brain regions belonging to the attention network and the dmn . furthermore , the abnormalities involved in the attention network showed significant correlations with the tinnitus distress . subjective tinnitus is generally associated with hearing loss which decreases the neural output of the cochlea . peripheral damage , in turn , is believed to trigger aberrant neuroplastic changes in the cns that result in tinnitus [ 10 , 11 ] . however , some tinnitus patients have normal hearing out to the extended high frequencies and no obvious signs of hearing pathologies raising questions about the source of the aberrant neural activity involved in their phantom percepts . to address this issue , we obtained structural and functional imaging data from normal controls and tinnitus patients , both with normal hearing thresholds out to the extended high frequencies and no evidence of hyperacusis or other medical problems . thus , the tinnitus patients evaluated in this study may represent a somewhat unique tinnitus phenotype different from others with mild hearing loss or hyperacusis [ 35 , 36 ] . since tinnitus has been associated with structural changes , we compared gm and wm volumes but did not detect any differences between our normal hearing tinnitus patients and matched controls . previous studies have reported decreases in gm volume in tinnitus patients in several brain regions including acc , nucleus accumbens , ventromedial prefrontal cortex , inferior colliculus , hippocampus , superior frontal gyrus , occipital lobe , hypothalamus , and heschl 's gyrus [ 3741 ] . increases in gm volume have also been observed in tinnitus patients in the stg and mtg . however , the changes in gm volume seen in these tinnitus patients were typically correlated with hearing loss particularly when testing was extended out beyond 8 khz [ 37 , 38 , 41 , 42 ] . since we did not detect significant differences in gm volume between our tinnitus patients and controls , the most parsimonious explanation for this is the absence of any hearing loss out to 16 khz and the absence of hyperacusis in our tinnitus patients . however , an alternative possibility is that our analytical techniques were not sensitive enough to detect regional differences in gm volume or intensity in our tinnitus patients [ 35 , 41 ] . regardless of which explanation is correct , our results suggest that abnormal functional neural networks can exist prior to major structural alterations in tinnitus patients with normal hearing . in the present study , the reho is a data - driven method used to measure the extent to which brain activity is synchronized within a cluster of voxels , that is , neural synchronization within a specific brain region . reho analyzes the regional connectivity of the neuronal tissue and may be seen as a measure of the smallest network integrity . altered reho is possibly related to the changes of temporal aspects of the spontaneous neuronal activity in the regional brain . therefore , increased or decreased reho reflects the local destruction of the synchronization of spontaneous neuronal activity in certain regions and implies functional deficits . increased local synchrony , as reflected in reho , could be a critical factor in initiating tinnitus since it might reflect the increased coherence of spontaneous neuronal activity [ 22 , 43 ] . enhanced local synchrony , or increased reho , could develop within a small cluster of neurons because of increased coupling of local factors such as loss of local intracortical inhibition , increased local intracortical excitation , aberrant receptors , and anatomical rewiring or plasticity - induced experience [ 4451 ] . local synchronization in one region of the brain could entrain other areas with preexisting long - range connections and reciprocal feedback circuits could further enhance interregional coupling [ 1 , 5254 ] . in some models , enhanced local synchrony results from inhomogeneities in cortical circuitry induced by cochlear hearing loss . these models would be difficult to reconcile with the absence of hearing loss in our patients . however , certain cochlear pathologies involving damage to the inner hair cells or auditory nerve fibers can go undetected by pta pointing out the need for more sophisticated testing to detect hidden hearing loss [ 55 , 56 ] . in tinnitus patients , reho values were significantly enhanced in four regions , the left and right ai , left ifg , and right smg . the ai and the ifg are key nodes in the attention networks , specifically the eca network . on the basis of resting - state quantitative electroencephalography ( qeeg ) , the ai and ifg have been implicated in tinnitus and specific tinnitus characteristics [ 5759 ] . moreover , tinnitus questionnaire scores were correlated to heart rate variability markers and related to bilateral neural activity in ai . greater synchrony of alpha activity was observed bilaterally in the ai of patients with more severe tinnitus - related distress . ai , which serves in the cingulo - opercular network as well as in the attention network , exhibits altered intra- and interregional synchronization in a number of pathological situations [ 6163 ] . similarly , the vital role of the frontal cortex in subserving tinnitus mechanism has been postulated [ 1 , 45 , 52 ] . previous research has already shown that the ifg is important for emotional processing of sounds [ 64 , 65 ] . the ifg serves as the core region of response inhibition and ifg activity might mirror the attempt to control the bottom - up attention allocation to the tinnitus percept in a top - down manner . thus , the ifg and the ai play important roles in the top - down modulation of automatic or peripheral physiological responses to emotional experiences [ 67 , 68 ] . previous positron emission tomography ( pet ) imaging studies found significant correlation of brain glucose metabolism in the ai and ifg with the distress and/or duration of tinnitus or tinnitus - like sounds [ 6971 ] . taken together , these results suggest that tinnitus distress , salience , or attentional focus is associated with increased intraregional synchronization combined with enhanced functional interconnectivity in these cerebral networks . we also found increased reho values in the smg , a region also associated with the attention network [ 72 , 73 ] . prior eeg or pet studies indicate that the smg may be involved in tinnitus [ 7476 ] . schmidt et al . demonstrated that the dorsal attention network , with seed regions in the bilateral intraparietal sulci , showed decreased correlations with the right smg in tinnitus subjects . thus , the increased local synchronization in the smg of tinnitus patients may alter the connectivity in the dorsal attention network . these features suggested that the alterations of the spontaneous fmri bold signals in attention network might be due to the abnormal local synchronization in chronic tinnitus . by contrast , the left cuneus showed reduced reho values in tinnitus patients , which may be due to compensatory mechanisms in visual regions associated with hearing a phantom sound . it has been suggested that sensory deprivation in the auditory modality could affect the function of the auditory modality [ 77 , 78 ] . we speculated that the decreased reho may be due to increased attention devoted to processing a phantom sound which decreases neural synchronic with the visual system . decreased spontaneous neural activity , as reflected in alff values , was also observed in visual areas , which again could be due to the increased salience of tinnitus . anyhow , it is not appropriate to conclude from the relationships between decreased reho and dysfunction of the visual area in tinnitus . whether reduced reho simply indicates visual impairment in tinnitus is unclear and needs further investigation . we further investigated the interregional synchronized neural activity in tinnitus patients using only seed regions which exhibited high reho values , namely , left and right ai , left ifg , and right smg . the functional connectivity networks from four rois were shown clearly on the three - dimensional brain graphs ( figure 2(c ) ) . remarkably , our study showed significantly enhanced functional connectivity especially within the eca network including the ai , the ifg , and the mfg . the increased functional connectivity between bilateral ai and bilateral mfg was positively correlated with tinnitus distress . many neuroimaging studies have confirmed the involvement of frontal cortex for tinnitus [ 45 , 71 ] . demonstrated structural and functional differences of ventromedial prefrontal cortex in tinnitus patients that were linked to tinnitus loudness , indicating that frontal cortex may contribute to certain perceptual features of tinnitus . the frontoinsular cortex potentially provides executive control overswitching attention between tinnitus and other conditions [ 8082 ] . the differences in tinnitus connectivity might reflect an adaptation to decrease the salience of phantom noises and maintain attention on nonauditory events . burton et al . also confirmed that functional connectivity in areas of eca network in tinnitus group was greater than that in the control group . similar to burton , we also found increased functional connectivity between the ai and the stg , the center of primary auditory cortex . the itg , another temporal cortex related to auditory perception , showed aberrant functional connectivity to the ai and ifg . reported that tinnitus distress was correlated positively with brain metabolism in bilateral itg using pet imaging . in our study , there also existed enhanced interregional synchronization between right smg and left ifg and right ofc , indicating the disrupted attention network associated with chronic tinnitus . besides the attention networks , significantly increased functional connectivity to several dmn regions , such as the precuneus , acc , and pcc , was also observed in tinnitus patients . the dmn , encompassing precuneus and mesiofrontal and temporoparietal junction areas , appears to have strong negative correlations with a network of brain regions commonly activated during the performance of goal - directed cognitive tasks termed the task - positive network . using seed - based , independent component analysis ( ica ) or graph theory analysis , previous functional connectivity studies have found altered interregional synchronization between the dmn and attention network in tinnitus subjects [ 12 , 20 , 84 ] . our study was inconsistent with reduced functional connectivity within the dmn in schmidt 's study as well as the lack of significant differences between the dmn and attention networks in wineland 's study [ 20 , 85 ] . these discrepancies might be due to the methodological features unique to the current study such as the use of seed regions with high reho values , the use of patient with normal hearing up to 16 khz , and elimination of subjects with hyperacusis . this current work was an exploratory study using high reho values to select seed regions for subsequent connectivity analysis and had several inevitable limitations . first , our sample size was moderate , 29 tinnitus patients and 30 normal hearing subjects . increasing the sample size with our approach would increase our ability to make causal relationships between the altered intra- or interregional synchronization and tinnitus characteristics . furthermore , though this study has attempted to minimize the amount of scanner noise with earplugs , we can not completely prevent subjects from hearing some sound . the existence of scanner noise may make the internal sound of tinnitus less salient thereby reducing the differences in resting - state networks between tinnitus and control groups . however , this limitation applies to virtually all resting - state studies in the literatures . nevertheless , this limitation should be taken into consideration while attempting to draw conclusions on resting - state fmri results in studies involving tinnitus patients as well as studies involving auditory stimulation in general . finally , participants with hyperacusis were excluded from the current study because tinnitus is often accompanied by hyperacusis that could cause resting - state pathological brain activation in tinnitus patients according to previous neuroimaging studies [ 86 , 87 ] . since the tinnitus subjects without hyperacusis could not represent all the chronic tinnitus patients , the role of chronic tinnitus accompanying hyperacusis should also be taken into account in future explorations . our combined reho and functional connectivity analyses demonstrated significantly altered infra- and interregional synchronization mainly within the attention network and the dmn prior to structural changes in tinnitus patients . thus , tinnitus can be regarded as the consequence of multiple resting - state networks involved in different aspects of tinnitus , such as auditory perception , attention , and affect . the identification of both local regions of aberrant resting - state activity by reho as well as aberrant interregional disturbances in brain connectivity could help unravel the complex cerebral networks subserving tinnitus and enhance our understanding of the pathophysiological mechanisms of this disorder .

objective . subjective tinnitus is hypothesized to arise from aberrant neural activity ; however , its neural bases are poorly understood . to identify aberrant neural networks involved in chronic tinnitus , we compared the resting - state functional magnetic resonance imaging ( fmri ) patterns of tinnitus patients and healthy controls . materials and methods . resting - state fmri measurements were obtained from a group of chronic tinnitus patients ( n = 29 ) with normal hearing and well - matched healthy controls ( n = 30 ) . regional homogeneity ( reho ) analysis and functional connectivity analysis were used to identify abnormal brain activity ; these abnormalities were compared to tinnitus distress . results . relative to healthy controls , tinnitus patients had significant greater reho values in several brain regions including the bilateral anterior insula ( ai ) , left inferior frontal gyrus , and right supramarginal gyrus . furthermore , the left ai showed enhanced functional connectivity with the left middle frontal gyrus ( mfg ) , while the right ai had enhanced functional connectivity with the right mfg ; these measures were positively correlated with tinnitus handicap questionnaires ( r = 0.459 , p = 0.012 and r = 0.479 , p = 0.009 , resp . ) . conclusions . chronic tinnitus patients showed abnormal intra- and interregional synchronization in several resting - state cerebral networks ; these abnormalities were correlated with clinical tinnitus distress . these results suggest that tinnitus distress is exacerbated by attention networks that focus on internally generated phantom sounds .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

he had suffered from intermittent headache for 2 months and had taken benzodiazepines and analgesics under the diagnosis of somatoform disorder at a local clinic . he had a 5-day history of diplopia and a 3-day history of blurred vision that progressed to blindness during the preceding 24 hours . on admission his blood pressure was 130/70 mmhg , pulse rate was 82/min , respiratory rate was 20/min , and body temperature was 36.3. on neurologic examination the patient was alert and exhibited no meningeal signs . only light perception was possible in both eyes , but no other neurological abnormality was noted . lumbar puncture showed the opening pressure of 160 mm h2o with clear cerebrospinal ( csf ) fluid . csf evaluation showed 30 red blood cells / mm , 80 white blood cells / mm , 80% lymphocytes , 41 mg / dl glucose , and 114 mg / dl protein . his body temperature increased to 38.8 1 day after admission , but cbc revealed no leukocytosis . brain mri showed no meningeal enhancement , parenchymal lesion , or intracranial vascular abnormality supplying the optic nerve , optic chiasm , or optic tract . the results of fundoscopic examinations were unremarkable , and visual evoked potential showed no wave formation on bilateral pathways ( fig . an india ink smear of the csf demonstrated encapsulated yeast , and cryptococcus neoformans was cultured ( fig . he was found to be seropositive for hiv with a high antibody titer ( 53.87 s / co ) . he was treated with both antiretroviraland antifungal agents , and his visual acuity had improved upon discharge . neuro - ophthalmic lesions are present in 6% of patients with hiv infection during the course of the disease , with most of them being are attributable to cryptococcal meningitis.3 cryptococcus neoformans , the cause of cryptococcal meningitis , is the fourth most common source of life - threatening infection in aids patients after infections of cytomegalovirus , pneumocystis carinii , and mycobacterium avium intracellulare.1 it is present in pigeon droppings and infects by inhalation of contaminated soil . cryptococcal meningitis is fatal in hiv - infected patients if not treated , and hence early diagnosis is very important . the signs and symptoms of cryptococcal meningitis include headache ( 80~92% of cases ) , meningeal signs ( 50~80% ) , nausea / vomiting ( 40~80% ) , fever ( 36~67% ) , and visual disturbances ( 33~47%).1 our patient presented with acute blindness without other definite clinical symptoms at the time of admission . possible mechanisms for binocular blindness due to cryptococcal meningitis include direct fungal infiltration of the optic nerve , optic chiasm , or optic tracts , adhesive arachnoiditis , cerebral vasculitis , and intracranial hypertension.4 it has been suggested that rapid - onset visual loss is caused by infiltration of the optic nerve or optic chiasm , while slow - onset visual loss is due to increased csf pressure.4 a csf opening pressure exceeding 200 mmh2o and papilledema reflect intracranial hypertension , but our patient showed a normal csf opening pressure and unremarkable fundoscopic examination findings . moreover , his visual symptoms developed very early in the course of the disease . thus , the sudden visual loss might have been due to retrobulbar fungal infiltration . whereas the prevalence of cryptococcosis is decreasing because of the widespread availability of antiretroviral therapy , cryptococcal meningitis is still a fatal complication of hiv infection . thus , both early diagnosis of cryptococcal meningitis and detection of the underlying causes are important . in our opinion , unexpected sudden binocular blindness should be considered as a possible initial manifestation of cryptococcal meningitis related to hiv infection .

ocular complications of hiv - related cryptococcal meningitis are reasonably common , but complete binocular blindness as the first manifestation of hiv is extremely rare . a 58-year - old man presented with binocular blindness . he experienced blurred vision for 3 days before the blindness . mild pleocytosis was present in the cerebrospinal fluid , from which cryptococcus neoformans was cultured . serology revealed positivity for hiv antibody . he was treated with antifungal and antiretroviral therapy . this case indicates that hiv - related cryptococcal meningitis should be taken into consideration when determining the cause of unexpected sudden binocular blindness .

CASE REPORT DISCUSSION

nonalcoholic fatty liver disease ( nafld ) is the most common chronic liver disease in europe and the us with a prevalence of up to 30% . it is associated with obesity and diabetes and is thus considered to be the hepatic manifestation of the metabolic syndrome . nafld ranges from simple hepatic steatosis , characterized by triglyceride accumulation in hepatocytes , to nonalcoholic steatohepatitis ( nash ) , which may be associated with fibrosis and progression to cirrhosis or hepatocellular carcinoma . while the diagnosis of nafld is based on histology and patients history , the increase in prevalence demands noninvasive methods for diagnosis and surveillance . hepatocyte apoptosis was identified as a key feature of nafld and correlates with disease severity . cytokeratin 18 ( ck18 ) is an intermediate filament expressed in single - layer epithelial tissues . during apoptosis , caspase - cleaved ck18 is released into the cytoplasm and released into the serum after cell death . therefore , soluble forms of extracellular ck18 in the serum are utilized to quantify activity of cell death . wieckowska et al . quantified cleaved ck18 fragments in patients with nafld and found a correlation with the occurrence of liver fibrosis and hepatic inflammation . [ 5 , 6 ] the published results of a multicenter validation study by feldstein et al . revealed ck18 fragments as a predictor of nash versus simple steatosis . most of its disassembly takes place in endothelial liver cells . because of the lack of function , fibrosis and cirrhosis lead to impaired clearance of hyaluronic fragments . several studies could show a correlation between serum hyaluronic acid and fibrosis stage in chronic liver diseases , including nafld [ 8 , 9 ] . here , we evaluated caspase - cleaved ck18 and hyaluronic acid as biomarkers for nafld and fibrosis in a cohort of 127 patients who underwent bariatric surgery and compared these results to the histological diagnosis , quantified by nafld - activity score ( nas ) , as established by kleiner et al . . in line with recent publications , we observed a clear correlation between caspase - cleaved ck18 and liver steatosis . a total of 127 morbidly obese patients ( mean age : 45 10 ; 78.7% females , mean bmi : 52 8) who underwent bariatric surgery at a center for bariatric surgery were included . indication for bariatric surgery was made according to national institutes of health ( nih ) guidelines ( bmi 40 kg / m or 35 kg / m , plus comorbidities ) . subjects reporting excess alcohol consumption ( > 20 g / day in males or > 10 g / day in females ) indicating alcoholic liver disease were excluded . the surgeon 's choice that is , adjustable gastric band , roux - y , or gastric bypass surgery was based on the current guidelines as adapted to the patient 's clinical conditions and comorbidities as well as on clinical experience . a control group of 10 healthy volunteers ( 7 males ; 3 females / median age : 26 7.6 years ) had an average bmi of 22.4 0.82 kg / m . this study was approved by the ethics committee ( institutional review board ) of the university hospital essen . patients volunteering were informed about intraoperative risks and benefits of wedge liver biopsy and provided informed consent . ck18 serum levels and hyaluronic acid were assessed in the sera of patients and healthy controls using the m30-apoptosense ( peviva , bromma , sweden ) and hyaluronic acid ( wako chemicals , neuss , germany ) elisa kits . the m30-apoptosense assay detects a specific epitope of caspase - cleaved ck18 , which will further be referred to as m30 . patients with and without nash were compared regarding metabolic characteristics , transaminases , nas , m30 , and hyaluronic acid levels using independent samples t - tests ( mann - whitney test ) . medline research was performed in january 2011 with the search terms serum markers nafld . analyses were performed with with spss 15.0.1 , version 2006 ( spss , chicago , il , usa ) and graph pad , version 5.03 ( graph pad , graph pad software inc . , ca , usa ) . the clinical characteristics of the 56 patients with nash ( nas 5 ) in comparison to 71 nafl patients ( nas < 5 ) are stated in table 1 . in patients with nash , risk factors of the metabolic syndrome as triglycerides and fasting glucose were higher in comparison to patients with nafl . as the nas score consists of the individual scoring values for steatosis , ballooning , and lobular inflammation , a nas 5 was accompanied with significantly higher scores for the individual characteristics of nafld . as expected , m30 was elevated in nash patients ( figures 1(a ) , 2(a ) , and 2(b ) ) . accordingly , serum transaminase levels were elevated in nash patients ( figure 1(b ) ) . the artificial cut - off for m30 to predict nash ( 275 u / l ) , established and validated by the feldstein group , in our cohort corresponded with histological steatosis , but not lobular inflammation . in serological nash , ballooning and nas score were only modestly elevated ( figure 1(c ) ) . however , alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) levels were significantly higher in patients with plasma levels of m30 275 u / l , indicating hepatocellular damage , despite no histological signs of lobular inflammation ( figure 1(d ) ) . interestingly , about two - third of our cohort had stage-2 fibrosis ( figures 2(a ) and 2(b ) ) . we did not find an increase in fibrosis score in patients with a nas 5 . however , morphometrically quantified liver collagen ( sirius red ) and serum hyaluronic acid were both elevated in histological nash versus nafl ( figures 3(a ) , 2(e ) , and 2(f ) ) . advanced fibrosis was further associated with more tunel positive cells per visual field in liver sections , and serum hyaluronic acid was dramatically increased in patients with advanced fibrosis ( figures 3(b ) , 2(c ) , and 2(d ) ) . accordingly , m30 levels were higher in patients with advanced fibrosis , while the nas score was not different between the groups at all ( figure 3(c ) ) . this supports the above - mentioned observation that fibrosis is associated with hepatocellular apoptosis , rather than lobular inflammation . in this context , the number of tunel positive cells in livers was significantly correlated with the percentage of sirius red positive area in the visual field and m30 was significantly correlated with serum hyaluronic acid ( figure 3(e ) ) . in our cohort of 127 morbidly obese patients , caspase - cleaved ck18 correlated with hepatic steatosis but not lobular inflammation as assessed by histological scoring . still , ast and alt were significantly higher in patients with ck18 levels above the established cut - off for nash , indicating a discrepancy between histological assessed inflammation and actual liver injury . interestingly , the degree of fibrosis did not correspond to the nas score , while a high apoptosis rate , as assessed by tunel staining in liver tissue and assessment of serum caspase - cleaved ck18 , correlated with increased fibrosis . this is in line with recent publications , that hepatocyte apoptosis , rather than hepatic inflammation , is a key trigger of hepatic stellate cell activation and thus fibrogenesis [ 12 , 13 ] . taken together , our data indicate that biomarkers in nafld might reveal more information than standard histological scoring . in the following , we will review the emerging data on serum markers in nafld , a field that is continuously growing ( figure 3(f ) ) . to date , liver biopsy and histological assessment of liver steatosis , ballooning , and lobular inflammation in h&e staining remain the gold standard for diagnosis of nash . however , despite a low rate of overall complications , percutaneous liver biopsy remains an invasive procedure with the risk of potentially lethal hemorrhage and infections and is further complicated in the growing number of obese patients with nafld [ 14 , 15 ] . given the increasing prevalence of nafld , noninvasive markers for nafld are a promising approach not only for screening reasons . in 2006 , wickowska et al . quantified soluble caspase - cleaved ck18 with a specific m30-elisa and found a correlation with the histological staging in nafld patients . this was validated by the same group and in a cohort of patients who underwent bariatric surgery , an m30-cutoff value of 275 u / l was established to discriminate simple steatosis from nash [ 7 , 17 ] . we and others were able to show that m30 correlates with fatty acid transporter expression in liver tissue and specific fatty acids in the serum [ 18 , 19 ] . in a cohort of patients with polycystic ovarial syndrome , we could identify a high rate of patients with nash utilizing this assay . lately , the feldstein group enhanced sensitivity and specificity of nash detection by detection of soluble fas and fas ligand additional to m30 and established an apoptotic index in the noninvasive diagnosis of nash . as mentioned above , we found not only a correlation of m30 with hepatic steatosis but also a good correlation between the apoptosis rate and markers for fibrosis in our cohort , which is in line with observations from other groups . hepatocyte apoptosis is known to activate hepatic stellate cells via formation of apoptotic bodies , which are either directly stimulating hepatic stellate cells or are engulfed by kupffer cells , which in turn activate stellate cells [ 23 , 24 ] . noninvasive diagnosis of fibrosis in nafld is complicated by the high rate of obese patients compared to hepatitis c infection . transient elastography , a method that accurately predicts fibrosis stage in hepatitis c patients , faces limitations in nash patients , as accuracy is dramatically reduced in obese individuals . hyaluronic acid has been implied as a good biomarker for fibrosis and was correlated with the apoptosis rate in our cohort . however , several multipanel tests are among the most promising in noninvasive diagnosis of fibrosis . these tests consist of different serum parameters , some even include assessment of hyaluronic acid and are validated in cohorts of hepatitis c patients but might as well be useful in patients with nafld , although validation studies still need to prove accuracy in this cohort [ 26 , 27 ] . taken together , because of the nature of nafld and the increase in prevalence , there is an increasing demand for noninvasive markers of nafld and fibrosis . since hepatocyte apoptosis is a key feature of nafld and also contributes to fibrogenesis , assessment of soluble markers of apoptosis appears to be a good alternative to liver biopsy in these patients . in fact , these methods might give better insight into the status and prognosis of liver disease than standard h&e assessment . however , especially fibrotic markers need further validation since the high rate of obesity might confound these tests .

hepatocyte apoptosis is a key event in nonalcoholic fatty liver disease ( nafld ) , and serum apoptotic markers are emerging as surrogate markers for nafld . we studied the role of caspase - cleaved cytokeratin18 in the diagnosis of fibrosis in a cohort of 127 morbidly obese patients and also performed a review of the literature biomarkers of nafld and fibrosis . here , we found that cleaved caspase 18 correlated with liver steatosis and liver injury as assessed by serum transaminase levels . furthermore , hepatocyte apoptosis as assessed by cleaved ck18 and tunel staining correlated with the extent of fibrosis as assessed by sirius red staining and serum hyaluronic acid . these results underscore the important role of hepatocyte apoptosis in the pathogenesis of fibrosis in nafld , which led to the utilization of surrogate markers for apoptosis in the noninvasive diagnosis of nafld . we furthermore reviewed current literature of biomarkers of nafld and fibrosis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion and Review 5. Conclusion

drug - induced gingival overgrowth ( digo ) remains a significant problem for the dental clinicians . amlodipine is a third - generation dihydropyridine calcium channel blockers ( ccb ) that is used in the management of both hypertension and angina . ellis et al . , first reported gingival sequestration of amlodipine and amlodipine - induced gingival overgrowth ( aigo ) . since then , very few isolated cases of aigo have appeared in the dental literature although there are numerous reports of nifedipine induced gingival overgrowth until date . the incidence of gingival hypertrophy with nifedipine therapy has been reported to be as high as 20% . other synonyms have been used to describe similar lesions , such as inflammatory pseudotumor , histiocytoma , xanthomatous granuloma , inflammatory myofibroblastic tumor , and spindle cell pseudotumor . it occurs primarily in the lungs , but has occurred in other extra - pulmonary sites . this lesion is not a neoplastic process , nor is it associated with a monoclonal expansion of a single plasma cell instead ; this is a reactive , inflammatory lesion which usually involves the mobile tissues of the oro - nasopharyngeal region , such as paranasal sinuses , buccal mucosa , tongue , and lip . they are even rarer on the gingiva and very few case reports have been documented . there are no reports of amlodipine - related plasma cell granuloma of gingiva existing in the extant literature . the present case report describes an unusual case of amlodipine induced massive plasma cell granuloma on the gingiva . a 54-year - old female patient reported to the multispecialty private dental clinic ( latur , india ) with the chief complaint of diffuse swelling in the right maxillary anterior region . patient was not aware of such growth until 8 months back when she noticed a small slowly growing bead - like nodular enlargement of the gums that gradually progressed to the present size covering almost the entire front teeth . her past medical history revealed that the patient was hypertensive for last 2 years and was under medication ( amlodipine 10 mg , once daily ) . the lesion was asymptomatic , but the patient complained it to be severely interfering with mastication , speech , and oral hygiene practice resulting in functional and aesthetic problem . on intraoral examination , the lesion was a well - circumscribed exophytic sessile spherical mass of 1.5 inches diameter with color same as that of the surrounding oral mucosa with the scattered erythema [ figure 1 ] . the lesion was extended from distal surface of upper right canine to distal surface of upper left central incisor crossing the midline . poor oral hygiene status of the patient was assessed from the presence of local irritating factors contributing to the mild inflammatory component of the gingival enlargement . pre - operative clinical presentation of amlodipine induced plasma cell granuloma of gingiva complete hemogram showed all blood counts to be within the normal limits . intraoral periapical radiograph and orthopantomogram in the region of aigo showed generalized advanced horizontal bone loss around all teeth resulting in pathologic migration the lesion was biopsied under local anesthesia . the area was sutured and the specimen submitted for histopathological examination . as the extraction of all the remaining teeth with poor prognosis was planned substitution of amlodipine was not considered . planned extraction of remaining mandibular teeth was carried out in subsequent appointment . following healing period of 2 months complete denture prosthesis histopathological examination using hematoxylin and eosin stain , revealed proliferative parakeratinized stratified squamous epithelium , connective tissue with sheets of plasma cells intermixed with scattered small lymphocytes . high power microscopy : h and e staining shows sheets of plasma cells intermixed with scattered small lymphocytes immunohistochemical study of the biopsy material revealed the polyclonal plasma cell infiltrate uniformly positive for cd138 , a marker for plasmacytoid cells [ figure 3 ] and kappa light chain [ figure 4 ] and weak expression was noted for the lambda light chain . absence of findings from common tetrad of multiple myeloma ( crab : c = calcium ( elevated ) , r = renal failure , a = anemia , b = bone lesions ) ruled out its possibility . positive staining for d138 positive staining for kappa light chain on the basis of clinicohistopathologic examination and immunohistochemistry , a confirmative diagnosis of plasma cell granuloma was made . healing was uneventful and the patient is presently under follow - up since 5 months . gingival overgrowth is an often overlooked , but potentially harmful side - effect of treatment with amlodipine and other ccb . the reason for this adverse event is not absolutely known , but two main inflammatory and non - inflammatory pathways have already been suggested . the proposed non - inflammatory mechanisms include defective collagenase activity due to decreased uptake of folic acid , blockage of aldosterone synthesis in the adrenal cortex and consequent feedback increase in adrenocorticotropic hormone level , and up - regulation of keratinocyte growth factor . alternatively , inflammation may develop as a result of direct toxic effects of concentrated drug in gingival crevicular fluid and/or bacterial plaques . this inflammation could lead to the up - regulation of several cytokine factors such as transforming growth factor beta . in a series of 150 cardiac patients , it was found that amlodipine at a dose of 5 mg / day can not induce gingival hyperplasia even if taken more than 6 months . plasma cells are terminally differentiated b lymphocytes , which are typically found in the red pulp of the spleen , medulla of the lymph nodes , tonsils , lamina propria of the entire gastrointestinal tract , mucosa of the nose and upper airway , and sites of inflammation . a plasma cell 's main function is to produce immunoglobulins or antibodies . periodontal lesions with a predominance of plasma cells were reported initially by during late 1960s and only very few case reports have been documented since then . these cases reported a similar reactive gingival growth with similar histological and clinical appearance , which was treated by excisional biopsy , as in the present case . gingival plasma cell granulomas have been reported in patients with cyclosporine - induced gingival overgrowth . it was suggested that interleukin-6 and phospholipase c-1 may induce heavy plasma cell infiltration in cyclosporine - induced gingival overgrowth . it is important to differentiate plasma cell granulomas from tumors of bone such as multiple myeloma , solitary myeloma , and soft - tissue myeloma ( extramedullary plasmacytoma ) considering the poor prognosis of these neoplasms . differentiating the type of soft - tissue tumor is mandatory , as plasma cell granuloma may be benign , extramedullary plasmacytoma may be malignant or a precursor to malignancy . histologically , extramedullary plasmacytoma consists of mixture of typical and atypical plasma cells while plasma cell granuloma consists of normal plasma cells and small lymphocytes that are surrounded by connective tissue septa . the immunohistochemical analysis have shown that in the case of malignancy ratio of the kappa to lambda light chain may be greater than 10:1 or 1:10 , whereas in a reactive lesion the ratio is 2:1 . plasma cell lesions with the predominance of plasma cells may represent an autoimmune reaction or an alteration of blood - flow imposing congestive vasodilatation or lesions occurring due to parasitic infiltration . recent studies have reported that a gingival plasma cell granuloma shows variable gene expression for cell - mediated immunity and stromal tissue degeneration , undergoing sclerotic fibrosis with a persistent inflammatory reaction . in conclusion , amlodipine induced plasma cell granuloma of gingiva is a distinct pathological entity characterized by the presence of mature polyclonal plasma cell sheets and fibrovascular connective tissue stroma . while the mechanism of amlodipine - induced gingival plasma cell granuloma of gingiva is considered to be multi - factorial , the drug / cellular interaction may play an important role in the pathogenesis of this entity . this case highlights the need to biopsy unusual lesions to rule out potential neoplasms and also emphasizes the need to submit the excised tissue for histopathological examination regardless of clinical notion and/or perceived surgical success .

drug - induced gingival overgrowth ( digo ) can be a serious concern for both patients and clinicians . digo is a well - documented side - effect of some pharmacologic agents , including , but not limited to , calcium channel blockers , phenytoin , and cyclosporine . plasma cell granulomas ( pseudotumors ) are exceedingly rare , non - neoplastic , reactive tumor - like proliferation , primarily composed of plasma cells that manifest primarily in the lungs , but may occur in various anatomic locations . intraoral plasma cell granulomas involving the lip , oral mucosa , tongue , and gingiva have been reported in the past . this is the first case report of amlodipine induced plasma cell granuloma of the gingiva in the medical literature presenting a 54 year - old female patient with hypertension , who received amlodipine ( 10 mg / day , single dose orally ) for 2 years , sought medical attention because of developing maxillary anterior massive gingival overgrowth causing functional and esthetic problem , which was treated by excisional biopsy . histologically , these lesions were composed of mature plasma cells , showing polyclonality for both lambda and kappa light chains and fibrovascular connective tissue stroma confirming a diagnosis of plasma cell granuloma . this case also highlights the need to biopsy for unusual lesions to rule out potential neoplasms .

INTRODUCTION CASE REPORT DISCUSSION

ludwig 's angina is a known , yet a rare surgical emergency that is potentially life threatening unless early recognised and aggressively treated . we highlight these controversies with a brief review of the literature and a retrospective review of recent experiences with ludwig 's angina . a 56-year - old male presented with a 72-hour history of a worsening dysphagia and submandibular swelling . the onset was following a visit to the dentist where a dental abscess was drained . 24 hours later he revisited his dentist complaining of a submandibular swelling , and was commenced on oral co - amoxiclav . despite that , his symptoms progressed and he made his way to our facility 72 hours later . based on his history and symptoms the diagnosis of ludwig 's angina was suspected . he was not in respiratory distress ; his respiratory rate was 23 , and o2 saturation was 96% on room air . based on this initial assessment , the decision was to manage him conservatively with close airway observation . he was commenced on intravenous co - amoxiclav and clindamycin , and a contrast - enhanced ct scan of his neck and upper thorax was performed to rule out the possibility of a deep neck abscess . this showed an extensive submandibular soft tissue swelling and inflammation with moderate tongue elevation and posterior displacement causing a degree of oropharyngeal airway compromise . no abscess cavity or laryngeal airway compromise was evident . he was admitted to the ear , nose and throat ( ent ) ward for hourly airway observation and intravenous antibiotic treatment . his symptoms improved on a daily basis maintaining a normal breathing rate and pattern with no o2 desaturations below 97% on room air on pulse oximetry . by the 5th day following his admission , his symptoms have fully resolved , and he was discharged from hospital on oral co - amoxiclav . two weeks and 3 months out - patient department followups showed no recurrent soft tissue swelling or oedema , and he was discharged from our service . a 59-year - old male with a background history of noninsulin - dependant diabetes mellitus and sebopsoriasis presented with 24-hour history of mild right - sided facial swelling , a worsening submandibular swelling , and mild dysphagia . he had low - grade pyrexia of 37.8c , his respiratory rate was within normal limits , and his o2 saturation was 98% on room air . on physical examination he had a mild right - sided facial swelling , a significant submandibular swelling , and skin erythema extending inferiorly to the level of the upper border of the sternum . he was commenced on intravenous clindamycin , ciprofloxacin , and benzylpenicillin , and a contrast - enhanced ct scan of his neck and upper thorax ( figures 1 and 2 ) was performed to role out a deep neck abscess or a mediastinum extension . this showed a significant submandibular soft tissue inflammation and oedema with a degree of oropharyngeal compromise . his laryngeal airway was normal , and no deep neck abscess or fascial extension was evident . he was admitted to the ent ward for hourly airway observation and intravenous antibiotic treatment . on the third day after admission , on the other hand , a worrying inferiorly spreading skin erythema to the level of the 5th costal cartilage was noted . despite that , his respiratory rate and o2 saturation remained unchanged , and he had no cardiothoracic complaints to suggest a danger space extension or a necrotising fasciitis . a clinical assessment including a chest plain film and a neck ultrasound was performed . the dermatology service was consulted , and a secondary psoriatic flare up was suspected . a topical daktacort hydrocortisone cream ( miconazole and hydrocortisone ) was added . a gradual improvement of his symptoms occurred on daily basis . by the sixth day following his admission his symptoms two weeks and 3 months out - patient department followups showed no recurrent laryngeal oedema or skin erythema , and he was discharged from our service . ludwig 's angina is named after the german physician , wilhelm friedrich von ludwig who first described this condition in 1836 . it is a potentially life - threatening cellulitis , or connective tissue infection , of the neck and floor of the mouth which is characterised by progressive submandibular swelling with elevation and posterior displacement of the tongue [ 2 , 3 ] . early antibiotic treatment should be broad spectrum to cover gram - positive and gram - negative bacteria as well as anaerobes . the use of intravenous steroids has been proposed as a mean of reducing soft tissue swelling and oedema and minimising the likelihood for the need of a surgical airway in ludwig 's angina [ 1 , 5 , 6 ] . this remains controversial , as up to this date no randomised controlled trials that demonstrate the efficacy of corticosteroids in these patients exist . traditionally aggressive airway management by securing the airway with endotracheal intubation or surgically with a surgical tracheostomy was the norm . although no specific guidelines are present for managing acute ludwig 's angina , decisions regarding airway protection are largely dependant on the practice guidelines for management of the difficult airway that were adopted by the american society of anaesthesiologists in 1992 and updated in 2003 . in these guidelines , a difficult airway is defined as the clinical situation in which a conventionally trained anaesthesiologist experiences difficulty with face mask ventilation of the upper airway , difficulty with tracheal intubation , or both . the guidelines specify that these recommendations may be adopted , modified , or rejected according to the clinical needs and constraints as these guidelines are not intended as standards or absolute requirements and their purpose is to assist the practitioner in decisions about health care . recent reports have encouraged conservative management of ludwig 's angina in selected patients over the conventional aggressive airway management . larawin et al . retrospectively studied a total of 103 patients with deep neck space infections from 1993 to 2005 . ludwig 's angina was the most commonly encountered infection seen in 38 ( 37% ) patients of treatment . 13 ( 34% ) patients managed successfully with medical therapy and only 4 ( 10% ) patients required a tracheostomy tube . kurien et al . reported a 13-year review of patients with ludwig 's angina between 1982 and 1995 . 70% were controlled with conservative medical management while 81% of adults required incision and drainage . a 9-year review by greenberg et al . of 29 cases of deep neck space infections reported 21 patients ( 72 % ) treated conservatively following initial clinical assessment . of those treated nonconservatively at initial presentation , 7 ( 24% ) patients were able to be intubated using fiberoptic nasoendoscopy and 1(3% ) patient required tracheostomy under local anaesthesia . early detailed imaging is essential to evaluate the extension of tissue infection or necrosis and to guide decisions regarding surgical approaches when indicated . ct scan and mri are of invaluable importance in the assessment of deep neck space infections and collections . miller et al . reported that combined clinical evaluation and ct findings lead to accuracy of 89% , sensitivity of 95% , and specificity of 80 % in identifying drainable collection . plain chest radiographs are useful when looking for signs of mediastinum extension such as mediastinitis and pleural effusion . although ultrasound is not as easily interpreted by clinicians and surgeons as other imaging modalities , its availability , cost effectiveness , reduced risk of radiation , and accuracy in differentiating cellulites - related oedemas from abscess collections make it a reliable supplement modality to ct scan in resistant cases [ 12 , 13 ] . however , in cases of significant airway compromise where an immediate decision regarding the need of a definitive airway is required , clinical experience and judgment are superior to imaging . from our clinical experience and the literature review we conclude that conservative management of ludwig 's angina is acceptable in selective cases , provided that early antibiotic therapy is commenced and any collectable abscess is drained . initial airway assessment is based on respiratory rate , oxygen saturation , and findings on fiberoptic laryngoscopy . patients are then categorised as having either a severe airway compromise or a stable airway . in the severely compromised group ( patients unable to maintain saturation on room air above 95% , respiratory rate > 25 , or awake fiberoptic - assisted intubation should be attempted first ; if this fails then a surgical tracheostomy is performed under local anaesthesia . in the other group , where patients are able to maintain normal oxygen saturation and respiratory rate on room air and where no significant airway compromise is evident on fiberoptic examination , this involves close airway observation ( oxygen saturation , respiratory rate , and serial fiberoptic laryngoscopy ) in a high dependency unit ( hdu ) or ent ward . after the initial clinical assessment and airway decision all patients should undergo ct scanning of their neck and thorax for further detailed airway and deep neck spaces evaluation . any abscess or collection cavity should be drained , and both groups should be kept in an hdu or ent ward for hourly airway assessment for 2448 hours . this is based on close airway observation on a specialised airway unit and a serial clinical airway assessment . improved imaging modalities , antibiotic therapy , surgical skills , and clinical experience are the key factors behind this change in practice .

objectives . to review the current protocols used for management of ludwig 's angina and to assess the efficacy of conservative measures in these cases . methods . a retrospective review of patients who were admitted to our institution for management of ludwig 's angina between 2003 and 2010 . results . two patients were identified . both were managed successfully with conservative measures and close airway observation . none needed an emergency intubation or surgical tracheostomy . there were no mortalities , and both had a short hospital stay . conclusion . recently , management of ludwig 's angina has evolved from aggressive airway management into a more conservative one . this is based on close airway observation on a specialised airway unit and a serial clinical airway assessment . improved imaging modalities , antibiotic therapy , surgical skills , and clinical experience are the key factors behind this change in practice .

1. Introduction 2. Case1 3. Case2 4. Discussion 5. How We Do It 6. Conclusion

62 newly diagnosed cases of moderate to severe primary glaucoma were recruited from the out - patient department and glaucoma clinics of a tertiary care center in new delhi , india . patients with characteristic changes in the optic nerve head and corresponding glaucomatous visual field defects on standard automated perimetry were included in the study . all patients had best corrected visual acuity of at least 20/200 in the better eye , were over 40 years of age and were conversant in hindi or english . exclusion criteria included subjects with history of previous treatment for glaucoma ; vision < 20/200 in better eye ; presence of other comorbid ocular conditions , e.g. , age - related macular degeneration , cataract , optic neuropathy other than glaucoma , that could potentially contribute to visual loss ; chronic systemic diseases that could significantly affect qol , e.g. , diabetes , arthritis , coronary artery diseases , cerebrovascular diseases , collagen vascular disorders , history of any ocular surgery in previous 3 months ; deaf or communication impaired ; and physically disabled individuals . eligible patients underwent a thorough history and ocular examination including evaluation of visual acuity ; slit lamp biomicroscopy , intraocular pressure ( iop ) assessment with goldmann applanation tonometer ; gonioscopy using goldmann two - mirror gonioscope ; and optic nerve head evaluation using a 90 d lens . visual fields examination was performed using the humphrey visual field analyzer ( humphrey instruments inc . , allergan humphrey , san leandro , ca ) using the swedish interactive threshold algorithm 302 . the patients were categorized with respect to the severity of glaucoma according to the hodapp parrish anderson classification . sixty healthy control subjects with no ocular or systemic disease visiting the hospital for refractive error were included . the controls were age - matched with the glaucoma cases and were evaluated in a similar manner . the ind vfq33 is a 33-item questionnaire comprising of 33 items in three domains ( annexure ) . the general functioning elicited items related to distance vision , near vision , ambulation , night vision , dark adaptation , color vision , depth perception . the psychosocial impact domain related to the feelings of the patient related to low vision , e.g. , whether the subject feared going out at night , was he / she a burden on their family or fear of losing the remaining vision . finally , visual symptoms domain described most common visual symptoms like glare , discomfort , and blurring . general functioning ( domain 1 ) had 21 items ( q1-q21 ) , a range of response varied from 1 to 5 giving a total range for domain 1 ( 21105 ) . psychosocial impact ( domain 2 ) and visual symptoms ( domain 3 ) had 5 items ( q22-q26 ) and 7 items ( q27-q33 ) , respectively . domain 2 and domain 3 had 14 as the range of response with a total score of responses varying from 5 to 20 in psychosocial impact and 128 in visual symptoms domain . the summary scores from each domain were added to give a total qol score with a minimum score of 33 and maximum 153 . the higher the score , the worse the qol . the mean total qol score of controls and glaucoma patients at each visit was divided into quartiles viz . no difficulty ( < 25% ) , mild difficulty ( 25% 50% ) , moderate difficulty ( > 5075% ) and severe difficulty ( > 75% ) with cut - off score of 3338 , 3844 , 4473 and > 73 respectively . the questions were translated and back - translated to the native language , hindi , for standardization . the ind - vfq33 questionnaire across the three domains was administered to the subjects , by a single investigator ( va ) in the native language . the evaluation included ophthalmological work - up including visual acuity assessment , slit lamp biomicroscopy , measurement of iop , optic disc assessment and repeat visual field testing using the same algorithm . qol assessment was repeated using ind - vfq33 questionnaire , this being administered by the same investigator ( va ) in same language as done at the initial visit . the responses were entered into microsoft excel 2007 data sheet and statistical analysis was done using stata 11 19852011 statacorp lp ( stata press , texas , usa ) . the mean qol scores of glaucoma patients obtained were compared with that of controls using the unpaired t - test . multiple linear regression was used to assess significant factors affecting the qol at baseline and 3 months after treatment . factors like age , sex , visual acuity in the better eye , iop in the better eye , glaucoma severity and number of medications used were included as these may affect the qol of the patient . correlation values between visual acuity in the better eye , presenting iop , glaucoma severity and total qol score were obtained at baseline and at 3 months . the ind vfq33 is a 33-item questionnaire comprising of 33 items in three domains ( annexure ) . the general functioning elicited items related to distance vision , near vision , ambulation , night vision , dark adaptation , color vision , depth perception . the psychosocial impact domain related to the feelings of the patient related to low vision , e.g. , whether the subject feared going out at night , was he / she a burden on their family or fear of losing the remaining vision . finally , visual symptoms domain described most common visual symptoms like glare , discomfort , and blurring . general functioning ( domain 1 ) had 21 items ( q1-q21 ) , a range of response varied from 1 to 5 giving a total range for domain 1 ( 21105 ) . psychosocial impact ( domain 2 ) and visual symptoms ( domain 3 ) had 5 items ( q22-q26 ) and 7 items ( q27-q33 ) , respectively . domain 2 and domain 3 had 14 as the range of response with a total score of responses varying from 5 to 20 in psychosocial impact and 128 in visual symptoms domain . the summary scores from each domain were added to give a total qol score with a minimum score of 33 and maximum 153 . the higher the score , the worse the qol . the mean total qol score of controls and glaucoma patients at each visit was divided into quartiles viz . no difficulty ( < 25% ) , mild difficulty ( 25% 50% ) , moderate difficulty ( > 5075% ) and severe difficulty ( > 75% ) with cut - off score of 3338 , 3844 , 4473 and > 73 respectively . the questions were translated and back - translated to the native language , hindi , for standardization . the ind - vfq33 questionnaire across the three domains was administered to the subjects , by a single investigator ( va ) in the native language . patients were reassessed at 3 months following the start of the ocular hypotensive therapy . the evaluation included ophthalmological work - up including visual acuity assessment , slit lamp biomicroscopy , measurement of iop , optic disc assessment and repeat visual field testing using the same algorithm . qol assessment was repeated using ind - vfq33 questionnaire , this being administered by the same investigator ( va ) in same language as done at the initial visit . the responses were entered into microsoft excel 2007 data sheet and statistical analysis was done using stata 11 19852011 statacorp lp ( stata press , texas , usa ) . the mean qol scores of glaucoma patients obtained were compared with that of controls using the unpaired t - test . multiple linear regression was used to assess significant factors affecting the qol at baseline and 3 months after treatment . factors like age , sex , visual acuity in the better eye , iop in the better eye , glaucoma severity and number of medications used were included as these may affect the qol of the patient . correlation values between visual acuity in the better eye , presenting iop , glaucoma severity and total qol score were obtained at baseline and at 3 months . the glaucoma subjects and the control population were well matched for age , gender and literacy rates ( p = 0.71 , 0.91 and 0.18 respectively ) . better eye logmar visual acuity was 0.35 0.25 and 0.08 0.11 in glaucoma patients and controls respectively ( p < 0.001 ) . glaucoma subjects had significantly higher baseline iop in the better eye than the control population ( 25.4 6.6 vs. 11.6 2.1 mm of hg respectively , p < 0.001 ) . demographic characteristics of glaucoma patients and controls a comparison of ind - vfq33 total and domain wise scores is provided in table 2 . there was a significant difference between the two groups with respect to the mean total qol scores , general functioning domain , psychosocial impact and visual symptoms ( p < 0.001 ) . as shown in table 3 , the total mean score increased from 74.8 to 78.3 ( p < 0.001 ) on repeating the assessment 3 months after initiating the anti - glaucoma therapy suggesting worsening of qol . comparison of baseline qol scores in glaucoma patients and controls qol scores of glaucoma patients at baseline and 3 months multiple linear regression analysis was used to assess the effect of various factors on the qol as assessed with the ind - vfq33 questionnaire [ table 4 ] . better eye visual acuity was found to have a significant contribution to the qol scores , both at baseline and after 3 months of starting ocular hypotensive therapy ( p < 0.001 and < 0.05 respectively ) . it was also noted that the use of more than two ocular hypotensive medications was significantly related to poor qol at 3 months assessment ( p < 0.05 ) . multiple regression analysis showing the correlation of factors and qol among glaucoma subjects table 5 gives a list of items and response scores that were significantly different between the glaucoma and control subjects . the general functioning domain showed that most of the glaucoma patients had significant difficulty in ambulation , night vision , recognition , and dark adaptation as compared to controls . most glaucoma patients were frightened to go out at night and were worried that they may lose their remaining vision . problems of glare and low vision were also significantly higher in glaucoma patients than controls . a comparison of commonly reported problems in glaucoma patients and their statistical significance as compared to control subjects table 6 elaborates the patient parameters and qol scores across the primary open - angle glaucoma ( poag ) and primary angle closure glaucoma ( pacg ) population as included in the study . these groups differed significantly in the visual acuity at baseline and at 3 months , being worse in the pacg population ( p < 0.001 ) . the mean iop and mean glaucoma severity as seen by the visual field mean deviation scores were comparable across the two groups . pacg patients had worse qol scores than the poag population both at baseline and at 3 months after initiating ocular hypotensive medications ( p = 0.12 and 0.09 respectively ) , however , the difference did not reach statistical significance . this is the first study that evaluates the vision related qol in newly diagnosed glaucoma patients using a questionnaire developed and validated specifically for the population of the indian subcontinent . have earlier validated this questionnaire for vision related qol in 273 cataract patients in southern parts of india . they noted that patients with severe visual impairment and blindness reported significantly worse vision - specific mobility and activity limitation ( mean change 18.82 , p = 0.007 and 29.48 , p < 0.001 respectively ) compared to those with no visual impairment . nelson et al . have developed a glaucoma specific gql-15 scale , and defined the vision related problems perceived by glaucoma patients , e.g. , peripheral field , color vision , glare , dark adaptation , which are well covered in the ind - vfq33 questionnaire . this study shows that subjects with glaucoma had worse qol as compared to control population . the fact that this further worsened after initiation of medical therapy has some pertinent implications . this highlights that the diagnosis of glaucoma , a chronic sight - threatening condition that may require life - long therapy , may have a significant psychological impact on a patient . this should be identified , acknowledged and managed by appropriate disease - related education and counseling . our results are similar to those reported by nelson et al . where they have noted a statistically significant decrease in performance - related qol between normal subjects and all groups of glaucoma patients . in another study , goldberg et a1 . also noted that patients with glaucoma had significantly poor qol as compared to subjects without glaucoma . we noted that in patients with worse visual acuity and those who had to be started on more than two medications , qol further worsened after initiation of medical therapy . this in turn highlights the importance of educating the patients about the nature of the disease and ensuring drug compliance despite a perceived deterioration in symptoms after starting antiglaucoma medications . a comparison between poag and pacg subjects suggested a possible worse qol in the latter . a number of studies have elaborated on the significant problems encountered by subjects with glaucoma . reported that activities involving glare , dark adaptation , central and near vision , peripheral vision , and outdoor mobility were most problematic for patients with glaucoma . in another study , mckean - cowdin et al . noted that persons with visual field loss had the greatest difficulty with driving activities , dependency , mental health , distance vision , and peripheral vision wu et al . reported that the presence of open - angle glaucoma was significantly associated with lower scores for distance activities , mental health , and color and peripheral vision . showed that difficulty with bright lights , and with light and dark adaptation ; were the most frequently reported symptoms related to visual function in glaucoma patients . these findings are comparable to the results obtained in our study whereby glaucoma subjects were noted to have significant problems in activities which involved near and distance vision , night vision , ambulation , dark adaptation , color vision and glare . both worse eye and better eye visual acuity have been independently associated with poor qol . we noted that the decrease in better eye visual acuity was associated with worse qol at baseline and at 3 months . they also noted that qol had a significant correlation with better eye visual fields and visual acuity varied from 0.07 to 0.18 , however that the strength of correlation was weaker as compared to our results . van gestel et al . found a significant relationship between qol and iop in the better eye ( p < 0.001 ) . have published that both visual field index and visual acuity have a linear correlation with glaucoma - related qol . however , to assess the qol in patients with primary adult - onset glaucoma , all patients with secondary glaucoma were excluded . also , the exclusion of patients with cataract attempted to remove the confounding of the results obtained . second , the effects of economic factors , which are especially important for people residing in developing countries , were not included in the questionnaire . nonetheless , this study shows the important implication of presence of glaucoma , suggesting that newly diagnosed patients may have manifested symptoms of the disease , and initiation of medical therapy may be associated with further worsening of qol . thus , eye care providers should take every opportunity to educate patients about the nature of disease . they should be encouraged to continue with therapy despite no apparent benefits or even worsening of their qol at the outset .

purpose : to evaluate the impact of initial topical medical therapy on newly diagnosed glaucoma patients using the indian vision function questionnaire ( ind - vfq33).patients and methods : the ind - vfq33 was used to evaluate the quality of life ( qol ) in 62 newly diagnosed patients with moderate to severe primary glaucoma and 60 healthy controls . ind - vfq33 is a 33 item qol assessment tool with three domains : general functioning , psychosocial impact and visual symptoms . the glaucoma patients were started on medical therapy and the qol assessment was repeated after 3 months.results:glaucoma patients ( mean age : 55.6 9.6 years , range 4077 years ) and controls ( mean age : 54.9 6.7 years , 4273 years ) were matched with respect to age ( p = 0.72 ) , gender ( p = 0.91 ) and literacy ( p = 0.18 ) . glaucoma patients had significantly worse qol as compared to controls at baseline across all the three domains ( p < 0.001 ) . 3 months after initiation of treatment , the overall qol life significantly worsened from baseline with a decrease in general functioning ( p < 0.001 ) and psychosocial impact ( p = 0.041 ) . visual acuity in better eye significantly co - related to poor qol at baseline ( p < 0.001 ) and at 3 months ( p = 0.04 ) . in addition , the use of > 2 topical medications significantly co - related to poor qol at 3 months ( p = 0.01).conclusions : evaluation using the ind - vfq33 revealed that newly diagnosed glaucoma patients have a significant worsening of qol after initiation of topical ocular hypotensive therapy . this should be an important consideration when educating patients about the disease and its therapy .

Patients and Methods Quality of life assessment Follow-up visit Statistical analysis Results Discussion

cyclosporine a has improved allograft survival and the quality of life for solid - organ transplant recipients . its effectiveness in transplantation by suppression of the immune system has led to its use in treating autoimmune diseases . csa inhibits the immune system by binding to cyclophilin , this complex then inhibits calcineurin , which in turn inhibits the translocation of the nuclear factor of activated t cells ( nfat ) and subsequent gene transcription . calcineurin inhibitors ( cni ) can cause nephrotoxicity involving acute renal vasoconstriction progressing on to glomerulosclerosis , tubulointerstitial fibrosis , and renal failure . due to cni - induced nephrotoxicity , the use of the immunosuppressive agent sirolimus ( srl ) in transplantations is becoming more widespread . srl has a different mechanism of immunosuppression compared to cnis , and a lesser degree of nephrotoxicity is observed with srl compared to that observed with the calcineurin inhibitors [ 4 , 5 ] . when administered with a cni , srl has been suggested to have a protective role when administered in conjunction with csa [ 6 , 7 ] . the rapamune us study group conducted a large multicentre clinical trial in which the efficacy of srl compared to azathioprine for reducing acute renal allograft rejection was investigated . the use of srl reduced occurrence and the severity of biopsy - proven acute rejection episodes . however , there have also been studies indicating enhanced nephrotoxicity when srl and csa are used in combination [ 9 , 10 ] . in another study , the authors showed that a combination of srl and csa significantly potentiated the nephrotoxic actions of csa by augmenting transforming growth factor ( tgf- ) . tgf- has been implicated as a major factor in the development of chronic cni toxicity . increased tgf- levels have been observed in renal cells exposed to csa , in animal models of csa toxicity and in patients with cni nephropathy [ 1215 ] ; however , the nephrotoxicity caused by csa remains to be fully elucidated . in this study , our hypothesis was to determine whether csa or srl had direct detrimental effects on the glomerulus and identify the possible mechanisms involved , using glomerular mesangial cells . human mesangial cells ( hmcs ) are key cells of the glomerulus and have an important role in regulating glomerular structure and function and have the potential to contribute to glomerulosclerosis by secreting profibrotic mediators , which can alter extracellular matrix ( ecm ) balance and disrupt renal function . this may be an important mechanism in renal disease progression and the upstream signalling pathways involved in csa - induced renal dysfunction are not well characterised and warrants further investigation . one intracellular pathway that may potentially be involved in immunosuppressive - induced renal damage is that of the mitogen - activated protein kinase ( mapk ) family , which has been implicated in tgf--induced cytotoxicity . the analysis of the differential activation of this pathway may provide a novel insight into the mechanisms of nephrotoxicity caused by csa . the hmcs were grown in rpmi 1640 containing 5% fcs , penicillin , streptomycin , and l - glutamine and maintained at 37c in a humidified atmosphere containing 95% air , 5% co2 . cells used in the inhibitor studies were pretreated for 1 hour with uo126 , prior to incubation with each drug treatment . mesangial cell viability was assessed using the resazurin conversion ( sigma - aldrich , 7017 ) cell viability assay . the viability of the cells was expressed as a percentage of the absorbance recorded for control cells . total rna was isolated using the trizol method from hmcs , according to the manufacturer 's protocol ( sigma - aldrich , t9424 ) . 1 g of total rna was used to synthesis cdna . a real - time pcr taqman assay was used to quantify the relative expression levels of genes of interest and has been described previously . briefly , cdna was amplified on the abi 7900ht sequence detection system at default thermal cycling conditions : 2 min at 50c , 10 min at 95c for enzyme activation , and then 40 cycles of 15 sec at 95c for denaturation and 1 min at 60c for annealing and extension . were used for all genes of interest , tgf- ( hs99999918_m1 ) , ctgf ( hs00170014_m1 ) , and mmp-9 ( hs00234579_m1 ) . the ribosomal 18s gene was used as an endogenous control for normalisation of the target genes . a negative control containing all reaction components except for superscript for each set of samples was used . a tgf-1 elisa was used to determine the effect csa had on secreted tgf-1 protein levels in the media of hmcs . the specificity and sensitivity of the assay was assessed using 5 ng of tgf-1 as a positive control and sterile water as a negative control . transfection reagent - dna complex was prepared by adding serum - free medium to a sterile eppendorf tube . fugene ( roche ) reagent was added directly to the tube and then 1 g of tgf- smad responsive ( caga ) luciferase reporter dna plasmid ( a gift from dr . roel goldschmeding ) and 1 g of control plasmid ( renilla ) ( promega ) . for multiple - well following transfection , cells were treated with each immunosuppressive agent for the required time period . cells were lysed using passive lysis buffer ( promega ) and put into fresh tubes . the luminometer was programmed to perform a 2-second premeasurement delay followed by a 10-second measurement . equal volumes of cell lysate and luciferase reagent were added together and the luminescence reading recorded . stop and glo reagent was added to halt the reaction and another reading performed . control lysates were made from untransfected cells to determine background luminescence levels and a positive control of cells treated with 5 ng tgf- was used . total protein was isolated from hmcs using the ripa buffer method ( sigma - alridch , r0278 ) according to the manufacturer 's protocol . expression levels of renal proteins following csa treatment was determined by western blot and has been described previously [ 15 , 20 , 21 ] . proteins of interest were detected using the following antibodies according to the manufacturer 's protocol ( rabbit anti - erk 1/2 , cell signalling technology , 9211s and 9211 ) . data was analysed by one - way analysis of variance ( anova ) , and multiple comparisons between control and treatment groups were made using the bonferroni posttest . the following scheme was used throughout the work ; * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . microscopic examination highlighted that treatment with csa or srl alone for 24 hours had no significant effect on hmc morphology ( figure 1(a ) ) . however , 24-hour treatment with csa / srl combination did cause alterations in hmc morphology ( figure 1(a ) ) . an elongation of normal hmc shape accompanied with gaps in the cell monolayer and cell death ( indicated by round floating cells ) was observed . treatment for 24 hour with csa or srl alone had no significant effect on hmc viability . treatment with csa / srl drastically reduced hmc viability ( 100 versus 54 3.9 , p < 0.05 ) . the concentrations of csa and srl used in this study were chosen following dose response studies , and it approximates to concentrations used in vivo and reflect concentrations in the kidney . treatment with csa for 24 hours caused a significant increase in tgf-1 secretion ( 843.1 7.1 versus 1089.5 26.1 pg / ml ; p < 0.05 ) as demonstrated by elisa ( figure 1(b ) ) . however , cotreatment of csa / srl caused the most significant rise in tgf-1 secretion ( 843.1 7.1 versus 1247.4 10.4 pg / ml ; p the increase in tgf-1 secretion observed with csa / srl was significantly greater than the increase observed with csa alone ( 1089.5 26.1 versus 1247.4 10.4 pg / ml ; p < 0.05 ) . to further examine the role of tgf- , we decided to investigate the effects of csa , srl , and csa / srl cotreatment on a smad - responsive luciferase construct . csa treatment caused a significant increase in smad activation ( 100 versus 156.9 1.7 luciferase units ; p < 0.05 ) . srl administration did not significantly alter smad activation ( 100 versus 123.5 4.3 luciferase units ) . treatment with csa / srl cotreatment caused the greatest increase in smad activation ( 100 versus 210.1 15.9 luciferase units ; p < 0.01 ) . the increase in smad activation in the presence of csa / srl cotreatment was significantly greater than with csa alone ( 156.9 1.7 versus 210.1 15.9 luciferase units ; p < 0.01 ) ( figure 1(c ) ) . the observation of increased smad signalling prompted an investigation into a downstream mediator of tgf- , connective tissue growth factor ( ctgf ) . treatment for 24 hours with csa showed a trend towards an increase in ctgf gene expression , which was not statistically significant . however , treatment with csa / srl cotreatment caused a significant increase in ctgf gene expression ( 1 versus 2.0 0.02 ; p < 0.01 ) ( figure 2(a ) ) . csa treatment for 24 hours caused a significant decrease in matrix metalloproteinase 9 ( mmp-9 ) gene expression ( 1.0 versus 0.18 0.15 ; p < 0.05 ) . csa / srl cotreatment also caused a significant decrease in mmp-9 gene expression ( 1 versus 0.37 0.2 ; p < 0.05 , figure 2(b ) ) . in order to determine the mechanism of csa / srl co - treatment - induced alterations , we investigated the effects of csa , srl , and csa / srl on erk 1/2 activation . csa significantly increased erk 1/2 phosphorylation after 15 , 30 , and 60 minutes administration ( figure 3(a ) ) . srl also significantly increased erk 1/2 phosphorylation after 15 and 30 and 60 minutes treatment ( figure 3(b ) ) . csa / srl co - treatment caused a synergistic increase in erk 1/2 phosphorylation at 15 , 30 , and 60 minutes . however , the combination of csa / srl co - treatment also significantly increased erk 1/2 phosphorylation at 24 and 48 hours , unlike the csa and srl individual treatments ( figure 3(c ) ) . the addition of uo126 prevented the csa , srl , and csa / srl co - treatment - induced stimulation of erk 1/2 ( figure 4 ) . total levels of erk 1/2 protein were unaltered following csa , srl , or csa / srl combination in the presence or absence of uo126 treatment . it was upon the notable activation of erk 1/2 phosphorylation that the effect of 24-hour csa / srl treatment in the presence of the erk 1/2 inhibitor uo126 was examined ( figure 5 ) . erk 1/2 inhibition appeared to partially ameliorate the csa / srl co - treatment - induced morphological alterations in hmcs . the csa / srl - induced reduction in hmc viability was prevented to some extent by erk inhibition ( 54 3.9 versus 88 3.5 , p < 0.001 ) . the addition of the erk inhibitor alone caused no effect on hmc viability or morphology . inhibition of erk 1/2 phosphorylation prevented the csa alone and csa / srl co - treatment - induced increases in tgf- secretion ( figure 4 ) . ( csa + uo126 , 518 23.5 versus 1089 26.1 , csa , p < 0.001 ) . ( csa / srl + uo126 , 424 54.2 versus 1247 10.4 , csa / srl , p < 0.001 ) . erk inhibition also dramatically reduced the csa / srl - induced increase in ctgf gene expression to below control levels ( csa / srl , 1.7 0.2 versus 0.6 0.14 , csa / srl + uo126 ) . erk inhibition also prevented the previously observed csa / srl co - treatment - induced decrease in mmp-9 gene expression ( 0.37 0.25 versus 1.6 0.2 ; p < 0.001 ) ( figure 4 ) . erk inhibition also restored the csa- and srl - induced decreases in mmp-9 and restored mmp-9 values to control levels . the results presented in this body of work demonstrated that the combination treatment of csa and srl did not result in an attenuation of the cni - associated changes in hmcs but in fact resulted in synergistic nephrotoxic - like effects . it appeared that the primary causative factor for the csa / srl - induced mesangial cell dysfunction was a significant dual increase in tgf- and ctgf expression . we also observed enhanced activation of the erk 1/2 mapk pathway , the tgf- signalling pathway , and alteration of ecm regulators . altered hmc morphology and viability gave the first indication that csa and srl combination treatment was exerting a detrimental effect when administered to hmcs in the present study . these initial findings of enhanced toxicity were surprising as it had been previously reported that srl had a protective role and could reduce the toxicity observed with cni administration [ 22 , 23 ] . however , more recently , experimental evidence has emerged suggesting that a combination of csa and srl might not be protective . in a rat model , kidney function and morphology were assessed following short - term combination therapy with csa , and srl . striped fibrosis and glomerular filtration rate ( gfr ) were significantly worse in rats receiving csa and srl combination according to the study by nielsen et al . . we observed that the secretion of tgf- was significantly increased following immunosuppressive drug treatment in the present model . tgf- is a major factor involved in csa - induced renal fibrosis and renal disease . tgf- has been shown to be upregulated in a number of in vitro and in vivo experimental models following csa treatment and in patients undergoing csa therapy [ 14 , 15 , 25 ] . increased tgf- may have contributed to the adverse effects observed in the present study . the lack of an increase in tgf- as observed with srl alone in the current study may help to explain the reduced nephrotoxic side effects associated with srl . it is accepted now that altered pharmacokinetics have a role in contributing to the observed toxicity with a combination of srl and csa . an in vitro study in human renal epithelial cells demonstrated that srl prolonged the intracellular accumulation of csa when given in combination . the authors showed that srl inhibited p - glycoprotein - mediated efflux contributing to csa nephrotoxicity . however , the reasons for the augmented nephrotoxicity resulting from a combination of srl and csa still remain to be fully defined , with some studies attributing the effect to pharmacokinetics and others to hyperglycaemia [ 10 , 26 , 27 ] . another known contributor to csa nephrotoxicity is tgf-. in the present hmc model , srl had a synergistic effect on tgf- secretion when coadministered with csa . however , similar increases in tgf- were also reported in a study on csa and srl combination therapy by shihab et al . . in that study , rats were given doses of csa alone , srl alone , or a combination of csa and srl . the authors observed a worsening in renal function in the group that were given csa and srl in combination compared to csa and srl alone . the csa / srl group also exhibited tubular injury , interstitial fibrosis , and arteriolopathy as indicated by histological analysis . elevated tgf- protein levels were also observed in the csa and srl co - treatment groups , and the levels were significantly higher than with csa or srl alone . to our knowledge , however , this is the first time that this effect has been observed in hmcs . ctgf was upregulated in the present hmc model following csa / srl co - treatment . ctgf has been found to be upregulated in many inflammatory glomerular diseases and in patient biopsies with numerous different conditions including glomerulonephritis and focal segmental glomerulosclerosis . it appeared that a novel dual elevation of tgf- and ctgf in the hmcs following csa / srl co - treatment contributed to the enhanced csa / srl - induced mesangial cell alterations . this dual elevation of tgf- and ctgf was not observed following treatment with csa or srl alone . in the current study , csa the observed reduction in mmp-9 in the present mesangial cell model may have facilitated ecm accumulation by preventing ecm degradation . it is known that ecm regulators are extremely context specific and chronologically variable . in models of chronic kidney disease , decreased mmp-9 has been shown to aid disease progression . in a rat ischemia - reperfusion model , caron et al . observed that mmp-9 was significantly upregulated and may have contributed to glomerular injury . in another model , transgenic mice overexpressing renin developed hypertension - induced renal dysfunction . isolated glomeruli from these mice exhibited elevated tgf- accompanied with decreased mmp-9 gene expression . these alterations in hmcs following csa / srl treatment are at least in part due to enhanced signalling through the erk 1/2 pathway . previous studies in our laboratory have indicated that the mapk pathways are also activated in response to csa in madin darby canine kidney ( mdck ) epithelial cells [ 32 , 33 ] . a biphasic activation of erk 1/2 following csa / srl co - treatment was observed in the hmcs and may be the mechanism by which the synergistic nephrotoxic effect is exerted by the csa / srl co - treatment . this is further supported by the fact that erk 1/2 inhibition resulted in significant attenuation of this csa / srl - induced hmc dysfunction . considering the well - characterised roles of erk 1/2 signalling in cell survival and proliferation , our finding that enhanced erk 1/2 signalling is central to csa / srl cytotoxicity is interesting . this apoptosis was accompanied by activation of the erk 1/2 mapk pathway . pharmacological inhibition of erk 1/2 similarly , in cisplatin - induced cytotoxicity , erk 1/2 has been shown to play a central role . several mechanisms of erk 1/2-mediated cytotoxicity have been proposed including erk - dependent activation of caspases and induction of autophagy . importantly from the perspective of this study , in examples of erk - mediated cytotoxicity , erk activation is unusually prolonged ( up to 72 hours ) . therefore , the prolonged erk activation observed in this study , in the presence of csa / srl co - treatment , may be a key mechanistic difference compared to the two immunosuppressants in isolation . this suggests that the erk 1/2 pathway may play a major role in tgf- signalling . erk 1/2 also appeared to play a role in ctgf expression in this mesangial cell model as ctgf gene expression was attenuated by erk inhibition . these observations have been observed in other models of csa nephrotoxicity [ 39 , 40 ] . our proposed mechanism for the enhanced csa / srl nephrotoxicity is that csa / srl strongly activates erk 1/2 , which promotes tgf- cellular secretion . tgf- may also promote decreased ecm degradation via decreased mmp9 , which contributes to the observed mesangial cell dysfunction . these findings are important in determining future immunosuppression strategies for srl therapy in clinical organ transplantation . currently , there are two main strategies : de novo use of srl in combination with reduced amounts of csa or complete conversion from a cni - based protocol to srl in cases where well - recognized adverse effects of cnis ( such as impaired renal function ) are prevalent . however , there is much debate on this issue and longer - term studies in larger cohorts of patients are required to determine whether replacement of csa with srl provides any significant improvement in patient and graft survival . the results shown in this study would suggest that long - term use of srl in patients will have serious nephrotoxic effects . this work was supported by the health research board , science foundation ireland , enterprise ireland , and the programme for research in third level institutions administered by the higher education authority and by the eu 7th framework grant syskid , health - f2 - 2009 - 241544 . c. slattery is funded by a government of ireland research fellowship from the irish research council for science , engineering and technology . the results presented in this paper have not been published previously in whole or part , except in abstract form .

end stage renal disease ( esrd ) is an ever increasing problem worldwide . however the mechanisms underlying disease progression are not fully elucidated . this work addressed nephrotoxicity induced by the immunosuppressive agents ' cyclosporine a ( csa ) and sirolimus ( srl ) . nephrotoxicity is the major limiting factor in long term use of csa . srl causes less nephrotoxicity than csa . therefore investigations into the differential effects of these agents may identify potential mechanisms of nephrotoxicity and means to prevent esrd induced by therapeutic drugs . using elisa , western blotting , quantitative pcr and a reporter gene assay we detailed the differential effects of csa and srl in human renal mesangial cells . csa treatment increased profibrotic tgf-1 secretion in human mesangial cells whereas srl did not , indicating a role for tgf- in csa toxicity . however we observed a synergistic nephrotoxic effect when csa and srl were co - administered . these synergistic alterations may have been due to an increase in ctgf which was not evident when the immunosuppressive drugs were used alone . the csa / srl combination therapy significantly enhanced smad signalling and altered the extracellular matrix regulator matrix metalloproteinase 9 ( mmp-9 ) . inhibition of the erk 1/2 pathway , attenuated these csa / srl induced alterations indicating a potentially significant role for this pathway .

1. Introduction 2. Methods 3. Results 4. Discussion Funding Conflict of Interests

to identify the most probable asian parental groups of the malagasy , we adopted a two - stage approach : first , we identified the most likely proxy populations using a data set with wide geographical coverage but relatively low density of single nucleotide polymorphism ( snp ) , then followed by a higher density snp data set that gives increased statistical power . this allows us to reconstruct the admixture processes that led to the emergence of modern malagasy . the admixture profile of our data set ( 2,183 individuals from 61 populations genotyped for 40,272 snps ; supplementary figs . s2 and s3 , 2009 ) , shows that the malagasy genetic diversity is best described as a mixture of 68% african genomic components and 32% asian components , corresponding well with the results of previous studies ( capredon et al . while the african ancestry component in malagasy appears to be broadly similar to that still present today in south african bantu , the asian ancestry presents a more complex pattern . this complexity is the key reason why previous studies have been unable to point firmly to a unique asian source , making any subsequent anthropological inferences debatable ( pierron et al . this problem arose with a study of the maanyan population of borneo , whose language has long been identified as the closest to the malagasy language ( dahl 1951 ) , but who surprisingly exhibit no clear genetic connection to malagasy ( kusuma et al . , the higher genetic complexity of the asian ancestry component in malagasy likely reflects the fact that more than a single source population was involved in its formation . affinities to the malagasy asian components are found at high frequency across several island southeast asian groups , but notably in malay , a dominant group of ancient seafaring traders ( first millennium ce ) , and admixed groups from borneo ( i.e. , banjar , ngaju , south kalimantan dayak , lebbo , murut , dusun , and bidayuh ; supplementary fig . the connection between malagasy , and the borneo and malay populations , is supported by f3-statistics ( z - scores<2 ; supplementary table s2 , supplementary material online ) ( patterson et al . 2012 ) and treemix analyses ( 35% of malay / borneo gene flow to malagasy ; supplementary fig . however , to more specifically identify the asian ancestry of the malagasy genome , we performed a local ancestry analysis with pcadmix ( brisbin et al . 2012 ) using two proxy parental meta - populations comprising 100 individuals with african ancestry ( randomly selected from yoruba , south african bantu , kenyan luhya , and somali groups ) and asian ancestry ( randomly selected from chinese , philippine igorot , bornean maanyan , and malay groups ) . masking the haplotypes inferred to derive from africa , we performed an ancestry - specific principal components analysis ( pca ) ( patterson et al . both show that the asian genomic components of malagasy cluster tightly with southeast borneo groups ( banjar , south kalimantan dayak , ngaju , and maanyan ) ( 1,664 snps ; fig . this connection is supported by the highest f 3-statistics and the lowest fst genetic distances also being observed between asian ancestry of the malagasy and these same southeast borneo groups ( f3 > 0.12 ; fst < 0.02 ; fig . 1b ; supplementary tables s3 and s4 , supplementary material online ) . fig . 1localization of the asian ancestry of malagasy by ( a ) a treemix dendrogram , ( b ) fst distances and f3 statistics , all based on the asian - snp data set , and ( c ) a shared identity - by - descent ( ibd ) analysis based on haplotypes inferred from the high density of snp data set . ( a ) the treemix dendrogram was inferred imposing no a priori assumptions of migration , displaying only the tree topology . ( b ) values of the f3 ( asian - snp vezo , x ; yoruba ) statistics are represented by dots with standard error bars . the color of each dot corresponds to the fst distances between the asian ancestry of the vezo and each asian population using a gray - yellow - red color scale from the highest ( 0.196 ) to the lowest values ( 0.02 ) . ( c ) the cumulative shared ibd ( mb ) between pairs of malagasy : asian individuals were averaged to obtain one value of ibd sharing per asian population . the numbers 115 correspond to the populations presented on the treemix dendrogram with the addition of 16 which stands for brahmin indian . localization of the asian ancestry of malagasy by ( a ) a treemix dendrogram , ( b ) fst distances and f3 statistics , all based on the asian - snp data set , and ( c ) a shared identity - by - descent ( ibd ) analysis based on haplotypes inferred from the high density of snp data set . ( a ) the treemix dendrogram was inferred imposing no a priori assumptions of migration , displaying only the tree topology . ( b ) values of the f3 ( asian - snp vezo , x ; yoruba ) statistics are represented by dots with standard error bars . the color of each dot corresponds to the fst distances between the asian ancestry of the vezo and each asian population using a gray - yellow - red color scale from the highest ( 0.196 ) to the lowest values ( 0.02 ) . ( c ) the cumulative shared ibd ( mb ) between pairs of malagasy : asian individuals were averaged to obtain one value of ibd sharing per asian population . the numbers 115 correspond to the populations presented on the treemix dendrogram with the addition of 16 which stands for brahmin indian . to explore this connection in more detail , we turned to the high density snp data set ( 551 individuals from 24 populations genotyped for 374,189 snps ; supplementary table s1 , supplementary material online ) . we confirmed the earlier result that malagasy have the highest values of cumulative shared identity - by - descent fragments with southeast borneo populations ( fig . s6 , supplementary material online ) . to expand on this , however , we inferred the population sources of the malagasy , their relative ratios and the dates of potential admixture events with globetrotter ( hellenthal et al . 2014 ) , defining each population in our data set as a donor / surrogate group and the malagasy as the recipient , using the haplotype painting data obtained with chromopainter ( lawson et al . the best fit outcome for the malagasy was obtained under a model of a single admixture event between two sources : the banjar representing 37% of modern malagasy and the south african bantu population representing the other 63% ( r=0.99 , p < 0.01 ; fig . 2 and supplementary table s5 , supplementary material online ) . the admixture event was dated to 675 years bp ( 95% ci : 625725 years bp , supplementary table s5 , supplementary material online ) , which is similar to the dates of admixture estimated by alder ( 550750 years bp ) using banjar population in combination with the south african bantu ( supplementary table s6 , supplementary material online ) ( loh et al . when each malagasy ethnic group is analyzed separately , similar parental populations , admixture proportions , and dates are obtained with the noticeable older estimated dates toward the east coast of madagascar ( supplementary table s5 , supplementary material online ) . 2scenario for the asian genetic ancestry in malagasy based on the best fit models inferred by globetrotter . the brown circle represents the malagasy ( bottom left ) , while the green circle represents the banjar ( right ) . red semicircles show the african ancestry ( south african bantu ) , whereas the other semicircles represent asian ancestry from malay ( blue ) , banjar ( green ) , and maanyan ( yellow ) . the arrows show migration events , with indicative routes , inferred in our analyses with dates of admixture in italic estimated by globetrotter . dates in bold correspond to dates of migration estimated from archaeological and historical data ( beaujard 2012a ) . scenario for the asian genetic ancestry in malagasy based on the best fit models inferred by globetrotter . the brown circle represents the malagasy ( bottom left ) , while the green circle represents the banjar ( right ) . red semicircles show the african ancestry ( south african bantu ) , whereas the other semicircles represent asian ancestry from malay ( blue ) , banjar ( green ) , and maanyan ( yellow ) . the arrows show migration events , with indicative routes , inferred in our analyses with dates of admixture in italic estimated by globetrotter . dates in bold correspond to dates of migration estimated from archaeological and historical data ( beaujard 2012a ) . crucially , these dates of genetic admixture , in agreement with a previous study ( pierron et al . 2014 ) , reflect the midpoint or end of noticeable admixture between groups of asian and african ancestry in madagascar , rather than the start of this contact . therefore , they could correspond to the end of the period of the main austronesian presence in madagascar that started around the first millennium ce ( dahl 1951 , 1991 ; dewar and wright 1993 ; adelaar 1995 ; cox et al . 2012 ; adelaar forthcoming ) . on the other hand , around 1100700 years bp , climatic changes in the south of africa forced bantu populations to move to more hospitable places ( huffman 2000 ) . this south bantu migration has previously been suggested as an explanation for the higher density of populations observed in the south of madagascar ( beaujard 2012a ) . as all of our sampled groups live in the south of madagascar , and considering that the estimated dates of admixture are more recent on the west coast ( supplementary tables s5 and s6 , supplementary material online ) , it is tempting to interpret our admixture date as marking the last significant bantu migration to madagascar , perhaps initiated by climatic changes in africa . these analyses clearly identify an austronesian - speaking population , the banjar in the southeast region of borneo , as the closest asian sources for modern malagasy . linguistic reconstruction of the proto - malagasy language indicated that it appears to be derived mainly from the southeast barito language spoken today by the maanyan ( dahl 1951 ) , a southeast borneo group . however , we have previously shown ( kusuma et al . 2016 ) , and reconfirm here , that in genetic analyses , the maanyan are only distantly related to the malagasy in terms of genetics . interestingly , the linguistic studies indicated a noticeable proportion of malay words in present - day malagasy languages ( adelaar 1989 , 2009b ) . we estimated the best fit scenario for the admixture process by modeling the current banjar diversity with globetrotter ( hellenthal et al . 2014 ) . the genetic diversity of the banjar best fits a model of a unique admixture event ( r=0.62 ; p < 0.01 ) between two major ancestries that can be traced back to malay ( 77% ) and maanyan ( 23% ) ( fig . 2 and supplementary table s5 , supplementary material online ) . we estimate the date of the last noticeable admixture approximately 425 years bp ( 95% ci : 275500 years bp ) . since the banjar originated from a maanyan - malay admixture , at a time preceding the supposed date of migration to madagascar ( i.e. , 1000 years bp ) , the ancestors of the banjar were presumably speaking a language close to that reconstructed for proto - malagasy ( adelaar forthcoming ) . although we can not fully exclude that the malay - maanyan admixture occurred in malagasy , prior to the bantu gene flow , the observed haplotypic structure is so similar to the ones observed in the banjar that it is more parsimonious to interpret this admixture to have happened first in borneo . this analysis reconciles both the linguistic and genetic data , strengthening our scenario placing the banjar as the main asian parental populations of the malagasy . their current genetic diversity appears to be the reflection of the historical relationship between madagascar , southeast borneo , and the malay . the maritime routes linking madagascar to borneo were particularly exploited during the rapid expansion of trading networks led by the hindu malay kingdoms , such as srivijaya ( 6th13th centuries ) ( ras 1968 ; beaujard 2012a ) . established on the islands of sumatra and java , the malay traded with far - distant regions , notably across east asia and reaching as far as east africa ( beaujard 2012a ) . their influence increased across all the southeast asian islands , notably in borneo where they established several trading posts , such as one in the city of banjarmasin in southeast borneo ( ras 1968 ; beaujard 2012a ) . as related in the only banjarese historical records available , the hikayat banjar ( tale of banjar ) ( ras 1968 ) , the main city of the banjar population was a major trading post in the former malay empires . this probably favored interactions with inland groups in borneo , such as the maanyan , but also with other populations such as the bajo sea nomads ( supplementary fig . s6 and table s5 , supplementary material online ) ( adelaar 2009a ; beaujard 2012a ; kusuma et al . the malay domination of trading networks collapsed during the 15th16th centuries , with the emergence of several sultanates and the arrival of europeans , which could correspond to the end of noticeable malay gene flow into the banjar population , as indicated by our estimated date of admixture between malay and maanyan around 425 years bp . our study provides strong support for a new scenario for the austronesian settlement of madagascar , reconciling cultural , linguistic , and genetic data , in which the banjar population played key roles in establishing the asian founder population of the malagasy . the malay trading networks during the first millennium ce triggered one of the earliest protoglobalization processes , bringing southeast asian populations to east africa ( beaujard 2012a ) . the banjar , currently living in southeast borneo , show the highest affinity to the main genetic ancestry component in malagasy and can therefore be suggested to be likely to have been the ethnic group that accompanied the malay in their maritime voyages to madagascar . this population with composite ethnic ancestry emerged from the long - standing presence of malay in borneo , creating an admixed community with local austronesian - speaking groups , such as the maanyan . before the probable date of migration ( around 1000 years bp ) , the ancestors of the current banjar would have contained both malay and maanyan genetic diversity , and probably linguistic inheritances from both ( adelaar forthcoming ) . although the exact maritime route(s ) of migration from borneo to madagascar are still an open question , our study identifies the flow of malay - maanyan genomic ancestries as carried by banjar ancestors as the source to malagasy . all experimental and analytical procedures are described in the supplementary method file , supplementary material online . this study was approved by the research ethics commission of the eijkman institute for molecular biology ( jakarta , indonesia ) .

malagasy genetic diversity results from an exceptional protoglobalization process that took place over a thousand years ago across the indian ocean . previous efforts to locate the asian origin of malagasy highlighted borneo broadly as a potential source , but so far no firm source populations were identified . here , we have generated genome - wide data from two southeast borneo populations , the banjar and the ngaju , together with published data from populations across the indian ocean region . we find strong support for an origin of the asian ancestry of malagasy among the banjar . this group emerged from the long - standing presence of a malay empire trading post in southeast borneo , which favored admixture between the malay and an autochthonous borneo group , the maanyan . reconciling genetic , historical , and linguistic data , we show that the banjar , in malay - led voyages , were the most probable asian source among the analyzed groups in the founding of the malagasy gene pool .

The Malagasy Asian Ancestry Derives from Southeast Borneo The Proto-Malagasy People Were a Malay-Maanyan Admixed Group Materials and Methods Supplementary Material

in the urban areas of developing countries such as turkey , biomass ( eg , wood , animal dung , crop residues ) is used as a source of energy.1,2 exposure to biomass smoke is the leading cause of copd , especially in developing countries.3 a half of copd deaths are due to biomass exposure , and 75% of these deaths occur in females.3,4 females are more exposed to biomass smoke than men in turkey because of traditional lifestyles in rural areas . carbon monoxide , nitrous oxide , sulfur oxide , formaldehyde , and polycyclic organic matter , including carcinogens such as benzopyrene , are all products of biomass smoke.5 these microparticulate products reach the peripheral airways and produce adverse effects on pulmonary functions.6 the primary aim of this study was to determine the difference of pulmonary functions between females who were exposed to biomass smoke and those who were not and the secondary aim was to determine the time course relationship with altered pulmonary function test ( pft ) results and define the importance of intensity of smoke on pulmonary functions , with the calculation of a new index ( cumulative exposure index [ cei ] ) , which has not been described in the literature before . there is a tradition in the village of kaizman ( a borough of kars located in the eastern part of turkey ) that females are responsible for the cooking of bread in their houses . people are exposed to heavy smoke due to the cooking conditions ( lack of chimney and poor ventilation ; figure 1 ) . girls start making bread at the age of 15 years , and the daily exposure to smoke is between 2 hours and 4 hours ; they usually cook 1 day / wk , ie , two to four times per month . they use organic wastes for burning fire , eg , dry animal dung ( manure ) , rather than wood or charcoal , as the fuel source ( figure 2 ) . our only inclusion criterion was screening the pulmonary functions in females who were exposed to biomass smoke . we had visits to the village and were able to screen 474 females who were exposed to biomass smoke . smoking is the leading cause of copd ; therefore , we eliminated females who were current or former smokers . cardiovascular diseases are included in the comorbidities of copd , and a volume overload due to heart failure or renal failure may affect pft results negatively . asthma is another important disease that results in altered pft results ; therefore , females who had history of allergy and asthma were excluded . due to its inflammatory process , respiratory tract infection may narrow the airways with secretions and may affect pft results , and hence those who received therapy due to upper or lower respiratory infections in the last 1 month were excluded . the final study group comprised 115 females who were purely exposed to biomass smoke ( table 1 ) . a control group was generated with 73 healthy individuals who lived in the same area and had never been exposed to biomass smoke . all the research procedures were approved by the local ethical committee of the public health directorship in kars , and all participants provided written consent for the study . a pft device ( spirolab iii ; mir , waukesha , wi , usa ) was used on each patient after being calibrated by the technician , and forced expiratory volume in 1 second ( fev1 ) , forced vital capacity ( fvc ) , and forced expiratory flow during the 25%75% portion of the fvc ( fef 2575 ) were recorded for both the study group and control group . pft results were grouped in accordance with the guidelines of the european respiratory society and american thoracic society.7 fef 2575 < 60% was accepted as small airway , fev1/fvc < 70% was accepted as obstructive , and fev1/fvc > 70% plus fvc < 80% was accepted as restrictive lung disease . after pfts were performed in the study group and control group , the differences between the pft results were evaluated . in addition , the age at which the participants started to cook and hours per day , weeks per month , and total years of cooking were questioned . these variables correlated with the pft results in the study group . the risk of duration in years for existence of pathologic pft results was calculated . in addition , we tried to formulate an index ( cei ) like cigarette pack year to provide data for intensity of biomass exposure . this index was defined by multiplying the duration of biomass exposure ( in years ) with the frequency of exposure ( hours per day , weeks per month ) and dividing the result by three . finally , the correlation between cei and pathologic pft results was defined . cei = hours per dayweeks per monthexposure duration in year3(1 ) statistical package for the social sciences 21.0 ( ibm corporation , armonk , ny , usa ) and medcalc statistical software ( medcalc software , ostend , belgium ) were used for statistical analysis . descriptive statistics ( frequency , percentage , mean [ min max ] ) were used to evaluate the study data . the independent sample t - test was used to compare parameters between the groups . a one - way analysis of variance test was used to compare the parameters between more than one group , and the bonferroni test was used to determine the group that showed significant difference . pearson s correlation analysis was used to evaluate the relationship between pft and independent variables ( age , body mass index , age of starting cooking and hours per day , weeks per month , and years spent cooking ) . in addition , linear regression analyses were performed to evaluate the correlation between independent variables and pft results . a receiver operating characteristic ( roc ) curve analysis was performed to determine cutoff levels for duration in years and cei for the existence of altered pft results ( small airway disease , obstruction , and restriction ) ; moreover , sensitivity and specificity were calculated based on the cutoff value . statistical package for the social sciences 21.0 ( ibm corporation , armonk , ny , usa ) and medcalc statistical software ( medcalc software , ostend , belgium ) were used for statistical analysis . descriptive statistics ( frequency , percentage , mean [ min max ] ) were used to evaluate the study data . the independent sample t - test was used to compare parameters between the groups . a one - way analysis of variance test was used to compare the parameters between more than one group , and the bonferroni test was used to determine the group that showed significant difference . pearson s correlation analysis was used to evaluate the relationship between pft and independent variables ( age , body mass index , age of starting cooking and hours per day , weeks per month , and years spent cooking ) . in addition , linear regression analyses were performed to evaluate the correlation between independent variables and pft results . a receiver operating characteristic ( roc ) curve analysis was performed to determine cutoff levels for duration in years and cei for the existence of altered pft results ( small airway disease , obstruction , and restriction ) ; moreover , sensitivity and specificity were calculated based on the cutoff value . a total of 188 females were evaluated in this study , of whom 115 had been exposed to biomass smoke and 73 had had no exposure to biomass smoke . the females who had been exposed to smoke were older than those in the control group , 33.47 years and 32.68 years , respectively . the study group and controls were grouped according to their pft results : small airway disease , obstruction , and restriction . the median fef 2575 value was 70.0% in the study group and 77.0% in controls ( p<0.001 ) . the median fev1/fvc value was 79.0% in the study group and 84.0% in controls ( p<0.001 ) . the median fev1 value was 78.0% in the study group and 80% in controls ( p=0.024 ) , and the median fvc value was 81.0% in the study group and 84.0% in controls ( p=0.036 ; table 2 and figure 3 ) . twenty - seven ( 23.8% ) females in the study group and four ( 5.5% ) in the control group had small airway disease . females who were exposed to biomass smoke had a higher probability of having small airway disease than those who were not ( =3.895 , p=0.038 ) . twenty - two ( 19.1% ) females in the study group and ten ( 13.7% ) in the control group had obstruction ( fev1/fvc < 70% ) . although the probability of having obstruction was higher in females who were exposed to biomass smoke , it was not statistically significant ( =0.933 , p=0.223 ) . twenty ( 17.3% ) females who were exposed to biomass smoke had restriction compared with ten ( 13% ) in the control group ( =0.982 , p=0.189 ; table 3 ) . we also evaluated correlations between pft results and some parameters such as age at starting to cook , how many hours per day and weeks per month spent cooking , and the duration of biomass exposure . the median values of the parameters for the patient group are shown in table 4 . in the study group , 27 ( 23.8% ) females had small airway disease and 22 ( 19% ) had obstructive airway disease . starting to make bread at younger age and more weeks and more years spent cooking were risk factors for the development of both small airway disease and obstructive airway disease , whereas hours per day spent cooking was not a risk factor ( table 5 ) . in the study group , when the parameters were evaluated in this group , it was observed that starting to cook at younger age , more hours per day , more weeks per month , and more years spent cooking were all risk factors for the development of restrictive lung disease ( table 5 ) . we also performed a correlation analysis between dependent ( fev1 , fev1/fvc , fvc ) and independent variables ( age at starting to cook , hours per day , weeks per month , duration in years ) . for fev1/fvc , the correlation analysis was statistically significant for duration of exposure to biomass smoke ; as the duration of biomass exposure increased , fev1/fvc was negatively affected . for fev1/fvc , conversely , with the exception of age of starting to cook , a negative correlation with all the independent variables for fvc was found ( table 6 ) . by using the roc curve analysis , we defined the duration for existence of small airway disease , obstruction , and restriction . the cutoff values were 16 years for small airway disease ( sensitivity : 100% , specificity : 76.9% ) , 17 years for obstructive lung disease ( sensitivity : 95.5% , specificity : 69.9% ) , and 17 years for restrictive lung disease ( sensitivity : 100% , specificity : 74.3% ; figure 4 ) . females who had been exposed to biomass smoke and had altered pft results had higher values of cei compared with females who had pft results with normal values ( table 7 and figure 5 ) . in addition , we calculated a cutoff value for pathologic pft results using the roc curve analysis . cei was 34.7 for the existence of small airway disease , 42.7 for obstruction , and 45.3 for restriction ( table 8 and figure 6 ) . this case control study has two major findings : first , females who are exposed to biomass smoke are at risk of developing altered pulmonary function ( both obstructive and restrictive lung disease ) , and second , the duration of exposure to biomass smoke is important for the probability of altered pulmonary function . in our study , both obstructive and restrictive lung diseases were observed among females who had been exposed to biomass smoke . chronic exposure to smoke may cause inflammatory reactions in the alveolar space and the bronchial wall.8 as expected , this was the reason for obstructive lung disease in our patients . in our study , we observed that as biomass exposure increased in quantity and intensity , the risk of appearance of copd increased . similar results were reported in the studies by ramrez - venegas et al9 and regalado et al.10 these authors reported that advanced stages of copd exist as the duration of biomass smoke increases . according to our data , females who are exposed to biomass smoke for > 17 years are at risk of developing copd . in the current literature , the risk of developing obstructive airway disease usually requires > 20 years of exposure.911 the females in our study were exposed to more concentrated smoke because of the poor conditions in the places in which they cooked ( figure 1 , no chimney and poor ventilation ) ; massive smoke exposure may be the reason for altered pft results of shorter duration . in addition to obstruction , we also observed restrictive pft results ( fev1/fvc > 70 , fvc < 80% ) in 22 ( 19.1% ) females in the study group . in the current literature , a few studies mention a restrictive pattern in biomass exposure : kara et al12 and arslan et al13 defined restrictive images ( opacities , fibrotic bands ) in computed tomography ( ct ) scans of patients who were exposed to biomass smoke . septal enlargements , goblet cell metaplasia , glandular hyperplasia , and fibrosis can be observed histopathologically when the source of energy is something other than wood.14 in our study , the restrictive results can be explained by the source of energy used by the females ( females - burned animal waste [ manure ] ; figure 2 ) . burning organic material such as manure may cause some kind of chemical reactions , which may be responsible for restrictive lung disease . although some studies have defined a correlation between restrictive lung disease and biomass exposure , none have mentioned the duration of exposure for the risk of developing restrictive lung disease.12,13 according to our data , females who are exposed to biomass smoke for > 17 years are at risk of developing restrictive lung disease . twenty - seven ( 23.8% ) females had small airway disease . in our study , small airway disease was observed among females who started to cook at younger ages , and the duration of exposure for the risk of developing small airway disease was 16 years . they claimed that exposure to biomass smoke at younger ages was not a risk factor for small airway disease . particles < 10 m in diameter , particularly those < 2.5 m , can penetrate deep into the lungs , especially into the peripheral airways.5,8 with the cei calculation , we tried to define the importance of the intensity of biomass smoke . in this study , we did not accept exposure to biomass smoke to be like cigarette packet years . cigarette smokers smoke continuously , but the people in our study were exposed to biomass smoke for only a few hours per day , one day per week , or nearly every week . prez - padilla et al16 and ekici at al17 described a calculation by multiplying hours per day and total years ; they defined that higher values from this calculation provided for greater probability of altered pft results . the main difference of their study from ours was that the number of days per week that people were exposed to biomass smoke was not added to their calculation . if it were possible to perform pulmonary imaging studies , particularly ct of the lungs , it would be possible to differentiate chronic bronchitis from emphysema and show reticulonodular appearance and fibrosis that could be suggestive for restrictive lung disease . if it were possible to perform pulmonary imaging studies , particularly ct of the lungs , it would be possible to differentiate chronic bronchitis from emphysema and show reticulonodular appearance and fibrosis that could be suggestive for restrictive lung disease . biomass exposure is a very important public health problem among females , especially in developing countries . the risk of developing problems in lung functions begins after exposure to smoke for > 15 years . precautions must be taken for populations living in these kinds of rural areas , and people must be educated about the adverse effects of biomass smoke .

backgroundbiomass smoke is the leading cause of copd in developing countries such as turkey . in rural areas of turkey , females are more exposed to biomass smoke because of traditional lifestyles.aimthe aim of this study was to determine the adverse effects of biomass smoke on pulmonary functions and define the relationship between duration in years and an index ( cumulative exposure index ) with altered pulmonary function test results.participants and methodsa total of 115 females who lived in the village of kaizman ( a borough of kars located in the eastern part of turkey ) and were exposed to biomass smoke were included in the study . the control group was generated with 73 individuals living in the same area who were never exposed to biomass smoke.resultstwenty-seven ( 23.8% ) females in the study group and four ( 5.5% ) in the control group had small airway disease ( p=0.038 ) . twenty - two ( 19.1% ) females in the study group and ten ( 13.7% ) in the control group had obstruction ( p=0.223 ) . twenty ( 17.3% ) females in the study group who were exposed to biomass smoke had restriction compared with ten ( 13% ) in the control group ( p=0.189 ) . the duration needed for the existence of small airway disease was 16 years , for obstructive airway disease was 17 years , and for restrictive airway disease was 17 years . the intensity of biomass smoke was defined in terms of cumulative exposure index ; it was calculated by multiplying hours per day , weeks per month , and total years of smoke exposure and dividing the result by three.conclusionexposure to biomass smoke is a serious public health problem , especially in rural areas of developing countries , because of its negative effects on pulmonary functions . as the duration and the intensity of exposure increase , the probability of having altered pulmonary function test results is higher .

Introduction Participants and methods Statistical analysis Results Discussion Study limitations Conclusion

hepatitis b virus infection ( hbv ) is an inflammatory disease of liver due to double stranded virus of the hepadnaviridae family . hepatitis b infection possesses a major health concern and is the most common blood borne viral infection , placing health care workers and medical and dental professionals at higher occupational risk . the other mostly common communicable diseases include human immunodeficiency virus ( hiv ) and hepatitis c virus ( hcv ) . the possible forms of transmission of hepatitis virus include unprotected sexual contact , blood transfusion , reuse of contaminated needles , and vertical transmission from mother to child during pregnancy . in dental setting the most common mode of transmission is from percutaneous exposure ( needle stick injuries ) and also from contact with blood or saliva of infected patients . the possibility of hbv transmission from exposure to saliva and gingival crevicular fluid has been confirmed , which makes the oral health care professionals more vulnerable for hepatitis infection . nearly two billion people in the world have been infected by hbv and there are nearly 350 million people who are chronic carriers . hepatitis b and hepatitis c infection can become persistent and show the way to cirrhosis of liver and even liver cancer . it is mainly acquired in the course of contaminated needles or tainted blood products and infection patterns are diffuse . among the professionals , dentists are placed in high risk group as actual sufferers and carriers with a grim picture . it is of prime importance for all dental schools , medical staff , and dental staff to conduct talks and create awareness about hepatitis b infection . india has the intermediate endemicity of hepatitis b virus with surface antigen ( hbsag ) prevalence between 2% and 10% among the population studied . in india about four percent of the population was estimated to be hbv carriers giving a total pool of approximately 36 million carriers . chronic infection with hepatitis b may be either asymptomatic or may be associated with a chronic inflammation of the liver ( chronic hepatitis ) , leading to a cirrhosis over a period of several years . studies have shown that the risk of exposure for general dentists is about three to four times greater and for nonimmunized surgical specialists about six times greater than that of the general population . in the dental setting , there are special circumstances and opportunities which can lead to the transmission of such organisms to dental healthcare professionals and to dental clinical students . the incidence of hbv can be reduced by giving proper education regarding its transmission and immunizations to the public , all healthcare workers ( hcv ) , and students . there are no adequate data on the awareness of hepatitis among dental college students in india . hence this forms the base of the present study which aimed to analyze the awareness of hepatitis b infection among the clinical students in a private university . this is an institutional based study conducted to determine the awareness on hepatitis b infection among dental students in university dental college . this study is conducted among the dental students who are attending the third year , final year , and internship ( fifth year trainee ) of graduate program in saveetha dental college and hospital . the students who were present at the day of the particular study and were willing to participate were included in the study and those who were not willing to participate were not included in the study . all the third year , final year , and intern students who were present at the day of study were considered as the sample size for the study . this is a self - reported questionnaire which takes about 10 mins for completion . this included questions about the awareness on hepatitis b infection and the preventive measures taken by the dentist to protect both patients and dentists from hepatitis infection . all data were entered in a data entry form which was transferred to spss software ( spss , version 17 for windows ) . analysis of variance ( anova ) was performed for each variable to assess whether significant differences were observed between the three years of study and also within groups . a total of 150 students participated in the study . of these 34 ( 22.7% ) students were male and 116 ( 77.3% ) were female . the question regarding possible transmission of hbv through contact with saliva , only 23 ( 25.3% ) of the third year students were aware of the fact while 45 ( 30% ) of the final year students and 41 ( 27.3% ) of the interns were already aware of salivary transmission which showed a significant difference ( p = 0.000 ) . in response to the question regarding confirmed risk of hbv transmission through dental treatments 30 ( 20% ) of the third year students , 35 ( 23.3% ) of the final year students , and 32 ( 21.3% ) of the interns were aware of the possible risk during the procedure . regarding high risk of hbv infection for dentist 24 ( 16% ) of the third year students , 40 ( 26.7% ) of the final year students , and 41 ( 27.3% ) of the interns were aware of the high risk , which showed statistically significant difference between various academic years ( p < 0.05 ) . in response to the question on needle stick injuries 30 ( 20% ) of the third year students , 34 ( 22.75% ) of the final year students , and 35 ( 15% ) of the interns reported having such unintentional procedures . this variable did not show a statistically significant difference between various academic years ( p = 0.541 ) . questions regarding high risk of transmission of hbv than hiv through needle stick injury 26 ( 17.3% ) of the third year students , 31 ( 20.7% ) of the final year students , 25 ( 16.7% ) of the interns replied that risk for hiv transmission is more . twenty three 23 ( 15.3% ) of the third year students , 27 ( 18% ) of the final year students , and 36 ( 24% ) of the interns were aware that hbv transmission from dentist to patient can be prevented with the use of gloves which did not show a statistically significant difference between academic years ( p = 0.026 ) . to question regarding the level of knowledge about universal precaution 6 ( 4% ) of the third year students , 5 ( 3.3% ) of the final year students , and 6 ( 4% ) of the interns were not aware about the precautions . five ( 3.3% ) of the third year students , 14 ( 9.3% ) of the final year students , and 19 ( 12.7% ) of the internship students have heard something about universal precautions . nineteen ( 12.7% ) of the third year students , 27 ( 18% ) of the final year students , and 21 ( 14% ) of the interns were being educated about universal precaution . twenty ( 13.3% ) of the third year students , 4 ( 2.7% ) of the final year students , and 4 ( 2.7% ) of the interns were following an executable protocol for universal precaution . this variable shows a significant difference between the academic years ( p = 0.002 ) . table 2 shows the comparison between and within groups on the response to each question . the question regarding salivary transmission of hbv showed a significant difference among the students of various years . the question regarding higher predominance of dentist among the population for hbv infection also showed a significant difference ( p < 0.05 ) . regarding the universal precaution there was a significant difference between the various year students ( p < 0.05 ) . the overall level of knowledge about viral hepatitis among the various years is fairly satisfactory . the level of knowledge regarding hbv was fairly good among final and the interns when compared to 3rd year students . there is no formal school based health education for students in india , and this may also be considered as one of the important reasons for lower knowledge of hepatitis b among 3rd year students . the dental curriculum in india is such that students enter the clinical practice only in third year of study . it is because of this the study population included students only in the clinical year of study . to our knowledge , this is the first study investigating this topic among dental students in chennai , india . based on the results of this study , we can infer that there is need for improving the knowledge of hbv infection among the nonclinical students . when a student enters the final year they are exposed more to the clinical situations and complications and hence exhibit improved knowledge when compared to third year students . a significant difference was seen among the third year students when asked regarding the transmission of hbv through salivary contact . most of the third year students were not aware of the increased risk among dental professionals when compared to general population . since the students enter the clinical in the third year of study , proper immunization and education among them can minimize the early transmission of hbv among the dental students . the level of knowledge and compliance with infection control measures was poor among the students . attributable reasons could be inadequate training for infection control measures , inadequate supply of personal protective equipment , and carelessness . proper hand washing and use of barriers such as gloves , gowns , and mask are the main components of standard precautions which can minimize mucocutaneous exposures . reducing the manipulation of manual sharp instruments the use of puncture - resistant containers for sharp disposal is also an effective strategy . use of protective eye wares and face mask can help in preventing blood or saliva contact during the procedure . indirect transmission of hepatitis b virus can also occur through the dental instruments hence a proper method of sterilization needs to be educated among clinical students . vaccination against hepatitis b is recommended for all the dental students before they start their clinical phase and for susceptible dentists and dental auxiliary staff [ 14 , 15 ] . it is recommended that a policy be implemented for complete vaccination and health education for all dental students in first year in all dental colleges . however , antibody titers should be routinely checked among all vaccinated students because in some cases there are chances of nonresponse to the first series of vaccination . it is of prime importance for all dental schools to conduct talks and create awareness about hepatitis b infection . the study highlights the need for implementing separate course in dental curriculum on communicable diseases in the first year of dental school . at the end of our study the students were given a lecture and demonstration on various universal precaution methods which they should follow when treating any patients . firstly , all collected data were self - reported and therefore not verifiable . in particular , there was some inconsistency in the collected data ( only yes or no option was given for all questions ) , indicating that some of the reported information was unreliable . since it is a cross - sectional study the knowledge at that point of study lastly , because of the nonrandom sampling , our conclusions have limited generalizability to other dental college students in india . however the results of the study can be used as a baseline for enhancing the knowledge about infection control by conducting continuing dental education program . although dentists and dental students can be exposed to the human immunodeficiency virus ( hiv ) , hepatitis b virus ( hbv ) , and hepatitis c virus ( hcv ) in their work environment , this particular study evaluated the awareness only on hepatitis b virus since it is most commonly underdiagnosed and the risk of transmission is much higher compared to other communicable diseases . although the overall level of knowledge about viral hepatitis among the various years is fairly satisfactory , the students entering the third year of clinical study have less knowledge of hbv infection .

hepatitis b virus transmission in a dental setting more commonly occurs due to inadequate / improper use of safety measures by the dentist . this particular study evaluated the hepatitis b virus infection related awareness among dental graduate students in a university dental college , india . a validated questionnaire regarding the awareness about hepatitis infection and various infection control measures was distributed among the students of different year of study in undergraduate bachelor dental graduate program . the data extracted were tabulated and analyzed . final year students showed an increased awareness when compared to third year students . there is need for improving the knowledge among the nonclinical students , mainly on transmission of virus through salivary contact . the overall awareness among the students is only fairly satisfying , which signifies the need for continued infection control education among the students .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

a prospective molecular epidemiologic study of s. aureus was performed in a 12-bed icu at the university hospital in montpellier , france , during 5 months in 2011 . s. aureus nasal carriage was investigated at admission and weekly in 89 patients and monthly in 63 volunteer health care workers ( hcws ) . simultaneously , all s. aureus isolates from clinical samples were obtained from the hospital laboratory of bacteriology and clinical data were recorded . pneumonia was diagnosed on the basis of clinical , biologic , and radiologic criteria , and a colony count 10 cfu / ml in bronchoalveolar fluid culture or 10 cfu / ml in sputum cultures . bronchial colonization was defined as a colony count < 10 cfu / ml in sputum cultures in asymptomatic patients . random sampling of surfaces was performed monthly in all rooms of the icu ( 864 environmental sites ) . isolates were characterized by using multilocus sequence typing , double - locus sequence typing ( dlst ) , and accessory gene regulation ( agr ) typing . virulence genes and erma , ermc , ermt , and msra genes were screened for by using pcrs . during the survey period , the number of samples obtained ranged from 1 to 32 per patient and from 1 to 3 per hcw . of these samples , 125 s. aureus isolates ( 110 mssa and 15 mrsa ) were obtained from 33 patients , 26 hcws , and 36 environmental sites ; these isolates belonged to 28 sts and 12 ccs . among these 125 isolates , 12 isolates from 5 patients , 2 isolates from 2 hcws , and 15 isolates from 15 environmental sites belonged to cc398 ( figure 1 ; technical appendix ) . the 29 strains were mssa and belonged to st398 ( n = 25 ) or to a new st submitted to the mlst database ( http://www.mlst.net/ ) as st2658 ( n = 4 ) . st398 and cc398 were the most prevalent genotype and clonal complex identified : 25/125 ( 20% ) and 29/125 ( 23.2% ) isolates , respectively ( figure 2 ) . flowchart of selection for methicillin - sensitive staphylococcus aureus clonal complex ( cc ) 398 from intensive care unit , france , 2011 . principal clonal complexes ( ccs ) among 125 isolates of staphylococcus aureus from intensive care unit , france , 2011 . the prevalence of mssa cc398 carriage was 3.2% ( 2/63 ) in hcws and 5.6% ( 5/89 ) in patients . the prevalence of mssa cc398 infection was 2.25% ( 2/89 patients ) ( figure 1 ) . these patients were hospitalized during the same period ; nosocomial pneumonia developed after nasal colonization , and was associated with bacteremia in 1 case . demographic and clinical characteristics were similar in patients colonized or infected with mssa cc398 or with other genotypes ( table 1 ) . genotype cc398 was found more frequently in the icu environment ( 15/36 , 41.7% ) than in patients ( 5/33 , 15.2% ; 4.7 , p = 0.03 ) and hcws ( 2/26 , 7.7% ; 7.1 , p = 0.007 ) ( technical appendix ) . * copd , chronic obstructive pulmonary disease ; crf , chronic respiratory failure ; is , immunosuppressive therapy ; icu , intensive care unit ; saps ii , simplified acute physiology score ii . four strains belonged to the new st2658 , which differed from st398 by a synonymous mutation ( ag ) at position 198 of the pta gene . these 4 strains were isolated from nasal carriage samples ( n = 2 ) , bronchial colonization samples ( n = 1 ) , and pneumonia testing samples ( n = 1 ) from 2 patients hospitalized at the same time . all mssa cc398 strains were agr type 1 , spa type t571 ( determined by using dnagear software ; http://w3.ualg.pt/hshah/dnagear/ ) , and dlst type 144186 ( dlst spa 186 corresponding to spa type t571 ) . genes encoding panton - valentine leukocidin , toxic shock syndrome toxin 1 , and staphylococcal enterotoxin a were not detected . sensitivity testing of mssa cc398 isolates showed that all isolates were resistant to erythromycin and had an inducible macrolide lincosamide streptogramin b phenotype . in addition , resistance to penicillin and amoxicillin caused by -lactamase production was observed in 41.4% ( 12/29 ) of the strains . resistance to kanamycin , tobramycin , and gentamicin was observed in 24.1% ( 7/29 ) of the strains ; all 7 strains were isolated from environmental samples . analysis of genes encoding antimicrobial drug resistance identified the ermt gene in all the cc398 strains and a variable distribution of erma and ermc genes . * p , patient ; hcw , health care worker , e , environment . s , sputum ; n , nose ; bal , bronchoalveolar lavage fluid ; b , bloodstream . bl , -lactamase ( resistance to penicillin and amoxicillin ) ; imls , inducible macrolide lincosamide streptomycin b ; ktg , kanamycin , tobramycin , gentamicin . identification of mssa cc398 in hcws , patients without exposure to livestock , and the environment in an icu indicates emergence of this clone in a hospital in france . the prevalence of nasal carriage in hcws and patients was high ( 5.6% ) in the context of the icu , where these persons have frequent contact with each other . the small number of patients colonized or infected with s. aureus cc398 limits statistical comparison of the 2 groups and identification of risk factors for infection . despite the monocentric nature and the short period of the study , which limit extrapolation of our results to other settings , our study underlines the capacity of mssa cc398 to circulate among and between patients , hcws , and the icu environment . reported prolonged survival of bovine mssa st398 strain in the human nose after artificial inoculation , which suggested that competition with human strains might facilitate its spread ( 12 ) . identification of st2658 in 2 patients hospitalized at the same time reinforces the hypothesis of an increased capacity of transmission of this clonal complex between patients . person - to - person spread of mssa st398 has been reported within community households ( 8,10 ) and more recently in a hospital ( 11 ) and an urban jail ( 9 ) , in which a high proportion of detainees sharing a holding tank were colonized with mssa st398 ( 9 ) . these findings contrast with limited transmissibility of livestock - associated mrsa st398 , which is partially explained by molecular signatures of bacterial host adaptation identified only in the mssa st398 genome , such as different composition of adhesion genes that result in enhanced adhesion to human skin ( 10 ) . all strains were spa type t571 , which is the major spa type associated with mssa st398 ( 2,3,57 ) . there are other similarities between our strains and strains from china , spain , belgium , and the united states . ( 2,6,7,11 ) , such as agr type 1 , the presence of the ermt gene , tetracycline susceptibility , and macrolide lincosamide streptogramin b phenotype . in icus , the association of mssa cc398 with the icu environment suggests that this environment could play a role as a bacterial reservoir as described ( 14 ) . one hypothesis for such an association is the capacity to form a biofilm , which could be correlated with the s. aureus genetic background ( 15 ) . our findings emphasize potential hospital - adapted characteristics of s. aureus cc398 , which is supported by others studies ( 6,11 ) , and indicate that surveillance programs are needed to determine the role of this clonal complex , particularly in the hospital setting . distribution of staphylococcus aureus cc398 isolates from patients in intensive care unit , health care workers , and environmental sites , france , 2011 .

during testing for staphylococcus aureus in an intensive care unit in france in 2011 , we found that methicillin - sensitive s. aureus clonal complex 398 was the most frequent clone ( 29/125 , 23.2% ) . it was isolated from patients ( 5/89 , 5.6% ) , health care workers ( 2/63 , 3.2% ) , and environmental sites ( 15/864,1.7% ) . results indicate emergence of this clone in a hospital setting .

The Study Conclusions None

a common reason for bringing an infant or child for medical visit is recurrent infections . this may refer to infections that are too great in number , too severe , or too long lasting ; that are associated with unusual complications ; or that fail to resolve with standard therapy . only 10% of such cases are due to deficiency in immunity either adaptive or innate . congenital neutropenia has an estimated frequency of two to three per million in the general population . elane ( elastase , neutrophil expressed ) gene related neutropenia includes congenital neutropenia and cyclic neutropenia , both of which are primary hematologic disorders characterized by recurrent fever , skin , and oropharyngeal inflammation ( ie , mouth ulcers , gingivitis , sinusitis , and pharyngitis ) , and cervical adenopathy . the diagnosis of elane - related neutropenia relies primarily on serial measurements of the absolute neutrophil count ( anc ) and clinical findings . molecular genetic testing of the elane gene , the only gene known to be associated with elane - related neutropenia , is available on a clinical basis . a 3-year - old girl was presented to the clinic with the complaint of recurrent fever in mid - september of the year 2009 . there was no significant birth history . during infancy , she had normal growth and no complaints suggestive of exocrine pancreatic insufficiency . on examination her stature was normal , there were no abnormality in skin pigmentation . on per abdominal examination investigations revealed anc of 639 cells / mm , that is , moderate neutropenia but other parameters were in normal range . she was advised biweekly follow - up for repeat cell count and monitoring for objective evidence of illness due to lack of authoritative past history , ie , history of recurrent fever prior to presentation in the clinic . she had to present everytime prior to the date of follow - up due to fever with either boils on skin or upper respiratory tract infection symptoms . it was then decided to put her on antibiotic prophylaxis and self - care advise including dental hygiene were explained to parents . follow - up visit throughout the period of 3 months showed consistent neutropenia with no cyclical variation in the count . she neither had any evidence of infection or disease that could result in neutropenia nor was on any drug that could result in the same . parents of the patient were explained about the possibility of various differential diagnosis that were probable . the report showed heterozygous mutation in exon2 at nucleotide position t201>a causing a codon change c55>s on polymerase chain reaction amplification followed by direct sequencing of all five exons and the promoter region of the neutrophil elastase ( ela2 ) gene . patient was started with filgrastim , recombinant methionyl human granulocyte - colony stimulating factor ( g - csf ) ( r - methug - csf ) on the weight - adjusted dosage schedule in february , 2010 . but in december , 2010 total count rose to 50 10 cells / l . histopathological examination of bone marrow specimen showed malignant transformation into acute myelogenous leukemia ( aml ) . most congenital neutropenia is diagnosed because of fever and severe infection in infants and young children . in 1956 , kostmann described congenital neutropenia ( agranulocytosis ) as an autosomal recessive disease occurring in an extended family in northern sweden . elane ( previously known as ela2 ) is the only gene known to be associated with elane - related neutropenia . its key physiologic role is in innate host defense , but it can also participate in tissue remodeling and possesses secretagogue actions important to local inflammatory responses . individuals have fever and recurrent skin and oropharyngeal inflammation , that is , mouth ulcers , gingivitis , sinusitis , pharyngitis , and cervical adenopathy . diarrhea , pneumonia , and deep abscesses in the liver , lung , and subcutaneous tissues are common . congenital neutropenia and cyclic neutropenia were initially thought to be distinct disorders ; however , following the discovery of the molecular basis of elane - related neutropenia , individuals with findings intermediate between these two phenotypes are also recognized . nonetheless , identification of the two phenotypes is helpful for diagnosis , prognosis , and management . diagnosis requires at least three ancs lower than 500 cells / mm obtained at least 3 months after the birth . bone marrow aspirate typically shows maturation arrest at the promyelocyte or myelocyte stage of neutrophil formation . the finding of an elane mutation in an individual with neutropenia establishes the diagnosis of elane - related neutropenia . common side effects of g - csf include bone pain and headache , splenomegaly , and osteoporosis . individuals with congenital neutropenia ( with or without an elane mutation ) who are treated with g - csf have approximately the same risk of the myelodysplasia syndrome / aml . the respective cumulative incidences 15 years after starting treatment with g - csf were 36% and 25% ( p=0.96 ) . the development of aml in our patient was within 10 months after starting g - csf . this is in contrast to the long 6-year observation period with 9% risk of transformation . hence , it is prudent to consider the aml as the predisposed malignancy associated with the natural history of these diseases . hematopoietic stem - cell transplant is the only alternative therapy for individuals with congenital neutropenia who are refractory to high - dose g - csf or who undergo malignant transformation . in our country , where infections are very common and the cost of g - csf treatment is high and self - financed , and also when a number of upcoming transplant centers are emerging , it is worthwhile to consider allogenic sibling stem - cell transplant , as one of the treatment modality , especially when there is an human leukocyte antigen ( hla)-matched sibling donor available . the cost - benefit ratio is much higher with the absence of long - term infectious complications and lesser infrequent hospital admissions . in our centre , we would start on prophylaxis with g - csf and then search for the hla - matched donor ( especially sibling ) for an allogenic transplant .

we descibe the case of a girl of indian origin who presented with recurrent infections . the only abnormality detected in the armoury of the immune system was consistent neutropenia . mutation analysis revealed ela2 ( neutrophil elastase ) gene mutation that has been associated with severe congenital neutropenia phenotype . patient was treated with the granulocyte - colony stimulating factor ( g - csf ) as prevention of infectious manifestations along with appropriate measure to curb secondary complications . she showed poor response to the g - csf during stringent surveillance . after being on treatment for 1 year , she developed acute myelogenous leukemia as inherit complication of this disease .

INTRODUCTION CASE REPORT DISCUSSION

gastric carcinoma is the fourth most common gastrointestinal cancer and has the second highest mortality rate among all gastrointestinal cancers . three critical measures improving patient prognosis are early diagnosis , radical surgery , and endoscopic surgery . although radical resection has been widely promoted , the post - surgery recovery is still unfavorable due to tnm stages . the prognosis of gastric cancer is also affected by patient biological factors and clinical pathological conditions , necessitating the identification of novel bio - markers for diagnosis and treatment . a widely accepted opinion is that oxidative stress ( os ) participates in pathogenesis of gastric cancer because it can damage dna and cause mucous injuries . nuclear factor e2-related factor 2 ( nrf2 ) , as a basic redox - sensitive bzip transcription factor , plays a role in intracellular anti - oxidation and phase ii detoxification through the up - regulation of various antioxidant response elements ( are ) genes via the keap1-cul3-dependent e3 ubiquitination pathway . under oxidative stress or chemical stimulus , nrf2 translocates into the nucleus , where it forms heterodimers with maf and binds onto the are sequence on the chromosome to activate the transcription of downstream genes , including antioxidants and phase ii detoxification enzymes [ 1214 ] . the importance of nrf2 resides in its protective roles against various human disease and pathological conditions , including cancer , neurodegenerative disease , cardiovascular dysfunction , inflammation , and pulmonary fibrosis , along with ameliorating aging [ 1519 ] , making nrf2 a beneficial transcriptional factor protecting the body from oxidative stress . in tumor tissues , therefore , nrf2 has a dual role in both preventing oncogenesis and protecting tumor cells from stress injury , making it a candidate factor for tumor growth and invasion . currently there is no available study regarding either expression or clinical significance of nrf2 in gastric carcinoma . this study therefore aimed to address this issue and further elucidate the clinical implication of anti - oxidative stress - related nrf2 expression . gastric cancer cells mkn74 , mnk45 , katoiii , and nugc4 ( cell institute of chinese academy of science , china ) were cultured in rpmi 1640 medium containing 10% fetal bovine serum ( fbs ) , 100 u / ml penicillin , and 100 g / ml streptomycin . cells collected by centrifugation were rinsed in phosphate - buffered saline ( pbs ) and extracted for total proteins by lysis buffer . cell nucleus / cytoplasmic fractions were separated using a test kit ( biovision , usa ) according to the manufacturer s instructions . denatured proteins were separated on 10% sds - page and transferred to pvdf membrane , which was blocked in 5% defatted milk powders overnight . mouse monoclonal anti - nrf2 antibody ( 1:500 , santa cruz , usa ) was used to incubate the membrane overnight . after rinsing in tris - buffered saline - tween 20 ( tbst ) , anti - mouse igg conjugated with horseradish peroxidase ( rd systems , us ) was used for a further 15-min incubation . the signal was finally developed using ecl - plus reagents and was visualized on x - ray films . the nucleus and cytoplasm fractions were labelled by anti - lamin b1 ( 1:1 000 , abcam , usa ) or anti- tubulin antibody ( 1:1000 , calbiochem , usa ) . all patients underwent surgical resection of stomach ( 57 cases of distal , 14 cases of proximal , 99 cases of total , and 5 cases of partial stomach resection ) with lymph node clearance between jan 2004 and dec 2013 in our hospital . there were 116 males and 59 females in the patient group , ages 3184 years ( average , 66 years ) . among all patients , 47 were at stage i when diagnosed , 33 were at stage ii , and 95 were at stage iii . histopathological typing showed 71 cases of differentiated ( papillary , high - differentiated , and moderate differentiated tubular adenocarcinoma ) tumors and 104 undifferentiated tumors ( including low differentiated adenocarcinoma , mucinous adenocarcinoma , and signet ring cell carcinoma ) . this study was pre - approved by the ethics committee of our hospital and we obtained written consent from all patients and their families . tumor tissues were first fixed in 10% formalin - pbs buffer , embedded in paraffin , sectioned ( 4-m thickness ) , and was mounted on glass slides . after de - waxing in xylene and re - hydration in gradient ethanol , endogenous peroxidase activity was quenched by 3% hydrogen peroxide in methanol . after gentle washing in pbs , antigen retrieval was performed using heated citrate buffers for 10 min . non - specific binding sites were further blocked in 10% fbs . anti - nrf2 antibody ( 1:200 , santa cruz , usa ) further detection was accomplished by streptavidin - biotin peroxidase ( sp ) kit ( nichirei , japan ) and was visualized by diaminobenzidine incubation . two independent blinded observers evaluated staining images . in brief , 10 representative regions within the tumor samples were selected . in each region , the expression was observed in 100 cells under a high - magnification microscope ( 400 ) . the undifferentiated region was preferred to differentiate tissues on the same slide . averaged nrf2 index was calculated based on the number of positive cells in each region . the expressional profile was described from both the positive rate and staining intensity , the latter classified as 0 , 1 + , and 2 + . we compared the nrf2 expression level in patients who underwent 5-fluorouracil ( 5-fu ) treatment . as only stage ii / iii patients were qualified for chemotherapy and patients with severe adverse effects were excluded , only 72 patients were recruited for the analysis of nrf2 expression and tumor chemoresistance . between - group comparisons were performed by chi - square , fisher s exact , or mann - whitney u test . the correlation between nrf2 expression and clinical indexes was analyzed by kaplan - meier curve , univariate / multivariate analysis , and log - rank test . gastric cancer cells mkn74 , mnk45 , katoiii , and nugc4 ( cell institute of chinese academy of science , china ) were cultured in rpmi 1640 medium containing 10% fetal bovine serum ( fbs ) , 100 u / ml penicillin , and 100 g / ml streptomycin . cells collected by centrifugation were rinsed in phosphate - buffered saline ( pbs ) and extracted for total proteins by lysis buffer . cell nucleus / cytoplasmic fractions were separated using a test kit ( biovision , usa ) according to the manufacturer s instructions . denatured proteins were separated on 10% sds - page and transferred to pvdf membrane , which was blocked in 5% defatted milk powders overnight . mouse monoclonal anti - nrf2 antibody ( 1:500 , santa cruz , usa ) was used to incubate the membrane overnight . after rinsing in tris - buffered saline - tween 20 ( tbst ) , anti - mouse igg conjugated with horseradish peroxidase ( rd systems , us ) was used for a further 15-min incubation . the signal was finally developed using ecl - plus reagents and was visualized on x - ray films . the nucleus and cytoplasm fractions were labelled by anti - lamin b1 ( 1:1 000 , abcam , usa ) or anti- tubulin antibody ( 1:1000 , calbiochem , usa ) . all patients underwent surgical resection of stomach ( 57 cases of distal , 14 cases of proximal , 99 cases of total , and 5 cases of partial stomach resection ) with lymph node clearance between jan 2004 and dec 2013 in our hospital . there were 116 males and 59 females in the patient group , ages 3184 years ( average , 66 years ) . among all patients , 47 were at stage i when diagnosed , 33 were at stage ii , and 95 were at stage iii . histopathological typing showed 71 cases of differentiated ( papillary , high - differentiated , and moderate differentiated tubular adenocarcinoma ) tumors and 104 undifferentiated tumors ( including low differentiated adenocarcinoma , mucinous adenocarcinoma , and signet ring cell carcinoma ) . this study was pre - approved by the ethics committee of our hospital and we obtained written consent from all patients and their families . tumor tissues were first fixed in 10% formalin - pbs buffer , embedded in paraffin , sectioned ( 4-m thickness ) , and was mounted on glass slides . after de - waxing in xylene and re - hydration in gradient ethanol , after gentle washing in pbs , antigen retrieval was performed using heated citrate buffers for 10 min . non - specific binding sites were further blocked in 10% fbs . anti - nrf2 antibody ( 1:200 , santa cruz , usa ) further detection was accomplished by streptavidin - biotin peroxidase ( sp ) kit ( nichirei , japan ) and was visualized by diaminobenzidine incubation . two independent blinded observers evaluated staining images . in brief , 10 representative regions within the tumor samples were selected . in each region , the expression was observed in 100 cells under a high - magnification microscope ( 400 ) . the undifferentiated region was preferred to differentiate tissues on the same slide . averaged nrf2 index was calculated based on the number of positive cells in each region . the expressional profile was described from both the positive rate and staining intensity , the latter classified as 0 , 1 + , and 2 + . we compared the nrf2 expression level in patients who underwent 5-fluorouracil ( 5-fu ) treatment . as only stage ii / iii patients were qualified for chemotherapy and patients with severe adverse effects were excluded , only 72 patients were recruited for the analysis of nrf2 expression and tumor chemoresistance . between - group comparisons were performed by chi - square , fisher s exact , or mann - whitney u test . the correlation between nrf2 expression and clinical indexes was analyzed by kaplan - meier curve , univariate / multivariate analysis , and log - rank test . as shown by western blotting in both nucleus and cytosolic fractions , nrf2 protein is mainly expressed in the nucleus , with minimal expression in the cytoplasm ( figure 1 ) . ihc staining obtained results consistent with those in the abovementioned western blotting , as the nrf2 signal localizes in the nucleus ( figure 2 ) . we calculated the staining scored as described in the methods section , and classified those with scores higher than 100 into the nrf2-positive group . in all 175 patients , 108 were classified into the positive group ( 61.7% ) and the other 67 were classified into the negative group ( 38.3% ) . further correlation analysis between nrf2 expression and clinical indexes significant correlations were discovered between nrf2-positive expression and patient sex , tumor volume , infiltrative depth , lymph node metastasis , lymph tube invasion , and tnm staging . among all 72 patients who underwent 5-fu therapy , there were 59 who were nrf2-positive and 13 who were nrf2-negative . among those 59 nrf2-positive patients , a total of 43 patients ( 72.9% ) developed 5-fu resistance , which occurred in only 5 of the 13 nrf2-negative patients ( 38.5% ) . using kaplan - meier method , we found that the overall survival rate in nrf2-positive patients was significantly lower than that in nrf2-negative patients ( 61% vs. 79% , p<0.01 , figure 3 ) . significant correlation factors of patient survival rate include invasive depth , tumor size , lymph node metastasis , tnm stage , and lymph tube infiltration , by univariate analysis . a further multivariate analysis indicated lymph node metastasis as an independent prognostic index ( table 3 ) . as shown by western blotting in both nucleus and cytosolic fractions , nrf2 protein is mainly expressed in the nucleus , with minimal expression in the cytoplasm ( figure 1 ) . ihc staining obtained results consistent with those in the abovementioned western blotting , as the nrf2 signal localizes in the nucleus ( figure 2 ) . we calculated the staining scored as described in the methods section , and classified those with scores higher than 100 into the nrf2-positive group . in all 175 patients , 108 were classified into the positive group ( 61.7% ) and the other 67 were classified into the negative group ( 38.3% ) . further correlation analysis between nrf2 expression and clinical indexes significant correlations were discovered between nrf2-positive expression and patient sex , tumor volume , infiltrative depth , lymph node metastasis , lymph tube invasion , and tnm staging . among all 72 patients who underwent 5-fu therapy , there were 59 who were nrf2-positive and 13 who were nrf2-negative . among those 59 nrf2-positive patients , a total of 43 patients ( 72.9% ) developed 5-fu resistance , which occurred in only 5 of the 13 nrf2-negative patients ( 38.5% ) . using kaplan - meier method , we found that the overall survival rate in nrf2-positive patients was significantly lower than that in nrf2-negative patients ( 61% vs. 79% , p<0.01 , figure 3 ) . significant correlation factors of patient survival rate include invasive depth , tumor size , lymph node metastasis , tnm stage , and lymph tube infiltration , by univariate analysis . a further multivariate analysis indicated lymph node metastasis as an independent prognostic index ( table 3 ) . as an antioxidant , nrf2 can protect normal cells from oxidative stress injuries , thereby forming a self - protective mechanism . the over - expression of nrf2 and its downstream genes in various tumors , however , raised the potency of nrf2 in facilitating survival and proliferation of cancer cells [ 2026 ] . our study for the first time reports that a close relationship exists between nrf2 expression in gastric carcinoma cell nucleus and patient clinical features . the prominent expression of nrf2 in nucleus of gastric cancer cells from both in vivo and in vitro samples suggests a persistent expression of nrf2 may cause production of antioxidants , which further endow cancer cells with elevated anti - reactive oxygen species ( ros ) activity . this proposed mechanism has been reported by ma et al . , who found higher nuclear nrf2 levels and downstream anti - oxidative proteins in more advanced cervical cancer tissues . therefore , it is likely that gastric cancer cell nuclear nrf2 level is related with tumor malignancy . ihc staining results showed elevated nrf2 expression in gastric cancer tissues . among all patients , 61.7% were nrf2-positive , higher than those in non - small cell lung cancer ( nsclc ) ( 26% ) or gall bladder cancer ( 23% ) . the survival rate - related factors include tumor invasive depth , tumor size , lymph node metastasis , tnm stage , and lymph tube infiltration , in agreement with a gall bladder cancer study . recent study in gastric carcinoma found consistent effects of nrf2 expression on the prognosis , but only with immune reactivity in cytoplasm rather than the nucleus , probably due to the use of different antibodies . various studies have confirmed the importance of cytoplasmic - nuclear translocation of nrf2 for exerting its anti - oxidative activity . persistent over - expression of nrf2 may protect cancer cells from ros injuries because it can work as an anti - oxidant . therefore , it is necessary to quantify nuclear but not cytoplasmic nrf2 proteins in gastric cancer tissues . although nrf2-positive is not included in multivariate analysis as an independent prognostic evaluating factor , our results showed that lymph node metastasis can significantly affect nrf2-positive rates as a marker for unfavorable prognosis . previous studies in nsclc and gall bladder cancer all supported existence of relationships between nrf2 positive expression and unfavorable prognosis , suggesting the utility of nrf2 as a prognostic index for evaluating the postoperative survival rate of patients . various studies have shown that nrf2 can decrease the survival rate via its facilitation on tumor cell resistance against radio-/chemo - therapy [ 2934 ] . this study found a higher rate of 5-fu resistance in nrf2-positive tumors ; therefore , the evaluation of nrf2 in gastric cancer patients may help to optimize the chemotherapy plan . the genetic silencing or functional inhibition can suppress activity of nrf2-modulated oxidase , including glutathione , thioredoxin , and mercaptan sulfur , leading to the recovery of tumor cell sensitivity to chemo-/radio - therapy . there have been clinical trials supporting this mechanism , such as the sensitization of cancer cells against alkylation drugs by nrf2 inhibition or the inhibition of tumor growth by the combination of nrf2 gene knockdown and cisplatin application . therefore , the next generation of chemotherapy plans involving modulating nrf2-related anti - oxidative functions may provide more satisfactory treatment efficacy and improve patient survival and prognosis . this study demonstrated a positive relationship between nrf2 expression and invasiveness of gastric carcinoma , suggesting the utility of nrf2 as a prognostic index .

backgroundnuclear factor e2-related factor 2 ( nrf2 ) plays an anti - oxidative and phase ii detoxification function via its up - regulation on various antioxidant response elements ( are ) genes . nrf2 can protect both normal and cancer cells from damages of cell stress , thereby exerting a critical role in the development of cancer . the expression and significance of nrf2 in gastric cancer , however , has not been reported . this study thus aimed to investigate the expression of nrf2 in gastric cancer tissues via immunohistochemical ( ihc ) staining.material/methodsgastric carcinoma tissues from a total of 175 patients during surgical resection were examined for nfr2 expression profiles using ihc staining on paraffin - embedded slides . between - group - comparisons were performed by chi - square , fisher s exact , or mann - whitney u test . the correlation between nfr2 expression and clinical indexes was further analyzed by kaplan - meier test , univariate / multivariate analysis , and log - rank test.resultsnrf2 is mainly expressed in nuclei of gastric carcinoma tissues , with significant correlation with clinical indexes , including tumor size , invasive depth , lymph node metastasis , and invasion . patients with nrf2-positive expression had significantly lower survival rates compared to those in the negative group ( p<0.01 ) , with chemo - resistance against 5-fluorouracil ( 5-fu ) ( p<0.05).conclusionsnrf2 expression is positively correlated with invasive gastric cancer , suggesting its utility as a predictive index for unfavorable prognosis .

Background Material and Methods Western blotting for Nrf2 expression in gastric carcinoma cell lines Patients and samples Nrf2 IHC staining Relationship between Nrf2 expression and chemo resistance Statistical analysis Results Expression of Nrf2 in gastric carcinoma cell lines The correlation between Nrf2 expression and clinical indexes Correlation between Nrf2 expression and 5-FU resistance 2 The relationship between Survival rate and Nrf2 Discussion Conclusions

copy number variation ( cnv ) is a structural genomic variation of the human genome that may either be inherited or caused by de novo mutation . cnvs can range in size from kilobases ( kbs ) to several megabases ( mbs ) that have not been identified by conventional chromosomal analysis . however , recent technology of genome - wide analysis such as comparative genomic hybridization ( cgh ) has led to the discovery of extensive genomic structural variation [ 13 ] . a recent report using microarray technology revealed that as much as 12% of the human genome are variable in copy number . these known cnvs are available from the interactive web - based database decipher ( database of chromosomal imbalance and phenotype in humans using ensembl resources , http://decipher.sanger.ac.uk/ ) . the decipher database is a consortium comprised of an international network of more than 100 centers and has uploaded more than 2000 cases ( current statistics can be found on the decipher homepage ) . de novo mutations are more likely to contribute to the development of sporadic genomic disorders [ 6 , 7 ] . in psychiatric disorders , asd and schizophrenia , extension of genome - wide association studies ( gwas ) have led to the discovery of both inherited and de novo sporadic cnvs . such cnvs resulted in altering gene dosage and dosage - sensitive gene expression , which may contribute to these disorders complexities . these human genetics studies have detected several cnvs ( e.g. , 1q21 , 3q29 , 10q26 , 11p14 , 15q11 , 15q13 , 16p13 , 17p12 , and 22q11 ) . this discovery suggests an important role for the strict regulation of gene dosage in asd and schizophrenia . to understand psychiatric disorders , while it is difficult to model human psychiatric phenotypes in animals ( e.g. , hallucinations and delusions characteristic of schizophrenia that are human specific ) , animal models may contribute to the elucidation of brain anatomy , behavioral characteristics , and molecular mechanisms that reflect aspects of human phenotypes . although there is a strong association between genetic rearrangement and psychiatric disorders ( e.g. , asd and schizophrenia ) , valid animal models that reflect etiology are rare . several efforts have been made to generate mouse models of psychiatric disorders by conventional gene targeting , conditional gene targeting , and point mutation by chemical mutagens . but these techniques are not enough to reflect complex human genomic rearrangements , such as large deletions , inversions , and duplications . in this regard , the cre / loxp - based chromosome engineering technique is useful to generate this kind of complex genomic rearrangements in the mouse genome . by using this chromosome engineering technique , we can accomplish cnv - based unbiased animal models of psychiatric disorders . in this paper , we focus on animal model of asd ( and schizophrenia ) which was generated by chromosome engineering , principle of this technology , and discuss for future directions . genetic abnormalities such as point mutations , deletions , duplications , inversions , and translocations can be induced by exposure to x - ray radiation , chemical mutagens ( e.g. , n - ethyl - n - nitrosourea ( enu ) ) , conventional gene - targeting , or chromosome engineering . the chemical mutagen , enu , induces single - base - pair substitutions in the genome causing mutations with partial functions [ 17 , 18 ] . animal models containing genes with point mutations can be used to reveal the gene 's functional domain in vivo . conventional gene targeting ( replacement ) is used to disrupt a gene ( inserting markers or reporters ) to determine a gene 's function . conditional gene - targeting utilizing the cre / loxp and flp / frt system allows spatial and temporal control of gene expression . chromosome engineering is based on cre / loxp technology , which can induce chromosome rearrangements ( deletions , duplications [ 10 , 20 , 21 ] , and inversions [ 22 , 23 ] ) in the mouse genome ( figure 1 ) . targeting vectors can be targeted in two orientations that result in deletion , duplication , or inversion . each targeting vector has a loxp site and drug selection marker , neomycin resistance ( neo ) , or puromycin - resistant gene ( puro ) . two loxp sites are sequentially inserted by each targeting vector into the mouse embryonic stem ( es ) cell genome . the vectors are manipulated by hypoxanthine phosphoribosyl transferase ( hprt ) expression following cre recombinase expression in es cells . clones which carry the desired chromosomal rearrangement are identified by various methods : drug selection by hypoxanthine - aminopterin - thymidine ( hat ) media , genomic southern blot analysis , fluorescent in situ hybridization ( fish ) , and cgh ( comparative genomic hybridization ) array . although cgh array can not identify structural chromosome aberrations such as balanced reciprocal translocations and inversions , this technique is a powerful tool to detect cnvs from genome . to inactivate a target gene or locus by chromosome engineering the mutagenic insertion and chromosome engineering resource ( micer ) ( http://www.sanger.ac.uk/resources/mouse/micer/ ) was developed by dr . allan bradley 's group , the wellcome trust sanger institute and is useful as a gene - targeting vectors resource . these ready to use targeting vectors can be accessed through the ensembl mouse genome browser ( http://www.ensembl.org/index.html ) . it is important to note that these targeting vectors use an insertion vector system rather than a replacement vector system . given the same length of homologous sequence insertion vectors have a ninefold higher targeting efficiency than replacement vectors . in spite of a strong association between asd ( and schizophrenia ) and cnv , animal models of cnv that reflect human genomic rearrangement are few . these animal models were generated by chromosome engineering and have several psychotic phenotypes similar to those seen in patients with genomic rearrangement ( table 1 ) . in this section we focus on 15q11 - 13 , 16p11.2 , and 22q11 locus , which are well - known copy number variant linked to asd ( or / and schizophrenia ) . human chromosome region , 15q11 - 13 , is a complicated region that contains -aminobutyric acidreceptor a ( gabaa receptor ) clusters and several imprinting genes . in addition to these genes , this locus includes noncoding small nucleolar rnas ( snornas ) that are located between snurf - snrpn and ube3a , which are paternally expressed and brain specific [ 27 , 28 ] . prader - willi syndrome ( pws ) and angelman syndrome ( as ) are affected by changes in the 15q11 - 13 locus . major clinical features of pws include low birth weight , short stature , small hands and feet , severe hypotonia , feeding difficulties , obesity associated with hyperphagia starting in early childhood , mild to moderate mental retardation , and learning and behavioral problems including obsessive - compulsive disorder and autism [ 29 , 30 ] . as patients exhibit developmental delay , gait ataxia , balance disorder , frequent laughter / smiling , easily excitable personality , hyperactivity , speech impairment , microcephaly , seizures , epilepsy , and abnormal eeg ( electroencephalogram ) . additionally , as patients often exhibit socialization and communication deficits , which are diagnostic criteria for asd [ 32 , 33 ] . duplication of the 15q11 - 13 locus was first reported as a partial trisomy of chromosome 15 , and then two individuals with autistic disorder were reported . this locus has been known as the most frequent cytogenetic abnormality in asd [ 36 , 37 ] . generally patients with 15q11 - 13 duplication show hypotonia , delay in motor skills and language development , epilepsy , and cognitive and learning problems . recently , michelson et al . reported a patient with severe intractable epilepsy who has familial partial trisomy 15q11 - 13 inherited from a mother who has schizophrenia . autistic phenotype associated with 15q11 - 13 duplication , usually believed that maternal origin , ube3a is involved [ 3946 ] . although maternal locus supposed to critical , paternally inherited patients had also developmental delay [ 44 , 4649 ] . clinical reports have been accumulating but no mechanism has been addressed . to address this question , nakatani et al . this mouse was generated by chromosomal engineering based on the cre / loxp system , and it has a 6.3 mb duplicated locus in mouse chromosome 7c which is highly similar to human 15q11 - 13 ( figure 2(a ) ) . gene expression analysis revealed that paternally expressed genes , both ndn and snrpn , were twofold higher in paternally inherited mice ( patdp/+ ) than wild - type ( wt ) mice . similarly , maternally expressed gene ube3a was twofold higher in maternally inherited mice ( matdp/+ ) than wt mice . monoamine levels in patdp/+ adult mice , serotonin ( 5-ht ) , and their metabolites 5-hydroxyindoleacetic acid ( 5-hiaa ) were significantly downregulated in the midbrain and olfactory bulb . also 5-ht content in developmental stage from postnatal 1 to 3 weeks in patdp/+ brain regions ( cortex , hippocampus , cerebellum , midbrain , hypothalamus , pons , and medulla ) was downregulated . this indicates 5-ht signaling during the developmental stage was significantly impaired in the brains of patdp/+ mice . 5-ht influences not only mental condition ( mood , social behavior , appetite , aggression and sleep ) but also normal development of the central nervous system [ 5052 ] . in addition to this , abnormal 5-ht levels have been found in asd patient blood cells . treatment with serotonin reuptake inhibitors ( ssris ) have shown moderate success in recovering behaviors . behavioral tests revealed that patdp/+ mice display autistic behaviors such as less social interaction in the three - chamber social interaction test , abnormal ultrasonic vocalizations ( usvs ) in postnatal developing pups separated from their dams , and behavioral inflexibility in the morris water maze and barnes maze . the phenotypes seen in patdp/+ mice indicate that these mice have impaired behaviors that include social interaction , communication , restricted interest , and resistance to change . furthermore , patdp/+ mice showed anxiety - related phenotypes : decreased locomotor and exploratory activities in the open field and y - maze test , and long latencies in novelty suppressed feeding test . these anxiety - related phenotypes frequently accompany autistic symptoms in humans [ 58 , 59 ] . also the marble burying test , which is a useful test for the study of anxiety , obsessive - compulsive disorder ( ocd ) , and neophobia , found that the number of buried marbles was significantly low in patdp/+ mice . deletion or duplication of the chromosome 16p11.2 locus was observed in nearly 1% of multiplex families with asd . meta - analysis of patients with asd and/or developmental delay estimated that 16p11.2 locus deletion is associated with a 38.7-fold increase in the odds of asd / developmental delay . on the other hand , 16p11.2 locus duplication is associated with a 20.7-fold increase in the odds of asd / developmental delay [ 6063 ] . in addition to these , 16p11.2 deletion is associated with obesity , and duplication is associated with schizophrenia as well as asd [ 60 , 66 ] . notably , a brain anatomical abnormality ( abnormal head size ) has been reported to be associated with this locus . for instance , patients with the 16p11.2 deletion had statistically significant macrocephaly and those with duplication had microcephaly . a mouse model of human 16p11.2 deletion ( df/+ ) as well as duplication ( dp/+ ) has been reported ( figure 2(b ) ) . this locus includes 27 genes , spn , qprt , c16orf54 , kif22 , maz , prrt2 , c16orf53 , mvp , cdipt , sez6l2 , asphd1 , kctd13 , loc124446 , hirip3 , ccdc95 , doc2a , fam57b , aldoa , ppp4c , ypel3 , gdpd3 , mapk3 , and coro1a . young df/+ mice ( before weaning ) tend to be smaller than wt siblings , but as adults they are almost the same size as wt siblings and look healthy . interestingly , 16p11.2 cnv mice , df/+ and dp/+ mice have opposite phenotypes . in a novel environmental cage , df/+ mice displayed longer distance traveled and time spent walking as compared with wt mice . in contrast , dp/+ mice traveled a shorter distance and spent less time walking as compared with wt mice . additionally , df/+ mice were significantly active in both dark and light period . these results indicate that 16p11.2 locus affects not only physical activity but also diurnal activity and sleeping related symptoms . also , a brain anatomical study using magnetic resonance imaging ( mri ) identified several regional changes in 16p11.2 cnv mice . for instance , df/+ mice showed increased volume of several brain regions ( percentage of total brain volume ) : forebrain , superior colliculus , fornix , hypothalamus , mammillothalamic tract , medial septum , midbrain , and periaqueductal grey . these brain regional volumetric changes were more significant between df/+ and dp/+ than betweendf/+ and wt mice . microdeletion of chromosome 22q11 is found in 1 out of every 4000 live births , making it one of the most common interstitial deletions . this 22q11.2 microdeletion causes craniofacial , cardiovascular abnormalities , immunodeficiency , hypocalcaemia , short stature , and cognitive dysfunctions [ 6971 ] . microdeletion of this region accounts for 1 - 2% of the cases of people with schizophrenia [ 72 , 73 ] . also , this locus accounts for up to 1 - 2% of cases of sporadic schizophrenia [ 7476 ] . volumetric reduction in total brain volume includes cortical regions ( e.g. , frontal , parietal , temporal , and occipital lobes ) , hippocampus , and cerebellum [ 7786 ] . however , inconsistency in these neuroimaging reports may be due to the small numbers of subjects used and differences in methodology . yet these neuroanatomical reports are informative because some abnormalities are consistent with phenotypes of those who have non-22q11.2 ds - associated schizophrenia . the majority of deletions in this locus are 3 mb deletions ( 90% of the cases ) , but 1.5 mb deletions ( < 10% of the cases ) contain 28 known genes which include critical genes and increased risk of mental disorders [ 73 , 87 ] . animal models of the human 22q11.2 deletion were generated by 2 groups , and both groups used chromosome engineering [ 14 , 88 ] ( figure 2(c ) ) . these mouse models , df(16)a and lgdel/+ , include 1.5 mb critical regions , and both of them display several behavioral abnormalities , such as deficits in working memory , sensorimotor gating , and fear conditioning [ 14 , 8992 ] . working memory deficits are becoming one of the main features of patients with schizophrenia , thus these animal models are supposed to reflect some aspects of 22q11.2 ds syndrome phenotype . in addition to behavioral abnormalities in this mouse , diminished 22q11 locus dosage disrupts cortical neurogenesis , interneuron migration , dendritic complexity , and formation of excitatory synapses . although , several interesting phenotypes have been reported in this mutant mouse , there are no studies published about brain structural abnormalities even though several brain abnormalities have reported in human studies . these brain anatomical changes and molecular mechanisms that underlie these phenotypes will be interesting to elucidate and will be addressed by using brain imaging techniques . application of new technologies , such as comparative genomic hybridization ( cgh ) and next - generation sequencing , will reveal more additional genomic rearrangements related to psychiatric disorders . thus , to analyze both phenotypes and underlying molecular mechanisms that originate from genetic rearrangements , animal models will be a powerful tool . in this context reported that they generated several hundred mice and embryos which have one loxp and lacz site at a random genomic positions that inserted by sleeping beauty - based transposition system . these lines are mapped in transposon and recombinase associated chromosomal engineering resource database ( tracer , http://tracerdatabase.embl.de/fmi/iwp/res/iwp_home.html ) . it is an orthodox approach to narrow down the region by systematically insertion of loxp combining the existed lines such as above tracer . generating bacterial artificial chromosome ( bac ) transgenic mice is another way to identify critical genes . bac transgenes inserted to the genome faithfully recapitulate chromosomal endogenous gene expression , since bac transgenic mice may appropriate animal model of gene duplication . also transient overexpressing ( or knockdown ) each transcript in developmental brain is possible strategy . identified a responsible gene kctd13 in 16p11.2 locus which causes brain malformation by using zebrafish . use of these technologies in generating valid and etiology - based animal model of psychiatric disorders will contribute to the development of drugs against disorders and elucidation of molecular mechanisms that underlie these psychiatric disorders .

the development of genetic technologies has led to the identification of several copy number variations ( cnvs ) in the human genome . genome rearrangements affect dosage - sensitive gene expression in normal brain development . there is strong evidence associating human psychiatric disorders , especially autism spectrum disorders ( asds ) and schizophrenia to genetic risk factors and accumulated cnv risk loci . deletions in 1q21 , 3q29 , 15q13 , 17p12 , and 22q11 , as well as duplications in 16p11 , 16p13 , and 15q11 - 13 have been reported as recurrent cnvs in asd and/or schizophrenia . chromosome engineering can be a useful technology to reflect human diseases in animal models , especially cnv - based psychiatric disorders . this system , based on the cre / loxp strategy , uses large chromosome rearrangement such as deletion , duplication , inversion , and translocation . although it is hard to reflect human pathophysiology in animal models , some aspects of molecular pathways , brain anatomy , cognitive , and behavioral phenotypes can be addressed . some groups have created animal models of psychiatric disorders , asd , and schizophrenia , which are based on human cnv . these mouse models display some brain anatomical and behavioral abnormalities , providing insight into human neuropsychiatric disorders that will contribute to novel drug screening for these devastating disorders .

1. Introduction 2. Chromosome Engineering in Mice 3. Animal Models Based on Human CNVs 4. Future Perspectives

osteoporosis is a systemic skeletal disease characterized by reduced bone mineral density and microarchitectural deterioration , compromising bone strength and increasing risk of fractures . magnetic resonance imaging ( mri ) is an ionizing radiation - free imaging modality , the application of which could be beneficial in the elderly population to monitor incidence , progression , and therapy of osteoporosis . due to the lack of signal from the bone matrix in conventional mri sequences , high - resolution mri of the trabecular bone has been previously accomplished relying on the bone marrow signal surrounding the bone matrix [ 2 , 3 ] . the vertebral bodies , one of the most important fracture sites , are filled with red marrow , which is a mixture of haematopoietic red blood cells and fat cells . despite recent progress [ 4 , 5 ] , direct high - resolution imaging of the trabecular bone has been limited on distal sites ( e.g. , radius , tibia , or calcaneus ) and its application in red marrow regions remains technically challenging . previous mri investigations have studied alternative indirect measures of trabecular bone quantity and quality in red marrow regions , including approaches aiming to measure primarily bone marrow t2 [ 6 , 7 ] . another property of bone marrow , which has recently gained significant attention due to its potential association with bone loss pathophysiology , is its fat content [ 810 ] . mr investigations employing single - voxel magnetic resonance spectroscopy ( mrs ) have recently shown the increase of vertebral bone marrow fat content with age in large scale in vivo studies [ 12 , 13 ] . in addition to age - related change of bone marrow fat content , recent in vivo studies have shown that an increase in bone marrow fat content is associated with a decrease in bone mineral density ( bmd ) [ 7 , 1420 ] . furthermore , there have been a limited number of studies analyzing transiliac bone biopsy samples showing an association between bone marrow adiposity and bone microstructure . additionally , it has been shown that imaging - based trabecular bone microstructure and texture parameters ( using primarily computed tomography ( ct ) and its variants ) can add significant information beyond bmd on predicting bone strength [ 23 , 24 ] . based on the negative association between bmd and vertebral bone marrow fat content , previous studies have recently proposed mrs - based bone marrow fat quantification as a potential noninvasive biomarker for prediction of fracture risk . however , many of these studies have used dual x - ray absorptiometry ( dxa ) for measurement of bmd , including therefore contributions from both the trabecular and the cortical bone compartments in the reported bmd measurements [ 7 , 1517 ] . in addition , there has been no previous groundwork on directly investigating the relationship between bone marrow fat content and biomechanical strength . determining the relationship between bone marrow fat content and trabecular bone microstructure parameters would require sampling larger specimens than those obtained with biopsy . a multimodality ex vivo study in bone specimens combining ct and mrs measurements with biomechanical testing would be required to study the aforementioned relationships . therefore , the purpose of the present pilot study was to investigate the correlation of mrs - based proton density fat fraction with bmd / trabecular bone microstructure parameters obtained from multidetector ct ( mdct ) measurements and bone strength determined from biomechanical testing , using human vertebral cadaveric specimens . ten vertebrae between thoracic vertebrae 5 and 10 ( t5t10 ) were harvested from four fresh human cadavers ( 1 woman and 3 men ; mean age standard deviation ( sd ) of 58 12 years ) . donors had no history of pathological bone changes other than osteoporosis ( i.e. , bone metastases , hematological , or metabolic bone disorders ) . the donors had dedicated their bodies for educational and research purposes to the local institute of anatomy prior to death , in compliance with local institutional and legislative requirements . written informed consent the surrounding muscle , fat tissue , and intervertebral discs were completely removed from the vertebrae . each vertebra was embedded in resin ( rencast isocyanat and polyol , huntsman group , bad sckingen , germany ) up to 2 mm above and below their vertebral endplates for the purpose of biomechanical testing . the resin fixation was performed with parallel alignment of the upper and lower endplate of the vertebrae with the outer surface of the resin chock to guarantee strict axial loading conditions of the vertebrae during the uniaxial biomechanical test . for the purpose of conservation , all vertebrae were stored in the freezer at 4 celsius during the study and degassed in sodium chloride solution at least 3 h before imaging to prevent air artifacts . the vertebrae were sealed in vacuum plastic boxes filled with sodium chloride solution during imaging . multidetector computed tomography ( mdct ) images of the vertebrae were acquired by using a whole - body 256-row ct scanner ( ict , philips medical care , best , netherlands ) . scan parameters were a tube voltage of 120 kvp , a tube load of 585 mas , an image matrix of 1024 1024 pixels , and a field of view of 150 mm . the real spatial resolution was 230 230 600 m as determined at 50 of the modulation - transfer - function . a dedicated calibration phantom ( mindways osteoporosis phantom , san francisco , ca , usa ) was placed in the scanner mat beneath the vertebrae . mdct images were transferred to a remote linux workstation and loaded into an in - house developed program based on idl ( interactive data language , research systems , boulder , co , usa ) . then , transverse cross - sectional area was determined in each section to obtain the mean and minimum transverse cross - sectional area of each vertebra . second , the twenty most central slices displaying the vertebra equidistant to its endplates were identified ( figure 1(a ) ) . similar to the mrs box ( as outlined below ) , rectangular regions of interest ( rois ) with an area of 12 12 mm were manually placed in the center of the vertebra in the selected twenty slices of the mdct images . lastly , rois were drawn in the phases of the calibration phantom in the mdct images . mean bmd in the rois was calculated by converting the pixel attenuations in hounsfield units [ hu ] into bmd values in calcium hydroxyapatite [ mg / cm ] by using the calibration phantom . similar to previous studies , 200 mg / cm calcium hydroxyapatite was identified as optimized global threshold [ 25 , 26 ] . two morphometric parameters were calculated in the rois in analogy to standard histomorphometry using the mean intercept length method : bone volume divided by total volume ( bv / tv ) and trabecular number ( tbn ; [ mm ] ) . in addition , fractal dimension ( fd ) as texture measurement of the trabecular bone microstructure was determined in the mdct images using a box counting algorithm as previously described . the vertebrae were scanned on a 3 t whole - body scanner ( ingenia , philips healthcare , best , netherlands ) using an 8-channel extremity coil . the mr exam consisted of two fat suppressed proton density- ( pd- ) weighted turbo spin - echo ( tse ) sequences ( one mimicking the sagittal anatomical orientation and one the axial anatomical orientation of the vertebrae ) and one single - voxel mrs sequence . sequence parameters for the tse sequence were te / tr = 40/3165 ms , tse factor = 11 , fov = 130 130 , 25 slices , slice thickness = 1.5 mm , and bw = 156.7 hz / pixel . based on the specimen geometry outlined in the pd - weighted sequences ( figure 1(b ) ) , a voxel was selected in the center of the vertebral body to perform single - voxel ( 12 12 12 mm ) mrs using a stimulated echo acquisition mode ( steam ) sequence with parameters : tr = 6 s ( long tr to remove any t1 effects ) , te = 12/15/20/25 ms ( steam with short tes to reduce j - coupling effects ) , 10 averages per te , 2 phase cycles , 4096 data points , 5 khz acquisition bandwidth , no water suppression , and no regional saturation bands . the voxel was positioned so that chemical shift displacement effects due to the finite bandwidth of the employed rf pulses used in the mrs voxel localization were minimized . spectra were fitted using gaussian line shapes and frequency - based methods based on in - house matlab ( mathworks , natick , ma ) routines . figure 1(d ) shows a typical bone marrow fat spectrum with fat peaks observed at spectral locations at 0.9 , 1.30 , 1.59 , 2.00 , 2.25 , 2.77 , 4.2 , 5.19 , and 5.31 ppm . the letters a , d , and e were assigned to peaks at 0.9 ppm ( (ch2)n ch3 ) , 2.77 ppm ( ch = ch ch2ch = ch ) , and 4.2 ppm ( ch2o co ) , respectively . the letter b was assigned to the superposition of peaks at 1.30 ppm ( (ch2)n ) and 1.59 ppm ( co ch2ch2 ) , the letter c was assigned to the superposition of peaks at 2.00 ppm ( ch2ch = ch ch2 ) and 2.25 ppm ( co ch2ch2 ) , and the letter f was assigned to the superposition of peaks at 5.19 ppm ( ch o peak fitting was performed by constraining the area of peaks e and f at a given ratio of peak a + b , based on the bone marrow triglyceride chemical structure determined previously . a common linewidth was assumed for all fat peaks and independent linewidth values were fitted for the two water peaks , resulting in a total number of three linewidths as free variables . fat peak locations were allowed to vary by 0.05 ppm and water peak locations were allowed to vary by 0.50 ppm . t2 correction was then performed using nonlinear least squares fitting , assuming the same t2 relaxation time value for all fat peaks and a different value for the water t2 relaxation time . the derived proton density fat fraction was determined as the ratio of all the fat peaks ( a , b , c , d , e , and f ) area with the sum of all the fat peaks and the narrow ( long t2 ) water peak area ( i.e. , excluding the broad - short t2 water peak area ) . the resin embedded vertebrae were fixed in a mechanical testing system ( wolpert werkstoffprfmaschinen ag , schaffhausen , switzerland ) . firstly , ten preconditioning cycles with uniaxial tension - compression up to a load between 10 n and 400 n with a rate of 5 mm / min were applied . then , a monotonic , uniaxial compression was performed at the same rate . the load - displacement curve was recorded and vertebral failure load ( fl ) was defined as the first peak of the load - displacement curve with a subsequent drop of > 10% . all statistical analysis was performed using spss ( spss , chicago , il , usa ) . mean and sd of all mr - based ( fat fraction ) , mdct - based ( bmd and trabecular bone microstructure parameters ) , and biomechanical testing - based ( failure load of each individual vertebra divided by the minimum transverse cross - sectional area of each individual vertebra , i.e. , normalized failure load ) parameters were computed over the ten measured vertebra bodies . the kolmogorov - smirnov test showed for all parameters no significant difference from a normal distribution ( p > 0.05 ) . therefore , correlations between the different parameters were computed with linear regression models and expressed as slope coefficient b , its standard error , correlation coefficient r , and its p value . due to the relatively small sample size in this pilot study , statistical results were expressed as bootstrap derived standard error of the coefficient b and p value of the regression model . figure 1(c ) shows the spectra acquired at different tes on a vertebra , confirming a faster t2 relaxation for the water peak than for the fat peaks and verifying the need for t2 correction to derive a proton density fat fraction . figure 1(d ) shows the experimentally measured spectrum and the fitted spectrum . there is a strong overlap between fat peaks e and f and the water peak , verifying the need for a constrained fitting of peaks e and f to achieve a reliable estimation of the water peak . table 1 summarizes the statistics ( mean and sd values ) of the main measured parameters . the proton density fat fraction ranged from 26% to 43% with a mean value of 32% and a sd of 5% . the transverse cross - sectional area of the vertebra ranged from 4.9 cm to 9.7 cm with a mean value of 6.5 cm and a sd of 1.5 cm . the normalized fl ranged from 157 n / cm to 798 n / cm with a mean value of 442 n / cm and a sd of 251 n / cm . mean and sd values for bmd and trabecular microstructure parameters ( bv / tv , tbn , and fd ) are also listed in table 1 . figure 2(a ) shows a negative correlation of proton density fat fraction with bmd ( r = 0.72 , p = 0.045 ) . figure 2(b ) shows a negative correlation of proton density fat fraction with normalized fl ( r = 0.77 , p = 0.013 ) . proton density fat fraction also correlated with trabecular microstructure parameters , showing a trend close to statistical significance ( p < 0.1 ) for bv / tv , tbn , and fd ( table 2 ) . normalized fl showed strong correlations with bmd and all trabecular microstructure parameters with correlation coefficients ranging between 0.83 and 0.90 with p < 0.01 ( table 2 ) . bootstrap derived standard error of the coefficient b and p value of all regression models validated the obtained results ( table 2 ) . the present in vitro study investigates , using human spine specimens , the relationship between mrs - based vertebral bone marrow proton density fat fraction , mdct - based measures of bmd and trabecular microstructure , and biomechanical strength . a strong correlation was observed between biomechanical strength and bmd and between biomechanical strength and trabecular microstructure parameters . a correlation was also observed between bone marrow proton density fat fraction and biomechanical strength , providing for the first time a direct validation of the negative association between bone strength and bone marrow fat content . the relationship between bone marrow fat content and bmd has been investigated in multiple previous studies [ 7 , 1421 ] . specifically , previous works have shown statistically significant differences in bone marrow fat content between controls and subjects with osteopenia and osteoporosis ( grouped based on their dxa - based t - score ) [ 1618 ] . it has been also shown that there is a negative correlation between fat content and dxa - based bmd [ 7 , 15 ] . the limitation of dxa - based bmd measurements is that they include contributions from both trabecular and cortical bone components . it has not been until recently that trabecular bmd values based on quantitative computed tomography have been used to study the relationship between trabecular bone density and bone marrow fat content [ 16 , 20 ] . the present study used thus mdct - based trabecular bmd measures excluding the contributions from cortical bone compartments in the study between bmd and bone marrow fat content . in vivo measurement of vertebral trabecular microstructure parameters using mdct would not be justifiable in clinical routine due to the need for high spatial resolution and the associated dose limitations ( effective dose of estimated 3 msv according to graeff et al . ) . that is why the acquisition of mdct data ex vivo in specimens constitutes a meaningful step in establishing any association between trabecular microstructure parameters and bone marrow fat content . the negative correlation between bone marrow fat content and bone density has been shown in multiple recent studies [ 7 , 1420 ] . different mechanisms have been proposed for explaining this negative association , suggesting that bone marrow fat is not simply a filler of the bone matrix cavities . proposed mechanisms include a drift in mesenchymal stem cell differentiation that favors adipogenesis over osteoblastogenesis or a direct effect of adipocytes on suppressing osteoblastogenesis . in parallel , it is well known that bone density is positively correlated with biomechanical strength . the present work shows a negative association between marrow fat content and biomechanical strength and provides to the best of our knowledge the first direct validation of the association between bone marrow fat content and biomechanical strength . therefore , the present results complement the existing knowledge about the importance of bone marrow adiposity in understanding the pathophysiology of bone weakening and about the value of the mrs - based proton density fat fraction of bone marrow as an additional useful parameter in monitoring osteoporosis diagnosis , progression , and therapy . however , future larger scale studies would be necessary to understand whether marrow fat content can become a predictor of bone strength after correcting for bmd effects . the present study uses single - voxel mr spectroscopy to measure the bone marrow proton density fat fraction . acquisitions with multiple tes are performed to account for t2 effects and a constrained fitting approach is adopted taking into consideration the bone marrow triglyceride structure to avoid the inclusion of fat peaks e and f in the water peak signal . the consideration of t2 effects and of the presence of the secondary fat peaks ( e and f ) overlapping with water peak aims for the extraction of a proton density fat fraction of bone marrow instead of a signal - weighted fat fraction reported in previous works [ 1618 ] . by using this mr spectra analysis method and an appropriate parameter selection ( long tr to remove any t1 effects and short tes to reduce j - coupling effects ) , mrs using a stimulated echo acquisition mode ( steam ) as preformed in our present study can be successfully applied for in vivo bone marrow fat quantification as recently shown in the proximal femur and spine [ 28 , 34 ] . single - voxel mrs has been the technique most frequently used to measure fat content in different bone marrow regions , including the vertebral bodies and the proximal femur . however , single - voxel mrs provides very poor spatial resolution , which is an important limitation when applied in bone marrow regions with a spatial heterogeneous distribution of fat content . quantitative water - fat imaging techniques have recently been applied for measuring bone marrow proton density fat fraction with high spatial resolution in good agreement with single - voxel mrs after accounting for appropriate confounding factors [ 28 , 35 , 36 ] . this relatively small sample size might be responsible for not reaching statistical significance ( p < 0.1 but p > 0.05 ) when studying the relationship between bone marrow fat content and certain trabecular microstructure parameters ( tbn and fd ) . second , given the limited spatial resolution of mdct , the mdct - based measured values of the trabecular microstructure can not depict the true trabecular structure . however , it has been previously shown that histomorphometric measurements as assessed with mdct and micro - ct correlate significantly . it has been also recently shown that the correlations of failure load versus trabecular bone microstructure parameters obtained with mdct and high - resolution peripheral quantitative computed tomography ( hr - pqct ) are not significantly different . third , the imaging - derived measurements are limited in the prediction of bone strength of an intact vertebra , since they do not account for the endplates , cortical shell , and posterior elements . in conclusion , a negative relationship was observed between bone marrow proton density fat fraction and trabecular bmd and a negative relationship was observed between bone marrow proton density fat fraction and biomechanical strength . this in vitro study confirms the previously reported negative association between bone marrow fat content and bone density and provides the first direct ex vivo validation of a negative association between bone marrow fat content and bone strength . these findings underline the importance of the bone marrow in the pathophysiology and imaging diagnostics of osteoporosis .

bone marrow adiposity has recently gained attention due to its association with bone loss pathophysiology . in this study , ten vertebrae were harvested from fresh human cadavers . trabecular bmd and microstructure parameters were extracted from mdct . bone marrow fat fractions were determined using single - voxel mrs . failure load ( fl ) values were assessed by destructive biomechanical testing . significant correlations ( p < 0.05 ) were observed between mrs - based fat fraction and mdct - based parameters ( up to r = 0.72 ) and mrs - based fat fraction and fl ( r = 0.77 ) . these findings underline the importance of the bone marrow in the pathophysiology and imaging diagnostics of osteoporosis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

a 62-year - old man developed sudden dysarthria and weakness of the right upper extremity . on admission , he was alert with intact orientation . the neurological examination revealed an impaired ability to perform rapidly alternating movements in the right upper extremity , but there was no other motor , sensory , or oculomotor abnormality . brain mri including diffusion - weighted imaging revealed an isolated lesion involving the left ventroposteromedial ( vpm ) thalamic nucleus ( fig . gustatory function was assessed using the standardized taste - strips test , and the olfactory function was tested using the korean version of the " sniffin ' sticks " test ii ( kvsst ) . the patient was unable to differentiate sweet , sour , salty , and bitter tastes on both sides of the tongue , and perceived all food as tasteless . his food intake stopped immediately after the stroke , but subsequently gradually returned to normal . kvsst performed 6 months after the thalamic stroke confirmed that gustatory dysfunction was still present in the patient . f - fdg pet imaging ( advance pet scanner , ge , milwaukee , wi , usa ) data obtained from the patient and 12 age - matched normal controls was subjected to spm analysis ( ultra - sparc 10 workstation , sun microsystems , silicon valley , ca , usa ; spm99 , institute of neurology , university college london , uk ) . all reconstructed pet images were spatially normalized into the mni template ( montreal neurological institute , mcgill university , canada ) using the affine transformation of the spm99 program . the normalized images were smoothed by convolution with an isotropic gaussian kernel with an fwhm of 8 mm to increase the signal - to - noise ratio . the images obtained from the patient were statistically compared with those of the 12 healthy volunteers on a voxel by - voxel basis using the t - test to detect significant decreases in the regional metabolism . voxel thresholding at p=0.01 ( uncorrected ) and p=0.001 ( uncorrected ) was used . spm analysis of brain pet images revealed hypometabolism in the left insular cortex ( fig . the solitary tract nucleus in the medulla is the first relay in taste sensation , which subsequently involves the central tegmental tract to the medial aspect of the vpm nucleus , immediately adjacent to the somatosensory area for the oral cavity and fingers . taste information is then relayed to the primary taste cortex in the frontal operculum and insular cortex , finally reaching the secondary cortical taste area in the orbitofrontal cortex.1 from an examination of 15 cases of unilateral gustatory disturbance due to central lesions , onoda and ikeda suggested that the central gustatory pathways in humans ascend ipsilaterally from the solitary nucleus of the medulla oblongata to the pons , from where they cross to a higher position in the midbrain and reach the thalamus contralaterally.2 another clinical and mri investigation also suggested that the central taste pathway in humans projects ipsilaterally from the solitary nucleus up to the level of the upper pontine or lower midbrain before crossing.3 it is generally accepted that the taste pathway projects from the ipsilateral solitary nucleus in the medulla , and immediately crosses and traverses the contralateral medial lemniscus on its way to the thalamus . however , the cortical representation of gustatory fibers in the central pathway from the vpm thalamic nuclei in humans has not been elucidated . this is due to the paucity of functional imaging studies on taste disorders in patients with cortical or thalamic stroke , despite the insular cortex and thalamus having an important role in gustatory and lingual somatosensory function . recent investigations in stroke patients have indicated the presence of ageusia contralateral to a thalamic or corona radiata infarction , supporting that the gustatory fibers ascend contralaterally in the cerebral hemisphere and that the pathway ascends from the thalamus to the cerebral cortex via the posterior part of the corona radiata.4 functional imaging of the central gustatory pathway from the thalamus to the cortex has been mainly performed in nonhuman animals . an anterograde and retrograde tract - tracing study of the projections from the thalamic gustatory area in the rat showed that parvicellular vpm neurons projecting to the amygdaloid complex differed from those projecting to the insular cortex.5 however , recent developments in functional brain mapping techniques using pet have revealed the specific structures in the human brain involved in taste sensation . a pet investigation of taste sensation in healthy humans showed that the thalamus , insular cortex , anterior cingulated gyrus , parahippocampal gyrus , lingual gyrus , caudate nucleus , and temporal gyri participated in the discrimination of a salty taste.6 however , these studies have not elucidated the termination laterality of fibers from the thalamic gustatory relay . the present report is one of only a few on bilateral taste loss associated with acute left unilateral thalamic infarction . moreover , there have been few functional imaging studies on taste disorders in patients with a localized vpm thalamic infarct , which would facilitate identification of the connection between cortical and subcortical areas . we had expected our pet study to reveal bilateral cortical hypometabolism , and hence we can not explain the exact reason for unilateral left insular hypometabolism manifesting as a bilateral taste loss . we postulate that the laterality of taste dominance is in the left hemisphere , with the right hemisphere only involved in the taste sensation of the right hemitongue . hypometabolism in the left thalamus was evident from our pet investigation but not from the spm analysis . we do not know the exact reason for this apparent discrepancy , but it might be attributable to the lesion being too small , even though there were definitely structural and functional impairments in that region . we believe that this case report provides useful information about the laterality of taste and the functional asymmetry of the cerebral hemisphere . further gustatory functional imaging studies are necessary in acute stroke patients to elucidate the cortical representation and laterality of taste .

unilateral taste loss is usually observed on the side contralateral to a thalamic infarction , despite gustatory function being represented bilaterally . we report a rare case of bilateral taste loss in a patient with an acute left unilateral thalamic infarction , with unilateral left insular hypometabolism demonstrated by statistical parametric map analysis of pet images . our observations suggest that the left insular cortex and left ventroposteromedial thalamic nuclei are critical to bilateral gustatory sensation .

CASE REPORT DISCUSSION

the aids epidemic which has hit southern africa with such devastating force affects a variety of reproductive issues among infected people . these include whether or not to become pregnant , when and which type of contraception to use , and decisions on whether to continue or try to terminate a pregnancy . findings from studies in both developing and developed nations indicate that a significant proportion of hiv infected adults still desire or intend to have children [ 14 ] . with the advent of highly active antiretroviral therapy ( haart ) and its impact on the health of the infected as well as its impact on lowering mother to child transmission of hiv , the number of hiv infected people considering childbearing has increased [ 57 ] . while much attention has been paid to the reproductive choices and intentions of the infected as well as to some factors that influence these [ 14 ] , most studies are silent on the role of health professionals in the reproductive and sexual lives of hiv infected people . there are few studies that mention the role of health professionals in the reproductive sphere of hiv positive people , yet these are the people who usually play a significant role in the decision making process of hiv positive people . this is because of their medical expertise and that most hiv infected people make their reproductive decisions within a biomedical and health institution context [ 7 , 9 , 10 ] . there are some studies that have involved health professionals and they found that biomedical considerations usually dominate health care providers ' attitudes towards reproduction by hiv infected people [ 11 , 12 ] . findings from this study indicate that there are three dominant discourses concerning childbearing by people with hiv among health professionals . the first two are rooted in the biomedical model of health where biomedical considerations are prominent while the third takes a human rights perspective . taped in - depth interviews were conducted with 12 health professionals in two opportunistic infections clinics in bulawayo . health professional interviewees were selected for their involvement in the care , treatment , and counselling of hiv positive people . this research among health professionals was part of a broader study that explored reproductive decisions among hiv positive couples in bulawayo , zimbabwe , in 2010 . interviews with hiv positive couples revealed that people who featured most in their reproductive and sexual lives were the health professionals ( hps ) ( nurses , doctors , and counsellors ) in opportunistic infections clinics and support groups . as a result the defining characteristic for this sample was involvement with hiv positive people in the past two years . using these characteristics , six counsellors , four nurses , and two doctors were interviewed by the researcher at their place of work . informed consent was obtained from all the respondents and so was the right to tape record the interviews . more counsellors than any other group of hps were selected because , according to the interviews with hiv positive people , they seemed to interact with them more than the nurses or the doctors . data were analysed using a grounded theory approach , based on a process that helps researchers to discover categories , themes , and patterns that emerge from the data . transcribed interviews were then content analysed to identify patterns and themes concerning attitudes of health professionals towards reproduction by hiv positive couples . the strategies used in the data analysis were a systematic review and a thoughtful reading of interview data , coding , categorising , and sorting for patterns , and the construction of the story told . this study found that the majority of hps interviewed generally gave people incomplete information on reproduction . the information given to hiv positive couples centred on pregnancy prevention and prevention of reinfection . the possibility of having children where and when it was discussed was usually presented as a dangerous possibility that people must try to avoid . responding to the question on what they tell people with hiv regarding reproduction some respondents had this to say;we tell them there is re - infection when you have intercourse with an infected person so the first piece of information that we give them is the proper use of the condom ( male counsellor).the use of the condom reduces the re - infection rate and apart from that it prevents pregnancy . if you get pregnant there are high chances of getting an hiv positive child ( nurse).what we tell them is that its not wise to be pregnant when one is hiv positive ( nurse ) . we tell them there is re - infection when you have intercourse with an infected person so the first piece of information that we give them is the proper use of the condom ( male counsellor ) . the use of the condom reduces the re - infection rate and apart from that it prevents pregnancy . if you get pregnant there are high chances of getting an hiv positive child ( nurse ) . what we tell them is that its not wise to be pregnant when one is hiv positive ( nurse ) . another counsellor also pointed out that they emphasised what he called practical aspects when giving hiv positive people information on their future reproductive prospects . he said they emphasised the issue of reinfection and drug resistance if people do not use condoms and the negative repercussions this has not only for them but also for the opportunistic infections clinics and others who are hiv positive . the practicalities that they are made aware of are in a way meant to steer them from the path of unsafe sex and dissuade them from having children . the manner in which the said objective information regarding reproduction was delivered reveals the subjective prejudices of most hps interviewed . all of the counsellors and some nurses indicated that they had in the past months ( before july 2010 ) been approached by an hiv positive individual or couple who wanted to have a child . most hps empathised and some sympathised with them and were aware of the social and personal challenges faced by these people . one counsellor said because you are young , you are a newly we d couple , you meet a lot of challenges and in an african situation where you are a daughter in law , you can not be a daughter in - law without children . because you are young , you are a newly we d couple , you meet a lot of challenges and in an african situation where you are a daughter in law , you can not be a daughter in - law without children . though aware of the sociocultural constraints faced by most of these couples or individuals , most health professionals still felt that they had to seek medical approval before they could reproduce . some pointed out that these people could have a child provided they fulfilled certain conditions set by the health professionals ( conditional choice stance ) . others were of the view that though their need to have a child may be genuine it was not necessary to have a child considering their condition ( antichildbearing stance ) . they felt the risks posed to both the mother and the child far outweighed the need to have a child . examining the information given to those who desire children , one can not help but notice that the information itself and the manner in which it was given were , in counselling principles , generally biased and meant to discourage childbearing . responding to how he would deal with someone desiring to have a child , one counsellor responded this way;well , our most important area of discussion is ; it is still possible to be pregnant and get a child when you are hiv positive but then our area of interest is what does it mean to be pregnant when you are hiv positive it means whilst we had built your health so much with arvs the stress and strain related to delivery and the psychological pressure related to nursing a child may actually be counter to what the arvs are trying to achieve . well , our most important area of discussion is ; it is still possible to be pregnant and get a child when you are hiv positive but then our area of interest is what does it mean to be pregnant when you are hiv positive it means whilst we had built your health so much with arvs the stress and strain related to delivery and the psychological pressure related to nursing a child may actually be counter to what the arvs are trying to achieve . other counsellors said there is a lot that goes on when you are pregnant . pregnancy lowers your immunity and you are then open to other infections , these other infections will also lower your cd4 cell count and increase the rate of progression to aids . you feel pity for them , really it 's a young couple , they have no child , they really want to have a child but just because of this ( hiv ) they can not . there is a lot that goes on when you are pregnant . pregnancy lowers your immunity and you are then open to other infections , these other infections will also lower your cd4 cell count and increase the rate of progression to aids . you feel pity for them , really it 's a young couple , they have no child , they really want to have a child but just because of this ( hiv ) they can not . most hps interviewed emphasised the negative aspects of childbearing when giving potential parents advice . apart from the fact that the validity of this information can be disputed , the manner in which it was delivered made it seem compulsory for hiv positive people to act upon . this deviates from the professional expectation from counsellors to give clients objective , unbiased , and unprejudiced information . the study found that there are three dominant discourses among hps concerning reproduction by hiv positive couples or people . these are the conditional choice discourse , the antichildbearing discourse , and the prorights discourse . the study found that six of the hps interviewed took a conditional choice stance , while four took an antichildbearing stance and only two took a prorights stance . the conditional choice stance argues that hiv positive people may have children as long as they made their decision on the basis of information and advice given to them by hps . there are a number of conditions that these health professionals indicate as necessary to be fulfilled before hiv positive people can have children . it is important to note that these conditions are to be determined by the hps though on the other hand they claim to be neutral facilitators . the following are some of the conditions pointed out:they have to do that ( decision making ) on an informed basis.i think people need information , the correct information and be allowed to make choices based on correct information.people can have children as long as they are able to make sure that they make every effort that child does not become infected.if they want to make a decision to get pregnant they have to consult a doctor who will advise them on how big the risk of getting pregnant is.they have to consult a medical person who will look at their cd4 cell counts , how they are clinically and what risk there is.we also check the stage ( of aids ) they are in.i referred them to their private doctor so he may tell them whether they can have a child or not . they have to do that ( decision making ) on an informed basis . i think people need information , the correct information and be allowed to make choices based on correct information . people can have children as long as they are able to make sure that they make every effort that child does not become infected . if they want to make a decision to get pregnant they have to consult a doctor who will advise them on how big the risk of getting pregnant is . they have to consult a medical person who will look at their cd4 cell counts , how they are clinically and what risk there is . we also check the stage ( of aids ) they are in . i referred them to their private doctor so he may tell them whether they can have a child or not . it seems as far as these hps are concerned hiv positive people have to fulfil and adhere to certain conditions determined by the health professionals before they can think of having children . the proponents of this stance regard childbearing by people living with hiv as an unnecessary risk to the unborn child . as far as they are concerned it is not only irrational but also immoral for hiv positive people to have children . it is immoral because there is a possibility of having a positive child and thus causing suffering to an innocent soul the hps who take this stance in a way argue that if it is irrational to allow the worst outcome of our actions , and if it is immoral to cause suffering , then it is irrational and immoral for hiv positive people to have children . are some of their responses regarding childbearing among those who are infected: .. this is a problem ( having children ) . the painful thing is to see the children when they get sick of aids that is painful especially if you deal with children who are hiv positive which is what i do most of the time ( counsellor).i do not think it is necessary ( to have a child)it 's not necessary . i believe there can still be a happy marriage without children and perhaps my opinion is heavily influenced by my medical background . i wish i could come out of it and stand on neutral ground , but i do not think it 's necessary , they should not ( doctor). both of you , you are ill now and the child will be ill as well and the child will be in and out of hospital now and again or you have a child and five years down the line both of you die what will happen to the child and worse if the child is positive as well , even if its negative what happens to her , and so forth they are very innocent but they are suffering ( nurse ) . .. this is a problem ( having children ) . the painful thing is to see the children when they get sick of aids that is painful especially if you deal with children who are hiv positive which is what i do most of the time ( i do not think it is necessary ( to have a child)it 's not necessary . i believe there can still be a happy marriage without children and perhaps my opinion is heavily influenced by my medical background . i wish i could come out of it and stand on neutral ground , but i do not think it 's necessary , they should not ( both of you , you are ill now and the child will be ill as well and the child will be in and out of hospital now and again or you have a child and five years down the line both of you die what will happen to the child and worse if the child is positive as well , even if its negative what happens to her , and so forth the response of this group to pregnancy among women on treatment or to couples / individuals who intend to reproduce is usually anger , disappointment , dejection , and a feeling of defeat and failure . its advocates argued that it is the right of every human being to choose freely without fear or fetters . it is also everyone 's right to be given the correct and complete information regarding reproduction when they need it . they argued thatevery human being has a right , has every right to decide what he wants concerning his health , family , just about everything . as we have here at oi clinics there are people who choose not to take arvs , that is the choice of the individual , it is his right every human being has a right , has every right to decide what he wants concerning his health , family , just about everything . as we have here at oi clinics there are people who choose not to take arvs , that is the choice of the individual , it is his right another counsellor argued that due to the number of adults infected with hiv in zimbabwe and given the high chances of having a negative child people have the right to choose to reproduce freely . he saidit is very important , to me i think it is very important for hiv positive people to have children because even if i give you our statistics in zimbabwe , it says around 20% of the adult population are people living with hiv . so considering the chances of these hiv positive people having negative children if they take the necessary drugs i think there is no reason for them not to have children . so i think being hiv positive should not ever be used to stop someone from having children . it is very important , to me i think it is very important for hiv positive people to have children because even if i give you our statistics in zimbabwe , it says around 20% of the adult population are people living with hiv . so considering the chances of these hiv positive people having negative children if they take the necessary drugs i think there is no reason for them not to have children . so i think being hiv positive should not ever be used to stop someone from having children . study findings revealed that there are three dominant discourses on the issue of childbearing by hiv positive people among health professionals . prevalent in the conditional choice and antichildbearing discourses is the view of hiv positive people as abnormals who do not have the same reproductive rights and freedom as normals . from these perspectives hiv / aids is framed as a disability and like most people with disabilities hiv positive people find themselves in a position where their condition is viewed as a handicap . persons with disabilities often face serious discrimination based on attitudes , perceptions , misunderstandings , and lack of awareness about disability [ 15 , 16 ] . similarly people with hiv / aids who desire to reproduce usually face discrimination as a result of negative social constructs of hiv / aids . as asch and fine ( 1988 ) note , the attitudes and structural barriers of the nondisabled turn disabilities into handicaps . ferri and gregg ( 1998 ) argue that the reasoning behind such a stereotype is the fear that people with disabilities will produce defective offspring . in the case of hiv positive people the fear seems to be not only that they will produce infected children but also that they will increase the number of orphans and child headed households in the society due to their early death . as a result people with hiv / aids find their right to reproduce being questioned and sometimes denied by both the medical fraternity and the society . there seems to be a view in this school of thought that the information given to hiv positive people should make them arrive at what is seen as an ideal decision , that is , not to procreate . such an attitude may discourage hiv positive people from consulting hps on issues relating to their sexual and reproductive health and life and this may consequently lead to negative health outcomes for hiv positive people . the prorights stance argues that like any normals , hiv positive people have the right to do what they want , when they want , in the matter of reproduction . this perspective does not frame hiv / aids as a disabling factor but rather a chronic but manageable condition . however the consideration of hiv positive people as abnormals in the society in general and in the medical fraternity in particular means that hps with such a liberal view are likely to be few . as a result their influence on the reproductive lives of people with hiv / aids is also likely to be limited . there is also a tendency among most hps to overemphasise the risk to the child though they are aware that this risk is considerably reduced with the help of prophylactic drugs . the way the risk to the child and the mother is emphasised makes it loom larger in the minds of hiv positive people than it actually is given the fact that hps are considered as authorities in this field by hiv positive people . there was a tendency among hps to omit information on strategies to reduce reinfection as well as mtct when giving hiv positive people information regarding reproduction . the information on how they can lower the rate of reinfection and the incidence of mtct and thus increase their chances of getting an hiv negative child was usually not given prominence . in their accounts of the reproductive information given to people , ten of the twelve hps interviewed were silent on the role of nevirapine and other arvs in lowering the incidence of mtct and how those who want children can take advantage of this . when probed on their silence on arvs one counsellor quipped , true as this may be , hiv positive people deserve to know all the possibilities available to them and it is the duty of hps to avail that information to them . health professionals ' attitudes towards childbearing among hiv infected couples were largely shaped by their medical background . the issue of reproduction tended to be medicalised and the aspects of patients ' lives and experiences that transcended the biomedical milieu tended to be neglected [ 11 , 19 ] . health professionals in the study were more concerned about the potential adverse effects of pregnancy , reinfection , and drug resistance than with the personal and social meaning of childbearing to their patients or their reproductive rights . this tendency to lean towards the biomedical model of health which by its nature is concerned more about the physical rather than the emotional and social health meant that there was a tendency among most health professionals to prescribe rather than advise a course of action . many health professionals in the study felt that deciding to have a child required careful planning and consideration , with a right time to fall pregnant , which included an adequately high cd4 count , access to art and pptct programmes , and whether the individual was physically healthy . right time was supposed to be determined by them or by some other health professionals . while the physical health of the infected is important , their psychosocial needs were usually ignored by this dominant discourse . the psychosocial aspect of health is as important as the physical in the overall health of the individual . the study results indicate that the stance of most hps in the area of reproduction among people with hiv is that of interested parties who instead of giving value free information give value laden , authoritative advice . the information given to hiv positive people generally emphasises safe sex and the risks involved in pregnancy while discounting the low risk of having a positive child when one is on haart . recent studies have indicated that mtct risk is very low among women on haart and takes nevirapine at the onset of labour [ 5 , 6 ] . there seems to be a general tendency among the hps to commit the error of omission when giving hiv positive people reproductive information . these are the principles of medical ethics , the oi clinic 's criteria on arv treatment , the biomedical underpinning of the field of medicine , and to a certain extent the personal views of hps on reproduction by hiv positive people . the biomedical model of health is by its nature prescriptive and it views the hp as the authority in terms of hp - patient relationship . modern medicine , argues samson ( 1999 ) , is based on a mechanistic , materialist view of the body and the hp , as the professional , exercises control over this body . the unequal relationship between health professionals and their patients where the doctor is in a position to determine how a health problem should be dealt with and the patient is not has come to be accepted as people normally do not talk back to the hps ; they just listen passively . as one nurse pointed out during the research,people generally have an impression that a nurse is someone who would just instruct you to do this and that . now we have a challenge to change the whole process so that people can be able to approach us freely . people generally have an impression that a nurse is someone who would just instruct you to do this and that . now we have a challenge to change the whole process so that people can be able to approach us freely . the interaction between hps and hiv positive people is embedded in a social and political context in which hps have medical knowledge and technical expertise that patients usually lack . as a result of their position as gatekeepers and because of the power they exercise over the behaviour of their patients they may feel obliged to prescribe rather than to advise their patients . the biomedical perspective taken by most hps in this research may also be based on a genuine concern for the health and wellbeing of hiv positive people as well as for children born to them and a misguided view that curtailing the reproductive rights of hiv positive people is ethical . until recently , hiv / aids has been a fatal disease and still is a potentially lethal and infectious condition . thus the concern and involvement of hps in the reproductive decision making process of hiv positive people may emanate from a rational logic to safeguard the health of hiv positive people . nonetheless , however altruistic their aims may be , the deliberate omission of important information relating to childbearing displayed by some hps in the study is not medically or ethically justifiable . as noted above this study was conducted in two urban opportunistic infections clinics that were fairly well resourced . as a result of the specificity of this study it possibly may not be representative of the views and attitudes of the majority of health professionals in other urban , nonurban , or resource poor settings . the results of this study indicate a general negativity towards reproduction by hiv positive people among health professionals . most of the reproductive information and advice given to hiv positive people was geared towards discouraging them from childbearing . the information was neither unbiased nor complete and the advice given to hiv positive people was not undirective or neutral as is required of counsellors . the study results also reveal a lack of clear guidelines in dealing with the issue of reproduction among people with hiv and hence the existence of varying discourses on the issue and the haphazard advice given to the patients by different hps . though health professionals are entitled to their own ideologies there is a need for clear counselling guidelines for hps on how to deal with hiv positive people who need to reproduce so as to harmonise the advice given to them . this need is urgent as the number of hiv positive people who intend to reproduce is likely to increase as more people are admitted into the highly active antiretroviral therapy program .

objective . the role of health professionals in the decision making process of patients is usually heard or seen from the perspective of the patients . this paper gives the usually silent and invisible health professionals voice and visibility . it describes their views and attitudes towards reproduction by couples who are hiv positive and attempts to understand their perspectives . methods . in - depth interviews were conducted with twelve health professionals at an opportunistic infections clinic . transcribed interviews were analysed using the grounded approach to identify patterns and themes concerning views and attitudes of health professionals towards reproduction by hiv positive people . results . the study found that most health professionals generally had a negative attitude towards childbearing by hiv positive couples . their views and approaches on the issue were based mainly on biomedical considerations . the main discourses on childbearing that emerged from the study were the conditional choice , the antichildbearing , and the prorights . conclusion . most of the health professionals interviewed tend to take a generally negative stance towards reproduction by people with hiv / aids . there is a need for a clear set of guidelines for health professionals ( hps ) on how to deal with hiv positive people who may desire to reproduce .

1. Introduction 2. Method 3. Results 4. Discussion 5. Study Limitations 6. Conclusion

according to a single - blind , within - subject comparison , 15 healthy , normal - weight men ( mean age se , 28.5 1.0 years ; bmi , 23.1 0.5 kg / m ) participated in two hyperinsulinemic - euglycemic clamp experiments ( human insulin , detemir ) spaced apart at least 1 week . all subjects gave written informed consent to the experiments , which were approved by the local ethics committee . in both experimental conditions , an insulin bolus injection ( 17.75 mu / kg body wt [ = 0.1065 nmol / kg body wt ] human insulin , insulin actrapid ; novo nordisk , bagsvrd , denmark ; 90 mu / kg body wt [ = 2.16 nmol / kg body wt ] detemir , insulin levemir ; novo nordisk ) was given followed by a steady 90-min infusion of 1.0 mu kg min (= 0.006 nmol kg min ) human insulin versus 2.0 mu kg min (= 0.048 nmol kg min ) detemir . to compensate for the relatively slower onset of the action of detemir , a higher dosage was chosen ( 15,17 ) to induce comparable peripheral effects of both compounds as assessed by rates of glucose infusion necessary to keep blood glucose levels in the euglycemic range . volunteers reported to the laboratory at 0800 , after an overnight fast of 10 h , and were prepared for electroencephalographic recordings , insulin infusions , and blood samplings . we inserted venous cannulas into the subject 's arms and connected them to tubes enabling infusion and blood sampling from an adjacent room without awareness of the subject . the arm from which samples were taken was positioned in a heated box ( 55c ) to enable drawing of arterialized venous blood . during recordings , subjects sat in a reclining chair in a sound - attenuated room of constant temperature , with their heads stabilized by a cushion . they were instructed to relax and not to move during recordings and to fixate their gaze on the wall in front of them . subjects pressed a button every estimated 30 s to maintain a constant state of mental activity and to not doze off . recordings of dc potentials started at 0940 with a baseline phase of 20 min followed by the bolus injection of human insulin and detemir , respectively ( t = 0 ) . subsequent insulin infusion lasted for 90 min , ending at 1130 when eeg recordings were also stopped . arterialized blood was drawn at 15-min intervals during baseline , at 5-min intervals during insulin infusion , and at 15-min intervals thereafter to monitor blood glucose concentration ( hemocue b - glucose - analyzer , hemocue ab , angelholm , sweden ) . during and after insulin administration , subjects intravenously received a 20% glucose solution at a variable rate to maintain normal plasma glucose levels . blood samples for the determination of hormonal parameters were repeatedly collected , and routine assays were used to determine concentrations of serum c - peptide , plasma acth , serum cortisol ( all immulite ; dpc , los angeles , ca ) , plasma glucagon ( ria ; adaltis , montreal , quebec , canada ) , and serum leptin ( ria ; linco research , st . charles , mo ) . at 1150 ( i.e. , 20 min after insulin infusion had stopped ) , a standardized buffet of around 4,650 kcal was offered from which subjects were allowed to eat ad libitum during the subsequent 50 min ( table 1 ) . subjects were kept unaware of hypothesized treatment effects on food intake and were not aware that their food intake was measured by weighing buffet components before and after food intake . in addition , to prevent overeating , subjects were allowed to take with them any remaining food afterward . before ( at 0915 ) and after ( at 1135 ) recordings and at the end of the session at 1300 , subjects rated their hunger , thirst , and tiredness on 10-point scales and completed a questionnaire assessing alertness and autonomic symptoms on 5-point bipolar scales of 20 contrasting adjective pairs ( e.g. , activated - inert and sweating - shivery ) ( 22 ) . they also filled in a checklist of 161 adjectives assessing mood on 14 dimensions ( 23 ) . composition of the test buffet composition of the buffet offered 20 min after infusion of human insulin and insulin detemir , respectively , had been stopped and from which subjects were allowed to eat ad libitum for 50 min . standard recordings of dc potentials , electro - oculogram , and electromyogram were performed as described previously ( 24,25 ) . dc - potential recordings were obtained from left and right frontal ( f3 , f4 ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) electrodes referenced to linked electrodes at the mastoids . a brainamp dc amplifier ( brain vision , london , u.k . ; low - pass filter : 30 hz , sampling rate : 200 hz ) was used . dc - potential drifts with short - circuited input were constantly < 5 v / h , and electrode impedance , measured before and after recordings , never exceeded 5 k. average dc - potential values were determined offline for subsequent 5-s intervals . linear potential drifts during the 20-min baseline period extending into the 90-min insulin infusion period were removed using a linear regression method . periods where electromyogram or electro - oculogram indicated increased muscular activity or eye movements were excluded from analysis . the average dc potential during baseline was set to 0 v , and potential shifts during treatment were expressed as difference values . differences in dc - potential values between conditions were evaluated first on an exploratory basis by point - wise comparisons using t tests to identify time ranges with most consistent differences ( 26 ) . the time range selected for analysis covered 2190 min of insulin infusion . values for this time interval were then subjected to anova , including the repeated - measures factors treatment ( human insulin vs. detemir ) and topography ( electrode locations ) . post hoc contrasts were used to specify significant anova main effects and interactions . for the dc - potential analysis , data from four subjects had to be excluded because of technical failures and artifacts of apparent nonbiological origin . behavioral measures and hormonal parameters were analyzed with anova and paired t tests as appropriate . according to a single - blind , within - subject comparison , 15 healthy , normal - weight men ( mean age se , 28.5 1.0 years ; bmi , 23.1 0.5 kg / m ) participated in two hyperinsulinemic - euglycemic clamp experiments ( human insulin , detemir ) spaced apart at least 1 week . all subjects gave written informed consent to the experiments , which were approved by the local ethics committee . in both experimental conditions , an insulin bolus injection ( 17.75 mu / kg body wt [ = 0.1065 nmol / kg body wt ] human insulin , insulin actrapid ; novo nordisk , bagsvrd , denmark ; 90 mu / kg body wt [ = 2.16 nmol / kg body wt ] detemir , insulin levemir ; novo nordisk ) was given followed by a steady 90-min infusion of 1.0 mu kg min (= 0.006 nmol kg min ) human insulin versus 2.0 mu kg min (= 0.048 nmol kg min ) detemir . to compensate for the relatively slower onset of the action of detemir , a higher dosage was chosen ( 15,17 ) to induce comparable peripheral effects of both compounds as assessed by rates of glucose infusion necessary to keep blood glucose levels in the euglycemic range . volunteers reported to the laboratory at 0800 , after an overnight fast of 10 h , and were prepared for electroencephalographic recordings , insulin infusions , and blood samplings . we inserted venous cannulas into the subject 's arms and connected them to tubes enabling infusion and blood sampling from an adjacent room without awareness of the subject . the arm from which samples were taken was positioned in a heated box ( 55c ) to enable drawing of arterialized venous blood . during recordings , subjects sat in a reclining chair in a sound - attenuated room of constant temperature , with their heads stabilized by a cushion . they were instructed to relax and not to move during recordings and to fixate their gaze on the wall in front of them . subjects pressed a button every estimated 30 s to maintain a constant state of mental activity and to not doze off . recordings of dc potentials started at 0940 with a baseline phase of 20 min followed by the bolus injection of human insulin and detemir , respectively ( t = 0 ) . subsequent insulin infusion lasted for 90 min , ending at 1130 when eeg recordings were also stopped . arterialized blood was drawn at 15-min intervals during baseline , at 5-min intervals during insulin infusion , and at 15-min intervals thereafter to monitor blood glucose concentration ( hemocue b - glucose - analyzer , hemocue ab , angelholm , sweden ) . during and after insulin administration , subjects intravenously received a 20% glucose solution at a variable rate to maintain normal plasma glucose levels . blood samples for the determination of hormonal parameters were repeatedly collected , and routine assays were used to determine concentrations of serum c - peptide , plasma acth , serum cortisol ( all immulite ; dpc , los angeles , ca ) , plasma glucagon ( ria ; adaltis , montreal , quebec , canada ) , and serum leptin ( ria ; linco research , st . at 1150 ( i.e. , 20 min after insulin infusion had stopped ) , a standardized buffet of around 4,650 kcal was offered from which subjects were allowed to eat ad libitum during the subsequent 50 min ( table 1 ) . subjects were kept unaware of hypothesized treatment effects on food intake and were not aware that their food intake was measured by weighing buffet components before and after food intake . in addition , to prevent overeating , subjects were allowed to take with them any remaining food afterward . before ( at 0915 ) and after ( at 1135 ) recordings and at the end of the session at 1300 , subjects rated their hunger , thirst , and tiredness on 10-point scales and completed a questionnaire assessing alertness and autonomic symptoms on 5-point bipolar scales of 20 contrasting adjective pairs ( e.g. , activated - inert and sweating - shivery ) ( 22 ) . they also filled in a checklist of 161 adjectives assessing mood on 14 dimensions ( 23 ) . composition of the test buffet composition of the buffet offered 20 min after infusion of human insulin and insulin detemir , respectively , had been stopped and from which subjects were allowed to eat ad libitum for 50 min . standard recordings of dc potentials , electro - oculogram , and electromyogram were performed as described previously ( 24,25 ) . dc - potential recordings were obtained from left and right frontal ( f3 , f4 ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) electrodes referenced to linked electrodes at the mastoids . a brainamp dc amplifier ( brain vision , london , u.k . ; low - pass filter : 30 hz , sampling rate : 200 hz ) was used . dc - potential drifts with short - circuited input were constantly < 5 v / h , and electrode impedance , measured before and after recordings , never exceeded 5 k. average dc - potential values were determined offline for subsequent 5-s intervals . linear potential drifts during the 20-min baseline period extending into the 90-min insulin infusion period were removed using a linear regression method . periods where electromyogram or electro - oculogram indicated increased muscular activity or eye movements were excluded from analysis . the average dc potential during baseline was set to 0 v , and potential shifts during treatment were expressed as difference values . differences in dc - potential values between conditions were evaluated first on an exploratory basis by point - wise comparisons using t tests to identify time ranges with most consistent differences ( 26 ) . the time range selected for analysis covered 2190 min of insulin infusion . values for this time interval were then subjected to anova , including the repeated - measures factors treatment ( human insulin vs. detemir ) and topography ( electrode locations ) . post hoc contrasts were used to specify significant anova main effects and interactions . for the dc - potential analysis , data from four subjects had to be excluded because of technical failures and artifacts of apparent nonbiological origin . behavioral measures and hormonal parameters were analyzed with anova and paired t tests as appropriate . 1a ; p > 0.14 for all comparisons ) , resulting in identical total amounts of energy supplied via glucose infusion ( human insulin , 240.8 23.3 kcal ; detemir , 239.5 25.0 kcal ; p > 0.93 ) . correspondingly , blood glucose concentrations were comparable throughout the experiment ( fig . 1b ; p > 0.34 for all comparisons ) as well as when restricting analysis to the period of insulin infusion ( p > 0.13 ) . serum c - peptide concentrations did not differ between conditions during insulin infusion ( p > 0.25 ) but rose to slightly elevated levels in the human insulin compared with the detemir condition at the end of experiments ( fig . 1d ) as well as leptin did not differ between conditions ( all comparisons , p > 0.40 ) . concentrations of plasma acth ( p > 0.57 ) and serum cortisol ( p > 0.71 ) were likewise similar in both conditions , with cortisol levels showing the expected meal - related increase ( f = 4.19 , p < 0.008 ) . a : rates of glucose infused to maintain euglycemia and concentrations of ( b ) blood glucose , ( c ) serum c - peptide , and ( d ) serum glucagon during intravenous infusion of human insulin ( ) and insulin detemir ( ) , respectively . infusions started with an insulin bolus injection ( human insulin , 17.75 mu / kg body wt ; detemir , 90 mu / kg body wt ) followed by a steady 90-min infusion ( 1.0 vs. 2.0 mu kg min ) . at 20 min after the end of infusions , subjects ate ad libitum from a test buffet . the dc potential in the detemir condition showed a marked negative shift shortly after insulin injection that reached maximum values exceeding 600 v toward the end of the recording epoch ( fig . analyses of average dc - potential levels during the relevant interval from 21 min after the start until the end of insulin infusions confirmed a distinctly more negative potential level in the detemir than human insulin condition ( f = 7.03 , p = 0.02 ; table 2 ) , with this effect displaying an even topographic distribution ( f = 0.59 , p > 0.59 , for treatment electrode location ) . comparisons with preinjection baseline levels confirmed significance for the negative dc potential in the detemir condition during 2190 min of insulin infusion ( f = 8.53 , p = 0.02 ; f = 1.04 , p > 0.39 for electrode location ) . although dc potentials in the human insulin condition appeared to shift slightly toward positive values over central positions , respective analyses did not yield significant differences from baseline values ( f = 0.17 , p > 0.43 ; table 2 ) . average dc potentials recorded from left and right electrodes over frontal ( f3 , f4 , respectively ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) cortical areas before and during intravenous infusion of human insulin ( thin lines ) and insulin detemir ( bold lines ) , respectively . infusions started with an insulin bolus injection ( human insulin , 17.75 mu / kg body wt ; detemir , 90 mu / kg body wt ) followed by a steady 90-min infusion ( 1.0 vs. 2.0 mu kg min ) . in both conditions , rows of asterisks indicate significance ( p < 0.05 ; t tests ) for point - wise comparisons of the potential levels between conditions ( upper row ) and between the detemir condition and respective baseline levels ( lower row ) . dc - potential levels during euglycemic infusion of human insulin and detemir average dc - potential levels ( in v ) over left and right frontal ( f3 , f4 ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) cortical areas from 21 to 90 min of intravenous infusion of human insulin ( hi ) and insulin detemir ( det ) , respectively . the right three columns indicate significance for differences , respectively , between conditions and between the potential levels in the human insulin and detemir conditions and respective baseline levels ( t test ; n= 11 ) . detemir in comparison with human insulin significantly reduced food consumption by 303 135.7 kcal . macronutrient comparisons suggested this effect was particularly pronounced for protein and , to a lesser extent , for carbohydrate intake , but there was no significant statistical interaction between the factors treatment and macronutrients ( f = 1.63 , p > 0.22 ) . the reduction in total energy consumption and also carbohydrate intake by detemir in comparison with human insulin was also observed in analyses taking into account the energy received in the form of intravenous glucose ( table 3 ) . differences in carbohydrate and protein intake between conditions correlated significantly with respective differences in dc - potential shifts ( averaged over all recording sites ) from 21 to 90 min of infusions ( r = 0.74 , p < 0.04 , and r = 0.87 , p < 0.01 , respectively , bivariate pearson coefficients ) . the respective correlation with total energy intake failed to reach significance ( r = 0.61 , p = 0.11 ; r = 0.21 , p > 0.62 for fat intake ) . food intake after euglycemic infusion of human insulin and detemir food intake from a test buffet of 4,650 kcal offered 20 min after infusion of human insulin and insulin detemir , respectively , had been stopped and from which subjects were allowed to eat ad libitum for 50 min . bottom lines indicate food consumption including the amount of energy infused as glucose to maintain euglycemia until the end of the test buffet . right column indicates significance for differences between conditions ( t test ; n = 15 ) . ten - point scale hunger ratings did not differ between conditions , showing the expected decline from baseline ( detemir , 4.87 0.68 ; human insulin , 5.93 0.54 ; p > 0.11 ) and post - eeg recording values ( 5.87 0.62 vs. 5.93 0.56 , p > 0.91 ) to low postingestion levels ( 1.47 0.43 vs. 1.00 0.24 , p > 0.33 ; p > 0.12 for treatment time ) . a comparable pattern without significant differences between conditions was observed for thirst ( all p > 0.12 ) and tiredness ( p > 0.33 ) ratings . according to the bipolar questionnaire , subjects in the detemir compared with the human insulin condition felt more critical ( critical - comfortable , 2.87 0.13 vs. 3.27 0.18 , p < 0.009 ) and reported increased wakefulness ( sleepy - awake , 3.33 0.23 vs. 2.73 0.23 , p < 0.03 ) and hunger ( full - hungry , 4.20 0.20 vs. 3.53 0.22 , p < 0.01 ) immediately after infusions . the mood adjective checklist did not yield significant differences between conditions for any of the subscales . 1a ; p > 0.14 for all comparisons ) , resulting in identical total amounts of energy supplied via glucose infusion ( human insulin , 240.8 23.3 kcal ; detemir , 239.5 25.0 kcal ; p > 0.93 ) . correspondingly , blood glucose concentrations were comparable throughout the experiment ( fig . 1b ; p > 0.34 for all comparisons ) as well as when restricting analysis to the period of insulin infusion ( p > 0.13 ) . serum c - peptide concentrations did not differ between conditions during insulin infusion ( p > 0.25 ) but rose to slightly elevated levels in the human insulin compared with the detemir condition at the end of experiments ( fig . 1d ) as well as leptin did not differ between conditions ( all comparisons , p > 0.40 ) . concentrations of plasma acth ( p > 0.57 ) and serum cortisol ( p > 0.71 ) were likewise similar in both conditions , with cortisol levels showing the expected meal - related increase ( f = 4.19 , p < 0.008 ) . a : rates of glucose infused to maintain euglycemia and concentrations of ( b ) blood glucose , ( c ) serum c - peptide , and ( d ) serum glucagon during intravenous infusion of human insulin ( ) and insulin detemir ( ) , respectively . infusions started with an insulin bolus injection ( human insulin , 17.75 mu / kg body wt ; detemir , 90 mu / kg body wt ) followed by a steady 90-min infusion ( 1.0 vs. 2.0 mu kg min ) . at 20 min after the end of infusions , subjects ate ad libitum from a test buffet . the dc potential in the detemir condition showed a marked negative shift shortly after insulin injection that reached maximum values exceeding 600 v toward the end of the recording epoch ( fig . analyses of average dc - potential levels during the relevant interval from 21 min after the start until the end of insulin infusions confirmed a distinctly more negative potential level in the detemir than human insulin condition ( f = 7.03 , p = 0.02 ; table 2 ) , with this effect displaying an even topographic distribution ( f = 0.59 , p > 0.59 , for treatment electrode location ) . comparisons with preinjection baseline levels confirmed significance for the negative dc potential in the detemir condition during 2190 min of insulin infusion ( f = 8.53 , p = 0.02 ; f = 1.04 , p > 0.39 for electrode location ) . although dc potentials in the human insulin condition appeared to shift slightly toward positive values over central positions , respective analyses did not yield significant differences from baseline values ( f = 0.17 , p > 0.43 ; table 2 ) . average dc potentials recorded from left and right electrodes over frontal ( f3 , f4 , respectively ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) cortical areas before and during intravenous infusion of human insulin ( thin lines ) and insulin detemir ( bold lines ) , respectively . infusions started with an insulin bolus injection ( human insulin , 17.75 mu / kg body wt ; detemir , 90 mu / kg body wt ) followed by a steady 90-min infusion ( 1.0 vs. 2.0 mu kg min ) . in both conditions , rows of asterisks indicate significance ( p < 0.05 ; t tests ) for point - wise comparisons of the potential levels between conditions ( upper row ) and between the detemir condition and respective baseline levels ( lower row ) . dc - potential levels during euglycemic infusion of human insulin and detemir average dc - potential levels ( in v ) over left and right frontal ( f3 , f4 ) , frontocentral ( fc3 , fc4 ) , and central ( c3 , c4 ) cortical areas from 21 to 90 min of intravenous infusion of human insulin ( hi ) and insulin detemir ( det ) , respectively . the right three columns indicate significance for differences , respectively , between conditions and between the potential levels in the human insulin and detemir conditions and respective baseline levels ( t test ; n= 11 ) . detemir in comparison with human insulin significantly reduced food consumption by 303 135.7 kcal . macronutrient comparisons suggested this effect was particularly pronounced for protein and , to a lesser extent , for carbohydrate intake , but there was no significant statistical interaction between the factors treatment and macronutrients ( f = 1.63 , p > 0.22 ) . the reduction in total energy consumption and also carbohydrate intake by detemir in comparison with human insulin was also observed in analyses taking into account the energy received in the form of intravenous glucose ( table 3 ) . differences in carbohydrate and protein intake between conditions correlated significantly with respective differences in dc - potential shifts ( averaged over all recording sites ) from 21 to 90 min of infusions ( r = 0.74 , p < 0.04 , and r = 0.87 , p < 0.01 , respectively , bivariate pearson coefficients ) . the respective correlation with total energy intake failed to reach significance ( r = 0.61 , p = 0.11 ; r = 0.21 , p > 0.62 for fat intake ) . food intake after euglycemic infusion of human insulin and detemir food intake from a test buffet of 4,650 kcal offered 20 min after infusion of human insulin and insulin detemir , respectively , had been stopped and from which subjects were allowed to eat ad libitum for 50 min . bottom lines indicate food consumption including the amount of energy infused as glucose to maintain euglycemia until the end of the test buffet . right column indicates significance for differences between conditions ( t test ; n = 15 ) . ten - point scale hunger ratings did not differ between conditions , showing the expected decline from baseline ( detemir , 4.87 0.68 ; human insulin , 5.93 0.54 ; p > 0.11 ) and post - eeg recording values ( 5.87 0.62 vs. 5.93 0.56 , p > 0.91 ) to low postingestion levels ( 1.47 0.43 vs. 1.00 0.24 , p > 0.33 ; p > 0.12 for treatment time ) . a comparable pattern without significant differences between conditions was observed for thirst ( all p > 0.12 ) and tiredness ( p > 0.33 ) ratings . according to the bipolar questionnaire , subjects in the detemir compared with the human insulin condition felt more critical ( critical - comfortable , 2.87 0.13 vs. 3.27 0.18 , p < 0.009 ) and reported increased wakefulness ( sleepy - awake , 3.33 0.23 vs. 2.73 0.23 , p < 0.03 ) and hunger ( full - hungry , 4.20 0.20 vs. 3.53 0.22 , p < 0.01 ) immediately after infusions . the remaining dimensions and the post food intake assessment were not affected . the mood adjective checklist did not yield significant differences between conditions for any of the subscales . administration of insulin to the central nervous system reduces food intake ( 3,5 ) and body weight ( 4,6 ) . we demonstrate that while eliciting comparable peripheral effects , euglycemic infusion of insulin detemir compared with human insulin triggers a distinct negative shift in eeg dc - potential recordings and reduces calorie uptake in healthy men , supporting our hypothesis that detemir affects brain functions to a greater extent than human insulin and induces stronger anorexigenic effects on central nervous networks that control food intake . this outcome suggests that enhanced catabolic insulin signaling to the brain may be an important mechanism behind the limitation of weight gain observed in diabetic patients receiving detemir treatment ( 9,1114 ) . in accordance with other investigators ( 15,17 ) , we administered insulin doses that were considerably higher in the detemir than in the human insulin condition to compensate for the delayed onset that human insulin accordingly , timing and strength of the effects of detemir and human insulin on systemic glucose homeostasis as reflected by the rates of glucose infusion as well as blood glucose and serum glucagon concentrations were identical . c - peptide concentrations likewise did not differ between conditions during insulin infusion , merely showing a slight increase in the human insulin condition after the test buffet that may have been due to greater food intake in this compared with the detemir condition . congruent peripheral effects were also indicated by comparable serum leptin concentrations that are known to respond to insulin infusion ( 27,28 ) . on the background of equipotent systemic effects , detemir elicited a marked brain response as indicated by a widespread negative shift of scalp - recorded dc potentials that started around 15 min after detemir bolus injection and exceeded potential levels in the control condition that remained unaffected by human insulin infusion . in the human insulin condition , subjects received roughly the same total amount of insulin that , when administered in single bolus form , induced a negative dc - potential shift in foregoing experiments ( 21 ) . slowly infused over the course of 90 min , this dose obviously was too weak a stimulus to evoke dc - potential responses to human insulin in the present experiments . in contrast , the 90-min infusion of a detemir dose equivalent in terms of systemic action triggered a sustained negative dc - potential shift comparable with the previously reported effect of human insulin administered in high - dose bolus form ( 21 ) . this pattern indicates that although central nervous detemir effects may be mimicked by disproportionally high doses of human insulin , the relative impact of detemir on brain functions is considerably greater when both insulins are administered at doses with similar peripheral impact . the mechanisms behind the strong effect of detemir on scalp - recorded dc potentials can not be derived from our data . brain dc - potential shifts of this amplitude most likely reflect changes in extracellular ionic concentrations stemming from potential shifts at glial membranes that are endowed with receptors for insulin and igf ( 21,2931 ) . the assumption of a widespread effect on cerebral cellular networks also fits with the global nature and long duration of the dc - potential shifts induced by detemir infusion . our observations corroborate previous findings of increased brain responses to detemir in comparison with human insulin in animals ( 32 ) and humans ( 1517 ) . superior central nervous efficacy of detemir may be due to improved permeation of the lipophilic molecule into the brain compartment , with enhanced receptor - mediated blood - brain barrier transport of albumin - bound detemir adding to this effect ( 15,32 ) . the detemir - induced negative dc - potential shift that is presumably of primary glial origin thus may be reinforced by electrical potentials generated in the course of receptor - mediated detemir transport across the blood - brain barrier ( 33 ) . a most remarkable finding of our study is the reduction of ad libitum food intake by around 300 kcal in the detemir compared with the human insulin condition in the presence of identical peripheral actions of both insulins . this pattern renders the contribution of systemic mediators to this effect highly unlikely , rather suggesting that enhanced central nervous insulin signaling in the detemir condition resulted in decreased caloric intake . the concept of insulin providing catabolic feedback on the body 's energy resources to brain networks that control energy homeostasis has been well established in animals ( 2,3 ) as well as in humans ( 5,6 ) . thus , the decrease in food intake after detemir compared with human insulin infusion suggests that the enhanced effect on brain functions indicated by the negative dc - potential shift particularly impacts the central nervous control of food intake . although because of methodological constraints , dc - eeg could not be recorded during food intake proper ( 34 ) , this interpretation is supported by the strong correlation between the reduction in calorie intake and the antecedent dc - potential effect elicited by detemir . it is also in line with animal experiments in which intravenous detemir compared with human insulin injections were associated with enhanced insulin receptor phosphorylation in hypothalamic and cerebrocortical tissue in conjunction with increased eeg - assessed cortical activity , whereas the activation of the insulin receptor signaling cascade was similar in muscle tissue and liver ( 32 ) . interestingly , detemir compared with human insulin infusion increased rather than decreased self - rated hunger before test buffet presentation , which may have been due to a biasing influence of enhanced wakefulness and activation after detemir infusion ( 35 ) . alternatively , this finding may also indicate that central nervous insulin exerts its anorexigenic effects via meal - related signals that contribute to the termination of a meal , but not by affecting hunger motivation per se ( 5 ) . weight gain is a frequent side effect when blood glucose levels of diabetic patients are normalized by insulin ( 36,37 ) , but is less pronounced in patients undergoing detemir therapy ( 9,1114 ) . the assumption that the use of detemir limits weight gain because its favorable safety profile decreases defensive snacking to prevent hypoglycemia was not supported by comparative clinical studies showing that insulin glargine , which like detemir reduces the risk of hypoglycemia , is associated with greater weight gain than detemir ( 38,39 ) . against this background , the anorexigenic brain impact of detemir found in our study rather suggests the contribution of central nervous mechanisms to the weight - sparing effect of detemir in the clinical context .

objectivein the treatment of diabetic patients , the long - acting insulin analog insulin detemir is less prone to induce weight gain than other insulin formulations . assuming that because of its pharmacologic properties , detemir displays stronger central nervous anorexigenic efficacy than human insulin , we compared acute effects of human insulin and detemir on electroencephalography ( eeg ) measures and food intake.research design and methodsfrontocortical eeg direct current ( dc ) potentials were recorded in 15 healthy men during two hyperinsulinemic - euglycemic clamps that included an insulin bolus injection ( human insulin , 17.75 mu / kg body wt ; detemir , 90 mu / kg body wt ) followed by a steady 90-min infusion ( 1.0 vs. 2.0 mu kg1 min1 ) . a higher dosage was chosen for detemir to compensate for its delay in impact relative to human insulin and to elicit similar systemic effects . at 20 min after infusion , subjects were allowed to eat ad libitum from a test buffet.resultsmean glucose infusions to maintain euglycemia ( p > 0.93 ) and blood glucose concentrations ( p > 0.34 ) did not differ between conditions . detemir infusion induced a negative dc - potential shift , averaging 372.2 v from 21 to 90 min that was not observed during human insulin infusion ( 146.5 v , p = 0.02 ) . detemir , in comparison with human insulin , reduced subsequent food intake by 303 kcal ( 1,257 vs. 1,560 , p < 0.04).conclusionswhile inducing comparable peripheral effects , detemir exerts stronger acute effects on brain functions than human insulin and triggers a relative decrease in food consumption , suggesting an enhanced anorexigenic impact of detemir compared with human insulin on central nervous networks that control nutrient uptake .

RESEARCH DESIGN AND METHODS Subjects and design. Procedure. Food intake and mood assessment. Recordings. Statistical analysis. RESULTS Glucose infusion rates, blood glucose, and hormonal parameters. Negative DC-potential shift during detemir infusion. Reduction of food intake by detemir in comparison with human insulin. Rating scales. DISCUSSION

to increase blood safety , we introduced minipool nat screening in our blood donor service in 1997 for hepatitis b virus ( hbv ) , hepatitis c virus ( hcv ) , and hiv-1 and in 2000 for hepatitis a virus ( hav ) and parvovirus b19 ( 4 ) . for these purposes , 100-l aliquots of up to 96 blood samples were pooled . the complete pool of up to 9.6 ml was centrifuged at 58,000 g for 60 min at 4c . viruses were extracted by using spin columns , and nucleic acid was eluted in a total volume of 75 l . only 60 l of extract is needed for routine nat screening . a residual volume of 15 l can then be used for additional nat testing ( 5 ) for influenza viruses . the real - time quantitative amplification of influenza / h5 was performed according to the manufacturer s instructions ( artus influenza / h5 lc rt - pcr kit , qiagen , hamburg , germany ) by using a thermocycler ( lightcycler ; roche applied science , mannheim , germany ) . the specificity of this reaction was demonstrated for all subtypes of influenza a ( h1h15 , n1n9 ) and all subtypes of influenza b. samples with a positive test result in the first pcr were analyzed in a second pcr with influenza ( h5n1)specific primers and probes . therefore , the assay allows differentiation between avian influenza ( h5n1 ) and other influenza virus strains . to mimic a situation like an h5-positive donation , a purified culture supernatant of vero cells infected with influenza ( h5n1 ) ( strain a / thailand/1 ( kan-1)/2004 ) ( 6 ) was used as an external quantification standard . the viral rna concentration was determined in an external laboratory by multiple quantitative real - time pcr determinations ( 7 ) . different dilutions of the external influenza ( h5n1 ) subtype quantification standard ( 0.0 , 0.91 , 1.96 , 3.91 , 7.81 , 15.63 , 31.25 , 62.5 , 125 , and 250 pfu / ml ) were prepared , and 100 l of each dilution was spiked into 9.5-ml negative plasma pools . each dilution was repeatedly spiked and tested in 8 minipools . five microliters of the extract was analyzed with the generic influenza nat as well as with the specific influenza ( h5n1 ) nat . probit analysis of these data yielded a detection probability of > 95% in parallel tests when an average of at least 13.4 pfu / ml ( 95% confidence interval [ ci ] 8.3184 pfu / ml ) and 7.4 pfu / ml ( 95% ci 5.214.7 pfu / ml ) for influenza generic assay and for the influenza ( h5n1)specific test , respectively , were present in individual plasma samples before pooling . * influenza ( h5n1 ) standard was extracted from 9.6 ml of 96 pooled donor samples after centrifugation . the 95% detection limit was 13.4 pfu / ml ; the 50% detection limit was 4.8 pfu / ml . * influenza ( h5n1 ) standard was extracted from 9.6 ml of 96 pooled donor samples after centrifugation . the 95% detection limit was 7.4 pfu / ml ; the 50% detection limit was 2.5 pfu / ml . a total of 117 routine minipools , representing 10,272 blood donor samples , containing an average of 88 8 samples per pool , had previously been tested for hiv-1 , hbv , hcv , hav , and parvovirus b19 . all pools were negative for influenza virus when tested with the generic influenza pcr and the influenza ( h5n1)specific pcr . one pool had invalid results ( failed amplification of internal control rna , representing 0.01% of all analyzed runs ) . ( 8) , nat significantly increased the safety of blood products . at the german red cross , look - back examinations showed only 1 transfusion had transmitted hiv-1 ( 1998 ) after the introduction of nat testing . blood donor screening by nat was made technically and financially feasible by creating minipools of up to 96 individual samples per pool . roth et al . demonstrated an efficient enrichment for all tested viruses in plasma samples ( 9 ) . in the absence of an infective donor , different concentrations of the new influenza genotype h5n1 were spiked into minipools of 95 samples . as shown in table 2 , the influenza ( h5n1 ) subtype was detected by the generic influenza primers as well as by the influenza ( h5n1)specific primers when our routine minipool screening procedure was used . sensitivity was expressed as pfu / ml and can be converted into viral genome copy number according the calculation of yoshikawa et al . therefore , the analytical sensitivity was 804 geq / ml and 444 geq / ml for a generic influenza and for the influenza ( h5n1 ) subtype , respectively . after screening 10,272 samples by minipool nat , none of the samples were found to be infected by influenza , which corresponds with the low eiss index ( european influenza surveillance scheme index ) of < 20 during the study period ( february april , 2006 ) ( 10 ) . an eiss index > 80 is expected during an influenza epidemic , as was seen in 2005 . as with other viruses , a viremic phase of infection can be assumed to precede clinical symptoms such as fever ( 13,14 ) . ( 15 ) detected influenza ( h5n1 ) virus ( 3,080 copies / ml ) in the plasma of a 5-year - old boy , which indicates a viremic phase of influenza ( h5n1 ) infection . in addition to quarantine of infected patients , treatment with antiviral drugs , and development of avian influenza vaccines , blood donors should be tested during a pandemic to avoid transfusion - transmitted infections . our study demonstrates that nat screening could be incorporated into blood testing without delay and that the influenza virus could be sufficiently enriched by centrifugation . sensitivity of our influenza - screening method would have been sufficient to detect recently reported virus concentrations in plasma of infected persons ( 15 ) . however , as with all minipool methods , infections can be transmitted to transfusion recipients on rare occasions because the viremia level in the donor is below the analytical sensitivity of the screening assay . to reduce this risk , a selective infectious dose nat strategy ( e.g. , triggering of infectious dose nat testing when at least 1 viremic donation is collected per week with the standard minipool screening algorithm ) , as performed for west nile virus ( wnv ) screening in the united states implementation of wnv - nat in the united states in 2003 interdicted well over 1,000 donations from persons infected with wnv and is a good example of successful implementation of nat screening for emerging viruses . the collective fight against new viruses such as severe acute respiratory syndrome virus , wnv , or influenza ( h5n1 ) presents an immense challenge for the whole community , but new molecular - biologic methods offer opportunities to overcome this challenge . nat screening tests are now available soon after the sequencing of new viruses . in the absence of a general pathogen inactivation method for all blood products ( erythrocytes , platelets , and plasma )

influenza viruses , including highly pathogenic avian influenza virus ( h5n1 ) , could threaten blood safety . we analyzed 10,272 blood donor samples with a minipool nucleic acid amplication technique . analytical sensitivity of the method was 804 geq / ml and 444 geq / ml for generic influenza primers and influenza ( h5n1 ) subtype specific primers . this study demonstrates that such screening for influenza viruses is feasible .

The Study Conclusions

small cell lung cancer ( sclc ) accounts for 1320% of all lung cancer diagnoses and is commonly classified into two stages , limited and extensive , according to the veteran 's administration lung cancer study group ( valg ) classification system . this system is used because most sclc patients present at a stage for which surgery is not appropriate , and thus are usually unable to be classified by the more commonly used cancer staging classification system , tumor - node - metastasis ( tnm ) , which requires surgical confirmation to achieve an accurate classification . sclc is characterized generally by a rapid growth rate , initial sensitivity to chemotherapy and radiation , and early metastasis to regional lymph nodes and/or distant sites . limited sclc is generally described as disease limited to one hemithorax , while extensive sclc is described as disease present in both hemithoraxes and/or metastasized to more distant areas of the body . those with limited stage sclc have a better prognosis than those with extensive stage disease . the median survival for limited sclc patients is 23 months , while those with extensive sclc have a median survival of 812 months , if treatment is administered . over 50% of lung cancer patients in canada are diagnosed at 70 years of age or older while over 20% are diagnosed at age 80 years or older . the standard of care for patients with sclc combined concurrent chemoradiotherapy for those with limited disease and chemotherapy alone for those with extensive disease . the preferred chemotherapy regimen is etoposide plus cisplatin ; however , etoposide plus carboplatin is an acceptable alternative for patients who are unable to tolerate cisplatin . many elderly sclc patients are not selected to receive chemotherapy , however , for fear of toxicity due to their age and the presence of comorbidities [ 7 , 8 ] . it is also recommended that patients who have achieved remission or stable disease after the completion of primary treatment receive prophylactic cranial radiation ( pci ) to reduce the risk of brain metastases . additionally , if a patient is not a good candidate for or refuses chemotherapy , they may receive radiation to symptomatic sites . evidence - based care for the elderly lung cancer population is lacking due to the underrepresentation of this population in clinical trials . cancer trials tend to consider 70 years of age as the reference point for being elderly ; however , there is not a specific minimum age that clearly defines the term . the tendency to exclude elderly patients from cancer treatment clinical trials on the basis of chronological age is largely because older patients are more likely to have serious comorbid conditions and have reduced organ function which can lead to higher drug - related toxicities [ 1114 ] . many elderly people , however , do not have any measurable loss of functional capacity and are free from significant medical problems . in canada , it has been estimated that 45% of those 7584 years of age and 22% of those 85 years of age and older are in overall good health . in addition , studies have shown that age alone is not significantly associated with adverse prognosis [ 7 , 17 ] . this suggests that elderly patients should not be excluded from therapeutic opportunities solely on the basis of age [ 18 , 19 ] . the care of elderly patients is , however , often complicated by comorbidities , frailty , and decreased organ function . the purpose of this study was to describe the receipt of chemotherapy provided to elderly patients with sclc in alberta , canada , and assess their chemotherapy tolerance and survival . we also sought to identify the reasons for not recommending chemotherapy and for dose reductions and assess the relationship of patient age in these decisions . in the absence of clear evidence from clinical trials , the analysis of the elderly sclc population through retrospective population - based studies such as this one helps assess and quantify the value of treating elderly cancer patients with chemotherapy . a retrospective , population - based study was conducted on all residents of alberta , canada , diagnosed with sclc at the age of 75 years or older in years 20042008 who had an oncologist - consult . selection of 75 years was chosen because the median patient age for sclc in alberta is about 70 years , and we wanted to focus on the significant minority of elderly patients . furthermore , on basis of our clinical experience , we felt that patients who are 75 years and older are the ones for whom ideal treatment is the least clear ; we , therefore , selected 75 years as the age cut - off . the province of alberta consists of an area of 660,000 km and has a population of 3.7 million . the healthcare system in alberta is funded and administered publically , as it is throughout all of canada ; standard cancer care such as consultations with specialists and chemotherapy is free to residents . consultations with oncologists , nonsurgical cancer treatment , and other services are provided at cancer care facilities . prior to receiving chemotherapy , a patient must be referred to one of six cancer facilities in the province to have a consultation with an oncologist with whom treatment options are discussed . two of these cancer facilities are located in the major cities of edmonton and calgary ; the remaining four are located in smaller cities . the alberta cancer registry was used to identify patients 75 years of age or older diagnosed with sclc ( international classification of diseases for oncology ( icd - o-3 ) topography codes c34.0c34.9 and morphology codes 80408045 ) in years 20042008 . patients were excluded if they were not residents of alberta , were diagnosed with combined small cell and nonsmall cell lung cancers , or had another cancer diagnosis for which they were receiving treatment . gender , date of birth , and date of death were also obtained from this source . the alberta cancer registry has been repeatedly recognized by the north american association of central cancer registries ( naaccr ) for its high level of completeness and for the timeliness of its data reporting . a chart review was conducted on all potentially eligible patients identified from the cancer registry to identify those who had an oncologist - consult and to obtain details of the chemotherapy received . the following data were extracted from patient charts : cancer stage ; presence and type of comorbidities ; eastern cooperative oncology group ( ecog ) performance status ; whether or not chemotherapy was recommended by the oncologist ; reasons for not recommending chemotherapy ; whether chemotherapy was administered or patient refused reasons patient refused chemotherapy ; chemotherapy start date ; treatment regimen received ; whether the patient received all chemotherapy cycles ; number of cycles received if less than the complete amount ; reasons for incomplete chemotherapy cycles ; whether dose reduction occurred ; reasons for dose reduction and changes to the initially recommended chemotherapy regimen . a complete course of chemotherapy was defined as receiving any of the regimens once every three weeks for 4 cycles . dose reduction was defined as any reduction in the dose of chemotherapy administered to the patient , compared to the recommended dose ; dose reduction that occurred at any time during chemotherapy treatment , including the first cycle , was included . information about other treatments received , such as radiation or second - course treatment , were not collected ; however , it is likely that most , if not all , patients with limited stage disease who received chemotherapy also received radiation . patients with extensive stage disease , however , would only have received radiation to relieve symptoms ; such treatment is palliative and would not impact survival . descriptive statistics were calculated to describe the utilization and tolerance of chemotherapy in the sclc patients who had an oncologist - consult . exploratory data analyses were performed to determine cut - off values for continuous variables and to assess the relationships of these variables with commencing chemotherapy , dose reductions , and not completing all chemotherapy cycles . chi - square test or fisher 's exact test ( if the expected value of a cell was less than 5 ) were performed to assess the statistical significance of these associations . kaplan - meier ( k - m ) curves were generated to compare patient survival by age ( < 80 versus 80 ) and treatment completeness status . in order to ensure chemotherapy , completeness status was known at the beginning of the time period ; the start time ( t0 ) was defined as 12 weeks after the oncologist - consult ; all patients were followed to the earlier of their death date or december 31 , 2010 . the log - rank test and the wilcoxon test were used to determine statistical differences between the curves . cox proportional hazard models were used to estimate the effect of treatment status on patient survival , adjusting for ecog score , disease stage , age at diagnosis , number of comorbidities , and chemotherapy regimen used . as in the k - m graphs , the start time ( t0 ) was defined as 12 weeks after the oncologist - consult date in order to categorize patients properly for chemotherapy completion and dose reduction statuses . the wald chi - square test was used to calculate p values for the hazard ratio estimates . sas software ( version 9.2 ; sas institute , cary , nc , usa ) was used to perform all analyses . there were 238 patients aged 75 years or older diagnosed with sclc in alberta , canada , in years 2004 to 2008 . of these , 11 were excluded for the following reasons : 2 were not residents of alberta ; 7 had a diagnosis of combined non - small cell and small cell lung cancer ; and 2 had another cancer diagnosis for which they were receiving treatment . of the remaining 227 potentially eligible patients , 171 ( 75% ) had an oncologist - consult to discuss treatment options and were included in this study . there were 56 patients ( 25% of those potentially eligible for this study ) who did not have an oncologist - consult . relative to the patients who had an oncologist - consult , those who did not tend to be older ( 46% were older than 80 years compared to 35% ) . additionally , almost half of them ( 46% ) died within two weeks of their diagnosis . figure 1 shows a flow chart of the proportion of patients for whom chemotherapy was recommended , began chemotherapy , refused it , received regimen , completed chemotherapy , and who received versus who did not receive chemotherapy cycles at the full dose . of the patients who had an oncologist - consult , 84% were recommended chemotherapy and 68% began chemotherapy ( including one patient who commenced chemotherapy despite the fact it is not recommended ) . the chemotherapy regimens received were cisplatin / etoposide , carboplatin / etoposide , cyclophosphamide / adriamycin / vincristine ( cav ) , and oral etoposide . the regimens most frequently used were combinations carboplatin / etoposide ( 47% ) and cisplatin / etoposide ( 31% ) . of those who began chemotherapy , 52% completed all cycles , 66% did not have any dose reductions , and 31% completed all cycles at the recommended dose . of those who completed all cycles of chemotherapy , 34% had limited stage disease . the relationship between the demographic and clinical characteristics of the patients included in the study and age is shown in table 1 . just over half of the patients in both age groups were male , and 77% had extensive disease . a higher percentage of patients 80 years and older had an ecog score of 3 or 4 compared to those 7579 years , 47% versus 39% , respectively , p = 0.18 . patients 80 years and older were more likely to have two or more comorbidities than those aged 7579 , 62% versus 48% , respectively . table 2 displays the demographic and clinical characteristics of the patients included in the study and the relationship between those characteristics and beginning chemotherapy , having a dose reduction , and incomplete chemotherapy cycles . of the patients included in the study , 57% were male , 35% were 80 years or older , 77% had extensive disease , 42% had an ecog score of 3 or 4 , and 24% had 3 or more comorbidities . a higher percentage of patients aged 7579 received chemotherapy than those 80 years or older , 74% versus 58% , respectively , p = 0.15 . of those who received chemotherapy , a higher percentage of patients 80 years or older had dose reductions than those 7579 years , 46% versus 29% , respectively , p = 0.09 . just over half of patients in both age groups , however , received all cycles of chemotherapy . patients with limited disease were more likely to receive chemotherapy than those with extensive disease ( 87% versus 63% , p = 0.02 ) ; of those who received chemotherapy , 52% ( 43 patients ) with extensive disease did not complete all chemotherapy cycles compared to 36% ( 12 patients ) with limited stage disease , p = 0.13 . similarly , patients with a poor performance status ( ecog 3 or 4 ) were less likely than those with a good performance status to complete all cycles of chemotherapy , 65% versus 37% , p = 0.007 . of those who had an oncologist - consult , 28 patients ( 16% ) were not recommended chemotherapy , and 27 patients ( 19% ) for whom chemotherapy was recommended refused it . oncologists ' reasons for not recommending chemotherapy and patients ' reasons for refusing it are listed in table 3 . the most common reason oncologists indicated for not recommending chemotherapy was patient performance status ( 22 of 28 patients ) . the second most common reason was the presence of comorbidities ( 16 of 28 patients ) . most patients who refused chemotherapy did so due to concerns about toxicity ( 20 of 27 patients ) . of those who began chemotherapy , the most common reason for dose reduction was hematological toxicity ( 30 of 40 patients ) , while 10 of 40 patients had a dose reduction due to frailty and performance status ( table 4 ) . similarly , receipt of an incomplete number of chemotherapy cycles was largely attributable to hematological toxicity ( 32 of 56 patients ) , concerns regarding frailty and performance status ( 25 of 56 patients ) , and non - hematological toxicity ( 19 of 56 patients ) . table 5 outlines the drug regimens received and the number of cycles completed by treatment status . patients who received the carboplatin / etoposide regimen were twice as likely to have dose reductions as those who received oral etoposide , 44% versus 20% , respectively , p = 0.13 . conversely , those who received the oral etoposide regimen were more likely to receive an incomplete number of chemotherapy cycles than those who received the combined etoposide / platin - based regimens , 64% versus 43% , respectively , p = 0.05 . of those who began chemotherapy , 61 patients ( 52% ) completed all cycles ; 25 ( 41% ) of those who completed all cycles had a dose reduction . a large proportion ( 26% ) of people who began chemotherapy only completed one cycle even though 20% of these people received it at a reduced dose . all but four patients died by the end of the follow - up period , december 31 , 2010 . lung cancer was the recorded cause of death for all patients with the exception of 14 ; 13 patients died of a noncancer related cause , and one patient died of prostate cancer . figure 2 displays k - m survival curves by chemotherapy cycle completion status ( complete versus incomplete / did not receive ) and age group ( 7579 versus 80 or older ) . those who completed chemotherapy had a better survival rate than those who did not ( p < 0.0001 ) . the median survival for those who did not complete chemotherapy was 3 months and 23 days , compared to 7 months and 13 days for those who completed all cycles . the survival rate of those who completed chemotherapy did not differ by age group ( p = 0.21 ) . table 6 presents the results from the adjusted survival analysis , generated from the cox proportional hazards model . the risk of death for patients who did not complete all cycles of chemotherapy was 2.72 ( 95% confidence interval : 1.52 to 4.87 ) relative to those who completed chemotherapy at full dose after adjusting for other variables ( p = 0.0007 ) . the risk of death for patients who completed treatment at a reduced dose did not differ from those who completed chemotherapy at the full dose ( hr = 1.02 , 95% confidence interval : 0.57 to 1.82 , p = 0.94 ) . due to the overlapping confidence intervals between the completed / reduced dose group and the not completed group , the model was rerun using the completed / reduced dose group as the reference . in this analysis , the risk of death for patients who did not complete chemotherapy was 2.67 ( 95% confidence interval : 1.45 to 4.91 , p = 0.0016 ) similar to the results shown in table 6 using the completed / full dose group as the reference . the purpose of this study was to describe the uptake and tolerance of chemotherapy among elderly patients with sclc and assess their survival . these elderly patients , compared to those 7579 years of age , received less chemotherapy and were more likely to receive a dose reduction , but were equally likely to complete all chemotherapy cycles . notably , the adjusted hazard ratio of death did not differ between the two age groups . overall , 52% of patients who began chemotherapy completed all cycles , and 41% had reduced chemotherapy doses . these results are confirmation that a significant proportion of elderly patients are able to tolerate chemotherapy and receive a survival benefit from it even in the presence of dose reductions . our results also suggest that elderly patients who have their chemotherapy dose reduced but complete all chemotherapy cycles have a similar survival ( hr 1.02 , ci 0.571.82 ) to those who complete all chemotherapy cycles at the full dose , after adjusting for ecog score , disease stage , age , co - morbidity count , and drug regimen . several phase ii clinical trials have tested the efficacy of lower dose combinations of concurrent carboplatin and etoposide regimens in elderly sclc patients [ 2326 ] . despite some differences in treatment schedule and dosing , three of these studies reported similar survival results as the usual treatment regimen , with a median survival of 4146 weeks . one of these studies reported lower median survival , however , with a median survival of 37 weeks . further investigation is , therefore , warranted to better assess the relationship between chemotherapy dose reduction and survival of elderly sclc patients . a larger study similar to ours which included a population - based group of elderly sclc patients was conducted in the netherlands . the most common reasons for not receiving chemotherapy were a combination of age , co - morbidity , poor performance status , and refusal by the patient or family , which are similar reasons as those identified in our study . they found that 53% of sclc patients received chemotherapy , which is also similar to the 52% of potentially eligible patients from our study that received chemotherapy . as well , a similar percentage of patients had a dose reduction ( 30% versus 34% ) and were unable to complete all chemotherapy cycles ( 43% versus 47% ) in the netherlands study compared to the current study . although a large proportion of elderly patients were able to tolerate and experience a survival benefit from chemotherapy , 48% of patients who began chemotherapy were not able to complete all treatment cycles and did not have a survival benefit . the difficulty is identifying the ones who are ; there is a need for a reliable means to identify elderly patients who would benefit from chemotherapy that does not base its conclusions on chronological age and rather aims to determine biological age by the measurement of objective standard measures [ 6 , 19 , 28 ] . the use of a multidimensional geriatric assessment tool for this purpose has been suggested as a means of achieving this end [ 19 , 29 ] . suggested domains of the assessment tool include co - morbidity , functional status , emotional conditions and mental status , social support , polypharmacy , and nutritional state . even though the tool was first introduced over 15 years ago , the best form of the tool has yet to be defined [ 6 , 29 ] . further efforts are needed to optimize such a tool and implement it in routine practice . a limitation to the study is the nature of all retrospective studies in that they can not prove causality . additionally , there is always selection bias in terms of which patients receive treatment in a real clinical situation as opposed to a clinical trial setting . on the other hand , an inherent strength of a population - level retrospective study such as this one is that the treatment and outcome can be described for every patient , as we have done so herein . the major limitations are in obtaining complete information on all the factors that might impact one of or both treatment and outcome in order to properly adjust for them in analyses . in our study we had limited information on the patients who did not have an oncologist - consult , representing 25% of the entire population of sclc patients aged 75 years or older in alberta . the data we do have , however , suggests that many of these patients would not have been candidates for any kind of treatment as they died very soon after being diagnosed . it is possible , however , that some of them could have benefited from chemotherapy but did not have the opportunity because they were not referred to an oncologist , were unable to obtain transportation to an oncologist , were not interested in receiving chemotherapy , or another reason . we were not able to identify reasons for not seeing an oncologist . regarding the patients who did have an oncologist - consult , performance status was missing for 18% of patients , and we did not collect information on receipt of other treatment modalities which could have affected survival and the ability to tolerate chemotherapy . it is possible that there is also missing / incomplete information related to the specific reasons for dose reductions and incomplete cycles . a further limitation arises from the relatively small number of patients with limited disease , which prevented us from fully exploring the interrelationships between age , stage , chemotherapy uptake , tolerance , and survival . we have shown that while an appreciable proportion of elderly patients diagnosed with sclc do not begin chemotherapy treatment , those that do are able to tolerate the treatment and receive survival benefits from it . it is , therefore , vital that elderly patients as well as younger patients are considered for established treatment . our results also suggest that elderly sclc patients who complete chemotherapy at a reduced dose have a similar prognosis to those who receive the full dose . future research should focus on better understanding the relationship between frailty and toxicity to ensure the careful selection of patients who will benefit from chemotherapy treatment .

the treatment of elderly cancer patients is complicated by many factors . we sought to assess the uptake and tolerance of chemotherapy among patients 75 years and older diagnosed with small cell lung cancer ( sclc ) in years 20042008 in alberta , canada , and assess their survival . all patients who met the above criteria and had an oncologist - consult were included . data were obtained from the alberta cancer registry and chart review . a total of 171 patients were included in the study , 117 ( 68% ) of whom began chemotherapy . of those , 52% completed all cycles , 66% did not have any dose reductions , and 31% completed all cycles at the recommended dose . the risk of death for patients who did not complete all cycles of chemotherapy was 2.72 ( 95% ci : 1.524.87 ) and for those who completed all cycles but with a reduced dose was 1.02 ( 95% ci : 0.571.82 ) relative to those who completed chemotherapy at full dose after adjusting for several demographic / clinical factors . our results suggest that a significant proportion of elderly patients are able to tolerate chemotherapy and receive a survival benefit from it while those who experience toxicity may receive a survival benefit from a reduction in chemotherapy dose as opposed to stopping treatment .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusion

the major cause for the failure of primary endodontic therapy is the persistence of intra- and extra - radicular microbial infections . in every failed case , whenever possible , nonsurgical endodontic retreatment should be preferred in comparison with other radical interventions such as apical surgery or extraction because the nonsurgical retreatment is less invasive and has good long - term survival rates . during nonsurgical endodontic retreatment therapy , for the retrieval of filling materials , several techniques such as hand files , rotary files , and ultrasonic instruments either alone or in combination with heat or solvents have been used . these removal techniques are dependent on the anatomy , size and regions of the root canal , aged , overfilled or overextended , and/or underfilled or underextended fillings . a combination of methods is frequently preferred to achieve a safe , efficient , and potentially complete removal of the filling materials from the root canal system . gutta - percha along with different endodontic sealers is the most commonly used filling material . retrieval of gutta - percha usually does not require a great effort while using the aforementioned techniques either alone or in combination . however , various evidence - based studies till date have reported that filling material residues , especially sealers present on canal walls and in their microscopic ramifications , may either remain inaccessible or resist dissolution . in such cases , organic solvents play a vital role in the thorough removal of endodontic sealers . this facilitates the efficient disinfection of the root canal system and thus the probability of long - term treatment success . although chloroform is considered as the most effective solvent in nonsurgical retreatment , it has been banned by the u.s . food and drug administration in 1976 due to its carcinogenic potential and toxicity to the tissues . therefore , various alternatives such as halothane , rectified turpentine , endosol r and e benzene , methyl chloroform , ether , xylene , orange oil , and eucalyptol have been suggested and used for softening of filling materials . xylene ( dimethylbenzene ) is an aromatic compound and has been reported to be a very efficient solvent for root canal obturating materials . essential oils such as orange oil , eucalyptus oil , and pine oil are able to dissolve most of the endodontic sealers . they have been reported to be safe , biocompatible , noncarcinogenic , and useful for this purpose . therefore , they could influence and consequently determine the clinical effectiveness of the commonly used organic solvents . apexit plus has been studied very well regarding their solubility in various solvents . however , there are as yet no studies that show the effectiveness of the aforementioned solvents on endomethasone n and adseal root canal sealers . therefore , a simple , reproducible , and cost - effective laboratory study was carried out to comparatively evaluate the effectiveness of eucalyptus oil , orange oil , and xylene in dissolving endomethasone n , apexit plus , and adseal . standardized stainless steel molds ( 8 mm diameter , 2 mm height ) were used to prepare two hundred and forty samples ( eighty for each endodontic sealer ) . endomethasone n ( septodont , saint maur , france ) , apexit plus ( ivoclar vivadent , schaan , liechtenstein ) , and adseal ( meta biomed co , cheongju , korea ) had been used in this study and their compositions are shown in table 1 . composition of different endodontic sealers as provided by manufacturers each sealer was mixed according to the manufacturer 's instructions . freshly mixed materials were carefully poured into the sample molds placed on a glass slab using a 2 ml syringe to prevent air entrapment , and a microscope slide covered with cellophane strip was then pressed onto the upper surface to make the surface flat . all samples along with their steel molds were then transferred to a chamber with 80% relative humidity and 37c temperature and left untouched to set sealers for 48 h and then removed from the chamber . the samples were weighed in grams ( up to four decimal places ) 3 times on an analytical balance ( sartorius te214s , sartorius ag , germany ) . the samples were then divided into four groups of twenty each for immersion in different organic solvents . solvents used in this study were eucalyptus oil , orange oil , xylene , and distilled water ( negative control group ) . each group was further subdivided into two equal subgroups ( n = 10 ) for 2 and 10 min of immersion . at room temperature , all sealer samples were immersed completely in 20 ml of solvent stored in glass vials . after the specified immersion period ( 2 and 10 min ) , the samples were removed from glass vial , rinsed with 100 ml of triple distilled water , and then blotted dry with absorbent paper . samples were allowed to dry for 24 h at 37 1c in an oven and then kept in dehumidifier / desiccators . thereafter , the samples were weighed 3 times and the mean was calculated . the amount of sealer dissolved was determined as the difference between the original weight of the sealer and its final weight . data were subjected to statistical analysis of percentage weight loss for each root canal sealer in different solvents at different time intervals and summarized as mean standard deviation . all groups were compared by two factor analysis of variance , and significance of mean difference within and between the groups was done by tukey 's post hoc test . the mean percentage of weight loss of all sealers and their relative solubility in different organic solvents at 2 and 10 min are shown in table 2 and figure 1 . mean percentage with standard deviation ( ) of weight loss for each endodontic sealer in different organic solvents at 2 and 10 min dissolution of different endodontic sealers in different organic solvents in all the solvent groups , all the three sealers showed more weight loss at 10 min than 2 min . the weight loss was highest for endomethasone n followed by apexit plus and adseal at both the periods . in the control group ( distilled water ) , minimum and insignificant ( p > 0.05 ) weight loss was observed for all sealers at both time periods . in essential oils , both apexit plus and endomethasone n dissolved more ( p < 0.001 ) at 10 min as compared to 2 min . however , adseal showed no significant ( p > 0.05 ) difference in its solubility between the periods . in xylene , all sealers showed significantly ( p < 0.05 or p < 0.001 ) more weight loss at 10 min compared to 2 min . for each time period , comparing the effect of eucalyptus oil on sealers , tukey test showed significantly ( p < 0.05 or p < 0.001 ) different and higher weight loss for both apexit plus and endomethasone n as compared to adseal at both 2 and 10 min . dissolution of apexit plus and endomethasone n did not differ ( p > 0.05 ) at 2 min . however , at 10 min , weight loss for endomethasone n was significantly ( p < 0.001 ) higher than apexit plus . similarly , in both orange oil and xylene , endomethasone n dissolved significantly ( p < 0.01 or p < 0.001 ) more than both apexit plus and adseal at both 2 and 10 min . apexit plus and adseal showed similar behavior in both orange oil and xylene at 2 min . however , at 10 min , apexit plus dissolved significantly ( p < 0.001 ) more than adseal in both solvents . apexit plus and endomethasone n showed significantly ( p < 0.001 ) different and higher weight loss at 10 min as compared to 2 min in all solvents except distilled water . adseal showed significantly ( p < 0.001 ) different and higher weight loss in xylene at 10 min as compared to 2 min . however , in other solvents , dissolution of adseal was not significantly different ( p > 0.05 ) between 2 and 10 min . apexit plus dissolved significantly ( p < 0.01 or p < 0.001 ) more in eucalyptus oil , orange oil , and xylene as compared to distilled water at both 2 and 10 min . however , its dissolution pattern did not differ ( p > 0.05 ) among eucalyptus oil , orange oil , and xylene at both the time periods . endomethasone n and adseal showed significantly ( p < 0.001 ) different and higher weight loss in eucalyptus oil , orange oil , and xylene as compared to distilled water at both 2 and 10 min . at 2 min , their dissolution profile did not differ ( p > 0.05 ) among eucalyptus oil , orange oil , and xylene . however , at 10 min , both endomethasone n and adseal showed significantly ( p < 0.01 or p < 0.001 ) higher weight loss in xylene as compared to eucalyptus oil and orange oil , in which their dissolution was not statistically significant ( p > 0.05 ) . in all the solvent groups , all the three sealers showed more weight loss at 10 min than 2 min . the weight loss was highest for endomethasone n followed by apexit plus and adseal at both the periods . in the control group ( distilled water ) , minimum and insignificant ( p > 0.05 ) weight loss was observed for all sealers at both time periods . in essential oils , both apexit plus and endomethasone n dissolved more ( p < 0.001 ) at 10 min as compared to 2 min . however , adseal showed no significant ( p > 0.05 ) difference in its solubility between the periods . in xylene , all sealers showed significantly ( p < 0.05 or p < 0.001 ) more weight loss at 10 min compared to 2 min . for each time period , comparing the effect of eucalyptus oil on sealers , tukey test showed significantly ( p < 0.05 or p < 0.001 ) different and higher weight loss for both apexit plus and endomethasone n as compared to adseal at both 2 and 10 min . dissolution of apexit plus and endomethasone n did not differ ( p > 0.05 ) at 2 min . however , at 10 min , weight loss for endomethasone n was significantly ( p < 0.001 ) higher than apexit plus . similarly , in both orange oil and xylene , endomethasone n dissolved significantly ( p < 0.01 or p < 0.001 ) more than both apexit plus and adseal at both 2 and 10 min . apexit plus and adseal showed similar behavior in both orange oil and xylene at 2 min . however , at 10 min , apexit plus dissolved significantly ( p < 0.001 ) more than adseal in both solvents . apexit plus and endomethasone n showed significantly ( p < 0.001 ) different and higher weight loss at 10 min as compared to 2 min in all solvents except distilled water . adseal showed significantly ( p < 0.001 ) different and higher weight loss in xylene at 10 min as compared to 2 min . however , in other solvents , dissolution of adseal was not significantly different ( p > 0.05 ) between 2 and 10 min . apexit plus dissolved significantly ( p < 0.01 or p < 0.001 ) more in eucalyptus oil , orange oil , and xylene as compared to distilled water at both 2 and 10 min . however , its dissolution pattern did not differ ( p > 0.05 ) among eucalyptus oil , orange oil , and xylene at both the time periods . endomethasone n and adseal showed significantly ( p < 0.001 ) different and higher weight loss in eucalyptus oil , orange oil , and xylene as compared to distilled water at both 2 and 10 min . at 2 min , their dissolution profile did not differ ( p > 0.05 ) among eucalyptus oil , orange oil , and xylene . however , at 10 min , both endomethasone n and adseal showed significantly ( p < 0.01 or p < 0.001 ) higher weight loss in xylene as compared to eucalyptus oil and orange oil , in which their dissolution was not statistically significant ( p > 0.05 ) . during nonsurgical endodontic retreatment , the removal of root canal obturating materials by purely mechanical means may lead to root perforation , canal straightening , or alteration of the original canal outline . therefore , the use of organic solvents has been anticipated to decrease the resistance of obturating materials inside the canal so that their retrieval can become easier in synergism with instrumentation . however , clinicians should be very cognizant about the use of removal techniques and materials for the dismantlement of the previous treatment because very strong solvents are capable of softening the enamel and dentin , which may promote canal transportation and chemical pericementitis if penetrated beyond the apex . there exist no specific standards for the measurement of root canal sealer solubility in organic solvents . various studies have reported that a mean time of 1.510.8 min is required for the removal of very well - compacted obturating materials by instrumentation with or without solvents . in the present study , application of 2 and 10 min for standardized samples allowed us to demonstrate clear differences in the solubility profiles of the endodontic sealers used in various solvents . to enhance the accuracy of the measurements , one sealer sample was used for just one immersion period , thus excluding its undesirable weight loss because of the repeated drying and immersion . after the specified immersion period , all samples were washed with distilled water to remove the decomposed loosen debris . although several studies regarding the solubility of endodontic sealers in various organic solvents have been reported in the literature , the comparison of the effects of sealers on solvents and vice versa was found interesting in this laboratory analysis . all endodontic sealers used in this study were found to be soluble to some extent in all the four solvents . xylene was the more effective solvent followed by the essential oils ( eucalyptus and orange oil ) and distilled water the least . moreover , the effect of all solvents was found gradual and proportional to the contact time with the surface of the sealers . organic solvents are usually employed in paint industries to soften the coated materials for their easy removal . these solvents can be applied in retreatment therapy for the retrieval of resistant or strongly adhered sealers in canal irregularities and ramifications . several organic solvents have been investigated in the literature for their softening or dissolution capability in endodontic retreatment . since all solvents are known for their toxicity to tissues to variable extent , the selection of an ideal organic solvent for any nonsurgical endodontic retreatment requires an equilibrium between its sealer dissolution competency and clinical safety regarding toxicity and belligerence toward the tissues . the use of essential oils in endodontics is growing because of their safety , biocompatibility , and noncarcinogenicity . eucalyptus oil is the distilled oil obtained from the leaves of eucalyptus globulus ; a plant of the family myrtaceae native to australia and cultivated worldwide . orange oil , an extract of the peel of sweet orange fruit ( citrus sinensis ) is an efficient alternative to potentially toxic solvents . sweet orange oil consists of approximately 90% d - limonene ; a solvent used in various household products . d - limonene is an efficient cleaning agent with a pleasant smell and is considered environment friendly . there is no evidence for its carcinogenicity or genotoxicity . further , orange oil is less cytotoxic and more biocompatible than eucalyptol and chloroform . owing to the concerns about the carcinogenicity of chloroform and unpredictable , idiosyncratic hepatic necrosis and toxicities of halothane , xylene and essential oils can be considered as safe alternatives . it is commonly considered as an efficient solvent for several organic materials such as gutta percha ( alkadienes ; a hydrocarbon ) , polymers ( resilons ; a polycaprolactone ) , resins and sealers . chloroform dissolves rather than softens the obturating materials , leaving residues on the canal walls and its fast evaporation makes use of more and more solvent , which makes its use messy and inconvenient . however , the action of xylene is relatively slow , which permits an efficient and biologically safe removal of softened filling materials . grduysus et al . reported that xylol showed similar behavior in dissolving gutta - percha as chloroform . in the present study , it has been reported that both xylol and orange oil were excellent in softening the gutta - percha and sealer cements without any deleterious effects . orange oil has been shown to be more biocompatible than eucalyptol , xylol , chloroform , and halothane . eugenol - based sealers was found similar to that of eucalyptol , chloroform , and xylol . however , orange oil and eucalyptol are poor to dissolve the resin - based materials . mushtaq et al . and martos et al . have stated that dissolving capacity of orange oil is inferior to chloroform and xylene . however , this is in contrast to some studies which showed similar dissolution behavior of orange oil , eucalyptol , chloroform , and xylol . stated that xylol was the best solvent whereas chloroform , eucalyptol , and orange oil presented a similar solvent profile . this indicates that both eucalyptol and orange oil could be suitable as solvents for softening or dissolving the endodontic sealers . the dissolution capacity of eucalyptol is slower than that of other commonly used solvents at room temperature . furthermore , this solvent can be easily washed out after retrieval of filling materials by irrigation with tensio - active solutions ( sodium laurel sulfate ) . under the experimental conditions of the present study , adseal ( an epoxy resin - based material ) it may be due to the fact that epoxy resin ( adseal ) is a heavily cross - linked , rigid , and strong polymer . adseal showed significantly higher dissolution in xylene at 10 min than eucalyptus and orange oils . interestingly , no significant dissolution was observed in eucalyptus oil and orange oil at both time periods . bodrumlu and kayaoglu in their in vitro study concluded that ah plus ( epoxy resin - based sealer ) dissolved to some extent and more than ketac - endo ( glass ionomer - based sealer ) , using either eucalyptus oil or chloroform as the solvent . martos et al . reported that the efficacy of eucalyptus oil , orange oil , xylene , and chloroform to dissolve ez - fill ( epoxy resin - based sealer ) was not significantly different from each other at 2 min . apexit plus , a calcium hydroxide - based sealer has a more convenient delivery form and hydrophilic formulation of apexit . consequently , the material is more reliable if used in thicker layers . in this investigation , apexit plus had shown more pronounced dissolution in all the organic solvents as compared with distilled water . no significant difference in its dissolution was observed among eucalyptus oil , orange oil , and xylene at both time periods . the reason for low solubility could be the more consistent setting reaction forming a more stable complex . apexit plus has a ph of < 8 , which is not true for other calcium hydroxide - based root canal sealers . this low ph may be because of less hydroxyl ion concentration which reacts with the acidic phenol group of salicylates subsequent to the dissociation of calcium hydroxide . mushtaq et al . reported that apexit plus showed the maximum weight loss in xylene . however , its dissolution in refined orange oil and tetrachloroethylene was found to the same extent . whitworth and boursin reported that apexit was significantly more soluble in halothane and chloroform as compared to ketac - endo and ah plus . there are no published data regarding the action of other organic solvents on this material . therefore , the effective retrieval of this material from the root canal system using these organic solvents can not be assured . it has been developed to ameliorate the neurotoxic and mutagenic effects of paraformaldehyde present in its predecessor . its cytotoxicity is approximately 30 times lower than a formaldehyde - containing sealer . in this study , it showed a higher weight loss than other endodontic sealers and the maximum in xylene followed by orange oil and eucalyptus oil . this high degree of solubility is probably due to the release of eugenol , and the hydrolysis of hardened zinc eugenolate . zoe - based materials decompose hydrolytically as follows : zn ( c10h11o2)2 + 2h2o = zn ( oh)2 + 2c10h11o2 this zinc hydroxide is almost insoluble in neutral , but highly soluble in an acidic solution . eugenol - based sealer ( endofill ) by orange oil , chloroform , and eucalyptus oil in a scanning electron microscope retreatment study . eugenol - based sealer presented significantly lower solubility in halothane than chloroform , which was 9 times more effective than eucalyptus oil when exposed for 20 min . the present laboratory investigation did not consider the clinically imposed parameters such as canal system anatomy , temperature , access , volume of exchange , dilution or displacement by biological fluids , or irrigants regarding the action of solvents on root canal sealing cement . therefore , its result can not be directly extrapolated to clinical scenarios . the search for more effective and biocompatible universal solvent should continue and should not be confined simply to the softening and gross removal of obturating materials . within the limitations of this laboratory study , the following conclusions had been drawn . xylene was the most effective solventorange oil and eucalyptus oil showed no significant difference in their solvent behaviorall the sealers showed more dissolution in all the solvents used at 10 min than 2 minin distilled water , insignificant sealer dissolution was observed . xylene was the most effective solvent orange oil and eucalyptus oil showed no significant difference in their solvent behavior all the sealers showed more dissolution in all the solvents used at 10 min than 2 min in distilled water , insignificant sealer dissolution was observed .

objective : the objective of this study was to evaluate the dissolution effectiveness of eucalyptus oil , orange oil , xylene , and distilled water on three different endodontic sealers.materials and methods : about 240 samples of root canal sealers ( eighty for each sealer ) were prepared and divided into four groups of 20 each for immersion in different organic solvents . each group was further subdivided into two subgroups ( n = 10 ) for 2 and 10 min of immersion time . the mean percentage of weight loss was determined for each sealer in each solvent at both time periods . data were statistically analyzed by two factor analysis of variance and significance of mean difference was obtained by tukey 's post hoc test ( p < 0.05).results : the lowest level of solubility was observed for adseal followed by apexit plus and endomethasone n at both time periods in all solvents . apexit plus showed no significant ( p > 0.05 ) difference in its dissolution in all the organic solvents except distilled water at both the time periods . the solubility profile of endomethasone n and adseal did not differ significantly among eucalyptus oil , orange oil , and xylene at 2 min and between eucalyptus oil and orange oil at 10 min . however , at 10 min , endomethasone n and adseal showed a more pronounced solubility in xylene as compared to both eucalyptus oil and orange oil.conclusions:in general , xylene was the most effective in dissolving root canal sealers than other organic solvents . essential oils ( eucalyptus oil and orange oil ) were found similar in their ability to dissolve apexit plus and endomethasone n.

INTRODUCTION MATERIALS AND METHODS RESULTS Dissolution of different sealers in each solvent Relative solubility of each sealer in different solvents DISCUSSION CONCLUSIONS Financial support and sponsorship Conflicts of interest

trypanosoma cruzi is an obligate intracellular parasite that is responsible for chagas disease , which affects 1618 million people in latin america . this parasite has a complex biphasic life cycle in which four developmental forms alternate between the reduviid beetle vector ( epimastigotes and metacyclic trypomastigotes ) and the mammalian host ( amastigotes and bloodstream trypomastigotes ) . transmission is initiated in the reduviid beetle vector , which becomes infected by taking up circulating trypomastigotes during a blood meal . after trypomastigotes differentiate to epimastigotes in the insect gut lumen , the parasite divides by binary fission before migrating along the hindgut and rectum , where they transform to metacyclic trypomastigotes . these trypomastigotes are released near the bite wound with the insect feces during the next blood meal . following its introduction into mammalian blood , the trypomastigotes penetrate nonphagocytic and phagocytic cells through a parasitophorous vacuole to start the intracellular cycle . in this stage amastigotes develop into nondividing bloodstream trypomastigotes that can either initiate another round of infection to propagate to different organs or can be taken up by the insect vector to complete the life cycle . throughout its life cycle , t. cruzi survives under a wide range of environmental conditions that induce complex morphological changes among parasite stages . in addition to the four main developmental forms , it is possible to observe intermediate forms ( ifs ) that seem to follow the same differentiation path , independent of whether they exist in a vertebrate or in an invertebrate host [ 1 , 2 ] . intermediate forms appear transiently during the differentiation of epimastigotes into metacyclic trypomastigotes ( metacyclogenesis ) in the triatomine , the differentiation of metacyclic trypomastigotes ( primary amastigogenesis ) , and tissue - derived trypomastigotes ( secondary amastigogenesis ) into amastigotes and also into bloodstream trypomastigotes inside the mammalian host cell [ 25 ] . adaptation of t. cruzi to diverse environments found in the different hosts undoubtedly induces a complex regulation of gene expression that apparently precedes the morphological changes observed during parasite transformation . several researchers have studied some of the factors that represent physiological stress for the parasite and have demonstrated that temperature , nutritional conditions , and ph stimulate morphological differentiation during amastigogenesis [ 58 ] . the vast majority of the information regarding in vivo and in vitro amastigogenesis comes from data in which tissue - derived trypomastigotes were used because it was possible to obtain higher yields of these parasites [ 3 , 5 , 815 ] . ultra - structural and molecular analyses during the trypomastigote to amastigote transformation have shown a complex and progressive morphological rearrangement of parasite shape and flagellum that has been associated with the differential expression of stage - specific antigens [ 3 , 5 , 8 ] . a comparative morphology study showed that even when metacyclic and bloodstream trypomastigotes share similar biological and morphological properties , primary and secondary amastigogenesis apparently display different developmental processes , which suggests that their intracellular mechanisms are different . although the basic features of the amastigogenesis transformation process are known , the molecular mechanisms involved are still unidentified . analysis of the molecules implicated in the detonation and control of the transformation process will increase our knowledge about morphogenesis and gene expression programs that are involved not only in the differentiation between developmental forms but also during parasite transitions from the nonreplicative to the replicative stage . the usefulness of a differentiation system for molecular research in which a population of cells is involved depends first on the synchrony of the transition , second on the availability of easily analyzable markers for monitoring the process , and third on the system efficiency for obtaining large enough amounts of analyzable sample for further biochemical , biological , and molecular analyses . to date , in vitro conditions that allow for obtaining ifs that satisfy these needs have not been reported . therefore , in vitro conditions that induce high rates of pure ifs during the transformation of culture - derived trypomastigotes into amastigotes are described in this work . furthermore , morphological , cellular , and molecular characterizations of the different ifs obtained are presented . nih 3t3 fibroblasts were grown in high glucose dulbecco 's minimal essential medium ( hgdmem ) supplemented with 10% fetal bovine serum ( fbs ) , 1% glutamine , and 5 g / ml penicillin - streptomycin at 37c in a humidified atmosphere with 5% co2 in a 75 cm corning cell culture flask ( catalog number 4306 - 41 ) . epimastigotes of t. cruzi cl - brener strain were grown in liver infusion tryptose medium ( lyt ) containing 10% fbs and hemin ( 25 g / ml ) at 28c . fifty percent confluent fibroblasts were infected with 2 10 cl - brener mid - log - phase epimastigotes per ml of hgdmem ( 15 ml ) supplemented with 2% fbs to get a parasite - host cell ratio of 10 : 1 . the nih 3t3 monolayers were washed every 2 days with hgdmem medium until nonadherent parasites were removed , and then fresh hgdmem plus 2% fbs was added . the parasites released from the early infections corresponding to the first 6 days after the first liberation were harvested every day at 2000 g for 5 minutes . the trypomastigotes were separated from amastigotes by immunoprecipitation using 500 l of hybridoma supernatant of monoclonal antibody 2c2b6 , which is specific for the ssp4 surface antigen of amastigotes , per 3 10 parasites at 37c for 1 hour . the trypomastigotes were separated from amastigotes at 800 rpm for 10 seconds in a microcentrifuge and were washed with 1x pbs as many times as necessary to obtain pure parasites . the amastigotes were found in the pellet , and the trypomastigotes were found in the supernatant . purified tissue culture - derived trypomastigotes ( 5 10 ) were harvested at 500 g for 10 minutes and were transferred to 100 20 mm untreated petri dishes containing 1 ml per experiment of hgdmem at different phs ( 4 , 5 , 6 , 7 , 8 , and 9 ) without or with different fbs concentrations ( 0.5% , 1% , 1.5% , and 2% ) incubated at 37c in a 5% co2 atmosphere . after 1 , 2 , 3 , 4 , 5 , 6 , 12 , 24 , 48 , or 72 hours , the parasites were washed , fixed with 4% paraformaldehyde in 1xpbs , washed again , and dropped ( 3 10 parasites/10 l ) over poly - l - lysine - treated slides ( silane - prep slides sigma diagnostics , catalog number s4651 ) inside circles delimited with a liquid - repellent slide marker pen ( electron microscopy sciences catalog number 71310 ) . after the slides were air dried , the parasites were stained with hema 3 according to the protocol supplied by the manufacturer ( fisher diagnostic 840021 ) , and the percentages of trypomastigotes , ifs , and amastigotes were determined for 100 cells analyzed randomly under an optic microscope . trypomastigotes , amastigotes , epimastigotes , or ifs ( 2 10 parasites ) were incubated with 500 l of fresh human serum at 37c for 30 , 60 , and 120 minutes . parasite lysis was determined by adding one volume of trypan blue ( 0.4% in 1x pbs , hycel 23850 ) and counting the complement - resistant parasites in a hemocytometer under a light microscope . three independent experiments , repeated in triplicate each time , were carried out using serum from different donors . the parasites were harvested , washed , fixed , and dropped over poly - l - lysine - treated slides as described above . the parasites were permeabilized with 0.1% triton - x100 for 5 minutes , rinsed extensively with 1x pbs , and treated with 2% bsa ( albumin , bovine , cohn fraction v / 1x pbs ph 7 ) at 37c for 30 minutes . these preparations were washed with pbs and incubated 1 hour at 37c with hybridoma supernatant ( 1 : 50 ) of the amastigote - specific monoclonal antibody 2c2b6 . after rinsing , a secondary antimouse antibody tagged with alexa fluor 488 green diluted 1 : 1000 was layered on the parasites and incubated for 1 hour at 37c . h-1000 ) , and observed under an olympus fluorescence microscope ( bx41 ) equipped with a 60x/1.25 oil iris ph3 uplanfl n objective . the images were captured using an evolution vf fast cooled color media cybernetics camera and were analyzed using the image - pro plus v 6.0 media cybernetics program . the parasites were processed and analyzed as per the indirect immunofluorescence protocol described above , with some specifications . after treatment with a polyclonal antibody against the epimastigotes ( 1 : 200 ) obtained from the mouse and the antimouse antibody tagged with alexa fluor 546 red ( 1 : 1000 ) as the first and second antibodies , the parasites were stained with 10 g / ml dapi ( molecular probes ) . as mentioned before , conditions such as temperature , nutritional environment , and ph stimulate the in vitro differentiation of trypomastigotes into amastigotes [ 58 ] . to determine the best conditions for obtaining the highest rates of transformation , in vitro experiments were performed using tissue - derived trypomastigotes incubated at 37c in hgdmem medium at different phs ( 4 , 5 , 6 , 7 , 8 , and 9 ) , without or with 0.5% , 1% , 1.5% , or 2% fbs for different lengths of time , as described in the materials and methods . the movement and morphology of the parasites were analyzed in fresh preparations under a light microscope , and the relative percentages of trypomastigotes , ifs , and amastigotes were determined . in all of the conditions in which parasite differentiation was achieved , the trypomastigotes showed gradual morphological changes and size reduction ; they transformed from the typical s- or c - shaped bloodstream morphology to diverse ifs that finally reached the rounded or oval shape characteristic of amastigotes after 12 hours of incubation . a progressive reduction of parasite movement concomitant with the gradual shortening of the undulating membrane and flagellum was also observed . although similar morphological patterns of differentiation could be seen in some of the different conditions tested , very different rates of transformation were obtained . incubation at 37c in hgdmem at ph 5 without fbs induced the most efficient rates of differentiation . under these conditions , the level of tissue - derived trypomastigotes decreased concomitantly with increasing amounts of ifs , which reached 85% within 3 hours of incubation ( figure 1 ) . subsequently , as the percentage of ifs decreased , the relative amount of amastigotes increased , and the transformation process was completed after 12 hours of incubation . a homogenous population ( 100% ) of round - shaped forms , which displayed either no flagella or very short protruding flagella and a noticeable reduction of movement , was observed at this point . on the contrary , when tissue - derived trypomastigotes were incubated in hgdmem at ph 4 without fbs , only 30% of the cells were transformed into amastigotes after 3 hours and 65% after 12 hours ( data not shown ) . in addition , only 21% of the trypomastigotes differentiated into amastigotes after 24 hours of incubation at ph 6 without fbs ( data not shown ) . finally , at phs 7 , 8 , and 9 in the absence of fbs as well as those same phs with 0.5% , 1% , 1.5% , and 2% these results indicate that the differentiation process during the in vitro secondary amastigogenesis involves several ifs as a result of the morphological change of the parasites . in addition , the optimal conditions to induce the highest rates of transformation from tissue - derived trypomastigotes into amastigotes were ph 5 , serum - deprivation and 37c . the different developmental forms of t. cruzi can be identified by morphological and biological parasite features , such as the size and shape of the parasite , undulating membrane and flagellum , the position of flagellum emergence , and the size , shape , and relative position of the nucleus and the kinetoplast . the amastigote has a spherical- to oval - shaped form that is 2 to 4 m in diameter with no or very short free flagellum and a kinetoplast located in the middle of the parasite body close to the nucleus . the trypomastigotes have a flagellum and an undulating membrane that extends the entire length of the parasite ( 1625 m long and 2 m diameter ) . trypomastigotes found in the blood of infected mammals have a slender s- or c - shaped form , while the trypomastigotes found in infected insects usually have a straight form . once the best conditions to induce the transformation of the parasite were determined , a detailed morphological analysis was carried out on fixed and stained preparations , and the relative amounts of trypomastigotes , amastigotes , and ifs were determined at different points of the differentiation kinetics at 37c using hgdmem at ph 5 with serum - deprivation ( figure 2 ) . this methodology allowed us to perform a morphometrical analysis and a more precise quantification of the transformation process compared to those obtained with fresh preparations . before initiating the differentiation process , tissue - derived trypomastigotes showed the typical morphology previously described ( figure 2a ) . during the transformation process , the parasite progressively reduced its entire length by 22% at 1 hour , 23% at 2 hours , 39% at 3 hours , 48% at 4 hours , 50% at 5 hours , and 53% at 6 hours of transformation as shown in figure 2 and table 1 . the quantitative analysis indicated that as little as 1 hour of transformation time was enough to induce high rates of ifs ( 80% ) in which the parasites displayed a widening and shortening of their body , flagellum , and undulating membrane ; however , this last one maintained the subterminal emergence site that is characteristic of trypomastigotes ( figure 2b and table 1 ) . after 2 hours of transformation , no trypomastigotes were detected , which indicates that the culture contained 100% ifs . these ifs showed size reduction , a light oval - shaped form , shortening of their flagellum , and an undulating membrane in which their emergence site was slightly displaced to the middle of the parasite body ( figure 2(c ) and table 1 ) . after 3 hours , the morphology of the ifs was very close to the one observed at 2 hours of transformation , but their size continued to reduce and the undulating membrane was not appreciable ( figure 2(d ) and table 1 ) . after 4 and 5 hours of transformation , the ifs showed similar size and morphology to the amastigotes and were only distinguished by the progressive shortening of their flagellum ( figures 2(e ) and 2(f ) and table 1 ) . finally , after 6 hours of transformation , the parasites reached the spherical- to oval - shaped form with no or very short free flagellum ( figure 2(g ) ) , and their morphology was indistinguishable from the one observed in the cell culture - derived amastigotes ( figure 2(h ) and table 1 ) . to assess the reversibility of the differentiation process , the ifs were cultured again in hgdmem at ph 7.2 complemented with 2% fbs after 1 , 2 , 3 , 4 , 5 , 6 , 12 , 24 , 48 or 72 hours of differentiation at 37c using hgdmem at ph 5 with serum deprivation . in all cases , the ifs continued their differentiation , thus indicating that once detonated , this process can not be stopped and is not reversible ( data not shown ) . these results showed that , under the in vitro conditions used , the trypomastigotes differentiated very efficiently into highly homogeneous and pure if populations after 2 hours of induction . to continue with the morphological analysis of the ifs , the shape and position of the nucleus and the kinetoplast at each point of the transformation kinetics were determined . the parasites were then stained with a polyclonal antibody against epimastigote total proteins , which had been previously shown to recognize all of the developmental forms and ifs of t. cruzi . the reactions were developed with an alexa fluor 546 red - conjugated antimouse antibody , and the kinetoplast and nucleus were counterstained with dapi . as shown in previous experiments , the same morphological transformation pattern of the parasite body was found with this technique ( compare figures 2 and 3 ) . nucleus remodeling and a progressive and continuous displacement of the kinetoplast from the posterior to the anterior position with respect to the parasite nucleus were also observed . as shown in table 1 , the distance between the nucleus and the kinetoplast became shorter during the transformation kinetics . at 1 hour of transformation ( figure 3(b ) ) , the distance between both organelles was reduced by 28% ( table 1 ) , even though the ifs showed a subterminal kinetoplast posterior to the nucleus , as commonly observed in trypomastigotes ( figure 3(a ) ) . after 2 hours of transformation , the ifs showed a displacement of their kinetoplast to the middle of the parasite body and reduced the distance with respect to the nucleus ( now remodeled from the lengthened - shaped form to an oval - shaped form ) by 58% ( figure 3(c ) and table 1 ) . after 3 hours of transformation , the kinetoplast remained located posterior to the nucleus , close to the middle part of the parasite body , with a 66% reduction in the distance between both organelles ( figure 3(d ) and table 1 ) . at 4 hours of transformation , the kinetoplast was positioned next to and parallel to the nucleus in a transversal position in the middle of the parasite body and showed 85% reduction in the organelle distance ( figure 3(e ) and table 1 ) . after 5 hours of transformation , the kinetoplast moved to an anterior position with respect to the nucleus , in the middle part of the parasite body and showed a 90% reduction in the distance between the organelles ( figure 3(f ) and table 1 ) . finally , at 6 hours of transformation ( figure 3(g ) and table 1 ) , the parasite morphology and the position of the kinetoplast were very similar to those observed in the tissue - derived amastigotes ( figure 3(h ) and table 1 ) . these results showed that , concomitant with the morphological parasite shape transformation , nucleus remodeling and kinetoplast displacement are observed during the transformation kinetics under the in vitro conditions used . the morphological analysis described above showed homogenous if populations ; nevertheless , the nucleus remodeling and kinetoplast displacement studies indicated that each point of the transformation kinetics is composed of 3 different ifs . the percentages of trypomastigotes , amastigotes and the different ifs were then determined for each time point evaluated in the previous experiment . as shown in figure 4 , 3 different ifs were observed at 1 , 2 , 3 , 4 and 5 hours of in vitro differentiation ( figures 4(a ) and 4(c ) ) . at 1 hour of transformation the first if , which was arbitrarily named if1 , showed similar morphology to the immediate previous parasite stage ( trypomastigotes for the first hour and if3 for 2 , 3 , 4 , and 5 hours ) and represented 2% to 3% of the total parasites . the second intermediary form , named if2 , showed a slightly , but clearly , more differentiated morphology than if1 and represented the most abundant parasite population ( 85% to 90% ) . the third if , still more differentiated than if2 and named if3 ( 2% to 15% ) , displayed characteristics similar to the if1 that emerged from the next time of transformation . at 1 hour of transformation , trypomastigotes comprised only 2% of the culture , which confirms that the transformation process is very efficient under the established conditions ( figures 4(a ) , 4(b ) and 4(c ) ) . moreover , from 1 to 5 hours of transformation were not observed any amastigotes ( panel a ) . finally , at 6 hours of transformation , 100% of the parasites showed a very similar morphology to that of tissue - derived amastigotes ( figures 3(g ) and 3(h ) , table 1 and figures 4(a ) , 4(b ) and 4(c ) ) . the only forms detected after 2 , 3 , 4 and 5 hours of transformation were ifs with a gradually increasing degree of differentiation . therefore , this experimental model could be useful for future analysis of the differential expression between the ifs and the completely differentiated forms of t. cruzi . in addition , even when the ifs at 1 hour of transformation showed morphometric characteristics that corresponded with an if , the presence of contaminant trypomastigotes ( 2% ) rendered this population not useful for differential expression studies ( figure 4 ) . the previous results demonstrated that different ifs , which can be identified by specific morphological characteristics , are generated during amastigogenesis . since it was necessary to know more about their biological properties , a molecular marker was evaluated for the different ifs during the transformation kinetics . it has been reported that the morphological differentiation of the ifs implies the remodeling of parasite surface molecules [ 3 , 8 ] . the expression of the amastigote - specific surface glycoprotein ssp4 was evaluated by indirect immunofluorescence in the diverse ifs as well as in trypomastigotes and amastigotes used as controls . the results presented in figure 5 showed that , as expected , the trypomastigotes did not express the amastigote - specific surface glycoprotein ( figures 5(a ) and 5(b ) ) , while amastigotes displayed heterogeneous levels of ssp4 ( figures 5(o ) and 5(p ) ) . moreover , while the ifs generated at 1 , 2 , and , 3 hours of transformation did not express ssp4 ( from figures 5(c ) to 5(h ) ) , approximately 8% and 36% of parasites at 4 ( figures 5(i ) and 5(j ) ) and 5 hours of differentiation ( figures 5(k ) and 5(l ) ) , respectively , showed low expression levels . in addition , after 6 hours of transformation ( figures 5(m ) and 5(n ) ) , approximately 76% of the parasites showed variable and lower levels of ssp4 compared to culture - derived amastigotes ( figures 5(o ) and 5(p ) ) . finally , after 72 hours of transformation , all parasites showed equivalent expression of ssp4 to that of culture - derived amastigotes ( data not show ) . these results indicated that the consecutive and gradual expression of ssp4 was concomitant with the morphological transformation of trypomastigotes into amastigotes , in which the ifs with a similar morphology to amastigotes were the ones that started expressing the amastigote - specific glycoprotein . moreover , even though the morphology of the parasites at 6 hours of transformation was similar to the tissue - derived amastigote morphology , the expression of this molecular marker indicated that these parasites were not completely transformed at the molecular level . continuing with the biological analysis of the different ifs , their resistance to complement - mediated lysis was determined . as the ifs are obtained during trypomastigote differentiation into amastigotes and both developmental stages are resistant to complement - mediated lysis , it would not be surprising if the ifs are also resistant . however , it was important to evaluate this phenotype because ( 1 ) the ifs are usually intracellular and therefore not exposed to the blood and extracellular space in the vertebrate host and so they would not need to be resistant to complement - mediated lysis and ( 2 ) the ifs obtained during metacyclogenesis and amastigogenesis show very similar morphological characteristics , and very little is known about biological properties that could be used to distinguish them . however , this biological property has not been evaluated in the ifs obtained during amastigogenesis . therefore , the complement - sensitivity of the ifs obtained was evaluated using fresh human serum as described in the materials and methods . as shown in figure 6 , the if at 3 hours of transformation , similar to trypomastigotes and amastigotes moreover , all of the ifs obtained through the transformation kinetics were also resistant to complement - mediated lysis ( data not shown ) . as expected , epimastigotes were sensitive to complement , thus reaching 100% lysed parasites in the first 30 minutes of treatment . these results suggest that the ifs obtained during the in vitro amastigogenesis do not lose the ability to resist complement - mediated lysis . therefore , even if the ifs from metacyclogenesis and amastigogenesis are morphologically similar , they have different biological properties that can be used to distinguish them . the lack of effective in vitro conditions to obtain high rates of synchronic and pure ifs has delayed the understanding of the molecular mechanisms that mediate the cellular remodeling and the identification of molecular markers that are important for amastigogenesis . in the present work , we established an improved method to obtain high rates of pure ifs and correlated parasite differentiation with the expression of a specific developmental marker , complement - mediated lysis sensitivity and morphometrical analysis of the nucleus , kinetoplast and parasite body throughout the complete transformation process . the efficient transformation of cell culture - derived trypomastigotes to amastigotes was induced using an acidic ph and serum deprivation at 37c ( figure 1 ) . the parasites showed dramatic cell restructuring with a gradual and progressive reduction of their size and the readsorption of their flagellum and undulating membrane until they reached the typical round shape of tissue - derived amastigotes ( figure 2 ) . these results are consistent with previous reports that document the existence of several intermediate forms during the life cycle of t. cruzi , either under in vivo or in vitro conditions that showed the same gradual and progressive parasite morphometrical transformation , apparently as an obligatory step for the differentiation process [ 1 , 3 , 5 , 8 , 1822 ] . the quantitative analysis demonstrated that parasite transformation was initiated immediately after the exposure to hgdmem at ph5 and 37c , thus reaching 100% ifs after only 2 hours of incubation ( figure 4 ) ; this indicates a faster and more efficient differentiation rate than previously reported [ 5 , 8 ] . these differences could be the result of the absence of bsa in the differentiation medium used in this study in comparison with the 0.4% bsa contained in the previously reported medium [ 5 , 8 ] . in addition , the condition of the cell culture - derived trypomastigotes used to initiate parasite differentiation may play an important role in the process . the parasites used in all of the experiments in this study were early released trypomastigotes that were obtained from early infections corresponding to the first 6 days after the first trypomastigote liberation , because the parasites released later showed variable , not synchronous and inefficient transformation rates . interestingly , andrews et al , and tomlinson et al , also used only trypomastigotes early released from infected cells for their transformation experiments . even when these authors did not justify this specification the morphological restructuring of t. cruzi during amastigogenesis has shown that the transition from the slender to the spherical or oval parasite shape comprises an extensive remodeling of cellular architecture , the flagellum and the undulating membrane , and a dramatic change in the overall parasite size , apparently as a result of the reorganization of their subpellicular microtubules . this dramatic restructuring also affects the location and morphology of the parasite organelles during t. cruzi differentiation . the kinetoplast of the trypomastigotes is spherical ; whereas in amastigotes , it is elongated [ 8 , 21 , 23 , 24 ] . in contrast , the nuclei of the trypomastigotes are elongated , apparently following the parasite 's shape ; meanwhile , it is round in amastigotes . these morphometrical characteristics of the nucleus and the kinetoplast have been reported to allow the distinction of the t. cruzi developmental stages . therefore , this was the criteria used to initiate the characterization of the ifs obtained ( figure 3 and table 1 ) . the results showed that the morphometrical analysis of the nucleus and the kinetoplast allows the clear identification of the different ifs . the trypomastigotes showed a bigger distance between the nucleus and the kinetoplast than did the amastigotes . in addition , during amastigogenesis , together with the parasite shape change , we observed nucleus remodeling and a progressive and continuous displacement of the kinetoplast from the posterior to the anterior position with respect to the parasite nucleus . similar observations were reported by contreras and collaborators in 2002 , during primary amastigogenesis . as in the quantitative analysis conducted during the morphometrical characterization of the ifs ( figure 2 and table 1 ) , the shape and position of the nucleus and the kinetoplast ( figure 3 and table 1 ) allowed us to very precisely determine that one of these populations was highly predominant even when three different if populations were present at each time of the transformation kinetics ( from 85% to 90% ) , which confirmed a high efficiency of the homogeneity and synchronicity of the differentiation process in our in vitro conditions ( figure 4 ) . differentiation of the diverse developmental stages of t. cruzi has been associated with changes in their biological properties and with the expression of stage - specific surface molecules . moreover , the morphological transformation during primary amastigogenesis has been associated with changes in the glycoprotein profile related to the expression of trans - sialidase and mucin previously described in t. cruzi . the same behavior was observed in this work during the secondary amastigogenesis : contrary to the positive expression of ssp4 observed in the amastigote surface , the trypomastigotes , epimastigotes and ifs at 1 , 2 and 3 hours of transformation did not express this amastigote - specific glycoprotein ( gp ) ( figure 5 ) . in the case of the ifs obtained at 4 , 5 and 6 hours of transformation , low and heterogeneous levels of ssp4 expression were observed . at these times , the total number of parasites expressing ssp4 as well as the expression level of this gp on their surfaces , increased in parallel with the degree of transformation from trypomastigotes to amastigotes , which confirms that the progressive expression of ssp4 can be useful as a molecular marker of differentiation [ 3 , 8 , 21 ] . to initiate and establish infection in the mammalian host , t. cruzi needs to develop several strategies to avoid the immune response . to survive and disseminate in the bloodstream and in the extracellular space , trypomastigotes and amastigotes have developed a stage - specific capacity to resist complement - mediated lysis [ 2527 ] , apparently using stage - specific regulators [ 2830 ] . conversely , epimastigotes found in the insect vector activate the complement cascade , but they are not able to inhibit its lytic action . complement - mediated lysis of the ifs obtained during in vitro secondary amastigogenesis was evaluated . as expected , trypomastigotes and amastigotes , but not epimastigotes , were resistant to the lytic effects of complement . besides this , the ifs obtained during in vitro amastigogenesis were not sensitive to complement lysis ( figure 6 ) . this result indicates that these ifs express the proteins that participate in the stage - specific inhibition of complement activation . nevertheless , future studies will be necessary to elucidate which stage - specific proteins from trypomastigotes and/or amastigotes are expressed by the ifs in order to inhibit complement activation . it has been reported that the ifs generated during the transformation from epimastigote to trypomastigote are sensitive to complement lysis . the ifs obtained during the metacyclogenesis and amastigogenesis are morphologically indistinguishable , which is remarkable , because this biological property might be used as a criterion to distinguish both types of ifs . moreover , this result further supports the existence of the alternative parasite life subcycle that was previously proposed and the hypothesis that this could be the result of the premature lysis of the infected cells or the extracellular parasite differentiation . in summary , we have shown that the experimental differentiation model reported in this work provides , for the first time , a highly synchronous system that could be useful for studying the molecular mechanism of the transformation process and the identification of the regulators involved in differentiation control , with the potential to identify routes to block the cycle of t. cruzi infection .

trypanosoma cruzi undergoes a biphasic life cycle that consists of four alternate developmental stages . in vitro conditions to obtain a synchronic transformation and efficient rates of pure intermediate forms ( ifs ) , which are indispensable for further biochemical , biological , and molecular studies , have not been reported . in the present study , we established an improved method to obtain ifs from secondary amastigogenesis . during the transformation kinetics , we observed progressive decreases in the size of the parasite body , undulating membrane and flagellum that were concomitant with nucleus remodeling and kinetoplast displacement . in addition , a gradual reduction in parasite movement and acquisition of the amastigote - specific ssp4 antigen were observed . therefore , our results showed that the in vitro conditions used obtained large quantities of highly synchronous and pure ifs that were clearly distinguished by morphometrical and molecular analyses . obtaining these ifs represents the first step towards an understanding of the molecular mechanisms involved in amastigogenesis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

there is an increasing recognition of comorbidity between intellectual disability ( i d ) and mental health problems , emotional disorders , and deficits in socialization skills.13 literature reveals that the aging process commences younger in people with i d at approximately 4050 years of age.4 as the previously mentioned problems may further lead to long - term health conditions and mortality,5 effective psychosocial interventions need to be developed for older adults with i d in addition to the pharmacological treatment . life story work ( lsw ) is : the construction , or reconstruction of an individual s life - story and involves the integration of the individual s internal process , as well as the relationships and values with the family , community , and culture in which the individual has developed.6 it creates an opportunity for the person to tell others about their past experiences and then use this life story to benefit them in their present situation.7,8 a variety of forms ( book , digital video disc , or collection of personal items ) can be used , and the content may contain photographs , written biographies , drawings , art pieces , and other aids for understanding a person s own memorable experiences . the lsw program ( p ) in particular , life story book was originally applied to children who were under adoption and foster care services.9 it helped children to develop a sense of identity and continuity in the new setting . lsw was then modified and introduced to a variety of different settings , including children with prior exposure to trauma , people with long - term illnesses,10 older people with or without dementia,11 and recently people with intellectual disabilities.12,13 our past experience and relationships shape our identity and make us who are today.14 this also applies to people with i d and lswp as a way of keeping their past history alive . there is evidence that lswp may encourage people with i d to present and express themselves13 and , hence , improve communication and relationships.15,16 therefore , lswp is like a bridge to create connections among clients , family caregivers , and support workers.17,18 research also indicates that lswp has a positive impact on participants mood . this is especially important for older adults with i d , who are at an increased risk of having mood disorders , particularly depression.19 similar to other aging people , older adults with i d carry with them many unpleasant past life events and face a great deal of unexpected changes , which they may not be able to cope with.20,21 they also have more difficulties in developing and maintaining a stable social support network,22 which is an essential element in fighting mood problems.23 older adults with i d are predisposed to have reduced subjective well - being , given their physical disabilities and related psychological stress.24 however , with a strengthened sense of identity , improved social interaction , and increased pleasure and enjoyment about life , it is reasonable to expect that lswp may enhance the participants quality of life ( qol ) by engaging them in an appropriate level of activities and contacts.2527 hence , it is hypothesized that lswp , when applied to older adults with i d , will have a positive impact on their mood , socialization , and ultimately their qol . thus , the evidence on the use of lswp is immature , and there is a great need for quantitative research evidence to substantiate the potential value of lsw and other cognitive behavioral treatments for patients with id,6,8,28 especially for people with id.16 in addition , to our knowledge , there are very few lswp studies on older adults with i d that have a well - established protocol tailor - made to them , despite their marked disparity from the norm . to address these issues , the present study aimed to develop a training protocol of lswp especially designed for older adults with mild - to - moderate levels of i d and to evaluate the effectiveness of lsw in this group of older adults on enhancing mood , socialization , and qol from a quantitative perspective participants were recruited from nine hostels , day service centers , and sheltered workshops of the hong chi association . the inclusion criteria were : 1 ) > 50 years of age ; 2 ) mild - to - moderate grade i d , according to the service admission record in their personal case files ; and 3 ) without severe psychiatric disorder or behavioral problem . it is suggested that gaining person - centered consent from such participants.29 this was achieved in this study via an ongoing evaluation of both the verbal and nonverbal cues of the participant during the research process , alongside written consent obtained from the guardian of the participant . only participants with both their guardians written informed consent and those who agreed to participate in the program joined the study . this study complied with the ethical standard stipulated by the survey and behavioural research ethics committee of the chinese university of hong kong and ethical approval was granted prior to the data collection . participants were assigned to either the intervention group ( n=32 ) or the control group ( n=28 ) . the intervention group received the lswp intervention led by trained lswp instructors , in addition to their usual daily activities for approximately 6 months . the control group received their usual activities ( ie , training on self - care and daily living skills , basic work skill training , activities that developed their hobbies and interests , physical exercises to maintain or strengthen their physical fitness , vocational training in a sheltered environment ) during this period . assessments on the participants mood , socialization , and qol were conducted at baseline and immediately after the intervention . the protocol of lswp for older people without i d could not fit the special needs of population with i d . therefore , a group of clinical psychologists developed a life story book protocol which was designed specifically for this population . in developing this protocol , the following recommendations were taken into consideration : 1 ) the effective features of a life story intervention design for nursing home residents ; and 2 ) suggestions on the best format for compiling life history resources for older people living in institutional settings.16,30 this life story book protocol consisted of 16 structured one - to - one or group sessions , each lasting for 1.52 hours . the entire program spanned a period of approximately 6 months . it comprised a series of activities of various psychosocial elements , such as field visits , outings , production of life story book with photos , presentation , group sharing , and collecting feedback from the caregiver . lswp instructors work with participants and their family members to collect information and photos that tell the participants life stories . lswp instructors also help participants to express their feelings on their life stories in a caring and accepting atmosphere . participants are encouraged to use the life story books to share their life stories and achievements with other people . participants were guided by trained lswp instructors , who were experienced tutors for people with i d and received training and regular supervision from the clinical psychologists . the protocol provided step - by - step guidelines for the instructors to produce an individualized life story book for each client . the life story book enabled clients to gather current information about themselves ( the present ) and their history ( the past ) . moreover , it was a useful tool that could assist the clients to express themselves and tell their own story to people around them . , each participant will have a personalized life story book that includes the recording of significant people , places , and events for themselves ( table 1 ) . participants were recruited from nine hostels , day service centers , and sheltered workshops of the hong chi association . the inclusion criteria were : 1 ) > 50 years of age ; 2 ) mild - to - moderate grade i d , according to the service admission record in their personal case files ; and 3 ) without severe psychiatric disorder or behavioral problem . it is suggested that gaining person - centered consent from such participants.29 this was achieved in this study via an ongoing evaluation of both the verbal and nonverbal cues of the participant during the research process , alongside written consent obtained from the guardian of the participant . only participants with both their guardians written informed consent and those who agreed to participate in the program joined the study . this study complied with the ethical standard stipulated by the survey and behavioural research ethics committee of the chinese university of hong kong and ethical approval was granted prior to the data collection . participants were assigned to either the intervention group ( n=32 ) or the control group ( n=28 ) . the intervention group received the lswp intervention led by trained lswp instructors , in addition to their usual daily activities for approximately 6 months . the control group received their usual activities ( ie , training on self - care and daily living skills , basic work skill training , activities that developed their hobbies and interests , physical exercises to maintain or strengthen their physical fitness , vocational training in a sheltered environment ) during this period . assessments on the participants mood , socialization , and qol were conducted at baseline and immediately after the intervention . the protocol of lswp for older people without i d could not fit the special needs of population with i d . therefore , a group of clinical psychologists developed a life story book protocol which was designed specifically for this population . in developing this protocol , the following recommendations were taken into consideration : 1 ) the effective features of a life story intervention design for nursing home residents ; and 2 ) suggestions on the best format for compiling life history resources for older people living in institutional settings.16,30 this life story book protocol consisted of 16 structured one - to - one or group sessions , each lasting for 1.52 hours . the entire program spanned a period of approximately 6 months . it comprised a series of activities of various psychosocial elements , such as field visits , outings , production of life story book with photos , presentation , group sharing , and collecting feedback from the caregiver . lswp instructors work with participants and their family members to collect information and photos that tell the participants life stories . lswp instructors also help participants to express their feelings on their life stories in a caring and accepting atmosphere . participants are encouraged to use the life story books to share their life stories and achievements with other people . participants were guided by trained lswp instructors , who were experienced tutors for people with i d and received training and regular supervision from the clinical psychologists . the protocol provided step - by - step guidelines for the instructors to produce an individualized life story book for each client . the life story book enabled clients to gather current information about themselves ( the present ) and their history ( the past ) . moreover , it was a useful tool that could assist the clients to express themselves and tell their own story to people around them . , each participant will have a personalized life story book that includes the recording of significant people , places , and events for themselves ( table 1 ) . validated assessment tools were used to collect data for both intervention and control groups at both pretest and posttest periods . as mood , socialization , and qol were the outcomes of interest , corresponding assessment tools of mood interest and pleasure questionnaire ( mipq),31 vineland adaptive behavior scales , second edition ( vineland - ii),32 and personal well - being index intellectual disability ( cantonese ) , third edition ( pwi - id),33 were used respectively . these standardized measurements were chosen as the most appropriate to detect any change in the outcomes of interest for the subjects over the study period . the selected assessment tools demonstrate good reliability and validity . for the purpose of this study , the analysis of vineland - ii mainly focused on the socialization domain , while the communication abilities were perceived as a background and independent variable . data were analyzed using the statistical package for social sciences version 15 ( spss inc . , chicago , il , usa ) . independent samples t - tests ( and chi - square when appropriate ) were used to compare demographic characteristics between the control and intervention groups at baseline . two - way repeated measures of analysis of variance was further used to examine the effectiveness of the lswp . the difference in each function or well - being was calculated by subtracting participants score measured at baseline from their score measured 2 weeks after the intervention . independent samples t - tests were further conducted to compare the direction and magnitude of change between the control and intervention groups . table 2 summarizes the baseline demographics of the participants . a total of 60 participants with i d were recruited into the study and were assigned to either the lswp intervention group ( n=32 ) or control group ( n=28 ) . results showed that there were no significant differences between the control and intervention groups in terms of demographic factors , including age , sex , education level , communication abilities , marital status , and types of services received . similarly , no significant differences were detected between the two groups on baseline measurements of personal well - being , mood , interest , and pleasure or adaptive behavior on socialization , as measured by the pwi , mipq , and vineland - ii scales , respectively . the lswp had the potential to prevent the deterioration of mood ( as measured by mipq ) of older adults with i d ( table 2 ) . results of repeated measures analysis of variance showed a marginally significant main effect of time ( p=0.07 ) , but the main effect of intervention / control group on the mipq score was insignificant ( p=0.85 ) . the overall interaction effect of time and intervention was also found to be marginally significant ( p=0.09 ) . further analysis showed that the mean mipq score declined from 67.3662.27 in the control group ; whereas , the mean mipq score for the intervention group remained almost the same from 65.6265.35 , indicating the effectiveness of lswp in preventing the negative change in mood , interest , and pleasure of the participants . independent samples t - tests were further conducted on the mean difference in the subdomains of mipq between the control and the intervention groups ( table 3 ) . interest and pleasure ( p=0.04 ) , while no differences were evident in other domains . the lswp showed promise in improving the socialization skills ( as measured by vineland - ii ) of older adults with i d ( table 3 ) . results of repeated measures analysis of variance showed no main effect of time ( p=0.54 ) or intervention / control group ( p=0.58 ) on the socialization skills . similarly , the overall interaction effect of time and intervention was not significant ( p=0.56 ) . independent samples t - tests were also conducted on the mean difference in adaptive behaviors and other subscales of the vineland - ii scale between the control and the intervention groups , but there were no significant differences . as stated in table 4 , concerning their socialization skills , the intervention group improved a little ( m = 3.19 ; sd = 20.66 ) while their counterparts in the control group remained the same ( m = 0.07 ; sd = 19.32 ) . the lswp enhanced qol ( as measured by the pwi - id ) of older adults with i d ( table 4 ) . results of repeated measures analysis of variance showed no main effect of time ( p=0.77 ) or intervention / control group ( p=0.96 ) on the pwi score . but the overall interaction effect of time and intervention was marginally significant ( p=0.09 ) . the mean pwi score declined from 82.04 to 76.24 in the control group while that for the intervention group increased from 75.24 to 81.31 , indicating the lswp tended to enhance the qol among older adults with i d . the mean scores of both the intervention and control groups were higher than that of the norm in hong kong which is 63.99.33 independent samples t - tests were further conducted on the change of mean ( m ) in different pwi life domains between the control and the intervention groups ( table 5 ) . particularly , the personal health status of participants in the intervention group improved after receiving the lsw treatment ( m = 7.60 ) , but it deteriorated in the control group ( m = -8.57 ) . there was marked improvement concerning community - connectedness among the intervention group ( m = 6.20 ; standard deviation [ sd ] = 29.91 ) ; whereas , a decrease in community - connectedness was detected in the control group ( m = -21.43 ; sd = 34.97 ) . the difference between the two groups was statistically significant ( p=0.01 ; table 5 ) . although there were no significant differences in the other five life domains between the control and the intervention group , the outcome of the intervention group seemed to be better than that of the control group in all of these domains , as demonstrated by the mean differences ( table 5 ) . the effectiveness of lsw tended to vary , depending on the participants communication abilities . to examine whether the effectiveness of lswp was dependent on the participants communication abilities , we divided the participants who received the intervention into two groups based on their communication abilities . a mean cut - off score of 27.7 ( according to the vineland - ii manual on adults with moderate - grade mental retardation ) was used to categorize participants into a low communication group ( mean score , 27.7 ) , and a high communication group ( mean score , > 27.7 ) . as a result , 18 participants were assigned to the low communication group , and 14 participants were assigned to the high communication group . independent samples t - tests were conducted on the change of mean ( m ) in different outcome variables between the low and high communication groups . compared to the low communication score group ( m = -0.95 ; sd = 29.06 ) , the lswp seemed to be more effective in improving the pwi of the group with the higher communication score ( m = 10.60 ; sd = 15.89 ) and its subdomains except for personal safety although this did not reach statistical significance . a similar pattern was observed for the socialization skills ( low communication score group , m = 0.44 , sd = 6.30 ; high communication score group , m = 6.71 , sd = 30.69 ) . however , all of these observed differences did not reach statistical significance , partly due to a relatively small sample in our study . table 2 summarizes the baseline demographics of the participants . a total of 60 participants with i d were recruited into the study and were assigned to either the lswp intervention group ( n=32 ) or control group ( n=28 ) . results showed that there were no significant differences between the control and intervention groups in terms of demographic factors , including age , sex , education level , communication abilities , marital status , and types of services received . similarly , no significant differences were detected between the two groups on baseline measurements of personal well - being , mood , interest , and pleasure or adaptive behavior on socialization , as measured by the pwi , mipq , and vineland - ii scales , respectively . the lswp had the potential to prevent the deterioration of mood ( as measured by mipq ) of older adults with i d ( table 2 ) . results of repeated measures analysis of variance showed a marginally significant main effect of time ( p=0.07 ) , but the main effect of intervention / control group on the mipq score was insignificant ( p=0.85 ) . the overall interaction effect of time and intervention was also found to be marginally significant ( p=0.09 ) . further analysis showed that the mean mipq score declined from 67.3662.27 in the control group ; whereas , the mean mipq score for the intervention group remained almost the same from 65.6265.35 , indicating the effectiveness of lswp in preventing the negative change in mood , interest , and pleasure of the participants . independent samples t - tests were further conducted on the mean difference in the subdomains of mipq between the control and the intervention groups ( table 3 ) . interest and pleasure ( p=0.04 ) , while no differences were evident in other domains . the lswp showed promise in improving the socialization skills ( as measured by vineland - ii ) of older adults with i d ( table 3 ) . results of repeated measures analysis of variance showed no main effect of time ( p=0.54 ) or intervention / control group ( p=0.58 ) on the socialization skills . similarly , the overall interaction effect of time and intervention was not significant ( p=0.56 ) . independent samples t - tests were also conducted on the mean difference in adaptive behaviors and other subscales of the vineland - ii scale between the control and the intervention groups , but there were no significant differences . as stated in table 4 , concerning their socialization skills , the intervention group improved a little ( m = 3.19 ; sd = 20.66 ) while their counterparts in the control group remained the same ( m = 0.07 ; sd = 19.32 ) . the lswp enhanced qol ( as measured by the pwi - id ) of older adults with i d ( table 4 ) . results of repeated measures analysis of variance showed no main effect of time ( p=0.77 ) or intervention / control group ( p=0.96 ) on the pwi score . but the overall interaction effect of time and intervention was marginally significant ( p=0.09 ) . the mean pwi score declined from 82.04 to 76.24 in the control group while that for the intervention group increased from 75.24 to 81.31 , indicating the lswp tended to enhance the qol among older adults with i d . the mean scores of both the intervention and control groups were higher than that of the norm in hong kong which is 63.99.33 independent samples t - tests were further conducted on the change of mean ( m ) in different pwi life domains between the control and the intervention groups ( table 5 ) . particularly , the personal health status of participants in the intervention group improved after receiving the lsw treatment ( m = 7.60 ) , but it deteriorated in the control group ( m = -8.57 ) . there was marked improvement concerning community - connectedness among the intervention group ( m = 6.20 ; standard deviation [ sd ] = 29.91 ) ; whereas , a decrease in community - connectedness was detected in the control group ( m = -21.43 ; sd = 34.97 ) . the difference between the two groups was statistically significant ( p=0.01 ; table 5 ) . although there were no significant differences in the other five life domains between the control and the intervention group , the outcome of the intervention group seemed to be better than that of the control group in all of these domains , as demonstrated by the mean differences ( table 5 ) . the effectiveness of lsw tended to vary , depending on the participants communication abilities . to examine whether the effectiveness of lswp was dependent on the participants communication abilities , we divided the participants who received the intervention into two groups based on their communication abilities . a mean cut - off score of 27.7 ( according to the vineland - ii manual on adults with moderate - grade mental retardation ) was used to categorize participants into a low communication group ( mean score , 27.7 ) , and a high communication group ( mean score , > 27.7 ) . as a result , 18 participants were assigned to the low communication group , and 14 participants were assigned to the high communication group . independent samples t - tests were conducted on the change of mean ( m ) in different outcome variables between the low and high communication groups . compared to the low communication score group ( m = -0.95 ; sd = 29.06 ) , the lswp seemed to be more effective in improving the pwi of the group with the higher communication score ( m = 10.60 ; sd = 15.89 ) and its subdomains except for personal safety although this did not reach statistical significance . a similar pattern was observed for the socialization skills ( low communication score group , m = 0.44 , sd = 6.30 ; high communication score group , m = 6.71 , sd = 30.69 ) . however , all of these observed differences did not reach statistical significance , partly due to a relatively small sample in our study . the present study represents one of the first attempts , using quantitative assessments , to evaluate the effectiveness of lswp in enhancing mood , socialization , and qol in older adults with i d . the results of the study showed that our lswp was generally effective in improving qol . it had the potential to prevent the deterioration of mood and showed promise in improving the socialization skills in older adults with i d . in addition , we also found that the effectiveness of lsw tended to vary , depending on the participants communication abilities . first , consistent with the results of the previous studies , our lswp improved the personal well - being of the participants , and it especially enhanced participants perceived personal health and sense of community - connectedness.8,34 since there is evidence that happiness and life satisfaction prospectively predict self - rated health,35 and people s self - rated health status is significantly and positively correlated with their actual physical and mental health , which may further contribute to better qol , the improvement of the participants perceived personal health was quite a desirable outcome of lswp.36 to some extent , it indicated participants ameliorated health status and qol after receiving lswp . second , although a significant improvement in mood was not detected in the participants of lswp , the results were encouraging in that , compared to the control group who experienced a drop in the mipq score , those who participated in the lswp had a relatively stable mood reflected by the mipq score . the lswp participants were more emotionally stable , showed interest , and actively participated in the lswp . a previous study has shown that emotional competence is positively and significantly associated with happiness and life satisfaction.37 as a matter of fact , it has been shown that people with i d are more likely to suffer from emotional disorders,1,19 and the severity of emotional problems including depressed mood and the loss of interest was positively correlated with age.5,38 these findings partly explain why a natural decline in the mipq score was detected in the control group in the present study . since previous studies have also found that emotional disorders may further affect long - term health conditions and mortality , effective interventions are needed.5 this study discovered the potential of our lswp to act as a protective factor in preventing the deterioration of mood in people with i d . third , results showed a positive trend of improvement among subjects in the intervention group in terms of their socialization skills , although this was not statistically significant . it could be that participants need some time to practice their improved social skills and , therefore , the improvement may not be immediately observable . in the program , it was believed that the tailor - made life story book with photos from lsw could assist the recall of past memories of the participants , help them to express themselves , and promote sharing with others . this aspect of change could be regarded as the improvement in socialization skills and community - connectedness . to some extent , the stronger sense of community - connectedness , the increased interest and pleasure , and the improved socialization skills can be perceived as enhanced participation , which has been found to be a valuable experience for people with different types of disabilities.39 last but not least participants with better communication skills seemed to benefit more from the program . compared to the group with a lower communication score , the lswp seemed to be more effective for the high communication group in improving their socialization skills and qol although statistical significance was not reached . a possible explanation was that those who had better expressive and comprehension skills were more actively involved in the lswp as compared to those with relatively limited verbal abilities . although the current study represents the first attempt to comprehensively and quantitatively evaluate the effectiveness of lswp on older adults with i d , the results might be affected by the relatively small sample size . in addition , as all of the participants were recruited from the same rehabilitation organization and the intervention and control group were not equally distributed in their living conditions for the ease of administration in the delivery of lswp , this might weaken the rigor and generalizability of the findings . therefore , further studies with larger sample sizes are warranted to provide more convincing evidence . . it would be better if regular booster trainings could be provided after the completion of the lsw , so that participants could update their lsw and refresh their memory and learning . the long - term effect of lsw could be further examined if booster trainings were incorporated into the program .

objectivethis study examines the effectiveness of a life story work program ( lswp ) in older adults with mild - to - moderate levels of intellectual disability ( id).methodsusing a quasiexperimental design , this study assigned 60 older adults who were between 5090 years old with mild - to - moderate levels of i d to receive either the lswp ( intervention group , n=32 ) or usual activities ( control group , n=28 ) during a period of 6 months . evaluation was made based on the outcomes assessed by the mood interest and pleasure questionnaire , the vineland adaptive behavior scales , and the personal wellbeing index id.results and conclusionlswp shows potential for improving the quality of life and preventing the loss of interest and pleasure in older adults with i d . it also shows promise in enhancing their socialization skills . patients with better communication abilities seemed to benefit more from the lswp .

Introduction Methods Participants Study design Content of the LSWp Measurement Data analysis Results Demographics and baseline measures Discussion and conclusion Limitations

the russian nickel refineries located in the cities of nikel and zapolyarny close to the norwegian border are responsible for extensive sulfur dioxide and nickel pollution , as well as severe ecological damage in both countries . the aim of our study was to investigate human nickel exposure in the populations living on both sides of the norwegian - russian border . the design was a cross - sectional population - based study of adults aged 18 - 69 years residing in sor - varanger municipality , norway , and nikel and zapolyarny , russia , during 1994 and 1995 . individual exposure to nickel was assessed by measurements of nickel in urine using electrothermal atomic absorption spectrometry . for controls , urine was collected from adults in the russian cities of apatity and umba ( kola peninsula ) and the norwegian city of tromso , all of which are locations without nearby point sources of nickel . altogether 2,233 urine specimens were analysed for nickel . people living in nikel had the highest concentrations ( median 3.4 microg / l ) , followed by umba ( median 2.7 microg / l ) , zapolyarny ( median 2.0 microg / l ) , apatity ( median 1.9 microg / l ) , tromso ( median 1.2 microg / l ) , and sor - varanger ( median 0.6 microg / l ) . regardless of geographical location , the russian study groups all had a higher urinary - nickel average than those in norway ( p<0.001 ) . with the exception of nikel , neither the russian nor the norwegian urinary - nickel levels were associated with residence location near a russian nickel refinery . we concluded that industrial nickel pollution alone could not explain the observed discrepancy between norway and russia ; we also discuss other possible nickel exposure sources that may account for the high urinary levels found in russia.imagesfigure 1figure 2figure 3figure 4figure 5

Images

corticosteroids remain the mainstay of treatment for the vast majority of patients with immune - mediated uveitis . however , those patients with active inflammation who are intolerant of or unresponsive to steroids require therapy with other immunosuppressive agents trying to prevent the potential sequelae associated with this vision - threatening condition . the off - label use of biologic agents and particularly those blocking tumor necrosis factor - alpha ( tnf- ) has demonstrated encouraging results when employed for management of patients with immune - mediated uveitis refractory to conventional treatment since their first reported use in 2001 . potential advantages of these agents when compared with traditional immunosuppressors include a substantial efficacy in recalcitrant cases , as well as a lower total immunosuppressive load , a rapid clinical effect , good safety profile , and significant improvement in quality of life . the present evidence shows that infliximab and adalimumab have the highest level of evidence and grade of recommendation , and thus both may be considered as first - line or second - line immunomodulatory agents for treatment of immune - mediated uveitis depending on which systemic immunologic disorder is associated with the intraocular inflammation [ 6 , 8 ] . golimumab ( glm ) ( trade name simponi ) , a fully human anti - tnf- monoclonal antibody , was approved by the us food and drug administration in 2009 for the use with methotrexate ( mtx ) in adults with moderate - to - severe active rheumatoid arthritis ( ra ) and with or without mtx or other biologic disease - modifying antirheumatic drugs in adults with active psoriatic arthritis ( psa ) or active ankylosing spondylitis ( as ) . some other studies have addressed the potential use of glm for treatment of uveitis , mainly associated with rheumatologic conditions [ 11 , 12 ] . we would like to present the results from three uveitis units in spain when using glm for treatment of patients with immune - mediated uveitis of various etiologies that had been resistant to several immunosuppressive agents . patients with different types of active immune - mediated uveitis that had been resistant to local and systemic corticosteroids and at least one additional immunosuppressive agent and who were treated with glm during at least 6 months were included in this study . table 1 lists demographic and diagnostic information for the 13 patients who form the basis of this report . in 12/13 patients ( 92.3% ) glm was at least the second biologic agent used for treatment of uveitis , whereas glm was used as first - line biologic therapy in one patient ( patient 6 ) . table 2 shows previous treatment regimens employed for management of uveitis in all included patients . we defined primary failure as an absence of a two - step decrease in level of inflammation ( e.g. , anterior chamber and/or vitreous cells ) or a decrease to grade 0 . we classified control of inflammation as grade 0 cells in both anterior and posterior segments in addition to absence of other signs of intraocular inflammation ( cystoid macular edema ( cme ) and vasculitis ) . all included patients received 50 mg of subcutaneous glm every four weeks during at least 6 months without modifications during the follow - up . chest x - ray , tuberculin skin test , and quantiferon - tb gold were performed in all patients before treatment . glm was the only immunomodulatory agent used in six of them . in seven patients , topical steroids were used by three patients ( patients 6 , 8 , and 9 ) at the beginning of the follow - up and were slowly tapered and discontinued after one month in all of them . uveitis clinical evaluation was performed at least four times ( before treatment and 1 , 3 , and 6 months after initiation of therapy with glm ) in all included patients . clinical evaluation included visual acuity ( bcva ; best - corrected snellen va ) and ophthalmic examination . anterior chamber was graded according to the classification established by the standardisation of uveitis nomenclature ; whereas the national eye institute system was adopted for grading vitreous inflammation [ 13 , 14 ] . optical coherence tomography ( cirrus hd - oct , carl zeiss meditec , dublin , ca , usa ) was used before and after treatment in both groups of patients to determine the presence of cme . the 1 mm central retinal thickness was evaluated using the macular cube strategy 512 128 in all patients at each study visit . macular edema was defined as central macular thickness > 300 and/or presence of intraretinal cysts in oct . fluorescein angiogram ( fa ) was performed routinely before and after starting treatment ( between 1 and 3 months after initiation of therapy ) to determine the presence or absence of retinal angiographic leakage . treatment - related side effects were assessed on each visit with a thorough review of systems and complete blood - cell counts , blood urea nitrogen ( bun ) level , creatinine level , and liver function test parameters obtained on an every study visit basis . results were expressed as mean sd for variables with a normal distribution or as median ( 25th75th interquartile range ( iqr ) ) when they were not normally distributed . eight men and 5 women ( 22 affected eyes ) with a median age of 30 years ( range 2038 ) and active immune - mediated uveitides were studied . uveitis was anterior in 8 patients ( 61.5% ) , intermediate in 1 patient ( 7.6% ) , and panuveitis in 4 patients ( 30.7% ) . all included patients ( 13/13 ) received previous treatment with systemic steroids ( using intravenous pulses of methyl - prednisolone ) in two of them . in addition , four patients ( 30.7% ) received coadjuvant intraocular steroids ( 2 intravitreal triamcinolone injections and 2 dexamethasone intravitreal implants ) . about traditional immunosuppressors , all included patients had been treated with methotrexate at any time prior to glm therapy , whereas cyclosporine a was used in 2 ( 15.38% ) , azathioprine in 1 ( 7.6% ) , tacrolimus in 1 ( 7.6% ) , mycophenolate mofetil in 1 ( 7.6% ) , cyclophosphamide in 1 ( 7.6% ) , and leflunomide in 1 ( 7.6% ) . only one patient received glm as first - line biologic therapy , whereas 12 patients received previous treatment with at least one other biologic agent . from the latter , 12 patients received treatment with at least one biologic drug prior to glm , 7 patients ( 53.8% ) received treatment with at least 2 biologics , 3 patients ( 23% ) received treatment with at least 3 biologics , and 1 patient ( 7.6% ) received treatment with at least 4 biologics . infliximab ( ifx ) was used as first biologic agent in 8 patients ( 61.5% ) , adalimumab ( ada ) in 3 patients , ( 23% ) , and etanercept ( etn ) in 1 patient ( 7.6% ) . ada was used as second biologic agent in 6 patients ( 46.1% ) and etn in 1 patient ( 7.6% ) . mean time on second biologic agent was 25.5 months ( range 1557 ) . abatacept was used as third biologic agent in 2 patients ( 15.3% ) and certolizumab in 1 patient ( 7.6% ) . etn was used as fourth biologic agent in 1 patient ( 7.6% ) during 7 months . coadjuvant immunosuppressive therapy was used in 7 of the studied patients including methotrexate ( 4 patients ) , azathioprine ( 1 patient ) , mycophenolate mofetil ( 1 patient ) , and leflunomide ( 1 patient ) . glm therapy achieved complete control of inflammation in 12/13 patients ( 92.3% ) after six months of treatment . the mean bcva increased from a basal value ( before initiation of glm ) of 0.60 to 0.68 at the six - month endpoint ( p = 0.009 ) . only one patient , patient number 12 , showed a score of anterior chamber and/or vitreous inflammation different than zero at the six - month endpoint . the mean 1 mm central retinal thickness decreased from a basal value of 317 to 261,2 at the six - month endpoint ( p = 0.05 ) . figure 1 shows changes in mean values of macular thickness ( 1 mm central thickness ) of all included patients over the study period . there was no evidence of active retinal vasculitis before initiation of therapy in any of the included patients . fluorescein angiogram results did not differ from those observed with oct regarding the presence of cme . only a mild and local cutaneous reaction was recorded in two patients ( patients 5 and 9 ) among all included patients over the entire study period . these results suggest that glm is well tolerated and is associated with control of inflammation in 92,3% of a heterogeneous group of immune - mediated uveitis patients resistant to traditional therapy and other biologic agents . the use of glm is also associated with short - term improvement in mean values of bcva and decrease of mean values of central retinal thickness . despite the evident limitations of this study , including its retrospective design , lack of a control group , short follow - up , and limited number of patients , the results suggest that further evaluation of this modality is appropriate . tnf- is recognized as one of the main inflammatory cytokines involved in the pathogenesis of immune - mediated uveitis [ 1416 ] . this ubiquitous cytokine plays a key role in initiating and maintaining the inflammatory processes by orchestrating leukocyte infiltration , dendritic cell maturation , and macrophage activation and driving t - helper lymphocytes ' response . therapy with two tnf- inhibitors , infliximab and adalimumab , has been proven to be effective for treatment of immune - mediated uveitis with considerable levels of recommendation and evidence [ 6 , 8 ] . the clinical efficacy of other tnf- blockers such as glm needs to be demonstrated and thus this drug is considered only as an alternative to those patients who have failed to respond to first - line tnf- inhibitors . however , it is necessary to emphasize that not all patients respond to their first anti - tnf agent , and so it is clearly useful to have a range of effective therapeutic options to treat those patients with severe and refractory immune - mediated uveitis . in this setting , . a potential limitation of these results could be related to the inclusion of less severe uveitis considering that we include 8 patients with anterior uveitis . however , anterior uveitis in these patients was associated with juvenile idiopathic arthritis ( patients 5 , 9 , 10 , and 11 ) and hla - b27 + haplotype ( patients 1 , 4 , 6 , and 8) . despite recent therapeutic progress , jia - associated uveitis has a severe course and the potential for long - term complications , including blindness . hla - b27 positive - associated anterior uveitis is associated with a substantially higher incidence of ocular complications and has a much worse prognosis when compared with hla - b27 negative - associated anterior uveitis . moreover , some of the patients with anterior uveitis ( patients 2 , 9 , and 11 ) had concomitant macular edema , the most vision - threatening complication associated with uveitis [ 20 , 21 ] . in this the seven cases that were included in our paper were severe and vision - threatening cases refractive to conventional and nonconventional treatment for such conditions . of note , patients included in the present study had a severe inflammatory condition which was resistant to several treatment - regimens inflammatory conditions . the positive response observed in almost all included patients needs to be analysed in this mentioned difficult clinical setting . this inclusion bias in addition to the short follow - up may have influenced the limited improvement in visual acuity observed in our study considering the long and severe course of intraocular inflammation in our patients . tnf- is one of the inflammatory cytokines that upregulates intraocular production of vegf [ 22 , 23 ] , which plays a crucial role in the pathogenesis of cme . we have previously reported how another tnf- blocker , adalimumab , induces a reduction in plasma vegf levels when employed for treatment of immune - mediated uveitis , which may correlate with clinical improvement . in our study glm also demonstrated a beneficial effect on cme thus strengthening the idea of a comparable efficacy with first - line tnf- blockers . previous reports on the use of glm for treatment of uveitis have focused on those patients with uveitis secondary to behet disease , juvenile idiopathic arthritis , and/or hla - b27 + haplotype . to the best of our knowledge , this is the first report of glm employed in the treatment of uveitis associated with sarcoidosis , vogt - koyanagi - harada disease , and/or psoriatic arthritis . the increasing potential treatment indications for glm may be of high interest in the therapeutical decision making of chronic uveitis patients . the main aim of this study is to show these encouraging results on the use of glm for treatment of immune - mediated uveitis . although these results are preliminary , further studies including a higher and more homogeneous group of patients are warranted .

objective . to evaluate , in three spanish tertiary referral centres , the short - term safety and efficacy of golimumab ( glm ) for treatment of immune - mediated uveitis resistant to previous immunosuppressive therapy . methods . nonrandomized retrospective interventional case series . thirteen patients with different types of uveitis that were resistant to treatment with at least 2 previous immunosuppressors were included in this study . all included patients were treated with glm ( 50 mg every four weeks ) during at least 6 months . clinical evaluation and treatment - related side effects were assessed at least four times in all included patients . results . eight men and 5 women ( 22 affected eyes ) with a median age of 30 years ( range 2038 ) and active immune - mediated uveitides were studied . glm was used in combination with conventional immunosuppressors in 7 patients ( 53.8% ) . glm therapy achieved complete control of inflammation in 12/13 patients ( 92.3% ) after six months of treatment . there was a statistically significant improvement in mean bcva ( 0.60 versus 0.68 , p = 0.009 ) and mean 1 mm central retinal thickness ( 317 versus 261.2 , p = 0.05 ) at the six - month endpoint when compared to basal values . no major systemic adverse effects associated with glm therapy were observed . conclusions . glm is a new and promising therapeutic option for patients with severe and refractory uveitis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the small sizes of the nanoparticles and large surface to volume ratio put the nanoparticles in a position for tremendous and wide applications essentially in biomedicine . though the small sizes of engineered nanoparticles have been linked with highly desirable properties ( mechanical , electrical , and chemical ) for specific uses , yet these same desirable properties are also likely to be associated with unwanted biological / toxicological reactivity . although metal nanoparticles have received increasing attention due to their widespread medical , consumer , industrial , and military applications , studies have correlated particle size of some metal - based nanoparticles ( e.g. , ag , au , and cu ) with toxicity , even if the same material is relatively inert in its bulk form [ 2 , 3 ] . indeed , there are increasing concerns about the safety of nanoparticles for human health and environment [ 46 ] , highlighting the need for further investigations on the safety of metal nanoparticles . moreover , data on the safety / toxicity profiles of metal nanoparticles are scarce . perhaps , the fears of health risks may not be completely unfounded , if the small sizes and the large surface area to volume ratio as well as the chemical reactivity and/or biological activity of the nanoparticles are to be considered . also there are studies revealing the potential of nanoparticles to alter normal physiology by interacting with biomolecules in living cells [ 79 ] thereby causing adverse effects at the cellular , subcellular , and protein levels . furthermore , nanoparticles enter the human body through ingestion , inhalation , and skin contact or genitourinary tract and become deposited in vital organs such as brain , liver , or kidneys [ 10 , 11 ] . studies have shown that nanoparticles may change or damage cellular processes by passing through cellular membranes to interact with biomolecules leading to dna and protein damage [ 12 , 13 ] or cross the blood - brain barrier to cause neurotoxicity . these factors underscore the urgent need for investigations aimed at establishing the influence of nanoparticles on biochemical parameters . the present study determined the effect of the oral administration of silver nanoparticle on some biochemical parameters in wistar rats . alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , and alkaline phosphatase ( alp ) assay kits were supplied by randox laboratory ( crumlin , uk ) . all other reagents were of analytical grade and were prepared in distilled water unless otherwise stated . male rats of wistar strain weighing between 170 and 180 g were obtained from the university of ibadan , ibadan , nigeria . animals were housed in hygienic environment and allowed to acclimatize for a week before commencement of treatments . the preparation and characterization of silver nanoparticles were as previously reported [ 15 , 16 ] . briefly , the agnps were made by adding 100 mm silver nitrate to a 1% ( w / v ) tannic acid solution ( ph adjusted to 8 by adding 150 mm potassium carbonate ) of polyvinylpyrrolidone ( pvp ) with stirring . the agnps were filtered using the 0.22 m filter and characterized by uv / vis spectrophotometry ( biotek epoch , usa ) , inductively coupled plasma optical emission spectrometry ( icp - oes , cambridge , united kingdom ) , and transmission electron microscopy ( tem , brno , czech republic ) . groups b , c , and d each were daily administered with 100 , 1000 , and 5000 mg / kg agnps , respectively , for 7 days . groups e , f , and g each were daily administered with 100 , 1000 , and 5000 mg / kg agnps , respectively , for 14 days . groups b , c , and d each were daily administered with 100 , 1000 , and 5000 mg / kg agnps , respectively , for 7 days . groups e , f , and g each were daily administered with 100 , 1000 , and 5000 mg / kg agnps , respectively , for 14 days . doses were fixed based on a recent report which demonstrated that the ld50 for silver nanoparticles ( agnps ) was greater than 5000 mg / kg . all treatments were orally administered with the aid of a cannula and animals sacrificed alternately 24 hours after cessation of treatments . the study was carried out in accordance with institutional guidelines on the handling of animals as approved for scientific research . 24 hours following cessation of last treatments , rats were sacrificed under anaesthetization in slight chloroform . blood samples were obtained by cardiac puncture into clean centrifuge bottles and spun at 4000 g for 5 minutes ( heraeus labofuge 300 , thermo scientific , hampshire , uk ) to yield the serum . the heart , liver , and kidneys from each animal were excised and weighed immediately . excised tissues were homogenized in ice - cold 0.25 m sucrose ( 1 : 5 w / v ) using a teflon homogeniser ( sigma - aldrich chemie gmbh , munich , germany ) . the tissue homogenates were centrifuged at 4000 g for 5 minutes ( heraeus labofuge 300 , thermo scientific , hampshire , uk ) to remove unbroken particulates . the following biochemical parameters were determined in rat serum , kidney , liver , and heart using a uv / vis spectrophotometer ( shimadzu , kyoto , japan ) where applicable ; protein concentrations in serum and tissue homogenates were estimated as described by gornall et al . . aspartate aminotransferase ( ast ) was determined using commercial randox kit [ 19 , 20 ] . data were subjected to statistical analysis using one - way anova with graphpad prism 3.0 ( graphpad software inc . , san diego , ca ) . the agnps had a maximal uv absorption at 430 nm with diameter sizes ranging between 8 and 20 nm ( figure 1 ) . treatment with agnps at the dose of 5000 mg / kg caused dullness in the rats , with one death recorded in the same group . the relative organ - to - body weight ratios for the animals are presented in table 1 . there are no significant differences when comparing between the agnps treatment groups and the control . the weights of the rats treated with silver nanoparticles increased at all concentrations ( figure 2 ) . however , the weight increments were only significant in the 1000 mg / kg for 14 days as well as the 5000 mg / kg for 21 days . treatment of rats with agnps caused elevation ( p < 0.05 ) in total protein levels in rat liver ( figure 3 ) . in contrast , the levels of total protein were reduced in rat serum , kidney , and heart for groups treated with agnps . oral exposure of rats to agnps at various concentrations inconsistently altered the serum and tissue levels of alp relative to the control ( figure 4 ) . in the serum , level of alp increased with increasing length of treatment administration . in contrast , nonsignificant reductions were recorded for tissue levels of alp caused by agnps treatments . for all the agnps treatment groups , the rat serum and tissue levels of ast were inconsistently affected relative to the control ( figure 5 ) . conversely , there was significant ( p < 0.001 ) reduction in the levels of alt in rat serum which was dose and duration dependent ( figure 6 ) . on the other hand , the rat kidney and heart levels of alt were not significantly altered by agnps treatment relative to control . humans can be exposed to these nanomaterials via a number of routes with the nanoparticles tending to accumulate in vital organs . according to gatti , nanoparticle deposition in vital organs or tissues the death could have been accidental . however , treatment at 5000 mg / kg agnps caused dullness in rats . the physical observation supports previous report which reported no death and no effect on the percentage weight gain between the control and treatment groups of mice orally given 5,000 mg / kg of colloidal agnps . , enzyme assays play a crucial role in toxicological evaluation . in the past several years , serum aminotransferases analyses have become a standard measure of hepatotoxicity because of the significance of these enzymes . normally , these enzymes are present in the liver and other tissues where they function in energy metabolism involving the transamination of amino acids . however , in cases of cellular damage , the ast and alt could leak out into the general circulation leading to elevated activity [ 2426 ] . in the present study , the treatment of rats with 100 mg / kg agnps decreased ( p < 0.001 ) levels of ast and alt enzyme significantly , whereas there were increases ( p < 0.001 ) in ast levels in serum , kidney , and heart for the 14- and 21-day treatment groups . treatment of rats with 1000 mg / kg and 5000 mg / kg agnps led to a significant decrease in alt levels and a significant increase in ast levels for the 14- and 21-day treatment groups . in contrast , ast levels significantly decreased while alt levels increased in rat serum treated with colloidal agnps for 7 days when compared with those treated for 21 days . this study also caused elevated ( p < 0.05 ) levels of rat serum alp levels . the effect of the oral administration of agnps to rats on alp , ast , and alt did not follow a definite pattern but may suggest partial inactivation of enzyme activity or depression of enzyme synthesis . although the liver has been reported as one of the recurrent target organs and a dominant site of accumulation of nanoparticles , the alterations to the levels of enzymes may represent adaptive mechanisms by the animals trying to offset stress imposed by exposure to the agnps . the dosages at 100 mg / kg produced more significant alterations to the biochemical parameters than did the higher dosages at 1000 and 5000 mg / kg , respectively . however , a previous study has demonstrated that administration of agnps to rats caused significant alterations to the alp levels . furthermore , alterations to the levels of ast , alt , or alp may not be unconnected with the affinity of agnps for thiol groups in protein molecules . moreover , a separate study by srivastava et al . has also demonstrated the potential of agnps to affect the activity of transaminase enzymes . in separate studies , the potential of silver nanoparticles to modulate enzyme activity was attributable to their affinity for thiol groups [ 15 , 16 ] . it is probable that thiol groups in the enzymes made them attractive to the agnps leading to formation of complexes and consequent modulation of enzyme activity . furthermore , the pronounced biochemical alterations noticed with the 100 mg / kg agnps in the present study may not be completely consistent with earlier report in which agnps had an ld50 of > 5000 mg / kg in mice . the administration of agnps in rats did not induce major changes in body weight and feed intake . however , this study is evidence indicating that rat tissue biochemical indices were altered following oral exposure to agnps . future studies are ongoing and target the determination of whether the alterations to the biochemical parameters were signs of agnps toxicity or not .

background . silver nanoparticles have found wider and increasing biomedical applications due to their broad antimicrobial characteristics . however , toxicity of nanoparticles is a subject of continued controversy , thus necessitating further studies in this direction . objectives . this study investigated the biochemical effects of silver nanoparticles in wistar rats . materials and methods . forty male rats were randomly distributed into eight experimental groups of five . group a served as the control and received distilled water . groups b to h were orally exposed to varying concentrations of silver nanoparticles ( agnps ) at 100 , 1000 , and 5000 mg / kg daily for 7 , 14 , and 21 days alternately . following cessation of treatments , rats were sacrificed and the blood and other vital organs were collected and prepared as specimens for biochemical analysis . results . administration of agnps to rats did not produce significant loss in feed intake and body weight . however , rat exposure to agnps caused significant alterations to levels of serum and tissue ast , alt , and alp . at the 100 mg / kg agnps exposure , rat serum and tissue ast and alt levels were significantly decreased ( p < 0.05 ) . in contrast , agnps administration elevated ( p < 0.05 ) alp levels in rat serum and tissues . conclusion . we show evidence that agnps administration to wistar rats altered some biochemical parameters .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

polycystic ovarian syndrome ( pcos ) is a heterogeneous group of conditions that include anovulation , hyperandrogenism , and polycystic ovaries . the nih - national institute of child health and human development conference of pcos originally recommended that the major criteria for pcos should include hyperandrogenism and/or hyperandrogenemia , oligoovulation , ultrasound pattern of polycystic ovaries and the exclusion of other known disorders . a pcos diagnosis is considered a hyperandrogenic disorder of exclusion with an ovarian etiology . in 2003 , the rotterdam consensus expanded the diagnostic criteria to include at least two of the following three features : clinical and/or biochemical hyperandrogenism , oligoanovulation , and polycystic ovaries , excluding any other endocrinopathies . in 2006 , the androgen excess - pcos society recommended that pcos be defined by clinical and/or biochemical hyperandrogenism , with either oligoanovulation and/or polycystic ovaries , excluding related disorders . the circulating total and free testosterone and dehydroepiandrosterone sulfate ( dheas ) levels are elevated in 5075% of women with pcos , if high quality assays are used . androgen excess is considered by some investigators to be the key feature of pcos ; however , only 8085% of women with clinical hyperandrogenism have pcos [ 4 , 5 ] . despite this evidence hyperandrogenism remains an important part of pcos and is included as major set of symptoms in both nih and rotterdam criteria . according to the nih criteria pcos affects 610% of women of the child bearing age [ 610 ] . as per the broader rotterdam criteria even more individuals can be classified as having pcos . therefore pcos becomes one of the most common human disorders and the single most common endocrinopathy in women of reproductive age . according to a common view pcos is a multifactorial and polygenic in nature [ 1 , 11 , 12 ] . up to now but the question still remains unanswered as to what is primary or secondary : metabolic syndrome or hyperandrogenism . there is an opinion and data suggests that testosterone was significantly related to metabolic syndrome and its components in obese adolescent girls [ 13 , 14 ] . other data reveals that in obese adolescent girls pcos does not add additional risk of further complications of metabolic syndrome [ 15 , 16 ] . pcos adolescent girls have been found to have increased visceral abdominal fat [ 16 , 17 ] , but there was no correlation between visceral abdominal tissue and total testosterone or free androgen index [ 15 , 16 ] . there are case studies that show that low hdl cholesterol is the criterion which best explains the high prevalence of the metabolic syndrome in pcos subjects which , in turn , is influenced by hyperinsulinemia , rather than by hyperandrogenemia . in both animal and human models the associations between serum testosterone and insulin resistance or metabolic syndrome / type 2 diabetes / pcos risk in women were demonstrated , but their cross - sectional nature did not allow conclusions about causality . as such the aim of our study was to find out whether elevated testosterone level impacts the presentation of metabolic syndrome in obese adolescent girls . we enrolled 107 adolescent girls from the pediatric endocrinology clinics and adolescent clinic at suny downstate medical center . pcos group was selected based on nih criteria including irregular menses and clinical and biochemical signs of hyperandrogenism . congenital adrenal hyperplasia , cushing 's syndrome , severe insulin resistance , and androgen - secreting tumors were excluded in all cases . also excluded from this study were patients under treatment with any lipid - lowering drugs , insulin sensitizers ( e.g. , metformin ) , or inositol supplements . the control group was selected from the adolescent clinic patients seen for routine health examinations . high testosterone ( ht ) : patients that met the nih and rotterdam criteria for pcos and had total testosterone > 90 ng / dl ; intermediate testosterone ( it ) : patients that met the nih and rotterdam criteria for pcos and had total testosterone in range 5190 ng / dl ; obese and normal testosterone ( ont ) : patients that did not fulfill the nih and rotterdam criteria for pcos and had bmi > 95th percentile , total testosterone < 50 ng / dl ; controls ( c ) patients that did not fulfill the nih and rotterdam criteria for pcos and had bmi < 95th percentile , total testosterone < 50 and regular periods , and did not meet any of the exclusion criteria . the group of 54 girls who had pcos according to nih criteria including irregular period or amenorrhea and increased level of testosterone was subdivided into 2 subgroups with ( a ) 23 patients with high level of testosterone ( t ) and ( b ) 31 patients with intermediate level of testosterone ( t ) . as a control we assigned 15 patients who had normal bmi and normal level of testosterone . data was obtained for blood pressure , bmi , testosterone , lh , fsh , prolactin , fasting lipid profile , and glucose . bmi was calculated as weight ( kg)/(height ( cm ) ) and bmi above 95th percentile according to the cdc , bmi charts was defined as obese . testosterone was determined by chemiluminescent immunoassay methodology ; high testosterone was defined as testosterone above 90 ng / dl and high intermediate as between 51 and 90 ng / dl . two - sample t - test assuming unequal variances analysis was performed to compare the means of the studied parameter between the 4 groups . multivariate logistic regression analysis was done for testosterone levels and lh , fsh , prolactin , lipid profile , fasting glucose , sbp , dbp , and bmi . for the statistical analysis we used the spss 19.0 software . there was no statistical difference between the high testosterone group ht and the other groups it and ont in sbp , dbp , fasting blood glucose , lipid panel , lh , fsh , and prolactin . furthermore our analyses did not yield any statistically significant difference between the intermediate testosterone group it and ont in any of the studied parameters ( table 1 ) . the control group had lower sbp and bmi comparing with the other groups but no statistical difference was found in dbp , fasting blood glucose , lipid panel , lh , fsh , or prolactin ( figure 1 ) . the regression analysis did not yield any correlation between the testosterone levels and any of the other parameters . the regressions were run both for the entire population studied and for each separate subgroup . bmi had statistically significant correlations with sbp , dbp , cholesterol profile , and lh but no correlation was seen for triglycerides , fsh , and prolactin ( table 2 ) . upon review of the literature , several studies suggest that pcos and high testosterone is an additional risk and is significantly related to metabolic syndrome and its sequelae in obese adolescent girls [ 2125 ] . pcos in adolescent patients has been found to have increased visceral abdominal fat , but there was no correlation between visceral abdominal tissue and total testosterone or free androgen index . an elevated risk profile for cardiovascular morbidity was demonstrated in pcos patients , mainly attributed to increases in type 2 diabetes , dyslipidemia , and hypertension [ 18 , 26 , 27 ] which might constitute a cofounder when studying the correlation between hyperandrogenism and the risk of metabolic syndrome in pcos . however , contrary with such studies [ 28 , 29 ] , we found that there were no significant differences in the relationship between the degree of hyperandrogenism and the metabolic parameters associated with metabolic syndrome . the level or degree of hyperandrogenism did not alter the metabolic parameters in our study group . while it is known that pcos is significantly more prevalent among obese patients and altered metabolic parameters are directly associated to degrees of bmi , there is still no consensus as to the question of what is primary or secondary metabolic syndrome or hyperandrogenism . pcos is polygenic condition and may be influenced by environmental factors like diet and lifestyle . in first - degree female relatives of pcos patients , it has been documented to be an increase in adrenal androgens and insulin resistance in these girls thus suggesting a genetic component . however , to date , there is no clearly defined genetic etiology that is associated with pcos and it is not clear whether hyperandrogenism is involved in the pathogenesis of this disorder . we may speculate that increased rate of metabolic syndrome among obese girl with pcos may be confounded with obesity rather than hyperandrogenism . another reason for lack of correlation between pcos and metabolic syndrome in adolescent girls may be that patients should be exposed to androgens longer to develop metabolic abnormalities in the adult age . it is important for further studies to investigate the effects of prolonged exposure to high circulating androgens mainly in lean pcos patients and the progression of this phenotype to metabolic syndrome . it is our belief that there may be an associated pathophysiological link with obesity , particularly visceral adiposity , and related adipose tissue factors , coagulation abnormalities , or insulin resistance [ 16 , 19 , 32 ] that may independently increase cardiovascular risk rather than a direct association of hyperandrogenism with metabolic syndrome morbidities . there can be limitations arising from the sample collection method or the chemiluminescent immunoassay method used to determine testosterone levels .

background . underlying insulin resistance and/or obesity has clearly been implicated in the development of metabolic syndrome in adolescents and young adults with polycystic ovarian syndrome ( pcos ) . it is not clear however what role hyperandrogenism has on the development of metabolic syndrome or its role on those metabolic parameters associated with metabolic syndrome . methods . we studied 107 adolescent girls ; 54 had pcos according to nih criteria . data was obtained for systolic and diastolic blood pressure ( sbp and dbp ) , body mass index ( bmi ) , total testosterone ( t ) , luteinizing hormone ( lh ) , follicle - stimulating hormone ( fsh ) , prolactin , fasting lipid profile , and glucose . the pcos group was divided initially into subgroups according to bmi ( kg / m2 ) , then based on t ( ng / dl ) levels as follows : high testosterone pcos ( ht ) , intermediate testosterone pcos ( it ) , obese and normal testosterone ( ont ) , and lean and normal t ( control , c ) . t - test analysis was performed in between all the groups . results . there was no statistical difference between ht and it , ht and ont , or it and ont in sbp , dbp , fasting blood glucose , lipid panel , lh , fsh , and prolactin levels . the control group had lower sbp and bmi comparing with ont , it , and ht groups . there were no statistical differences found in dbp , fasting blood glucose , lipid panel , lh , fsh , or prolactin . conclusion . metabolic profile in adolescent girls with pcos is not affected by either the presence of hyperandrogenism or the degree of hyperandrogenism .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

most common cause of lower gastrointestinal hemorrhage ( lgib ) in elderly patient is diverticular disease and mortality rate is very low 24% . a massive lgib from primary ilio - rectal fistula is rare and difficult to diagnosis but more common from secondary after previous vascular surgery a variety of treatment options are available , such as in situ graft , closure of defect alone , endovascular stent graft , extra - anatomical bypass and embolic coiling . exploration using laparotomy for ligation internal iliac aneurysm and rectal resection is a simple operative procedure which can be applied when emergency option is needed to save a life . we describe successful emergency surgery in primary ilio - rectal fistula when patient presents a massive lgib and hypovolemic shock . an 88-year - old man , his underlying diseases are hypertension , dyslipidemia , moderate aortic stenosis and mitral valve stenosis , chronic kidney disease and prostate cancer . at emergency department , physical exam showed hypotension blood pressure 70/50 mmhg and per rectal exam showed blood clot with enlarged prostate . after resuscitation until stable vital sign , he was sent for colonoscopy but can not be evaluated due to a lot of blood clots in the rectum . he was admitted for observation and we planned to repeat colonoscopy again following day because he was stable and bleeding was stopped . following day after admitting , he had massive lower gastrointestinal bleeding again fresh blood ~1000 ml from his anus . but the patient had a problem vascular access site and then send to computed tomography angiography ( cta ) for evaluate access site . we found 3 cm aneurysm of right internal iliac artery with partial thrombus and attached to rectosigmoid colon with leakage of contrast into sigmoid lumen ( figs 12 ) . he was sent to operating room during transferring we gave blood transfusion and then emergency explore laparotomy was performed , the operation performed by partial aneurysmectomy , ligated right internal iliac , wedge resection rectum wall and temporary abdominal closure with swab packing due to bowel distension and abdominal pressure was high . he was sent to operating room for change swab packing on day 3 and permanent abdominal closure on day 5 . during postoperative period primary aorto / ilio - enteric fistula ( paef ) is very rare , but secondary fistula is more common . sir astley cooper was the first to describe a paef as a condition caused by spontaneous erosion of the aorta into the gastrointestinal tract . etiology of paef are several causes , most causes are due to aneurysm , infection , tumor , radiotherapy and foreign body ingestion [ 59 ] . the most common site of fistula located in duodenum 54% , esophagus 28% , small bowel and large bowel 15% . the classical triad of symptoms associated with a fistula is gastrointestinal hemorrhage , abdominal pain and a pulsating abdominal mass . most common sign and symptoms of fistula is gastrointestinal bleeding , but only 11% presented with classical triad . the diagnosis of paef is difficult to make . because most of patients were send to endoscope due to gastrointestinal bleeding symptoms . several diagnosis investigations were used when patients are clinically stable such as cta , angiography , colonoscopy , and red blood cell scan . all of these do not constitute specific investigation . however , ct scan can diagnose specifically aorto / ilio - enteric fistula ( for example , air within aortic wall or contrast fill in bowel lumen ) that detection rate 61% when failure diagnosis from endoscopy . such as , in situ graft , closure of defect alone , endovascular stent graft , extra - anatomical bypass and embolic coiling . optional treatment depends on surgeon s experience , hospital facilities and the type of paef . this case was send to the operating room after diagnosis right internal ilio - rectal fistula for emergency exploration with laparotomy because the patient s active bleeding and vital signs were not stable preventing adequate preparation time for intervention or stent graft in hospital . we decided to ligate right internal iliac artery , wedge resection rectum with suture repair because this is a simple operation and can save patient s life . other options could be done by endovascular therapy or embolic coiling if we had time to prepare and the patient was already stabilized in this hospital . in conclusion , paef is very rare . the patient who has massive lower gastrointestinal bleeding with failure of endoscope may need to consider imaging to rule out paef . there are several treatment options for paef but no conclusive specific treatment it depends on patient s situation and physician s experience . although endovascular or embolization is minimally invasive surgery and good for the patient who is a high operative risk but an emergency simple operation is an effective procedure not only saves patient s life but also can be done by a general surgeon ( fig . figure 1:axial view iliac aneurysm with partially thrombose contact rectosigmoid colon and contrast leak.figure 2:coronal view iliac aneurysm.figure 3:cta after 1 year .

abstractmassive lower gastrointestinal from primary isolated ilio - rectal fistula is a rare condition and difficult to diagnosis and emergency surgery for this situation has a high mortality rate . this report describes a successful operation in an 88-year - old man at present with massive lower gastrointestinal hemorrhage from ilio - rectal fistula and hypovolemic shock . underlying diseases are prostate cancer , hypertension , dyslipidemia , aortic stenosis , mitral valve stenosis and chronic renal disease . operative treatment is to explore laparotomy with internal iliac artery ligation and rectal resection . during postoperative period patient developed acute cholecystitis and treated by cholecystectomy 1 month after operation the patient went home without morbidity and 1-year follow - up he had not any complications .

INTRODUCTION CASE REPORT DISCUSSION CONFLICT OF INTEREST STATEMENT

diabetes , obesity , and cardiovascular diseases are interrelated , with diet being one factor that links them all together . specifically , the current obesity epidemic has been suggested to be a result of increased carbohydrate intake , while dietary fat has frequently been touted as the primary dietary culprit in the cause of many deleterious metabolic conditions . as a nation , we increased carbohydrate consumption during the latter years of the past century as the obesity epidemic began to surge . while it is laudable to try to change the behavior of individuals so they choose other foods , it might be more effective in the short term to address this nutritional issue by providing bioactive compounds that behave like traditional starch yet elicit more favorable metabolic outcomes ( acutely and chronically ) . in other words , let people continue to choose some of the foods they prefer , but make those foods healthier by incorporating bioactive ingredients . to that end , incorporating resistant starches into foods by substituting them for the typical starch has been shown to acutely decrease postprandial glucose and insulin . there are five types of resistant starch , with rs types 2 , 3 , and 4 tending to be studied more frequently . gram for gram , some resistant starches have been reported to elicit minimal glucose and insulin excursions compared with similar amounts of dextrose and are easily incorporated into regular food items with minimal aversion by consumers . given the number of resistant starches commercially available , there is a paucity of evidence from human trials illustrating the effects various types of resistant starches have on glucose metabolism . likewise , some consumers are looking to food to assist them with regulating food intake and/or regulating blood glucose . there is evidence that resistant starch might be able to achieve this by affecting satiety and subsequent food intake , and attenuating postprandial glycemia and insulinemia [ 2 , 5 ] . to complicate matters , behall et al . reported that it is imperative that individual starches and fibers be tested for efficacy given the unique structure and function qualities of starches that are quickly becoming available . for example , haub et al . observed that specific forms of rs2 and rs4 elicit different glycemic responses when compared at the same dose . while cross - linked rs4 has been shown to elicit significant reductions in glycemia and insulinemia , newer versions are being formulated and might provide even greater and/or different health impacts . one new version of rs4 is commercially available but has not been clinically tested to determine its efficacy to assist with regulating blood glucose and minimizing hyperglycemia . therefore , the purpose of this study was to determine the glycemic and satiety effects of novel forms of rs4 , derived from potato starch . the hypotheses were that consuming the rs4 treatments would not affect glycemia compared with a dextrose - only control solution ; and would increase ratings of fullness when added to dextrose control solution . the institutional review board of kansas state university approved the study , and written informed consent was obtained from all volunteers prior to the study . inclusion criteria were no diagnosis of acute or chronic metabolic and cardiovascular diseases , free of gastrointestinal disorders , body mass index of 2030 kg / m , and nonsmokers . volunteers completed five trials via a single - blind randomized crossover design ( we did not alter the water to match the taste / color of the dextrose solution ) . however , neither the subject nor the technician knew which rs treatment they were receiving . during each visit , volunteers consumed one of the following : dextrose solution of 50 g oral glucose tolerance beverage ( dex ) , 38 g of pf mixed into dex ( pf+ ) , 38 g of pr mixed into dex ( pr+ ) , 38 g of pf mixed in to water ( pf ) , and 38 g of pr mixed into water ( pr ) . the doses of rs were chosen to provide 30 g of resistant starch as 80% of each resistant starch was determined to contain rs and dietary fiber ( table 1 ) . the resistant starches were selected as they are novel , were uniquely produced using proprietary techniques , and had not been clinically tested for efficacy regarding their effects on glycemia as resistant starches do not necessarily elicit the same glycemic response . the treatments were randomly administered in crossover fashion using a latin square design . after providing informed consent , as approved by the university research compliance office at kansas state university , volunteers were enrolled into the study . for testing the fasting capillary blood samples were drawn by finger stick prior to drinking the assigned treatment for that day . the remaining blood samples were collected at 30 , 45 , 60 , 90 , and 120 min after ingesting the treatment . blood samples were analyzed in duplicate for glucose concentration using a ysi 2300 stat ( yellow springs , oh ) . after blood was collected , the participants were provided a visual analog scale ( satiety labeled intensity magnitude ( slim ) scale ) to provide a rating of fullness ( rof ) as used by others . volunteers were not shown previous surveys before the next treatment . at the conclusion of the study , one technician ( blind to treatments ) recorded the individual rof responses . the incremental area under the curve ( iauc ) was calculated for glucose using the trapezoid model ( prism v5 , graphpad ) . a repeated measures analysis of variance was used to determine the presence of significant main and interaction effects , and bonferroni post - hoc assessments were performed to determine between treatment effects and significance set at p = 0.05 ( prism v5 , graphpad ) . there was a significant ( p < 0.05 ) difference between the two water trials and three dextrose trials , with the water + rs trials eliciting a significantly decreased glycemic response compared with the three dextrose trials ( figure 1 ) . there were no treatment differences ( p > 0.05 ) within the three dex treatments ( dex , pr+ , and pf+ ) or within the two water treatments ( pr and pf ) . there was a significant main effect for time in pr+ , pf+ , and dex , while there were no time effects following the ingestion of 38 g of each resistant starch mixed with water . the pr+ and pf+ treatments with 38 g of potato - derived modified starches added to dex did not increase the glycemic response compared with dex alone . this study illustrates that two novel potato - derived resistant starches did not elicit a glycemic response when added to 296 ml of water . likewise , there was no treatment effect of each rs4 added to dex when compared to dex alone . the glycemic results of the present study are similar to data from our previous assessment of a wheat - derived rs4 in that the excursion from baseline was minimal when pf and pr were ingested when added to water . the acute glycemic effect of resistant starch , regardless of type , has been studied extensively and has been shown to decrease glucose and insulin when ingested as part of a food [ 2 , 6 , 9 ] , but few studies to date have concomitantly investigated the effects on satiety . a study by raben et al . , who also used potato starch , had volunteers ingest meals containing raw or pregelatinized potato starch on postprandial glucose and insulin concentrations and satiety . they observed that the replacement of raw potato starch ( increased rs content ) for pregelatinized starch elicited decreased glucose and insulin levels . contrary to the present observations , they reported that the resistant starch meal elicited a significant ( p < 0.05 ) decrease in fullness and satisfaction . the difference between their observations and those of the present study are likely due to the methods of incorporating the resistant starch into the treatments that were ingested . raben et al . replaced digestible starch with resistant starch , while we added the starch to the digestible carbohydrate . thus , the treatments used by raben et al . did not use treatments that had equal amounts of readily digestible starch . since the resistant starch treatment had 50% less energy from readily digestible starch , their decreased postprandial glucose and insulin responses are expected and are in agreement with the glucose differences observed in the present study between the pf and pr treatments when compared with dex , pf+ , and pr+ treatments , as the pf and pr treatments did not contain 50 g of dextrose . the difference in satiety results reported between studies may , also , be due to the energy differences of the meals reported by raben et al . , as their rs treatment was reported to contain 367 kj , while the pregelatinized starch meal contained 917 kj . however , a study by leeman et al . supports the satiety responses observed in the present study as they reported no difference in ratings of satiety for potato foods ( french fries and boiled potatoes ) with differing levels of energy content , indicating that factors other than energy content , such as energy density , may need to be taken into account when assessing satiety and subsequent energy intake . the present data , also , support the notion that postprandial glycemia and satiety responses may not always coincide . even though subjects were consuming more energy with each dextrose treatment ( pf+ , pr+ , and dex ) , the reported satiety responses were not different from those observed with pf and pr. this observation has been previously reported . an explanation for the lack of an rof effect might be that the beverages did not reach a portion threshold to elicit a satiety response . the limitations of this study are as follows : the starches were not incorporated into a food ( bread , muffin , etc . ) , rof could have been influenced by volume of intake as the pf+ and pr+ treatments ( 88 g of carbohydrate ) had a greater volume than the dex trial ( 50 g of carbohydrate ) , the sample size was powered for glycemia and not fullness , only one outcome of satiety was assessed . even with shortcomings , this study is significant as it illustrates that glycemia did not influence rof indicating that beverage - induced increases in blood glucose do not appear to impact rof . future studies need to measure intake overtime and take more measures of satiety to better understand how results from acute studies translate to habitual eating . in conclusion , this study presents novel data regarding the combined physical ( glucose ) and psychological ( satiety ) effects of a potato - derived resistant starch . these data indicate that 38 g of pf and pr added to water do not affect capillary glucose over two hours . likewise , when 38 g of pf and pr were added on top of 50 g of dextrose ( 88 g of carbohydrate ) , those resistant starches did not affect glucose or satiety responses when compared with the dex ( 50 g of carbohydrate ) treatment . since the addition of these starches did not affect blood glucose , these rs products might be useful substitutions for standard rapidly digestible starches to decrease postprandial glucose , and likely insulin , to better control blood glucose when incorporated into a food product . however , those foods would need to be clinically tested to insure the effects translate .

this study was designed to determine the efficacy of two novel type - four resistant starches ( rs4 ) on postprandial glycemia and ratings of fullness . volunteers ( n = 10 ) completed completed five interventions designed to determine the glycemic and satiety ( fullness ) effects of the starches ( 38 g , ) alone and when added on top of available carbohydrate . the dose of the starches provided 30 g of resistant starch per treatment . the treatments were : commercial resistant starch added to water ( pf ) , noncommercial resistant starch added to water ( pr ) , dextrose solution ( dex , 50 g ) , and dex with penfibe starch ( pf+ ) , and dex with the non - commercial starch added ( pr+ ) . blood glucose was measured in the fasted state and following the randomly assigned treatments at 30 , 45 , 60 , 90 , and 120 minutes post - consumption . a visual analog scale was used to determine fullness at each time point . there were no differences in the glucose incremental areas under the curve ( iauc ) for pf+ and pr+ compared with dex . the pf and pr treatments had decreased ( p < 0.05 ) iaucs for glucose compared with dex , pf+ , and pr+ . there were no treatment differences for rof . the dose ( 38 g ) of starches did not to alter glucose responses when added on top of 50 g of dextrose .

1. Introduction 2. Methods 3. Results 4. Discussion

there is evidence based on the remineralization potential of agents such as fluoride , casein phosphopeptide amorphous calcium phosphate ( cpp - acp ) , casein phosphopeptide amorphous calcium phosphate with fluoride ( cpp - acpf ) . it has been observed that cpp - acp remineralized initial enamel lesions and has shown increased remineralization potential when used along with fluoridated toothpaste . apf gel forms more fluoride in enamel than neutral gel and it is more efficient in reducing enamel demineralization of enamel blocks submitted to cariogenic challenge than the neutral one . cpp - acpf is proven to produce significantly greater mean percentage of remineralization in comparison with cpp - acp . mineral deposition throughout the lesion has been proven in relation to use of both cpp - acp and cpp - acpf . it has been observed that gums comprising of cpp - acp nano complexes have a marked remineralization potential . the cpp - acp has also been shown to remineralize enamel subsurface lesions in situ when delivered through oral care products . the probable anticariogenic mechanism of cpp - acp is its ability to localize acp at the tooth surface , which brings about buffering of calcium and phosphate free ion activities , thereby helping to maintain a state of super saturation with respect to tooth enamel negating demineralization and enhancing remineralization . cpp - acpf due to its added fluoride content has shown improved ability to remineralize initial caries . in incipient enamel caries low concentrations of fluoride are able to penetrate deeper into the body of the lesion and bring about remineralization , hence sodium fluoride ( naf ) ( 200 ppm/0.044% ) has been opted for use in this study . the study aimed at quantitatively evaluating the enamel remineralizing potential of cpp - acp , cpp - acpf and naf using surface microhardness analysis ( vickers hardness test ) . the teeth were cleansed of visible blood and gross debris and were maintained in a hydrated state during storage . extracted teeth were placed in sodium hypochlorite solution diluted with saline in a ratio of 1:10 in the container with a secure lid to prevent leaking and labeled with the biohazard symbol . teeth that do not contain amalgam restorations were preferred because they can be safely autoclaved . however , extracted teeth containing amalgam restorations , were immersed in 10% formalin solution for 2 weeks . enamel samples ( 2 mm thickness ) were prepared from the buccal and lingual surfaces of the teeth selected , using a double faced diamond disc mounted on a contra - angle hand piece . following sample preparation windows were created ( dimension of 5 mm 5 mm ) using adhesive tape and the sample was made completely resistant to acid attack by coating nail varnish . the adhesive tape was removed from the enamel using a sharp tipped instrument exhibiting a rectangular area on the enamel surface . a total of 50 enamel slabs were randomly divided into five groups of 10 samples in each based on the type of remineralizing agent to be used [ table 1 ] . the division of groups each of the enamel samples were then immersed in 40 ml of demineralizing solution ( acetate 0.1 mol / l , calcium 0.1 mol / l , phosphate 0.1 mol / l , fluoride 0.1 mg / l , ph 5.0 ) for a period of 4 days at a constant temperature of 37c , in an incubator to induce artificial caries formation , simulating an active area of demineralization . slurry of cpp - acp and cpp - acp along with fluoride were prepared by agitating the above mentioned preparations in deionized water in the ratio of 1:3 . ph cycling model was adopted to simulate the dynamic process of demineralization and remineralization that occurs in the oral cavity . each of the enamel samples were treated with the respective remineralizing agents for a period of 2 min , following which the samples were individually immersed in 20 ml of demineralizing solution ( calcium 2.0 mmol / l , phosphate 2.0 mmol / l , acetic acid 75.0 mmol / l , ph 4.4 ) for a period of 3 h. this was followed - up with treatment of the samples again with slurries of the respective remineralizing agents for 2 min . all the enamel samples were individually immersed in 30 ml of remineralizing solution ( 1.5 mm calcium , 0.9 mm phosphate , 0.15 m kcl in 0.1 m tris buffer , ph 7 ) for a period of 17 h. the remineralizing solution was replaced every 48 h and the demineralizing agent replaced every 5 days . the ph cycling was carried out for a period of 28 days . after the completion of the process of ph cycling , all the groups of enamel samples were assessed for surface microhardness using vickers hardness test ( micro vickers hardness tester , matsuzawa co. , ltd , toshima , japan ) . the surface microhardness of the specimens was determined using digital microhardness tester ( matsuzawa co. , ltd . model - mmt x7 , japan ) with a vickers elongated diamond pyramid indenter and a 40 objective lens . a load of 100 g was applied to the surface for 10 s. five indentations were placed on the surface and the average value was considered . the diagonal length of the indentation was measured by built in scaled microscope and vickers values were converted to microhardness values . multiple comparisons between groups were performed by posthoc tukey test [ tables 2 and 3 ] . the teeth were cleansed of visible blood and gross debris and were maintained in a hydrated state during storage . extracted teeth were placed in sodium hypochlorite solution diluted with saline in a ratio of 1:10 in the container with a secure lid to prevent leaking and labeled with the biohazard symbol . . however , extracted teeth containing amalgam restorations , were immersed in 10% formalin solution for 2 weeks . enamel samples ( 2 mm thickness ) were prepared from the buccal and lingual surfaces of the teeth selected , using a double faced diamond disc mounted on a contra - angle hand piece . following sample preparation windows were created ( dimension of 5 mm 5 mm ) using adhesive tape and the sample was made completely resistant to acid attack by coating nail varnish . the adhesive tape was removed from the enamel using a sharp tipped instrument exhibiting a rectangular area on the enamel surface . a total of 50 enamel slabs were randomly divided into five groups of 10 samples in each based on the type of remineralizing agent to be used [ table 1 ] . each of the enamel samples were then immersed in 40 ml of demineralizing solution ( acetate 0.1 mol / l , calcium 0.1 mol / l , phosphate 0.1 mol / l , fluoride 0.1 mg / l , ph 5.0 ) for a period of 4 days at a constant temperature of 37c , in an incubator to induce artificial caries formation , simulating an active area of demineralization . slurry of cpp - acp and cpp - acp along with fluoride were prepared by agitating the above mentioned preparations in deionized water in the ratio of 1:3 . ph cycling model was adopted to simulate the dynamic process of demineralization and remineralization that occurs in the oral cavity . each of the enamel samples were treated with the respective remineralizing agents for a period of 2 min , following which the samples were individually immersed in 20 ml of demineralizing solution ( calcium 2.0 mmol / l , phosphate 2.0 mmol / l , acetic acid 75.0 mmol / l , ph 4.4 ) for a period of 3 h. this was followed - up with treatment of the samples again with slurries of the respective remineralizing agents for 2 min . all the enamel samples were individually immersed in 30 ml of remineralizing solution ( 1.5 mm calcium , 0.9 mm phosphate , 0.15 m kcl in 0.1 m tris buffer , ph 7 ) for a period of 17 h. the remineralizing solution was replaced every 48 h and the demineralizing agent replaced every 5 days . the ph cycling was carried out for a period of 28 days . after the completion of the process of ph cycling , all the groups of enamel samples were assessed for surface microhardness using vickers hardness test ( micro vickers hardness tester , matsuzawa co. , ltd , toshima , japan ) . the surface microhardness of the specimens was determined using digital microhardness tester ( matsuzawa co. , ltd . model - mmt x7 , japan ) with a vickers elongated diamond pyramid indenter and a 40 objective lens . a load of 100 g was applied to the surface for 10 s. five indentations were placed on the surface and the average value was considered . the diagonal length of the indentation was measured by built in scaled microscope and vickers values were converted to microhardness values . multiple comparisons between groups were performed by posthoc tukey test [ tables 2 and 3 ] . in spite of the enamel remineralizing potential of saliva , by itself it fails to initiate the process of increasing the levels of calcium and phosphate . calcium and phosphate ions must first penetrate the surface layer of enamel , to bring about deposition of minerals through the body of the lesion , which confirms the reason for the cpp supported metastable calcium phosphate solutions of being such efficient remineralizing solutions . majority of them are composed of calcium and phosphate with acetic acid or lactate . the main variation lies in concentrations of each component , which influences the final ph and the sample exposure time . the ph employed varies from 3.5 to 5 and the time differs from 2 h to 21 days . in this study demineralization various studies have used different methods to assess the process of enamel remineralization . the commonly used microhardness tests for evaluating enamel remineralization are vickers microhardness test and knoop microhardness test . as this study put the focus on evaluation of surface microhardness of enamel , vickers surface microhardness test was used . the values of surface microhardness indicate that remineralization of enamel is more in samples of group iii ( cpp - acpf ) followed by group iv ( naf ) and group ii ( cpp - acp ) . this may be because of the presence of fluoride in cpp - acp makes it more capable to remineralize the enamel . however , group iv ( f ) showed a marginal increase in remineralization compared with group ii ( cpp - acp ) . one - way anova shows that there is a significant difference between all the five groups . however , multiple group posthoc tukey test showed a significant difference only between groups v with the other groups . no other group showed significance when they were inter - compared . adopting the usage of low fluoride concentration as present in cpp - acpf ( 0.2% ) , there is a complex localization of free calcium phosphate and fluoride ion activities , which aid in maintaining a state of super saturation by suppressing demineralization . even though fluoride is present in tooth pastes manufactured in india and china , research has also proven that apf forms more fluoride and is more efficient in reducing enamel demineralization when compared with neutral gel . sugar free chewing gums containing cpp - acp and citric acid result in higher remineralisation when compared with chewing gums without cpp - acp and citric acid and gums with citric acid alone . research suggest that fluoride dentifrices in combination with daily applications of acidulated phosphate fluoride ( apf ) topical thrice and four times a day were the only treatments able to increase the surface microhardness of enamel . the use of fluoride and the cpp - acp in recent years have been the best possible method in prevention of enamel caries and also in halting the progress of the existent enamel lesions . cpp - acp containing remineralising paste has shown remineralization effect within the first three month evaluation period . conversely , research also suggest that acp - cpp cream is nt as effective as fluoride in remineralizing early enamel caries at surface level . combination of fluoride and acp - cpp does not provide any additive remineralization potential compared to fluoride alone . however , it 's important to note that compliance of patient in oral hygiene maintenance and in home fluoride use is of utmost importance in prevention of enamel caries . the results of this study showed that cpp - acpf remineralized enamel subsurface lesion better in comparison with naf and cpp - acp . naf shown to be better than cpp - acp in enamel remineralization although the comparison between these two agents was insignificant statistically . with this basis we can confirm that cpp - acpf is an excellent material for remineralization of white spot or initial enamel caries . cpp - acp effectively remineralizes initial enamel caries , but to a lesser extent in comparison to cpp - acpf and naf.the addition of fluoride to cpp - acp shows improved remineralization of initial enamel caries when compared with cpp - acp and naf . cpp - acp effectively remineralizes initial enamel caries , but to a lesser extent in comparison to cpp - acpf and naf . the addition of fluoride to cpp - acp shows improved remineralization of initial enamel caries when compared with cpp - acp and naf .

aim : the aim of this study is to evaluate the enamel remineralization after treatment with three different remineralizing agents using surface microhardness assessment.materials and methods : this in vitro study involves 50 enamel samples divided into five groups of 10 samples each . the positive control group consisted of intact enamel and a negative control group consisted of demineralized enamel samples . all groups excluding the positive control group were subjected to demineralization following which three of these groups were remineralized using remineralizing agents ( casein phosphopeptide amorphous calcium phosphate [ cpp - acp ] [ gc tooth mousse ] , casein phosphopeptide amorphous calcium phosphate with fluoride [ cpp - acpf ] [ gc tooth mousse plus ] , sodium fluoride [ phos - flur ] ) . the groups treated with remineralizing agents were subjected to ph cycling over a period of 28 days . this was followed with assessment of surface microhardness ( micro vickers hardness tester , matsuzawa co. , ltd , toshima , japan).statistical analysis : one - way analysis of variance test and posthoc tukey test were conducted for multiple group comparison.results:there was an improved enamel remineralization in the group , remineralized using cpp - acpf in comparison with the other groups.conclusion:casein phosphopeptide with fluoride is a promising material for remineralization of enamel subsurface lesions .

INTRODUCTION MATERIALS AND METHODS Infection control protocol Sample preparation Groups Lesion preparation Slurry preparation of CPP-ACP, CPP-ACPF and NaF pH cycling model Surface microhardness Statistical analysis DISCUSSION CONCLUSION

pancreatic neuroendocrine tumors ( pnets ) represent a relatively uncommon form of malignancy with an incidence of 0.43 cases per 100,000 in the usa . at diagnosis , nearly 70% of patients have metastatic disease , of which 85% will have liver metastases . management options for pnets metastatic to the liver include surgical , ablative , cytotoxic , and radioisotope approaches . unfortunately , due to the scarcity of these tumors there is a paucity of randomized trials to guide optimal therapy sequencing . the north american neuro - endocrine tumor society and european neuroendocrine tumor society both support the use of radioembolization for progressive or symptomatic liver metastasis [ 3 , 4 ] . to date , yttrium-90 ( y ) therapy has appeared safe ; however , there is no randomized controlled trial assessing toxicities . we present the case of a woman undergoing y therapy for metastatic pnet to the liver who developed liver enzyme elevation and subsequent cirrhosis following treatment . there are only 3 other reported de novo cases of cirrhosis following y administration , with only 1 demonstrating confirmatory pathology [ 6 , 7 , 8 ] . ultrasonography and computed tomography ( ct ) of the abdomen revealed a 9.5 8.6 10.5 cm , heterogeneous , hypervascular mass adjacent to the spleen and abutting the stomach wall and tail of the pancreas . fine - needle aspiration guided by endoscopic ultrasound revealed cytologic evidence of a neuroendocrine tumor . the patient proceeded to a distal pancreatectomy , splenectomy , wedge resection of the stomach , and partial resection of the left adrenal gland . pathology demonstrated a 13-cm , well - differentiated neuroendocrine tumor of the pancreas with perineural invasion , but no vascular invasion and negative margins . it was found to be adherent to both the spleen and the stomach , but did not invade either . it had a mitotic rate of 2 mitoses / high - power field and a ki-67 index of < 2% . two months postoperatively , the patient was found to have 4 subcentimeter hypervascular lesions in the liver which were in octreotide scan negative . over the following 9 months , the patient developed 8 new lesions , while the original lesions increased to a maximum size of 1.2 cm . therapy with octreotide lar 20 mg intramuscularly once monthly was initiated but discontinued after 9 months due to progressive hepatic disease . a ct scan of the liver performed 3 months after embolization demonstrated a mixed tumor response with the overall impression of progressive disease and development of new liver metastasis . the patient was presented with the option of systemic therapy with everolimus , shown in phase iii trials to improve progression - free survival in patients with well - differentiated pnets . due to the absence of extrahepatic metastasis , liver - directed therapy with y embolization was also offered , which the patient chose to proceed with . prior to y treatment , there was no radiologic evidence of cirrhosis and the liver enzymes were within normal ranges ( ast 24 u / l [ normal range ( n ) 1038 < 50 u / l ] , alkaline phosphatase 156 u / l [ n 50200 u / l ] , total bilirubin 5 mol / l [ n 018 mol / l ] ) . she had a technetium-99 macroaggregate albumin planning spect ct demonstrating multiple focal regions of increased activity in the left and right lobes of the liver which corresponded to the patient 's known metastases . radioembolization with 3.5 gbq of y theraspheres was administered to the right hepatic artery , delivering a total dose of 140 gy to the right lobe of the liver , and 1.8 gbq of y theraspheres was delivered through the left hepatic artery with a dosing of 140 gy to the left lobe of the liver on the same day . over the following 3 months , the patient developed abdominal pain and nausea and was found to have elevated liver enzymes , in a pattern suggesting damage to the biliary tree ( ast 52 u / l , alt 86 u / l , alkaline phosphatase 405 u / l , ggt 604 u / l , total bilirubin 5 ct scanning of the abdomen demonstrated generalized mottling of the liver , compatible with postembolization edema with a substantial decrease in tumor burden and 2 significant lesions remaining . the patient 's liver enzymes remained elevated over the following 6 months until she developed significant right upper quadrant pain . ct 9 months after y treatment revealed a very inhomogeneous liver texture and a large biloma traversing segments 5 and 8 of the liver , measuring 8.5 6.5 5.5 cm . this was initially noted 10 months after y treatment and was slightly progressive on the 14-month scan ( fig . 1 ) . imaging also demonstrated multiple subcentimeter right hepatic lesions raising concern for metastatic disease , some of which had not previously been seen . due to radiographic evidence of progressive disease , everolimus 10 mg once daily was initiated , and the patient continued on this for 36 months with stabilization of the disease . her liver enzymes remained unchanged over this time , with elevated hepatobiliary enzymes and borderline - elevated hepatocellular enzymes . at 25 months after initiation of everolimus therapy , progressive disease was noted in 2 solitary hepatic lesions and was treated with radiofrequency ablation . due to disease control in the remainder of the hepatic parenchyma , everolimus was resumed after radiofrequency ablation . thirty - five months after initiation of everolimus therapy , radiographic note was made of the advanced cirrhotic appearance of the liver ( fig . 1 ) and the increase in size of a left hepatic lesion . there was no evidence of portal hypertension . due to the radiographic evidence of progressive disease and the cirrhotic appearance of the liver , everolimus therapy was interrupted and a liver biopsy to further characterize the nature of the parenchymal disease was performed . a single 18-gauge core was obtained from the left lobe of the liver in order to avoid the biloma involving the right lobe . the biopsy demonstrated large fibrotic bands in keeping with cirrhosis with mildly active steatohepatitis ( approx . the patient had not been started on any other new medications , did not drink alcohol excessively , performed no high - risk activities for viral hepatitis , and had no family history of liver disease . serology was nonreactive for hbsag , hbcab , and hepatitis c virus , and the patient had immunity to hepatitis b virus . her antinuclear antibody was equivocal , and her anti - smooth muscle antibody and antimitochondrial antibody were negative . given the chronologic association of y administration with liver enzyme elevation , with the exclusion of other causes of cirrhosis , the diagnosis of y - induced cirrhosis was made . she has not suffered any cirrhosis - associated complications and is currently child - turcotte - pugh class a. to date , y - related cirrhosis has only been reported in 3 cases [ 6 , 7 , 8 ] . a prior systematic review assessing outcomes following y radioembolization identified grade 3 and higher adverse events in 012.9% of patients . in their review , the authors were able to identify 1 episode of cirrhosis and 3 episodes of hepatic failure . the 1 cirrhotic patient identified was seen by saxena et al . , who described a patient with cirrhosis and ascites 6 months after treatment with grade 3 elevation of serum alkaline phosphatase and grade 2 elevations of alt and bilirubin . other reported cases of cirrhosis come from case reports by brock et al . and ayav et al . brock et al . described a patient with metastatic breast cancer with bone and liver metastases who received y. the patient had a good response to treatment at 4 weeks , but 3 months later developed ct imaging findings consistent with cirrhosis and portal hypertension . described a 39-year - old man who received y for colon carcinoma metastatic to the liver . four months after administration , the patient was found to have signs of portal hypertension and had a biopsy consistent with cirrhosis . the timeline of initial hepatic changes seen with our patient closely resembles these previous reports , with a subacute onset of irregular echotexture and cirrhosis occurring several months following treatment with y [ 6 , 7 , 8 ] . y microspheres deliver focused radiotherapy to metastases in the liver while sparing viable hepatic tissue , due to the predominant arterial supply of hepatic metastases as compared to the predominantly portal venous blood supply of normal liver parenchyma . an assessment of explanted livers following y treatment showed no fibrosis > 1 cm from tumor borders . the case of our patient adds to 3 previously reported cases that demonstrate cirrhosis as a potential long - term complication of y treatment . an increasingly long median life expectancy is observed with pnets , with a 5-year overall survival of patients with low - grade tumors of 75% . therapies with a significant rate of long - term toxicities should therefore be avoided early in the course of therapy among patients with advanced disease . the notion that y therapy may lead to cirrhosis is supported by radiographic studies assessing volume changes and signs of portal hypertension following y treatment . in a series of 17 patients treated with y , a mean decrease in liver volume of 11.8% and a mean increase in splenic volume of 27.9% were noted , accompanied by increases in portal vein diameter . in another series of 45 patients , liver volumes were shown to decrease in lobes treated with radioembolization by up to 45% at 12 months after treatment . the difficulty with utilizing volume changes and liver texture to define outcomes following y administration lies in differentiating normal radiographic changes following radioembolization from true cirrhosis . in the current case report , imaging was reported as being consistent with prior radioembolization throughout many of the reports , with a progressive worsening noted over time . while differentiating this from cirrhosis is very difficult , the differential for these radiographic changes needs to include cirrhosis . the only other agent that could be chronologically associated with cirrhosis in our patient is everolimus ; however , this was started after radiographic changes had already been seen in the liver . in addition , early preclinical work suggests that inhibition of the mtor pathway with mtor inhibitors may be antifibrotic . there is , however , 1 case report of steatohepatitis following administration of everolimus . while our patient did not have steatosis severe enough to be considered solely responsible for the observed cirrhosis , it is possible that she suffered an initial insult from y administration and had impaired hepatic regeneration subsequently due to everolimus - induced steatosis , thus causing accelerated progression to cirrhosis she developed a large biloma 10 months following y treatment . in a 327-patient retrospective review by atassi et al . in contrast to normal hepatocytes , intrahepatic bile ducts lack a dual blood supply and are fed by intrahepatic arteries . biloma development is thought to develop following peripheral bile duct necrosis , resulting in biliary drainage into surrounding tissue . this case report adds to a growing body of evidence that y treatment may cause serious damage to the biliary tree , and it is clinically important because it demonstrates pathology confirming that a long - term outcome of y administration may be cirrhosis . this long - term risk needs to be considered when sequencing therapy for patients who have a high rate of 5-year survival and who have other systemic and ablative treatment options .

backgroundmanagement options for pancreatic neuroendocrine tumors ( pnets ) metastatic to the liver include surgical , ablative , cytotoxic , and radioisotope approaches . one potential local treatment option includes selective internal radiotherapy utilizing yttrium-90 ( 90y ) microspheres . 90y has also been used in the treatment of hepatocellular carcinoma and tumors metastatic to the liver . it appears to be well tolerated ; however , there is no randomized controlled trial reporting long - term toxicities . previous retrospective reports have described biliary damage as a potential complication of therapy with 90y and chemoembolization ; however , the long - term sequelae of 90y treatment are poorly understood.case presentationwe present the case of a 65-year - old caucasian woman who suffered biliary damage following 90y administration for metastatic pnets and subsequently developed cirrhosis . given the timeline of her various treatments and the lack of any other identifiable etiology for her cirrhosis , we believe this to be a potential long - term complication of 90y therapy.conclusionthis case provides pathologic confirmation of cirrhosis as a potential long - term sequela of 90y treatment . this long - term risk needs to be considered when sequencing therapy for patients with neuroendocrine tumors who have a good prognosis . there are now several other systemic and ablative treatment options available to these patients , and long - term complications must be considered during treatment .

Introduction Case Report Discussion Conclusions Statement of Ethics Disclosure Statement

comparar las mediciones de la presin intraocular ( pio ) obtenidas con el tonmetro de rebote ( rt ) , el tonmetro de contorno dinmico ( dct ) y el tonmetro de aplanamiento de goldmann ( gat ) en crneas con queratocono , e investigar los efectos del espesor central de la crnea ( cct ) y los radios de curvatura de la crnea ( cr ) en las mediciones de la pio . este estudio transversal se realiz sobre sesenta y tres ojos de un nmero igual de pacientes con queratocono . se midi la pio de cada sujeto siempre en el mismo orden , icare rt - pascal dct - gat , tras un intervalo mnimo de diez minutos entre mediciones . las mediciones de cct y cr se realizaron utilizando una cmara scheimpflug rotatoria , antes de medir la pio en todos los sujetos . se utilizaron los anlisis de coeficiente de correlacin de pearson y la anova de una va de medidas repetidas para realizar la valoracin estadstica . la pio media para todos los ojos estudiados fue de 11,72 2,59 mm hg para gat , 9,34 3,29 mm hg para rt , y 15,42 3,31 mm hg para dct . se produjeron diferencias estadsticamente significativas entre los tres tonmetros ; gat y rt ( p<0,001 ) , gat y dct ( p<0,001 ) , rt y dct ( p<0,001 ) . gat y rt reflejaron una relacin significativamente positiva con cct ( r=0,288 , p=0,025 y r=0,483 , p<0,001 , respectivamente ) . dct no reflej una correlacin significativa con cct ( r=0,115 , p=0,377 ) ni con cr ( r=0,179 , p=0,168 ) . el tonmetro dct sobreestim las mediciones de la pio , y el rt subestim las mismas , con arreglo a las mediciones de gat en las crneas con queratocono . dct ha demostrado ser el tonmetro ms adecuado para utilizar en las mediciones de la pio en los casos de queratocono , ya que no parece depender de cct y cr . proper measurement of intraocular pressure ( iop ) is fundamental in the diagnosis and follow - up of glaucoma because elevated iop is the basic treatable risk factor in the management of glaucoma . the goldmann applanation tonometer ( gat ) is currently the most widely used device in clinical practice , and is accepted as the gold standard method for iop measurement . however , it is known to be affected by changes in corneal thickness , structure , and curvature . keratoconus is a bilateral , progressive , non - inflammatory corneal ectasia that results in irregular astigmatism and reduced vision quality because of corneal thinning and protrusion . hence , the corneal changes associated with keratoconus may potentially lead to difficulties in accurate determination of iop in these patients . previous studies have shown that currently widely used tonometers such as the gat , tend to underestimate iop in keratoconic eyes mainly because of the characteristic reduced corneal thickness . because of the many difficulties in iop estimation in the keratoconic eyes , clinicians are interested in new tonometers that attempt to measure iop independently of corneal thickness and curvature . the icare rebound tonometer ( rt ) is a portable handheld tonometer , which does not require any topical anesthetic . it records iop by detecting the deceleration of a rod probe as it is bounced off the cornea . as the iop increases , the rod probe bounced off the cornea faster rt also minimizes corneal injury and avoids the risk of cross infection through the use of disposable probes . rt has been shown to correlate well with gat and is generally accepted to be dependent on corneal parameters . rt readings are , however , on average , higher than gat readings in previous studies.5 , 6 , 7 the pascal dynamic contour tonometer ( dct ) claims to be relatively unaffected by corneal biomechanical properties . it is a slit - lamp mounted , nonapplanation , contour - matching contact tonometry . the tip of the tonometry has a concave surface and measures iop when the cornea of patient matches the tip of the tonometry . it produces minimal distortion of the cornea and the iop is the result of a direct measurement by a sensor integrated into the center of the tip . the iop and quality of the data ( q1 - 5 ) are reported on a digital display . dct also evaluate ocular pulse amplitude ( opa ) which is the difference between the average systolic and diastolic iops . dct would be theoretically unaffected by neither central corneal thickness ( cct ) nor corneal radius of curvature ( cr).8 , 9 , 10 the purpose of this study was to compare iop measurements obtained by gat , rt , and dct and to assess relationship between iop measurements and cct , cr in keratoconic corneas . this cross - sectional study was conducted at the department of ophthalmology of the eskiehir osmangazi university school of medicine . the study was performed in accordance with the declaration of helsinki principles and the local medical ethics committee approved the study . all study participants underwent a detailed ophthalmologic examination including best - corrected visual acuity , slit - lamp biomicroscopy , and fundoscopy . the diagnosis of keratoconus was made by an experienced corneal specialist ( n.y . ) on the basis of the following diagnostic criteria ( 1 sign or a combination of signs ) : external signs such as munson 's sign ( v - shaped conformation of the lower lid on down gaze ) , biomicroscopic signs such as stromal thinning , conical protrusion , fleischer ring , vogt striae , and enlarged corneal nerves ; and an abnormal retinoscopy reflex . the diagnosis was confirmed topographically with the oculus pentacam system ( tkc topographical keratoconus classification ) . the contact lens wearers stopped using their contact lenses for 1 week before all measurements . patients who had corneas with apical scarring or any kind of surgical treatment for keratoconus were excluded . all iop measurements were taken between the 9 am and 11 am to minimize the potential effect of diurnal variation in iop . iop was measured on each subject in a sitting position and always in the same order , rt - dct - gat , after a minimum interval of 10 min between measurements . icare rt ( ta01i , tiolat oy , helsinki , finland ) is conducted by positioning the tip of the probe in front of the central cornea at a distance of 48 mm before the measurement . the software discards the highest and lowest iop readings automatically and calculates the average iop value from the rest . pascal dct ( smt swiss microtechnology ag , port , switzerland ) is a self - calibrating device mounted on the slit - lamp . it consists of a sensor tip with a 10.5 mm radius of curvature , a concave surface , and a miniaturized pressure sensor integrated into the center of the contact surface . the device displays the iop value accompanied by a quality control ( q1 - 5 ) . measurement was performed under topical anesthesia with one drop of 0.5% topical proparacaine solution ( alcaine , alcon laboratories inc . mean of three qualified iop values ( q result is 1 or 2 ) were considered for statistical analysis in this study . gat ( at900 , haag - streit , koeniz , switzerland ) measurement was performed using a slit - lamp with same topical anesthetic and fluorescein under cobalt blue filtered light . three consecutive readings were obtained moving the probeaway from the cornea after each measurement and a mean iop value was calculated . in all subjects , cct and cr were measured using a rotating scheimpflug camera ( oculus pentacam , wetzlar , germany ) before the iop measurements . the differences between iop readings were compared with the one way repeated measures anova . the relationship between cct , cr , and we use only one eye data per person to avoid problems arising from using dependent measurements ( measurements of both eyes of the same person ) . we choose the eye with the higher mean keratometry reading when the second eye of the same patient has keratoconus . all analyses were performed wih the softwares ibm spss statistics version 21 and medcalc version 12.7.5.0 . the statistical power analysis of our findings was made by using r for windows x64 ( v.3.2.2 ) , a free and powerful statistical analysis software and programming language ( r foundation for statistical computing , vienna / austria , 2016 , https://www.r-project.org ) . as we have had one study group and our findings were mainly based on correlation relationship , we have preferred to use power correlation calculation . the results are presented in the following table : correlation between(n ) case number(r ) correlation valuesignificance levelpower valuegat cct630.1150.3770.5457dct cr630.1790.1680.5171as it can bee understood from the table , calculated power levels of the given correlations are greater than 0.50 threshold cut - off level and this is sufficient for the given number of patients . a total of 63 eyes of 63 patients ( 27 females and 36 males ) with a mean sd age of 33.57 9.41 years ( range , 1961 years ) were enrolled in the study . mean iop measurements obtained by each tonometer , mean cct , and mean cr values are shown in table 1 . comparison of the gat , rt , and dct derived iop measurements are shown in table 2 . dct measurements were significantly higher than gat measurements ( p < 0.001 ) and rt measurements ( p < 0.001 ) . also gat measurements were significantly higher than rt measurements ( p < 0.001 ) . we found significantly positive correlation between gat measurements and cct ( r = 0.288 , p = 0.025 ) . rt measurements were significantly positively correlated both cct ( r = 0.483 , p < 0.001 ) and cr ( r = 0.550 , p < 0.001 ) . however , dct did not correlate with cct ( r = 0.115 , p = 0.377 ) and cr ( r = 0.179 , p = 0.168 ) . rt is the most affected and dct is the least affected tonometer from cct and cr . the gat is the most widely used method of measuring the iop , but corneal parameters , especially corneal thickness , affect the accuracy of this tonometer . so , newer devices such as rt and dct are the new alternative techniques for iop measurements . the initial reports on these new tonometers are promising and the reproducibility or reliability of data is being evaluated . in our study , dct measurements were significantly higher than gat measurements , but rt measurements were significantly lower than gat measurements in keratoconic corneas . rt has recently appeared in clinical practice after being used for some time in animal research . its relatively low cost , portability , lack of need for topical anesthesia , being independent of a slit lamp and ease of use make it ideal for routine clinical practice . previous comparative studies of iop measurements recorded with rt and gat have shown clinical agreement between the two devices , with a slight overestimation of readings with rt when compared with gat.5 , 6 , 7 to the best of our knowledge , there is no study investigating rt measurements in keratoconic corneas . compared rt , gat and dct for measuring iop in 171 eyes with corneal abnormalities . they reported that rt significantly underestimated iop according to gat ( 12.7 mm hg vs 15.5 mm hg ) measurements . however , only 21 eyes of 171 eyes had keratoconus in this study , being post - keratoplasty eyes ( 95 of 171 ) the most relevant of the corneal abnormalities included in this study . arribas - pardo et al . compared iop measurements in 60 ectatic corneas having intrastromal corneal ring segment implantation using the rt and gat . they found that icare significantly underestimated iop compared with gat , whereas icare pro showed no statistical differences compared with gat . we found that rt measurements were on average 2.38 mm hg lower than gat measurements . rt more affect than gat from cct in this study ( see table 3 ) , therefore individuals had thin corneas such as keratoconus iop tended to be underestimate with rt . dct is a method to measure iop by using a pressure - sensitive tip that is closely shaped following the corneal curvature to minimize the corneal deformation . the forces of both sides of the cornea are meant to be nearly equal during the measurement . according to studies using human cadaver eyes , iop values measured by dct were significantly closer to the manometric reference pressure than the gat measurements . previous studies have demonstrated an excellent agreement between gat and dct , although dct readings tended to be generally higher in healthy eyes and glaucomatous eyes.4 , 9 , 10 , 18 conversely to rt , there are many studies investigating dct measurements in keratoconic corneas . these studies are summarized in table 4.19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 dct measurements about 4 mm hg high than gat measurements in keratoconic corneas shown in table 4 . overestimation of dct measurements can be explained the absence of correlation of iop measurements with cct , especially in eyes with thinner corneal thickness just as keratoconic corneas . also gat measurements have been found to be higher than dct measurements in eyes with thicker corneas . in agreement with previous studies , we found that found that dct measurements were 3.70 mm hg higher than gat measurements in our study.today , many studies have shown that cct is variable and is a major source of error in gat , so the common practice of relying on unadjusted gat results in misdiagnosis and mismanagement.1 , 12 we considered two corneal parameters ( cct and cr ) to evalute their effect on iop measurements in this study . we found significantly positive correlation between cct and iop measurements in gat and rt but not in dct . rt is the most affected tonometer and dct is the least affected tonometer from cct . similarly , our previous study has reported that the iop measured by rt increased 8 mm hg for every 100-micron increase in cct . on the other hand , there is no consensus in the literature about the relation between the cct and iop measurements by rt ; some of the studies state that cct affect the iop measurements by rt5 , 6 , 28 but the others did not report this relationship.7 , 29 dct did not significantly correlate with cct in our study . dct has been proposed to measure iop irrespective of the corneal thickness because dct does not flatten the cornea , which allows the cornea to maintain its shape provoking minimal distortion during the measurement.4 , 8 , 9 , 10 , 16 , 17 , 18 many published studies have suggested correction factors based on cct and gat , but the effects of cr on iop measurements by gat remain uncertain . orssengo and pye discussed the deformation of a central cornea flattened by the pressure of the prism and bulging outward from the middle to the peripheries due to the inner pressure of the eye . however , other studies could not find any significant correlation between cr and iop.32 , 33 gunvant et al . reported that an increase of 1 mm of mean cr was accompanied by a rise in iop of 1.14 mm hg measured by gat , but this effect was weak and not statistically significant . our previous study show that cr had no significant effect on measured iop with rt in 165 healthy schoolchildren . francis et al . reported that cr affected iop measurements with dct but not with gat , with mean dct iop increased with increasing cr . we found a positive significant correlation between cr and iop measurements in rt but not in gat and dct in this study . the ocular response analyzer was the first device introduced to measure biomechanical features of the cornea . corneal resistance factor has been formulated to delineate the effect of cct on corneal hysteresis . both corneal hysteresis and corneal resistance factor decrease in keratoconic corneas compared with normal patients , which indicates mechanical weakening of the stroma.23 , 37 , 38 we could not evaluate corneal biomechanics in this study , and it may be pointed as the limitation of our study . sahebjada et al . reported that corneal thickness at the center and at the apex is different in different levels of keratoconus severity . these changes result in significant alterations in these parameters as severity of the disease increases . in addition to this , corneal pachymetric readings correlate well with corneal curvature but cct and the cr may not match with the thinnest point of the cornea or the radius of curvature in the area of the conus . in conclusion , dct has overestimated but rt has underestimated iop readings according to gat measurements in keratoconic corneas . we also found significantly positive correlation between cct and iop measurements in gat and rt but not in dct . f performed study concept and design , literature search , patient 's randomization and data collection , writing and reviewing of the study . ny performed study concept and design , literature search , writing and reviewing of the study .

purposeto compare the intraocular pressure ( iop ) measurements obtained with the rebound tonometry ( rt ) , dynamic contour tonometry ( dct ) and goldmann applanation tonometry ( gat ) in keratoconic corneas and to investigate the effects of central corneal thickness ( cct ) and corneal radius of curvature ( cr ) on iop measurements.methodssixty-three eyes of 63 keratoconus patients were enrolled in this cross - sectional study . iop was measured on each subject always in the same order , icare rt - pascal dct - gat , after a minimum interval of 10 min between measurements . cct and cr were measured using a rotating scheimpflug camera before the iop measurements in all subjects . one way repeated measures anova and pearson correlation coefficient analysis was used for the statistical assessment.resultsmean iop for all enrolled eyes was 11.72 2.59 mm hg for gat , 9.34 3.29 mm hg for rt , and 15.42 3.31 mm hg for dct . there were statistically significant differences among the three tonometers ; gat and rt ( p < 0.001 ) , gat and dct ( p < 0.001 ) , and rt and dct ( p < 0.001 ) . gat and rt were significantly positively correlated with cct ( r = 0.288 , p = 0.025 and r = 0.483 , p < 0.001 , respectively ) . rt was also significantly positively correlated with cr ( r = 0.550 , p < 0.001 ) . dct was not significantly correlated with cct ( r = 0.115 , p = 0.377 ) nor cr ( r = 0.179 , p = 0.168).conclusionsdct has overestimated but rt has underestimated iop readings according to gat measurements in keratoconic corneas . dct may be the most appropriate tonometer to use in keratoconus for the measurements of iop , because dct do not appear to be dependent upon cct and cr .

Objetivo Mtodos Resultados Conclusiones Introduction Subjects and methods Results Discussion Funding Author's contribution Conflicts of interest

the other types of internal hernia that have been described include transmesenteric , supra- and/or perivesical , intersigmoid , foramen of winslow , and rarely , omental hernias . paraduodenal hernia is usually a congenital anomaly due to non - fusion of the mesocolon with the parietal wall that leaves a potential space . it manifests commonly in adults in the age group of 5060 years and usually presents as intestinal obstruction . internal hernias in todays era of advanced laparoscopic surgery are usually due to rents or defects in the mesentery . we present a case of intestinal obstruction due to internal herniation following laparoscopic donor nephrectomy , followed by a brief discussion . a 47-year - old lady presented with a history of vomiting and constipation for the past 5 days . upper gastrointestinal ( gi ) endoscopy revealed large amount of bile stained fluid in the stomach . a cect suggested dilatation of the stomach , duodenum and proximal jejunum with features of bowel obstruction in the mid jejunum , with the loops lying in left renal fossa [ figure 1 ] . patient was explored laparoscopically , through the same port sites that were made earlier for the nephrectomy ( two 10 mm ports , one at the level of umbilicus on the left side lateral to rectus muscle and another in the midclavicular line just above the left anterior superior iliac spine ; two 5-mm ports , one subcostal in the midclavicular line and another in the anterior axillary line in the lumbar region ) . herniation of small bowel was noted in the left paraduodenal space [ figure 2 ] . the herniation had occurred through a defect in the transverse mesocolon which probably would have occurred during the donor nephrectomy procedure . the loop of bowel was densely adhered to the tail of the pancreas and had to be dissected of it and reduced [ figure 3 ] . patient had an uneventful recovery and was discharged from hospital on the 5 postoperative day . cect scan showing obstructed bowel loops in the left renal fossa image showing herniated bowel loops image showing obstructed bowel loops being separated from the tail of pancreas image showing the end result following the closure of the mesocolic defect the increased use of laparoscopy for colonic resections , bariatric surgery , specifically the procedure of gastric bypass and laparoscopic nephrectomies have resulted in an increase in the postoperative complication of intestinal obstruction due to internal hernias . internal hernias have also been reported after liver transplantation specifically where the biliary continuity is restored through a roux - en - y choledochoenteric anastomosis . these hernias usually occur through the mesenteric or mesocolic defects that are either deliberately or inadvertently made during the above mentioned procedures and are not subsequently closed . in view of the fact that internal herniation of small bowel occurs through the transmesenteric or transmesocolic defects , it is generally recommended that these rents or openings should be specifically sutured and closed to prevent postoperative intestinal obstruction . in a retrospective review of 1,064 cases of laparoscopic gastric bypass , comeau and colleagues strongly recommended complete closure of all mesenteric defects to avoid internal hernias and their associated complications . however , following laparoscopic right colectomy for neoplasia in 530 consecutive patients , over a 7-year period , cabot et al . the incidence of intestinal obstruction was not statistically significant in their series when these transmesenteric defects were not sutured . they , however , stressed the need for more extended long - term follow - up in these series . most publications dealing with internal hernias following laparoscopic procedures in todays age do insist on closing mesenteric defects.[58 ] the diagnosis of intestinal obstruction due to internal herniation is usually difficult to be made by clinical signs and symptoms . plain radiographs as well as contrast - enhanced ct may sometimes suggest upper small gut obstruction . cect usually shows the jejunum massed in the left renal fossa as was reported in our case . though our case was not a true congenital paraduodenal hernia , the internal herniation had occurred into the left paraduodenal space through the mesocolic defect . surgical management of internal hernias has been traditionally performed by laparotomy , reduction of the hernia contents and closure of the defect . subsequently , laparoscopic repairs , using mesh as well as meshless have been performed by many groups . intestinal obstruction due to internal hernias following laparoscopic radical nephrectomy and laparoscopic donor nephrectomy , though few , have been reported in the literature . management in most of these cases has been exploration through either a laparotomy or laparoscopy . if the entrapped bowel is viable and not gangrenous , it can be usually reduced laparoscopically and the mesenteric or mesocolic rent sutured subsequently , as was done in our case . laparoscopic donor nephrectomy is the procedure of choice today , for procurements of kidneys across many centres , worldwide . small bowel obstruction due to internal hernia following this procedure though rare can lead to significant morbidity in an otherwise normal and healthy person . we do stress the need to be vigilant while mobilizing the colon and to suture any mesenteric or mesocolic defect deliberately or inadvertently made during the procedure . the other aspect to be highlighted is that in the current era , laparoscopy can be the modality of management especially in those patients who are haemodynamically stable and there is no suggestion of bowel necrosis or gangrene .

internal hernias are a rare cause of small bowel obstruction . following laparoscopic bariatric surgery , specifically gastric bypass and laparoscopic colonic resections , there has been an increase in the incidence of internal hernias . this has been due to either a mesenteric or mesocolic defect being not closed or completely missed . small bowel loops usually herniate through these defects and present as intestinal obstruction . internal hernia following laparoscopic donor nephrectomy is a rare complication . the need for presenting this case is the rarity of its occurrence , to stress the fact that following major abdominal laparoscopic surgery the mesenteric or mesocolic defects should be closed , and that this complication was managed laparoscopically , through the same port sites as used earlier for the donor nephrectomy .

INTRODUCTION CASE REPORT DISCUSSION

omega-3 ( n-3 ) fatty acids can be divided into alpha - linolenic acid ( ala ; c18:3n-3 ) from plant origin , and eicosapentaenoic acid ( epa ; c20:5n-3 ) and docosahexaenoic acid ( dha ; c22:6n-3 ) from seafood . because the human body lacks the enzymatic capacity to synthesize ala the estimated average ala intake in the united states and most european countries is 1.3 to 1.7 g / d [ 13 ] . the institute of medicine ( iom ) of the national academies established dietary reference intakes for macronutrients in 2002 . for ala , the adequate intake ( ai ) was set at 1.6 g / d for men and 1.1 the iom noted that intakes of n-3 fatty acids above the ai may confer additional health benefits , especially with respect to cardiovascular health . many advisory boards consider ala intakes greater than 1.5 g / d important for human health . to achieve an adequate ala intake , food sources such as flaxseed and flaxseed oil , walnuts and walnut oil , and canola and soybean oil are recommended . for epa and dha from fish this evidence has been confirmed in randomized controlled trials [ 58 ] . for ala , several large , prospective cohort studies in the united states have shown inverse associations of ala intake with risk of cardiovascular diseases , but other epidemiologic studies have been inconclusive [ 911 ] . a meta - analysis of observational studies showed that increased intake of ala might reduce coronary heart disease ( chd ) mortality by 21% , although this was not statistically significant . in the lyon diet heart study , a randomized controlled trial in coronary patients , consumption of a mediterranean - type diet that included an additional daily intake of roughly 1 g of ala significantly decreased the risk of cardiac death and nonfatal myocardial infarction ( mi ) by more than 60% . this study , however , was not specifically designed to assess the effect of ala supplementation , and many dietary factors differed between the experimental and control group . since then , no randomized controlled trials of ala and cardiovascular events have been published . this article summarizes the current literature ( published after 2008 ) on dietary ala intake , ala tissue levels , and cardiovascular health in humans . several trials have recently been published on the effect of ala supplementation on blood lipids , inflammatory markers , and other indicators of cardiovascular health ( table 1 ) [ 13 , 14 , 1517 , 18 ] . trials were mostly of relatively short duration ( 612 weeks ) and ala doses ranged from 1.2 to 3.6 g / d . there was one long - term trial ( 52 weeks ) in which a high ala dose of 8.8 g / d was given [ 18 ] . increased ala intake was achieved by means of flaxseed oil [ 13 , 15 ] , ala - enriched margarine [ 14 ] , or other ala - enriched foods [ 16 , 17 , 18 ] . table 1overview of randomized controlled trials of increased alpha - linolenic acid intake and cardiovascular risk factors published between january 2008 and june 2010study / yearpopulationdesignoutcome for alakaul et al . /200888 healthy non - smoking canadian men and premenopausal women , aged 33 y12-week , double - blind , parallel randomized controlled trial ; sunflower oil ( placebo ) , flaxseed oil ( 1 g / d ala ) , hempseed oil ( 0.3 g / d ala ) , or fish oil ( 0.6 g / d epa+dha)plasma ala levels increased ( p < 0.05 ) after 6 wk ; no differences in total cholesterol , ldl - c , hdl - c , tg , ldl oxidation , platelet aggregation , or inflammation markers ( crp , tnf-)egert et al . [ 14]/200979 healthy non - smoking german men and premenopausal women , aged 1945 y6-week , double - blind , parallel randomized controlled trial ; ala ( 3.4 g / d ) , epa ( 2.2 g / d ) , or dha ( 2.3 g / d ) via enriched margarinesldl - ala levels increased ( p < 0.05 ) ; fasting serum tg decreased ( p < 0.05 ) ; no differences in total cholesterol , ldl - c , or hdl - cbarcel - coblijn et al . /200862 american men > 40 y of age12-week , parallel randomized controlled trial ; different doses of flax oil , fish oil , and sunflower oil in capsules ; ala doses were 1.2 g / d , 2.4 g / d , and 3.6 g / d2.4 and 3.6 g / d of ala significantly increased erythrocyte ala and epa levels ; no differences in inflammation markers ( crp , tnf- , svcam-1 ) , total cholesterol , tg , or hdl - csioen et al . /200959 healthy belgian male prisoners12-week single - blind study ; diet with 3.2 g / d extra alano effect on waist circumference , weight , bmi , systolic blood pressure ; diastolic blood pressure decreased and hdl - c increased in non - smokersbloedon et al . /200862 men and post - menopausal women from philadelphia , aged 4475 y , with hypercholesterolemia10-week , blind , parallel randomized controlled trial with low - fat diet with extra flaxseed or with wheat bran ( control ) ; ala dose of 3.4 g / dserum ala levels increased ; ldl - c was decreased after 5 wk but not after 10 wk ; lipoprotein(a ) was decreased and insulin sensitivity ( homa index ) improved ; no effect on inflammation ( il-6 , hs - crp ) or oxidative stress ( ox - ldl , urinary isoprostane ) ; hdl - c was reduceddodin et al . [ 18]/2008199 canadian menopausal women , aged 4965 y52-week , blind parallel trial ; 40 g / d flaxseed or wheat germ ; ala dose of 8.8 g / dserum ala levels increased ; modest effects on apolipoproteins a - i and b ; no effects on ldl electrophoretic characteristics or markers of hemostasis and inflammationala alpha - linolenic acid ; bmi body mass index ; dha docosahexaenoic acid ; epa eicosapentaenoic acid ; hdl - c high - density lipoprotein cholesterol ; homa homeostasis model assessment ; hs - crp high - sensitivity c - reactive protein ; il-6 interleukin-6 ; ldl - c low - density lipoprotein cholesterol ; svcam-1 soluble vascular cell adhesion molecule-1 ; tg triglycerides ; tnf tumor necrosis factor overview of randomized controlled trials of increased alpha - linolenic acid intake and cardiovascular risk factors published between january 2008 and june 2010 ala alpha - linolenic acid ; bmi body mass index ; dha docosahexaenoic acid ; epa eicosapentaenoic acid ; hdl - c high - density lipoprotein cholesterol ; homa homeostasis model assessment ; hs - crp high - sensitivity c - reactive protein ; il-6 interleukin-6 ; ldl - c low - density lipoprotein cholesterol ; svcam-1 soluble vascular cell adhesion molecule-1 ; tg triglycerides ; tnf tumor necrosis factor kaul et al . studied the effects of low - dose supplementation ( 2 g / d , by means of capsules ) of flaxseed oil , fish oil , and hempseed oil in 86 healthy canadian men and women about 34 years of age in a 12-week , randomized , double - blind , placebo - controlled trial . flaxseed oil ( ala dose 1 g / d ) increased plasma ala by 30% to 40% , had a small nonsignificant effect on plasma epa ( 7%8% ) , and no effect on plasma dha . none of the treatments affected serum total , low - density lipoprotein ( ldl ) , or high - density lipoprotein ( hdl ) cholesterol , triglycerides , ldl oxidation , platelet aggregation , or inflammatory markers . in another randomized trial in 62 healthy men approximately 40 years of age in the united states , participants were randomized to flax oil ( ala doses of 1.2 , 2.4 , or 3.6 g / d ) , fish oil ( 0.6 or 1.2 g / d ) , or sunflower oil for 12 weeks . increasing doses of flax oil caused elevation of the ala content in erythrocyte membranes by 40% to 80% , and also of epa ( 20%35% ) , but not of dha . none of the treatments altered plasma inflammatory markers ( c - reactive protein [ crp ] , tumor necrosis factor [ tnf]- , soluble vascular cell adhesion molecule-1 [ svcam-1 ] ) , plasma total or hdl cholesterol , or triglycerides . enrolled 62 american men and post - menopausal women aged 44 to 75 years with hypercholesterolemia . all participants were on a low - fat , low - cholesterol diet and subsequently randomized to flax - based or wheat - based products for 10 weeks . ala intake in the flaxseed group was 3.4 g / d higher than in the control group . flax - based products improved insulin sensitivity and reduced plasma ldl cholesterol by 7% to 13% and lipoprotein(a ) by 14% compared with wheat - based products . in men , there was also a decrease in hdl cholesterol . treatment had no effect on markers of inflammation ( interleukin-6 , high - sensitivity crp ) or oxidative stress ( oxidized ldl , urinary isoprostanes ) . the extent to which the observed effects of the flax - based diet were due to its ala content or other components of flax seeds is not clear . in a single - blind , 12-week field study among 59 healthy male prisoners ( mean age of 42 years ) in belgium , daily ala intake was increased from 2.8 to 4.9 g / d by means of ala - enriched foods without changing the linoleic acid content of the diet . all individuals were first on a regular diet , which was followed by an ala - rich diet , and no randomization was applied . epa and dha , but not ala , were assessed in platelet phospholipids , which showed no significant changes during ala intervention . body weight , waist circumference , and systolic blood pressure did not change , and there were no effects of ala on plasma total and ldl cholesterol , triglycerides , apolipoproteins a - i and b , glucose , and crp . [ 14 ] studied the effects of increased intake of ala , epa , and dha in a 6-week parallel trial in 74 german normolipidemic men and women aged 19 to 43 years . participants were randomly assigned to trial margarines that provided additional ala ( 3.4 g / d ) , epa ( 2.2 g / d ) , or dha ( 2.3 g / d ) . no placebo group was included . in the ala group , the ala content of ldl particles increased by 178% and the epa content increased by 36% , whereas dha remained unchanged . fasting serum triglycerides significantly decreased with epa ( 0.14 mmol / l ) , dha ( 0.30 dha intake significantly increased serum hdl cholesterol , whereas no changes were found with ala or epa intake [ 14 ] . finally , dodin et al . [ 18 ] evaluated the effect of flaxseed on markers of cardiovascular disease risk in 169 healthy menopausal canadian women who were randomly assigned to 40 g / d of flaxseed - based products or wheat - based products for 12 months . in the active - treatment group , flaxseed products increased plasma ala by 85% and plasma epa by 51% after 12 months of intake , which differed significantly from wheat - based intervention ( 12% and 29% , respectively ) . the 12-month intervention with flaxseed had significant effects on body weight ( 0.8 kg ) and serum total cholesterol ( 0.20 ldl cholesterol was reduced by 0.13 mmol / l ( p = 0.09 ) . apolipoproteins a - i and b increased in both groups , but less during flaxseed - based than wheat - based intervention . treatment had no effect on plasma lipoprotein(a ) , fibrinogen , crp , insulin , glucose , or ldl peak particle size . zatnski et al . examined trends in chd mortality in 11 eastern european countries and linked these figures to national data on vegetable oil consumption after 1990 . they showed the strongest decline in chd mortality in countries where rapeseed oil ( 9% ala ) rather than sunflower oil ( 0% ala ) was used . although these data are suggestive for a beneficial effect of ala , no definite conclusions can be drawn because the countries also differed in many other aspects that could impact cardiovascular health . cross - country comparisons based on aggregate data can not be adjusted for potential confounders , ( eg , socioeconomic status , lifestyle and other dietary components ) and should be considered for hypothesis generation only . in costa rica , soybean oil has been substituted for palm oil since the 1980s , which has led to an increase in ala intake . [ 19 ] performed a case control study in 3638 costa rican individuals to examine the association between ala and nonfatal mi ( fig . 1 ) . ala intake was assessed by a 135-item food frequency questionnaire and ranged from 1.1 to 2.4 g / d ( mean , 1.6 g / d ) in this population . dietary ala was inversely associated with nonfatal mi , with odds ratios indicating a 39% reduced risk for approximately a 0.6-g / d difference in intake . the relationship between ala and mi was nonlinear and mainly confined to the lowest levels of intake . dietary ala intake in this study correlated well with ala in adipose tissue , plasma , and erythrocytes , but poorly with biomarkers of epa and dha , suggesting a direct cardioprotective effect of ala rather than via conversion to long - chain n-3 fatty acids [ 19 ] . 1odds ratios and 95% confidence intervals for nonfatal myocardial infarction ( mi ) by deciles of alpha - linolenic acid in adipose tissue ( a ) or intake ( b ) in a case control study of 3638 men and women in costa rica . data were adjusted for smoking status , physical activity , household income , history of diabetes mellitus , history of hypertension , waist - to - hip ratio , saturated fat intake , and linoleic and trans fatty acids in adipose tissue . [ 19 ] ; with permission ) odds ratios and 95% confidence intervals for nonfatal myocardial infarction ( mi ) by deciles of alpha - linolenic acid in adipose tissue ( a ) or intake ( b ) in a case control study of 3638 men and women in costa rica . data were adjusted for smoking status , physical activity , household income , history of diabetes mellitus , history of hypertension , waist - to - hip ratio , saturated fat intake , and linoleic and trans fatty acids in adipose tissue . [ 19 ] ; with permission ) an anti - inflammatory action of ala has been proposed as an explanation for the inverse association with cardiovascular diseases found in the case control study in costa rica [ 19 ] , although negative findings on ala and inflammatory markers have been reported by others . [ 20 ] examined habitual ala intake and plasma concentrations of inflammatory markers , including il-6 and sil-6r , in 353 middle - aged men in the united states who were recruited from a twin registry . ala intake , assessed by the willett questionnaire , ranged from 0.2 to 2 g / d , and was significantly inversely related to plasma sil-6r independent of shared genetic factors and a wide range of potential confounders . a twin with a 1-g higher ala intake ( equivalent to one tablespoon of canola oil ) had 11% lower sil-6r concentrations than his twin with a low intake . despite the robust association with sil-6r , no significant associations were found with plasma il-6 , tnf- , or high - sensitivity crp [ 20 ] . in a study of 511 japanese employees of municipal offices , ala intake was assessed by a diet history questionnaire that had been validated against 16-day weighed food records ( pearson correlation for ala , r = 0.3 ) . ala comprised 0.8% to 1.0% energy ( > 2 g / d ) and was inversely related to serum crp . data were adjusted for age , body mass index ( bmi ) , lifestyle factors , and physical activity , but not for dietary factors associated with ala , and should therefore be interpreted with caution . [ 22 ] assessed dietary ala intake by the willett questionnaire in 260 post - mi patients and linked these data to 24-hour electrocardiogram recordings that were analyzed for ventricular premature beats . ala intake ( expressed per 1,000 kcal / d ) was associated with a significant reduction in ventricular premature beats after adjustment for age , sex , cardiovascular medication , and co - morbidities . however , lifestyle ( eg , smoking ) and dietary factors were not controlled for and the study had a cross - sectional design , which has inherent methodologic weaknesses . previous analyses in the national heart , lung , and blood institute nhlbi family heart study suggested that ala may protect against atherosclerosis [ 23 , 24 ] . recently , sala - vila et al . investigated whether serum phosphatidylcholine content of ala and other fatty acids was related to carotid atherosclerosis in a cross - sectional study of 451 asymptomatic spanish individuals ( mean age of 45 years ) with primary dyslipidemia . over half of the participants the habitual mediterranean diet in this population provided a mean ala intake of 0.8 g / d , mainly from olive oil and walnuts , which correlated well with serum ala ( r = 0.44 ) . the association of serum fatty acids with intima - media thickness ( imt ) of the carotid arteries was assessed , adjusting for age , sex , bmi , smoking , antihypertensive drugs , statins , and other serum fatty acids . significant inverse associations were found between serum ala and internal carotid artery imt , and between serum dha and common carotid artery imt . serum epa was not associated with imt . in a small cross - sectional study of 50 asian men and women ( mean age of 58 years ) who suffered a first nonfatal mi , the mean common carotid imt was inversely associated with ala content of erythrocytes ( p = 0.09 ) and ala intake ( p = 0.02 ) . data , however , were only adjusted for age , sex , and total energy ( for dietary ala ) . the average intake of ala was 0.6 g / d , which was similar to that of epa and dha intake . ebbesson et al . examined whether ala content of erythrocytes was related to heart rate as a risk indicator for ventricular arrhythmias . they performed a cross - sectional study in 707 alaskan eskimos ( mean age of 50 years ) who had a habitual intake of marine n-3 fatty acids of 2.9 g / d . after adjustment for gender , height , bmi , blood pressure , smoking , and heart rate lowering medications , no association was observed with ala ( p = 0.98 ) . epa and dha , on the other hand , were significantly inversely associated with heart rate . the delta(6)-desaturase enzyme is the rate - limiting step in the conversion of ala into epa and dha , and genetic variation in the delta(6)-desaturase gene ( fads2 ) may therefore affect the associations of ala with cardiovascular health . truong et al . , in a cross - sectional study , examined the association of ala in adipose tissue with metabolic syndrome , and possible effect modification by fads2 . in a cohort of 1,815 men and women from costa rica , the prevalence of metabolic syndrome ( 656 cases ) was 19% lower in the upper compared with the lower quintile of adipose tissue ala . there was no association between ala and metabolic syndrome among homozygous carriers of the fads2 deletion allele , suggesting that conversion of ala into epa may play a role . it should be noted , however , that the fads2 polymorphism did not influence the inverse association of ala with nonfatal mi in a previous case ala status has been inversely associated with cardiovascular disease events , although data are less consistent than for epa and dha [ 710 ] . an overview of ala biomarker studies is provided in table 2 . in the aforementioned case [ 19 ] , ala was measured in adipose tissue as a biomarker of intake , which correlated well with dietary ala . ala was strongly inversely associated with nonfatal mi , with a 57% reduced risk when comparing the 7th decile with the lowest decile . the relationship between ala and mi was nonlinear and mainly confined to levels below the median ( fig . 1 ) . mozaffarian et al . suggested that ala may particularly reduce chd risk when intake of marine n-3 fatty acids is low . in the study by campos et al . [ 19 ] , however , concurrent fish intake ( range , 332 g / d ) or epa and dha intake ( range , 130520 mg / d ) did not modify the associations of ala with mi . table 2overview of biomarker studies of alpha - linolenic acid and cardiovascular events published between january 2008 and june 2010study / yearpopulationdesignoutcomecampos et al . [ 19]/2008costa rica : 1,891 cases with first nonfatal mi and 1,891 population - based controls ; matching for age , sex , and area of residencecase control study : association of ala intake from ffq and ala in adipose tissue with risk of first nonfatal mior ( 95% ci ) for first nonfatal mi was 0.41 ( 0.250.67 ) for top vs lowest decile of ala in adipose tissue , and 0.61 ( 0.420.88 ) for high vs low ala intake ; associations only present at lower ala levelsyamagishi et al . /2008usa , minneapolis : 3,575 white men and women from aric study , ages 4564 yprospective cohort study : association of plasma ala with incident heart failure ; 14.3 y of follow - up195 participants ( 5.5% ) developed heart failure ; ala status ( top vs bottom quintile ) was not associated with incident heart failure ; age- and sex - adjusted hr was 0.99 ( 0.631.53 ) for cholesteryl ester fraction and 0.97 ( 0.611.54 ) for phospholipid fractionwarensj et al . /2008sweden : 2,009 men from ulsam study , aged 50 yprospective cohort study : association of ala in serum cholesteryl esters with cvd mortality ; 30.7 y of follow - upmultivariable - adjusted hr was 1.10 ( 1.001.21 ) per 1-sd increase in serum alapark et al . /2009south korea : 40 cases of ischemic stroke , 40 cases of hemorrhagic stroke and 40 healthy controls ; matching for age and sexcase control study : association of ala in erythrocytes with risk of ischemic and hemorrhagic strokeerythrocyte ala concentrations ( area% ) in hemorrhagic stroke patients ( 0.71 0.21 ) and ischemic stroke patients ( 0.24 0.03 ) were not significantly different from controls ( 0.44 0.05 ) after adjustment for family history of stroke ; inverse association of ala with ischemic stroke after adjustment for age and systolic blood pressure ( p = 0.045).virtanen et al . [ 34]/2009finland : 2,174 men from kuopio ischemic heart disease risk factor study , ages 4260 yprospective cohort study : association of serum ala with incident atrial fibrillation ; 17.7 y of follow - up240 men ( 11.0% ) developed atrial fibrillation ; multivariable - adjusted hr for serum ala ( compared to q1 ) was q2 : 1.26 ( 95% ci , 0.841.89 ) , q3 : 0.74 ( 0.461.20 ) , and q4 : 1.14 ( 0.721.79 ; p for trend = 0.98).lemaitre et al . [ 35]/2009usa , seattle : 265 out - of - hospital sudden cardiac arrest patients and 415 community members ; matching for age , sex , and calendar yearcase control study : association of ala in erythrocytes with risk of sudden cardiac death ; blood collection immediately after the event ( patients ) or during interview ( control)multivariable - adjusted or over quartiles of ala in erythrocytes ( compared to q1 ) : q2 was 1.7 ( 1.03.0 ) , q3 was 1.9 ( 1.13.3 ) , q4 was 2.5 ( 95% ci , 1.34.8 ) ; association independent of erythrocyte levels of epa and dha , linoleic acid , and trans fatty acidsala alpha - linolenic acid ; aric atherosclerosis risk in communities ; cvd cardiovascular diseases ; dha docosahexaenoic acid ; epa eicosapentaenoic acid ; ffq food frequency questionnaire ; hr hazard ratio ; mi myocardial infarction ; or odds ratio ; q quartile ; sd standard deviation ; ulsam uppsala longitudinal study of adult men overview of biomarker studies of alpha - linolenic acid and cardiovascular events published between january 2008 and june 2010 ala alpha - linolenic acid ; aric atherosclerosis risk in communities ; cvd cardiovascular diseases ; dha docosahexaenoic acid ; epa eicosapentaenoic acid ; ffq food frequency questionnaire ; hr hazard ratio ; mi myocardial infarction ; or odds ratio ; q quartile ; sd standard deviation ; ulsam uppsala longitudinal study of adult men yamagishi et al . the data used were from 3,575 white men and women in the united states ( mean age of 54 years ) who participated in the atherosclerosis risk in communities ( aric ) study . during 14 years of follow - up plasma ala was not associated with risk of heart failure ( hazard ratios of 0.99 and 0.97 for upper versus lower quintiles of cholesteryl ester and phospholipid fractions , respectively ; p = 0.8 ) . data were extensively adjusted for major confounders , including age , sex , bmi , lifestyle factors , and cardiovascular risk factors , but not for potential dietary confounders . conducted a prospective cohort study of ala in serum cholesteryl esters and cardiovascular mortality in more than 2,000 swedish men ( mean age of 50 years ) . the study had 30 years of follow - up and comprised over 60,000 person - years . a 10% higher risk of fatal cardiovascular events was found per standard deviation increase in serum ala , which was borderline statistically significant . data were adjusted for serum cholesterol , bmi , smoking , physical activity , and presence of hypertension . erythrocyte concentrations of n-3 fatty acids were studied in relation to hemorrhagic and ischemic stroke in a case control study of 120 asian men and women ( mean age of 57 years ) . the average total n-3 fatty acid intake in this population was 1.1 g / d , about half of which was ala . erythrocyte ala concentrations ( area% ) were 0.71 0.21 in hemorrhagic stroke patients and 0.24 0.03 in ischemic stroke patients , which did not differ significantly from controls ( 0.44 0.05 ) after adjustment for family history of stroke . in a logistic regression model , both epa and dha were also inversely related to hemorrhagic stroke , but this was not the case for ala . data , however , were only adjusted for age and systolic blood pressure , so residual confounding may have been present . the risk of atrial fibrillation in relation to serum n-3 fatty acids was examined in a prospective cohort study of 2,174 finnish men ( mean age of 53 years ) [ 34 ] . during 18 years of follow - up hazard ratios in consecutive quartiles of ala were 1.26 ( 95% ci , 0.841.89 ) , 0.74 ( 95% ci , 0.461.20 ) , and 1.14 ( 95% ci , 0.721.79 ) compared with the lowest quartile ( p for trend = 0.98 ) . serum epa did not show an association but dha was inversely related to atrial fibrillation ( hazard ratio of 0.62 for upper vs lower quartile ; p for trend = 0.02 ) [ 34 ] . [ 35 ] investigated in a case control study whether ala levels in erythrocytes were associated with risk of sudden cardiac death . blood was collected from 265 out - of - hospital sudden cardiac arrest patients in seattle , wa immediately after the event and from 415 randomly selected community members ( mean age of 58 years ) . in contrast to what was expected , higher ala levels were associated with a higher risk of sudden cardiac arrest . after adjustment for age , sex , smoking , diabetes , hypertension , education , physical activity , weight , height , and total fat intake , the risk increased over the quartiles with an odds ratio of 2.5 ( 95% ci , 1.34.8 ) for the highest compared with the lowest quartile . the association was independent of other fatty acids in erythrocyte membranes , including epa and dha [ 35 ] . the trials reviewed here consistently showed an increase in blood ala levels after ala supplementation , starting at low doses ( < 2 g / d ) . ala supplementation also increased blood levels of epa , but not of dha , indicating conversion of ala to epa through elongation and desaturation . short - term trials ( 612 weeks ) in generally healthy individuals mostly showed no or inconsistent effects of ala intake ( 1.23.6 g / d ) on blood lipids , ldl oxidation , lipoprotein(a ) , and apolipoproteins a - i and b. previous studies suggested an anti - inflammatory action of ala [ 5 , 7 , 8 ] , but recent trials showed little effect of ala on crp or other inflammatory markers . there was , however , an interesting inverse association of ala with sil-6r in the twin study by dai et al . the few studies that addressed ala intake in relation to glucose metabolism or blood pressure yielded inconsistent results [ 16 , 17 , 18 ] . there is , however , some observational evidence that a high ala status may be related to a lower risk of metabolic syndrome . long - term treatment with high ala doses had a beneficial effect on body weight and blood ldl cholesterol [ 18 ] , which warrants confirmation in future trials . 23 g / d ) for the primary and secondary prevention of chd . the recently published case control study by campos et al . [ 19 ] showing strong inverse associations of ala status and intake with nonfatal mi is in line with this recommendation . recent data provide some support that ala could protect against atherosclerosis [ 25 , 26 ] , but it should be noted that this evidence comes from relatively small cross - sectional studies and that conclusions on causality can not be drawn . concerning the hypothesis of an anti - arrhythmic effect of n-3 fatty acids , there was some evidence for protection against ventricular premature beats [ 22 ] , but no evidence for a relation with heart rate or incidence of atrial fibrillation [ 34 ] . moreover , data from two recent well - conducted epidemiologic studies suggested that high tissue ala is related to an increased rather than decreased risk of fatal cardiovascular events and sudden death [ 35 ] . performed a meta - analysis of previous studies on tissue fatty acid composition and risk of chd published until 2006 . they showed that ala in adipose tissue or phospholipids was inversely associated with chd , although the association was not statistically significant for fatal events . of 16 studies reviewed , about half were supportive for a beneficial role of ala , whereas other studies were negative or supportive for an adverse effect . in conclusion , there is a need for long - term trials investigating the effect of ala supplementation on cardiovascular risk factors and clinical end points . data are awaited from the alpha omega trial , in which 4,837 post - mi patients ( mean age of 69 years ) were randomized to 2 g / d of ala and/or 400 mg / d of epa and dha and followed for fatal and nonfatal cardiovascular disease events for 40 months . the findings of this study may answer the question of whether a food - based dose of ala affects cardiovascular health in high - risk individuals and , if so , whether this is comparable to the effect of marine n-3 fatty acids .

there is a large body of scientific evidence that has been confirmed in randomized controlled trials indicating a cardioprotective effect for omega-3 fatty acids from fish . for alpha - linolenic acid ( ala ) , which is the omega-3 fatty acid from plants , the relation to cardiovascular health is less clear . we reviewed the recent literature on dietary ala intake , ala tissue concentrations , and cardiovascular health in humans . short - term trials ( 612 weeks ) in generally healthy participants mostly showed no or inconsistent effects of ala intake ( 1.23.6 g / d ) on blood lipids , low - density lipoprotein oxidation , lipoprotein(a ) , and apolipoproteins a - i and b. studies of ala in relation to inflammatory markers and glucose metabolism yielded conflicting results . with regard to clinical cardiovascular outcomes , there is observational evidence for a protective effect against nonfatal myocardial infarction . however , no protective associations were observed between ala status and risk of heart failure , atrial fibrillation , and sudden death . findings from long - term trials of ala supplementation are awaited to answer the question whether food - based or higher doses of ala could be important for cardiovascular health in cardiac patients and the general population .

Introduction Effect of ALA Supplementation on Cardiovascular Risk Factors Observational Studies on ALA Intake and Cardiovascular Risk Biomarker Studies of ALA and Cardiovascular Risk Biomarker Studies of ALA and Cardiovascular Endpoints Conclusions

pancreatic cancer is the fourth leading cause of cancer death in the western world and shows the worst mortality among common malignancies with a 5-year survival rate of lower than 5% . the current standard of care includes surgical resection when appropriate and gemcitabine - based chemotherapy . recent data suggests the use of folfirinox as initial treatment of patients with metastatic disease who have a good performance status improves survival . single - agent gemcitabine is often administered to patients with advanced , metastatic pancreatic cancer . studies with gemcitabine have demonstrated a significant clinical response ( decreased pain , increased functional status ) even in the absence of a measurable tumor response . unfortunately , there is currently no standard second - line chemotherapy for metastatic pancreatic cancer . one of the current major challenges is the lack of validated markers for prediction of response to chemotherapy in the metastatic pancreatic cancer setting . a 49-year - old hispanic male , with a 25-pack year smoking history , moderate alcohol consumption and a family history reportedly noncontributory for gastrointestinal malignancies or liver disease , was found to have a biopsy - proven poorly differentiated ductal adenocarcinoma of the pancreas . the patient had a past medical history of gastritis ; pancreatitis ; new onset insulin - dependent diabetes mellitus ; depression , and anxiety . a diagnostic ct of the abdomen performed at an outside institution immediately prior to presentation to our center , revealed an infiltrative mass of the head of the pancreas measuring 4.6 3.5 cm in transverse and anteroposterior diameters and approximately 3.4 cm in longitudinal diameter , which was obstructing the common bile duct and pancreatic duct , infiltrating the peripancreatic and perivascular spaces and occluding the superior and mesenteric vein . the pathology report described a poorly differentiated pancreatic adenocarcinoma that had metastasized to the liver . the patient 's ca19 - 9 was 5,590 u / ml at presentation , and cea 2.8 u / ml ( both doubled in value over a period of approximately 2 weeks prior to presentation to our center ; table 1 ) . symptoms at presentation consisted of fatigue and intermittent abdominal pain , controlled by pain medications ( opioids ) . the patient also reported an approximately 79 kg weight loss over a period of 34 months ( weight at presentation 59.4 kg ) . a ct - guided biopsy of the anterolateral right lobe liver lesion confirmed metastatic pancreas cancer . the immunostains performed on paraffin sections were supportive of the above diagnosis : the tumor was positive for ck7 , ck20 and ca19 - 9 and negative for ttf1 . it was decided to pursue with chemotherapy consisting of a doublet gemcitabine and oxaliplatin ( gemox ) . the patient received gemcitabine at 850 mg / m / dose on day 1 and day 8 and oxaliplatin at 100 mg / m / dose on day 2 , every 21 days . the patient also received l - glutamine powder 15 g twice / day dissolved in protein shakes . other supplements were taken along with chemotherapy ( self - administered ) : herbal mixtures anamu ( cuba ) and brim ( ecuador ) . the first three cycles of chemotherapy were reasonably well tolerated without any significant side effects . the patient 's appetite and nutritional intake improved and weight gain was noted . mild hyperkalemia was observed , presumed to be due to increased potassium intake ( nutritional shakes ) . a pet / ct evaluation performed after 3 cycles of chemotherapy revealed decreased fdg uptake within the lesion in the head of the pancreas ( suv of 2.8 compared to 6.5 on previous examination ) and left adrenal gland ( suv 2.7 decreased from 3.8 ) , compatible with response to therapy . there was complete resolution of the focus of mildly intense fdg uptake in the anterior right lobe of the liver . new minimal fdg uptake was observed in the left lower lobe of the lung , presumed to be of inflammatory etiology . the ct scan of the abdomen showed overall decrease in size and volume of the pancreatic head lesion and of the tiny left adrenal nodule , as well as resolution of anterior right hepatic lesion consistent with response to therapy . the patient completed 8 cycles of chemotherapy with complete radiographic and excellent tumor marker response ( ca19 - 9 level decreased from 5,590 u / ml to 130 u / ml ) and minimal symptoms . two treatment delays / dose reductions due to neutropenia developed during the 6-month treatment period . at the 1-month evaluation , the ca19 - 9 level continued to decrease from 130 u / ml to 55 u / ml , markedly decreased from 5,590 u / ml prior to initiation of therapy . the ct scan of the chest , abdomen and pelvis , revealed no definite pancreatic masses or liver metastases . the evaluation performed two months later , after a treatment break , showed essentially stable findings , with the ca19 - 9 slowly trending upwards to a value of 125 u / ml . at another 2-month interval , the pet / ct scan showed mild interval disease progression in the pancreatic head surrounding the common bile duct stent and interval progression of multifocal hepatic metastatic disease in both liver lobes , which was also evidenced on ct scan . the radiographic changes were paralleled by the elevation of ca19 - 9 level from 125 to 7,730 u / ml . at this point in time the patient was in overall good health , with good appetite and an ecog ps of 0 . second - line therapy with gtx regimen was initiated consisting of the following dosages / schedule : gemcitabine 600 mg / m day 1 and day 8 , docetaxel 30 mg / m day 4 and day 11 , and capecitabine at 1,000 mg p.o . an evaluation performed after 3 cycles of the second - line chemotherapy program revealed the patient to be doing reasonably well with mild numbness and tingling noted in the hands and feet . he had lost approximately 1.8 kg in weight but otherwise remained in reasonably good health . the ca19 - 9 level had decreased to 493 u / ml ( from 7,730 u / ml prior to the initiation of gtx regimen ) . the restaging ct scan of the chest , abdomen , and pelvis performed at this visit showed interval response to therapy of multifocal hepatic metastatic disease . at a subsequent evaluation performed after 5 cycles of this therapy there was continued evidence of a response , with the ct scan revealing a decreased size of the pancreatic head mass . however , there was a mild increase in size of two previously noted liver lesions and one small lesion was unchanged in size from the previous examination . the ca19 - 9 continued to decline and reached the level of 155 u / ml after 5 cycles of therapy , consistent with an ongoing treatment response . treatment with gtx regimen continued and the patient completed 8 cycles with good overall tolerance . at this point imaging studies revealed stable disease with a slight increase in the ca19 - 9 level ( from 155 u / ml to 264 u / ml ) . three months later the patient presented for a follow - up evaluation with reportedly increased epigastric and right upper quadrant pain , increased flatulence and a 4-kg weight loss during the previous two months . . a restaging ct scan of the chest , abdomen and pelvis showed significant interval progression within the liver with a large heterogeneous 9-cm central mass centered at the hepatic hilum with near occlusion of the right portal vein and mild to moderate bilateral intrahepatic biliary ductal dilatation . the ca19 - 9 level had increased from 264 to 90,200 u / ml . the treatment management plan consisted of initiation of third - line chemotherapy with gemcitabine and nab - paclitaxel ( abraxane ) . the regimen dosages / schedule were as follows : gemcitabine 700 mg / m and nab - paclitaxel 70 mg / m , both administered on day 1 , 8 and 15 , every 28 days . cycle 1 of nab - paclitaxel and gemcitabine was reasonably well tolerated with moderately well controlled pain in the epigastric area ( reportedly , the patient did not follow his pain regimen as indicated ) . the patient was also seen by interventional radiology and was not considered to be a suitable candidate for chemoembolization at that point in time . in view of the excellent tolerance to the gemcitabine / nab - paclitaxel chemotherapy regimen , improvement in liver function tests and hematology parameters , a decision was made to increase the gemcitabine dose to 900 mg / m and the nab - paclitaxel dose to 100 mg / m . during this time the patient received hematological growth factor prophylaxis . after 3 cycles of gemcitabine / nab - paclitaxel repeat imaging and tumor markers again demonstrated evidence of a favorable response . the ca19 - 9 level was markedly decreased from 90,200 u / ml to 4,830 u / ml and the ct of chest / abdomen revealed less compression of the portal vein compared to the previous study . the patient subsequently continued treatment with this regimen at an outside facility , eventually experiencing progression of the disease process . in summary , and of considerable interest , our patient lived for a total period of 2 years after his initial diagnosis of metastatic pancreatic carcinoma . pancreatic cancer is one of the most lethal tumors of the gastrointestinal tract . the ability to predict which patients would benefit most from surgical intervention and/or chemotherapy would be a great clinical advance . considerable research has focused on identifying molecular events in pancreatic carcinogenesis , and the correlation with clinicopathological variables of pancreatic tumors and survival . for the most part , the evidence regarding the application of biomarkers as prognostic indicators in this malignancy is conflicting . the advent of gene microarray and mass spectrometric protein profiling offers the potential to examine many different biomarkers simultaneously . this work may allow researchers to develop accurate and reproducible predictors of survival based on genetic signatures . genetic and pharmacokinetic testing were not performed in our patient , but his exceptional response to chemotherapy treatments may lead to the conclusion that this patient 's pancreatic tumor may have had a unique genetic and molecular makeup . highlights of this case report are a dramatic clinical , radiographic and serologic ( tumor markers ) response observed with each chemotherapy regimen administered , as well as significant improvement of the performance status and quality of life for our patient , secondary to chemotherapy treatment . evidence supports the suggestion that treatment with gemcitabine / oxaliplatin is superior to gemcitabine alone in terms of response rate , clinical benefit rate and progression - free survival , but the differences did not reach the significant level for overall survival . data for second - line therapy with gemcitabine - based regimens after first - line gemcitabine treatment have been published . the combination of gemcitabine , docetaxel and capecitabine ( gtx ) is an active regimen in patients previously treated with gemcitabine for metastatic pancreatic cancer . better performance status and > 75% drop in pretreatment ca19 - 9 were associated with longer survival . gtx has a promising survival benefit of greater than 1 year in patients with advanced pancreatic adenocarcinoma when compared to studies using single agent gemcitabine or other combination chemotherapies . following second line with gtx our patient experienced a significant response to a third - line gemcitabine - based regimen ( gemcitabine and nab - paclitaxel ) . gemcitabine plus nab - paclitaxel has promising antitumor activity in unresectable and borderline resectable pancreatic cancer patients . pancreatic cancer cells and surrounding stroma are known to overexpress sparc ( secreted protein acid rich in cysteine ) , which is associated with poor clinical outcomes . nab - paclitaxel , an albumin - bound nanoparticle form of paclitaxel , increased tumor accumulation of paclitaxel through binding of albumin to sparc . a disease - specific phase 1 study was designed to evaluate the safety and efficacy of gemcitabine + nab - paclitaxel and the correlation of response with tumor sparc and serum ca19 - 9 levels . the combination of nab - paclitaxel and gemcitabine was generally well tolerated and had substantial enough antitumor activity in patients with pancreatic cancer to warrant a phase iii clinical trial . a number of possible hypotheses can be advanced for why our patient exhibited this unexpected degree of persistent sensitivity to gemcitabine - based chemotherapy , including an inability to repair chemotherapy - induced dna damage and a role for the glutamine supplementation he received during his treatment regimen . hopefully , future research in this area will elucidate the reasons for such relatively favorable outcomes .

pancreatic cancer exhibits profound chemoresistance resulting either from pre - existing ( intrinsic ) mechanisms , or from anticancer drug treatment itself ( acquired chemoresistance ) . we present the case of a patient with pancreatic adenocarcinoma metastatic to the liver who experienced clinical , radiographic and tumor marker response to three lines of gemcitabine - based chemotherapy . the regimens included : 8 cycles of gemcitabine and oxaliplatin ( gemox ) , 8 cycles of gemcitabine , docetaxel and capecitabine ( gtx ) and more than 3 cycles of gemcitabine and nab - paclitaxel , with an exceptional response 2 years from the initiation of chemotherapy for metastatic pancreatic cancer .

Introduction Case Report Discussion

medication errors are known to be a significant source of risk and harm to pediatric patients [ 14 ] , particularly in neonatal and pediatric intensive care units ( picus ) [ 58 ] . a study looking at prescribing errors intercepted by pharmacists in a maternity and children 's hospital found the risk of prescribing errors to be fourfold higher in pediatric patients than in the maternity population ( 1,391 errors in 61,458 orders versus 644 errors per 119,333 orders ) . they found that intercepted errors in pediatric patients were most commonly related to dosing , with detection of doses 1.5- to 10-fold higher than recommended . finally , the use of intravenous ( iv ) medications has also been identified as a specific source of medical risk [ 10 , 11 ] . in response to the errors and harm associated with medication infusions , the adoption of a range of healthcare information technologies including computer order physician entry ( cpoe ) , bar coded medication administration , and smart infusion pumps has been recommended [ 1214 ] . while these technologies have demonstrated the capacity to decrease the frequency of errors [ 1517 ] , results are mixed in studies trying to document reduction in harm . while some have been able to show a decrease in mortality [ 18 , 19 ] , others have failed to demonstrate efficacy of the technology or reduction in harm [ 2026 ] . notably , others have uncovered associations between cpoe and new and unanticipated errors as well as harm [ 2730 ] . the same authors as the present paper conducted a study in 2007 measuring discrepancies between medication orders for infusions entered into a cpoe system and the medication ( or intravenous fluid ( ivf ) ) actually being infused at the bedside within a picu . rates of discrepancy were calculated and discrepancies were categorized by type . a high frequency of discrepancies between cpoe orders for medications and programmed settings on smart infusion pumps at the bedside ( 24% ) and between intravenous fluids and programmed pump settings ( 42% ) was observed . we concluded that the discrepancies were most likely related to interactions between providers performing the tasks of ordering intravenous medications and fluids and the programming of the infusion pumps and that more intensive understanding of these interactions was essential to the process of risk mitigation and elimination . since the time of the original study , a bidirectional interface between the cpoe and pharmacy systems was established at the study site . this allowed orders entered by providers to go directly to the pharmacy system for verification rather than being printed and reentered into the pharmacy system by a pharmacist prior to order verification . closed - loop medication management systems automate steps in the complex process of medication delivery in an effort to reduce the number of opportunities for mistakes . relatively little has been published about the performance of these systems . one study in 2012 demonstrated a decrease in time from order placement to administration of antibiotics following implementation of a closed - loop order - processing system . another study examined the effects of closed - loop electronic prescribing , automated dispensing , barcode patient identification , and electronic medication administration record and found a decrease in prescribing and administration errors . we were interested in examining the impact of a bidirectional interface between cpoe and pharmacy systems within a picu on the frequency and types of discrepancies between orders for medication and ivf infusions and settings on bedside infusion pumps . we hypothesize that the frequency of discrepancies will be less but that the observed changes in rates and types of discrepancies will not be attributable to the closed - loop system alone . the picu also underwent expansion and relocation in the interim , and we suspect that changes in workflow may be in part responsible for any observed decreases in discrepancies . the study was performed in a 72-bed picu with approximately 1800 admissions per year within a freestanding children 's hospital located in the midwest . patients admitted to this picu include children ranging from one day to over 18 years of age , with a wide range of disease processes including trauma , cardiothoracic surgery , respiratory failure , metabolic disease , and sepsis . orders for iv medication infusions and ivf may be entered into the cpoe system by attending physicians , trainees ( fellows and resident physicians ) , and nurse practitioners and physician assistants . data were gathered over a period of seventeen weekdays . between study periods , the picu also underwent relocation and expansion from 30 beds to 72 beds . the cpoe system , sunrise clinical manager version 4.5 by eclipsys technologies corporation , was implemented in september of 2000 a closed - loop system consisting of a bidirectional interface between cpoe and pharmacy systems was established in september of 2008 . intravenous medication infusions were defined as medications requiring the use of an infusion pump . only medications given as continuous iv infusion were included . medications given via infusion pump were excluded if dosing was intermittent , a change from methodology of the previous study . intravenous fluids were defined as total parenteral nutrition ( tpn ) , lipids , and crystalloid infusions given continuously via infusion pump . data were simultaneously collected from the medication orders in the cpoe system and the bedside infusion pumps by trained observers once a day over a period of seventeen days in august of 2010 . one observer recorded date , time , bed number , each infused medication or fluid , and corresponding dose or rate . a second observer simultaneously recorded existing orders by bed space , capturing the date and time of observation , and each ordered medication or fluid with its respective dose or rate . a line - by - line comparison of order observation data with the pump observation data was performed , matched by time and bed number . observations occurring more than fifteen minutes apart were excluded to minimize the effect of any interim changes to order or pump . for each observed medication infusion or ivf , analysis began with verifying the presence of a corresponding order . for those that had a corresponding order , the medication doses or ivf rates that were ordered were compared to those observed to be infusing at the bedside . discrepancies were defined as follows : a medication or fluid found to be infusing without a corresponding order was categorized as an unauthorized medication or unauthorized fluid . when no medication or fluid infusion was observed despite the presence of an active order , finally , when the medication or fluid infusing at the bedside was observed to differ in dose ( for medications ) or rate ( for fluids ) when compared to the active order in cpoe , this discrepancy was categorized as a wrong medication dose or wrong fluid rate . any difference in dose ( for medications ) or rate ( for ivf ) between the computerized order and the bedside pump setting proportions of discrepant medications and fluids for the two study periods ( original study in 2007 , current study in 2010 ) were compared . p values were calculated using two - proportion z test , and p values < 0.05 were considered significant . a total of 303 observations of medication infusions and 152 observations of ivf were completed during the study period . the number of medication observations was similar ( 296 observations in 2007 versus 303 observations in the current study ) . no observations required exclusion based on the predetermined 15-minute time window for orders and programming . during this study period 54 of 303 ( 18% ) observations of medication infusions revealed order - programming discrepancies , while 46 of the 152 ( 30% ) observations of ivf revealed order - infusion pump discrepancies ( tables 1 and 2 ) . the decrease seen in medication infusion discrepancies did not reach statistical significance ( p = 0.05 ) . however , this represented an overall decrease in the discrepancy rate for the ivf group , which included tpn , lipids , and crystalloid infusions , following implementation of the bidirectional interface ( p = 0.01 ) . the decrease in discrepancies between orders and ivf was due in large part to a significant decrease in discrepancies for tpn . ten of 55 ( 18% ) tpn observations had discrepancies , down from a rate of 50% in the prior study ( p < 0.01 ) ( table 2 ) . there were no significant changes in overall rates of discrepancy for crystalloid or intralipid infusions . however , the proportion of unauthorized fluid discrepancies ( ivf infusing without a corresponding order ) decreased significantly ( 32% to 15% , p < 0.05 ) ( table 3 ) . although the overall discrepancy rate for medications did not change following implementation of the pharmacy - order entry interface , the types of discrepancies that were observed did change . for example , unauthorized medications ( medications infusing without a corresponding order ) accounted for 60% of the medication discrepancies in the previous study and decreased to 4% ( p < 0.01 ) in the current study ( table 3 ) . on the other hand , we observed significant increases in the proportion of omitted medications ( order present but no infusion ) and medications infusing at the wrong dose ( p < 0.05 for both ) . similar to the previous study , when discrepancies in medication infusions were examined by type of medication , the greatest frequency of discrepancies occurred within cardiovascular medication group ( 27% , n = 35 of 128 observations ) ( table 1 ) . discrepancies between orders and pump programing for milrinone and epinephrine infusions increased between study periods ( p < 0.01 for both ) . finally , the anticoagulant group , comprised entirely of heparin infusions for the current study , saw a reduction in discrepancy rate from 46% to 9% ( p < 0.01 ) . in a study performed in 2007 , we observed a high frequency of discrepancies between medication and intravenous fluid orders within a cpoe system and programmed settings on infusion pumps at the beside . subsequently , a bidirectional interface between pharmacy and order entry systems was established , and the icu underwent expansion and relocation . contrary to our hypothesis , while the rate of discrepancies decreased for ivf , the overall frequency of discrepancies among medication infusions did not decrease to a level of statistical significance between study periods . while sample size certainly could alter this finding , given the strong push for adoption of healthcare information technologies , we believe these results are still relevant . furthermore , our analysis suggests that the observed decreases in discrepancies are not solely attributable to the technology and that workflow and other factors are partly responsible for the observed changes . we suspect that this change was related to the impact of the bidirectional interface on the workflow for verbal requests for new medications : previously , if a provider requested that a new medication be made urgently , the pharmacist could deliver the medication to the bedside but was unable to reconcile the order . unless the provider immediately entered the order in cpoe , a discrepancy characterized as an unauthorized medication was created . the bidirectional interface allowed the pharmacist to immediately reconcile the verbal order ( an order communicated verbally from a physician to a pharmacist ) . similarly , the decrease in discrepancies for anticoagulants could be explained by the same mechanism as that just described wherein pharmacists utilize the bidirectional interface to reconcile verbal orders . while unauthorized medications decreased , there was an increase in omitted medications as well as wrong dose discrepancies . we suspect that a change in workflow is the reason for the increase in observed omitted medication discrepancies . around the time of picu relocation , anesthesiologists began placing orders for cardiovascular and sedation / analgesia medications they anticipated would be used intraoperatively , such as an epinephrine or fentanyl infusion , the day prior to scheduled surgery . as such , patients in picu awaiting surgery would have orders for these infusions halted at bedside in the cpoe system but no infusion present until they returned from the operating room the following day . we believe this was responsible for many of the omitted medication discrepancies . the rate of discrepancies between orders and pump settings decreased for fluids , due in large part to a decrease in discrepancies within the total parenteral nutrition subgroup . we have not identified a mechanism by which implementation of the bidirectional interface could account for this decrease . rather , a change in workflow on rounds is more likely responsible for this decrease . between study periods environment pharmacy and dietary presence on rounds increased , resulting in greater collaboration among pharmacists , dieticians , and the providers responsible for ordering tpn . previously , a single patient 's tpn may have been reordered more than once on a given day due to modifications in the composition ordered . we suspect that the described change in workflow allowed for consensus on the desired tpn composition , resulting in fewer total tpn orders and therefore fewer opportunities for discrepancy . little is known about the effects of implementation of systems like this bidirectional interface or other types of closed - loop systems . one found a decrease in mean time from order to administration of iv antibiotics after closed - loop implementation in patient care areas such as general medicine and cardiology . however , due to a small number of observations in intermediate and intensive care areas , the study was underpowered to detect a significant difference in these areas that were examined in our study . the second study found a decrease in medication administration errors ( maes ) for non - iv medications following closed - loop implementation but increased pharmacy and medical staff time to perform tasks . however , medications given via iv infusion , the subject of our investigation , were excluded from this study . while these studies support the use of closed - loop systems , like ours they were not designed to show an improvement in patient outcome or a decrease in patient harm . first , as mentioned , the study was not designed to detect harm , and endpoints such as frequency of adverse events or length of hospital stay were not captured . whether the changes in discrepancies were associated with changes in the incidence of harm to patients or with improvement in other measures of quality of care can not be determined . also , as an uncontrolled before and after study , the ability to draw conclusions about the causes of observed changes is limited and part of the analysis is purely subjective . finally , while the sample size allowed for detection of differences in discrepancy rates within certain groups of medications and ivf , it is possible that the other differences could have been detected with greater numbers in some of the subgroups . fewer discrepancies between ivf orders and programmed settings on bedside infusion pumps were observed following implementation of a bidirectional interface between pharmacy and order entry systems in a picu setting . furthermore , subjective analysis of causation suggests that changes in workflow and other factors are likely to have contributed as much to the observed changes as did the bidirectional interface . study design precluded investigation of any potential association between the changes in discrepancies and changes in patient outcomes or harm . demonstrating such an association is essential in the assessment of the value and efficacy of safety technologies .

background . the ability of safety technologies to decrease errors , harm , and risk to patients has yet to be demonstrated consistently . objective . to compare discrepancies between medication and intravenous fluid ( ivf ) orders and bedside infusion pump settings within a pediatric intensive care unit ( picu ) before and after implementation of an interface between computerized physician order entry ( cpoe ) and pharmacy systems . methods . within a 72-bed picu , medication and ivf orders in the cpoe system and bedside infusion pump settings were collected . rates of discrepancy were calculated and categorized by type . results were compared to a study conducted prior to interface implementation . expansion of picu also occurred between study periods . results . of 455 observations , discrepancy rate decreased for ivf ( p = 0.01 ) compared to previous study . overall discrepancy rate for medications was unchanged ; however , medications infusing without an order decreased ( p < 0.01 ) , and orders without corresponding infusion increased ( p < 0.05 ) . conclusions . following implementation of an interface between cpoe and pharmacy systems , fewer discrepancies between ivf orders and infusion pump settings were observed . discrepancies for medications did not change , and some types of discrepancies increased . in addition to interface implementation , changes in healthcare delivery and workflow related to icu expansion contributed to observed changes .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

renal transplantation is the unique curative option for patients suffering from end - stage renal disease , but to date the evolution of each patient after transplantation can not be predicted . in the past decades , acute graft rejection has decreased dramatically as a result of the introduction of immunosuppressive drugs . however , immunosuppressive drugs carry undesired and severe side effects such as infections , malignancies , and metabolic disorders which may threaten patient 's life . yet , chronic rejection is still the main cause of long - term graft loss [ 2 , 3 ] . the holy grail of organ transplantation is to maintain long - term graft function without immunosuppressive treatment , namely , operational tolerance ( ot ) . however , ot is a rare event in kidney transplanted patients , as only about 0.03% of cases are estimated to be in such state . thus , despite the efforts made in the past , there is still a clear need to find new strategies to achieve long - term tolerance and to investigate the immunological mechanisms that may be implicated in the process of ot . among the actors implicated in the mechanisms of the immune response , b and t lymphocytes are the main characters that lead to graft rejection . in this play , b lymphocytes have a dual key role since they present antigens of the donor to t cells in addition to secreting antibodies that can lead to acute rejection or , later in time , chronic rejection . nevertheless , a sparse b cell subset has been attributed immune regulatory functions which conveys that not all b cells play on the rejection side . although it was first described in 1974 it was not until 2000 that this population was named regulatory b cells ( breg ) . in the last decade , the regulatory role played by breg has been highlighted by many authors in autoimmune diseases such as systemic lupus erythematosus ( sle ) , rheumatoid arthritis , and pathologies that promote antineutrophil cytoplasmic antibodies and also in allograft tolerance in organ transplantation [ 12 , 13 ] . the current general consensus is that breg develop their function mainly via the secretion of il-10 [ 14 , 15 ] . however , a complete phenotype signature , development pathway , or the immunoregulatory properties of breg have not been fully discovered in mice nor in humans , thus granting future research on this cell type . in this review , our aim is to gather the current knowledge about regulatory b cells and their role in kidney transplantation tolerance in humans and to discuss their potential application as cellular therapeutic agent . one of the darkest spots of breg is their phenotype , since for years researchers in the field have tried through multiple approaches to find unique characteristic markers to define them . there is less discussion about their mechanism of action , which is principally accepted to be il-10 , but the lack of knowledge on what triggers its secretion and the fact that other regulatory mechanisms have also been proposed leave this issue , to date , unresolved . as previously occurred in the studies on regulatory t cells , many researchers have prompted to identify a unique set of markers , transcription factors , or mechanism of action that exclusively identify breg in all contexts . in this sense , genetic and surface expression studies have been conducted with partial success to unravel a unique breg signature [ 16 , 17 ] . also , some hypothesis have been formulated on breg development pathways from a common precursor [ 18 , 19 ] , but the results so far are not conclusive . thus , most authors rely on the capacity to produce interleukin- ( il- ) 10 and on the two main phenotypical signatures used to define breg : ( 1 ) transitional b cell phenotype cd19cd24cd38 and ( 2 ) cd19cd5cd1d ( used in both human and mice ) [ 20 , 21 ] . nevertheless , we still face a lack of specific breg markers , and different phenotypes for il-10-producing b cells with regulatory capacity have been proposed through the years . in 2008 , yanaba and colleagues identified an il-10-producing regulatory b cell subset in mice expressing cd1dcd5 which they referred to as b10 cells . a few years later , the same group characterized a similar il-10-producing b cell subset in humans . human b10 cells ' regulatory potential was shown by their capacity to inhibit tumor necrosis factor- ( tnf- ) production by cd4 t helper cells and monocytes . in peripheral blood , b10 cells were found exclusively among cd24cd27 cells , whereas in spleen no difference was observed between il-10-producing and nonproducing b cells regarding their surface markers . when testing the immunomodulatory capacity of the same subset from patients with allergic asthma in vitro , these cells were less capable of secreting il-10 and inducing the secretion of il-10 from cd4 t compared to the same cell population from healthy subjects , suggesting that this population could hold immunomodulatory capability . nevertheless , matsumoto et al . found that cd27cd38 immunoglobulin- ( ig- ) secreting plasmablasts that arise from nave and immature b cells from human blood are the major il-10-producing b cells after in vitro stimulation . yet , the transitional b cell subset cd24cd38 also seems to have regulatory capacity , since after cd40 stimulation they could suppress the differentiation of nave t cells into t helper 1 ( th1 ) and th17 and lead cd4cd25 t cells conversion into regulatory t cells ( treg ) , partially via il-10 [ 9 , 24 ] . due to the disparity of the results showing that different b cell subsets can express immunomodulatory properties , a current emerging view is that breg are not a specific b cell subset but rather a circumstantial b cell phenotype . in this scenario , b cells could acquire a regulatory role when appropriate signals are generated in the environment , as has been already suggested by some authors [ 2527 ] . it would seem reasonable to think that , depending on the type of activated immune cells and cytokines released to the environment , some b cells could shape their response towards the appropriate way to modulate the response of other immune cells . the adaptability of the breg response could explain the different outcomes depending on the disease studied in vivo or the stimulation provided in vitro . breg marker must be reoriented to find the right stimulation for b cells to become stable regulators of the immune response in a given scenario . as mentioned above , il-10 production is perhaps the principal hallmark to define regulatory b cells , describing their immunomodulatory potential and explaining their mechanism of action . il-10 is a regulatory cytokine secreted by almost all innate and adaptive immune cells that plays an essential role in maintaining immune homoeostasis . it binds as a homodimer to its receptor which is a tetramer formed of two ( il-10r1 ) and two ( il-10r2 ) chains . il-10r1 binds to the cytokine while il-10r2 is responsible for the downstream signaling activation through jak1 and signal transducer and activator of transcription 3 ( stat3 ) . il-10 is the only ligand for il-10r1 which in turn is the unique receptor of il-10 , while il-10r2 is shared by several cytokines such as il-20 , il-22 , il-24 , il-26 , il-28 , and il-29 . although little is known about the molecular pathways involved in il-10 secretion in humans , in mice it is mediated by store - operated ca influx from the endoplasmic reticulum , which is further regulated by the calcium sensors stromal interaction molecule ( stim ) 1 and stim2 . among other biological functions , il-10 promotes the downregulation of antigen presentation by macrophages and dendritic cells and suppresses the production of proinflammatory cytokines such as il-1 , interferon ( ifn)- , and tnf- by cd4 t cells , monocytes , and macrophages [ 29 , 31 ] ( figure 1 ) . besides the functional relevance of il-10 expression , il-10-producing cd19cd24cd38 b cells have also been shown to promote the expansion of il-10-producing foxp3 treg and to play a role in inducing their recruitment to the site of inflammation . in addition , human il-10-producing b cells may block the cd28 inducible t cell costimulator ( icos ) costimulatory pathway , thus blocking t cell activation via phosphorylation of src homology region 2 domain - containing phosphatase-1 ( shp1 ) , a downstream molecule of the il-10 receptor intracellular pathway . the key role of il-10 released by b cells has been also proven in multiple sclerosis ( ms ) patients , who have b cells with impaired il-10 production under cd40 stimulation . similarly , in sle patients , b cells fail to produce il-10 in response to cd40 but not to cpg oligodeoxynucleotides ( cpg ) . these results indicate an impaired t cell - dependent breg induction in both autoimmune diseases . not only il-10 but also other regulatory mechanisms like il-35 , granzyme b ( gzmb ) , transforming growth factor- ( tgf- ) , and indoleamine 2,3-dioxygenase ( ido ) have been suggested as important molecules in breg tolerogenic function . figure 1 depicts some of the different breg inducers , mechanisms of action , and functions described in several studies . in one of them , when cd4cd25 t cells were cocultured with cd40-cpg - stimulated b cells from either healthy controls ( hc ) , immunosuppressive - dependent stable graft function ( si ) patients , or ot patients , the proliferation of t cells was inhibited . when il-10 , tgf- , or gzmb were blocked separately , only the anti - gzmb antibody hindered the inhibitory effect on t cell proliferation . however , in a similar experimental set - up where b cells were stimulated with cpg alone , the blockade of tgf- and/or ido activity led to decreased antiproliferative function of breg in coculture with t cells , suggesting different immunosuppression mechanisms depending on the stimulation . somehow these papers entail an il-10 alternative immunosuppressive mechanism of action rather than a characterizing feature of breg . this might hold true for determined breg subsets and strengthens the idea of diverse breg phenotypes depending on the environment . due to their central role as effector cells in the immune response , particularly in acute organ rejection , t lymphocytes have been one of the main targets of immunosuppressive treatments . b lymphocytes also participate in acute rejection by infiltrating allografts and presenting alloantigens to t lymphocytes , promoting the production of ifn- , il-4 , and il-6 among others cytokines . these cells are also capable of differentiating into plasma cells , switching from antigen presenting cells to antibody secretory cells that may target mhc class i and ii molecules of the graft . to hamper this process , an anti - cd20 b cell depleting monoclonal antibody , rituximab , has been introduced as immunosuppressive treatment for transplanted patients . despite the fact that the use of this drug has increased patients ' survival , it fails to induce chronic unresponsiveness to the graft [ 39 , 40 ] . one of the possible reasons underneath may be that plasmablasts and plasma cells , two key players in chronic rejection , do not express cd20 on their cell surface . an additional explanation may be that breg are also depleted by the treatment , thus hampering their tolerogenic function . in this sense , some studies have shown that preserving the b cell compartment favors ot in renal transplantation . seminal papers coled by us and uk consortia ( iot , riset , and itn ) [ 42 , 43 ] showed a similar transitional - breg - related gene signature corresponding to immunosuppressant - free spontaneous ot kidney transplant patients . using microarray analysis and real time pcr , they identified a b cell specific gene signature and different b cell subpopulations distribution in ot patients compared to si patients after transplantation . the signature proposed by newell et al . , relating ot patients to hc but not to their is counterparts , includes 30 genes , most of them are encoding for the / light chains of ig . in the cross - validation experiments , three of these genes were found to be the most predictive : igkv1d-13 , igll1 , and igkv4 - 1 . on the other hand , flow cytometry analyses revealed an increased number of total and nave b cells in ot with respect to si patients . transitional b cells ( defined by the group as cd19cd24cd38igd ) were also found to be increased in tolerant patients and that was consistent in both itn and iot cohorts . since then , several other groups have showed similar traits in their ot or si patients [ 13 , 44 ] . reported that tolerant patients showed a higher frequency of transitional ( defined as cd20cd24cd38 ) and nave ( defined as cd20cd24cd38 ) b cells and a higher production of il-10 compared to si patients . in line with this observation , patients with chronic antibody mediated rejection after renal transplantation were found to have less percentage and absolute numbers of transitional b cells ( defined as cd19cd24cd38 ) when compared to the group of si patients . a recently published update of the itn study revealed a maintained gene signature among ot patients but surprisingly the gene set also increased over time in those si patients . flow cytometric analysis of the b cell population shows a persistent increase in total , nave , and transitional b cell population in ot compared to si patients . furthermore , additional studies have compared transitional / breg frequencies in ot , si , hc , and also chronic rejection patients . interestingly , the last group shows low levels of transitional b cells comparable to the ones of si patients . drawing on the correlation between kidney transplant tolerance and regulatory b cells , the prognostic value of pretransplantation transitional / regulatory b cells and transplantation outcome has been approached [ 48 , 49 ] . in a prospective study , shabir and colleagues show that only higher transitional b cell frequencies before transplantation , but not regulatory t cells , total b cells , or memory b cells , correlate with lower incidence of biopsy proven acute rejection . moreover , patients lacking transitional b cells three months after transplantation are at higher risk of suffering from both t cell and antibody mediated rejection . altogether these studies suggest a marked role of the transitional b cell compartment in graft acceptance and tolerance achievement , which implies that transitional b cells and breg are at least partially overlapping populations . it still remains unclear whether the tolerogenic effect is only created by the breg present in the recipient or whether they can be induced in any patient to generate a tolerance status . since breg and transitional b cells have been acknowledged as a key cell type in the induction and maintenance of tolerance , several groups have studied the effect of different treatments on these b cell compartments in the human setting . the study of the b cell subsets profile in patients under different immunosuppressive regimes has been approached by some groups . the results reported so far have demonstrated that neither mtor nor calcineurin inhibitors ( cni ) induce transitional nor regulatory b cells [ 5052 ] . although mtor inhibitors have shown treg inducing capacity , this effect seems to be breg independent . further , the in vitro study of the effect of cni revealed that it inhibits il-10 expression of b cells . other immunosuppressive agents , such as the b cell depleting antibodies alemtuzumab ( anti - cd52 ) and rituximab ( anti - cd20 ) , have also been tested in transplant patients for their capacity to induce breg . alemtuzumab treated patients show a transient increase in transitional b cells along with a sustained increase in nave b cells . conversely , rituximab has produced far more controversial results . while a single prophylactic dose seemed to protect from developing acute cellular rejection and even induce a b cell repopulation based on transitional b cells , a clinical trial using two doses of the same compound on days 0 and 7 after transplantation had highly deleterious effects , causing excessive rates of acute cell rejection which forced the premature termination of the trial . these studies may suggest that there is a window of time- and dose - dependent effect of b cell depletion to induce regulatory or effector b cell subsets in patients under these treatments . finally , next generation blockers of the b cell function which are being approached in autoimmune diseases , such as belimumab ( b cell activating factor ( baff ) blocker ) or atacicept ( transmembrane activator and calm interactor ( taci ) blocker , affecting both baff and a proliferation - inducing ligand ( april ) ) , will undoubtedly also have an effect on the b cell profile of patients , but to date there is no information on their effect on the breg population . beyond conventional immunosuppressive treatments , mesenchymal stem cells ( msc ) therapy is one of the leading nonpharmacological therapies in transplantation . several clinical trials have approached their tolerogenic potential and a few brought their attention to breg induction . patients with refractory chronic graft versus host disease ( cgvhd ) present lower frequencies of total b cells and cd5il-10 b. however , after three months of msc treatment patients showed improvement of their symptoms correlating with increased cd5il-10 b cells . of note , in another phase ii multicenter clinical trial , lymphocyte subsets were analyzed in patients infused several times with umbilical cord - derived msc to treat cgvhd . although there were no differences between the control and the treated groups regarding b cell numbers , the number of particular cd27 b cells was higher in the treated group after some months of msc infusions , and the clinical symptoms improved . an additional way to induce il-10 and functional breg may rely on helminths infections . individuals infected with schistosoma haematobium have higher percentage of il-10 producing b cells that are able to induce treg and il-10 production by t cells in coculture . moreover , helminthic infection of ms patients has shown therapeutic potential since those patients that were infected presented less clinical symptoms compared to noninfected ms subjects . the authors determined that b cells from helminths - infected ms patients produced more il-10 than noninfected ms patients , and that these il-10 producing cells had a phenotype similar to nave b2 cells . altogether these studies show the potential of several compounds and therapeutic approaches to induce breg . however , the significance of the increase of this particular b cell subset and their specific role in the progression of the disease or the therapeutic effect still need to be fully determined . hence , a proper knowledge on breg is mandatory to monitor the efficacy of the treatment as well as the tolerogenic status of the patient . in view of the potential of breg , many efforts have been made trying to find out how to effectively induce breg in vivo and to deepen into the mechanisms of action underlying breg induction . this vast knowledge is of paramount importance to get more insight into the potential mechanisms and therapeutic targets to induce breg in vivo , strategies for ex vivo induction for forthcoming cell therapy - based approaches , and purification of breg for their further study and characterization . the cell source to purify b cells and to produce breg in vitro differs from one lab to the other . while most groups use peripheral blood mononuclear cells as the main source of b cells due to the easy accessibility of blood , other sources such as lymph nodes ( i.e. , per indication from removed tonsils ) or spleen ( i.e. , discarded organ from cadaveric organ donor ) may also be important to get even larger numbers of b cells . although the levels of expression of some surface markers could vary between b cells from different compartments , little is known about how this can affect the induction of breg in in vitro experiments . cd19 is expressed from the early pro - b cell stage to the b cell lymphoblast stage , but the expression is downregulated upon b cell maturation to plasma cells . aiming at minimizing b cell activation induced by cd19 ligation , many other groups use cd19 negative selection to purify b cells . cd43 is expressed on activated b cells , plasma cells , cd5 b-1a cells , and non - b cells , thus resulting in a good marker to isolate untouched resting mature b cells . alternatively , cd22 is expressed on the surface of mature b cells in peripheral blood , but not on plasma cells or early stages of b cell differentiation , resulting in the isolation of untouched cd19 b cells . as the only current defining characteristic of regulatory b cells is their capacity to secrete il-10 , induction of breg from b cells is usually measured based on the proportion of il-10-producing b cells . although the intracellular pathways are not well known yet , they seem to be inducible in different ways . ligation of cd40 , b cell antigen receptor ( bcr ) , and/or toll - like receptors ( tlr ) together with il-2 or il-4 are the most used stimulating factors . however , a consensus regime to induce il-10 producing breg is still to be defined . decreased expression of tlr9 due to polymorphisms in the tlr9 gene can increase predisposition to sle in humans , which suggests that this is a key factor in breg induction . tlr9 ligation to induce breg can be achieved basically with cpg type b ( generally 2006 ) . lipopolysaccharide ( lps ) , which ligates to tlr4 , is more frequently used in mice since human b cells express very low levels of this receptor in physiological conditions . however , stimulation with anti - igm , cd40l , and il-4 can increase tlr4 expression by human b cells . found that both lps and cpg induced il-10 b cells and cd40 ligation enhanced this effect . also , april has been demonstrated to promote the generation of il-10 producing b cells via stat3 induction . compared to nave b cells from peripheral blood , nave b cells from cord blood seem to have a higher capacity to produce il-10 after stimulation , which could be related to a higher level of pstat3 after cd40 stimulation . this observation reinforces the importance of the source of b cells for ex vivo expansion . our group has recently demonstrated that msc support b cell survival and have a direct effect on their differentiation . when b cells derived from tonsils were stimulated with bcr plus cd40 ligation in the presence of il-2 , plasmablasts were induced . but when b cells in the same setting were cocultured with msc derived from adipose tissue , plasmablast formation was abrogated and breg ( cd19cd24cd38il-10-producing b cells ) were induced . similar results were obtained using b cells from blood , as when they were cultured together , msc promoted the survival and proliferation of b cells and increased the cd5 b cell subset , which has also been described to have immunoregulatory capacity . even though the mechanisms underlying these effects are unknown , in the same study they showed that inhibition of the ido pathway partially reduced the effect of msc on b cells , while blockade of cox-2/prostaglandin - e2 pathway , il-6 , or il-10 did not have any effect . based on the studies summarized in this review , and also in other studies that have not been mentioned due to space limitation , it is clear that breg may be envisaged as an additional approach for promoting tolerance in several pathologic situations . cell therapy is not a new concept anymore and even in the solid organ transplantation field protocols and clinical trials are being set up to promote tolerance in the absence or in a minimized immunosuppressive regime . msc therapy has taken the lead in this area with several trials done and published in kidney , liver , and bone marrow transplantation . in parallel , regulatory immune cell types such as regulatory t cells , tolerogenic dcs , or regulatory macrophages are the main immune cell types being studied and used for cell therapy in human organ transplantation . the one study , a cooperative project that aims at developing immunoregulatory cell therapies for organ transplanted patients , is the paradigm since they compile and share the knowledge among the research groups devoted to that field . however , to this moment , there are no trials on the use of breg as a cell therapy . the incomplete knowledge on breg induction , stability , and functional potential and the lack of a consensus breg signature are just some of the hurdles to be bypassed to generate a safe and efficient cell product . we might be dealing with different subsets of breg depending on the induction cocktail and system used that might present different stability and functionality . since most of the induction systems used at this moment promote activation of b cells , fillatreau and colleagues propose a method to induce il-10 expression on resting b cells to generate tolerogenic b cells which are poor immunogenic and present a lower potential risk of switching into effector b cell . in contrast to dendritic cells , b cells can not phagocyte an antigen to present it on their surfaces but instead it needs to be recognized by specific bcr , internalized , and presented in mhc - ii . it is unknown whether this antigen is inducing specific tolerance , but if this was the case , it would be necessary to find out how to generate antigen - specific breg . the effect that donor or recipient - derived breg could have in modulating the immune reaction remains unknown if we envision a therapy in the field of organ transplantation or the effect of autologous or allogeneic breg in autoimmune diseases . identifying the mechanism of action by which one and not the other could induce allograft tolerance can shed light on the role of direct and indirect pathway of antigen presentation and tolerance induction . moreover , the age of the patient is a relevant factor in the capacity of regulatory b cells to produce il-10 since it is impaired in cd38cd24 b cells from old individuals independently of the stimulating factor used ( cd40l , phorbol 12-myristate 13-acetate ( pma)/ionomycin , or cpg ) . there are other mechanistic issues that would have to be addressed such as the time needed to produce enough breg , infusion timing and dosage , route of administration , and gmp compliance . in addition to all the above mentioned issues , we are facing an added difficulty in the development of such a therapeutic strategy : the model . in mice models , multiple studies show that breg can induce treg and are capable of transferring tolerance in allogeneic cardiac allograft , islet allograft , and arthritis models . these studies point out the central role of il-10 in the modulation of the immune response . also , another study with islet allograft full mch - mismatched model suggested that treg induction by breg could be mediated through tgf- . in a rat cardiac allograft model , transferred breg from tolerant animals migrated to the graft where they maintained their regulatory capacity . back to mice , t cell ig mucin protein-1 ( tim-1 ) also seems to be a key molecule for breg since tim-1 b cell subset is highly enriched for il-10 producing cells , and the secretion of il-10 increases substantially after tim-1 ligation . nevertheless , it is proven that murine and human breg are essentially different and that their ex vivo induction involves different mechanisms and molecular pathways . in this scenario , we will have to rely on human cell culture approaches and humanized mouse models in order to develop a therapeutic strategy . besides the generation of therapeutic protocols to induce breg in vivo and taking into account the achievements in in vitro expansion of breg , one can envision in the near future a cell therapy approach using breg to promote tolerance . regulatory b cells are one of the newest members of the regulatory immune cells family . many researchers in the field of transplantation and autoimmune diseases have turned their attention to this cell type for their implication in maintaining homeostasis and achieving a tolerant state . while patients suffering from autoimmune diseases such as sle or ms have shown nonfunctional breg populations [ 9 , 81 ] in the transplantation field , higher pretransplantation breg numbers have been associated with lower antibody mediated rejection in kidney transplant recipients . further , in kidney transplantation , breg have become highly interesting due to their association with tolerance [ 12 , 42 , 43 ] . however it still remains elusive whether the increase in breg is cause or consequence of the tolerance status . despite the increasing number of papers published about breg , one of the main hurdles in their study is the absence of a breg signature , and the fact that murine breg are substantially different to the human ones is hindering this endeavor . until now the human breg signature has been mainly resolved by the use of transitional b cell phenotype and/or the ability to secrete il-10 but other extracellular markers and released cytokines have been associated with this cell type . the variability of the breg signature might be due to different breg phenotypes depending on the disease , the activation milieu , or the cell origin . unraveling a proper set of markers that identify this regulatory subset will help in the monitoring of patients and will bring new light into their relation with the immune homeostasis . . the generation of a breg in vitro might be the key point to regain the lost tolerance status opening new doors to the development of innovative therapies .

regulatory b cells ( breg ) are in the spotlight for their role in immune homeostasis maintenance and tolerance achievement as in the last years the correlation with functional and increased breg numbers in autoimmune diseases and transplantation has been extensively proven . their study is , however , in its infancy with still little knowledge and consensus on their origin , phenotype , and mechanism of action . all this hampers the pursuit of an effective breg induction method for therapeutic purposes . in this review we aim to summarize the studies on human breg and their implication in kidney transplantation and to further discuss the issues surrounding therapeutic applications of this cell subset .

1. Introduction 2. Regulatory B Cells: Phenotype and Function 3. Potential Role of Regulatory B Cells in Transplantation 4. Breg as Cell Therapy 5. Conclusions

epithelial cells can contribute to chronic inflammatory disorders , synthesizing and secreting a variety of proinflammatory cytokines , such as il-8 , which regulates the neutrophil accumulation in the airways of chronic obstructive pulmonary disease ( copd ) subjects [ 1 , 2 ] . in response to proinflammatory stimuli in addition , in human bronchial epithelial cells , the nfb activation may regulate il-8 release via erk / map kinase - dependent or kinase - independent processes . cigarette smoke , source of oxidative stress in the airways , is able to induce mucin synthesis in epithelial cells and a subsequent goblet cell production . the mucociliary dysfunction component of copd is due to mucus hypersecretion coupled with a decrease in mucus transport , and it is an important pathophysiological feature requiring appropriate treatment . il-17a , a major product of th17 cells , is implicated in the pathogenesis of several inflammatory and autoimmune diseases [ 7 , 8 ] . il-17a is involved in the development and progression of inflammatory diseases of the airways , including allergic asthma , rhinitis , and copd [ 911 ] . recent studies have demonstrated the effect of il-17a on il-8 secretion in the airway epithelial cells and in airway smooth muscle cells [ 9 , 12 , 13 ] . furthermore , il-17a promotes the growth of airway epithelial cells through erk - dependent signaling pathway and is able to generate muc5ac by nfb in bronchial epithelial cells . acetylcholine ( ach ) it is synthesized by choline acetyl - transferase ( chat ) in different cell types ( macrophages , t - lymphocytes , fibroblasts , and epithelial cells ) acting as an autocrine / paracrine growth factor in regulating various aspects of the innate mucosal defense mechanisms including mucociliary clearance and regulation of macrophage function . nonneuronal ach is involved in the activation of bronchial epithelial cells and alveolar macrophages as well as in the release of chemotactic mediators for eosinophils and neutrophils . it contributes to the inflammatory processes of copd via the activation of muscarinic receptors ( mrs ) m1 , m2 , and m3 [ 15 , 21 , 22 ] , and it is involved in the th17 immunity of copd patients . cholinergic agonists promote mucociliary clearance and the release of inflammatory mediators from airway epithelial cells . anticholinergic drugs , currently used in the treatment of copd , block the activity of muscarinic receptors in the airway secretory cells and in smooth muscle , reducing vagal tone and mucus secretion in copd [ 25 , 26 ] . furthermore , in vitro , anticholinergic drugs control the release of ltb4 in the inflammatory cells recovered from induced sputum of copd . we investigated whether il-17a , via erk1/2 and nfb signal pathway activation , is able to modulate the synthesis of chat promoting the autocrine ach release and binding on the cell surface of 16-hbe , in an in vitro model of bronchial epithelial cell line . furthermore , we studied whether the autocrine ach activity , induced by il-17a , promotes the production of il-8 and muc5ac in bronchial epithelial cells . finally , we tested the effectiveness of tiotropium bromide ( spiriva ) , anticholinergic drug usually used in the treatment of copd , in our in vitro model of bronchial inflammation . the sv40 large t antigen - transformed 16-hbe cell line , an immortalized normal bronchial epithelial cell line , or primary normal human bronchial epithelial ( n - hbe ) cells ( atcc , catalog number pcs-300 - 010 ) were used in this study . d. gruenert laboratory ( university of california , san francisco , california ) to ibim - cnr , italy . the cells represent a clonal diploid ( 2n = 6 ) cell line isolated from human lung . evidences showed that 16-hbe cells are similar to primary normal human bronchial epithelial ( n - hbe ) cells and to bronchial epithelial cells from bronchial brushings concerning the response to proinflammatory stimuli and anti - inflammatory drugs . 16-hbe cells and n - hbe cells were cultured as adherent monolayers in eagle 's minimum essential medium ( mem ) supplemented with 10% heat - inactivated ( 56c , 30 min ) fetal bovine serum ( fbs ) , 1% mem ( nonessential amino acids , euroclone ) , 2 mm l - glutamine , and gentamicin 250 g / ml at 37c in a humidified 5% co2 atmosphere . viable 16-hbe and n - hbe cells ( 5 10 ) were seeded into six - well plate in mem 10% fbs and cultured until confluence ( 7080% ) . cells were then made quiescent by culturing for 24 h in mem serum - free . the 16-hbe cells were then stimulated with rhil-17a ( 050 ng / ml ) ( r&d systems , minneapolis , mn , usa ) for 30 minutes to test the activation of the intracellular signal pathways and for 24 h to evaluate the intracellular expression of chat ( protein and mrna ) , ach expression , il-8 release , and muc5ac production . the n - hbe cells were stimulated with rhil-17a 20 ng / ml for 24 h to evaluate the intracellular expression of chat ( protein and mrna ) , ach expression , il-8 release , and muc5ac production . we tested the effects of 2-(2-amino-3-methoxyphenyl)-4h-1-benzopyran-4-one ( pd098,059 , an inhibitor of mapkk activation , 25 m ) ( sigma aldrich s.r.l . , milan , italy ) and ( e)-3-(4-methylphenylsulfonyl)-2-propenenitrile ( bay11 - 7082 , an inhibitor of ikb phosphorylation , 50 m ) ( sigma aldrich s.r.l . , milan , italy ) in 16-hbe cells stimulated in the presence and absence of rhil-17a 20 ng / ml . furthermore , we tested the effect of hemicholinium-3 ( hch-3 ) ( a potent and selective choline uptake blocker , 50 m ) ( sigma aldrich , milan , italy ) in 16-hbe cells stimulated in the presence and absence of rhil-17a 20 ng / ml . finally , we studied the effects of anticholinergic compound tiotropium ( spiriva ) ( 100 nm ) ( boehringer ingelheim pharma gmbh & co. kg , biberach , germany ) in 16-hbe and n - hbe cells stimulated in the presence and absence of rhil-17a 20 ng / ml . the drugs were added to the cells medium 1% fbs ( 5% co2 at 37c ) 1 h before the stimulation with rhil-17a . the expression of chat protein was determined in 16-hbe and n - hbe cells treated with rhil-17a for 24 h or medium alone using indirect label immunofluorescence analyzed by flow cytometry ( facstar plus analyzer , becton dickinson , mountain view , ca ) as previously described . furthermore , the expression of chat protein was measured by western blot analysis as previously described . the primary mouse anti - chat antibody ( mab5270 , chemicon , millipore ) was used for both flow cytometry and western blot . total rna was extracted from 16-hbe cells with trizol reagent ( invitrogen ) following the manufacturer 's instructions and was reverse - transcribed into cdna , using m - mlv - rt and oligo(dt)1218 primer ( invitrogen ) . quantitative real - time pcr of chat transcripts was carried out on steponeplus real - time pcr system ( applied biosystems , foster city , ca , usa ) using specific fam - labeled probe and primers ( prevalidated taqman gene expression assay for chat , hs00253141 m1 , assays - on - demand , applied biosystems ) . the expression of chat gene was normalized to glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) endogenous control gene . relative quantitation of gene expression was carried out with the comparative ct method ( 2 ) and it was plotted as fold change compared with untreated cells as the reference sample . the 16-hbe cells were collected , washed in cold pbs , and incubated 1 h at 4c with a rabbit polyclonal anti - ach antibody ( ab8884 , abcam , cambridge , uk ) . after washing with cold pbs , fitc - conjugated polyclonal swine anti - rabbit igg ( dako , glostrup , denmark ) was added to the cells for 30 min at 4c . fluorescence - positive cells were analyzed using facscalibur flow cytometer ( becton dickinson , mountain view , ca , usa ) . the percentage of positive cells was determined from forward scatter ( fs ) and sideways scatter ( ss ) patterns . no specific binding as well as background fluorescence was detected by analyzing negative control samples . it was measured in protein extracts from cultured 16-hbe cells by a fluorimetric method using a commercial kit ( biovision research products , ca , usa , cat . # the kit detects choline ( ch ) and total choline ( tch ) by adding acetylcholine esterase to the reaction that converts ach into ch with sensitivity until 50 pmol / well by plotting fluorescence readings ( ex / em 535/587 nm ) against the standard curve . this sensitivity is correspondent to the concentration of 1 m of tch or ch . fluorescence intensity was read using a wallac 1420 victor multilabel counter ( perkinelmer life sciences , turku , finland ) . the activation of erk1/2 and nfb pathway was performed by western blot analyses as previously described . we used two rabbit monoclonal antibodies against anti - phospho - erk1/2 and against anti - phospho - ikb ( cell signaling technology , beverly , ma ) , respectively , and an anti--actin antibody ( sigma , st . the cells were washed with cold pbs and nuclear / cytoplasmic extracts were obtained using an ne - per nuclear and cytoplasmic extraction kit ( thermo scientific , rockford , usa ) , which ensures efficient cell lysis and extraction of separate cytoplasmic and nuclear protein fractions by centrifugation . then , 2530 g of the lysate was denatured under reducing conditions by boiling for 3 min in 50 mm tris - hcl ( ph 6.8 ) , 1% sodium dodecyl sulfate ( sds ) , 2% -mercaptoethanol , and 0.01% bromophenol blue . the nuclear and cytoplasmic proteins extracts were separated by sds - polyacrylamide gel electrophoresis ( page ) and transferred via electrophoresis onto immobilon - p membranes ( millipore , bedford , ma , usa ) . after transfer , the membranes were blocked overnight at room temperature in pbs containing 3% bsa and 0.5% tween 20 and then incubated for 1 h at room temperature with anti - nfb - p65 ( c-20 ) sc-372 , santa cruz biotechnology ( santa cruz , ca , usa ) . 16-hbe and n - hbe cells were previously fixed with 4% paraformaldehyde in pbs , washed , and permeabilized with pbs ( containing 0.1% saponin , 1% sodium azide , and 10% fbs ) and incubated with primary antibody , mouse monoclonal anti - muc5ac clone 45m1 ( 200 g / ml , # ms-145-p , neomarkers , fremont , ca ) . the cells were washed twice and then incubated with fitc - conjugated rabbit polyclonal anti - mouse igg f(ab)2 ( dako , glostrup , denmark ) for 30 min at 4c and then analyzed by flow cytometry analyses ( facscalibur flow cytometer , becton dickinson , mountain view , ca , usa ) supported by cellquest acquisition and data analysis software ( becton dickinson , mountain view , ca , usa ) . the cells were considered muc5ac positive when their fluorescence 1 ( fl1 ) was greater than a gate set to exclude all cells in the fl1 peak from an isotype matched control antibody . 16-hbe and n - hbe cells were lysed with lysis buffer ( 10 mm tris - hcl ( ph 7.4 ) , 50 mm nacl , 5 mm edta , and 1% np-40 nonidet ) containing protease and phosphatases inhibitors and frozen at 20c . after being defrozen , samples were centrifuged at 12000 rpm for 20 min , supernatants were recovered , and the protein concentration was quantified by bradford solution . equal amounts of cell extract proteins ( 40 g / lane ) were separated via sds - page electrophoresis in 8% acrylamide - bisacrylamide ( 80 : 1 ) under nonreducing conditions [ 32 , 33 ] . the proteins were then transferred electrophoretically to nitrocellulose membranes that were incubated with 5% fat - free skimmed milk in pbs for 1 h and then incubated with the same antibody and then western blot ( dilution 1 : 500 , overnight at 4c ) . subsequently , the membrane was washed and incubated for 1 h with a secondary antibody conjugated to hrp . after wash in pbs 1x , detection was performed with an enhanced chemiluminescence system ( ambion , austin , tx ) followed by autoradiography . the levels of il-8 were determined in 16-hbe supernatants using a commercial elisa kit ( r&d systems , inc . furthermore , the levels of il-8 expression were determined in 16-hbe and n - hbe protein extracts by western blot using a mouse monoclonal anti - il-8 ( dilution 1 : 100 , overnight at 4c ) ( sc-8427 , santa cruz biotechnology , inc . ) and a sheep anti - mouse igg - hrp ( dilution 1 : 1000 ) ( na931 , ge healthcare uk , little chalfont , buckinghamshire , uk ) as primary and secondary antibody , respectively . cell transfection was performed according to the manufacturer 's instructions ( 72 h at 37c ) in siport neofx transfection agent ( ambion , inc . , texas , usa ) diluted in opti - mem ( gibco invitrogen , milan , italy ) and chat sirna ( 20 m , s-2969 ambion , inc . , texas , usa ) diluted in opti - mem for a final concentration of 30 nm . a sirna ( 20 m , ambion , inc . , texas , usa ) , containing a scrambled sequence without significant homology to the human genome , was used as negative control . furthermore , the effect of chat sirna was checked in il-8 measurement and in muc5ac production obtained as mentioned above . gel images were taken with epson gt-6000 scanner and then were imported into national institutes of health image analysis 1.61 program to determine band intensities . data are expressed as arbitrary densitometric units ( adu ) corrected against the density of -actin bands . analysis of variance ( anova ) corrected with fisher 's test and t - test was used for comparisons . the stimulation of 16-hbe cells with rhil-17a ( 20 and 50 ng / ml for 24 h ) significantly increased chat protein expression compared with unstimulated cells by both flow cytometry ( figures 1(a ) and 1(b ) ) and western blot analyses ( figure 1(c ) ) . the stimulation of the cells with rhil-17a 20 ng / ml reached the higher levels of chat synthesis ( figure 1 ) . accordingly , we showed that the levels of chat mrna , obtained by rt - pcr , significantly increased in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with unstimulated cells ( figure 1(d ) ) . finally , we showed that rhil-17a ( 20 and 50 ng / ml for 24 h ) significantly increased the ach binding ( figures 2(a ) and 2(b ) ) and production ( figure 2(c ) ) compared with unstimulated cells . the stimulation of the cells with rhil-17a 20 ng / ml reached the higher levels of ach binding and production ( figure 2 ) . the pikb and perk1/2 were significantly increased in 16-hbe cells stimulated with rhil-17a 20 ng / ml for 30 min in comparison with untreated cells , reaching higher levels when compared with the cells stimulated for 2 h with rhil-17a 20 ng / ml ( figures 3(a ) and 3(b ) ) . the dose - response curve showed a significant increase of pikb and perk1/2 in 16-hbe cells stimulated with rhil-17a 20 ng / ml in comparison with unstimulated cells . the levels of pikb and perk1/2 shaped in 16-hbe cells stimulated with rhil-17a 50 ng / ml in comparison with the cells stimulated with rhil-17a 20 ng / ml are shown in figures 3(c ) and 3(d ) . finally , we showed an increase of nfb - p65 nuclear translocation in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with untreated cells ( figure 3(e ) ) . the preincubation of 16-hbe cells with pd098,059 or bay11 - 7082 significantly reduced the expression of chat protein in 16-hbe cells stimulated with rhil-17a 20 ng / ml for 24 h by both flow cytometry ( figures 4(a ) and 4(b ) ) and western blot analysis ( figure 4(c ) ) . accordingly , the pretreatment of the cells with pd098,059 and bay11 - 7082 significantly decreased ach binding ( figures 5(a ) and 5(b ) ) and production ( figure 5(c ) ) in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with the cells stimulated with rhil-17a alone . finally , the use of tiotropium significantly decreased the ach binding in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with the cells stimulated with rhil-17a alone ( figures 5(d ) and 5(e ) ) . the stimulation of 16-hbe cells with rhil-17a 20 ng / ml for 24 h significantly increased the levels of il-8 protein expression and release compared to unstimulated cells ( figure 6 ) . the pretreatment of the cells with hch-3 ( 50 m ) or tiotropium ( 100 nm ) significantly reduced the levels of il-8 protein expression ( figures 6(a ) and 6(b ) ) and release ( figure 6(c ) ) in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with the cells stimulated with rhil-17a alone . additionally , the stimulation of 16-hbe cells with rhil-17a 20 ng / ml for 24 h significantly increased muc5ac expression , compared with unstimulated cells evaluated by both flow cytometry and western blot analysis ( figure 7 ) . the pretreatment of the cells with hch-3 ( 50 m ) or tiotropium ( 100 nm ) significantly reduced the muc5ac protein expression in 16-hbe cells stimulated with rhil-17a 20 ng / ml compared with the cells stimulated with rhil-17a alone ( figure 7 ) . the temporary transfection of 16-hbe cells with chat sirna generated a significant decrease in muc5ac expression ( figures 8(a ) and 8(b ) ) and il-8 release ( figure 8(c ) ) in 16-hbe cells stimulated with rhil-17a 20 ng / ml , when compared with unsilenced or scrambled cells stimulated with rhil-17a . knockdown efficiency of chat mrna ( 40 2.5% ) was obtained comparing the levels of chat protein expression in silenced and scrambled unstimulated 16-hbe cells ( figure 8(d ) ) . the stimulation of n - hbe cells with rhil-17a 20 ng / ml for 24 h significantly increased the levels of chat , muc5ac , and il-8 protein expression compared with unstimulated cells . the pretreatment with tiotropium ( 100 nm ) significantly reduced the levels of muc5ac and il-8 protein expression in n - hbe cells stimulated with rhil-17a 20 ng / ml ( figure 9 ) . in our in vitro model , we demonstrated for the first time that il-17a , via erk1/2 and nfb pathway activation , is able to generate an increased synthesis of chat protein promoting ach production and binding in human bronchial epithelial cells . the autocrine ach activity observed in the presence of il-17a increased the levels of il-8 and muc5ac production in human bronchial epithelial cells . finally , anticholinergic drugs such as tiotropium ( spiriva ) might have anti - inflammatory and antisecretory properties by the control of ach activity generated in bronchial epithelial cells stimulated with il-17a . much of our knowledge comes from the interactions between environmental and inflammatory stimuli , and the airway epithelium has been derived extensively from in vitro cell culture models using transformed 16-hbe cells , representing an invaluable model in understanding the physiological properties of human airway epithelium [ 22 , 27 , 34 ] . in accordance with this concept , our study is based principally on the use of an immortalized airway epithelial cell line , 16-hbe . nevertheless , to strengthen the message of our findings we performed some experiments using commercially available primary bronchial epithelial cells . ach , classically known as a parasympathetic neurotransmitter , is able to affect the inflammatory processes in copd [ 19 , 22 , 35 ] . th17 cells producing il-17a are associated with nonneuronal ach in the systemic inflammation of copd patients . the stimulation of cholinergic receptors enhances il-10 and il-17a and inhibits ifn- secretion in murine spleen t - cells suggesting a link between t - cell , cholinergic receptors , and th17 lineages . furthermore , it was observed that il-17a is a proinflammatory cytokine involved in modulating airway immune response in several aspects covering both the innate and the adaptive immunity in chronic lung disorders [ 3739 ] . bronchial epithelial cells from copd patients as well as 16-hbe cell line express il-17 receptor . in light of this background , we hypothesized a link between il-17a and the production of autocrine growth factor ach in bronchial epithelial cells . accordingly , we found that rhil-17a is able to increase the basal levels of chat protein ( the enzyme involved in the synthesis of ach ) synthesis , the levels of autocrine ach , and the related binding to cellular surface of 16-hbe cells . rhil-17a affects the synthesis of chat protein also in our in vitro experiments with primary epithelial cells from normal donors ( n - hbe ) . these findings might suggest that th17 immunity is involved in the chat / ach activity promoting the bronchial epithelial cells activation during inflammatory process of the airways . a relevant number of studies identified that il-17a promotes the activation of bronchial epithelial cells through erk1/2 or nfb dependent signaling pathway [ 14 , 15 ] . the activation of mek / erk cascade regulates chat promoter via nfb signal pathway in transfected chp126 neuroepithelioma cells . accordingly , we observed higher levels of erk1/2 and ikb phosphorylation in 16-hbe cells stimulated with rhil-17a 20 ng / ml , suggesting the involvement of mek / erk and nfb pathway activation in our in vitro model . furthermore , looking at nfb - p65 in nuclear extract ( as upstream of pikb ) , we underlined an increase of the nuclear translocation of nfb in 16-hbe cells stimulated with il-17a 20 ng / ml . these findings might provide evidences for the involvement of nfb pathway in bronchial epithelial cells stimulated with il-17a . to demonstrate that rhil-17a regulates chat synthesis via mek / erk cascade and via nfb pathway , we preincubated with pd098,059 ( inhibitor of mapkk activation ) and bay11 - 7082 ( inhibitor of ikb phosphorylation ) the 16-hbe cells stimulated with rhil-17a . the use of the specific inhibitors reduced the levels of chat protein synthesis and ach production and binding in the cells stimulated with rhil-17a suggesting the involvement of mek / erk cascade and via nfb pathway in this mechanism of synthesis . however , we observed the dose - response curve of rhil-17a peaks at 20 ng / ml for erk1/2 and ikb signaling to shape at the concentration of il-17a 50 ng / ml . in contrast to these data , we showed persistence of chat synthesis and ach production and binding . these findings might suggest that the higher concentration of rhil-17a might be involved in the chat synthesis , independently of the mek / erk cascade and nfb pathway , by the activation of other intracellular signal pathways . however , in this study we focused our attention on the effect of rhil-17a 20 ng / ml . nevertheless , we suggest that further studies will be necessary to better clarify the role of intracellular signal pathway involved in chat synthesis and autocrine ach activity of bronchial epithelial cells stimulated with rhil-17a 50 ng / ml . th17 immunity has an emerging role in the induction of neutrophilic airway inflammation [ 9 , 12 , 13 ] and muc5ac production . the reduced sensitivity to gcs related to th17 immunity has been clinically associated with neutrophilic airway inflammation [ 42 , 43 ] , but it is still largely unclear which cellular and molecular mechanisms contribute to this phenomenon . il-17a activated the p38 , extracellular signal - related kinase ( erk ) , and phosphoinositide-3-kinase ( pi3k ) pathways inducing gc insensitivity . furthermore , mechanisms whereby pharmacological agents such as glucocorticoids repress mucin gene expression are not well studied , although they might be important for formulating therapeutic interventions in chronic lung diseases . preclinical studies have demonstrated that stimulation with cholinergic agonists ( ach , methacholine ) or cholinergic antagonists ( atropine ) , targeting muscarinic receptors , increases mucociliary clearance [ 24 , 45 , 46 ] . accordingly , anticholinergic drugs block muscarinic receptors activity on airway secretory cells and smooth muscle and so , theoretically , may reduce vagal tone and mucus secretion in copd facilitating cough - induced mucus clearance [ 25 , 26 ] . consistent with this suggestion is the observation that tiotropium reduces levels of mucus secretion in patients with copd . furthermore , tiotropium reduces exacerbation frequency in copd , but this effect does not appear to be due to a reduction in il-8 systemic inflammation and is able to control il-8 release in epithelial cells in vitro [ 22 , 49 ] . in this scenario , we speculate that the blockade of il-17a downstream , regarding chat synthesis , and autocrine ach production might represent a new strategy for therapeutic intervention in gc insensitivity of airway inflammation using anticholinergic drugs . accordingly , we showed that the use of tiotropium is able to reduce autocrine ach binding . these results suggest the involvement of machrs in the activation of bronchial epithelial cells stimulated with il-17a . furthermore , we observed that the use of muscarinic receptor antagonists such as tiotropium is able to control the muc5ac and il-8 production blocking the activity of ach bound to machrs generated by il-17a in bronchial epithelial cells . we support this observation showing the effect of hch-3 ( choline uptake blocker ) that , blocking the synthesis of autocrine ach , reduced the muc5ac and il-8 production in 16-hbe cells stimulated with rhil-17a . finally , we observed that the chat enzyme rna interference promoted the reduction of muc5ac and il-8 production in the 16-hbe cells stimulated with rhil-17a rather than in both unsilenced and scrambled cells stimulated with rhil-17a . these results might suggest the potential involvement of chat / ach pathway in the regulation of mucin production and inflammation in bronchial epithelial cells during chronic airway disease . however , rhil-17a did not affect the expression of machrs ( m13 ) in 16-hbe cells ( data not shown ) . in this scenario , our in vitro model suggests the potential relevant contribution of anticholinergic drugs to the blockade of mucus and inflammatory secretion during copd exacerbations . accordingly , we showed that tiotropium reduced muc5ac and il-8 production in the experiment performed with 16-hbe and primary n - hbe cells stimulated with rhil-17a . nevertheless , further in vivo clinical study should be necessary to clarify the role of anticholinergic drugs in the control of mucus and inflammatory mediator secretion from bronchial epithelial cells during il-17a mediated airway inflammation . to our knowledge , this is the first descriptive study demonstrating the involvement of il-17a in the induction of the chat / ach activity in bronchial epithelial cells promoting inflammation and mucus secretion in the airways . the ability of muscarinic receptor antagonists , including tiotropium , to modulate il-17a activity might open up perspectives for novel therapeutic strategies in the control of th17 immunity during the airway inflammation and the mucus secretion of copd patients ( figure 10 ) .

il-17a is overexpressed in the lung during acute neutrophilic inflammation . acetylcholine ( ach ) increases il-8 and muc5ac production in airway epithelial cells . we aimed to characterize the involvement of nonneuronal components of cholinergic system on il-8 and muc5ac production in bronchial epithelial cells stimulated with il-17a . bronchial epithelial cells were stimulated with recombinant human il-17a ( rhil-17a ) to evaluate the chat expression , the ach binding and production , the il-8 release , and the muc5ac production . furthermore , the effectiveness of pd098,059 ( inhibitor of mapkk activation ) , bay11 - 7082 ( inhibitor of ikb phosphorylation ) , hemicholinium-3 ( hch-3 ) ( choline uptake blocker ) , and tiotropium bromide ( spiriva ) ( anticholinergic drug ) was tested in our in vitro model . we showed that rhil-17a increased the expression of chat , the levels of ach binding and production , and the il-8 and muc5ac production in stimulated bronchial epithelial cells compared with untreated cells . the pretreatment of the cells with pd098,059 and bay11 - 7082 decreased the chat expression and the ach production / binding , while hch-3 and tiotropium decreased the il-8 and muc5ac synthesis in bronchial epithelial cells stimulated with rhil-17a . il-17a is involved in the il-8 and muc5ac production promoting , via nfb and erk1/2 pathway activation , the synthesis of chat , and the related activity of autocrine ach in bronchial epithelial cells .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

an estimated 630,000 people worldwide were diagnosed with head and neck squamous cell carcinoma ( hnscc ) in 2008 , representing 6% of all malignancies and making it the 6th most common cancer [ 1 , 2 ] . in the united states , approximately 48,000 cases occurred in 2009 , with 11,300 deaths . however , two - thirds of patients are diagnosed at a locoregional advanced stage ( iii - ivb ) , with 5-year survival rates of 30 to 60% for these patients . in the past decade , treatment of locoregional advanced hnscc has shifted from primary surgery to organ preservation with combination chemoradiotherapy ( crt ) . the current approach attempts to achieve both organ preservation and function with outcomes superior to radiotherapy alone or surgery with postoperative radiotherapy [ 612 ] . a recent meta - analysis by pignon et al . showed an absolute survival benefit of 6.5% at five years when chemotherapy was administered concomitantly with radiotherapy . the mechanism for the survival benefit of crt is thought to occur via increased tumor sensitization to the cytotoxic effects of radiotherapy , while providing adjuvant treatment for potential distant metastatic disease . however , crt has acute and long - term toxicities that can both limit treatment and increase morbidity . furthermore , although several crt regimens produce high rates of complete response at the primary site and regional neck nodes , there exists a high rate of failure to systemically eradicate micrometastases . this is demonstrated by the later occurrence of distant metastases , which account for many cancer - specific deaths . therefore , despite the successful use of numerous crt regimens and the development of multidisciplinary management , the prognosis of locoregional advanced hnscc remains poor . in this study , we review the outcomes of a heterogeneous cohort of patients with locoregional advanced hnscc . all patients were treated with curative intent with a uniform crt regimen that consisted of hyperfractionated radiotherapy and concurrent cisplatin/5-fluorouracil ( 5-fu ) . outcomes evaluated were overall survival ( os ) , locoregional control ( lrc ) , and disease - free survival ( dfs ) . in an irb - approved study design ( greater baltimore medical center irb number 07 - 044 - 11 ) , the medical records of 105 patients with previously untreated , locoregional advanced , nonmetastatic stage iii - ivb squamous cell carcinoma of the oropharynx , hypopharynx , or larynx were reviewed . patients with cancers of the salivary glands , sinuses , or unknown primary sites were excluded , as were patients with recurrent tumors or previous chemotherapy or radiation to the head or neck . patients were evaluated by a head and neck surgeon , medical oncologist , radiation oncologist , dentist , speech pathologist , nurse , and social worker . all cases were discussed prior to therapy and on a regular basis thereafter at multidisciplinary conference . all patients underwent comprehensive head and neck exam , including laryngoscopy and triple endoscopy when necessary , and imaging assessment with chest x - ray , ct , pet / ct , or mri of the head and neck when appropriate . all patients had a histologic diagnosis of squamous cell carcinoma and were staged according to american joint committee on cancer ( ajcc ) guidelines . when possible , tumor samples were tested for hpv-16 dna via in situ hybridization - catalyzed signal amplification as previously described . patient demographic and clinical characteristics collected at baseline included age , gender , race , patient - reported weight loss , and karnofsky performance status ( kps ) . in addition , history of tobacco and alcohol use was collected and categorized as follows : tobacco as nonsmoker , < 20 pack - years ( py ) , 2040 py , 4060 py , or > 60 py ; alcohol as nondrinker , < 7 drinks / week ( social ) , 714 drinks / week ( moderate ) , or > 14 drinks / week ( heavy ) . chemotherapy consisted of cisplatin ( 12 mg / m ) administered over one hour and 5-fu ( 600 mg / m ) over twenty hours , dosed for five consecutive days in an inpatient setting during weeks one and six of radiation therapy . radiation therapy consisted of hyperfractionated doses of 125 cgy delivered twice daily for 2833 days for a total dose of 7075 gy to the primary tumor site , 60 gy to involved lymph nodes , and 50 gy to uninvolved cervical and supraclavicular lymph nodes . patients were treated with 6 mv photon beams , opposed lateral fields with focus blocks , and neck nodes were boosted with electron beam after a cumulative dose of 40 gy . treatment interruptions were minimized as much as possible , and a planned treatment break of one week was included after a cumulative dose of 40 gy . mucositis severity , scored according to the world health organization ( who ) oral toxicity scale , was collected from records of patient visits to speech language pathology and clinical notes of the radiation and medical oncologists . duration of gastrostomy tube dependence was calculated from the initiation of crt until the date of removal . all but seven patients with clinical n2 or n3 disease at the time of presentation underwent planned neck dissection . after treatment , patients returned for followup every 2 - 3 months in years 1 - 2 , every 36 months in years 35 , and every 612 months thereafter , or sooner in the event of a clinical concern requiring closer scrutiny . event time distributions were estimated with the method of kaplan and meier and compared using the log - rank statistic or the proportional hazards regression model . the simultaneous effect of two or more factors was studied using the multivariate proportional hazards model , which was reported with 95% confidence intervals ( cis ) . os was calculated from the date of treatment initiation to the day of death or last followup . dfs was calculated from the date of treatment initiation to the day of recurrence or death , whichever came earlier . lrc was similarly calculated from the date of treatment initiation to the day of local or regional recurrence , whichever came first . factors evaluated for prognostic value included age , gender , race , tumor site , histologic grade , ajcc stage , tumor stage , nodal stage , self - reported weight loss , kps , pretreatment hemoglobin , tobacco and alcohol history , and hpv status . in proportional hazards regression models , variables were entered as categorical effects and the hazard ratios for these factors reflect either its presence or absence . the median followup of surviving patients was 57.6 months ( range 4.6 to 118.8 ) . median survival was 99 months , with 3- and 5-year overall survival rates of 77 and 63% for stage iii and 72 and 58% for stage iv . including both stages iii and iv , the 3- and 5-year os was 75 and 60% . uni- and multivariate analyses of factors associated with survival are listed in figure 1(b ) . on uni- and multivariate analysis , age greater than 55 , primary hypopharyngeal cancers , and advanced t3/t4 tumors were associated with decreased survival , while male gender was associated with increased survival . on univariate analysis only , any smoking history and greater than 40 pack - year smoking history were associated with decreased survival . hpv - positive cancers of the oropharynx were associated with slightly decreased mortality ; however , this was not statistically significant ( p = 0.3 ) . the distribution of deaths from primary head and neck cancer and other causes is shown in table 2 . the average time to locoregional recurrence was 13.8 months ( range 6.3 to 33.9 ) after initiation of crt . the 3- and 5-year rates of lrc were 76 and 68% , respectively ( figure 2(a ) ) . of the five patients who developed regional recurrences , three had undergone planned neck dissection following completion of crt . two of these three patients had viable carcinoma identified in the ipsilateral cervical lymph nodes , while the other patient had no evidence of viable tumor identified in any lymph nodes . the most common site of distant metastatic disease was the lungs ( n = 12 ) . the average time to diagnosis of distant metastasis was 14.1 months ( range 3.2 to 31.9 ) after initiation of crt . the average time to development of any recurrence or metastasis was 14.1 months ( range 3.2 to 33.9 ) after initiation of crt . median disease - free survival was 96 months , with 3- and 5-year rates of 63 and 56% , respectively ( figure 3(a ) ) . uni- and multivariate analyses of factors associated with dfs are listed in figure 3(b ) . hypopharyngeal cancer and t3/t4 tumors were both significantly associated with decreased disease - free survival . eighteen second primary malignancies ( spms ) were diagnosed in 17 patients after the completion of treatment . the most common spm was lung ( n = 7 ) , followed by colorectal ( n = 3 ) , hnscc ( n = 2 ) , prostate ( n = 2 ) , medullary thyroid carcinoma ( n = 1 ) , chronic lymphocytic leukemia ( n = 1 ) , multiple myeloma ( n = 1 ) , and cutaneous squamous cell carcinoma ( n = 1 ) . the average time to diagnosis of spm was 33 months ( range 3.0 to 63.2 ) . twenty - four patients ( 36% ) had grade 3 mucositis , and 39 patients ( 59% ) had grade 4 mucositis . the median duration of peg use was 134 days ( range 311570 ) , which included patients who died with a peg tube in place . thirty - two of 94 patients ( 34% ) required a peg for greater than 6 months , and 10/94 patients ( 11% ) required a peg for greater than 12 months . thirteen out of these 67 patients ( 19% ) developed a stricture , as reported previously . seventy - one of 105 patients were nodal stage n2 or n3 , and 64 patients underwent neck dissection ( 61% ) . of the seven patients with n2 or n3 disease who did not undergo neck dissection , two died prior to surgery , one was too ill to undergo surgery , one refused surgery , and reasons were not available for the other three patients . this rate of viable carcinoma detected post - crt is comparable to that in the cohort of patients with oropharyngeal cancer previously reported by hillel et al . and the use of combination chemotherapy and radiation therapy as primary treatment for locoregional advanced hnscc in medically fit patients has been well established as a treatment option in numerous trials and meta - analyses . furthermore , altered fractionation radiotherapy with concomitant chemotherapy is a well - established treatment for locoregional advanced , nonmetastatic disease . the landmark study by brizel et al . showed that hyperfractionated radiotherapy with cisplatin and 5-fu resulted in improved survival compared to radiation therapy alone . therefore , we sought to review the efficacy of a uniform treatment regimen in a heterogeneous cohort with locoregional advanced hnscc . the results of the concurrent administration of crt for 105 consecutive patients revealed favorable outcomes . for example , two other studies reported 5-year overall survival rates of 59% and 40% , respectively , in cohorts of patients with stage iii or iv disease who received similar radiation and the same chemotherapeutic agents [ 21 , 22 ] . in another series of stage iv patients who received concurrent crt , the 5-year os was 46% . likewise , in the study by brizel et al . , which employed similar hyperfractionated radiotherapy and concurrent cisplatin and 5-fluorouracil in the same doses as our regimen , the 3-year os was 55% and the lrc was 70% . in our cohort , 12 patients ( 11% ) developed locoregional recurrence , and 16 patients ( 15% ) developed distant metastasis . this is comparable to other studies with similar crt regimens , which have reported locoregional recurrence in 2231% of patients and distant metastasis in 1320% of patients [ 21 , 22 ] . the patterns of failure were approximately equal between locoregional ( n = 12 ) and distant sites ( n = 16 ) , which contrasts with several studies in which the majority of failures occur either at the primary tumor site or cervical lymph nodes [ 6 , 12 , 23 ] . reported the results of their experience with two main treatment regimens : type 1 , intensive induction chemotherapy followed by split - course chemotherapy , or type 2 , intensive , split - course hyperfractionated chemotherapy . they reported a 5-year lrc rate of 31 and 17% for types 1 and 2 , respectively , and a 5-year distant failure rate of 13 and 22% for types 1 and 2 . interestingly , the patients who received induction crt were more likely to have locoregional control but were also more likely to have distant metastatic relapse . this has prompted some to suggest the role of induction chemotherapy in treating micrometastatic disease , as other trials have shown a reduction in rates of distant metastasis with the use of induction crt . in our cohort , there were 14 patients who presented with a primary cancer of the hypopharynx and one patient with cancers of the hypopharynx and oropharynx . eleven of the 14 patients ( 79% ) with hypopharyngeal cancer underwent neck dissection , and 6/11 ( 55% ) had viable carcinoma ( versus 28% of the overall cohort who underwent neck dissection ) . eight of 14 patients ( 57% ) had a recurrence , compared to 25/105 ( 24% ) in the overall cohort . furthermore , of the eight recurrences in the hypopharynx group , seven of them presented with distant metastases . these data reflect the poor overall survival of those with hypopharynx cancers in this cohort , which is similar to other published studies [ 2528 ] . patients with hypopharyngeal squamous cell carcinoma may therefore need a different therapeutic approach . given the ongoing debate regarding the possibility of induction chemotherapy to better treat micrometastases , this method of crt should be considered in a direct trial against concomitant crt or perhaps a return to primary surgery with postoperative radiotherapy is warranted . the high rate of grade 3 or 4 mucositis observed in this cohort was consistent with other reports [ 29 , 30 ] . with regard to the elective placement of peg tubes , this is supported by the need to maintain or minimize the weight loss associated with crt , which is between 10 to 14% [ 12 , 30 , 31 ] . in one study , elective versus nonelective use of peg was compared , and elective peg resulted in less weight loss and decreased length of hospitalization . the median duration of peg use and the rate of patients that required a peg tube for longer than 6 or 12 months is similar to other studies [ 3335 ] . furthermore , the exact duration reported may be overestimated due to the retrospective nature of this study and the inability to determine exactly when the patients no longer used the peg tube . patients with head and neck cancer have an increased rate of second primary malignancies , estimated at 39% per year [ 2 , 36 ] . these cancers affect the entire aerodigestive tract , are often related to smoking history , and are therefore of great significance in survivors of head and neck cancer . consistent with these studies , the high rate of second primary lung cancer detected in our patient cohort was not unexpected and was ultimately responsible for a significant fraction of patient deaths after they were without evidence of disease of head and neck cancer . in our cohort , 2 of 18 spm were cancers of the head and neck , similar to another cohort of patients treated with crt . the average time to occurrence of spm was 33 months ( 2.75 years ) in our cohort , similar to other publications of 2.8 years [ 30 , 37 ] . in addition , treatment compliance was high , and few patients experienced unplanned treatment breaks or delays due to excessive toxicity . furthermore , long - term followup was available . only two patients were lost to followup immediately after treatment , and all but six remaining patients had records available from a provider at our institution within the previous year . other strengths included the utilization of a uniform crt regimen , and a thorough chart and database review and availability of the medical records of several departments . despite these strengths , although efforts were made to collect toxicity data , this was often unavailable and not systematically recorded in patient notes ; therefore , documentation of toxicity may have been underestimated and therefore may not be representative . the results of this study show that the use of hyperfractionated radiotherapy with concurrent cisplatin and 5-fluorouracil remains an excellent regimen for the primary treatment of locoregional advanced head and neck cancer . however , the prognosis for patients who experience relapse remains poor , and research focused on predicting which patients will experience these events and what treatment modifications , if any , should be made in order to improve the outcomes for these patients is warranted . lastly , the poor outcomes of patients with cancer of the hypopharynx merit consideration of ongoing research and novel therapies to lessen the mortality of this disease .

objective . we reviewed a cohort of patients with previously untreated locoregional advanced head and neck squamous cell carcinoma ( hnscc ) who received a uniform chemoradiotherapy regimen . methods . retrospective review was performed of 105 patients with stage iii or iv hnscc treated at greater baltimore medical center from 2000 to 2007 . radiation included 125 cgy twice daily for a total 70 gy to the primary site . chemotherapy consisted of cisplatin ( 12 mg / m2/h ) daily for five days and 5-fluorouracil ( 600 mg / m2/20 h ) daily for five days , given with weeks one and six of radiation . all but seven patients with n2 or greater disease received planned neck dissection after chemoradiotherapy . primary outcomes were overall survival ( os ) , locoregional control ( lrc ) , and disease - free survival ( dfs ) . results . median followup of surviving patients was 57.6 months . five - year os was 60% , lrc was 68% , and dfs was 56% . predictors of increased mortality included age 55 , female gender , hypopharyngeal primary , and t3/t4 stage . twelve patients developed locoregional recurrences , and 16 patients developed distant metastases . eighteen second primary malignancies were diagnosed in 17 patients . conclusions . the crt regimen resulted in favorable outcomes . however , locoregional and distant recurrences cause significant mortality and highlight the need for more effective therapies to prevent and manage these events .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

with the rapid economic development , elevated standard of living , dietary shifts , lifestyle alterations , and aging , diabetes mellitus ( dm ) has become an important public health problem worldwide [ 13 ] , which is estimated to be the third most challenging disease threatening public health after malignant tumors and cardiocerebral vascular diseases . it has been estimated that the global number of individuals with diabetes will double from 171 million in 2000 to 366 million in 2030 among adults aged 20 years . data from european countries have indicated that the health care expenditure for patients with diabetes mellitus was significantly higher than for those who were not diagnosed with this disease [ 68 ] . also , in the united states , it has been estimated that approximately 17.5 million people were diagnosed with insulin - dependent diabetes mellitus ( iddm ) or non - insulin - dependent diabetes mellitus ( niddm ) in 2007 , and the total annual cost in higher medical costs and lost productivity was estimated to be $ 174.4 billion , including $ 159.5 billion for the 16.5 million people with niddm and $ 14.9 billion for the 1 million people with iddm . a recent global study indicated that the prevalence of diabetes mellitus was rising rapidly , particularly in developing countries . moreover , more than 60% of the population with diabetes mellitus all worldwide comes from asia , as this remains the world 's most populous region . the number of persons living with diabetes will increase substantially in each asian country over the next few decades . china is the world 's largest developing economy and the most populous country , with one - fifth of the global population . due to the rapid westernization of diet and lifestyle , the total number of people with diabetes in china is projected to increase from 20.8 million in 2000 to 42.3 million in 2030 . diabetes and its complications also result in significant economic burden among individuals , families , and health care systems . according to who estimates , china will lose $ 558 billion of its national income to heart disease , stroke , and diabetes from 2006 to 2015 . therefore , there is an urgent need to reduce the future diabetes burden by providing adequate financial resources and structures of health care delivery in china , particularly within the context of continued rapid urbanization . diabetes can affect many organ systems throughout the body ( e.g. , nervous system , renal system , and eyes ) and can lead to serious complications over time [ 14 , 15 ] . recently , a meta - analysis confirmed that individuals with diabetes mellitus have an approximately 2-fold higher risk of large - vessel disease , such as coronary heart disease ( chd ) and stroke , and nonvascular mortality . thus , control of the growing prevalence of diabetes mellitus has been widely promoted in order to reduce the risk of large - vessel disease . the pharmacological treatment of diabetes mellitus and lifestyle modification have been shown to decrease the incidence of diabetes mellitus . however , it is very important to first determine the prevalence of diabetes mellitus in the general population , the levels of awareness , treatment , and control of diabetes mellitus . the key elements of effective control include an improvement in the awareness of diabetes mellitus among both health professionals and the general population . some studies [ 2123 ] have revealed that more than half of the individuals with diabetes mellitus were unaware of the condition . furthermore , the percentage of patients with diabetes mellitus who were treated and controlled to target levels was substantially low . moreover , knowing factors associated with the conditions should be useful for health services and public health action in terms of management and prevention . an improvement in the awareness , treatment , and control of diabetes is , therefore , essential for the management and reduction of its prevalence . recently , a systematic review on the prevalence of diabetes was published which included 22 cross - sectional studies . however , there was no information provided about the trends in the prevalence of diabetes and the awareness , treatment , and control of the disease . to date , there has been no systematic review or meta - analysis on the level of awareness , treatment , and control of diabetes in mainland china . thus , the purpose of the current paper was to perform a systematic review and meta - analysis of the published literature regarding the prevalence , awareness , treatment , and control of diabetes in mainland china . the objectives of our study were ( i ) to estimate the trends in prevalence , awareness , treatment , and control of diabetes from 1979 to 2012 in mainland china ; and ( ii ) to estimate the gender , location , and age distributions of patients with diabetes . this systematic review and meta - analysis could provide an overview of the epidemiology of diabetes in the past thirty years in china on the level above the provincial . pubmed , embase , chinese biomedical database ( cbm ) , cnki database , chinese wanfang database , and chongqing vip database were searched from the date of establishment up to february 2013 using the search terms chronic disease , metabolic syndrome , diabetes , diabetes mellitus , prevalence , epidemiology , awareness , treatment , control , cross - sectional survey , longitudinal study and china . all included studies were required to meet the following selection criteria : ( i ) cross - sectional or longitudinal studies that provided the prevalence , awareness , treatment , and control of diabetes in mainland china ; ( ii ) based on population samples rather than volunteers ; and ( iii ) the study population being representative of the provincial or national population . exclusion criteria were ( 1 ) reviews , editorials , letters , commentaries , or reports ; ( 2 ) articles repeating data from other articles that were already included ; ( 3 ) self - reporting data ; and ( 4 ) studies based on special populations , that is , physical examination crowds , industry , or occupational groups , ethnicity , or age groups . we contacted the authors of eligible studies to request further or missing information if needed for subsequent analysis . data regarding the first author , year of publication , study location , survey date , age range , sampling method , location ( urban / rural ) , diagnostic criteria , diagnosis method , total sample size , total case size , gender distribution , age distribution , and prevalence , awareness , treatment , and control of the diabetes were extracted wherever available . an awareness of dm was considered a self - reported previous diagnosis of dm by a physician or other healthcare practitioner among participants with dm . treatment of dm was determined as self - reported if taking oral hypoglycemic medications , using insulin , or other nonpharmacological treatments for the management of high glucose levels . the management of fasting plasma glucose ( fpg ) at levels lower than 7.0 rnmol / l ( 126 mg / dl ) in patients of dm in treatment was defined as control of dm . stata software version 11.1 ( stata , college station , tx , usa ) and review manager ( revman ) version 5.1 were used to calculate the pooled prevalence , awareness , treatment , and control of diabetes from all of the eligible studies . a summary of the prevalence , awareness , treatment , and control estimates was obtained using random - effects meta - analysis . we identified 45,947 references through electronic searches of pubmed ( n = 3,541 ) , embase ( n = 4,013 ) , chinese biomedical database ( cbm ) ( n = 9,547 ) , china national infrastructure database ( cnki ) ( n = 8,189 ) , chinese wanfang database ( n = 9,165 ) , and chongqing vip database after excluding duplicates and following examination of titles , abstracts , and full texts , 172 potentially eligible studies were identified . in addition , with a manual search of references , two more studies [ 27 , 28 ] were obtained from the papers . 57 included repetitive data , 54 studies were researched in specific populations , and 7 studies were self - reports of diabetes prevalence . therefore , we obtained 56 studies in total that were suitable for inclusion in our study [ 2123 , 2779 ] . among the included studies , one study contained survey data for two periods , with the data for 2002 - 2003 being duplicated in another study . we summarized the characteristics of the 56 included studies which contained 7 nationwide studies and 49 provincial studies conducted in the general chinese population . among the included studies , there were 56 concerning the prevalence of diabetes , 10 regarding the awareness of diabetes , 8 involving the treatment of diabetes , and 8 regarding the control of diabetes . a total population of 2,058,243 individuals was investigated , and 120,992 patients with diabetes were detected . the 56 studies were conducted among all of the provinces of mainland china , and included 22 provinces , 4 municipalities , and 5 autonomous regions . four studies were conducted among all ages , with the age of participants in 9 studies being greater than 30 years old ; 3 studies did not provide information regarding the age range investigated . the sampling methods applied in the studies included random sampling , stratified sampling , cluster sampling , multistage - stratified sampling , or combinations of these and general surveys . in terms of diagnostic criteria for diabetes , 7 studies used the american diabetes association criteria ( ada ) from 1997 or 2009 , 31 studies used the criteria of the world health organization ( who ) from 1985 , 1988 , 1995 , or 1999 , one study used the international diabetes federation criteria ( idf ) from 2005 , and one study was performed according to the criteria outlined in the lanzhou conference on diabetes in china ; however , 12 studies did not provide clear information on the diagnostic criteria employed . eighteen studies used fasting plasma glucose ( fpg ) and oral glucose tolerance tests ( ogtt ) as the methods of diagnosis , 17 studies used fpg alone , 13 studies used ogtt , and one study used fpg , ogtt , and urine glucose tests . the prevalence of diabetes in 56 studies varied from 0.61% to 20.85% . levels of awareness , treatment , and control ranged from 28.50 to 62.54% , 17.72 to 92.50% , and 6.86 to 35.87% , respectively ( table 1 ) . as shown in table 2 , the overall prevalence of diabetes was 6.41% ( 95%ci : 5.507.33 ) . table 2 and figure 1(a ) illustrate the trend in the overall prevalence of diabetes in mainland china from 1979 to 2012 , showing that it increased as time progressed . the lowest prevalence of 0.81% was found in 1979 initially and showed a stable increase until 2001 . after a slight decrease , the prevalence increased quickly from 2002 to 2009 ( with the highest prevalence of 15.60% in 2009 ) , before decreasing rapidly again from 2009 to 2012 . the prevalence of diabetes in males was 6.91% ( 95%ci = 5.728.09 ) , and the prevalence in females was 6.43% ( 95%ci = 5.127.74 ) ; there was no significant difference in the prevalence of diabetes between males and females ( or = 1.07 , 95%ci = 0.981.16 ) . overall , trends in the prevalence of diabetes between males and females were increased and similar to the overall trend for the prevalence of diabetes ; no significant differences could be observed between males and females ( figure 1(b ) ) . the prevalence of diabetes in urban and rural areas was 7.82% ( 95%ci = 5.939.72 ) and 6.26% ( 95%ci = 4.258.27 ) , respectively . a statistically significant difference could be found in the prevalence of diabetes between urban and rural areas ( or = 1.61 , 95%ci = 1.252.06 ) . as shown in figure 1(c ) , trends in the prevalence of diabetes in both urban and rural areas increased over time , and the prevalence of diabetes in urban areas was consistently higher than that in rural areas . the prevalence of diabetes in the groups aged less than 39 , 4059 , and over 60 was 1.98% , 6.96% , and 13.24% , respectively . table 2 and figure 1(d ) show the information and trends in the prevalence of diabetes by age . an increasing tendency could be observed in all age groups over time . also , the prevalence of diabetes increased with age ( figure 1(d ) ) . however , no obvious increasing trend could be observed in awareness of diabetes from 1998 to 2012 ( figure 2(a ) ) . overall , the rate of awareness of diabetes in males was 40.86% and was 41.58% for females . no significant difference could be found in the awareness of diabetes between males and females ( or = 0.99 , 95%ci = 0.871.13 ) ( table 3 ) . the awareness rate in urban areas was 44.25% ( 95%ci = 32.655.9 ) , while it was 34.27% ( 95%ci = 2147.54 ) in rural locations ( table 3 ) . the combined result for the treatment rate of diabetes was 42.54% ( 95%ci = 13.6971.38 ) ( table 3 ) . as shown in figure 2(b ) , an increasing tendency in the treatment of diabetes could be observed from 2001 to 2005 . however , it decreased quickly after 2008 and then rapidly increased again from 2010 to 2011 . the treatment rate of diabetes in males was 38.48% , whereas it was 41.18% for females . comparing the treatment rate of diabetes for males to that of females , no significant difference could be observed ( or = 0.9 , 95%ci = 0.721.14 ) ( table 3 ) . the treatment rates in urban and rural areas were 50.18% ( 95%ci = 31.22100.39% ) and 45.42% ( 95%ci = 12.7% and 103.6% ) , respectively ( table 3 ) . comparing the treatment rate of diabetes between rural and urban areas , there was no significant difference ( or = 1.30 , 95%ci = 0.772.20 ) . the pooled control rate was 20.87% ( 95%ci = 10.7630.97 ) for diabetes from the combined information of eight studies ( table 3 ) . there was an increasing tendency in the control of diabetes from 2001 to 2008 , whereas the trend of control from 2008 to 2011 was similar to that of the treatment ( figure 2(b ) ) . overall , the control rate of diabetes in males was 19.26% and was 19.03% for females . there was no significant difference between males and females ( or = 1.06 , 95%ci = 0.981.15 ) ( table 3 ) . the control rate of diabetes in urban areas was 16.7% ( 95%ci = 2.3935.8% ) and 18.59% ( 95%ci = 1.238.39 ) in rural locations . no significant differences were found between urban and rural populations ( or = 18.59 , 95%ci = 1.2038.39 ) ( table 3 ) . due to the rapid development of the economy in china , the dietary habits and lifestyles of individuals have changed remarkably , which might have contributed to the increase in many chronic diseases such as diabetes [ 11 , 80 ] . overall , the results of our study showed that the prevalence , awareness , treatment , and control of diabetes in mainland china were 6.41% , 45.81% , 42.54% , and 20.87% , respectively . a higher prevalence of diabetes was found in urban areas than in rural locations . as for the awareness of diabetes , this was also higher among residents in urban than in rural areas . there were no significant differences when data were stratified by gender or location in the subgroup analysis with regard to the treatment and control of diabetes . to the best of our knowledge , our study is the first systematic review on the awareness , treatment , and control of the diabetes and covers the longest time period from 1979 to 2012 in mainland china on the level of survey above the provincial . the diabetes prevalence in our study ranged from 0.61% to 20.85% with an average of 6.41% ; however , many authors have shown different findings when studying other countries in asia . similar to our results , it was reported that the prevalence of diabetes in indonesia is 5.7% . in contrast , a survey conducted in vietnam indicated a prevalence of 1.4% to 2.5% , which is relatively lower than that of our study . on the contrary , epidemiological data from thailand and japan show that diabetes prevalence estimates were approximately 11.9% and 10% , which were higher than our study [ 82 , 83 ] . the wide variation in the prevalence could be explained by the heterogeneity of the studies , geographical differences , and the application of different diagnostic and sampling methods . according to the statistics of the idf , nationwide epidemiological surveys of diabetes were conducted in china and the prevalence showed a 5-fold increase [ 27 , 32 , 8587 ] . in accordance with this , an increasing trend in the prevalence of diabetes was found in our study . however , limited studies were included for pooled prevalence estimates ; therefore , more studies with high quality and larger sample sizes are required to further confirm our findings . as to the prevalence by gender , no significant difference could be found in our study between males and females , which is similar to the results of most studies according to the international diabetes federation ( idf ) . however , the study reported by yang et al . in 2010 showed a difference in the prevalence of diabetes between males and females . this might partly be explained by the fact that men are more accustomed to unhealthy diets due to their work and also smoke more frequently than women , which are the main risk factors for diabetes . moreover , men are much more careless with regard to their health . however , further studies are required to confirm our findings . in the analysis stratified by location , the prevalence of diabetes in urban areas was higher than in rural locations , with an odds ratio of 1.61 for residents in urban and rural areas , which suggests that residents in urban areas were more likely to suffer from diabetes than those in rural regions . in accordance with our findings , many studies worldwide have also reported a higher prevalence of diabetes in urban areas than in rural populations [ 32 , 86 , 88 ] . with the rapid development of the economy urbanization is related to the change in the food supply and lifestyles which could lead to an unhealthy diet , sedentary habits , and overnutrition [ 72 , 90 ] . the prevalence of overweight and obesity has increased over the past two decades , especially in urban areas and high - income groups , which are the risk factors for diet - related disease and contribute to the development of diabetes . it was reported that the prevalence of diabetes increased with age [ 85 , 86 ] . a nationwide epidemiology survey showed that prevalence of diabetes in the age group of 2039 was 1.01% , while it reached 6.31% in the age group over 40 ; however , the highest prevalence of 11.34% could be found in the age group over 60 . results of our study further confirm these findings . with the largest population in the world , china has become an ageing country ; therefore , the prevalence of diabetes will increase as a result of the aging population in china . ten studies provided information on the awareness of diabetes . among the included study subjects , 45.81% were aware of having diabetes . from 1998 to 2011 , there was no obvious improvement in the awareness rate of diabetes . however , we report a difference between the urban and rural areas when conducting stratified analysis by location . this difference in awareness may be a result of a lack of access to health care and knowledge in rural areas . increasing the awareness through health education remains an effective method for the prevention and treatment of diabetes . among the participants who had diabetes in our study , 42.54% of them were undergoing treatment this is high compared with the study which first reported the treatment rate of diabetes ( 27.2% ) in china . the results of our study also showed an increasing trend in the treatment rate of diabetes from 2001 to 2011 . convenient , economic , and effective detection tools could improve the treatment rate of this disease . it was reported that controlling blood glucose at a normal level can prevent many diabetes - related complications , such as retinopathy , nephropathy , neuropathy , and macroangiopathy . the control rate of diabetes in our study is 20.87% , which is higher than that reported from a previous study with a control rate of 9.7% , but lower than that identified in another study ( 40.3% ) . the control of diabetes can be influenced by many factors , for example , obesity , smoking , insufficient exercise , and genetic susceptibility . moreover , adjusting dietary habits , changing lifestyles , and giving up smoking are essential when taking the risk factors for diabetes into account . coory stated that it was very difficult to avoid heterogeneity in a meta - analysis , and this is also true for the meta - analysis of data from epidemiologic studies due to methodological problems . there were several methodological problems that might help to explain the heterogeneity : ( 1 ) different degrees of urbanization and socioeconomic conditions existed ; ( 2 ) the included studies were carried out in different cities at various time points ; ( 3 ) large differences existed in the age range , sampling methods , sample sizes , and response rates ; ( 4 ) different diagnostic criteria and diagnosis methods were used in studies , with other studies not mentioning them at all ; and ( 5 ) not all of the included studies provided sufficient information on gender , location , and age for subgroup analysis . there are some limitations of the current study which need to be highlighted . firstly , the present study might have underestimated the true prevalence of diabetes , since some of the studies included in the present review only used fasting plasma glucose ( fpg ) levels to diagnose new cases of diabetes ; also , some studies did not provide any information about the diagnostic methods . thus , more accurate measurements in the detection of undiagnosed diabetes are necessary in future research , for example , the two - hour glucose tolerance test and the oral glucose tolerance test ( ogtt ) . secondly , in addition to the subgroups of gender , location , and age , we did not report any positive risk factors associated with the prevalence of diabetes and the awareness , treatment , and control of the diabetes ( e.g. , overweight , obesity , hypertension , and hyperlipidemia ) ; thus , we were unable to assess the association between them . the age distribution in the sample population could markedly affect the results , since some locations contain a large number of individuals > 40 years old ; therefore , the prevalence of diabetes in some studies is likely to be higher than in others . fourthly , limited studies were included in our meta - analysis for the pooled estimates ; for example , only one study was included for analysis in 2009 and 2012 as studies from that time are possibly yet to be published . this could also be seen with regard to the trends in awareness of diabetes in 2001 and in the treatment and control of diabetes in 2011 . a further limitation of the present study is that information in the subgroup analysis of awareness , control , and treatment by gender , location , and age was limited ; therefore , we did not perform the relevant trend analyses . the study showed an increasing trend for the prevalence , treatment , and control of diabetes among the population of mainland china from 1979 to 2012 , but not in the awareness . this review will help us understand the gaps in the current research , which is useful for investigators and health care providers regarding aboriginal health . thus , urgent measures are needed to prevent the high prevalence of diabetes and to improve diabetes awareness , control , and treatment among the chinese populations .

diabetes mellitus ( dm ) is one of the primary causes of premature death and disability worldwide . we performed a systematic review and meta - analysis of the published literature regarding the trends in prevalence , awareness , treatment , and control of diabetes mellitus in mainland china . pubmed , embase , chinese biomedical database , china national infrastructure database , chinese wan fang database , and chongqing vip database were searched . fifty - six eligible studies were included . increasing trends in the prevalence , treatment , and control of diabetes in mainland china from 1979 to 2012 were observed . the pooled prevalence , awareness , treatment , and control of diabetes mellitus were 6.41% , 45.81% , 42.54% , and 20.87% , respectively . a higher prevalence of diabetes mellitus was found in urban ( 7.48% , 95%ci = 5.45~9.50 ) than rural ( 6.53% , 95%ci = 4.30~8.76 ) areas . furthermore , an increasing chronological tendency was shown in different subgroups of age with regard to the prevalence of diabetes . a higher awareness of dm was found in urban ( 44.25% , 95%ci = 32.60~55.90 ) than rural ( 34.27% , 95%ci = 21.00~47.54 ) populations , and no significant differences were found in the treatment , and control of diabetes among the subgroups stratified by gender and location . from 1979 to 2012 , the prevalence , treatment , and control of diabetes mellitus increased ; nevertheless , there was no obvious improvement in the awareness of diabetes .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

focal segmental glomerulosclerosis ( fsgs ) is a clinicopathologic entity responsible for up to 20% of all cases of end - stage kidney disease in the united states . the incidence of fsgs is estimated at 7 per million individuals annually , has a slight male predominance ( male : female ratio 1.52 ) , and now represents the leading cause of idiopathic nephrotic syndrome in adults . although the pathogenesis of fsgs has not yet been fully described , the lesions that are induced include tuft collapse , segmental hyalinosis , and effacement of foot processes as revealed by electron microscopy . fsgs may also occur secondarily to certain genetic predispositions as well as disorders such as sickle cell disease , hiv nephropathy , and obesity ; in these instances , plasma exchange would not be considered a primary therapeutic option and treatment would instead be directed at the underlying driver . clinically , patients with fsgs manifest significant , nephrotic - range proteinuria , reduced renal function , and hypertension . eighty percent of fsgs cases are characterized as primary and are suspected to be caused by a circulating fsgs permeability factor , a low - molecular weight anionic protein . this same factor may be responsible for the recurrence of fsgs in the renal allograft , a scenario that occurs in approximately 2050% of primary allografts , most commonly within the first 3 months following transplant [ 4 , 5 ] . plasmapheresis removal of this factor appears to effectively treat many such cases [ 6 , 7 ] . recurrent fsgs can be suspected in patients who develop impaired graft function and significant proteinuria , defined as > 1 g/24 h in the posttransplant period . in many cases early recognition is therefore critical in properly diagnosing and managing this disorder . if recurrent fsgs is suspected ( even in the absence of a pretransplant history of fsgs ) then it is important to inform the pathology department of this suspicion so that biopsy specimens can be properly processed for electron microscopy , which is needed to evaluate for the foot process effacement characteristic of fsgs . the american society for apheresis guidelines designate recurrent fsgs in the renal allograft as a category i indication for therapeutic plasma exchange ( grade 1b , strong recommendation ) . we present two patients who developed recurrences of fsgs in their primary renal allografts treated with plasmapheresis and intravenous immune globulin ( ivig ) . a 39-year - old hispanic male with a history of end - stage renal disease ( esrd ) , hypertension and hypertrophic cardiomyopathy underwent deceased donor renal transplantation with thymoglobulin induction and standard steroid taper . he developed poor graft function and nephrotic - range proteinuria beginning on posttransplant day 1 . he required posttransplant hemodialysis on posttransplant days 3 , 6 , 8 , and 11 , as well as initiation of therapeutic plasma exchange and ivig on postoperative day 5 . renal transplant biopsies obtained on posttransplant day 7 confirmed the team 's suspicion for fsgs recurrence in the renal allograft . the patient is currently 4 years posttransplant and continues to demonstrate excellent renal allograft function ( serum creatinine of 1.6 ) with continued absence of proteinuria . a 37-year - old asian male with esrd due to primary fsgs underwent living unrelated renal transplantation performed with thymoglobulin induction followed by standard steroid taper . on posttransplant day 3 , significant proteinuria and a rise in serum creatinine developed . therapeutic plasma exchange was initiated on posttransplant day 4 and continued forward as noted in figure 3 . the patient also received a single dose of rituximab as well as ivig as treatment for his recurrent fsgs . a kidney biopsy on posttransplant day 8 was negative for rejection , but demonstrated typical foot process effacement changes consistent with fsgs recurrent in the renal allograft . following an initial complete response to therapeutic plasma exchange by posttransplant day 78 , a repeat allograft biopsy was obtained , which demonstrated improvement in the degree of foot process effacement and no evidence for rejection . the second bout of allograft dysfunction was ultimately discovered to be due to interval development of high - grade stenosis in the allograft ureter leading to a postobstructive nephropathy . as of posttransplant day 317 , blood urea nitrogen and creatinine ( both as mg / dl ) are 13 and 1.3 , respectively , and there is continued absence of proteinuria . we describe two cases of fsgs recurrent in the primary allografts successfully treated with therapeutic plasma exchange . in both cases , remission was associated with resolution of proteinuria and histologic improvement in the degree of foot process effacement on electron microscopy . , 10/11 patients resulted in a persistent reduction in 24-hour urine protein following 511 ( mean of 6 ) therapeutic plasma exchange procedures in conjunction with immunosuppressant medications . in another study , patients with recurrent fsgs not managed with plasma exchange were used as historic controls and were compared to 13 patients treated with plasma exchange . while persistent proteinuria contributed to graft loss in all untreated controls , 11/13 ( 85% ) patients treated with plasma exchange achieved either complete or partial remission . in another report , three of five patients with early recognition of recurrent fsgs treated with plasma exchange responded well , resulting in the reversal of foot process effacement and remission of proteinuria . among 14 pediatric patients with fsgs recurrent in the renal allograft , 9 were treated with 10 cycles of plasma exchange ( 3 cycles per week , the same regimen as ours ) with 5/9 ( 55.5% ) and 1/9 ( 12% ) achieving complete and partial remissions , respectively ; no remissions were observed among the 5 patients not treated with plasma exchange . in a treatment series of fsgs recurrent in the renal allograft , alachkar and colleagues noted a complete response rate in 9/25 ( 36% ) and partial response in 10/25 ( 25% ) of patients treated with combinations of plasmapheresis and rituximab . interestingly , levels of soluble urokinase - type plasminogen activator ( supar ) a prospective permeability factor elevated in up to two thirds of those with primary fsgs were found to correlate both with recurrence and response [ 11 , 12 ] . supar , however , is not specific for fsgs and has shown to be elevated in immune activation states , such as sepsis , hiv infection , and paroxysmal nocturnal hemoglobinuria , among others . furthermore , supar rebounds quickly following plasma exchange , and clinical response associated with plasma exchange treatment occurred despite sustained reductions in supar levels . . showed no improvement in proteinuria upon addition of rituximab to chronic plasma exchange therapy in three retransplanted patients with recurrent fsgs . in contrast , kumar and colleagues , upon retrospective review , identified complete responses [ defined as reduction in urine protein : creatinine ( pr : cr ) ratio to < 0.2 ] and partial responses ( defined as decrease in urine pr : cr ratio by 50% and < 2.0 ) among 2/8 and 4/8 pediatric patients with recurrent fsgs . there have also been cases of responses to rituximab after incomplete or absent response to plasma exchange [ 18 , 19 , 20 ] . the precise mechanism of rituximab , a monoclonal antibody directed against cd20 , merits further research . a cd20-independent mechanism was studied by fornoni and colleagues , who described marked disruption of the actin cytoskeleton of podocytes exposed to fsgs sera . rituximab , through binding and preservation of sphingomyelin - related enzymes ( sphingomyelin phosphodiesterase acid like 3b - smpdl-3b ; acid sphingomyelinase ) , partially prevented the cytoskeletal damage incited by fsgs sera , thus protecting the podocyte filtration barrier and preserving function . this mechanism was corroborated by takahashi and colleagues , who demonstrated that rituximab , but not purified igg , significantly reduced proteinuria in an adriamycin - induced nephropathy rat model . this appears to be related to binding of rituximab to glomerular smpdl-3b and protection of podocyte - related proteins , nephrin and podocin . although precise mechanisms require further research to elucidate , the authors provide a theory that smpdl-3b is a key factor in the actin - cytoskeleton remodeling process within podocytes and that rituximab binding to smpdl-3b provides a salutary effect . evidence appears to support a similar protective action of cyclosporine a on podocytes , which blocks calcineurin - mediated desphosphorylation of synaptopodin , thus preserving cytoskeleton stability and preventing foot process effacement . there is also evidence of reduction in proteinuria with higher - dose intravenous ( but not standard - dose oral ) cyclosporine . inhibition of the renin - angiotensin system ( ras ) also has an antiproteinuric effect in recurrent fsgs patients . in one report , authors used triple ras suppression with angiotensin - converting enzyme inhibitor , angiotensin receptor blocker , and aliskiren , a direct renin inhibitor . their patient was treated with a combination of rituximab and plasma exchange , and the sequential triple ras inhibition by the latest addition of aliskiren led to a significant reduction in recalcitrant proteinuria . in a study by gohh et al . , preemptive plasma exchange treatment was explored as a means of reducing posttransplant fsgs recurrence in ten patients considered at high risk for recurrence ( esrd within 3 years of fsgs diagnosis or advanced azotemia at presentation or prior allograft loss due to recurrent fsgs ) . at a mean of 751 314 days three patients , each of whom had already manifested previous graft loss due to recurrent fsgs , developed biopsy - proven recurrence in the allograft . two of these patients returned to dialysis ; the third remained nephrotic with a creatinine of 2.6 mg / dl at the time of publication . park and colleagues , in an observational cohort study , found no difference in fsgs recurrence rates whether adult kidney transplant patients received pretransplant plasma exchange ( 1/4 , 25% ) , pretransplant plasma exchange plus rituximab ( 1/5 , 20% ) or no pretreatment ( 5/18 , 27.7% ) . in the pediatric population , gonzalez and colleagues found absent protective effect of pretransplant plasma exchange with recurrence rates of 47 and 63% , respectively , for living and deceased donor first - time kidney transplantation . however , preemptive treatment did lead to a lower than expected rate of recurrence among patients undergoing transplant who had previously lost a graft due to recurrence . among those with recurrences , plasma exchange was highly effective as a treatment modality with 88% complete or partial remission rate . in patients referred for renal transplantation , a vague diagnosis of hypertensive nephrosclerosis particularly in younger patients raises concern for the absence of a clearly defined etiology for primary renal failure . in some cases , a primary disorder such as fsgs may have been causative . this is of particular concern considering the high risk of recurrence of primary fsgs in the renal allograft . fsgs recurrent in the renal allograft can be diagnosed on electronic microscopy in proteinuric patients . the prompt institution of therapeutic plasma exchange is an important treatment modality , and rituximab may be added to this as adjunctive therapy . further research is required regarding the role of rituximab therapy either as a therapeutic modality in established fsgs recurrence or possibly as pretransplant prophylaxis to reduce the risk of recurrence . monitoring of treatment response to ongoing plasmapheresis treatment is accomplished through measurement of urine spot pr : cr ratios and serum creatinine . in responding patients , treatment should be continued until proteinuria has been reliably suppressed to below 0.5 g / day . was in part supported by grants from nih - ncrr ul1 tr000153 , kl2 tr000147 , and the juvenile diabetes research foundation international 17 - 2011 - 609 .

focal segmental glomerulosclerosis ( fsgs ) causes glomerular lesions that can progress to end - stage renal disease . it is suspected to be caused by a circulating factor that is amenable to plasmapheresis removal and exhibits a risk for recurrence in the renal allograft . we present two patients with fsgs recurrence in their allograft kidneys diagnosed by biopsy after significant proteinuria developed in the posttransplant setting . treatment with therapeutic plasma exchange induced long - term remission in both patients . spot urine protein : creatinine ratios were monitored and treatment was continued until a target of < 0.5 was achieved . in patient number two , a second peak in proteinuria and azotemia was ultimately attributable to ureteral stenosis and these values normalized following repair . in conclusion , therapeutic plasma exchange is an effective treatment for fsgs recurring following renal transplant .

Introduction Case 1 Case 2 Discussion Conclusion Statement of Ethics Disclosure Statement

key goals of health systems are to improve the health of the population and to do so in an equitable way . although the health of the population to a large extent is influenced by broader improvements in living conditions , well - functioning health care systems also contribute to the health of populations . however , their ability to do so varies and there is increasing interest in measuring their performance ; the introduction and diffusion of medical innovations should be an important part of this process . there have long been concerns about the delay in introducing innovative drugs in different countries , . for instance , this has been reported to have been somewhat delayed in the united states , sweden and italy when compared with united kingdom , west germany and france , . however , given the relative ease in obtaining data on year of registration , delays in the registration process have been the main focus of debate about international variation in the timing of introduction of innovative drugs , even though other health system factors have also been identified , . in the european union ( eu ) however , for a drug to impact on the health of the population , it must also be used in clinical practice . for instance , pharmaceuticals may have been used in clinical trials before registration year ( which may have a considerable impact if trials are relatively large and the condition is rare ) , or there may have been a delay after the registration year before the drug is widely adopted . the theory of diffusion of innovations envisages cumulative adoption following an s - shaped curve , with rogers describing diffusion of innovations as the process through which an innovation is communicated through certain channels over time among the members of a social system . ( 1 ) innovators , about 2.5% of the population. they are not opinion leaders , but prone to novelty and with little to lose . ( 2 ) thereafter come : ( 3 ) early majority , who tend to rely heavily on the early adopters and ( 4 ) the late majority , which relies in turn on the early majority . they are considered more conservative and will not adopt an innovation until it is standard practice . finally , ( 5 ) the laggards , ( or traditionalists ) , wedded to the old ways , are critical of new ideas and will only accept them once the new idea has become mainstream or even tradition . commonly , these are descriptive studies showing the variation in the time of introduction of new innovations . other studies analyse factors that could explain the process of diffusion . furthermore , there has been concerns about inequity in medical care related to variations in the diffusion of innovation to different population groups such as racial and ethnic disparities 1215 as well as gender , age and social differences , . these studies have used a variety of empirical data such as health administrative data , , medical records or questionnaires to or interviews with key informants 2325 . for pharmaceuticals , official data on registration as well as sales and prescribing statistics of pharmaceuticals , , applying the theory of diffusion to the introduction of new pharmaceuticals implies the need to obtain empirical data showing when the innovators and early adaptors started to use the new treatment . however , where our goal is to identify when an innovation might be expected to improve the health of the population , we will need data also on the diffusion of the innovation . this study is part of the amiehs project ( avoidable mortality in the european union : towards better indicators for the effectiveness of health systems ) , which seeks to develop indicators of the effectiveness of health systems . mortality for specific causes of death that are considered amenable to medical care is increasingly used as an indicator of the quality of health care . high death rates from these causes , collectively termed avoidable or amenable mortality , have been suggested to motivate further investigations of the quality of health care . there is now extensive experience in their use in different countries , health administrative areas , socioeconomic and ethnic groups and with respect to gender , . several studies have shown that mortality from these causes have decreased more rapidly than total mortality in several industrialized countries 3032 . for some avoidable causes of death , mortality has also been found to decline faster after the introduction of innovations in health care , such as improved management of hypertension , leading to lower mortality from cerebrovascular disease and screening to prevent deaths from cervical cancer . however , to assess the effectiveness of health care at a population level , a precise measure of the timing of the introduction of innovations is necessary in order to evaluate whether they have impacted on the health of the population . the objective of this paper is to analyse the variation in the introduction of specific pharmaceutical innovations that may influence the mortality outcome among seven european countries for comparison applying both official registration data and indicators of the start of the diffusion of the innovative drugs . key goals of health systems are to improve the health of the population and to do so in an equitable way . although the health of the population to a large extent is influenced by broader improvements in living conditions , well - functioning health care systems also contribute to the health of populations . however , their ability to do so varies and there is increasing interest in measuring their performance ; the introduction and diffusion of medical innovations should be an important part of this process . there have long been concerns about the delay in introducing innovative drugs in different countries , . for instance , this has been reported to have been somewhat delayed in the united states , sweden and italy when compared with united kingdom , west germany and france , . however , given the relative ease in obtaining data on year of registration , delays in the registration process have been the main focus of debate about international variation in the timing of introduction of innovative drugs , even though other health system factors have also been identified , . in the european union ( eu ) however , for a drug to impact on the health of the population , it must also be used in clinical practice . for instance , pharmaceuticals may have been used in clinical trials before registration year ( which may have a considerable impact if trials are relatively large and the condition is rare ) , or there may have been a delay after the registration year before the drug is widely adopted . the theory of diffusion of innovations envisages cumulative adoption following an s - shaped curve , with rogers describing diffusion of innovations as the process through which an innovation is communicated through certain channels over time among the members of a social system . ( 1 ) innovators , about 2.5% of the population. they are not opinion leaders , but prone to novelty and with little to lose . ( 2 ) thereafter come : ( 3 ) early majority , who tend to rely heavily on the early adopters and ( 4 ) the late majority , which relies in turn on the early majority . they are considered more conservative and will not adopt an innovation until it is standard practice . finally , ( 5 ) the laggards , ( or traditionalists ) , wedded to the old ways , are critical of new ideas and will only accept them once the new idea has become mainstream or even tradition . commonly , these are descriptive studies showing the variation in the time of introduction of new innovations . other studies analyse factors that could explain the process of diffusion . furthermore , there has been concerns about inequity in medical care related to variations in the diffusion of innovation to different population groups such as racial and ethnic disparities 1215 as well as gender , age and social differences , . these studies have used a variety of empirical data such as health administrative data , , medical records or questionnaires to or interviews with key informants 2325 . for pharmaceuticals , official data on registration as well as sales and prescribing statistics of pharmaceuticals , , applying the theory of diffusion to the introduction of new pharmaceuticals implies the need to obtain empirical data showing when the innovators and early adaptors started to use the new treatment . however , where our goal is to identify when an innovation might be expected to improve the health of the population , we will need data also on the diffusion of the innovation . this study is part of the amiehs project ( avoidable mortality in the european union : towards better indicators for the effectiveness of health systems ) , which seeks to develop indicators of the effectiveness of health systems . mortality for specific causes of death that are considered amenable to medical care is increasingly used as an indicator of the quality of health care . high death rates from these causes , collectively termed avoidable or amenable mortality , have been suggested to motivate further investigations of the quality of health care . there is now extensive experience in their use in different countries , health administrative areas , socioeconomic and ethnic groups and with respect to gender , . several studies have shown that mortality from these causes have decreased more rapidly than total mortality in several industrialized countries 3032 . for some avoidable causes of death , mortality has also been found to decline faster after the introduction of innovations in health care , such as improved management of hypertension , leading to lower mortality from cerebrovascular disease and screening to prevent deaths from cervical cancer . however , to assess the effectiveness of health care at a population level , a precise measure of the timing of the introduction of innovations is necessary in order to evaluate whether they have impacted on the health of the population . the objective of this paper is to analyse the variation in the introduction of specific pharmaceutical innovations that may influence the mortality outcome among seven european countries for comparison applying both official registration data and indicators of the start of the diffusion of the innovative drugs . these were selected on the basis of their effectiveness , as demonstrated in clinical trials , in reducing specific causes of death , where those causes were sufficiently common and where there had been an observed decline in mortality in recent decades , making it possible to undertake robust statistical testing for any association in another part of the project . interventions included in the analysis of timing of innovations cisplatin was introduced for the treatment of testicular cancer already in the 1970s and has been shown to improve outcome when included in combination therapy . the h2-receptor antagonist cimetidine was evaluated in clinical trials of peptic ulcer treatment in the late 1970s supporting evidence on the ulcer healing , . tamoxifen has been shown to reduce recurrences and mortality from breast cancer in several clinical trials . clinical trials have found oxalaplatin to be effective as a component of combination therapy for advanced colorectal cancer , . the antiretroviral drugs azidothymidine and zidovudine were shown to improve survival with aids in randomized clinical trials for these specific innovations , a questionnaire was developed and answered by the participating partners from the united kingdom , the netherlands , germany ( west germany ) , france , spain , estonia and sweden . information was sought on the first introduction of the innovation and the period of implementation . for the first part , documents on the official and organized introduction were asked for . these were for instance , the registration year for pharmaceuticals as well as the year of national programs and guidelines . to get information on the implementation of the interventions , data on scientific or committee reports evaluating the implementation were requested . for pharmaceuticals , this data was used to verify that the medicine has been available in the respective country and also to indicate the speed of the implementation . to facilitate comparisons between countries , statistics on daily defined doses ( ddd ) sales statistics were available from sweden ( 19772008 ; only from year of registration ) , estonia ( 19992008 ) , germany ( 19992008 ; hospital prescribing and privately insured patients were unavailable ) ) france ( 20022007 ) , united kingdom ( mainly 1999 ; hospital prescribing unavailable ) and spain ( 20002008 ; hospital prescribing unavailable ) . sales statistics measured by ddd was available for most of the period from sweden , estonia and germany only . articles registered in medline with any of the key words ( or words in title or abstract ) standards , guidelines , official policy , consensus development , evaluation studies or clinical trial in combination with the terms for the innovation and the country names were scrutinized for applicable information . the country representatives were asked to comment on the data found and to collect further data based on the information . the data from the questionnaire and literature review were combined in order to get several indicators of the diffusion process of the specific innovations in each country . we looked for both very early indicators of early adaptors introducing the method and indicators of a continued diffusion of the method and used specific criteria for defining the start of the diffusion criteria 1 : the first documented year of introduction of the pharmaceutical in a specific country was used to define the year of the start of diffusion . the start of first clinical trials or clinical studies , available sales statistics from the introduction period or evaluation reports describing the introduction of the pharmaceuticals were accepted as data on the start of the diffusion . if the starting year of the clinical trial was not mentioned , we used the year 3 years before the publication year as the indicator of the introduction . when no data was available , the year of registration was used . criteria 2 : in order to define the start of the diffusion , we also judged that data indicating a continued diffusion of the drug was needed . this was indicated by further clinical trials , evaluation reports , guidelines and sales statistics . we present in this article the references to the early indicators of the start of diffusion and to evaluation reports and guidelines indicating the further diffusion of the pharmaceuticals . the availability of sales statistics was presented above . when data was available , we analysed the year when the peak level of sales of the pharmaceutical occurred and the diffusion time from start of diffusion to this year . the variation in year of introduction among the countries was studied using both official data of year of registration and data on the start of the diffusion of the pharmaceuticals , respectively . the time lag between the first introduction in any of the countries and in the others was calculated . a mean score of the time lag including data on all the six pharmaceuticals was analysed for each country . with the exception of estonia , cisplatin was introduced for the treatment of testicular cancer in all countries in the 1970s or early 1980s ( table 2 ) . in estonia , it was delayed until the 1990s , when the country had achieved independence . in most countries , the introduction started with clinical trials or other clinical studies in the period 19761981 4347 , while registration was some years later , that is , between 1979 and 1983 . in several countries , cisplatin was registered for the treatment of cancers at several other sites so sales data could not be used to evaluate its diffusion as a treatment for testicular cancer . one study from the netherlands found that cisplatin was not in widespread use between 1970 and 1978 ( table 3 ) . in the united kingdom , the uk children 's cancer study group , followed up children with testicular cancer from 1979 to 1988 , during which period only about 7 % of patients received the drug . the year of the introduction of medical innovations measured by indications of the start of diffusion of innovations compared to the registration year for selected causes of death doi , indication of the start of the diffusion of innovation ; n.d . , no data available ; reg . , based on official data of registration . guidelines and evaluation reports indicating the continued diffusion of medical innovations cimetidine was introduced for the treatment of peptic ulcer in most countries in the late 1970s or early 1980s . in estonia however , the drug was first registered in 1993 . in germany and france , , clinical trials started a few years before the year of registration . in spain , the year of registration and first clinical trial coincided tamoxifen , used to treat breast cancer , was introduced in most countries in the late 1970s or early 1980s . however , in estonia , it was first available in the 1990s , where it was registered in 1992 . in germany , clinical trials were reported a few years before registration , and in sweden , the first reported clinical trials , coincided with registration . immunosuppressive treatment with cyclosporine following kidney transplantation was introduced in the 1980s in most countries with the exception of estonia where it was again delayed until the 1990s . in most countries , the year of registration and the start of the clinical trials were close in time . however , in germany , clinical trials were reported 11 years before the official registration . clinical trials were reported from united kingdom , , the netherlands , germany , spain and sweden . as with cisplatin , clinical trials of oxalaplatin started before registration ( which was usually at the end of the 1990s ) in several countries . the time lag varied between 4 years in the united kingdom and spain to 8 years in france . in some countries , the diffusion process can be assessed by consensus statements and guidelines . in the united kingdom , guidelines were published in 2002 , 7 years after the introduction oxalaplatin was recommended for patients with inoperable liver metastases to make them eligible for surgery . in germany , a 2000 consensus statement on treatment of colon cancer mentioned oxalaplatin as a promising new drug but not yet generally recommended . in sweden , oxalaplatin was recommended as one alternative in an evidence review from 2001 , that is , 13 years after the introduction . the antiretroviral drugs azidothymine or zidovudine were introduced in most countries between 1987 and 1995 . in the netherlands , the registration year coincided with the first reported clinical trial starting in 1987 . in the united kingdom , , germany , france , spain and sweden , clinical trials started a few years after the year of registration . their use was endorsed by clinical guidelines or recommendations in united kingdom , germany , spain and sweden . the guidelines were published between 7 and 17 years after the introduction in the respective country . as illustrated in table 4 , the variation among countries in the introduction of new drugs was largest for cisplatin , cimetidine and tamoxifen , all introduced first in the 1970s . for the most recent pharmaceuticals , the antiretroviral drugs and oxalaplatin , the variation was considerably less . some countries were consistently among the first to introduce new drugs , such as germany , france , sweden , united kingdom and the netherlands . introduction of modern drugs was delayed until after independence in estonia , while spain often introduced the drugs studied later than other countries . variation in the start of diffusion of medical innovations among countries based on country - specific year of introduction the delay since the first introduction was shortest for france , the netherlands and united kingdom ( table 5 ) , and longest for estonia . this was true both when the official year of registration and when other data on the start of the diffusion of innovation were used . when the start of diffusion was used the variation was greater and the ranking between the countries differed somewhat from what was found using the registration year . for instance , the delay in registration was shortest in the netherlands ( 1.3 years ) while the time lag until the start of diffusion was shortest in france ( 2.2 years ) . the sum * and mean scores of time lag in year of introduction after the corresponding year of introduction in the first of the countries for the six studied pharmaceuticals sum score , total lag compared with first country , six pharmaceuticals . n.a . , not applicable . for several innovations , the length of period of diffusion from introduction to the year when the peak level of use was reached was similar ( table 6 ) . for some pharmaceuticals cisplatin , cimetidine and cyclosporine a delay in peak level was found in estonia although when the time length for diffusion was similar . in these cases , the diffusion started later in estonia , but this seems however to have been compensated by a faster diffusion ( 11 years compared with about 20 years in the compared countries ) . for treatment with cisplatin , the early introduction in sweden was followed by a fast diffusion , which increased the variation among the countries further . for zidovudine , the diffusion seems to have been fast since the sales of the pharmaceutical peaked before or at the start of the period of available sales statistics in most countries , that is , around the late 1990s . the diffusion period * of selected medical innovations period between the year of the first indication of the start of diffusion ( as presented in table 2 ) and the year of the peak of sales level of the pharmaceutical in each country . several pharmaceuticals developed in the 1970s and 1980s were introduced about the same time in most countries with the exception for estonia , where cimetidine , cisplatin and cyclosporine were only introduced in the 1990s . this was true also for treatment of breast cancer with tamoxifen , although the variation was fairly large also among the other countries . for the drugs developed later , oxalaplatin and antiretroviral drugs , however , introduction was at about the same time in all countries , in the late 1980s or early 1990s . these results are consistent with the aspiration by the european countries to harmonize regulations with regards to medicines and other pharmaceutical products . the concept of the establishment of the multi state licensing procedure in 1975 was that pharmaceuticals that had been approved in one member country should be authorized in other countries . this procedure , which was not very successful at first , was replaced in 1987 by the concertation procedure , which in turn was replaced in 1995 by the european medicines evaluation agency . once estonia regained its independence , it became integrated with the global economy , especially since acceding to the eu in 2004 , and has seen sustained improvements in health care , . in general , innovative drugs were first introduced in the netherlands , the united kingdom and in france , whether assessed by date of registration or other indicators of when diffusion started . the process was generally delayed in spain , especially when indicators of when diffusion started were considered . the delay in sweden was somewhat larger when assessed by the start of diffusion than registration . importantly , these findings demonstrate that registration does not always coincide with uptake of drugs , even though most attention so far has been on the former , . thus , it is necessary to look at other characteristics of the health system to explain why some european citizens wait longer to receive innovative treatments than others , , especially given the success of harmonization of the registration process . of the more recently introduced pharmaceuticals ; oxalaplatin was first approved in france in 1996 , and approved throughout the eu through the mutual recognition procedure in 1999 , france being the reference member state . zidovudine was first approved in 1987 using national licenses , before the concertation procedure became mandatory for hiv / aids treatments . for these pharmaceuticals , the variation in timing in introduction was low among the countries , including estonia . for tamoxifen , there was a time lag in several countries between the registration of the drug and its use in clinical trials . at that time , several therapeutical strategies were being discussed and its role of tamoxifen seems not to have been clearly defined . scientific papers at that time argue that it had a limited role and called for more clinical trials , which started in most of the countries in this study in the late 1970s and 1980s . to define the start of the diffusion process , one needs empirical longitudinal data on the uptake of drugs , such as sales statistics . however , in most cases , these were only available for recent years when the drugs were already registered for some years . thus , sales statistics were mainly used to verify that the drug had diffused . instead , diffusion was often considered to have begun with the first clinical trials in each country , provided indicators of a continued diffusion were available . for tamoxifen and antiretroviral drugs , there may also have been less well documented use of the drug in some countries not captured by the search for clinical trials so the variation between countries should therefore be interpreted with caution . there were several indications of a continued diffusion of the different innovations . for several innovations , the length of period of diffusion seems to be similar among the countries according to sales statistics . for these pharmaceuticals , variations in use may instead reflect variation in the start of the diffusion among the countries . in most cases , there was a time lag of between 7 and 17 years from the introduction until guidelines were published . thus , the presence of clinical guidelines would not reflect an early phase of the diffusion of innovation promoted by innovators and early adaptors . a previous review have found that the mean compliance rate for guidelines was 54% 3 years after the publication . thus , it seems as if the publication of guidelines may reflect the phase when the innovation diffuses from the early majority to the late majority . this would be in line with the theory of diffusion of innovation , where the late majority is considered to be more conservative and will not adopt an innovation until it is standard practice . several modifiable reasons have been found for not using proven pharmaceutical interventions , including clinician , patient and system factors . thus , it may be possible to influence the implementation of a pharmaceutical innovation in order to limit the variation in introduction and diffusion . in order to establish a new medical drug in medical practice , its efficacy must be proved in clinical trials and the drug must be approved by the regulatory authorities based on data on efficacy and safety . efficacy refers to the potential of improving health of the patients under ideal conditions of use , which should be the case in clinical trials . the pharmaceuticals studied in this paper have all passed this phase of assessment and have been approved for use in medical practice . however , we must also consider that the effectiveness , defined as what is achieved under ordinary conditions , may vary . there may be variation in the uptake of pharmaceuticals and other medical interventions and the quality of care may differ . thus , the outcome of medical care may differ from what would be expected from the results of clinical trials . as pointed out by brook and lohr , there is need to integrate the concepts of efficacy , effectiveness , variations in population - based rates of use and quality of care when building models for policy , planning and evaluation of medical care . in order to assess the impact on populations health of a new medical drug , we have to be able to measure the timing of introduction of the new drug as well as the diffusion process . this information should then be linked to population outcome measures , in order to assess whether the new treatment has been effective in improving the health of the population . although the introduction of a new drug may be regarded as the date of registration , this paper has shown that the year when the drug was first used in medical care often differs from the official registration year . according to the theory of diffusion of innovations , the medical intervention may be introduced by innovators but in order to have a broader impact on populations health , there must also be a continued diffusion of the innovation . when applying this concept , we found that the registration year of the pharmaceuticals studied may differ from the year of introduction with a range between 11 years before and after the registration year . in assessing any impact on population health however , although we used a wide range of data in order to ascertain the introduction and diffusion of new innovations , our main finding is the need for harmonized data in eu countries . the lack of data on different phases of the diffusion process limited the possibilities to analyse the impact of introduction and diffusion of the new drugs . data on the diffusion of drugs and not simply the registration year should routinely be documented in a comparable way across the eu . this is most likely going to require prescribing data , which at present is inconsistent and only some elements are in the public domain . this should , ideally , include information on the indications for prescribing , although clearly , this will not be possible for some time , except where functioning patient information systems at a population level exist . it will also be important to use harmonized measures of the amount of drugs prescribed , such as the ddd . such improvements in the information on the introduction and diffusion of drugs would be a valuable tool in evaluating and planning health care . several pharmaceuticals developed in the 1970s and 1980s were introduced about the same time in most countries with the exception for estonia , where cimetidine , cisplatin and cyclosporine were only introduced in the 1990s . this was true also for treatment of breast cancer with tamoxifen , although the variation was fairly large also among the other countries . for the drugs developed later , oxalaplatin and antiretroviral drugs , however , introduction was at about the same time in all countries , in the late 1980s or early 1990s . these results are consistent with the aspiration by the european countries to harmonize regulations with regards to medicines and other pharmaceutical products . the concept of the establishment of the multi state licensing procedure in 1975 was that pharmaceuticals that had been approved in one member country should be authorized in other countries . this procedure , which was not very successful at first , was replaced in 1987 by the concertation procedure , which in turn was replaced in 1995 by the european medicines evaluation agency . once estonia regained its independence , it became integrated with the global economy , especially since acceding to the eu in 2004 , and has seen sustained improvements in health care , . in general , innovative drugs were first introduced in the netherlands , the united kingdom and in france , whether assessed by date of registration or other indicators of when diffusion started . the process was generally delayed in spain , especially when indicators of when diffusion started were considered . the delay in sweden was somewhat larger when assessed by the start of diffusion than registration . importantly , these findings demonstrate that registration does not always coincide with uptake of drugs , even though most attention so far has been on the former , . thus , it is necessary to look at other characteristics of the health system to explain why some european citizens wait longer to receive innovative treatments than others , , especially given the success of harmonization of the registration process . of the more recently introduced pharmaceuticals ; oxalaplatin was first approved in france in 1996 , and approved throughout the eu through the mutual recognition procedure in 1999 , france being the reference member state . zidovudine was first approved in 1987 using national licenses , before the concertation procedure became mandatory for hiv / aids treatments . for these pharmaceuticals , the variation in timing in introduction was low among the countries , including estonia . for tamoxifen , there was a time lag in several countries between the registration of the drug and its use in clinical trials . at that time , several therapeutical strategies were being discussed and its role of tamoxifen seems not to have been clearly defined . scientific papers at that time argue that it had a limited role and called for more clinical trials , which started in most of the countries in this study in the late 1970s and 1980s . to define the start of the diffusion process , one needs empirical longitudinal data on the uptake of drugs , such as sales statistics . however , in most cases , these were only available for recent years when the drugs were already registered for some years . thus , sales statistics were mainly used to verify that the drug had diffused . instead , diffusion was often considered to have begun with the first clinical trials in each country , provided indicators of a continued diffusion were available . for tamoxifen and antiretroviral drugs , there may also have been less well documented use of the drug in some countries not captured by the search for clinical trials so the variation between countries should therefore be interpreted with caution . there were several indications of a continued diffusion of the different innovations . for several innovations , the length of period of diffusion seems to be similar among the countries according to sales statistics . for these pharmaceuticals , variations in use may instead reflect variation in the start of the diffusion among the countries . in most cases , there was a time lag of between 7 and 17 years from the introduction until guidelines were published . thus , the presence of clinical guidelines would not reflect an early phase of the diffusion of innovation promoted by innovators and early adaptors . a previous review have found that the mean compliance rate for guidelines was 54% 3 years after the publication . thus , it seems as if the publication of guidelines may reflect the phase when the innovation diffuses from the early majority to the late majority . this would be in line with the theory of diffusion of innovation , where the late majority is considered to be more conservative and will not adopt an innovation until it is standard practice . several modifiable reasons have been found for not using proven pharmaceutical interventions , including clinician , patient and system factors . thus , it may be possible to influence the implementation of a pharmaceutical innovation in order to limit the variation in introduction and diffusion . in order to establish a new medical drug in medical practice , its efficacy must be proved in clinical trials and the drug must be approved by the regulatory authorities based on data on efficacy and safety . efficacy refers to the potential of improving health of the patients under ideal conditions of use , which should be the case in clinical trials . the pharmaceuticals studied in this paper have all passed this phase of assessment and have been approved for use in medical practice . however , we must also consider that the effectiveness , defined as what is achieved under ordinary conditions , may vary . there may be variation in the uptake of pharmaceuticals and other medical interventions and the quality of care may differ . thus , the outcome of medical care may differ from what would be expected from the results of clinical trials . as pointed out by brook and lohr , there is need to integrate the concepts of efficacy , effectiveness , variations in population - based rates of use and quality of care when building models for policy , planning and evaluation of medical care . in order to assess the impact on populations health of a new medical drug , we have to be able to measure the timing of introduction of the new drug as well as the diffusion process . this information should then be linked to population outcome measures , in order to assess whether the new treatment has been effective in improving the health of the population . although the introduction of a new drug may be regarded as the date of registration , this paper has shown that the year when the drug was first used in medical care often differs from the official registration year . according to the theory of diffusion of innovations , the medical intervention may be introduced by innovators but in order to have a broader impact on populations health , there must also be a continued diffusion of the innovation . when applying this concept , we found that the registration year of the pharmaceuticals studied may differ from the year of introduction with a range between 11 years before and after the registration year . in assessing any impact on population health , therefore , the key issue is when the drug came into widespread use . however , although we used a wide range of data in order to ascertain the introduction and diffusion of new innovations , our main finding is the need for harmonized data in eu countries . the lack of data on different phases of the diffusion process limited the possibilities to analyse the impact of introduction and diffusion of the new drugs . data on the diffusion of drugs and not simply the registration year should routinely be documented in a comparable way across the eu . this is most likely going to require prescribing data , which at present is inconsistent and only some elements are in the public domain . this should , ideally , include information on the indications for prescribing , although clearly , this will not be possible for some time , except where functioning patient information systems at a population level exist . it will also be important to use harmonized measures of the amount of drugs prescribed , such as the ddd . such improvements in the information on the introduction and diffusion of drugs would be a valuable tool in evaluating and planning health care . several pharmaceuticals first available in the 1970s and 1980s were introduced fairly simultaneously in most countries with the exception for soviet era estonia , in which the introduction was delayed until the 1990s . the delay in introducing the pharmaceuticals was shortest in france , the netherlands and united kingdom . this was true both for year of registration and first indicators of diffusion of the drugs , suggesting that delays are not only due to differences in the processes of registration . however , comparisons are challenging and there is a need for improved information on the introduction and diffusion of therapeutic innovations to inform comparisons of health system performance .

rationale , aims and objectivesdifferences in the performance of medical care may be due to variation in the introduction and diffusion of medical innovations . the objective of this paper is to compare seven european countries ( united kingdom , the netherlands , west germany , france , spain , estonia and sweden ) with regard to the year of introduction of six specific pharmaceutical innovations ( antiretroviral drugs , cimetidine , tamoxifen , cisplatin , oxalaplatin and cyclosporin ) that may have had important population health impacts.methodswe collected information on introduction and further diffusion of drugs using searches in the national and international literature , and questionnaires to national informants . we combined various sources of information , both official years of registration and other indicators of introduction ( clinical trials , guidelines , evaluation reports , sales statistics).results and conclusionsthe total length of the period between first and last introduction varied between 8 years for antiretroviral drugs and 22 years for cisplatin . introduction in estonia was generally delayed until the 1990s . the average time lags were smallest in france ( 2.2 years ) , united kingdom ( 2.8 years ) and the netherlands ( 3.5 years ) . similar rank orders were seen for year of registration suggesting that introduction lags are not only explained by differences in the process of registration . we discuss possible reasons for these between - country differences and implications for the evaluation of medical care .

Introduction The introduction and diffusion of innovative drugs Development of indicators of the effectiveness of health systems Material and methods Results Discussion Between-country variation in introduction of pharmaceuticals Implications for evaluation of medical care Conclusions

breast cancer , first described as early as 3000 b.c . by edwin smith papyrus of egypt , comprises 23% of all female malignancies ( excluding non melanomatous skin cancer ) [ 1 , 2 ] . in 2008 , the number of deaths from breast cancer totaled 460,000 patients ; it is a global concern accounting for 14% of all cancer deaths in females . it is the most common invasive cancer in women with an incidence that ranges between 19.3 per 100,000 in eastern africa to 89.7 per 100,000 in western europe [ 4 , 5 ] . the mortality in breast cancer patients is attributed to metastatic disease [ 3 , 6 ] . it is known to metastasize to numerous organs including lymph nodes , lung , bone , liver , skin , kidneys , brain , adrenal , thyroid , and heart [ 3 , 6 , 7 , 8 ] . breast cancer metastasizing to the urinary bladder has only been reported sporadically totaling 41 cases in the english medical literature [ 3 , 913 ] . bladder metastasis from breast cancer as the only organ involved is very rare , with only eight cases reported worldwide [ 3 , 11 , 12 , 14 ] . we herein present a patient who presented with bladder metastasis from breast cancer with the bladder being the only organ involved . a 64year old female patient , a non smoker known to have hypertension , diabetes mellitus , dyslipidemia , supraventricular tachycardia , and osteoporosis was diagnosed in 2005 with left breast intraductal carcinoma . ten out of 23 nodes were positive ; she was staged as t2 ( 4 cm ) n3 m0 disease . the patient was treated with eight cycles of chemotherapy , adriamycin , cytoxan , and taxol and 25 sessions of radiation therapy ( total dose of 50 grays ) , and completed a 5year treatment with an aromatase inhibitor . she had no evidence of disease until march 2010 , when she presented to our clinic with recurrent urinary tract infections and urinary incontinence that failed to resolve with antibiotics alone . workup included a computed tomography ( ct ) scan of her abdomen and pelvis , which showed diffuse thickening of the urinary bladder wall with surrounding fat streaking of the pelvis and retroperitoneum ( figure 1 ) . there was evidence of mild right hydroureteronephrosis with no evidence of obstructing urinary tract calculi ( figure 1 ) . a , b. diffuse thickening of the urinary bladder wall ( arrows ) with surrounding fat streaking of the pelvis . a pocket of gas is noted c , d. mild right hydroureteronephrosis ( arrowheads ) . pathology showed an unremarkable bladder mucosa , but a submucosal nest of carcinoma cells was found . the cells were plasmacytoid with marked nuclear pleomorphism , frequent mitotic figures and multiple foci suggestive of lymphovascular invasion were present . the tumor cells were positive for estrogen receptor and e cadherin ; they were negative for progesterone receptors . a. h&e sections of the urinary bladder biopsy revealing a dense submucosal infiltrate ( mag . b. the cells are cohesive , plasmacytoid with an abundant eosinophilic cytoplasm and eccentric nucleus ( mag . the cells demonstrate positive immunostaining with anti estrogen receptor ( er ) antibody ( c , mag . chest ct scan and bone scan were performed as part of the full work up and failed to show any evidence of other distant metastasis . one week after receiving the first cycle of chemotherapy , the patient developed hematuria and clot retention . several attempts of irrigation failed so the decision was made to perform cystoscopy in order to fulgurate all bleeders . the cystoscopy identified a large clot in the bladder , which was removed and all bleeding areas were fulgurated . . however , a few days after the third chemotherapy cycle she developed severe dyspnea and was found to have pneumonia that progressed to septic shock . the patient passed away from cardiorespiratory arrest one year after the diagnosis of the bladder metastasis . until 2012 , 41 cases of bladder metastasis from breast cancer have been reported and they were mostly associated with systemic dissemination and multiple organ involvement . only eight cases of solitary bladder metastasis from primary breast cancer have been documented and our case represents the ninth in the english medical literature [ 3 , 11 , 12 , 14 ] ( table i , in bold ) . macroscopically , bladder metastasis may appear as a mass , irregular lesion , mucosal nodularity , abnormally thickened bladder wall , or plaque with telangiectasias . cystoscopy was performed based on the suspicious ct scan findings , and it revealed an abnormal bladder wall thickening and inflammation , which were both subsequently biopsied . abbreviations : gu genitourinary , nr not reported , mets metastasis , ln lymph node , sb small bowels , lb large bowels , ilc invasive lobular carcinoma , idc invasive ductal carcinoma , er estrogene receptors , pr progesterone receptors the breast primary tumor subtype was invasive intraductal carcinoma while in the previously published reports , the most common histology of the breast primary was invasive lobular ( 10 out of the 15 cases where the breast cancer subtype was determined ) . bates and baithun reported 4.5% incidence of secondary bladder metastasis among all bladder cancer [ 9 , 15 ] , with secondary metastasis to the bladder from breast cancer being approximately 3% [ 16 , 17 ] . when autopsy and pathology are used as mainstay for diagnosis , the incidence ranges from 0% to 7% . bladder metastasis from previously diagnosed breast cancer is reported in the literature to vary from 2% to 14% . the most common primary tumors metastasizing to the bladder are : stomach , lung , skin / melanoma , and breast . it is only when the mucosa is involved by the disease will symptoms become clinically detectable . since mucosal involvement is the last stage of metastatic invasiveness into the bladder , the prognosis is very poor with a mean survival of two to three years , although a 5year survival of two patients out of the 41 was reported in the literature [ 14 , 20 ] . as a consequence , early stages of breast cancer metastasizing to the bladder the most common findings in patients with secondary bladder metastasis are lower urinary tract symptoms ( luts ) , flank or abdominal pain , hydronephrosis , and the painless hematuria that is in many cases the most common initial symptom ( microscopic being more frequent than gross ) . hematuria as a sign of bladder involvement following primary breast cancer is considered sensitive , but not specific for tumor metastasis . gross hematuria with a history of breast cancer needs to be thoroughly investigated , keeping in mind the side effects of cyclophosphamide as treatment of the primary breast cancer , regardless of time or duration of treatment . suprapubic and bilateral flank pain was later the major disabling symptom that warranted the investigation through ct scan imaging . ca 153 is one method to follow up breast cancer recurrence or metastasis , but strong evidence are lacking on its clinical usefulness . the positron emission tomography ( pet ) scan has been showed to have increasing usage after suspecting bladder involvement in a breast cancer patient ; however , its cost effectiveness is yet to be determined . breast metastasis to the bladder has been shown to have a worse prognosis than metastasis to bone . the time interval between primary tumor diagnosis and detection of metastasis is highly variable between 0 month and 30 years with an average of 6.2 years ( table 1 ) . bladder metastases in our patient were identified five years after the initial diagnosis of primary breast carcinoma . conduction of the proper investigations prevented the delay in the diagnosis of the metastatic disease . the patient survived one year from the time she first presented with urinary symptoms , and there was no evidence that her death was related to the bladder metastasis . only 8% of all breast cancer is lobular carcinoma , however , it is the most common type of breast cancer type involving the bladder ( 33% of secondary bladder metastasis ) followed by ductal carcinoma , which accounts for the majority of primary breast cancer ( 66% ) and metastasizes mostly to the lung parenchyma . one hypothesis is that lobular carcinoma is of the serosal type , which gives it a predilection to spread to the gastrointestinal and gynecological systems . it is part of the seeding soil hypothesis : the interaction of tumor with specific host factors in the metastasized organ . another culprit is concomitant steroid therapy , which is thought to be due to exacerbation of the immunosuppressive effect . estrogen , progesterone , and her2 receptors are the three main receptors studied in breast cancer . discrepancy between receptors is not uncommon between the primary and the secondary tumor ( reported between 30 and 39% ) . bladder metastases from our case were positive for estrogen receptors , which was also true for the patient 's known primary cancer of the breast . however , progesterone receptors were only present in the malignant breast cells and not the secondary bladder metastasis . one hypothesis is that the polyclonicity of breast tumor cells is affected by treatment modalities ( hormonal therapy may select some and suppress others ) , which manifests itself later in case of bladder metastasis . it has been shown that if receptors convert from positive in the breast to negative in the bladder , it is associated with decrease survival [ 17 , 24 ] . even with receptor negative secondary bladder metastasis , a trial of anti receptor therapy has been used with promising results in controlling disease . reported cases of bladder metastasis were managed through surgery , chemotherapy , radiotherapy , hormonal therapy , or a combination of those . in our patient , we report a rare case of breast cancer with solitary urinary bladder metastasis that was diagnosed several years after the initial presentation . secondary malignancies of the bladder are difficult to distinguish from non transitional cell primary bladder cancer . a high level of suspicion and extensive investigation are warranted if a known primary cancer already exists . we emphasize the need to be more aware of the possible metastatic nature of every urinary symptom that shows in a breast cancer patient .

breast cancer is the most common malignancy in woman . the urinary bladder is an unusual site for metastasis from primary tumors of the breast , especially when it is the only organ involved . we present the case of a female patient with known breast cancer stage t2n3m0 who developed isolated bladder metastasis five years after the primary diagnosis . we reviewed the literature for similar cases and discussed the clinical presentation , pathophysiology , and prognosis of this entity .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSIONS

coronary artery fistulae are direct connections from one or more coronary arteries to cardiac chambers or a large vessel . congenital anomalies are more common than acquired,1)2 ) being found in up to 0.2% of routine angiocardiography.3 ) most reported cases are about coronary artery fistulae to right cardiac structure,4 ) but the fistula between coronary artery and left ventricle is considerably rare.4 - 6 ) moreover , a case of multiple fistula emptied into the left ventricle through the entire left ventricular walls including left ventricular free wall , interventricular septum and apex is uncommon . the following we presented is such a case , with impressive echocardiac images which demonstrating diastolic massive abnormal color doppler flows on the entire left ventricular walls which were mimicking firecracker on the whole left ventricle . a 31-year - old woman was referred from local clinic for further investigation of cardiac murmur . past health status was good . physical examination revealed a blood pressure of 107/43 mmhg , and regular pulse of 86 beats / min . electrocardiography demonstrated biphasic t wave in lead v1 - 3 and borderline prolongation of qt interval ( fig . transthoracic echocardiography demonstrated a normal functioning left ventricle with hypertrophy and trabeculation of left ventricular free wall and interventricular septum ( fig . 2 ) . imaging with color flow doppler demonstrated multiple sparkling colors doppler flow through left ventricular free wall and interventricular septum during diastole ( using a 4 - 6 mhz - frequency transducer and high nyquist limit : 74 ) , and these multiple sparkling color flows demonstrated multiple fistula formation from the epicardial surface into the entire left ventricular cavity through the hypertrophied segment of myocardium during diastole ( fig . it also showed suspicious non - compacting myocardium at apical infero - posterior wall of left ventricle . we observed two separated layers of myocardium with a thin , compacted , epicardial layer and a thick , non - compacted endocardial zone . the ratio of non - compacted myocardium to compact myocardium at the end of systole was 2.9 : 1 with mean non - compacted myocardium of 1.3 cm and compacted myocardium thickness mean of 0.4 cm . for detailed anatomical information , the computerized tomographic ( ct ) angiography also identified multiple fistula from the left coronary artery towards the entire left ventricular walls including left ventricular free wall , interventricular septum and apex . coronary artery had markedly tortuous and dilated morphology from left main coronary artery to left anterior descending artery . coronary artery fistulae are rare and are most often diagnosed by angiography incidentally . in our case , because of the prominent firecracker on the whole left ventricle , we could make the early detection of coronary fistulae by noninvasive transthoracic echocardiography without invasive coronary angiography . imaging with color flow doppler , using a 4 - 7 mhz - frequency transducer and high nyquist limit revealed unusual multiple high velocity color - flows from the epicardial surface into the left ventricular cavity during diastole . it seemed that those multiple diastolic mosaic flows reflect the presence of fistula between epicardial coronary system and left ventricular cavity . left ventricular walls including left ventricular free wall and interventricular septum had sinusoidal appearance and mesh like structure which were plexus of multiple small vessels emptying exclusively into the left ventricle through the whole left ventricular wall , and also she had marked trabeculations and deep sinusoidal recesses involving the apex , apico - lateral and apico - inferior walls . this exam revealed two separated layers of myocardium with the ratio of non - compacted to compacted myocardium was greater than 2 , measured at end systole in the parasternal short - axis view . the definition and diagnostic criteria of non - compaction is not yet fully established , but non - compaction is generally characterized by continuity between the ventricular cavity and the intertrabecular recesses , which are filled with blood from the ventricle and which have no communication with the epicardial coronary system . however , in the presented case , which had multiple direct communications with the epicardial coronary system through the entire left ventricular wall . in that point , we concluded this case is more compatible with multiple fistula than non - compaction . although the etiology of non - compaction has not been fully investigated , our case is thought to result from an arrest in the regression of embryonic sinusoids during the embryonic period . the arrest of myocardial compaction that occurs in the early stages of fetal development result in the persistence of intertrabecular spaces and incomplete formation of capillaries . in this case , we believed that this process have a role in the formation of multiple fistula with the ventricular cavity and epicardial coronary circulation . the main limitation of our case was that we could not perform angiography to confirm coronary artery fistula . but ct angiographic finding was also compatible with multiple fistula draining into the left ventricle . in the presented case , the left ventricular functions were preserved , although the fistulae were very extensive . in a patient with coronary artery fistulae , myocardial ischemia and diastolic volume overload of the left ventricle can be caused by left - to - left shunt : however , the clinical and hemodynamic consequences are incompletely understood . in the presented case , the patient had no symptom and refused further evaluations including coronary angiography and catheterization . with regard to this special case , due to the fact of patient 's refusal and absence of angina , it was decided clinical follow - up of the patient . she remained asymptomatic and no complicate events were recorded in the next 5-year follow - up . in conclusion , this case report represents multiple fistula emptied into the left ventricle through the entire left ventricular walls including left ventricular free wall , interventricular septum and apex , confirmed by transthoracic echocardiography and ct angiography .

coronary artery fistulae are usually identified during invasive coronary angiographies . however , in this case , we made the early detection of coronary artery fistulae during non - invasive transthoracic echocardiography , by demonstrating diastolic multiple abnormal color doppler flows on the entire left ventricular walls including left ventricular free wall , interventricular septum and apex , which were mimicking firecracker on the whole left ventricle . fistulous communication from the coronary artery to the left ventricle is rare . moreover , a case of multiple coronary fistulae emptying into the left ventricle through the entire left ventricular walls including left ventricular free wall , interventricular septum and apex is uncommon . we report a case of a 31-year - old woman who was diagnosed with multiple fistula communicating with entire left ventricular wall .

INTRODUCTION CASE DISCUSSION

the detection and quantification of tumour - specific rearrangements are important issues in cancer research and in clinical diagnosis of tumours . in particular , its significance became obvious for haematological malignancies that exhibit characteristic translocations in specific tumour subgroups . although gene rearrangements are typical for haematological malignancies , they also may occur in solid tumours as characteristic changes . this has been shown for ret / ptc rearrangements in papillary thyroid carcinoma ( ptc ) that fuse the ret proto - oncogene to a variety of constitutively expressed partner genes ( for review see zitzelsberger ) . this was further improved by the development of fluorescence in situ hybridization ( fish ) techniques that allows a cytogenetic analysis of rearrangements on metaphase spreads as well as on interphase cell nuclei . multicolour fish approaches such as spectral karyotyping ( sky ) allowed a more detailed analysis of cytogenetic aberrations , in particular in the case of complex and hidden rearrangements [ 5 , 6 ] . the analysis of interphase nuclei by fish has the advantage that gene rearrangements can be investigated at single cell level in nonproliferating cells . an evaluation of fish signals is usually performed by visual inspection directly from the microscopic image . in this case , cell numbers for further statistical analysis and a possible bias of the investigator towards positivity or negativity of fish signals indicating the rearrangement are major limitations . in order to analyse a statistically relevant number of cells , an automatic scanning system for fluorescence spot counting using a fully motorized fluorescence microscope with an eight - slide scanning stage and a high - resolution ccd camera driven by the metacyte software ( metasystems , altlussheim , germany ) has been established and optimized . to demonstrate routine application of the scanning system , the ret / ptc rearrangement in papillary thyroid carcinomas has been scored with a probe set that produces split fish signals if a gene rearrangement is present . therefore , the parameters of the scanning system had to be optimized using cell culture models as positive and negative controls . the aims of the present study were to establish such optimised scanning parameters and to characterise chromosomal and ret / ptc rearrangements in a ptc cohort . primary cell cultures of 23 ptcs from children and adults from ukraine that developed papillary thyroid carcinomas in the aftermath of the chernobyl accident were established according to a published protocol . the median age of the patients at operation was 21 years , ten patients were male , and 13 patients were female . 21 out of 23 cases were investigated for chromosomal aberrations and 22 cases for ret / ptc rearrangements . in addition , a cell line originating from a ptc ( tpc1 ) carrying the ret / ptc1 rearrangement served as a positive control [ 9 , 10 ] . as negative control we used a cell line derived from human retinal epithelium ( rpe , htert immortalised ) that displays a normal karyotype . all cell lines and primary cell cultures were grown in rpmi 1640 ( paa laboratories , clbe , germany ) with the addition of penicillin ( 5 iu / ml ) and streptomycin ( 5 g / ml ) ( gibco - brl life technologies , karlsruhe , germany ) and supplemented with 10% or 20% fbs ( sigma , taufkirchen , germany ) , respectively . therefore 2.5 10 cells were grown in 4 ml media on a sterile glass slide positioned in quadriperm cell culture chambers ( in vitro systems and services gmbh , gttingen , germany ) and addition of 0.05 g / ml colcemid ( roche , penzberg , germany ) overnight arrested cells in metaphase . after 2432 h growth , the media were removed and the slide covered with 4 ml hypotonic kcl - solution ( 0.075 m ) . after incubation under hypotonic conditions for 20 min at 37c , 4 ml of ice - cold fixative ( methanol / glacial acetic acid , 3 : 1 ) were added followed by another incubation step for 20 min on ice . subsequently the solutions were removed and replaced by another 4 ml of ice - cold fixative . finally , the slides were air - dried perpendicularly under a laminar flow . for interphase preparations , cells cells were fixed with carnoy 's fixative ( methanol / acetic acid ; 3 : 1 ) , air - dried , and stored at room temperature for 7 days before hybridization . briefly , metaphase preparations were pretreated with rnase a ( 0.1 mg / ml in 2 ssc ) prior to hybridization . chromosome denaturation was achieved by treatment of the slides in 70% formamide in 2 ssc at 72c for 1 - 2 min . subsequently the slides were dehydrated in a 70% , 90% , and 100% ethanol series and hybridized with a denatured sky - probe mixture ( skypaint dna kit , applied spectral imaging , mannheim , germany ) . after hybridization ( 24 h ) , slides were washed in 0.5 ssc for 5 min at 75c , 4 ssc/0.1% tween for 2 min and h2obidest for 2 min , both at room temperature . probe detection was achieved using antidigoxigenin ( 1 : 250 ; roche , penzberg , germany ) , avidin - cy-5 , and avidin - cy-5.5 antibodies ( both 1 : 100 ; biomol , hamburg , germany ) according to the manufacturers ' protocols . metaphase spreads were counterstained with 0.1% 4,6-diamidino-2-phenylindole ( dapi ) in antifade solution ( vectashield mounting medium ; vector laboratories , burlingame , ca , usa ) . a minimum of 15 metaphases were analyzed to determine the karyotype of each primary culture . image acquisition was done using a spectracube system , and analyses were accomplished using the skyview imaging software ( both from applied spectral imaging , mannheim , germany ) . for fish analysis of ret / ptc rearrangements , labelling of yac dna probes 344h4 , 214h10 and , the yac probes 313f4 and 214h10 map proximal to and include the ret locus , whilst clone 344h4 contains dna sequences distal to ret . they were labelled either with digoxigenin-11-dutp ( 344h4 ) or with biotin-16-dutp ( 214h10 , 313f4 ) using nick translation and were detected with antidigoxigenin - cy3 antibody , followed by rat - anti - mouse cy3 and mouse - anti - rat cy3 for red fluorescence , and streptavidin - fitc , followed by biotin - antistreptavidin and streptavidin - fitc , respectively . a normal ret locus results into two overlapping red and green fish signals , while split fish signals ( separated red and green signals ) indicated a rearranged ret gene . only cells with either two overlapping signals or one split and one overlapping signal were analysed to ensure completeness of the nuclei . for the analysis of the ret / ptc rearrangements , a fluorescence - based scanning system , metafer4 ( metasystems , altlussheim , germany ) , was used . this scanning system is based on a motorized axioplan 2 microscope ( zeiss , oberkochen , germany ) , a motorized eight - slide scanning stage ( mrzhuser , wetzlar , germany ) , and high - resolution ccd camera ( jai corporation , japan ) . the classifiers of the metacyte software allow the settings of image capture , exposure parameters , image processing , and cell processing steps . these classifiers contain variable criteria for cell selection taking into account cell characteristics like cell area , aspect ratio , concavity index , and signal intensity . for capturing of cell images , slide scanning procedure was started with the focus determination of cells in the dapi channel in the selected scanning area . then , a stack of five images within a distance 0.9 m were captured in the cy3 and fitc channels . from each stack , a 2d image with all signals in focus was created and a local background reduction was performed applying two standard top hat filters . overlapping or incomplete cell nuclei as well as nuclei with incorrect numbers of red and green signals were excluded from the analysis . for the analysis of fused or split signals , the distance of signals was measured in the xy positions as well as in z positions . between 100 and 870 cells each 2d image was displayed as gallery pictures presenting the cell number , the number of red and green signals , and the number of overlapping red and green signals . on the gallery screen also the results for each sample could be displayed as scatter diagram and/or as bar diagram . all data can be exported into common statistics and graphic software programs . in parallel , every captured cell was analysed visually in order to compare visual and automated scoring of fish signals . in contrast to automated scoring the visual analysis can be performed in two dimensions only . for optimization of the classifier parameters for ret / ptc rearrangements exhibiting split signals negative and positive control samples were analysed several times after changing the parameter settings for image capture , cell nucleus characteristics , and cell nucleus selection , by criteria such as nuclear area , aspect ratio , and concavity index of the nuclei , as well as size and distance of red and green signals . the final parameter settings for the automated analysis were optimised for the lowest numbers of false positive and false negative results . frequencies of cells with split signals determined by automated analyses and by visual analyses were compared with an test . significant differences were accepted for p values less than .05 after adjustment for false detection by the bonferroni method . 21 ptcs were analyzed for chromosomal aberrations , and 22 ptcs were investigated for ret / ptc rearrangements . the ret / ptc status was determined by fish analysis on interphase cells from the same primary cultures that were used for sky analysis of chromosomal aberrations . for an evaluation of ret / ptc rearrangements an automated scoring system ( metafer4 ) was used and data were compared to fish signals that had been scored visually . sky analysis revealed clonal chromosomal rearrangements in five out of 21 cases ( 24% ) . in two cases ( 10% ) structural aberrations involving chromosome 11 could be observed . additionally , numerical chromosome aberrations could be detected in 13 cases ( 62% ) with frequent losses of chromosomes 21 ( six cases , 29% ) , 20 ( five cases , 24% ) , 7 , 10 , and 22 ( three cases each , 14% ) . figure 1 shows an exemplary sky image of case 402 t exhibiting a deletion on chromosome 11 and i(11)(q10 ) . fish was carried out on interphase cell preparations from primary cultures of 22 ptcs using a combination of three yac probes that were labelled in two different colours . cell nuclei exhibiting a rearranged ret gene show a split fish signal in red and green in addition to an overlapping fish signal , whereas normal cells show two overlapping fish signals ( figure 2 ) . sixteen out of 22 ptcs ( 72% ) exhibited ret rearrangements diagnosed by fish interphase analysis ( table 1 ) . the highest frequency of rearranged cells after fish interphase analysis was 41% ( case s430 t ) . these 16 cases showed a significantly elevated frequency of split fish signals compared to rpe cell line and s414 normal tissue which represent negative controls without any ret / ptc rearrangement . the frequency of false positive fish signals in these control cells is in the order of 13% ( table 1 ) . therefore , we used a threshold of 7.1% of cells with a split fish signal in order to define a ret / ptc - positive tumour as published earlier in . the positive control cell line tpc1 showed 98% rearranged cells . in order to create the initial parameter settings for classifiers of the automated metafer4 scoring system the rpe ( human retina pigment epithelial ) cell line and primary culture of normal tissue from case s414 , both with a normal karyotype , were used as negative control . the tpc1 cell line that was derived from a human papillary carcinoma carrying a ret / ptc1 rearrangement was used as a positive control . based on these control cells the classifiers of the metafer4 system were optimized several times by changing the parameter settings for cell nucleus characteristics and cell nucleus selection by criteria such as nuclear area , aspect ratio , and concavity index of the nuclei . for the scoring of fused and split fish signals an optimisation of the parameters for minimum signal area , maximum distance of red and green signals , and the minimum signal intensity has been performed in multiple training procedures . for testing the final parameter settings of the classifier the above - mentioned 22 ptcs were analysed using the automated scoring system as well as visual scoring of the recorded images . the negative control cell lines showed a frequency of false positive ret / ptc rearrangement of 13% . the frequencies of ret / ptc positive cells among the ptc primary cultures varied between 1.0% and 41.5% . concordance of results from automated and visual scoring was tested statistically . statistical correlation analysis using the test confirmed a concordance of the data from automated and visual analysis in 19 cases ( 86% ) . only in three cases ( s407 t , s418 t , and s422 t ) the automated and visual analysis differed significantly ( p < .05 ; bonferroni value , figure 3 ) . in this study , we describe karyotype abnormalities and rearrangements of the ret proto - oncogene in ptc from patients that were exposed to the radioiodine fallout of the chernobyl accident . there is evidence from several studies that exposure to ionising radiation leads to the induction of chromosomal rearrangements that may result in gene alterations and deregulated gene expression [ 13 , 14 ] . in ptc chromosomal breakpoints on 1p32 - 36 , 1p11 - 13 , 3p25 - 26 , and 7q32 - 36 have previously been reported after conventional karyotyping . other cytogenetic studies on ptc showed a deletion on chromosome 11q and a chromosome 2 rearrangement with an assumed tyrosine kinase gene at the breakpoint . in addition , novel breakpoints of structural rearrangements of chromosomes 4q , 5q , 6p , 12q , 13q , and 14q and of complex rearrangements have been reported using a complementary analysis of conventional karyotyping , sky and fish with bac clones [ 8 , 18 , 19 ] . in our study , also rearrangements involving chromosome 11 could be detected in two cases ( table 1 , figure 1 ) , indicating an important gene on this chromosome that might be involved in thyroid carcinogenesis . besides the structural rearrangements it is remarkable that many numerical aberrations were observed mostly involving chromosomes 20 , 21 , and 22 . loss of chromosome 22 has already been reported to represent a cytogenetic marker for poor prognosis in thyroid cancer [ 2022 ] . thus , this observation in ptc may explain to some extent the more aggressive phenotypes of tumours that have developed after the chernobyl accident . another frequent cytogenetic finding in ptc is the rearrangements of chromosome 10q with breakpoints at 10q11.2 that lead to an activation of the ret proto - oncogene [ 23 , 24 ] . the most frequent rearrangements are paracentric inversions on chromosome 10q leading to the oncogenes ret / ptc1 and ret / ptc3 . thus , these chromosomal rearrangements lead to transcribed fusion genes that affect the mapkinase pathway . investigations of these ret / ptc rearrangements are important in ptc since they represent frequent alterations and molecular targets for therapeutic interventions [ 25 , 26 ] . in this study , we have investigated ret / ptc rearrangements in the ptc using an interphase fish approach that allows to detect ret rearrangements regardless of the specific fusion partner involved at a single - cell level . the frequency of ret / ptc - positive cases of 72% is in line with earlier reports on tissue sections using a three - dimensional evaluation of fish signals either with laser - scanning microscopy or apotome - equipped fluorescence microscopy [ 7 , 27 ] . the reported genetic heterogeneity could be confirmed in this study since only a subpopulation of tumour cells showed the ret / ptc rearrangement . although interphase fish analysis has a number of advantages in detecting gene rearrangements , it is a challenge to score adequately the frequency of rearranged cells . a major problem that also affects the sensitivity of the fish approach is the inevitable scoring of false positive fish signals due to random generation of rearrangement - positive fish signals . the choice of adequate fish probes ( fusion probes or split probes for the detection of a rearranged cell ) is one issue that has to be addressed ; an impartial evaluation of fish signals is another important issue . in this study , we have compared visual inspection of fish signals with an automated evaluation . in the automated process , a correct detection of fish signals is a great challenge , since fish signals exhibit large variations in shape , size , and intensity . after cell nucleus selection and correct fish signal detection , a discrimination of nuclei with and without ret / ptc rearrangement could be achieved by measuring the signal distances and defining the minimal distance to diagnose a split fish signal . tpc1 cell line has this feature and showed in our study 97% and 98% positivity , respectively . the automated analysis reported in this study was optimised to detect ret / ptc rearrangements by means of a yac probe set covering the ret gene locus . differential labelling of the yac probes in red and green resulted in overlapping red / green signals for the wild - type ret gene and in a split red and green fish signals for the rearrangement . the automated evaluation of fish signals revealed matching results in 87% of the 22 cases with the visual analysis of fish signals . a possible explanation for three misclassified cases is a bias of the investigator scoring visually towards ret / ptc - positive or -negative cells , especially in cases with high background signals . also different cell features in those three cases an additional difference in fusion counting automatically or by eye is that the automated system is measuring the distance 3-dimensionally , whereas directly at the microscope or with captured images a visual scoring is performed at 2d projection . a comparison of automated and manual evaluation of interphase fish results was only presented by kajtr et al in case of bcr / abl rearrangements in cml patients . although the probe design is different ( fusion probe versus split signal probe ) , we received a similar good concordance of automated and manual evaluation results . we have demonstrated here for the first time the usage of the 3d automated fish analysis for the detection of ret / ptc rearrangements in ptc . in conclusion , we have shown that chromosomal rearrangements ( 5 out of 21 ) and rearrangements of the ret gene ( 16 out of 22 ) are frequent in papillary thyroid carcinomas from patients of the ukraine after the chernobyl accident . for the detection of ret / ptc rearrangements we have demonstrated an automated fish analysis approach which provides reliable results in higher cell numbers . the results of ret / ptc rearrangements again indicate a genetic heterogeneity since only subpopulations of tumour cells carried the ret / ptc rearrangement .

structural genomic rearrangements are frequent findings in human cancers . therefore , papillary thyroid carcinomas ( ptcs ) were investigated for chromosomal aberrations and rearrangements of the ret proto - oncogene . for this purpose , primary cultures from 23 ptc have been established and metaphase preparations were analysed by spectral karyotyping ( sky ) . in addition , interphase cell preparations of the same cases were investigated by fluorescence in situ hybridisation ( fish ) for the presence of ret / ptc rearrangements using ret - specific dna probes . sky analysis of ptc revealed structural aberrations of chromosome 11 and several numerical aberrations with frequent loss of chromosomes 20 , 21 , and 22 . fish analysis for ret / ptc rearrangements showed prevalence of this rearrangement in 72% ( 16 out of 22 ) of cases . however , only subpopulations of tumour cells exhibited this rearrangement indicating genetic heterogeneity . the comparison of visual and automated scoring of fish signals revealed concordant results in 19 out of 22 cases ( 87% ) indicating reliable scoring results using the optimised scoring parameter for ret / ptc with the automated metafer4 system . it can be concluded from this study that genomic rearrangements are frequent in ptc and therefore important events in thyroid carcinogenesis .

1. Introduction 2. Material and Methods 3. Results 4. Discussion

hurling is a stick and ball invasion field sport native to ireland ( reilly and collins , 2008 ) . the movement profile of players is stochastic in nature , where the timing of high speed running follows the ebb and flow of competitive play ( reilly and collins , 2008 ) . despite its spectator popularity very few research investigations have been conducted on hurling cohorts ( reilly and collins , 2008 ) . the training - recovery relationship is an important consideration in the training prescription of players and a clear understanding of training loads can help inform practice . recent reports have linked the training load and inadequate fitness to the high number of injuries observed within the gaelic sports ( blake et al . , 2014 ) . ( 2014 ) reported that the injury incidence rate for match play ( 61.75/1000 hr ) is 21 times that of training ( 2.99/1000 hr ) . this suggests that training does not adequately prepare players for the competitive demands of match - play . the training load ( tl ) in field sports can be divided into internal ( heart rate , rpe ) or external ( distance covered ) responses . an understanding of the tl allows for a more individualised understanding of the dose - response relationship of training and match play ( impellizzeri et al . , 2005 ; stagano et al . , 2007 ) . recent advancement in technology has improved the ease to which locomotion data collection can take place . there has been an increase in monitoring of the external training load in match and training situations through the use of global positioning satellite systems ( gps ) ( casamichana et al . the advent of this technology has resulted in total distance covered and distance covered at arbitrary demarcated thresholds of high speed locomotion being utilised to quantify the tl . the poor sensitivity and variability of these performance metrics within match play and training environments has been previously highlighted ( gregson et al . , 2010 ; kempton et al . , 2014 ; mclaren et al . , 2015 ; stevens et al . , 2016 ) . as a consequence these metrics may be unreliable to gain full appreciation of the tl . the understanding of the dose - response relationship has been advocated as an important consideration for coaches within the training process . monitoring the tl in team sports is difficult due to different exercise designs resulting in different physiological and mechanical demands . additional complications are presented in the form of inter - individual responses to the prescribed exercise ( akubat et al . , 2012 ) . o2 consumption relationship appears to be valid even during intermittent exercise ( esposito et al . , 2004 ) , the itrimp methodology has potential for use for monitoring the dose - response of players to specific training programs within a team sport environment ( manzi et al . , 2013 ) . indeed , measures of the internal tl have been validated with a dose - response relationship in team sports ( akubat et al . , 2012 ; both studies demonstrated that the fully individualized training impulse ( itrimp ) showed relationships with changes in aerobic - fitness measures of soccer players . previous studies ( manzi et al . , 2013 ) have shown that itrimp measures over a training period were correlated to the percentage improvement in vo2max ( r = 0.77 , p = 0.002 ) and yo - yoir1 performance ( r = 0.69 , p = 0.009 ) . ( 2014 ) through the integration of external ( total distance [ td ] ; high speed distance [ hsd ] ) and internal loading parameters ( itrimp ) . interestingly , these measures have shown a relationship with aerobic fitness measures in soccer players ( akubat et al . , 2014 ) . the investigation reported that both td : itrimp showed moderate to large correlations with vobla ( r = 0.65 ; p = 004 ; large ) and vobla ( r = 0.69 ; p = 0.03 ; large ) , with td not significantly related to vlt ( r = 0.28 ; p = 0.43 ; small ) and vobla ( r = 0.14 ; p = 0.69 ; small ) . this highlights the potential merits of using tl ratios to better quantify the dose - response of the tl . furthermore , studies within the rugby league ( weaving et al . , 2014 ) have shown that the integration of tl measures better explain a greater proportion of training component variance that internal or external measures of load alone fail to fully explain . at elite levels of hurling a disproportionate number of injuries occur during match play ( murphy et al . , 2007 ) with most occurring in the last quarter of games due to increased fatigue states ( blake et al . , this is in line with previous investigations ( watson , 1996 ) that have reported injury occurrences in hurling populations which are attributable to poor conditioning of players . given such a scenario , it would appear that a situation where an analysis and assessment of aerobic fitness training through data collected routinely at elite levels could prove useful . considering the potential ease of quantifying the hr ( internal load ) and the gps ( external load ) , both the internal and external output of exercise can be measured . if external : internal measures relate to measures of fitness that predetermine a given performance , more frequent analysis of training status and match performance could be made by practitioners . this would allow for more informed and proactive decisions related to player s fitness and fatigue status , therefore , providing a more thorough understanding of the training load paradigm in intermittent team sports . hence , the current study investigated whether information such as the hr and distance could potentially be used to assess the match play load . therefore , the study aimed to examine a novel approach of integrating external and internal workload variables as a ratio during hurling specific simulated match play . finally , the study aimed to quantify the relationship of integrated tl ratios and aerobic fitness measures in hurling players . twenty - five hurling players ( age : 24 4 yrs ; body height : 1.80 0.02 m ; body mass : 78 3 kg ; vo2max : 57.78 3.05 mlkgmin ) took part in this study . all subjects provided written informed consent to the experimental procedures after all possible benefits and risks were explained to them . ethical consent for the study was granted by the research ethics committee of the institute of technology tallaght . the study conformed to the codes of ethics of the world medical association ( declaration of helsinki , 1964 ) the study was completed over a 3 week period . during the 1 week an incremental vo2max and lactate threshold test ( vo2/lt ) was conducted . the vo2/lt consisted of five ( 8 , 10 , 12 , 14 & 16 kmh ) 4 min stages followed by an increase in speed at a rate of 0.2 kmh every 12 s until exhaustion was reached . the treadmill gradient was set at 1% for the entire test to reflect the energetic cost of outdoor running ( jones and doust , 1996 ) . during the incremental test , each stage was separated by a 1 min recovery period where capillary blood lactate was taken ( lactate plus , nova medical ) in duplicate , with the mean value for each stage recorded . the velocity at 2 mmoll ( vlt ) and velocity at 4 mmoll ( vobla ) were considered as markers of aerobic fitness . maximal aerobic capacity ( vo2max ) was assessed during the vo2/lt through breath by breath analysis ( cosmed k4b , rome , italy ) . vo2max was recorded as the highest mean vo2 obtained for a 1 min period with the following criterion met : ( 1 ) a plateau in vo2 despite increasing treadmill speed ( 2 ) a respiratory ratio above 1.10 ( 3 ) attainment of the age predicted hr ( lucia et al . , 2004 ) . the hr was recorded using hr belts ( polar team system , polar electro , oy , finland ) . the mean hr during the last minute of each stage was utilised to ascertain the individualized hr blood lactate relationship for the calculation of itrimp ( au ) weightings . finally , the peak hr during the incremental treadmill test was considered the peak hr of the participant . during weeks 2 and 3 and at least 5 days after the vo2max / lt test , participants completed a hurling match play simulation protocol . the hurling simulation protocol was chosen given its accurate physiological replication of hurling match play ( collins et al . before conducting the study , test retest reliability analysis was conducted on the hurling match play simulation protocol to ensure that the test provides external validity and reliability . results showed that there was no significant difference between the 1 and 2 trial of the hurling simulation protocol ( 7411 354 m ; 7311 362 m ; p = 0.19 ; trivial ) . the coefficient of variation ( cv ) was 1.9% ( 95% ci : 1.1 - 4.8 ) highlighting the reliability of the simulation . the hurling match play simulation protocol was completed at the same time of the day ( 10.30 14.00 hr ) to account for any circadian variation in performance . during the simulation participants wore an individual gps unit ( vxsport , lower hutt , new zealand , issue : 330a , firmware : 3.26.7.0 ) sampling at 4 hz and containing a triaxial acceloremter and a magnetometer in a total of 30 games . the gps unit ( mass : 76 g ; 48 mm x 20 mm x 87 mm ) was encased within a protective harness between the player s shoulder blades in the upper thoracic - spine region what ensured that players range of movement in the upper limbs and torso was not restricted . the system had been validated , deemed accurate and reliable during intermittent exercise ( buchheit et al . , 2014 ) . following each match gps data were downloaded using the same proprietary software ( vxsport view , new zealand ) . each file was trimmed so that only data recorded when the player was on the field was included for further analysis . the proprietary software provided instantaneous raw velocity data at 0.25 s intervals , which were then exported and placed into a customised microsoft excel spreadsheet ( microsoft , redmond , usa ) . the spreadsheet allowed analysis of distance covered ( m ) in the following categories : total distance ( td ) , high speed distance ( hsd : 17 kmh ) and sprint distance ( sd : 22 kmh ) . internal loading was measured as individualised training impulses ( itrimp ) ( manzi et al . , 2013 ) . pearson correlation coefficients were used to assess the relationships between ( 1 ) aerobic fitness and performance , and ( 2 ) distance : itrimp and fitness . qualitative interpretations of the correlation coefficients and the 95% confidence intervals ( ci ) as defined by hopkins ( 2004 ) ( 0.09 trivial , .10.29 small , .30.49 moderate , .50.69 large , .70.89 very large , .90.99 nearly perfect , 1 perfect ) are provided for all correlations . all statistical analyses were performed using spss for windows ( version 22 , spss inc . chicago , il , usa ) with statistical significance set at an accepted level of p<0.05 . twenty - five hurling players ( age : 24 4 yrs ; body height : 1.80 0.02 m ; body mass : 78 3 kg ; vo2max : 57.78 3.05 mlkgmin ) took part in this study . all subjects provided written informed consent to the experimental procedures after all possible benefits and risks were explained to them . ethical consent for the study was granted by the research ethics committee of the institute of technology tallaght . the study conformed to the codes of ethics of the world medical association ( declaration of helsinki , 1964 ) the vo2/lt consisted of five ( 8 , 10 , 12 , 14 & 16 kmh ) 4 min stages followed by an increase in speed at a rate of 0.2 kmh every 12 s until exhaustion was reached . the treadmill gradient was set at 1% for the entire test to reflect the energetic cost of outdoor running ( jones and doust , 1996 ) . during the incremental test , each stage was separated by a 1 min recovery period where capillary blood lactate was taken ( lactate plus , nova medical ) in duplicate , with the mean value for each stage recorded . the velocity at 2 mmoll ( vlt ) and velocity at 4 mmoll ( vobla ) were considered as markers of aerobic fitness . maximal aerobic capacity ( vo2max ) was assessed during the vo2/lt through breath by breath analysis ( cosmed k4b , rome , italy ) . vo2max was recorded as the highest mean vo2 obtained for a 1 min period with the following criterion met : ( 1 ) a plateau in vo2 despite increasing treadmill speed ( 2 ) a respiratory ratio above 1.10 ( 3 ) attainment of the age predicted hr ( lucia et al . , 2004 ) . the hr was recorded using hr belts ( polar team system , polar electro , oy , finland ) . the mean hr during the last minute of each stage was utilised to ascertain the individualized hr blood lactate relationship for the calculation of itrimp ( au ) weightings . finally , the peak hr during the incremental treadmill test was considered the peak hr of the participant . during weeks 2 and 3 and at least 5 days after the vo2max / lt test , participants completed a hurling match play simulation protocol . the hurling simulation protocol was chosen given its accurate physiological replication of hurling match play ( collins et al . before conducting the study , test retest reliability analysis was conducted on the hurling match play simulation protocol to ensure that the test provides external validity and reliability . results showed that there was no significant difference between the 1 and 2 trial of the hurling simulation protocol ( 7411 354 m ; 7311 362 m ; p = 0.19 ; trivial ) . the coefficient of variation ( cv ) was 1.9% ( 95% ci : 1.1 - 4.8 ) highlighting the reliability of the simulation . the hurling match play simulation protocol was completed at the same time of the day ( 10.30 14.00 hr ) to account for any circadian variation in performance . during the simulation participants wore an individual gps unit ( vxsport , lower hutt , new zealand , issue : 330a , firmware : 3.26.7.0 ) sampling at 4 hz and containing a triaxial acceloremter and a magnetometer in a total of 30 games . the gps unit ( mass : 76 g ; 48 mm x 20 mm x 87 mm ) was encased within a protective harness between the player s shoulder blades in the upper thoracic - spine region what ensured that players range of movement in the upper limbs and torso was not restricted . the system had been validated , deemed accurate and reliable during intermittent exercise ( buchheit et al . , 2014 ) . following each match gps data were downloaded using the same proprietary software ( vxsport view , new zealand ) . each file was trimmed so that only data recorded when the player was on the field was included for further analysis . the proprietary software provided instantaneous raw velocity data at 0.25 s intervals , which were then exported and placed into a customised microsoft excel spreadsheet ( microsoft , redmond , usa ) . the spreadsheet allowed analysis of distance covered ( m ) in the following categories : total distance ( td ) , high speed distance ( hsd : 17 kmh ) and sprint distance ( sd : 22 kmh ) . internal loading was measured as individualised training impulses ( itrimp ) ( manzi et al . , 2013 ) . pearson correlation coefficients were used to assess the relationships between ( 1 ) aerobic fitness and performance , and ( 2 ) distance : itrimp and fitness . qualitative interpretations of the correlation coefficients and the 95% confidence intervals ( ci ) as defined by hopkins ( 2004 ) ( 0.09 trivial , .10.29 small , .30.49 moderate , .50.69 large , .70.89 very large , .90.99 nearly perfect , 1 perfect ) are provided for all correlations . all statistical analyses were performed using spss for windows ( version 22 , spss inc . chicago , il , usa ) with statistical significance set at an accepted level of p<0.05 . the td , hsd and sd covered was 7604 510 m , 1623 149 m and 300 47 m , respectively . the internal tl ( itrimp ) of simulated match play was 534 74 au . the relationships between external load measures and fitness are shown in table 1 . specifically , td covered during the match simulation was not significantly correlated to aerobic fitness measures i.e. vlt ( r = -0.066 ; p = 0.747 ; 95% ci : 0.014 to 0.081 ; trivial ) , vo2max ( r = 0.152 ; p = 0.458 ; 95% ci : 0.114 to 0.261 ; small ) and vobla ( r = 0.014 ; p = 0.945 ; 95% ci : -0.014 to 0.084 ; trivial ) . hsd was not related to players vo2max ( r = 0.086 ; p = 0.677 ; 95% ci : 0.014 to 0.092 ; trivial ) and vobla ( r = 0.076 ; p = 0.712 ; 95% ci : 0.034 to 0.090 ; trivial ) . in contrast to previous observations , hsd was significantly related to vlt ( r = 0.485 ; p = 0.012 ; 95% ci : 0.314 to 0.619 ; moderate ) . finally , sd showed no significant correlation with vlt ( r = -0.189 ; p = 0.356 ; 95% ci : 0.014 to 0.091 ; trivial ) , vo2max ( r = 0.094 ; p = 0.647 ; 95% ci : 0.074 to 0.102 ; trivial ) and vobla ( r = 0.012 ; p = 0.955 ; 95% ci : 0.004 to 0.074 ; trivial ) . the integration of tl measures was shown to provide significant correlations with aerobic fitness measures . the relationship between tl integration ratios and aerobic fitness measures is shown in table 2 . specifically as shown in figure 1 , td : itrimp showed significant correlations with vo2max ( r = 0.524 ; p = 0.006 ; 95% ci : 0.224 to 0.754 ; large ) and vobla ( r = 0.559 ; p = 0.003 ; 95% ci : 0.314 to 0.774 ; large ) . similar trends were shown in figure 2 for hsd : itrimp and aerobic markers for fitness measures . p = 0.009 ; 95% ci : 0.214 to 0.861 ; large ) and vobla ( r = 0.407 ; p = 0.039 ; 95% ci : 0.204 to 0.641 ; moderate ) . finally , the integration of sd : itrimp shown in figure 3 was significantly related to vlt ( r = 0.611 ; p = 0.001 ; 95% ci : 0.414 to 0.841 ; large ) . table 1the correlation of the external tl with measures of aerobic fitnessexternal tlvo2max ( mlkgmin)vlt ( kmh)vobla ( kmh)total distance ( m)-0.158 - 0.0660.014high speed distance ( m)0.0860.4850.076sprint distance ( m)0.094 - 0.1890.012high speed distance ( m ; 17 kmh ) ; sprint distance ( m ; 22 kmh ) ; vlt = velocity at the lactate threshold ; vobla = velocity at onset of blood lactate accumulation**correlation is significant p= 0.012 table 2the correlation of external - internal tl ratios with measures of aerobic fitnessexternal : internal tl ratiovo2max ( mlkgmin)vlt ( kmh)vobla ( kmh)td : itrimp0.524 0.3300.599 hsd : itrimp0.3250.502 0.407 sprint : itrimp0.3580.611 0.170td : itrimp = total distance ( m):itrimp ( au ) ; hsd : itrimp = high speed distance ( m ) : itrimp ( au ) ; sprint : itrimp = sprint distance ( m):itrimp ( au ) ; vlt = velocity at the lactate threshold ; vobla = velocity at onset of blood lactate accumulation**correlation is significant p 0.05**correlation is significant p 0.05**correlation is significant p 0.05**correlation is significant p 0.05**correlation is significant p 0.05 figure 1a scatter plot showing the relationship between ( a ) td : itrimp and vobla ( kmh ) ( b ) td : itrimp and vo2max ( mlkgmin ) figure 2a scatter plot showing the relationship between ( a ) hsd : itrimp and vobla ( kmh ) ( b ) hsd : itrimp and vlt ( kmh ) figure 3a scatter plot showing the relationship between sd : itrimp and vlt ( kmh ) the correlation of the external tl with measures of aerobic fitness high speed distance ( m ; 17 kmh ) ; sprint distance ( m ; 22 kmh ) ; vlt = velocity at the lactate threshold ; vobla = velocity at onset of blood lactate accumulation correlation is significant p= 0.012 the correlation of external - internal tl ratios with measures of aerobic fitness td : itrimp = total distance ( m):itrimp ( au ) ; hsd : itrimp = high speed distance ( m ) : itrimp ( au ) ; sprint : itrimp = sprint distance ( m):itrimp ( au ) ; vlt = velocity at the lactate threshold ; vobla = velocity at onset of blood lactate accumulation correlation is significant p 0.05 correlation is significant p 0.05 correlation is significant p 0.05 correlation is significant p 0.05 correlation is significant p 0.05 a scatter plot showing the relationship between ( a ) td : itrimp and vobla ( kmh ) ( b ) td : itrimp and vo2max ( mlkgmin ) a scatter plot showing the relationship between ( a ) hsd : itrimp and vobla ( kmh ) ( b ) hsd : itrimp and vlt ( kmh ) a scatter plot showing the relationship between sd : itrimp and vlt ( kmh ) the current study investigated a novel approach of integrating external and internal workload variables as a ratio during hurling specific simulated match play . the results of the study show that measures of match running performance relate poorly to aerobic fitness measures . interestingly , there appears to be a relationship between markers of aerobic fitness and high speed running performance . the relationship has been previously reported in soccer populations ( akubat et al . , 2014 ) , but this is the first study to report this relationship in a hurling population . caution should be taken when utilising high speed running as a marker of performance , the training load and fatigue , given the match to match variability in this performance measure . gregson and colleagues ( 2010 ) reported that high speed running performance could vary by as much as 16% ( cv : 16.2 6.4% , 95% ci : 15.6 - 16.7% ) between competitive games 2015 ) observed large between - match ( within - player ) variation for high speed running distance ( 27.6% ; 90% confidence limits 6.9% [ forwards ] , 20.1% ; 4.1% [ backs ] ) , very high speed running distance ( 68% ; 19% , 34.1% ; 7.5% ) within rugby union . these findings question the reliability of these measures as accurate determinants of a player training load . the non - significant relationship between external load measures and measures of fitness seen in this study is in contrast to many studies that have analysed performance in other sports such as endurance running where the relationships between similar aerobic fitness variables in endurance events show very large to nearly perfect relationships ( mclaughlin et al . , 2010 ) . possible explanations of the non - significant relationships between the external measure of performance and fitness measures seen in this study can be explained by the simulated nature of match play . during competitive hurling match play greater effort may be required at a given time due to external stimuli such as standard of opposition , tactical formation or contextual factors ( paul et al . , 2015 ) . match simulations such as the hurling match play simulation protocol have been previously questioned as they allow players to pace themselves at levels that fail to replicate match play accurately . this pacing strategy can be related to the absence of opposition , tackling , tactical responsibility and game situation , all of which impact the locomotor performance and result in variability that may influence performance ( akubat et al . , 2014 ) . the impact of the above may explain the limited relationships between running performance and aerobic fitness variables observed during the current investigation . with the known limitations of analysing running performance , it may be more valuable to integrate both the external ( distance ) and internal ( itrimp ) load to provide a ratio that considers the internal load of exercise and the external output ( performance ) , thus providing a value representative of match day performance and fatigue ( akubat et al . , 2014 ) . previous studies have shown the value of the basic arbitrary itrimp unit as a marker of assessing adaptations in fitness throughout a pre - season period within professional soccer populations ( manzi et al . , 2013 ) . adding to this the integration method has been shown to have moderate to large correlations with aerobic fitness markers in a soccer population ( akubat et al . , 2014 ) . however , this study is the first to begin the process of integrating tl values in hurling . during the analysis td , hsd and sd athletes are provided with a valuable training and match day marker of the tl given banister s ( 1991 ) proposal that performance at a given time point is a result of fitness of an individual minus the accrued fatigue . the ratio provides the practitioner with a measure of the accrued fatigue at a given time point ( distance covered during the match or training session ) and the fitness measures ( itrimp ) . in addition , the temporal pattern of performance decrement has often been attributed to fatigue ( paul et al . , 2015 ) , therefore , this measure appears to have merits as a tl marker considering that it accounts for performance decrement and provides integration of this decrement with fitness measures . given the amateur nature of hurling players , frequent laboratory testing of fitness may be difficult . in addition , considering the known match to match variability in traditional external load measures such as td and hsd , the tl integration method may provide advancement in the assessment of the fitness if these measures of fitness predetermine a given performance and are reduced due to fatigue , it is reasonable to expect a performance decline . black and dobson ( 2011 ) showed that exercise induced fatigue reduced vo2peak and the ventilatory threshold showing a temporary reduction in measures of aerobic fitness . future research should be conducted during actual match play situations to assess if the integration ratio relationships hold true . moreover , there is a need for the assessment of these ratios as a marker of fatigue . by determining this , we can assess the validity of this ratio as a marker of the dose - response relationship as well as allow practitioners to become more proactive and manipulate the dose rather than reacting to the response . the current study presents additional findings to support the utilisation of integrated tl ratios in intermittent team sport environments . the findings suggest that the use of tl ratios provides data to practitioners that are correlated to aerobic fitness measures . in the current investigation , td was not significantly correlated to fitness measures i.e. vlt ( r = -0.066 ; p = 0.747 ; 95% ci : 0.014 to 0.081 ; trivial ) , vo2max ( r = 0.152 ; p = 0.458 ; 95% ci : 0.114 to 0.261 ; small ) and vobla ( r = 0.014 ; p = 0.945 ; 95% ci : -0.014 to 0.084 ; trivial ) . similar trends were seen with hsd with this external load measure not correlated to vo2max ( r = 0.086 ; p = 0.677 ; 95% ci : 0.014 to 0.092 ; trivial ) and vobla ( r = 0.076 ; p = 0.712 ; 95% ci : 0.034 to 0.090 ; trivial ) . interestingly , tl integration ratios were correlated to fitness measures more closely than external load measures . td : itrimp correlated with aerobic fitness measures i.e. vo2max ( r = 0.524 ; p = 0.006 ; 95% ci : 0.414 to 0.724 ; large ) and vobla ( r = 0.559 ; p = 0.003 ; 95% ci : 0.314 to 0.774 ; large ) . similar trends were shown for hsd : itrimp and aerobic markers for fitness measures i.e. vlt ( r = 0.502 ; p = 0.009 ; 95% ci : 0.214 to 0.861 ; large ) and vobla ( r = 0.407 ; p = 0.039 ; 95% ci : 0.204 to 0.641 ; moderate ) . the sd : itrimp showed significant correlations with vlt ( r = 0.611 ; p = 0.001 ; 95% ci : 0.414 to 0.841 ; large ) . overall , these measures support the use of integrated ratios as a method of monitoring training loads . integrated ratio measures were correlated to fitness measures , as such the use of these ratios presents advancement from the use of external load measures alone in the assessment of aerobic fitness of players .

abstractthe current study aimed to assess the relationship between the hurling player s fitness profile and integrated training load ( tl ) metrics . twenty - five hurling players performed treadmill testing for vo2max , the speed at blood lactate concentrations of 2 mmoll-1 ( vlt ) and 4 mmoll-1 ( vobla ) and the heart rate - blood lactate profile for calculation of individual training impulse ( itrimp ) . the total distance ( td ; m ) , high speed distance ( hsd ; m ) and sprint distance ( sd ; m ) covered were measured using gps technology ( 4-hz , vx sport , lower hutt , new zealand ) which allowed for the measurement of the external tl . the external tl was divided by the internal tl to form integration ratios . pearson correlation analyses allowed for the assessment of the relationships between fitness measures and the ratios to performance during simulated match play . external measures of the tl alone showed limited correlations with fitness measures . integrated tl ratios showed significant relationships with fitness measures in players . td : itrimp was correlated with aerobic fitness measures vo2max ( r = 0.524 ; p = 0.006 ; 95% ci : 0.224 to 0.754 ; large ) and vobla ( r = 0.559 ; p = 0.003 ; 95% ci : 0.254 to 0.854 ; large ) . hsd : itrimp also correlated with aerobic markers for fitness vlt ( r = 0.502 ; p = 0.009 ; 95% ci : 0.204 to 0.801 ; large ) ; vobla ( r = 0.407 ; p = 0.039 ; 95% ci : 0.024 to 0.644 ; moderate ) . interestingly sd : itrimp also showed significant correlations with vlt ( r = 0.611 ; p = 0.001 ; 95% ci : 0.324 to 0.754 ; large ) . the current study showed that tl ratios can provide practitioners with a measure of fitness as external performance alone showed limited relationships with aerobic fitness measures .

Introduction Material and Methods Participants Procedures Statistical Analysis Results Discussion Conclusions

medical experts consider skin - lightening and skin - bleaching practices as one of the most common forms of harmful body modification practices ( charles 2003 , p. 711 ) . melanie de souza argues that the desire for even - toned , blemish - free skin spans human populations . skin - lightening is just one of the multiple options for augmenting the skin s surface appearance , including but not limited to tanning , scarification , makeup , tattooing , face lifts , nose jobs , botox , lip extensions , and piercings . the desire to change skin colour from darker to lighter or from lighter to darker share an enhanced effect for the consumer , which has subjective and objective characteristics . this enhanced effect is directed to the way products are marketed that is to achieve a desirable skin colour or to improve an undesirable one . ironically , such an enhanced effect is overdetermined by inherent health risks , including skin cancers , steroid - induced acne , atrophy and telangiectasia . this practice can be traced back to colonialism , a period of institutionalised exploitation by colonists of indigenous populations . during colonisation privileged lighter skin with socioeconomic privilege . this paper traces historical events in south africa which may have aided or influenced the uptake and use of skin lightening creams . while globally , skin lighteners have been used for centuries , the earliest records of their use in south africa among black women suggest that it began in the 1950s alongside the coloured labour preference act of 1955 . this racially divisive legislation provided a distinct advantage to coloured individuals over black africans in relation to employment , accumulation of material wealth and property , and ease of movement , amongst other things . black women in the western cape province in particular , were more likely to find employment as domestic workers and cooks if they appeared to have a lighter complexion . in addition to the racial hierarchy of the apartheid state , colonial histories were dominated by subjective interpretations and morally - coded indictments of race and beauty . kenyasue smart argues that colonial vestiges cast european characteristics of whiteness with beauty and purity , while africans were characterised as demonic , ugly savages political , social and economic ideology premised on racial inferiority the legacy of apartheid in south africa coupled with westernised ideals of beauty underpins the desire to lighten as a means to overcome institutional forms of discrimination including colour stigma . former south african president thabo mbeki once referred to apartheid law ( 1948 - 1994 ) as poverty and the rule of race . apartheid was a system of governance premised on the oppression of dark - skinned populations by light populations . racial segregation occurred in almost every domain of public and private life ; wherein the minority white population received privileges and rights not available to the majority black population . simultaneously , the global media industry fuelled the notion that fair - skinned people were beautiful and thus , a standard was set for beauty . these factors together with trauma of colonization , slavery , discrimination , mistreatment , and colour rating in social class against dark skin continued to be further embedded in the psyche of those with more pigmented skin . in his book , black skin , white masks , franz fanon draws on his own experiences as a black person in a white dominated world . in his own struggles with stereotypes and prejudices fanon only wanted to be oneself with all the multiplicities , systems and contradictions of one s own ways of being , doing and knowing ( 1952 : pg . his work which can also be applied to the life of the american popular star michael jackson , describes the psychology of blackness and how notions of whiteness are internalized by colonizers as well as the manifestation thereof in the collective black psyche ( supplementary figure s1 ) . this manifests currently in the marketing of skin lightening products using terms such as bright , radiance , light and clear on the packaging because south african legislation prohibits the advertising of skin lightening products to bleach , lighten or whiten . all these factors continue to uphold white supremacy leading to a south african pigmentocratic society . paradoxically , the use of skin lightening creams increased after south africa achieved democracy in 1994 . as a result of liberation from apartheid - era legislation and racial classificatory schemes , new spaces for the expression of identity opened up . lightening in this way might be seen not in terms of black people aspiring to be white , but rather , free from the planters , where planters in this instance refers to the oppressors that rooted people to racial classificatory systems . global aesthetic regimes continue to place emphasis on , and preference for , lighter shades of brown . lighter shades of skin continue to inform beauty practices even in the context of black empowerment and afropolitan movements that continually seek to rupture colonial and western domination . consumer choice now fashions lightening as a form of human agency , where the surface of the skin can be manipulated to conform to , or resist global and local beauty standards . capitalism is thus implicated in the process of commodification identity politics . today , these socio - political influences are evident by a shared view , nahomie julien that a lighter shade of brown ( also referred to as yellow - bone ) is the most attractive skin colour . for example the magazine industry bears this out , with only one woman of colour appearing as one of the top 100 sexiest women in the global men s magazine , for him magazine ( fhm).the cosmetic industry unscrupulously advertises lightness to market products , which have the potential to endanger life . a conservative estimate proposes that 35% of south african women use skin lightening creams . in a more recent study , by ncoza dlova , which focused on the perception of possible benefits and risks associated with the use of skin lightening creams among africans and indians in durban , 32.2% of the population admitted to using skin lightening creams . the use of creams is prevalent across rural and urban demographics as well as across income and class stratification . studies located in asia , usa , u.k . , india , china and the caribbean indicate the prevalence of a thriving skin lightening cream industry . in three different african countries , the statistics demonstrate that 25% of women in bamako , mali a further 52% in dakar , senegal , and 77% in lagos , nigeria use skin lighteners . the underlying motivations to lighten skin in in south africa , as within an african context , drive our enquiry here . some people use skin lighteners to treat dermatological conditions such as hyperpigmentary melasma , age - induced darkening and acne . these treatments involve the use of hydroquinone ( hq)-containing products such as imiquimod but are under the strict guidelines of clinical use . some consumers use skin lightening products to lighten skin colour , enhance luminescence or radiance , even out skin tone , improve the texture of the skin , to satisfy peers , to satisfy ones partner and/or to attract partners and to enhance / increase employment opportunities . some studies have shown the impact of black celebrity endorsements for skin lightening products on consumer markets . for example , music celebrities like beyonce , rhianna and nicky minaj , give the impression that lighter skin is beautiful skin . even though none of these celebrities acknowledge the use of lightening products , there has been gradual lightening of their skin as can be observed in the media . while these celebrities can afford the most expensive product lines , average consumers tend to purchase creams at local suppliers , which do not comply with health regulations . some consumers make their own formulations from household products combined with skin lightening products , this in an attempt to enhance the whitening effect . this condition is characterised by localized , blue - black hyperpigmentation in the epidermis , dermis and subcutaneous layers of the skin . it is notifiable by progressive darkening in the area wherein the hydroquinone containing cream is applied . the efficacy of the majority of well - researched , marketed skin lighteners on sale at brand stores are effective when used correctly work well . the skin lighteners available in mainstream retailers are highly efficacious , but are marketed as skin toners or moisturisers . these formulations contain regulated amounts of hq and other ingredients such as retinoids and corticosteroids . according to current south african legislation , hydroquinone in skin lightening preparations it is crucial to note that the regulated formulations are sold with a product insert providing the necessary ingredient list and the correct usage , which should translate into the appropriate daily application . . lack of affordability may be one of the most significant drivers of the black market in south africa and africa where unregulated - and more affordable - products flood the market . due to the lack of product knowledge and absence of a product description , consumers rely on the reputation of the cream reinforced through positive word of mouth and consumer feedback . after the initial stages of application and resultant visible changes in complexion , consumers may apply more product than advised in a bid to make the product work faster and better . the consequence however results in irreversible damage to the skin , a condition known as exogenous ochronosis ( supplementary figure s1 ) . a more systemic , sustainable intervention is therefore needed at both the local and national governmental level before the colorism pandemic reaches exorbitant proportions . part of the solution would be an increased awareness through scientific and social engagement as well as harnessing the influential power of the media . the media s role in contributing to the positive outcome in the war against unregulated use of skin lighteners can not be overstated . the media plays an influential role in the purchase and use of skin lightening products . fairness can be portrayed as a sign of what is idealised and as a standard for beauty and competency . billboard advertising in africa for over 50 years portrayed white - skinned individuals as icons of beauty , as did the print and electronic media industries . today , in an even greater way , the media plays an influential role in how people live and how they perceive themselves . television , magazines , newspapers schoolbooks and the likes of social media platforms , facebook and twitter , ( supplementary figure s2 ) further emphasise the importance of image and beauty and how integral they are to achieving success . these platforms encourage the use of products as it presents visual stimuli where individuals with a light skin tone are portrayed as being more attractive and more likely to be successful in life . this ideology bolsters the perception that a fairer complexion is equated to material and social success ( supplementary figure s3 ) . advertisements promote the idea of fairness with slogans such as successful people , making your dreams come true , add sparkle to your life and lighter and lovelier . women claim that the way the television advertises skin lightening products , compels them to prefer lighter skin tones . commercials and advertisements for skin lightening products offer the promise of lighter , whiter skin . to tout the skin lightening products , advertisements are usually expensively produced , featuring ultra - light celebrities or super models , and presenting ( and mixing ) both traditional and westernized visual signifiers to evoke atmospheres of purity , cleanliness and sophistication ( leong , 2006 : pg . these forms of tele - marketing suggest black women are unhappy , ignored by men and they suffer from low self - esteem . ultimately , advertisements suggest , the lighter your skin , the more likely you are to find your dream occupation or even a suitable partner . when women are exposed to , or confronted with visual stimuli from the media , it creates a sense of anxiety and insecurity which results in them engaging in harmful forms of body beautification such as skin - lightening practices . well - known south african celebrities nomasonto mshoza maswanganyi ( supplementary figure s4 ) , a south african artist , bleached her skin because she was tired of being ugly ( drum , 17 november 2011 ) . other celebrities such as kelly khumalo , khanyi mbau and surisha naidoo have also been associated with lightening their skin . moving up towards upper africa the artist dencia has developed her own skin lightening product called whitenious where rumours also arise that she herself is using the product . in contrast to these celebrities encouraging skin lightening use , lupita nyongong , in her acceptance speech after winning an oscar embraced her blackness and spoke openly of her own insecurities over her dark skin and how she learned to love her skin . celebrities carry credibility and prestige , and their use of skin lighteners are perceived as being acceptable , even encouraged . consequently , consumers become obsessed with this practise because of the results obtained by its use and positive feelings associated with it . this can be attributed to the extent to which these products are marketed that is to improve appearance . this model tries to show that many variables , biological , psychological and social , interact to better understand and explain the reality of health and disease . adopting the biopsychosocial approach to or making a biopsychological review of the phenomenon of skin lightning means to underline or taking into consideration the interaction that exist between the three factors in all the process of skin bleaching : the motivation of doing it , the different practices and the effects of this practice , and even in the prevention and treatment ( support ) processes . this biological body is constructed on socio - cultural and psychological events of the individual . the skin is also a strong metaphor in the social sciences and embodies the realms of the aesthetic , political and economic , the social and cultural , and the genetic and phenotypic , as well as psychological worlds from an anthropological perspective , the skin has a physical reality as well as a social reality . the physical communicates shapes , sizes status which are then differentiated by culture . clothing on skin acts as protection even though some body parts are exposed . these shape , size and surface do have a social function which then applies to extreme forms of body mutilations such as tattooing , and piercings ( also known as cultural skins ) . these cultural skins also constitute them as being part of a group or some culture where they find a sense of belonging . helman also refers to people as social animals in the sense that they are organised into groups that regulate and perpetuate themselves . he argues that the persons experience as member of society that shapes his / her life of the world . in doing so it is believed that it is through one s culture that they organise and legitimizes their society . he describes culture as how humans organise themselves and the way they view the world which they inhabit . therefore in order to understand humans we need to study their society and their culture . terence turner s concept of social skin resonates in this case , wherein skin itself acts as an interface for political , cultural and social identity . the proliferation of skin - lightening creams emphasizes the importance of classification through skin - colour , stigma and preferences for lighter skin in an increasingly globalized world . he emphasizes that on a macro - social level , the conventionalized modifications of skin that comprise the social skin define , not individuals , but categories or classes of individuals thus claiming that the social skin becomes the boundary between social classes ( turner , 2012:503 ) . that means that the skin is an element of belonging , of classification , recognition , distinction and pride . skin bleaching is the use of cosmetics lightening products on the skin to look lighter . this practice sometime has negative effects as we said , and this effects side can have an impact on our body image and our self image the practice of skin - lightening may be deeply rooted in an individual s overall emotional and cognitive evaluation of his / her own worth ( self - esteem ) , their collections of belief about themselves and forces that influence thoughts , behaviour and personality . the desire to lighten one s skin is related to some aspects of self - hate ( extreme dislike or hatred against oneself ) and low self - esteem . even though colonialism and apartheid has the transgenerational psychological scars still persist and have been internalized by many . many women still regard lighter skin as beautiful and associated dark skin with negative connotations such as evil , disease , dirt ugliness etc . the hierarchy of women in terms of lightness of skin also known as pigmentocracy employs hegemonic ideals of beauty , influenced by the privileges of white supremacy established historically . many individual mimic the behaviour and attitudes of others with the hope of being like them . for example many women compare themselves with celebrities and turn to skin lighteners because they are dissatisfied with their appearance and are under the impression that they could be just as successful as the celebrities engaging in skin - lightening practices . in that sense skin - lightening practices can be perceived as an external ( social ) factor which dictates standards of beauty because having a light skin complexion is associated with elegance , beauty , attractiveness especially towards the opposite sex . lightness and darkness have moral connotations for example ; whiteness or lightness can be associated with youth , innocence , purity , virginity , spirituality and vulnerability , whereas darkness can refer to threat , aggression , danger , virility . individuals who are insecure , suffering from low self- esteem are more likely to engage in skin - lightening practices than those individuals who are more confident in their skin . skin lightening is a global phenomenon but has there been any attempt to reduce the practice of skin lightning ? despite the bans and existing health campaigns , the practice of skin lightening continues to grow . there is a need for greater government bans as well as control on the availability of skin lighteners , the marketing and sale thereof and well as the active ingredients found in these products . not only should government be involved , there should also be more awareness on the dangers associated with using skin lightening products . in addition social marketing in combating self - esteem issues has been proposed to reduce the risk that it may pose health risks , as they relate to skin alterations . social marketing is described as a tool that uses the concepts of commercial marketing to create positive social change . it is founded on the idea that media can shape popular perception and , thus promotes positive behaviour change by marketing ideas of products . therefore by promoting ideas around positive self - esteem , public health interventions can better address skin toning alterations . the history of skin- lightening practices were discussed by reviewing colonialism and apartheid as mediating factors in skin lightening use age . we also shed light on the reasons for skin lightening use and the dangers behind inappropriate application thereof . the media portray light skin desirable and beautiful and advertise skin lightening products as a means to solve problem skin . in their marketing strategies they use models , celebrities and high profile individuals to convey messages of lightness , beauty , wealth etc . the psychosocial effects on the consumer revealed that as a result of internalising the effects of colonialism and apartheid many individuals use skin lightening creams as a means to fit in the still much dominated white supremacy . lastly there is a great need for stricter government control and policy development in the marketing and distribution of products together with educational programmes to create awareness on the health risk posed by skin lightening products .

skin - lightening is an aesthetic practice of global concern . by adopting a biopsycho - social approach , we consider the interplay between the biological , psychological and social factors that underpin the circulation and consumption of skin lighteners in south africa . this paper reflects on biological aspects of skin lightening , interpersonal relationships , individual beliefs and expectations about the maintenance of health and well being that informs cosmetic practices . the paper seeks to examine claims made by historians ( thomas ) and political philosophers and activists ( biko ) that colonialism and apartheid in south africa historically reinforced the use of skin lightening products in the country . the paper also investigates the role of media in staking out the boundaries of beauty . we argue that men and women practice skin - lightening not only as a complex result of the internalization of global standards of beauty , but meshed with a national politics of race and colorism . banning skin lightening products without understanding the biological effects but also the social forces that underlie their increased popularity will prove futile . moreover , we must consider the immeasurable pleasures associated with lightening , and the feelings with achieving visibility in south africa , a country that continues to wrestle with blackness .

Introduction History of skin lighteners Why do people use skin lighteners? Dangers of skin lightening products Influence of the media Biopsychosocial aspects of skin bleaching Review on measures to reduce skin lightening Conclusions

interleukin 10 ( il-10 ) is a potent immunosuppressive cytokine made by regulatory t cells ( tregs ) and other cell types [ 13 ] . il-10 inhibits antigen - specific immune responses in part via suppression of activated macrophage and monocyte functions , which include cytokine synthesis and expression of class ii mhc and costimulatory molecules such as il-12 and cd80/cd86 . endogenous il-10 production is correlated with transplant acceptance in multiple animal models and human tissues [ 58 ] . il-10 has been evaluated as a treatment to improve the survival of engrafted islets , which has been accomplished by transfer of il-10-producing tregs , gene therapy [ 9 , 10 ] or direct administration of il-10 alone , or in conjunction with immunomodulatory drugs [ 1113 ] . it is noteworthy that systemic il-10 treatment has failed to support islet engraftment in mice in the setting of established autoimmunity and may induce immune suppression . these results suggest that an alternative approach that provides a sustained , local presence of il-10 at the graft site might be more effective at preventing islet rejection . we recently reported a role for the extracellular matrix ( ecm ) macromolecule hyaluronan ( ha ) in regulating il-10 production by t cells . ha is a simple , long - chain glycosaminoglycan polymer made up of repeating disaccharides of n - acetyl glucosamine and glucuronic acid . ha is an important structural component of many tissues , but also has important roles in inflammation and tissue repair [ 1518 ] . short ha oligomers ( < 30 kda ) generated through tissue catabolism are typically proinflammatory [ 1618 ] . conversely , plate - bound ha or chemically crosslinked ha is anti - inflammatory and promotes il-10 production by foxp3(+ ) natural tregs ( ntregs ) and conventional t cells in vitro . induction of il-10 in these systems was mediated by crosslinking of cd44 , the primary receptor for ha . we have proposed that plate - bound ha and ha hydrogels may function as biomimetics of ha - containing tissue matrices . however , the minimum size for ha - mediated cd44 crosslinking and il-10 production by t cells is unknown . additional support for a role for ha in il-10 production is provided by observations of ha - induced upregulation of il-10 by cultured synoviocytes and elevated il-10 levels in intestinal biopsies of mice given oral ha . however , ha alone does not appear to promote il-10 induction by t cells in vitro . indeed , our data suggest that concomitant antigenic stimulation through the t cell receptor ( tcr ) complex is required for efficient il-10 induction in the presence of ha . ha preparations are currently used as treatments for arthritis , atopic dermatitis , prevention of abdominal adhesions [ 25 , 26 ] and are under evaluation as an experimental treatment for burns and wounds [ 27 , 28 ] . in most of these preparations , crosslinking ( as well as plate - binding or sustained release from alginate ) may also limit the generation of pro - inflammatory ha fragments . building upon these findings , we have evaluated whether ha has utility in promoting il-10 production in vivo . here , we describe and evaluate a pair of technologies that both provide antigenic stimulation in the context of ha . first , we have asked whether cells implanted within a crosslinked ha hydrogel that incorporates a supplemental complex to induce polyclonal tcr stimulation could enhance production of il-10 in vivo . second , we have developed a bioengineered implant capable of delivering an antigenic signal along with sustained release of ha in fluid form . these technologies represent parallel strategies for delivering ha as a medium to promote il-10 production in vivo , with the ultimate objective of inducing durable immune tolerance to transplanted islets in individuals with autoimmune diabetes . c57bl/6 green fluorescent protein ( gfp)-foxp3 knock - in and ripmova / rag2 mice were the kind gifts of dr . a. rudensky ( memorial sloan - kettering cancer center , new york , ny , usa ) and dr . all mice were maintained in a specific pathogen - free , aaalac - accredited facility at bri , and all experiments were approved by the bri institutional animal care and use committee ( iacuc ) , protocol approval number 10116 . mouse lymphocyte populations were prepared as previously described . in brief , for the in vitro experiments , cd4(+ ) cells were isolated using macs kits ( miltenyi , inc . ) , and the gfp - foxp3( ) fraction was isolated from the cd4(+ ) population using a facs vantage cell - sorter ( bd biosciences ) . cd4(+)/gfp - foxp3( ) t cells were used to ensure that any il-10 production we measured would be from conventional t cells , rather than from activated gfp - foxp3(+ ) ntregs . cells were cultured in opti - mem ( invitrogen ) serum - free media supplemented with 100 g / ml penicillin and 100 u / ml streptomycin ( p / s ) . where specifically noted , cells were cultured in complete media consisting of dulbecco 's modified eagle 's medium ( dmem)-10 ( invitrogen ) supplemented with 10% fetal bovine serum ( fbs ) ( hyclone ) , p / s , 50 m -mercaptoethanol , 2 mm glutamine , and 1 mm na pyruvate ( invitrogen ) . cell culture plates ( 96-well ) were coated with 0.5 g / ml of anti - cd3 antibody ( 145 - 2c11 , bd biosciences ) , washed , and then subsequently coated with either 0.2 mg / ml bovine serum albumin ( bsa)- conjugated ha ( 1.5 10 da ) ha ( genzyme ) or 10% bsa . cd4(+)/gfp - foxp3( ) t cells ( 2 10 per well ) were cultured for 96 hours on these plates , followed by collection of the culture supernatants for analysis . measurement of cytokines in the cell culture supernatants was performed using enzyme - linked immunosorbent assays ( elisas ) or cytometric bead assays ( bd biosciences ) . hydrogels were made from thiolated constituents ( ha , heparin sulfate [ hs ] , and collagen ) crosslinked with polyethylene glycol s - s diacrylate ( pegssda ) . these reagents are available as a kit ( extracel - hp , glycosan / biotime ) and were used per the manufacturer 's instructions . of note , our understanding from communications with the manufacturer is that ha of > 1 10 da is used in the kits . prior to addition of the crosslinker , the mixture was supplemented with 10 g / ml of streptavidin ( sigma aldrich ) , 10 g / ml each of biotinylated anti - cd3 and anti - cd28 antibodies ( 145 - 2c11 , 37.51 , bd biosciences ) , and 20 iu / ml of il-2 . hydrogels of this formulation are referred to here as supplemented ha hydrogels . for in vitro cell culture experiments , 2 10 cd4(+)/gfp - foxp3( ) t cells were layered on top of 25 l volumes of the hydrogel . after 96 hours of culture , cells and culture supernates were collected for analysis . to control the collagen constituent of the ha hydrogels , a set of hydrogels lacking ha / hs was made by replacing the thiolated ha / hs with an equivalent volume of thiolated collagen . 3 10 cd4(+)/gfp - foxp3( ) t cells were dispersed in supplemented ha hydrogels of 300 l volume prior to crosslinking with pegssda , which was initiated 30 min prior to intraperitoneal injection into mice . for these studies in vivo , the supplemented ha hydrogels incorporated 360 iu / ml of il-2 . four days after injection of the supplemented ha hydrogels , the mice were sacrificed and lymphoid tissues were harvested . residual hydrogel material in the peritoneal cavity was also removed and dissolved by mild reduction of the pegssda ( per the manufacturer 's instructions ) in order to retrieve cells for analysis . intracellular staining of these cells for il-10 and subsequent flow cytometry assays utilized antibodies and equipment as previously described . briefly , c57bl/6 mice of 1224 weeks age were anesthetized with 2,2,2-tribromoethanol in phosphate - buffered saline ( pbs ) . the descending aorta of each anesthetized mouse was transected , the bile duct clamped at its distal ( intestinal ) end , and a 30-gauge needle was used to inflate each pancreas through the common bile duct with 4 ml of 4c islet medium comprised of rpmi 1640 containing 1.0 g nahco3 , 10% fbs ( atlanta biologicals , cat . number s12450h ) , 1 mm na - pyruvate , and p / s . the islet medium was supplemented with 0.8 mg / ml of collagenase p ( roche , cat . number 11 - 249 - 002 - 001 ) and filtered at 0.22 m prior to injection . subsequently , 2 - 3 excised pancreata were placed in separate 50 ml conical centrifuge tubes and incubated in 5 ml of islet medium for 13 min at 37c . the medium was then decanted , fresh 4c islet medium was added , and the tubes were shaken vigorously to disrupt the pancreata . the tissue suspensions were filtered through a 30-mesh metal screen to remove large debris , the filtrates were pelleted by centrifugation , and the pellets resuspended in 4c islet medium . the resuspended material was centrifuged through histopaque 1077 to isolate the islets , which were washed , resuspended in islet medium , and placed in a tissue culture ( tc ) incubator . after all pancreata were processed , the isolated islets were hand picked , cultured overnight , and picked again the next day before being placed in bioengineered implants . biopsy punches ( sklar instruments ) were used to cut 10 mm diameter disks from 2 mm thick sheets of pva sponge ( type cf90 , 500 m average pore size with no surfactant treatment a generous gift from merocel / medtronic , inc . ) . subsequently , each disk was through - punched with a single central hole of 2 mm diameter and six peripheral holes of 1.5 mm diameter , using correspondingly sized biopsy punches ( acuderm , inc . ) . the punched disks were washed 5 10 min on a rocker in 50 ml centrifuge tubes filled with 40 ml of sterile distilled water , then air - dried on whatman filter paper , transferred to 60 mm dishes , sterilized by gamma irradiation , and stored until needed for bi assembly . one volume of a stock solution of rat tail native type i collagen in dilute ( 0.02 n ) acetic acid ( bd biosciences ) was combined with 1/9 volume of 10-strength nahco3-saturated medium 199 ( invitrogen ) and sufficient dmem and normal mouse serum ( nms ) to yield a working solution containing 2.5 mg / ml collagen and 10% nms . the working solution was prepared just prior to assembly of the bis and kept on ice until needed . number a0682 ) , filtered at 0.45 m , was used for preparation of spheres for sustained release of vascular endothelial growth factor ( vegf ) and ha . briefly , a mixture of 2% alginate and 5 ng/l vegf was formed into 10 l ( 2.2 mm diameter ) spheres using a gravity - drop method , crosslinked into a hydrogel for 15 min in 0.1 m cacl2 , washed 2 2 min in 0.15 m nacl/25 mm hepes/2 mm cacl2 , ph 7.2 ( saline / hepes / ca ) , transferred to serum - free dmem / p / s , and kept in a tissue culture incubator until needed for bi assembly . fabrication of ha spheres was similar to that of the vegf constructs , with replacement of the vegf with 50 g of 120 kda ha ( genzyme ) . ha of this size ( approximately 317 disaccharide units ) was chosen to facilitate a complete delivery of ha from the spheres within a 2 week experimental time period . dry pva sponge scaffolds were allowed to swell for 5 min in sterile dmem / p / s . subsequently , a single , freshly prepared alginate sphere containing vegf and five spheres containing ha were gently pressed into the 6 peripheral holes of each expanded scaffold . the scaffolds were then blotted on sterile whatman filter paper , transferred to 60 mm plastic cell culture dishes lined with uv - sterilized parafilm m , and flooded with 60 l of type i collagen working solution containing suspended islets . the pva sponges absorbed the collagen solution , with the majority of the islets entering the 2 mm diameter central hole of the scaffold . subsequently , the dishes were covered with dish tops ( lined with moist filter paper ) and placed in a tissue culture incubator for 30 min to polymerize the collagen into a hydrogel . the completed bis were placed in dmem/10% nms / p / s in 24-well cell culture plates and kept in a tissue culture incubator prior to implantation in mice . to measure the kinetics of release of ha from alginate hydrogels in vitro , spheres containing 2% alginate and 2.5 g of fluorescein isothiocyanate ( fitc)-conjugated 120 kda ha or 1.5 10 da ha were prepared as described previously . the spheres were placed in 96-well cell culture plates ( one sphere per well ) that had each of the wells filled with 200 l of dulbecco 's ca / mg pbs ( dpbs ca / mg , invitrogen ) . the plates were placed in a tissue culture incubator , and 100 l volumes of the media were removed from each well at specific time points ( up to 14 days ) and analyzed by fluorescence spectrophotometry to quantify released fitc - ha , using a standard curve of fluorescence versus known concentration of fitc - ha . following removal of the medium at each time point , the residual medium in each well was discarded , and each well was refilled with 200 l of fresh medium . to determine the percentage of ha retained in alginate spheres during their fabrication , freshly prepared spheres containing 2.5 g of fitc - ha were dissolved in pbs/100 mm ethylenediaminetetraacetic acid ( edta ) , and the resultant solution was analyzed by fluorescence spectrophotometry to quantify total fitc - ha per sphere . bis were implanted into mesenteric pockets of ripmova / rag2 mice ( one bi per mouse ) using previously described protocols , followed by injection of the mice 24 hours later with 1 10 purified ova - specific cd4(+ ) do11.10 t cells we previously demonstrated that plate - bound ha together with an antigenic signal promotes il-10 production by cd4(+)/gfp - foxp3( ) t cells . this led us to ask whether we could develop this finding into a tool for use in promoting il-10 production in vivo . to this end , we modified a ha - based hydrogel to deliver a polyclonal antigenic stimulus through addition of streptavidin , biotinylated anti - cd3/cd28 antibodies , and il-2 . we have previously shown that a similar form of supplemented ha hydrogel is an efficient way to elicit il-10 production from t cells in vitro . we found that cd4(+)/gfp - foxp3( ) t cells exposed to the supplemented ha hydrogels produced il-10 at significantly higher levels than did corresponding t cells activated with anti - cd3/cd28 antibodies and il-2 on cell culture plates ( figure 1(b ) ) . this was the case whether the cells were cultured on top of the gels ( as shown ) or embedded within the gels ( data not shown ) . omission of either streptavidin or anti - cd3 antibody from the gel mixture likewise abrogated il-10 production ( data not shown ) , indicating that cd3 was required for the stimulus and suggesting that streptavidin was necessary to retain cd3 in the hydrogel lattice . streptavidin , biotinylated anti - cd3/cd28 antibodies , and il-2 incorporated into a hydrogel lacking ha ( supplemented collagen hydrogel ) did not significantly increase il-10 production over plate - bound activation by these agents ( figure 1(b ) ) , which demonstrated the potentiating influence of ha on il-10 production . the unique capability of ha to stimulate il-10 production by t cells is underscored by the observation that hydrogels made from other types of ecm , including basement membrane components ( matrigel ) and fibrin , are not stimulatory in vitro . to evaluate whether supplemented ha hydrogels could be used to induce il-10 production in vivo , the gels were populated with 3 10 cd4(+)/gfp - foxp3( ) t cells from cd45.2 mice and injected into the peritoneal cavities of cd45.1 mice . by use of the cd45.1 and cd45.2 allelic markers four days after implantation , spleens and lymph nodes were harvested , processed , the released cells stained for intracellular il-10 and cd markers , and gating performed to distinguish donor t cells from host t cells ( figure 2(b ) ) . as controls , analogous supplemented collagen hydrogels lacking ha were populated with cells and injected into a designated set of mice . after 4 days , a substantial volume of residual ha hydrogel was found within the peritoneal cavities of the treated mice ; however , the control collagen hydrogels had dissolved . in separate experiments , we found that after 7 days no implanted ha hydrogels were identifiable , indicating that extensive catabolism of the hydrogels takes place in vivo . the cells within the ha hydrogel residue 4 days after implantation were primarily cd45.2(+ ) and expressed il-10 at a high level relative to host t cells from the spleen ( figure 2(c ) ) . these cells remained foxp3( ) ( data not shown ) , consistent with our previous report that ha does not induce foxp3 expression . cell isolates from the spleens and lymph nodes of the transplanted mice contained cd45.2(+ ) donor t cells ( figure 2(d ) ) , which indicated that the t cells embedded in the hydrogels had migrated into lymphoid tissues . donor t cells that migrated from the supplemented ha hydrogels expressed higher levels of il-10 than the corresponding donor t cells that migrated from the control collagen hydrogels . host t cells from these two groups of mice did not express il-10 above levels of the nonspecific antibody controls ( figure 2(d ) ) . these data indicate that ha hydrogels providing endogenous tcr stimuli can be used as platforms to induce il-10 production in vivo . while supplemented ha hydrogels are a novel system for inducing implantable t cell populations that produce il-10 , we sought to devise an implantable platform that would elicit il-10 production from endogenous t cells in an antigen - specific manner . to this end , we adapted a novel bioengineered implant ( bi ) we had developed from an earlier study to combine the antigenic stimulus with sustained release of ha within the same construct . we recently reported on the development of the bi as a model system to explore improved approaches for islet transplantation . the bi , sized for mesenteric or subcutaneous implantation in mice , consists of a disk - shaped pva sponge infused with a type i collagen hydrogel that contains dispersed donor islets . to promote islet vascularization previously , we used syngeneic mice to demonstrate that bis containing 450500 islets and 20 ng of vegf could reverse streptozotocin ( stz)-induced diabetes in 100% of recipients . notably , none of these mice required exogenous insulin therapy once the bis began to fully regulate levels of blood glucose . moreover , the transplanted mice responded to glucose challenge in a near - normal manner . induction of pro - tolerogenic cytokines , such as il-10 , is an appealing strategy to help facilitate transplantation of islets . here , we have adapted our bi device to evaluate the capacity of ha in fluid form ( i.e. , ha not crosslinked to form a hydrogel ) to elicit il-10 production in an autoimmune setting . to test this model , we loaded the bi with islets expressing the ova antigen , transferred in ova - specific t cells , immunized the recipient mice with ova , and asked whether these cells expressed il-10 in an ova or tcr - specific manner . we first evaluated the kinetics of release of ha from 2 mm diameter , 2% alginate spheres under physiological conditions in vitro ( figure 3 ) . we found that release of 1.5 10 da ha was linear , but relatively slow in contrast , the release of 120 kda ha was much more rapid essentially 100% was released within 14 days , which was a useful time frame in which to analyze post - transplantation immune responses . we found that over 60% ( 63.7% 6.1% ) of the 120 kda ha loaded into each sphere was retained by the alginate after crosslinking with calcium . the bis we designed for our experiments in vivo ( figure 4 ) incorporated a single alginate sphere containing 20 ng of vegf and 5 spheres that contained a total of 160 g of 120 kda ha ( the total is derived from a value of 32 g of ha per sphere , based on 64% retention of the 50 g of ha present in each sphere prior to calcium crosslinking ) . a set of control bis incorporated one vegf sphere and 5 spheres loaded with saline in place of the ha . the central hole of the bi was infused with a type i collagen hydrogel containing islets from ripmova mice , which express chicken ovalbumin driven by the rat insulin promoter ( rip ) . bis of this design were implanted into mesenteric pockets of ripmova / rag2 mice ( one bi per mouse ) , followed by injection of the mice 24 hours later with 1 10 purified ova - specific cd4(+ ) do11.10 t cells . forty - eight hours after implantation , each mouse was immunized with 100 g of ova peptide ( aa 323339 ) . on day 14 after implantation , splenocytes were isolated from the mice and assayed for il-10 production in vitro after 96 hours of stimulation with either anti - cd3/anti - cd28 antibodies or antigen - specific ova peptide ( figure 5(a ) ) . in this assay , the splenocytes from the mice treated with ha produced more il-10 than the splenocytes from the control mice that were not exposed to ha . this differential response was observed when the splenocytes were given either a nonspecific stimulus with cd3/cd28 ( figure 5(b ) ) or a specific stimulus with ova peptide ( figure 5(c ) ) . unfortunately , these data do not allow us to discern which cells are the source of il-10 in this assay and specifically whether the cells in question are foxp3(+ ) tregs or foxp3( ) conventional t cells . we demonstrate , using two separate model systems , that delivery of ha together with antigenic signals promotes the production of il-10 in vivo . our data suggest a potential clinical application for ha - mediated induction of il-10-producing t cells using injectable hydrogels . ha hydrogel platforms are in development for a variety of applications , including drug delivery and wound dressings , and are noted for their biocompatibility [ 31 , 32 ] . in the present study , we have shown that augmentation of ha hydrogels with a complex of biomolecules that provide tcr stimulation in addition to the ha signal can deliver the requisite cues for il-10 induction , both in vitro and in vivo . in treatments of diabetic patients that involve transplantation of islets , controlling rejection levels must be low enough to permit a reasonable degree of protective immunity against pathogenic organisms , but high enough to effectively suppress allo- and autoimmune activity . in the case of simultaneous pancreas - kidney ( spk ) transplants , some current immunosuppression regimens are inadequate to control autoimmunity [ 33 , 34 ] . moreover , no matter what the dose , systemic immunosuppression can be accompanied by a variety of undesirable side - effects on tissue and organ systems that are not directly associated with the transplant . in light of the problems associated with systemic treatments , an alternative approach would be to confine the delivery of immunotherapy to the implant itself . in this way , immunomodulatory compounds could be delivered at relatively high concentrations , but within the limited volume of the implant , thereby minimizing side - effects on tissues and organs outside the zone of delivery . to this end , the bi described here includes a mechanically - supportive scaffold and ecm hydrogel that concentrates the islets in a small volume , and a sustained - release component for local delivery of immunomodulatory compounds . in the present study , we have adapted our bi to release ha in fluid form . rather than using ha of 11.5 10 da that is typically incorporated into ha hydrogels , we used ha with a 10-fold lower mw ( 120 kda ) to provide release kinetics that were optimal for the 14-day duration of our experiments in vivo . of note , we observed that this shorter ha could induce an il-10 response from host mice . to our knowledge , this observation is the first demonstration of il-10 production by ha of this weight class . it is possible that the 120 kda ha is crosslinked into higher mw forms after its release into tissue from alginate , which could be accomplished by ha - binding molecules such as inter - alpha - trypsin inhibitor ( ii ) and/or tumor necrosis factor - stimulated gene-6 protein ( tsg-6 ) which are present at sites of inflammation and which are known to crosslink ha into macromolecular assemblies [ 3537 ] . such crosslinking could result not only in a functional increase in the mw of ha , but also promote the retention of ha in the fibrovascular tissue that invades the bi and in the tissues immediately surrounding the implant . our future studies will continue to use bis as platforms to evaluate the effectiveness of ha and other specific ecm and cytokine environments on islet survival and reversal of diabetes in the setting of autoimmunity .

local induction of pro - tolerogenic cytokines , such as il-10 , is an appealing strategy to help facilitate transplantation of islets and other tissues . here , we describe a pair of implantable devices that capitalize on our recent finding that hyaluronan ( ha ) promotes il-10 production by activated t cells . the first device is an injectable hydrogel made of crosslinked ha and heparan sulfate loaded with anti - cd3/anti - cd28 antibodies and il-2 . t cells embedded within this hydrogel prior to polymerization go on to produce il-10 in vivo . the second device is a bioengineered implant consisting of a polyvinyl alcohol sponge scaffold , supportive collagen hydrogel , and alginate spheres mediating sustained release of ha in fluid form . pancreatic islets that expressed ovalbumin ( ova ) antigen were implanted within this device for 14 days into immunodeficient mice that received ova - specific do.11.10 t cells and a subsequent immunization with ova peptide . splenocytes harvested from these mice produced il-10 upon re - challenge with ova or anti - cd3 antibodies . both of these devices represent model systems that will be used , in future studies , to further evaluate il-10 induction by ha , with the objective of improving the survival and function of transplanted islets in the setting of autoimmune ( type 1 ) diabetes .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

long term use of chronic oral anticoagulants can be complicated by anticoagulation associated intracranial hemorrhage ( aaich ) , the most devastating complication of anticoagulant therapy . among patients who received anticoagulant for management of thromboembolic problems , intracranial hemorrhages led to approximately 90% of deaths and major disability in survivors5 ) . rapid reversal is essential for prevention of enlargement of the aaich , which could result in brain herniation . on the other hand , reversal and discontinuance of anticoagulant can result in development of several kinds of side effects , such as thromboembolic complication . the risk and incidence of thromboembolic complication after cessation of anticoagulation in korean society have not been accurately reported ; in addition , there is no consensus regarding the proper period for withholding anticoagulant in the case of these patients . based on results of other studies , discontinuation for seven to 10 days appears to be safe2 ) . however , this has limitation as a proper guideline because these data were reported from small western retrospective series3,6,11 ) . in this study , we discussed reasonable access for management of patients with aaich who are at a high thromboembolic risk in the view of using an anticoagulant . from january 2008 to december 2012 , 47 patients with warfarin associated intracranial hemorrhage were admitted to a single neurological institution . eleven patients ( 23.4% ) died due to an initial massive hematoma and were excluded from this study . of the remaining 36 patients , 19 patients were not restarted with anticoagulant due to high risk of rebleeding and 17 patients were restarted with anticoagulant at a different time depending on each patient 's condition . restarting of drug was decided after consultation with the doctor who treated the patients due to the underlying disease . however , they did not give a clear answer regarding when the drug should be restarted after hemorrhage . if the rebleeding risk was greater than the thromboembolic risk , anticoagulants were not restarted . for these reasons , underlying disease to get oral anticoagulant , presenting hemorrhage type , thromboembolic risk factors , event day international normalized ratio ( inr ) , prothrombin time ( pt ) , and thromboembolic complication after cessation of anticoagulation were investigated . data analysis was performed retrospectively using the statistical package for the social sciences ( spss ) version 20.0 ( spss inc . , descriptive statistics were performed for determination of the influence of clinical factors on development of thromboembolic events in the non - restarted anticoagulant group . the kaplan - meier method was used to assess the incidence and probability of thromboembolic events in patients with passage of time . we need to identify the exact degree of thromboembolic risk in the patients ' group in order to obtain objective validity when comparing the results with those of other authors . in this study the cha2ds2-vasc [ congestive heart failure / left ventricular dysfunction , hypertension , age 75 ( double ) , diabetes , stroke ( double)-vascular disease , age 65 - 74 , and sex category ( female ) ] has been used in multiple cohorts and is better at identifying patients with true risk . the score is inclusive of the most common risk factors for stroke in everyday clinical practice4,8 ) . from january 2008 to december 2012 , 47 patients with warfarin associated intracranial hemorrhage were admitted to a single neurological institution . eleven patients ( 23.4% ) died due to an initial massive hematoma and were excluded from this study . of the remaining 36 patients , 19 patients were not restarted with anticoagulant due to high risk of rebleeding and 17 patients were restarted with anticoagulant at a different time depending on each patient 's condition . restarting of drug was decided after consultation with the doctor who treated the patients due to the underlying disease . however , they did not give a clear answer regarding when the drug should be restarted after hemorrhage . if the rebleeding risk was greater than the thromboembolic risk , anticoagulants were not restarted . for these reasons , underlying disease to get oral anticoagulant , presenting hemorrhage type , thromboembolic risk factors , event day international normalized ratio ( inr ) , prothrombin time ( pt ) , and thromboembolic complication after cessation of anticoagulation were investigated . data analysis was performed retrospectively using the statistical package for the social sciences ( spss ) version 20.0 ( spss inc . , descriptive statistics were performed for determination of the influence of clinical factors on development of thromboembolic events in the non - restarted anticoagulant group . the kaplan - meier method was used to assess the incidence and probability of thromboembolic events in patients with passage of time . we need to identify the exact degree of thromboembolic risk in the patients ' group in order to obtain objective validity when comparing the results with those of other authors . in this study the cha2ds2-vasc [ congestive heart failure / left ventricular dysfunction , hypertension , age 75 ( double ) , diabetes , stroke ( double)-vascular disease , age 65 - 74 , and sex category ( female ) ] has been used in multiple cohorts and is better at identifying patients with true risk . the score is inclusive of the most common risk factors for stroke in everyday clinical practice4,8 ) . the demographic and clinical characteristics of 19 patients in whom anticoagulants were not started are shown in table 1 and 2 . the most common type of aaich was spontaneous hemorrhage , which presented in eight cases ( 42.1% ) . acute subdural hematoma was the next main type of aaich in five cases ( 21.1% ) . the mean discontinuance time of the anticoagulant was 475.79682.49 days ( range , 8 - 1813 days ) . there were eight cases ( 42.1% ) with thromboembolic complications , three of which ( 37.5% ) resulted in death . two deaths were caused by sudden cardiac arrest , which was suspected with acute myocardial infarction , and another patient died of pulmonary thromboembolism . among the survivors , deep venous thrombosis followed by intravenous filter insertion occurred in two cases and another two patients presented with angina pectoris . and non - fetal pulmonary embolism occurred in one case . mean time to occurrence of thromboembolic complication was 21.3814.89 days ( range , 8 - 56 days ) . the probabilities of having thromboembolic complications at 7 , 14 , and 30 days following cessation of warfarin therapy were 0.0% ( 95% confidence interval , 0.00 - 20.92% ) , 10.53% ( 95% confidence interval , 1.84 - 34.54% ) , and 38.49% ( 95% confidence interval , 18.42 - 62.85% ) , respectively ( fig . the inr showed a gradual decrease to the normal range , and then thromboembolic complications started to occur after a few days . from the result , we found that all thromboembolic complications and death occurred after seven days in all cases , and most of these thromboembolic complications tended to be concentrated between one and two weeks . this study provided the longest follow up data on discontinuance of anticoagulant in patients presenting with aaich who have been at high thromboembolic risk estimated by cha2ds2-vasc score in korean society . first , discontinuance of the anticoagulant is common in aaich patients in the actual clinical field . proper restart of warfarin treatment after aaich was not prescribed for almost half of patients ( 47.2% , 17/36 ) . aaich induced mortality is very high and survivors from initial neurological damage are faced with the decision of whether or not to restart anticoagulan3,5 ) . however , proper use of anticoagulant in patients with aaich has not yet been established , and guidelines could not be obtained from a limited number of previous retrospective series3,6,11 ) . according to american heart association recommendations , in patients with a very high risk of thromboembolism in whom restarting warfarin is considered , warfarin therapy may be restarted at seven to 10 days since onset of the original hemorrhage2 ) . in this study , the consensus of the resumption of anticoagulant in aaich patients is not clear in our institution . decisions regarding to the starting time of anticoagulant were differed significantly among physicians due to the fact . and available data for determination of the optimal timing and dosage for restarting anticoagulation following an episode of aaich are inadequate . second , in this study , short duration ( within 7 days ) discontinuance of anticoagulants was relatively safe , similar to the result of a previous study series . kawamata et al.7 ) found no cases of ischemic stroke when warfarin treatment was discontinued for three days in 27 patients with aaich . tinker et al.10 ) retrospectively reviewed the risk of discontinuing warfarin therapy in 159 patients with mechanical heart valves undergoing elective surgery ; none of the patients had in - hospital thromboembolic complications . ananthasubramaniam et al.1 ) also reported that no thromboembolic complications occurred in 24 patients with prosthetic heart valves after withholding anticoagulant for an average of 15 days . like these previous studies , in this study , there was also no occurrence of thromboembolic complications within seven days since aaich . although a temporary withdrawal of anticoagulants within seven days may be safe , prolonged cessation could lead to catastrophic results . we found that thromboembolic complications begin to occur after seven days and the incidence shows a rapid increase around 14 days later . however , additional events occurred after two weeks . overall occurrence of thromboembolic complications was 42.1% ( 8/19 ) , higher than that reported in previous series1 ) . first , the time for withdrawal of anticoagulant was long , compared to the previous reports . in previous studies1 ) , anticoagulant was restarted within at least two weeks after a hemorrhagic event . the inr in patients with thromboembolic complication showed a gradual reduction and it fell below the normal range on ictus days . because the thromboembolic risk was accumulated after cessation of anticoagulants , second , the patients belonged to a very high risk group for occurrence of thromboembolic events . the cha2ds2-vasc score has been used in multiple cohorts for measurement of severity and for better identification of patients with true risk4 ) . the score includes the most common risk factors related to stroke in everyday clinical practice . among patients with cha2ds2-vasc score=2 , the incidence of thromboembolic complication in one year is 2.69% and the rate increased by 3.20% at a score of 3 points . for prevention of thromboembolism , anticoagulants are recommended for patients with a score of more than 2 points9 ) . in this study , the cha2ds2-vasc score was more than 2 points for all patients ( 2 points in three cases , 3 points in five , and 4 and 5 points in one case each ) , indicating that the patient has a high underlying thromboembolic risk . otherwise , previous reports did not objectively demonstrate the patients ' underlying thromboembolic risk , causing difficulty in comparison and analysis of results between studies . the limitation of this study is the retrospective design with a very small number of cases . however , the incidence of patients who did not restart anticoagulation after aaich was very low . over the past five years discontinuance of anticoagulant within seven days presented a relatively low incidence of thromboembolic complications in patients with aaich at a high thromboembolic risk ( cha2ds2-vasc score > 2 ) , and withdrawal of more than seven days may increase the risk of devastating results . we think that short term discontinuance of anticoagulant limited within seven days appears to be safe in korean people . unfortunately , this study was conducted retrospectively in a small number of cases of aaich and has several limitations to understanding . for a more reasonable and acceptable guideline on the use of anticoagulant in patients with aaich , conduct of further studies will be required .

objectivethere was no abundance of data on the use of anticoagulant in patients with previous high risk of thromboembolic conditions under a newly developed intracranial hemorrhage in korean society . the purpose of this study was to evaluate the safety of discontinuance and suggest the proper time period for discontinuance of anticoagulant among these patients.methodswe reviewed the medical records of 19 patients who took anticoagulant because of thromboembolic problems and were admitted to our department with newly developed anticoagulation associated intracranial hemorrhage ( aaich ) , and stopped taking medicine due to concern of rebleeding from january 2008 to december 2012 . analysis of the incidence of thromboembolic complications and proper withdrawal time of anticoagulant was performed using the kaplan - meier method.resultsour patients showed high risk for thromboembolic complication . the cha2ds2-vasc score ranged from two to five . thromboembolic complication occurred in eight ( 42.1% ) out of 19 patients without restarting anticoagulant since the initial hemorrhage . among them , three patients ( 37.5% ) died from direct thromboembolic complications . mean time to outbreak of thromboembolic complication was 21.3814.89 days ( range , 8 - 56 days ) . the probability of thromboembolic complications at 7 , 14 , and 30 days since cessation of anticoagulation was 0.00 , 10.53 , and 38.49% , respectively.conclusionshort term discontinuance of anticoagulant within seven days in patients with aaich who are at high embolic risk ( cha2ds2-vasc score > 2 ) appears to be relatively safe in korean people . however , prolonged cessation ( more than seven days ) may result in increased incidence of catastrophic thromboembolic complications .

INTRODUCTION MATERIALS AND METHODS Patient selection Statistical analysis CHA RESULTS DISCUSSION CONCLUSION

world health organization 's ( who ) international standards of 1958 and 1963 referred to fluoride for drinking water , claiming that consumption of water with fluoride concentrations above 1.01.5 mg / l can result in pathological changes in teeth causing dental fluorosis ( df ) , which is characterized by light yellow to brown black horizontal lines on the teeth surface and chipped off edges . high concentrations of fluoride can also produce long - term bone damage in children and adults such as skeletal fluorosis . traditionally , dental fluorosis has been connected with a higher intake of fluoride coming from drinking water , which may contain high fluoride concentrations , especially in groundwater of areas of volcanic rocks . these high - risk areas are mostly located in arid and semi - arid regions that are characterized by a rapid rate of chemical weathering of geological materials . according to the who , permissible fluoride concentration limit in drinking water is 1.0 mg / l , and mexican normativity stipulates a limit of 1.5 mg / l . nonetheless , in mexico , there are some areas that have high amounts of fluoride in water , mainly in the states of the north and center of the country , most notably in chihuahua , durango , aguascalientes , and guanajuato . fluoride ingested remains for a long time in the human body , however , approximately 80% of fluoride entering the body is excreted mainly through urine ; the rest of it is absorbed into body tissues from where it is released very slowly . excreted fluoride can be monitored by biomarkers of fluoride , which are values that serve to identify deficient or excessive consumption and bioavailability of fluoride in the body . who defines different fluoride biomarkers ; current ( urine , plasma , and saliva ) , recent ( nails and hair ) , and historical biomarkers ( bones and teeth ) . urine fluoride concentration among the biomarkers of fluoride exposure is generally accepted as the best indicator of fluoride exposure because it can be recollected noninvasively and systematically reflects the burden of fluoride exposure from drinking water . hence , special attention has been given to it as a biomarker , and is used as an indirect indicator of fluoride intake . official mexican norms ( nom-013-ssa2 - 1994 ) stipulates , periodically monitoring urine fluoride concentration has been stipulated ; nonetheless , there is scarce data regarding df prevalence and urinary fluoride excretion in adolescents living in rural communities with no central water supplies and where concentrations of fluoride may be above optimal . this descriptive study aimed to assess urinary fluoride concentration in a community where water supplies contain higher amounts of fluoride than recommended . this cross - sectional study was conducted in an endemic fluorosis area in guanajuato state where natural high concentrations of fluoride in groundwater and endemic dental fluorosis have been reported . areas with the highest concentration of fluoride are located toward the northwest between san felipe , san luis de la paz , and dolores hidalgo . participants were individuals aged 1120 years who were born and had resided in the area since their birth . a questionnaire was administered to all the participants at the time of admission to collect demographic data . fejerskov index ( tfi ) , which was selected because of its accuracy to identify df severity . one trained examiner performed clinical evaluations ; previously intraexaminer reliability was assessed using the kappa test ( kappa value = 0.82 ) . anthropometric measures such as weight and height were registered , and using these data body mass index ( bmi ) was calculated . percentage of body fat was also assessed by the bioimpedance method obtained by using a tanita scale sc240 . early morning spot urine sample were recollected in polyethylene containers and stored at 20c until analysis . urine fluoride ( uf ) concentrations were determined using an electronic meter ( orion 720a ) and a fluoride - specific ion electrode , which was calibrated with fresh , serially diluted standard solutions . during the measurement , written informed consent was obtained from all the participants or by their legal guardians in case they were minors . this study was approved by the committee of ethics the national autonomous university of mexico , enes len . descriptive analysis of the data ( arithmetic mean , standard deviation and percentages ) were obtained , bivariate analyses were performed to compare variables , and then a logistic regression model was created . population was divided into two groups according to the presence or absence of severe fluorosis ( tfi < 6 vs tfi > 6 ) . data was processed using spss version 21 for windows ( statistical package for the social sciences , spss inc . a total of 307 participants were included ; 59.9% ( n = 184 ) were females and 40.1% ( n = 123 ) were males . fluoride content in urine ranged between 0.5 and 6.65 mg / l , with a mean of 1.27 1.2 mg / l [ table 1 ] . descriptive data about age and urine fluoride concentration by sex most of the population ( 62.5% ) showed normal weight ; 21.5% were underweight , 11.1% were overweight , and 4.9% were obese . df was present in 91.9% of the participants , of which 61.6% were ( tfi > 4 ) moderate or severe cases , as observed in table 2 . teeth more frequently affected were premolars and those less affected were central inferior incisors . nutritional status and dental fluorosis severity by sex bivariate tests were performed to compare uf concentration according to different variables such as sex , bmi , and tfi . according to the kolmogorov smirnov test , the distribution of data was not normal and hence nonparametric tests were used . no differences in uf concentrations among girls and boys were observed ( mann whitney u test = 10589.50 , p = 0.335 ) . regarding bmi and uf , no difference in the prevalence of df according to nutritional status was observed ( chi square test = 29.746 ; p = 0.326 ) . nonetheless , significant differences ( chi square test = 11.22 ; p = 0.011 ) were observed when comparing the prevalence of severe df ( tf 6 ) and nutritional status ; 42% of the children having tfi 6 were underweight while of those having tfi < 6 18.6% were underweight , as shown in table 3 . urine fluoride concentration and dental severe fluorosis according to nutritional status positive correlation was observed among urine fluoride concentration and fluorosis severity ( rho spearman = 0.224 ; p < 0.001 ) . to perform bivariate analysis to identify the association between uf concentration and dental fluorosis severity status , this last variable was recoded in order to reduce it into 5 categories ; significant differences were noted ( kruskal wallis test = 16.200 ; p = 0.003 ) . children having dental fluorosis tfi = 79 had greater concentration of fluoride in urine [ table 4 ] . urine fluoride concentration according to dental fluorosis severity a logistic model was constructed to explore the association between severe dental fluorosis ( tfi < 6 vs tfi 6 ) and fluoride concentration in urine , controlled by age , sex , nutritional status , ( bmi ) and body fat percentage . it was observed that sex , age , body fat , and uf concentration were variables that were statistically significant in this model . male gender ( or = 0.127 ) , increment of percentage in body fat ( or = 0.875 ) and age ( or = 0.640 ) were protective factors . the increment of uf ( or = 1.40 ) concentration was a related risk to have severe df [ table 5 ] . potos state , in an area where fluoride level was similar ( 4.54 ppm ) , df was present in all participants , of which 95% had severe cases . in a mexican community where fluoride concentration was lower ( 1.9 ppm ) than that found in our study area , df prevalence was 98% , being severe in 47% . mexico found df in 85.5% of the population when fluoride in water was 3.005.99 ppm . ambient temperature , meters above mean sea level , risk practices as direct consumption of boiled water , and preparing food with tap water may explain the differences in df prevalence , even when concentration of fluoride in water are similar . range of fluoride content in urine was similar to that reported in other mexican children population , aged 6 - 12 , authors reported a range of uf concentration of 11.1 to 5.9 mg / l ; with a mean of uf content of ( 3.14 1.09mg / l . in an indian group aged 6 to 18 , the highest uf concentration recorded was 17 in other study in indian population , in individuals aged 1116 years , fluoride concentration found in urine samples ranged from 0.90 to 3.25 mg / l with an average of 2.35 mg / l . these variations might derived not only from variation on water fluoride content but from different use and consumption practices of water and other sources of fluoride among populations . we observed a positive correlation among uf concentration and fluorosis severity ; these results are congruent with those reported by jarqun - yaez et al . who found that urine fluoride concentration was more elevated in those showing greater fluorosis severity . they reported levels of 2.66 ( 0.89 ) in children with tfi of 45 , 3.11 ( 1.06 ) in the tfi of 67 , and 3.75 ( 1.10 ) ppm in tfi of 89 . nonetheless , heintze et al . reported no correlation between uf levels and df , however , that study was conducted in low - fluoride areas , which may be one of the causes of these different results . age was significantly associated with df , suggesting that age is a protective factor ; nonetheless , this does not imply that df decreases as age . increases , but it is not possible because df is irreversible . rather , these results might suggest that the problem is exacerbating , probably reflecting an increase in the consumption of fluoride in new generations that could come from higher concentration of fluoride in the water of the zone , as suggested by some authors who reported that as the depth of water extraction increases the concentration of this element also increases , raising the risk of developing df . pontigo - loyola et al . also reported similar results showing that children aged 12 years had greater chance to have fluorosis compared to those aged 15 years . the epidemiology system for oral diseases ( sivepab ) in 2010 also proposed an increase in df prevalence , especially in the younger age groups ( under 25 years ) . similarly , this has been observed in other countries , for instance , in a study performed in rural areas of brazil was observed that children between 10 and 12 years and those between 13 and 15 years of age had greater chance of having severe dental fluorosis in comparison with the younger children and individuals aged between 16 and 22 years . these results contrast to the study by rwenyonyi et al . who found significant increase in the severity of fluorosis with increasing age in a community with high concentration of fluoride in water . on the other hand reported that overall fluoride exposure dose has negative correlation with bmi ( r = 0.083 ) , which would be similar to that found in our population . we found no difference in the prevalence of df according to nutritional status , nonetheless significant differences were observed when comparing the prevalence of severe df , with 42% of the children having tfi 6 being underweight . some epidemiological studies have indicated that manifestations of fluorosis are more marked among communities exposed to chronic malnutrition . showed that , among participants with poor nutrition , the prevalence of df increased to 61.6% and skeletal fluorosis increased to 23.9% . furthermore in a study by irigoyen et al . in mexico , association between malnutrition and defects in the enamel were observed in an area where the water contained 2.7 mg / l of fluoride . similarly prez - prez et al . observed statistically significant differences in height for age , and reported a or = 2.66 for children with short stature to present fluorosis tf 4 . in addition , it was observed that males have less risk to present severe df than girls , these results are congruent to those reported by ramezani et al . who observed greater prevalence of severe fluorosis in girls ( 65% ) than in boys ( 34.2% ) . fluoride concentration in the water of this population exceeds the permissible limits for human consumption ( 0.71.5mg / l ) ; owing to the potential of adverse health effects of this situation , immediate actions are needed to reduce the exposure , thus diminishing adverse health effects in this population as df , which is an irreversible alteration . hence , actions taken would not only reduce dental fluorosis in future generations but also would prevent the prevalence or severity of other alterations that excessive consumption of fluoride can cause . most of the studied population had df and most of the cases were moderate or severe . water fluoride concentration of this population exceeds the limits stipulated by national and international norms . given the potential of adverse health effects that this may produce , immediate actions are needed to reduce the exposure to this element .

objective : the aim of this study was to assess urine fluoride concentration , nutritional status , and dental fluorosis in adolescent students living in the rural areas of guanajuato , mexico.materials and methods : a cross - sectional study was conducted including participants aged 1120 years . the presence and severity of dental fluorosis was registered according to the thylstrup and fejerskov index ( tfi ) criteria . anthropometric measures were also recorded . urine sample of the first morning spot was recollected to assess urine fluoride concentration by using the potentiometric method with an ion - selective electrode . water samples were also recollected and analyzed . bivariate tests were performed to compare urine fluoride concentration according to different variables such as sex , body mass index , and tfi . nonparametric tests were used . a logistic regression model was performed ( spss 21.0).results : this study included 307 participants with a mean age of 15.6 1.6 ; 62.5% of the participants showed normal weight . a total of 91.9% of the participants had dental fluorosis , and 61.6% had tfi > 4 . mean fluoride content in urine ranged between 0.5 and 6.65 mg / l , with a mean of 1.27 1.2 mg / l . underweight children showed greater urine fluoride concentration . the increment of urine fluoride was a related ( or = 1.40 ) to having severe dental fluorosis.conclusions:most of the studied population had moderate or severe dental fluorosis . urine fluoride concentration was related to fluorosis severity and nutritional status . underweight children showed greater urine fluoride concentration as well as severe dental fluorosis .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS Financial support and sponsorship Conflicts of interest

solid organ transplantation provides an effective therapy for patients with kidney , liver , heart , and pulmonary failure . long - term graft survival is limited by adaptive alloimmune responses directed against transplant ( typically allogeneic major histocompatibility complex [ mhc ] ) antigens , that are expressed within the organ and on endothelial cell surfaces and that interface with circulating recipient immune cells . in addition , it is appreciated that a substantial number of memory t cells reside within non - lymphoid tissues ( mueller et al . , 2013 , solid organ allografts may therefore deliver passenger donor lymphocytes to the recipient after transplantation . currently , little is known about whether passenger lymphocytes remain in the allograft or reach recipient secondary lymphoid organs or how long they survive , given that their likely recognition by natural killer ( nk ) cells might be expected to ensure rapid elimination . however , the precise role of nk cells in solid organ transplantation remains unclear ( gill , 2010 , hadad et al . , 2014 , van der touw and bromberg , 2010 , hidalgo et al . , 2010 ) , and early transplant studies indicate that circulating donor lymphocytes are often detectable in human transplant recipients , albeit in small numbers ( starzl et al . their presence may manifest as devastating , acute graft - versus - host ( gvh ) disease ( sharma et al . , 2012 ) , or as passenger lymphocyte syndrome , in which hemolysis is triggered by donor b cell recognition of mismatched abo blood group antigens in the recipient ( nadarajah et al . , 2013 ) . thus , the impact of passenger lymphocytes on the recipient immune response to the allograft has still to be clarified ( turner et al . , 2014 ) . we have shown that in a murine heart transplant model with an isolated mhc class ii - mismatch [ b6(c)-h2-ab1bm12/khegj ( bm12 ) to c57bl/6 ( b6 ) ] , passenger bm12 cd4 t cell recognition of i - a mhc class ii on host b cells triggers the production of anti - nuclear autoantibody , which causes allograft vasculopathy ( motallebzadeh et al . , 2012 , for example , activation of host dendritic cells ( dcs ) and macrophages following recognition of surface mhc class ii by donor cd4 t cells could prompt more vigorous host alloimmunity from more effective processing and presentation of graft alloantigen as self - restricted peptide fragments . to examine the possibility that passenger donor lymphocytes augment conventional host alloimmunity , we developed a murine transplant model incorporating a new bm12-derivative donor strain that expresses additional mhc class i and class ii alloantigens to act as targets for conventional cellular and humoral allorecognition ( ali et al . , 2016 ) . here we describe how in this model , heart allografts provoke autoantibody production in b6 recipients as a consequence of gvh recognition by passenger donor cd4 t cells . we show that even though donor cd4 t cells survive for only a few days after heart transplantation , their survival provokes a marked and long - lasting augmentation of cellular and humoral alloimmunity and results in early allograft rejection . however , this augmentation is prevented in completely mismatched strain combinations by rapid nk cell killing of donor lymphocytes . these data have important clinical implications , suggesting that partial mhc mismatch between donor and recipient to promote nk cells responses against passenger lymphocytes may reduce alloimmune responses . human organs procured for transplantation , including kidney , liver , and heart , contain significant populations of effector and effector - memory cd4 and cd8 t lymphocytes ( figure s1 ) . we therefore sought to examine the impact of these passenger donor lymphocytes on recipient adaptive alloimmune responses . to address this question , we developed a mouse strain that expressed multiple mhc alloantigens , sufficient to stimulate cellular and humoral alloimmunity , in addition to provoking humoral autoimmunity . a series of backcrosses were performed between bm12 , b6.k ( honjo et al . , 2004b ) , and b6.i - e ( conlon et al . , 2012a ) strains to derive the bm12.k.ie strain , which differs from the b6 recipient strain at the classical mhc class i k and class ii a and e loci ( h-2 , k , a , e , and d ; figures 1a and s2 ) . when bm12.k.ie hearts allografts were transplanted into b6 recipients , the additional mhc class i h-2k and class ii i - e mismatched alloantigens provoked strong alloimmune responses , with production of long - lasting alloantibody to both antigens ( figure 1b ) . recipients also developed anti - nuclear autoantibody ( figure 1c ) that was comparable in magnitude to the responses previously observed in b6 recipients of bm12 heart allografts ( win et al . these antibody responses were associated with c4d complement deposition on heart graft endothelium ( figure 1d ) , which was not evident in syngeneic heart transplants , suggesting a humoral component to the allograft vasculopathy that developed within allografts by day 100 ( figure 1e ) . to determine whether , as in the bm12 to b6 model , autoantibody production in b6 recipients of bm12.k.ie heart allografts was due to donor cd4 t cell allorecognition of recipient i - a mhc class ii ( callaghan et al . bm12.k.ie donor mice were treated with depleting anti - cd4 monoclonal antibody ( mab ) before sacrifice . this resulted in profound depletion of circulating and tissue resident cd4 t cell compartments by the time of heart allograft procurement ( figures 1f and 1 g ) . anti - cd4 antibody was not carried over to the recipient ( figure 1h ) ; nevertheless , donor treatment with anti - cd4 mab abrogated the recipient autoantibody response ( figure 1i ) , confirming that passenger cd4 t cells within the bm12.k.ie donor heart are responsible for initiating recipient humoral autoimmunity . despite the development of humoral autoimmunity , no overt autoimmune disease was observed in kidney , liver , skin , or native heart in b6 recipients up to 100 days after transplantation with a bm12.k.ie heart allograft ( figure s3 ) . the ability , through specific targeting of the donor cd4 t cell population , to independently manipulate recipient autoimmune and alloimmune responses provided a means to examine whether gvh allorecognition augments host alloimmunity . comparison of recipient cellular and humoral alloimmune responses in recipients of unmodified and cd4 t cell - depleted bm12.k.ie heart allografts revealed that alloantibody responses against the h-2k alloantigen were substantially reduced in recipients of cd4 t cell - depleted allografts ( figure 2a and s4 ) . responses against the disparate donor mhc class ii alloantigen were similarly ameliorated ( figure 2b ) . allo- and autoantibody responses were restored in recipients of cd4 t cell - depleted bm12.k.ie heart allografts by adoptive transfer of purified donor cd4 t cells at transplantation ( figures 1i and 2a ) . the disparate h-2k alloantigen might be expected to act as a target for recognition by recipient cytotoxic cd8 t cells ( harper et al . , 2015 ) , but whereas b6 recipients of fully mhc - mismatched balb / c heart allografts generated robust cd8 t cell responses , the response in recipients of unmodified bm12.k.ie heart allografts was weak and transient ( figure 2c ) . nevertheless , cytotoxic cd8 t cell responses were barely detectable in recipients of cd4 t cell - depleted bm12.k.ie heart transplant recipients at any time point ( figure 2c ) . helper cd4 t cell alloresponses were also examined in the recipient groups , by evaluating proliferation of tcr75 cd4 t cells that were adoptively transferred 5 weeks after the heart transplant . tcr75 cd4 t cells recognize k alloantigen via the indirect pathway ( ali et al . , 2013 ) as self - i - a - restricted , but not donor - i - a - restricted , allopeptide ( honjo et al . , 2004a , conlon et al . , 2012b ) . in recipients of cd4 t cell - replete heart grafts , marked tcr75 t cell proliferation was observed , indicating ongoing presentation of immunogenic k allopeptide epitope . in contrast , tcr75 t cell responses in recipients of cd4 t cell - depleted hearts were approximately 50% weaker ( figure 2d ) . the marked reduction in the alloimmune response to cd4 t cell - depleted bm12.k.ie heart allografts ameliorated graft rejection , in that vasculopathy was minimal in heart allografts from cd4 t cell - depleted donors and comparable to that observed in syngeneic heart transplants ( figure 3a ) . in addition , all heart transplants from cd4 t cell - depleted donors were beating strongly at day 50 ( figure 3b ) . adoptive transfer of donor cd4 t cells at time of transplant to recipients of cd4 t cell - depleted bm12.k.ie heart allografts restored the development of allograft vasculopathy ( figure 3a ) . in contrast to human organs where memory t cell populations dominate ( figure s1 ) , the cd4 t cell compartment in mice housed in specific - pathogen - free conditions is maintained in a largely naive state . we therefore sought to examine how memory cd4 t cells within an allograft might influence host alloimmunity , by priming bm12.k.ie donors with a b6 skin graft 6 weeks before procurement of the heart allograft to generate resident memory t cells . heart allografts from such donors were rejected more rapidly by b6 recipients than were heart grafts from naive donors , and they triggered augmented auto- and alloantibody responses ( figures 3a3d ) . amplification of the recipient alloreactive t - b lymphocyte axis is likely the principal mechanism by which donor cd4 t cell gvh recognition triggers accelerated graft rejection , because host germinal center ( gc ) alloantibody responses were less established in recipients of t cell - depleted , than t cell - replete , heart allografts ( figure 3e ) , as was complement c4d deposition on allograft endothelium ( figure 1d ) . similarly , heart grafts were not rejected , and developed only minimal vasculopathy , when transplanted into either b cell - depleted ( figure s5 ) or t cell - deficient tcrbd recipients ( figures 3a and 3b ) . to examine whether the augmentation in recipient cd4 t cell responses triggered by donor gvh recognition was dependent upon host b cell immunity , b cell - depleted recipients were transplanted with either cd4 t cell - replete or t cell - deficient bm12.k.ie heart grafts , and proliferation of transferred tcr75 t cells was examined as earlier . for recipients of cd4 t cell - replete heart grafts , t cells was substantially less in b cell - depleted than in untreated recipients ( figure 2e ) and approximated that observed in untreated recipients of cd4 t cell - depleted bm12.k.ie heart allografts . furthermore , unlike b cell - replete recipients , proliferation of transferred tcr75 cd4 t cells in b cell - depleted recipients was not influenced by depletion of donor cd4 t cells ( figure 2e ) . the role of recipient b cells in gvh - mediated augmentation of recipient t cell alloreactivity does not simply reflect function as the major cell population expressing target i - a for optimal gvh activation of donor cd4 t cells , because the latter still divided readily in b cell - depleted donors ( figure 3f ) , such that no carboxyfluorescein succinimidyl ester ( cfse ) staining was detectable in the sub - population of alloreactive bm12.k.ie cd4 t cells as early as 3 days after transfer ( figure 3f ) . although transplantation of bm12.k.ie hearts into tcrbd recipients prompted autoantibody and weak alloantibody responses ( figures 3 g and 4h ) , there was no associated gc activity ( figure 3e ) . thus , the requirement for host cd4 t cells in bm12.k.ie heart graft rejection appears to reflect provision of essential help for development of sophisticated host humoral alloimmunity , a function not provided by donor cd4 t cells ; transferred donor cd4 t cells are rapidly killed by adaptive alloimmune recognition in b6 hosts , because whereas bm12.k.ie cd4 t cells were readily identified 7 days after transfer into rag-2 hosts , they were undetectable following transfer into wild - type b6 hosts ( figure 3i ) . hence , it is unlikely that the donor cd4 t cells survive long enough to contribute directly to the progression of allograft vasculopathy . their effect appears to be mediated principally through a relatively short - lived interaction with host b cells , but prolonged augmentation of humoral alloimmunity is dependent upon additional help from host cd4 t cells . in considering how donor cd4 t cells amplify humoral alloimmunity , transfer of bm12 cd4 t cells into b6 hosts prompted upregulation of mhc class ii expression on mature b cells ( figure 4a ) , in keeping with global activation from recognition of all allogeneic mhc class ii complexes on their surface . yet only a limited repertoire of antibody directed against nuclear self - antigen was produced ( data not shown ) . to examine the hypothesis that plasma cell differentiation requires b cell receptor ( bcr ) ligation , in addition to cognate interaction between the mhc class ii complex and the donor cd4 t cell , tcrbd b6 mice were challenged with purified bm12 cd4 t cells and immunized with ovalbumin ( ova ) protein . in this situation , cd4 t cell help for humoral responses can only be provided by the transferred donor cd4 t cells . as expected , mice in both groups developed anti - nuclear autoantibody , but anti - ova immunoglobulin g ( igg ) responses were only detectable in the group immunized with ova ( figures 4b and 4c ) . similarly , challenge of tcrbd b6 mice with cd4 t cells from bm12 mice that expressed transgenic h-2k antigen ( bm12.k ) provoked autoantibody , but also strong anti - k igg alloantibody , which was not observed in tcrbd b6 mice challenged with bm12 cd4 t cells ( figures 4d and 4e ) . bm12.k cd4 t cells are selected against reactivity to self ( i - a)-restricted k peptide and are unable to provide help to k - specific bm12 b cells for generating anti - h-2k antibody ( figures 4f and 4 g ) . thus , their provision of help for generating anti - h-2k antibody in b6 hosts reflects peptide - degenerate direct - pathway allorecognition of i - a mhc class ii on h-2k - specific b6 b cells that , with simultaneous bcr ligation , provokes class - switched alloantibody . these alloantibody responses presumably explain why bm12.k.ie cd4 t cells are undetectable within a week of transfer into b6 tcrbd mice but survive long term in rag-2 mice ( figure 3i ) . in summary , despite being tolerant of h-2k antigen on the bm12 background , bm12.k cd4 t cells provoke anti - k alloantibody when transferred into b6 hosts ; this alloantibody results in rapid destruction of the bm12.k cd4 t cells . whether the amplification of host humoral immunity by gvh recognition is an intrinsic component of the alloresponse or is dependent upon the degree of mhc mismatch between donor and recipient has not been addressed . given that donor bm12.k.ie cd4 t cells survive long term in rag-2 b6 hosts ( figure 3i ) , we examined whether innate immune evasion , and specifically lack of nk cell allorecognition of donor lymphocytes , was critical in triggering autoantibody generation . in this regard , cd4 t cells purified from the completely mismatched balb / c donor strain did not survive when injected into b6 rag-2 hosts and did not provoke humoral auto- or alloimmunity upon injection into b6 tcrbd mice ( figures 5a5c ) . this contrasts with long - term survival and development of strong igg allo- and autoantibody when purified cd4 t cells from the less mismatched strains were injected ( figures 5a5c ) . furthermore , depletion of nk cells by administration of anti - nk1.1 antibody , in the b6 rag-2 recipients , resulted in long - term survival of transferred balb / c cd4 t cells and , in tcrbd recipients , provoked class - switched auto- and alloantibody responses ( figures 5b5d ) that were even stronger than those observed upon administration of cd4 t cells from the less mismatched donor strains . nk t cells , which also express nk1.1 , do not develop in tcrbd mice ( figure s6 ) ; these experiments therefore serve as an apposite control that the administered anti - nk1.1 antibody is acting principally upon nk cells . irrespective of gvh recognition , injection of balb / c cd4 t cells into wild - type , immunocompetent b6 mice would be expected to provoke alloantibody , but autoantibody was only produced if host nk cells were depleted simultaneously ( figure 5e ) , confirming that elimination of the transferred donor cd4 t cell population , by either host cytotoxic cd8 t cell or alloantibody responses , does not occur quickly enough to obviate a gvh response and that nk cell allorecognition is instead essential for its prevention . these observations suggest that gvh - mediated amplification of host alloimmune effector responses is normally prevented in mhc - mismatched transplant models by host nk cell alloreactivity . the role of nk cells in rejection of completely mismatched balb / c hearts by b6 recipients was therefore examined . however , in this model of acute rejection , unmodified b6 recipients reject balb / c heart allografts within days , and it seemed unlikely that host nk cell depletion would influence such a robust rejection response . instead , a further model of chronic alloantibody - mediated allograft vasculopathy was developed in which b6 tcrbd recipients of balb / c heart allografts are reconstituted at transplantation with b6 tcr75 cd4 t cells but at limiting numbers ( 10 per mouse ) , such that rejection occurs slowly and is mediated by anti - h-2k gc alloantibody responses , with help provided by differentiation of the transferred tcr75 t cells to follicular helper t cells ( figure 6a ) . in contrast to the gradually evolving anti - k alloantibody responses observed in nk cell - replete recipients , responses in the nk cell - depleted recipients were stronger ( figure 6b ) , and the heart grafts were rejected within the first week ( figure 6c ) . autoantibody was also generated in the nk cell - depleted recipients ( figure 6d ) , confirming the development of gvh responses mediated by donor balb / c cd4 t cells . critically , autoantibody generation , the augmented alloantibody response , and rapid allograft rejection were ameliorated in nk cell - depleted recipients by depletion of cd4 t cells from the balb / c donor before heart graft procurement ( figures 6b6d ) . finally , to test the relevance of our findings to a model in which graft rejection is prevented by administration of immunosuppression , as occurs routinely in clinical practice , heart allografts from balb / c donor mice that had been challenged 6 weeks earlier with a b6 skin graft were transplanted into b6 recipients that were treated with anti - cd154 monoclonal antibody at transplantation . in b6 recipients of heart grafts from unmodified donors , this protocol results in long - term allograft survival ( larsen et al . , 1996 , ali et al . , 2016 ) , without development of autoantibody ( figure 6e ) , but in recipients of heart allografts from challenged donors ( that contained memory passenger cd4 t cells ) , depletion of nk cells at transplantation resulted in development of anti - nuclear autoantibody and more pronounced splenic gc activity ( figures 6e and 6f ) . despite the robust gc response , anti h-2k alloantibody responses were not observed ( data not shown ) . depletion of cd4 t cells in the donor before heart allograft procurement abrogated the autoantibody response ( figures 6e and 6f ) . although the presence of donor lymphocytes in the circulation of recipients of solid organ allografts was first demonstrated more than 2 decades ago ( starzl et al . , 1992a , starzl et al . , 1992b ) , the extent to which they affect recipient alloimmunity has remained unclear . clarification of the contribution of passenger donor lymphocytes to graft rejection has become more pertinent with the realization that non - lymphoid tissue contains substantial populations of either resident or circulating memory t lymphocytes , and their presence has been described within all solid organs currently transplanted in humans ( casey et al . , 2012 , sathaliyawala et al . , 2013 ) . here , we used a combination of donor cd4 t cell depletion and adoptive transfer of donor cd4 t cells , in conjunction with transplantation of heart allografts from primed donors , to demonstrate that gvh allorecognition by donor cd4 t cells augments recipient alloimmunity and that this augmentation is more pronounced for allografts procured from donors sensitized against recipient mhc . our findings thus reveal a mechanism by which donor lymphocytes may influence graft rejection and suggest that their impact may be more important than previously considered . pivotal to this augmentation of host alloimmunity is the ability of donor cd4 t cells to recognize host mhc class ii via the direct pathway ( ali et al . , 2013 ) this provides an unusual form of peptide - degenerate help , reflecting the unique nature of direct - pathway allorecognition ( macdonald et al . , 2009 , ali et al . , 2013 ) , in which the precursor frequency of cd4 t cells that respond to a particular mhc class ii alloantigen is 100- to 1,000-fold greater than for the response against conventional , self - restricted peptide antigen , because all mhc class ii alloantigen complexes are recognized as foreign , irrespective of bound peptide . this results in activation of all recipient b cells , but we detail that differentiation to an igg antibody - secreting plasma cell is dependent upon simultaneous b cell receptor ligation . thus , although donor cd4 t cells can provide help to recipient b cells in an antigen - independent fashion , antigen specificity is maintained through the requirement for b cell receptor ligation . this atypical help does not , however , completely replicate conventional cognate help provided by cd4 t cells with self - restricted specificity for peptide derived from target antigen , because although gvh recognition by donor cd4 t cells could trigger auto- and alloantibody responses , these were not sustained in the absence of a recipient cd4 t cell population , and allograft rejection did not occur . our findings thus reveal an interaction between donor and recipient t and b lymphocytes , as depicted in figure 7 . passenger lymphocytes only augmented recipient alloimmunity if they were not eliminated rapidly by recipient nk cells . the contribution of nk cell alloresponses to allograft rejection is still debated ( gill , 2010 , hadad et al . , 2014 , van der touw and bromberg , 2010 ) . it has been suggested that host nk cells promote allograft rejection ( maier et al . , 2001 , uehara et al . , 2005 , 2008 ) either through the destruction of opsonized donor cells or perhaps through regulation of t cell immunity ( maier et al . , 2001 ) . our results suggest the converse : that a major function of nk cells is inhibition of destructive cellular and humoral alloimmunity that is triggered by passenger cd4 this accords with several studies reporting a key role for nk cells in allograft tolerance ( beilke et al . , 2005 , yu et al . , 2006 ) . the mechanisms by which nk cells promote tolerance in these studies have not been firmly established , but inhibition of recipient alloimmune responses through killing of donor dcs may be important ( yu et al . , 2006 ) ; in support , laffont et al . ( 2008 ) have reported that nk cell - mediated destruction of donor dcs downregulates cd4 t cell alloimmunity . the different mechanism highlighted by our study the killing of passenger lymphocytes may be more clinically relevant , because irrespective of nk cell allorecognition , adaptive alloimmune recognition would be expected to result in prompt destruction of donor dcs ; in the laffont et al . ( 2008 ) study , cd8 mice were studied to obviate rapid killing by cytotoxic t lymphocytes . our results reveal that the critical window for passenger donor cd4 t cells to augment host alloimmunity is within the first few days after transplant and that evasion of nk cell - mediated killing is essential for this effect . donor cd4 t cells prompt host adaptive responses that engender their own rapid destruction , but the delay in development of these responses , at most a few days when compared to nk cell recognition , is sufficient for gvh recognition to occur . one could argue , on the basis of the derived nature of the bm12.kd.ie donor strain and the lack of requirement for administration of immunosuppression , that the clinical relevance is limited . similarly , it is perhaps surprising that passenger donor lymphocytes were present in sufficiently large numbers within heart allografts to provoke such a marked augmentation in the host s alloimmune response . against this , cd4 t cells could be readily detected in all sampled human organs that have been procured for transplantation but not used . in addition , to counter concerns regarding the wider applicability of the bm12.kd.ie model , we employed an additional model of chronic allograft vasculopathy using completely mismatched balb / c donor and b6 recipient strains . this model enabled clarification of the crucial role of host nk cells in killing donor hematopoietic cells ; nevertheless , the potential for passenger donor lymphocytes to augment host alloimmunity was again observed . we further demonstrated in this model that memory donor cd4 t cells ( as would be expected to be present within human allografts ) were able to provide co - stimulation - independent help to naive recipient b cells for production of a gc autoantibody response . with regards the seemingly large numbers of donor lymphocytes contained within our murine heart allografts , our experiments were not able to distinguish whether these were truly resident within the parenchyma or trapped within the microcirculation of the heart allograft , and it is possible that different procurement and storage techniques used in clinical transplantation denude a heart allograft of most of its passenger lymphocyte populations . against this , deliberate flushing of our mouse hearts via the coronary arteries at explant ( as typically occurs in clinical heart allograft procurement ) did not make any appreciable difference to the numbers of cd4 t cells subsequently found within the heart allograft ( data not shown ) . in any event , we stress that the heart allograft model was used as a means of delineating the precise mechanism by which donor cd4 t cells influence the host s response to an allograft . in this respect , whereas the impact of passenger lymphocytes in clinical cardiac transplantation may be limited , lung , small bowel , and composite tissue allografts will almost certainly transfer large numbers of donor lymphocytes that originate from organized lymphoid tissue contained within the allograft . transplant outcomes for these organs are poorer than for other organs ; for example , a report of chronic face allograft rejection described the development of autoimmune , scleroderma - type features consistent with skin manifestations of chronic gvh ( petruzzo et al . , 2015 ) . one might therefore predict that transplant outcomes would be particularly poor for individuals that receive such organs from donors matched for killer cell immunoglobulin - like receptor ( kir ) recognition ( which occurs in approximately 50% of kidney transplant pairings ; van bergen et al . , 2011 ) , because the avoidance of immediate host nk cell detection would enable passenger donor lymphocytes to potentiate host alloimmunity . however , the impact of nk cell alloreactivity in transplant outcomes remains uncertain ( tran et al . , 2013 , van bergen et al . , 2011 ) , possibly because studies to date have avoided the confounding impact of human leukocyte antigen ( hla ) mismatches on allograft survival by including only hla - matched donor - recipient combinations , whereas our findings suggest that kir - ligand matching would compromise transplant outcomes when donor and recipient are mismatched additionally at the hla class ii loci . it is likely that the ability of donor cd4 t cells to provide peptide - independent help to host b cells has implications beyond solid organ transplantation . in hematopoietic stem cell transplantation , an association between chronic gvh disease and humoral immunity is increasingly recognized ( nakasone et al . , 2015 , dubovsky et al . , 2014 , shimabukuro - vornhagen et al . our findings suggest that this may relate to a chimeric state in which the co - existence of populations of donor and recipient t and b lymphocytes tends to provoke destructive alloantibody responses . in addition , persistence of a mixed chimeric state implies that reciprocal nk cell tolerance to donor and host had been achieved ( narni - mancinelli et al . , 2013 ) , which may be particularly relevant to strategies for hematological malignancy that use less toxic , non - myeloablative conditioning to initially establish mixed hematopoietic chimerism and then later convert to full donor chimerism by infusion of donor lymphocytes ( chang and huang , 2013 ) . our findings suggest that inhibition of host nk cell alloresponses may enable gvh recognition by cd4 t cells within the subsequent donor infusion to provide promiscuous help for antibody production from residual host b cells that are concurrently engaging target antigen . this may explain reports documenting the development of humoral immunity against tumor antigen following establishment of mixed hematopoietic chimerism ( bellucci et al . similarly , the presence of donor cd4 t cells within donor lymphocyte infusions has been associated with loss of donor mixed hematopoietic chimerism ( kim et al . , 2004 , hock et al . , 2014 ) , but rather than this being a bystander consequence of the general inflammatory milieu created by the gvh response ( hock et al . , 2014 ) , our results suggest that the loss may instead be due to cognate recognition of mhc class ii on the surface of recipient alloreactive b cells by donor cd4 t cells . in summary , we demonstrate an unexpected role for donor passenger cd4 t cells within allografts in the provision of help to recipient b cells for generating humoral responses directed against the transplant . passenger donor lymphocytes may therefore influence recipient alloimmune responses more profoundly than previously considered and represent a therapeutic target in solid organ transplantation . b6 ( h-2 ) and balb / c mice ( h-2 ) were purchased from charles river laboratories . bm12 mice and t cell receptor - deficient mice ( h-2 , tcrbd ) b6.129p2-tcrbtcrd tcr - transgenic rag-1 tcr75 mice ( h-2 ) , specific for i - a - restricted h-2k5468 peptide ( honjo et al . , 2004a ) and b6-tg(k)rpb ( b6.k ) mice , which express the full sequence of h-2k ( honjo et al . , 2004b ) b6 mice that lack i - a but express i - e ( b6.i - e ; conlon et al . , 2012a ) all animals were maintained in specific pathogen - free facilities , and experiments were approved by the uk home office animal ( scientific procedures ) act of 1986 . fully vascularized cardiac allografts were transplanted intra - abdominally ( conlon et al . , 2012b ) . grafts were excised at predetermined time points after transplantation and stored at 80c or fixed in 10% buffered formalin . in certain experiments , heart allografts were retrieved from donor mice challenged with a recipient strain skin allograft 6 weeks earlier , or recipients were additionally injected intraperitoneally ( i.p . ) with 500 g anti - cd154 mab ( clone mr-1 ; be0017 - 1 ; bio x cell ) on days 2 and 0 in relation to transplantation , a protocol that prevents acute allograft rejection but that results in development of chronic allograft vasculopathy . bone marrow - derived dendritic cells ( bmdcs ) were prepared as described previously ( curry et al . , 2007 ) . briefly , bone marrow ( bm ) was flushed from femurs and tibias with hank s balanced salt solution ( invitrogen ) . cells were disaggregated by passing through a 40-m mesh , and bm cells cultured in six - well plates at 3 10/ml in 6-ml complete medium ( rpmi 1640 , 10% fetal calf serum [ fcs ] , 100 iu / ml penicillin , 100 g / ml streptomycin , and 2 mm l - glutamine ; invitrogen ) , supplemented with murine granulocyte - macrophage colony - stimulating factor ( peprotech ) at 20 ng / ml and recombinant murine interleukin-4 ( peprotech ) at 10 ng / ml . cells were maintained by replacing half the culture medium with fresh medium on alternate days . nonadherent cells were discarded on day 4 , and dcs were used on day 8 for flow cytometric analysis . anti - nuclear autoantibody responses were determined by hep-2 indirect immunofluorescence ( the binding site ) , as described previously ( callaghan et al . , 2012 ) , by incubating test sera on slides coated with hep-2 cells and detecting bound antibody with fluorescein isothiocyanate ( fitc)-conjugated goat anti - mouse igg ( star 70 ; serotec ) . for each test serum , photomicrographs were taken , and the intensity of staining was determined by integrated morphometric analysis using metamorph software . the fluorescence value was then derived by comparison with a standard curve , obtained for each assay by serial dilutions of a pooled hyperimmune serum that was assigned an arbitrary value of 1,000 fluorescence units . sera were collected from experimental animals weekly and analyzed for anti - i - e alloantibody ( at week 4 in the case of balb / c alloantibody ) by flow cytometric detection of binding to target cells . briefly , target b6.i - e and balb / c bmdcs were first blocked with anti - mouse cd16/cd32 ( clone 2.4g2 ; bd pharmingen ) and then incubated with serial dilutions ( 3-fold ) of heat - inactivated test serum for 30 min . bound alloantibody was detected with fitc - conjugated goat anti - mouse igg ( star 70 ; serotec ) , and cells were analyzed by flow cytometry . for each sample , the geometric mean - channel fluorescence was obtained and plotted against dilution , and the area under the curve ( auc ) was then calculated as a percentage of the auc of a standard of pooled hyperimmune sera . serum samples were collected from experimental animals weekly and analyzed for the presence of anti - h-2k igg alloantibody by elisa . in brief , 96-well elisa plates ( immulon 4hbx ; thermo scientific ) were coated with recombinant conformational h-2k at 5 g / ml in na2co3-nahco3 buffer ( ph 9.6 ) . plates were blocked with 1% marvel dried skimmed milk powder ( premier international foods ) , tripling serial dilutions of test sera added and bound igg antibody detected by incubating with biotinylated rabbit f(ab)2 anti - mouse igg ( star11b ; abd serotec ) and extravidin peroxidase conjugate ( sigma ) . sure blue substrate ( kpl ) was then added , the reaction was stopped by the addition of 0.2 m h2so4 , and the absorbance ( optical density 450 ) was measured in a fluostar optima plate reader ( bmg labtech ) . for each sample , an absorbance versus dilution curve was plotted , and the auc was calculated ( conlon et al . , 2012a ) . the auc of an experimental sample was expressed as the percentage of positive control ( pooled hyperimmune ) serum . in certain experiments , mice were additionally immunized with ova protein 100 g in incomplete freund s adjuvant subcutaneously . anti - ova antibody was assayed in a similar fashion , and performed on test sera 4 weeks after immunization , using an ova - specific elisa . cd8 t cell enzyme - linked immunospot was performed as described ( sivaganesh et al . briefly , purified cd8 t cells were mixed with irradiated balb / c stimulator splenocytes and added to multiscreen hts filtration system plates ( millipore ) that had been coated with anti - mouse interferon- ( ifn- ; bd pharmingen ) in 0.1 m bicarbonate buffer ( ph 9.6 ) . plates were incubated at 37c and 5% co2 for 20 hr , and after washing , spots were developed with biotinylated rat anti - mouse ifn- ( bd pharmingen ) , followed by streptavidin - horseradish peroxidase and the substrate , h2o2 , together with the 3-amino-9-ethylcarbazole color indicator . plates were read ( autoimmun diagnostika ) , and data were expressed as spot counts per 10 responder cd8 t cells for each well . antigen - presenting cell - conjugated anti - mouse cd4 ( rm4 - 5 ) , fitc - conjugated anti - mouse cd19 ( 1d3 ) , r - phycoerythrin ( pe)-conjugated anti - mouse cd90.1/thy1.1 ( clone ox-7 ) , pe - cy7-conjugated anti - mouse cd4 ( clone l3t4 ) , pe - conjugated anti - mouse h-2k ( sf1 - 1.1 ) , and fitc - conjugated anti - mouse i - a ( clone af6 - 120.11 ) were purchased from bd pharmingen . peripheral blood ( depleted of erythrocytes by incubating with 0.17 m nh4cl red cell lysis buffer ) and splenic single - cell suspensions were blocked with anti - mouse cd16/cd32 ( clone 2.4g2 ; bd pharmingen ) , before staining with the relevant antibodies and dead cell exclusion dye 7-aminoactinomycin d ( bd pharmingen ) . all cells were analyzed on a facscanto ii flow cytometer with facsdiva software ( bd biosciences ) . single - cell suspensions of splenocytes obtained from tcr75 mice were stained with 5 m cfse ( molecular probes ) in the dark for 5 min and then quenched with 5% fcs / pbs . cfse - stained splenocytes ( 2 10 to 5 10 ) were injected intravenously ( i.v . ) into recipient mice and spleens harvested 4 or 7 days later ; flow cytometry was performed using allophycocyanin - conjugated anti - cd4 plus pe - conjugated anti - cd90.1/thy1.1 to identify tcr75 t cells . proliferation of wild - type bm12.k.ie cd4 t cells in b6 hosts was assessed similarly , by analysis of csfe - staining 3 days after transfer of 5 10 cells , with the caveat that in contrast to transfer of a monoclonal population , analysis was restricted to the relatively small ( 5% ) alloreactive population nested within a large wild - type repertoire that did not undergo proliferation . formalin - fixed hearts were paraffin mounted and stained using h&e and weigert s elastin van gieson method to delineate the internal elastic lamina and the severity of allograft vasculopathy assessed morphometrically , as reported previously ( motallebzadeh et al . , 2012 ) . complement c4d deposition was assessed on 7-m cryostat sections of donor heart allografts explanted after 50 days by an avidin - biotin - peroxidase technique ( vector laboratories ) , using unconjugated rat anti - mouse c4 mab ( 16d2 ; abcam ) , as described previously ( win et al . , 2009 ) . gcs were quantified on 7-m cryostat sections of recipient spleens harvested 50 days following transplant by immunofluorescence staining of b220 b cells using rat anti - mouse b220 ( clone ra3 - 6b2 ; bd pharmingen ) detected with cy3-conjugated goat anti - rat igg ( clone 112 - 165 - 143 , jackson immunoresearch laboratories ) and peanut agglutinin ( pna ) gc b cells using fitc - conjugated pna ( vector laboratories ) , as described previously ( conlon et al . , 2012b ) . numbers of pna gc were expressed as a percentage of total ( b220 ) lymphoid follicles . donor mice were injected i.p . with 2 1.0 mg doses of depleting anti - cd4 mab ( yts 191.1 ; hybridoma from the european collection of animal cell cultures ) 6 days and 1 day before heart graft procurement . depletion of cd4 t cells ( typically > 99% ) was confirmed by flow cytometric analysis of peripheral blood . to confirm cardiac parenchymal cd4 t cell depletion , donor hearts were homogenized following incubation with collagenase digestion buffer , as described previously ( sivaganesh et al . , 2013 ) , with a single - cell suspension prepared by filtration through a 40-m nylon cell strainer . cd4 t cells were quantified by flow cytometry , with a mean of 5,137 cd4 t cells identified in an untreated donor heart . in certain experiments , recipients of cd4 t cell - depleted allografts were adoptively transferred i.v . 1 10 donor cd4 t cells ( purified with anti - mouse cd4 microbeads ( mitenyi ) using an automacs separator ( mitenyi ) . 250 g depleting anti - cd20 mab ( 18b12 ; gifted by cherie butts at biogen idec ) 7 days before and 14 days after transplantation ( ueki et al . , depletion of b cells was confirmed by flow cytometry of peripheral blood mononuclear cells ( pbmcs ) the day before heart transplantation . depletion of the recipient nk cell population was achieved by injecting i.p . 500 g depleting anti - nk1.1 ( pk136 ; hybridoma from the european collection of animal cell cultures ) 2 days and 1 day before transplant or cell transfer and three times weekly thereafter . depletion of nk cells was confirmed by flow cytometry of pbmcs the day before transplantation or transfer . adoptive transfer studies of purified b6 , balb / c , bm12.k , and bm12.k.ie cd4 t cells into b6 , tcrbd , and tcrbd.bm12 mice were performed by injecting i.v . 1 10 cells purified as earlier . two - way anova was employed for comparison of intensity of hep-2 fluorescence scores and anti - h-2k antibody levels . graft survival was depicted using kaplan - meier analysis , and groups were compared by log rank ( mantel - cox ) testing . i.g.h . , j.m.a . , and g.j.p . wrote the first draft of the paper . i.g.h . , j.m.a . , s.j.f.h . , e.w . , j.a . , m.c.n . , m.s.q . , r.m .- z . , k.s .- p . , e.m.b . , j.a.b . , m.r.c . , t.m.c . , and g.j.p . reviewed and edited the manuscript , approving the final version .

summarychronic rejection of solid organ allografts remains the major cause of transplant failure . donor - derived tissue - resident lymphocytes are transferred to the recipient during transplantation , but their impact on alloimmunity is unknown . using mouse cardiac transplant models , we show that graft - versus - host recognition by passenger donor cd4 t cells markedly augments recipient cellular and humoral alloimmunity , resulting in more severe allograft vasculopathy and early graft failure . this augmentation is enhanced when donors were pre - sensitized to the recipient , is dependent upon avoidance of host nk cell recognition , and is partly due to provision of cognate help for allo - specific b cells from donor cd4 t cells recognizing b cell mhc class ii in a peptide - degenerate manner . passenger donor lymphocytes may therefore influence recipient alloimmune responses and represent a therapeutic target in solid organ transplantation .

Introduction Results Discussion Experimental Procedures Author Contributions

in ovo electroporation and in situ hybridization was performed as in previous studies ( 6 ) , and at least three embryos were analyzed for each condition . rna probes were transcribed in vitro from cdna clones provided by bbsrc ( bmp7 : chest290n8 ; bapx1 : chest177b22 ; pitx2 : chest76c15 ) , except for the neurog3 cdna provided by anne grapin - botton and the bmp4 cdna provided by cliff tabin . probes for nkx6.1 and hes1 were used as in earlier studies ( 6,17 ) the xenopus noggin cdna was provided by richard harland , and a cooh - terminal cmyc epitope tag inserted by pcr . the mouse dnalk3 was a cooh - terminal truncated receptor ( encoding aa 1237 ) lacking the kinase domain . a similar construct has previously been used to block bmp signaling in duck and chicken embryos ( 18 ) . briefly , embryos were cleared in dent 's bleach and incubated overnight with antibodies diluted in blocking buffer . confocal images were obtained from embryos cleared in benzyl alcohol / benzyl benzoate ( babb ) ( 19 ) on a zeiss lsm510 axioimager . for antibodies , these data can be found in online appendix supplementary table 1 , available at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1010/dc1 . perfusion of embryos with lens culinaris agglutinin was performed with a protocol modified from jilani et al . the embryos were dissected in pbs , and 10 l was injected into the heart with a pulled glass pipette . labeled areas were quantified using imagej software by analyzing every second optical section corresponding to an optical depth of 20 m through the whole pancreas ( between 7 and 12 sections from each embryos ) . lentiviral constructs were generated by gateway recombination cloning , using entry vectors with the same constructs used in the chicken experiments . ( 21 ) , except that the epithelium was not separated from the mesenchyme before lentiviral infection . all lentiviral vectors were used at viral concentrations corresponding to 300 ng of p24 capsid protein per explant . the e12.5-pancreas explants were fixed in formalin and embedded in paraffin 7 days after transduction . the explants were sectioned ( 4 m ) and stained for insulin , amylase , and dna ( dapi ) as described by haumaitre et al . quantification was performed every fifth section spanning the entire explant using imagej software , and total area , insulin area , and amylase area surface were measured . in the e10.5 gut tube explants 10-m cryosections of the entire explants were stained for insulin , amylase , and dna ( dapi ) . quantification was performed every second section by counting the nuclei of insulin and amylase - positive cells . bmp signaling is transduced by smad1 , 5 , and 8 which , upon signaling , become phosphorylated and accumulates in the nucleus where they act as transcription factors ( 23 ) . we used a phosphosmad1,5,8-specific antibody ( 24 ) to characterize endogenous bmp signaling in the embryonic chicken pancreas ( fig . 1 ) at hamburger and hamilton ( hh ) stages 12 , 18 , and 21 ( 25 ) . this corresponds to time points when the pancreas has just been specified in the endoderm , dorsal and ventral buds have formed , and -cells , -cells , and amylase - positive cells can be detected ( 6,17 ) . psmad1,5,8 stainings on e2 , e3 , and e4 ( hh st.12 , 18 , and 21 ) chicken embryos ( a j ) , e9.5 mouse embryo ( k l ) , and e11.5-dissected mouse gut ( m n ) . images are either projections of confocal z - stacks of thick vibratome sections ( a c ) or an optical section ( d ) . boxed area in b is shown in higher magnification in c and d. a : projected image from a z - stack showing psmad1,5,8 reactivity in the ventral forgut endoderm ( arrows ) and dorsal neural tube ( arrowhead ) . b : projected image at the presumptive pancreas level . note psmad1,5,8 reactivity in the lateral plate mesoderm and the underlying endoderm that appears yellow because of coexpression with foxa2 ( arrow ) . c and d : psmad1,5,8 reactivity can be observed in the endothelial cells of the dorsal aortas and in endoderm lateral to the nkx6.1 expression domain ( arrowhead ) . e and f : a section of an e3 pancreas stained as indicated ( shown with and without nkx6.1 ) . note the psmad1,5,8 reactivity in the mesenchyme and the absence of staining in the pancreas epithelium ( arrows point to the dorsal pancreas ) . g : composite of two images showing the dorsal and ventral pancreas and the liver ; psmad1,5,8 can be detected in the pancreas mesenchyme and in mesenchymal and epithelial compartments of the liver . h j : another section from the same pancreas showing absence of psmad1,5,8 immunoreactivity in the nkx6.1-positive pancreatic epithelium and -cells ( recognizable by their morphology , arrowhead ) . k and l : optical sections from a z - stack of an e9.5 mouse stained in whole mount ; psmad1,5,8 can be detected in the dorsal aorta and intersomitic vessels and in mesenchymal cells in close contact with the ventral pancreas epithelium . a , aorta ; dp , dorsal pancreas ; duo , duodenum , v , right omphalomesenteric vein ; vp , ventral pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) at hh st . 12 , embryos were whole - mount stained and 200-m transverse vibratome sections were analyzed ( fig . d ) and in the ventral part of the anterior foregut endoderm ( arrows , fig . 1a , ) as previously reported ( 24 ) . at the level of the 3rd to 8th somite pairs , where the prospective pancreatic endoderm is located ( 3,26 ) , psmad1,5,8 was detected in the lateral plate mesoderm and in the endoderm lateral to the nkx6.1 expression domain ( fig . 1 ) . we could also observe psmad1,5,8 in the endothelium of the paired dorsal aortas ( fig . 18 , psmad1,5,8 immunoreactivity was detected in the pancreas mesenchyme and at lower levels in the duodenal epithelium ( fig . one day later , we still observed a mesenchymal psmad1,5,8 signal ( fig . 1g j ) , but no signal was detected in the dorsal or ventral pancreatic epithelium . the liver epithelium had a strong signal with a sharp border of immunoreactivity in the bile duct ( fig . 1 g arrows ) . no psmad1,5,8 reactivity was detected in nkx6.1-positive cells , which at this stage comprise both undifferentiated epithelial cells and -cells ( 17 ) ( fig . the absence of labeling in -cells was confirmed by colabeling with an insulin antibody ( supplementary fig . 1 g and h ) . to evaluate the status of smad1,5,8 phosphorylation in the early mouse pancreas , we performed whole - mount staining at e9.5 and e11.5 for psmad1,5,8 combined with pdx1 ( fig . no psmad1,5,8 was detected in the pdx1-positive endoderm . at e11.5 , we observed psmad1,5,8 reactivity in the pancreas mesenchyme , but no reactivity in the pancreas epithelium ( fig we conclude that endogenous signaling leading to detectable levels of psmad1,5,8 in the early chicken and mouse pancreas is entirely restricted to the mesenchyme . bmp4 , -5 , and -7 mrna have been reported to be expressed in the embryonic mouse pancreas by rt - pcr ( 15 ) , and bmp4 and bmp7 have been localized to the pancreas epithelium ( 16 ) , but little is known about bmp expression during chicken pancreas development . 22 ) to characterize the expression patterns of bmp2 , bmp4 , bmp5 , and bmp7 ( fig . 2 and data not shown ) . we found that bmp4 and bmp7 are expressed in the chicken pancreas mesenchyme and excluded from the epithelium at the stages examined ( fig . we could not detect bmp2 or bmp5 in the pancreas at any stage ( data not shown ) . from these results we concluded that bmp signaling is active in the pancreas mesenchyme , possibly mediated by bmps expressed within the mesenchyme . mrna ish , showing the expression of bmp4 and bmp7 at the level of the posterior stomach ( in a and c , arrows point at the dorsal aorta . arrowheads in a point to mesonephros , and arrowheads in c point to expression in the stomach mesenchyme ) and the pancreas ( b and d ) at hh . note that the mesenchymal expression of bmp4 and bmp7 in the pancreas mesenchyme ( arrows , b and d ) . ( a high - quality digital representation of this figure is available in the online issue . ) to investigate the requirements for bmp signaling in pancreas development , we applied two complementary approaches . we ectopically expressed the secreted bmp antagonist noggin or a dominant negative bmp receptor type 1 ( dnalk3 ) in the pancreas epithelium using in ovo electroporation of the endoderm ( 6,27 ) . we expected that the secreted antagonist noggin should block bmp signaling in the epithelium as well as in the mesenchyme , whereas dnalk3 should be autonomous to the epithelial cells expressing this construct . 1012 , and the introduced genes were thus expressed soon after the specification of the pancreas endoderm ( 17 ) . first we electroporated with a cmyc tagged noggin in the pcig5 vector which has an ires nuclear enhanced green fluorescent protein ( egfp ) sequence allowing direct monitoring of electroporated cells ( 6 ) . as expected , egfp was restricted to the epithelium after 32 h. however , cmyc immunoreactivity demonstrated that noggin was efficiently secreted and spread throughout the surrounding mesenchyme ( supplementary fig . we next assayed for psmad1,5,8 in the pancreas 24 and 48 h after electroporation ( fig . 3 ) . electroporation with a control plasmid did not change the pattern of endogenous psmad1,5,8 ( fig . 3b and f ) , but ectopic expression of noggin resulted in loss of mesenchymal psmad1,5,8 immunoreactivity around the electroporated area ( fig . we could still detect psmad1,5,8 in the mesenchyme at a distance from the electroporated area ( fig . we noted that the nkx6.1-positive pancreas epithelium appeared less developed than the corresponding controls after 48 h ( compare fig . ectopic expression of noggin in the chicken pancreas epithelium leads to loss of psmad1,5,8 immunoreactivity in the mesenchyme . as indicated , 24 h ( a d ) and 48 h ( e h ) after electroporation . note the loss of psmad1,5,8 in the pancreas mesenchyme around the noggin transfected area compared with controls . h : arrowheads point to psmad1,5,8 signals maintained at a distance from the electroporated area . ( a high - quality digital representation of this figure is available in the online issue . ) to assess pancreas morphogenesis , we performed whole - mount immunofluorescent staining of electroporated embryos at 24 , 48 , and 72 h. three - dimensional projections of confocal z - stacks were generated showing green fluorescent protein ( gfp ) , nkx6.1 , and glucagon / insulin ( fig . after electroporation with control plasmid or noggin , the dorsal and ventral pancreata were both formed normally , and endocrine cells were found exclusively in the dorsal pancreas ( fig . d ) . at 48 h , the pancreata electroporated with empty vector developed normally with primary branching , two distinct ventral pancreas buds ( 5 ) , and endocrine cells confined to the dorsal pancreas ( fig . instead the dorsal pancreas appeared as a tubular structure extending anteriorly along the stomach ( fig . 4 g and h ) . quantifying the amount of epithelial and endocrine areas showed that the total endocrine area was unchanged , but precocious endocrine cells could be observed in the ventral pancreas which was hypoplastic ( fig . 4 g and h , arrow ; supplementary table 2 ) . in some embryos , ectopic noggin expression in the pancreas results in poor epithelial branching , precocious endocrine differentiation . d : at 24 h after electroporation with control plasmid ( a and b ) and noggin ( c and d ) . projected images from z - stacks show correct specification of the dorsal and ventral pancreas under both conditions . b and d are identical to a and c , except that the gfp signal was removed to show the distribution of pancreatic cell types . e and f : forty - eight hours after electroporation with control plasmid ( e and f ) and noggin ( g and h ) . e and g : projected images from a z - stack . f and h : optical sections from the stack . in the control , primary branchpoint in the epithelium can be observed ( f , arrowheads ) and endocrine cells are restricted to the dorsal pancreas . the dorsal pancreas is completely unbranched after noggin electroporation and extends as a tubular structure anteriorly along the stomach ( arrowheads in g and h ) . numerous endocrine cells can be seen in the ventral pancreas ( arrow in g and h ) . l : seventy - two hours after electroporation with control plasmid ( i and j ) and noggin ( k and l ) . i and k : projected images from a z - stack . j and l : optical sections from the stack . branching is more pronounced in the controls after 72 h ( j , arrowheads ) , and endocrine cells a large cluster of pancreatic endocrine cells can be found detached from the pancreas in the stomach mesenchyme ( k and l , arrowhead ) . in the small remaining ventral pancreas , m : less frequently observed phenotype 48 h after noggin electroporation the dorsal pancreas is almost entirely converted into a large endocrine cell mass . n : electroporation with dnalk3 has no effect on the normal pancreas development 48 h after electroporation . see table 1 for quantifications . ( a high - quality digital representation of this figure is available in the online issue . ) at 72 h after electroporation with control vector , endocrine cells were still confined to the dorsal pancreas and branching of the epithelium was prominent ( fig . 4i and j ) . conversely , the pancreata of noggin electroporated embryos were hypomorphic , and large endocrine clusters detached from the pancreas could be observed in the stomach mesenchyme ( fig . there was no epithelial branching and endocrine cells were found in the ventral pancreas ( fig . cell - autonomous inhibition of bmp signaling in the endoderm via electroporation with dnalk3 had no effect on pancreas development ( fig . 4n ) , suggesting that the effect elicited by noggin is through inhibition of bmp signaling in the mesenchyme . in neural tube electroporation experiments , dnalk3 , as well as noggin , was able to block smad1,5,8 phosphorylation in the dorsal neural tube . confirming that the dnalk3 construct worked as expected ( supplementary fig . 2c h ) the pancreas of noggin electroporated embryos was further analyzed on sections 48 h after electroporation ( fig . the anterior extension of the pancreas contained nkx6.1 , glucagon , and insulin - positive cells ( fig . 5c ) , but no exocrine cells were found in noggin electroporated embryos ( fig . pancreatic cell types can be observed in the stomach mesenchyme and exocrine differentiation is reduced 48 h after electroporation with noggin . a and b are adjacent sections at the level of the stomach in a noggin electroporated embryo showing nkx6.1 mrna expression and insulin and glucagon protein expression , respectively . large clusters of pancreatic cells can be found in the stomach mesenchyme , and both glucagon and insulin are readily found ( a and b ) . c and d : sections of the pancreas of control ( c ) and noggin ( d ) electroprated embryos imunoflurescently labeled for amylase and showing gfp expression in electroporated cells . in d inset : the boxed area is without gfp . note the absence of amylase - positive cells in the noggin - electroporated pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) the results presented so far indicate that bmp signaling is required in the mesenchyme and that the effect on the epithelium is indirect . this was difficult to demonstrate directly since electroporation in the chicken embryo does not permit cell - autonomous inhibition of bmp signaling in the mesenchyme . therefore , we took advantage of established protocols for in vitro development of mouse pancreas explants and lentiviral gene transduction ( 28 ) . we explanted e12.5 pancreata transduced with lentivirial vectors encoding either gfp , noggin , or dnalk3 . when whole pancreas explants were exposed to lentiviral vectors , exclusive infection of the mesenchyme cell autonomous bmp signaling inhibition in the mouse pancreas mesenchyme results in increased -cell differentiation . mouse pancreas organ cultures explanted and transduced at e12.5 ( a k ) or 10.5 ( l n ) with lentiviral constructs as indicated . a d f : stereomicrographs of three different explants of each condition after 7 days in culture . g and h : explants transduced with a control egfp construct , immunflurescently stained for e - cadherin ( red ) and showing egfp with or without dapi nuclear counterstain . note how gfp expression is restricted to the mesenchyme 3 and 7 days after transduction . immunostained for amylase ( green ) , insulin ( red ) , and nuclei ( dapi , blue ) . n : explants transduced at e10.5 and cultured for 8 days , then stained for amylase and insulin with dapi nuclear counter stain . see table 2 for quantifications . ( a high - quality digital representation of this figure is available in the online issue . ) stereomicrographs of the explants cultured for 7 days showed that dnalk3 and noggin - transduced explants had a similar morphology and were of similar size as controls ( fig . f ) . costaining for e - cadherin and gfp on gfp - transduced explants confirmed the mesenchymal - specific expression after 3 and 7 days in culture ( fig . we quantified the number of exocrine cells and -cells after 7 days in culture ( fig . l , supplementary table 3 ) and found a 2.8-fold increase in the relative area of -cells in dnalk3-transduced explants compared with controls . this expansion was even more pronounced in noggin - transduced explants which showed a 3.6-fold increase in relative -cell area . in contrast , the relative exocrine area was diminished in dnalk3 and noggin - transduced explants compared with controls ( not statistically significant ) . there was no obvious branching defect in these studies , which could be a result of different timing of bmp inhibition compared with the studies performed in chicken . e10.5 gut tubes were dissected ; transduced with gfp , noggin , or dnalk3 ; and cultured for 4 and 8 days . after 4 days , the total explant volume was reduced by 5.5- and 1.8-fold when transduced with noggin and dnalk3 , respectively ( compared with control gfp transduction ; supplementary fig . noggin transduction resulted in a subtle change in the overall branching pattern , visualized by whole - mount mucin-1 staining , as main ducts were not well defined and appeared diffuse compared with controls ( supplementary fig . mesenchymal noggin expression increased the total number of insulin - positive cells by 3.8-fold , whereas the total number of amylase - positive cells were reduced by 1.6-fold ( fig . similarly , mesenchymal expression of dnalk3 increased the number of insulin - positive cells by 2.5-fold , demonstrating that cell autonomous bmp signal reception in the mesenchyme is required for a normal rate of endocrine cell differentiation to occur . we did observe a small but statistically significant effect on total exocrine cell numbers in noggin - transduced explants and in relative numbers of exocrine cells in both noggin and dnalk3 transduced ( supplementary table 3 ) . the effect of mesenchymal expression of dnalk3 on branching morphogenesis was ambiguous ; some explants exhibited a phenotype similar to the noggin - transduced explants , whereas some had a normal appearance ( not shown ) . since our results suggested that noggin inhibited bmp signaling in the mesenchyme , we next investigated mesenchymal gene expression patterns . pitx2 is normally expressed in the left side of the mesenchyme of vertebrate embryos and is involved in asymmetrical organ development ( 29,30 ) . bapx1 was recently demonstrated to be involved in the left - sided lateral growth of the e10.5 mouse dorsal pancreas because of a requirement for bapx1 in the formation of a specialized mesothelial structure , the splancnic mesodermal plate ( smp ) ( 31 ) . it is normally expressed in the left side of the mesenchyme , and it is required for the separation of the splenic and pancreatic mesenchyme and maintenance of the pancreas character in the distal part of the dorsal pancreas ( 31,32 ) . to evaluate the expression of pitx2 and bapx1 in relation to the chicken pancreas , we first performed mrna in situ hybridizations on serial sections for nkx6.1 and shh , together with pitx2 and bapx1 ( supplementary fig . 4 ) . we found that , as in the mouse , bapx1 was initially expressed bilaterally in the pancreas region ( supplementary fig . 4p ) , but from e3 strong expression was restricted to the pitx2-positive mesenchyme on the left side of the pancreas ( supplementary fig . bapx1 appeared to be symmetrically expressed at the level of the stomach ( supplementary fig . , we found that bapx1 was expressed left sided in the pancreas mesenchyme together with pitx2 after 48 h ( fig . 7c and e ) . in contrast , noggin - electroporated embryos displayed a duplication of bapx1 expression , whereas pitx2 remained left sided , suggesting that bapx1 and pitx2 expression is uncoupled at least under these conditions ( fig . these results are in agreement with a role for bmp signaling in development of the pancreas mesenchyme . since bapx1 is involved in the formation of the spm in the mouse embryo , we hypothesized that this structure could be affected in the bmp - inhibited embryos . we therefore stained for isl1 and laminin or nkx6.1/nkx2.2 with dapi nuclear counter stain to visualize this structure ( supplementary fig . , the spm was asymmetric with a condensation of the mesothelium on the left side at hh st . 5c and d ) , suggesting that downregulation of right - sided bapx1 expression is required for establishment of the asymmetric spm . electroporation with noggin results in persistence of a bapx1-positive pancreas mesenchyme on the right side of the pancreas 48 h after electroporation . a , c , e and b , d , f are serial sections from the same embryos , g j are serial sections from other embryos . pitx2 and bapx1 are normally coexpressed on the left side of the pancreas in control embryos ( arrows , c and e ) . however , in noggin - electroporated embryos , bapx1 expression becomes symmetrically expressed on both sides of the pancreas ( arrows , f ) , whereas pitx2 remains left sided ( arrow , d ) . most of the unbranced dorsal pancreas in noggin electroporated embryos does not express hes1 ( g and h ) , but the duodenum maintains hes1 expression . the observation of precocious endocrine differentiation in noggin - electroporated embryos prompted us to analyze the expression of hes1 . we found that the unbranched tubular dorsal pancreas was hes1-negative 48 h after electroporation , suggesting that the excessive endocrine differentiation is coincident with downregulated hes1 expression ( fig . 7e and k ) . we therefore looked after 32 h of development and earlier ( supplementary fig . 6 and data not shown ) . most of the nkx6.1-positive dorsal pancreas epithelium had differentiated after 32 h and was hes1-negative , but the remaining nkx6.1-positive cells expressed normal levels of hes1 . at earlier time points when the pancreas was more normal , we could not detect a general downregulation of hes1 in the epithelium ( not shown ) . we can therefore not distinguish between loss of hes1 followed by differentiation or vice versa , likely because our ish protocol does not allow quantitative measurements of mrna expression levels . the bilateral expression of bapx1 in the mesenchyme of noggin electroporated embryos was notable . in chicken and mice , the right omphalomesenteric vein is normally found at this position , and the developing pancreas grows around this vessel ( 4,5 ) . gene expression changes in this structure might indicate that the normal intimately joined development of the pancreas and the vein was disturbed . to visualize the vasculature and the pancreas , we injected embryos with fluorescently - labeled lens culinaris agglutin , a lectin with high affinity to chicken endothelial cells ( 20 ) , and subsequently we stained for nkx6.1 by whole - mount immunohistochemistry ( fig . 8) . embryos perfused with a fluorescently - tagged lens culinaris agglutinin ( labeling the vascular endothelium ) and subjected to whole - mount immunostaing for nkx6.1 and gfp . a , b and e , f show projected z - stacks from lateral views at two different magnifications . c and g : projected images from transverse thick vibratome sections from the same embryos ( indicated by dashed lines in a and e ) . note how the dorsal aorta is well separated from the pancreas in the control and how the dorsal pancreas curls around the omphalomesenteric vein . in noggin - electroporated embryos , the omphalomesenteric vein is consistently found ventrally to the pancreas , and in some of the embryos , the paired dorsal aortas fail to fuse . the bisymmetrical mesenchyme is indicated by dashed lines in f. ( the contrast was temporarily enhanced in the image to allow the drawing based on a background signal . the mesenchyme is not readily observable at the published contrast setting ) . d and h : schematic drawing summarizing the relationship between the gut and pancreas ( green ) and the omphalomesenteric vein ( red ) . a , aorta ; dp , dorsal pancreas ; duo , duodenum ; dv , ductus venosus ; li , liver ; ov , omphalomesenteric vein ; vp , ventral pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) at 3 days of development ( hh st . 19 ) , the paired omphalomesenteric veins run on each side of the gut tube and join anteriorly at the level of the liver in the ductus venosus ( 33 ) ( supplementary fig . the bilateral , ventral nkx6.1 domains are in close contact to these veins and the dorsal pancreas has grown asymmetrically over the right omphalomesenteric vein ( supplementary fig . the dorsal aorta is well separated from the pancreas by the pancreatic mesenchyme . during the next day , a series of anastomoses of the veins occur and most of the left omphalomesenteric vein regresses , leaving behind the right omphalomesenteric vein which curls around the gut at the level of the pancreas ( 5,33 ) ( supplementary fig . one of the ventral pancreata lie in close contact to the right omphalomesenteric vein ( supplementary fig . we analyzed the vascular development in control and noggin electroporated embryos 48 h after electroporation . 8c ) , and , as expected , the dorsal aorta was well separated from the dorsal pancreas ( fig . the omphalomesenteric vein was found on the ventral side of the pancreas and gut ( n = 6 ) and , in some embryos , the dorsal aortas failed to fuse and move dorsally ( 2 of 6 embryos ) . to assess the development of the microvasculature , we made flk1 ish on sectioned embryos . this revealed a normal microvasculature around the dorsal pancreas 32 h after electroporation when the omphalomesenteric vein is already displaced to the ventral side in bmp - inhibited embryos ( supplementary fig . bmp signaling is transduced by smad1 , 5 , and 8 which , upon signaling , become phosphorylated and accumulates in the nucleus where they act as transcription factors ( 23 ) . we used a phosphosmad1,5,8-specific antibody ( 24 ) to characterize endogenous bmp signaling in the embryonic chicken pancreas ( fig . 1 ) at hamburger and hamilton ( hh ) stages 12 , 18 , and 21 ( 25 ) . this corresponds to time points when the pancreas has just been specified in the endoderm , dorsal and ventral buds have formed , and -cells , -cells , and amylase - positive cells can be detected ( 6,17 ) . psmad1,5,8 stainings on e2 , e3 , and e4 ( hh st.12 , 18 , and 21 ) chicken embryos ( a j ) , e9.5 mouse embryo ( k l ) , and e11.5-dissected mouse gut ( m n ) . images are either projections of confocal z - stacks of thick vibratome sections ( a c ) or an optical section ( d ) . boxed area in b is shown in higher magnification in c and d. a : projected image from a z - stack showing psmad1,5,8 reactivity in the ventral forgut endoderm ( arrows ) and dorsal neural tube ( arrowhead ) . b : projected image at the presumptive pancreas level . note psmad1,5,8 reactivity in the lateral plate mesoderm and the underlying endoderm that appears yellow because of coexpression with foxa2 ( arrow ) . c and d : psmad1,5,8 reactivity can be observed in the endothelial cells of the dorsal aortas and in endoderm lateral to the nkx6.1 expression domain ( arrowhead ) . e and f : a section of an e3 pancreas stained as indicated ( shown with and without nkx6.1 ) . note the psmad1,5,8 reactivity in the mesenchyme and the absence of staining in the pancreas epithelium ( arrows point to the dorsal pancreas ) . g : composite of two images showing the dorsal and ventral pancreas and the liver ; psmad1,5,8 can be detected in the pancreas mesenchyme and in mesenchymal and epithelial compartments of the liver . h j : another section from the same pancreas showing absence of psmad1,5,8 immunoreactivity in the nkx6.1-positive pancreatic epithelium and -cells ( recognizable by their morphology , arrowhead ) . k and l : optical sections from a z - stack of an e9.5 mouse stained in whole mount ; psmad1,5,8 can be detected in the dorsal aorta and intersomitic vessels and in mesenchymal cells in close contact with the ventral pancreas epithelium . a , aorta ; dp , dorsal pancreas ; duo , duodenum , v , right omphalomesenteric vein ; vp , ventral pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) at hh st . 12 , embryos were whole - mount stained and 200-m transverse vibratome sections were analyzed ( fig . d ) and in the ventral part of the anterior foregut endoderm ( arrows , fig . 1a , ) as previously reported ( 24 ) . at the level of the 3rd to 8th somite pairs , where the prospective pancreatic endoderm is located ( 3,26 ) , psmad1,5,8 was detected in the lateral plate mesoderm and in the endoderm lateral to the nkx6.1 expression domain ( fig . 1 ) . we could also observe psmad1,5,8 in the endothelium of the paired dorsal aortas ( fig . 18 , psmad1,5,8 immunoreactivity was detected in the pancreas mesenchyme and at lower levels in the duodenal epithelium ( fig . one day later , we still observed a mesenchymal psmad1,5,8 signal ( fig . 1g j ) , but no signal was detected in the dorsal or ventral pancreatic epithelium . the liver epithelium had a strong signal with a sharp border of immunoreactivity in the bile duct ( fig . 1 g arrows ) . no psmad1,5,8 reactivity was detected in nkx6.1-positive cells , which at this stage comprise both undifferentiated epithelial cells and -cells ( 17 ) ( fig . the absence of labeling in -cells was confirmed by colabeling with an insulin antibody ( supplementary fig . 1 g and h ) . to evaluate the status of smad1,5,8 phosphorylation in the early mouse pancreas , we performed whole - mount staining at e9.5 and e11.5 for psmad1,5,8 combined with pdx1 ( fig . no psmad1,5,8 was detected in the pdx1-positive endoderm . at e11.5 , we observed psmad1,5,8 reactivity in the pancreas mesenchyme , but no reactivity in the pancreas epithelium ( fig we conclude that endogenous signaling leading to detectable levels of psmad1,5,8 in the early chicken and mouse pancreas is entirely restricted to the mesenchyme . bmp4 , -5 , and -7 mrna have been reported to be expressed in the embryonic mouse pancreas by rt - pcr ( 15 ) , and bmp4 and bmp7 have been localized to the pancreas epithelium ( 16 ) , but little is known about bmp expression during chicken pancreas development . 22 ) to characterize the expression patterns of bmp2 , bmp4 , bmp5 , and bmp7 ( fig . 2 and data not shown ) . we found that bmp4 and bmp7 are expressed in the chicken pancreas mesenchyme and excluded from the epithelium at the stages examined ( fig . we could not detect bmp2 or bmp5 in the pancreas at any stage ( data not shown ) . from these results we concluded that bmp signaling is active in the pancreas mesenchyme , possibly mediated by bmps expressed within the mesenchyme . mrna ish , showing the expression of bmp4 and bmp7 at the level of the posterior stomach ( in a and c , arrows point at the dorsal aorta . arrowheads in a point to mesonephros , and arrowheads in c point to expression in the stomach mesenchyme ) and the pancreas ( b and d ) at hh . note that the mesenchymal expression of bmp4 and bmp7 in the pancreas mesenchyme ( arrows , b and d ) . ( a high - quality digital representation of this figure is available in the online issue . ) to investigate the requirements for bmp signaling in pancreas development , we applied two complementary approaches . we ectopically expressed the secreted bmp antagonist noggin or a dominant negative bmp receptor type 1 ( dnalk3 ) in the pancreas epithelium using in ovo electroporation of the endoderm ( 6,27 ) . we expected that the secreted antagonist noggin should block bmp signaling in the epithelium as well as in the mesenchyme , whereas dnalk3 should be autonomous to the epithelial cells expressing this construct . 1012 , and the introduced genes were thus expressed soon after the specification of the pancreas endoderm ( 17 ) . first we electroporated with a cmyc tagged noggin in the pcig5 vector which has an ires nuclear enhanced green fluorescent protein ( egfp ) sequence allowing direct monitoring of electroporated cells ( 6 ) . as expected , egfp was restricted to the epithelium after 32 h. however , cmyc immunoreactivity demonstrated that noggin was efficiently secreted and spread throughout the surrounding mesenchyme ( supplementary fig . we next assayed for psmad1,5,8 in the pancreas 24 and 48 h after electroporation ( fig . 3 ) . electroporation with a control plasmid did not change the pattern of endogenous psmad1,5,8 ( fig . 3b and f ) , but ectopic expression of noggin resulted in loss of mesenchymal psmad1,5,8 immunoreactivity around the electroporated area ( fig . we could still detect psmad1,5,8 in the mesenchyme at a distance from the electroporated area ( fig . we noted that the nkx6.1-positive pancreas epithelium appeared less developed than the corresponding controls after 48 h ( compare fig . 3g ectopic expression of noggin in the chicken pancreas epithelium leads to loss of psmad1,5,8 immunoreactivity in the mesenchyme . sectioned pancreata immunolabeled as indicated , 24 h ( a d ) and 48 h ( e h ) after electroporation . note the loss of psmad1,5,8 in the pancreas mesenchyme around the noggin transfected area compared with controls . h : arrowheads point to psmad1,5,8 signals maintained at a distance from the electroporated area . ( a high - quality digital representation of this figure is available in the online issue . ) to assess pancreas morphogenesis , we performed whole - mount immunofluorescent staining of electroporated embryos at 24 , 48 , and 72 h. three - dimensional projections of confocal z - stacks were generated showing green fluorescent protein ( gfp ) , nkx6.1 , and glucagon / insulin ( fig . after electroporation with control plasmid or noggin , the dorsal and ventral pancreata were both formed normally , and endocrine cells were found exclusively in the dorsal pancreas ( fig . d ) . at 48 h , the pancreata electroporated with empty vector developed normally with primary branching , two distinct ventral pancreas buds ( 5 ) , and endocrine cells confined to the dorsal pancreas ( fig . 4e and f ) . instead the dorsal pancreas appeared as a tubular structure extending anteriorly along the stomach ( fig . 4 g and h ) . quantifying the amount of epithelial and endocrine areas showed that the total endocrine area was unchanged , but precocious endocrine cells could be observed in the ventral pancreas which was hypoplastic ( fig . 4 g and h , arrow ; supplementary table 2 ) . in some embryos , ectopic noggin expression in the pancreas results in poor epithelial branching , precocious endocrine differentiation . d : at 24 h after electroporation with control plasmid ( a and b ) and noggin ( c and d ) . projected images from z - stacks show correct specification of the dorsal and ventral pancreas under both conditions . b and d are identical to a and c , except that the gfp signal was removed to show the distribution of pancreatic cell types . e and f : forty - eight hours after electroporation with control plasmid ( e and f ) and noggin ( g and h ) . e and g : projected images from a z - stack . f and h : optical sections from the stack . in the control , primary branchpoint in the epithelium can be observed ( f , arrowheads ) and endocrine cells are restricted to the dorsal pancreas . the dorsal pancreas is completely unbranched after noggin electroporation and extends as a tubular structure anteriorly along the stomach ( arrowheads in g and h ) . numerous endocrine cells can be seen in the ventral pancreas ( arrow in g and h ) . l : seventy - two hours after electroporation with control plasmid ( i and j ) and noggin ( k and l ) . i and k : projected images from a z - stack . j and l : optical sections from the stack . branching is more pronounced in the controls after 72 h ( j , arrowheads ) , and endocrine cells are still confined to the dorsal pancreas . in noggin a large cluster of pancreatic endocrine cells can be found detached from the pancreas in the stomach mesenchyme ( k and l , arrowhead ) . in the small remaining ventral pancreas , m : less frequently observed phenotype 48 h after noggin electroporation the dorsal pancreas is almost entirely converted into a large endocrine cell mass . n : electroporation with dnalk3 has no effect on the normal pancreas development 48 h after electroporation . see table 1 for quantifications . ( a high - quality digital representation of this figure is available in the online issue . ) at 72 h after electroporation with control vector , endocrine cells were still confined to the dorsal pancreas and branching of the epithelium was prominent ( fig . 4i and j ) . conversely , the pancreata of noggin electroporated embryos were hypomorphic , and large endocrine clusters detached from the pancreas could be observed in the stomach mesenchyme ( fig . there was no epithelial branching and endocrine cells were found in the ventral pancreas ( fig . cell - autonomous inhibition of bmp signaling in the endoderm via electroporation with dnalk3 had no effect on pancreas development ( fig . 4n ) , suggesting that the effect elicited by noggin is through inhibition of bmp signaling in the mesenchyme . in neural tube electroporation experiments , dnalk3 , as well as noggin , was able to block smad1,5,8 phosphorylation in the dorsal neural tube . confirming that the dnalk3 construct worked as expected ( supplementary fig . 2c h ) . the pancreas of noggin electroporated embryos was further analyzed on sections 48 h after electroporation ( fig . the anterior extension of the pancreas contained nkx6.1 , glucagon , and insulin - positive cells ( fig . 5c ) , but no exocrine cells were found in noggin electroporated embryos ( fig . pancreatic cell types can be observed in the stomach mesenchyme and exocrine differentiation is reduced 48 h after electroporation with noggin . a and b are adjacent sections at the level of the stomach in a noggin electroporated embryo showing nkx6.1 mrna expression and insulin and glucagon protein expression , respectively . large clusters of pancreatic cells can be found in the stomach mesenchyme , and both glucagon and insulin are readily found ( a and b ) . c and d : sections of the pancreas of control ( c ) and noggin ( d ) electroprated embryos imunoflurescently labeled for amylase and showing gfp expression in electroporated cells . in d inset : the boxed area is without gfp . note the absence of amylase - positive cells in the noggin - electroporated pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) the results presented so far indicate that bmp signaling is required in the mesenchyme and that the effect on the epithelium is indirect . this was difficult to demonstrate directly since electroporation in the chicken embryo does not permit cell - autonomous inhibition of bmp signaling in the mesenchyme . therefore , we took advantage of established protocols for in vitro development of mouse pancreas explants and lentiviral gene transduction ( 28 ) . we explanted e12.5 pancreata transduced with lentivirial vectors encoding either gfp , noggin , or dnalk3 . when whole pancreas explants were exposed to lentiviral vectors , exclusive infection of the mesenchyme cell autonomous bmp signaling inhibition in the mouse pancreas mesenchyme results in increased -cell differentiation . mouse pancreas organ cultures explanted and transduced at e12.5 ( a k ) or 10.5 ( l n ) with lentiviral constructs as indicated . a d f : stereomicrographs of three different explants of each condition after 7 days in culture . g and h : explants transduced with a control egfp construct , immunflurescently stained for e - cadherin ( red ) and showing egfp with or without dapi nuclear counterstain . note how gfp expression is restricted to the mesenchyme 3 and 7 days after transduction . immunostained for amylase ( green ) , insulin ( red ) , and nuclei ( dapi , blue ) . n : explants transduced at e10.5 and cultured for 8 days , then stained for amylase and insulin with dapi nuclear counter stain . see table 2 for quantifications . ( a high - quality digital representation of this figure is available in the online issue . ) stereomicrographs of the explants cultured for 7 days showed that dnalk3 and noggin - transduced explants had a similar morphology and were of similar size as controls ( fig . f ) . costaining for e - cadherin and gfp on gfp - transduced explants confirmed the mesenchymal - specific expression after 3 and 7 days in culture ( fig . we quantified the number of exocrine cells and -cells after 7 days in culture ( fig . l , supplementary table 3 ) and found a 2.8-fold increase in the relative area of -cells in dnalk3-transduced explants compared with controls . this expansion was even more pronounced in noggin - transduced explants which showed a 3.6-fold increase in relative -cell area . in contrast , the relative exocrine area was diminished in dnalk3 and noggin - transduced explants compared with controls ( not statistically significant ) . there was no obvious branching defect in these studies , which could be a result of different timing of bmp inhibition compared with the studies performed in chicken . e10.5 gut tubes were dissected ; transduced with gfp , noggin , or dnalk3 ; and cultured for 4 and 8 days . after 4 days , the total explant volume was reduced by 5.5- and 1.8-fold when transduced with noggin and dnalk3 , respectively ( compared with control gfp transduction ; supplementary fig . noggin transduction resulted in a subtle change in the overall branching pattern , visualized by whole - mount mucin-1 staining , as main ducts were not well defined and appeared diffuse compared with controls ( supplementary fig . after 8 days in culture , mesenchymal noggin expression increased the total number of insulin - positive cells by 3.8-fold , whereas the total number of amylase - positive cells were reduced by 1.6-fold ( fig . similarly , mesenchymal expression of dnalk3 increased the number of insulin - positive cells by 2.5-fold , demonstrating that cell autonomous bmp signal reception in the mesenchyme is required for a normal rate of endocrine cell differentiation to occur . we did observe a small but statistically significant effect on total exocrine cell numbers in noggin - transduced explants and in relative numbers of exocrine cells in both noggin and dnalk3 transduced ( supplementary table 3 ) . the effect of mesenchymal expression of dnalk3 on branching morphogenesis was ambiguous ; some explants exhibited a phenotype similar to the noggin - transduced explants , whereas some had a normal appearance ( not shown ) . since our results suggested that noggin inhibited bmp signaling in the mesenchyme , we next investigated mesenchymal gene expression patterns . pitx2 is normally expressed in the left side of the mesenchyme of vertebrate embryos and is involved in asymmetrical organ development ( 29,30 ) . bapx1 was recently demonstrated to be involved in the left - sided lateral growth of the e10.5 mouse dorsal pancreas because of a requirement for bapx1 in the formation of a specialized mesothelial structure , the splancnic mesodermal plate ( smp ) ( 31 ) . it is normally expressed in the left side of the mesenchyme , and it is required for the separation of the splenic and pancreatic mesenchyme and maintenance of the pancreas character in the distal part of the dorsal pancreas ( 31,32 ) . to evaluate the expression of pitx2 and bapx1 in relation to the chicken pancreas , we first performed mrna in situ hybridizations on serial sections for nkx6.1 and shh , together with pitx2 and bapx1 ( supplementary fig . 4 ) . we found that , as in the mouse , bapx1 was initially expressed bilaterally in the pancreas region ( supplementary fig . 4p ) , but from e3 strong expression was restricted to the pitx2-positive mesenchyme on the left side of the pancreas ( supplementary fig . bapx1 appeared to be symmetrically expressed at the level of the stomach ( supplementary fig . 4h ) as in the mouse ( 31 ) . in control embryos , we found that bapx1 was expressed left sided in the pancreas mesenchyme together with pitx2 after 48 h ( fig . 7c and e ) . in contrast , noggin - electroporated embryos displayed a duplication of bapx1 expression , whereas pitx2 remained left sided , suggesting that bapx1 and pitx2 expression is uncoupled at least under these conditions ( fig . these results are in agreement with a role for bmp signaling in development of the pancreas mesenchyme . since bapx1 is involved in the formation of the spm in the mouse embryo , we hypothesized that this structure could be affected in the bmp - inhibited embryos . we therefore stained for isl1 and laminin or nkx6.1/nkx2.2 with dapi nuclear counter stain to visualize this structure ( supplementary fig . , the spm was asymmetric with a condensation of the mesothelium on the left side at hh st . 5c and d ) , suggesting that downregulation of right - sided bapx1 expression is required for establishment of the asymmetric spm . electroporation with noggin results in persistence of a bapx1-positive pancreas mesenchyme on the right side of the pancreas 48 h after electroporation . mrna in situ hybridization on electroporated embryos 48 h after electroporation . a , c , e and b , d , f are serial sections from the same embryos , g j are serial sections from other embryos . pitx2 and bapx1 are normally coexpressed on the left side of the pancreas in control embryos ( arrows , c and e ) . however , in noggin - electroporated embryos , bapx1 expression becomes symmetrically expressed on both sides of the pancreas ( arrows , f ) , whereas pitx2 remains left sided ( arrow , d ) . most of the unbranced dorsal pancreas in noggin electroporated embryos does not express hes1 ( g and h ) , but the duodenum maintains hes1 expression . the observation of precocious endocrine differentiation in noggin - electroporated embryos prompted us to analyze the expression of hes1 . we found that the unbranched tubular dorsal pancreas was hes1-negative 48 h after electroporation , suggesting that the excessive endocrine differentiation is coincident with downregulated hes1 expression ( fig . 7e and k ) . most of the nkx6.1-positive dorsal pancreas epithelium had differentiated after 32 h and was hes1-negative , but the remaining nkx6.1-positive cells expressed normal levels of hes1 . at earlier time points when the pancreas was more normal , we could not detect a general downregulation of hes1 in the epithelium ( not shown ) . we can therefore not distinguish between loss of hes1 followed by differentiation or vice versa , likely because our ish protocol does not allow quantitative measurements of mrna expression levels . the bilateral expression of bapx1 in the mesenchyme of noggin electroporated embryos was notable . in chicken and mice , the right omphalomesenteric vein is normally found at this position , and the developing pancreas grows around this vessel ( 4,5 ) . gene expression changes in this structure might indicate that the normal intimately joined development of the pancreas and the vein was disturbed . to visualize the vasculature and the pancreas , we injected embryos with fluorescently - labeled lens culinaris agglutin , a lectin with high affinity to chicken endothelial cells ( 20 ) , and subsequently we stained for nkx6.1 by whole - mount immunohistochemistry ( fig . 8) . embryos perfused with a fluorescently - tagged lens culinaris agglutinin ( labeling the vascular endothelium ) and subjected to whole - mount immunostaing for nkx6.1 and gfp . a , b and e , f show projected z - stacks from lateral views at two different magnifications . c and g : projected images from transverse thick vibratome sections from the same embryos ( indicated by dashed lines in a and e ) . note how the dorsal aorta is well separated from the pancreas in the control and how the dorsal pancreas curls around the omphalomesenteric vein . in noggin - electroporated embryos , the omphalomesenteric vein is consistently found ventrally to the pancreas , and in some of the embryos , the paired dorsal aortas fail to fuse . the bisymmetrical mesenchyme is indicated by dashed lines in f. ( the contrast was temporarily enhanced in the image to allow the drawing based on a background signal . d and h : schematic drawing summarizing the relationship between the gut and pancreas ( green ) and the omphalomesenteric vein ( red ) . a , aorta ; dp , dorsal pancreas ; duo , duodenum ; dv , ductus venosus ; li , liver ; ov , omphalomesenteric vein ; vp , ventral pancreas . ( a high - quality digital representation of this figure is available in the online issue . ) at 3 days of development ( hh st . 19 ) , the paired omphalomesenteric veins run on each side of the gut tube and join anteriorly at the level of the liver in the ductus venosus ( 33 ) ( supplementary fig . the bilateral , ventral nkx6.1 domains are in close contact to these veins and the dorsal pancreas has grown asymmetrically over the right omphalomesenteric vein ( supplementary fig . the dorsal aorta is well separated from the pancreas by the pancreatic mesenchyme . during the next day , a series of anastomoses of the veins occur and most of the left omphalomesenteric vein regresses , leaving behind the right omphalomesenteric vein which curls around the gut at the level of the pancreas ( 5,33 ) ( supplementary fig . one of the ventral pancreata lie in close contact to the right omphalomesenteric vein ( supplementary fig . we analyzed the vascular development in control and noggin electroporated embryos 48 h after electroporation . 8c ) , and , as expected , the dorsal aorta was well separated from the dorsal pancreas ( fig . in noggin electroporated embryos , the vasculature developed abnormally ( fig . 8e g ) . the omphalomesenteric vein was found on the ventral side of the pancreas and gut ( n = 6 ) and , in some embryos , the dorsal aortas failed to fuse and move dorsally ( 2 of 6 embryos ) . to assess the development of the microvasculature this revealed a normal microvasculature around the dorsal pancreas 32 h after electroporation when the omphalomesenteric vein is already displaced to the ventral side in bmp - inhibited embryos ( supplementary fig . development of the pancreas depends on interactions between the epithelium and the mesenchyme as recognized since the studies by golosow and grobstein ( 12 ) , but few endogenous signaling factors have been identified . here , we used chicken in ovo endoderm electroporation timed to express the pancreatic transgenes after specification of the pancreas . detection of psmad1,5,8 shows that early pancreatic mesenchyme receives a bmp signal , possibly through alk3 , which is expressed in the chicken pancreas mesenchyme ( 34 ) . since we find bmp expression in the mesenchyme , it is possible that an autocrine signaling mechanism is occurring . epithelial expression of the secreted bmp antagonist noggin resulted in the loss of psmad1,5,8 immunoreactivity in the adjacent mesenchyme and affected epithelial and mesenchymal development . the epithelium displayed reduced branching , anterior extension of the dorsal pancreas into the stomach mesenchyme , and precocious endocrine differentiation . inhibiting bmp signaling compromised angiogenic remodeling that positions the right omphalomesenteric vein adjacent to the pancreas . instead , we observed a persistence of mesenchymal bapx1 expression , a bilateral smp , and failure of the dorsal aortas to fuse in the most severely affected embryos . we can not distinguish a direct effect on the endothelial cells from an indirect effect acting through the mesenchyme . however , the microvasculature seems normal in bmp - inhibited embryos , suggesting that some aspects of angiogenesis occur normally and the defect appears limited to major vessels . notably , the mouse explants corroborate the findings in chick , arguing against involvement of the major vessels . additionally , mesenchymal isl1 expression , dependent on signals from blood vessels ( 35 ) , is maintained . the results presented herein appear to conflict with a recent report by goulley et al . bmp signaling was perturbed by the expression of noggin and bmp4 in the pancreas epithelium using the pdx1 promoter , with no profound effect on pancreatic development . we speculate that this could be due to different levels of expression since establishment of high - expressing transgenic mouse lines used in their studies would be prevented by a severe vascular or pancreatic phenotype caused by embryonic or perinatal lethality , and thus a selection for low expressers . a similar study expressing bmp6 under the control of the pdx1 promoter resulted in complete pancreas agenesis at a late gestational age , and these mice displayed a hypomorphic spleen , suggesting that the mesenchyme was also affected ( 15 ) . the present study suggests that there is no epithelial bmp signaling in the pancreas at the investigated stages , and that the effect on epithelial development is secondary to inhibition of bmp signaling in the mesenchyme . this is supported by the observation that cell autonomous bmp - signaling inhibition in the mouse pancreas mesenchyme leads to an increase in endocrine differentiation concomitant with a decrease in exocrine development . it is possible that the effect of bmp inhibition on the mesenchyme can be subdivided into an inhibition of an autocrine mesenchymal signal and an associated effect on vascular remodelling . bmp signaling in the mesenchyme may be required for the mesenchyme to express a secondary factor acting on the epithelium . fgf10 is one candidate because mesenchymal fgf10 is required for epithelial branching and progenitor cell proliferation ( 911 ) . however , there is little fgf10 expression left at e12.5 , the time of explanting in some of the organ culture experiments , suggesting that other factors could be involved .

objectivepancreas organogenesis is orchestrated by interactions between the epithelium and the mesenchyme , but these interactions are not completely understood . here we investigated a role for bone morphogenetic protein ( bmp ) signaling within the pancreas mesenchyme and found it to be required for the normal development of the mesenchyme as well as for the pancreatic epithelium.research design and methodswe analyzed active bmp signaling by immunostaining for phospho - smad1,5,8 and tested whether pancreas development was affected by bmp inhibition after expression of noggin and dominant negative bmp receptors in chicken and mouse pancreas.resultsendogenous bmp signaling is confined to the mesenchyme in the early pancreas and inhibition of bmp signaling results in severe pancreatic hypoplasia with reduced epithelial branching . notably , we also observed an excessive endocrine differentiation when mesenchymal bmp signaling is blocked , presumably secondary to defective mesenchyme to epithelium signaling.conclusionswe conclude that bmp signaling plays a previously unsuspected role in the mesenchyme , required for normal development of the mesenchyme as well as for the epithelium .

RESEARCH DESIGN AND METHODS RESULTS Phospho-Smad1,5,8 immunoreactivity is restricted to the pancreas mesenchyme. Several BMPs are expressed in the pancreas mesenchyme. Ectopic expression of Noggin in the pancreas leads to loss of pSmad1,5,8 immunoreactivity and severely affects pancreas development. Cell-autonomous BMP inhibition in the mesenchyme has a similar effect on endocrine and exocrine differentiation as BMP inhibition by Noggin. Mesenchymal gene expression is severely affected by Noggin-mediated BMP inhibition. The angiogenic remodeling of major vessels is compromised in Noggin-electroporated embryos. DISCUSSION

the combination of erosion , attrition and abrasion is called tooth wear . erosion is the loss of hard tissues due to chemical effects , but not bacteria . attrition is the wear of tooth against tooth and abrasion is the wear of teeth from other surfaces . recently , the role of abfraction has raised interest into abrasion and the link with attrition but this area is under research.1 extensive tooth wear is considered a potential threat to functional dentition . the management of tooth wear , especially from attrition , is becoming a subject of increasing interest in the prosthodontic literature , both from a preventive [ how to stop the progress of tooth substance loss ( tsl ) ] and from a restorative point of view ( how to replace the lost tooth substance and to restore function).2 by definition , attritional wear is the loss of tooth tissue due to friction between opposing teeth and is thus related to dental occlusion . tsl considered to be normal in aging process , in which depositioning of secondary dentine , alveolar growth , muscle adaptation , and attrition are all parts of a compensation mechanism.2 clinicians are often faced with the challenge of restoring severely worn dentition . a critical aspect for successful treatment of these patients is to determine the occlusal vertical dimension and the interocclusal rest space . a systematic approach to managing this type of complete oral rehabilitation can lead to a predictable and favorable treatment prognosis.3 when tooth surface loss is severe , it can be associated with decreased vertical dimension of the occlusion resulting in a poor aesthetic appearance , loss of muscle tone and decreased masticatory efficiency.4 in addition , tooth tissue loss from bruxism has been demonstrated to be associated with various dental problems such as tooth sensitivity , excessive reduction of clinical crown height and possible changes of occlusal relationship . this case report will present a sequence of treatment , including conservative multidisciplinary approach to restoring esthetics and function in a patient with worn anterior dentition . this case report describes the management of excessive tooth tissue loss in a 45 year old woman with a history of bruxism . prior to treatment , a detailed dental , medical , and social history was obtained from the patient . she started to notice that her teeth were getting shorter about 20 years ago ; however , she chose to leave the problem unattended . clinically , the patient demonstrated partial edentulism , several maxillary and mandibular teeth showing severe attrition to the free gingival level , an uneven occlusal plane anteroposteriorly and mediolaterally . clinically , the patient s facial appearance showed signs of a collapsed occlusal vertical dimension ( figure 1 ) . the preoperative interocclusal rest space was 3 mm . periodontal condition and soft - tissue examination showed no pocket depth of over 2 mm or mobility of any remaining teeth . the patient s maxilla diagnosed with class ii div 1 and mandibula class iii div 1 according to the kennedy classification system for partial edentulism ( figure 1 ) . the treatment goals were to restore the lost occlusal vertical dimension ( ovd ) to correct the occlusal plane , to restore function , and to restore the esthetics of the patient s dentition . phase i included a splint therapy and a provisional fixed prosthesis to re - establish correct vertical dimension of occlusion and stable occlusal contacts . tmj and muscle examinations were done at the first week and at the first month . this procedure should only be considered when the remaining root is supported by a healthy periodontium and the post - surgery crown / root ratio will be favorable . in the clinical examination there was no sign of gingival inflammation or periodontal infection , or tooth mobility . in the periapical radiographic examination , root / crown ratio of the teeth were more than two , and there was no alveolar resorption . sulcular and internal bevel incisions were performed with preserving the gingival papillas , without any vertical incisions . because there was an adequate amount of attached gingiva , internal bevel incision was performed 34 mm far away from the gingival margin , considering the zenith points in the anterior maxilla . after the removal of remnant gingiva , full - thickness muco - periosteal flap elevated . flap was closed using nylon sutures with vertical matrix suture technique . and also frenulum attachment was removed by frenectomy operation . wound healing was completed at the 6 week after the surgery in the follow - up period ( figure 3 ) . the design of the tooth preparation should encompass necessary reduction relative to tooth position and the requirements of the restorative material . the abutment teeth ( # 11,#12 , # 13 , # 21 , # 22 , # 23 ) for zirconium restorations were prepared , which implied a 1.2-mm deep circumferential shoulder and a slightly rounded inner angle.5,6 the other abutment teeth ( # 14 , # 15 , # 24 , # 25 , # 27 , # 33 , # 34 , # 37 , # 43 , # 44 , # 45 , # 47 ) were prepared with a knife edge finish line ( figure 4 ) . impressions for the maxillary and mandibular interim prostheses were made using a vinyl polysiloxane impression ( elite hd , zhermak , germany ) material . the impression was cast with a type iv dental stone ( silky - rock ; whip mix corp , louisville , ky ) , and the stone cast was mounted in a semi adjustable articulator ( dentatus arh - type ; dentatus ab , stockholm , sweden ) with an opposing mandibular cast . feldspathic porcelain was chosen to restore other teeth in both jaws ; the patient also was given an occlusion guard to protect the restoration against future bruxism . the crowns were luted with self - polymerizing composite resin cement ( multilink , ivoclar vivadent , schaan , liechtenstein ) ( figure 5 ) . after prosthetic management , the patient was instructed about individual oral hygiene care of fixed prostheses . after insertion of the interim prostheses the patient reported no muscular or temporomandibular joint discomfort . follow - up treatments were done to evaluate the patient s comfort , arch form , and potential occlusal vertical dimension problems . patient was recalled twice for postoperative examinations during a 1-year follow - up period ( figure 6 ) . in the controls it was seen that marginal adaptation of the prostheses was appropriate and there were no signs of gingival inflammation and recession . the treatment goals were to restore the lost occlusal vertical dimension ( ovd ) to correct the occlusal plane , to restore function , and to restore the esthetics of the patient s dentition . phase i included a splint therapy and a provisional fixed prosthesis to re - establish correct vertical dimension of occlusion and stable occlusal contacts . tmj and muscle examinations were done at the first week and at the first month . this procedure should only be considered when the remaining root is supported by a healthy periodontium and the post - surgery crown / root ratio will be favorable . in the clinical examination there was no sign of gingival inflammation or periodontal infection , or tooth mobility . in the periapical radiographic examination , root / crown ratio of the teeth were more than two , and there was no alveolar resorption . sulcular and internal bevel incisions were performed with preserving the gingival papillas , without any vertical incisions . because there was an adequate amount of attached gingiva , internal bevel incision was performed 34 mm far away from the gingival margin , considering the zenith points in the anterior maxilla . after the removal of remnant gingiva , full - thickness muco - periosteal flap elevated . wound healing was completed at the 6 week after the surgery in the follow - up period ( figure 3 ) . the design of the tooth preparation should encompass necessary reduction relative to tooth position and the requirements of the restorative material . the abutment teeth ( # 11,#12 , # 13 , # 21 , # 22 , # 23 ) for zirconium restorations were prepared , which implied a 1.2-mm deep circumferential shoulder and a slightly rounded inner angle.5,6 the other abutment teeth ( # 14 , # 15 , # 24 , # 25 , # 27 , # 33 , # 34 , # 37 , # 43 , # 44 , # 45 , # 47 ) were prepared with a knife edge finish line ( figure 4 ) . impressions for the maxillary and mandibular interim prostheses were made using a vinyl polysiloxane impression ( elite hd , zhermak , germany ) material . the impression was cast with a type iv dental stone ( silky - rock ; whip mix corp , louisville , ky ) , and the stone cast was mounted in a semi adjustable articulator ( dentatus arh - type ; dentatus ab , stockholm , sweden ) with an opposing mandibular cast . feldspathic porcelain was chosen to restore other teeth in both jaws ; the patient also was given an occlusion guard to protect the restoration against future bruxism . the crowns were luted with self - polymerizing composite resin cement ( multilink , ivoclar vivadent , schaan , liechtenstein ) ( figure 5 ) . after prosthetic management after insertion of the interim prostheses the patient reported no muscular or temporomandibular joint discomfort . follow - up treatments were done to evaluate the patient s comfort , arch form , and potential occlusal vertical dimension problems . patient was recalled twice for postoperative examinations during a 1-year follow - up period ( figure 6 ) . in the controls it was seen that marginal adaptation of the prostheses was appropriate and there were no signs of gingival inflammation and recession . the etiology of occlusal wear for our patient is not fully understood ; however , it can be hypothesized that the patient had a parafunctional occlusal habit and started grinding her anterior teeth . once the anterior teeth got shorter , the patient lost anterior guidance and developed posterior interferences . the posterior interferences in lateral excursions can activate the masseter and temporalis muscles , enabling the patient to generate more forces to grind her teeth more aggressively.7 a mutually protected occlusal scheme was used to prevent the destruction of the new prostheses.3 mutually protected articulation is described as an occlusal scheme in which the posterior teeth prevent excessive contact of the anterior teeth in maximum intercuspation , and the anterior teeth disengage the posterior teeth in all mandibular excursive movements . studies have shown that in lateral excursive movements,8 the anterior teeth can best receive and dissipate the forces9 and posterior contacts in excursions appear to provide unfavorable forces to the masticatory system because of the amount and direction of the applied forces.10,11 in addition to the use of the mutually protected occlusal scheme , an occlusal splint was fabricated for night wear , and the patient was instructed and trained to keep her teeth apart when not actively chewing . zirconia ceramic crowns were selected for the patient s treatment to ensure adequate strength on upper anterior teeth . the primary advantage of a zirconia restoration is esthetic benefit , as it is translucent and tooth - colored.12 a metal - free ceramic crown can transmit a great amount of incident light through to a ceramic core where light is scattered in a natural fashion.12 thus , the appearance of definitive restorations may be very close to that of a natural tooth . strength , fit , and esthetics are traditionally considered in the selection of material for full coverage restorations . traditional cements occupy the space between the restoration and the tooth surfaces but do not provide adhesion between them . resin cements provide adhesion to both surfaces and can act to transfer force from the restoration to the underlying tooth and strengthen all - ceramic restorations.13 also resin cement was used to provide additional bonding strength to increase the retention of the restorations because our patient s clinical crown was not long enough . in the present case , the maxillary occlusal plane had already been established . the use of a provisional occlusal splint is generally considered the first step in the treatment of inappropriate horizontal and vertical maxillomandibular relationships . in the present case , approximately 4 mm of crown lengthening was obtained in the maxillary anterior teeth by resective bone surgery . some studies suggested that patients with healthy periodontium have 0.69 mm mean sulcus depth , 0.97 mm epithelial attachment and 1.07 mm connective tissue.14 therefore the total length of supracreasteal gingival tissue was 2.73 mm . so , reconstitution of 2.73 mm of gingival tissue must be considered , while deciding the amount of bone resection.15 protection sufficient amount of attached gingiva around the teeth after the surgery is also an important task to achieve.16 in our case , 5 mm of attached gingiva existed after the surgery . in order to prevent the frenulum become high after the surgery , frenectomy operation also performed at the same appointment . in the present case report , it has been shown that , after the use of occlusal guard and the surgical treatment ; restoration of maxillary teeth with full coverage restorations and mandibular teeth with metal ceramic restorations help to restore the occlusal vertical dimension . dentists have the responsibility of developing proper form and function to protect the integrity of the masticator system , and must connect the new materials and technology with traditional functional concepts to be successful . as the case presented here demonstrates , this combination of innovation and tradition is achievable with careful planning . the restored occlusal vertical dimension has shown to be physiologically and esthetically acceptable to the patient .

the management of the interim phase of a complete oral rehabilitation in patients with severely worn dentition is often challenging due to the loss of occlusal vertical dimension , loss of tooth structure , uneven wear of teeth creating an uneven plane of occlusion , and parafunctional habits . this case report describes the management of excessive tooth tissue loss in a 45 year old woman with a history of bruxism , esthetical complaints in anterior teeth , and impaired dental function due to reduced tooth height . the patient used occlusal splint for a month and than resection of the alveolar bone was performed on the vestibular sides of the maxillary anterior teeth , except the interdental alveolar crest . maxillary anterior teeth were restored with zirconia porcelain . feldspathic porcelain was chosen to restore remaining teeth in both jaws ; the patient also was given an occlusion guard to protect the restoration against future bruxism . regardless of the cause of occlusal instability , it is important that the restorative dentist should be able to recognize its signs such as tooth hypermobility , tooth wear , periodontal breakdown , occlusal dimpling , stress fractures , exostosis , muscle enlargement , and loss of posterior disclusion . when restoring the worn dentition , the clinician should bear in mind the five p s : proper planning prevents poor performance .

INTRODUCTION CASE REPORT Prosthodontic management DISCUSSION CONCLUSIONS

one of the most frequently used measures of health status is the question how would you rate your health ? , a single question asking people to evaluate their overall health on a scale from excellent to poor . this single item measure has been demonstrated to be a robust predictor of health outcomes , including mortality , independent of health indicators of physical health . because of the wide range of associations with other health indicators , and the simplicity with which it is collected , self - rated health is widely used in large population surveys as a proxy measure for general health status . earlier studies assumed that the answer to this single question embodied a simple summation of all objective states , and therefore focused on the differences in prediction between the objective measures and the subjective self report . when the subjective self perception of health remained a strong predictor of mortality regardless of the statistical control of numerous objective health variables , it became clear that the simple question is not as simple as was originally thought . the attempts to understand what lies behind this measure produced studies that included mental / emotional variables in addition to physical health variables , and one explanation for the ability of the self rated health to predict mortality was that the single question of how would you rate your health is interpreted by subjects as referring to their overall health , including psychosocial aspects and not only to their physical health . two studies showed that mental health was the mediator in the relationship between physical health and self reported general health . in one case , mental health was measured by the anxiety and depression scale hads and the study was done on 449 adults undergoing hip or knee replacement in hospitals in canada . in the other case , mental health was measured by the geriatric depression scale gds in a longitudinal study of 150 older american adults . another general population study from germany found that in healthier individuals , positive affect was more important than physical functioning in predicting self rated general health , whereas among less healthy individuals the opposite was found . positive affect in that study was measured by the positive and negative affect schedule ( panas ) . the single question how would you rate your mental health ? was used in surveys much less than the single question about general health . ahmad et al . conducted a review of the literature and found fifty - seven studies that included a measurement of self rated mental health ( srmh ) but only four of these studies tried to validate the srmh against known measures of mental health . self - rated mental health was associated with use of mental health services and of medical care services . when checked against other mental health indicators the use of srmh as a proxy for mental morbidity was not recommended . flieshman and zuvekas examined the associations between srmh and measures of psychological distress , activity limitations and social role functioning . they found that the measures of emotional / psychological distress were correlated with each other much more strongly than they were with srmh , while srmh was related to physical health . their conclusion was that the self rated mental health was not a pure measure of mental morbidity and that it can not be used as the sole indicator of psychological distress in surveys . mawani and gilmour checked the associations between the srmh , mental health diagnoses , wmh - cidi diagnoses and measures of psychological distress . they found that a sizeable percentage of respondents who were classified as having mental disorders perceived their mental health as good ; on the other hand , respondents who did not pass the threshold for diagnoses perceived their mental health as fair / poor . their conclusion was that the srmh should not be used as a proxy for mental morbidity because it underestimates the prevalence of mental morbidity , and may reflect other factors as well . to our knowledge , there were no studies that checked simultaneously the self ratings of physical health , mental health and overall health . using data from a large representative sample of the adult population of israel , that included the three self rating scales as well as other objective health status indicators , we tried to understand what is the contribution of the self rating of mental health to the self rating of general health . the israel national health survey followed procedures established by the world mental health survey ( wmh ) of the world health organization ( who ) . the sample was extracted from israel s national population register and constituted non - institutionalized legal residents aged 21 and over . the sample was designed to reflect the population distribution by age , gender and three population sectors : arabs ; post-1990 jewish immigrants from the former soviet union ; and jews and others , including jewish immigrants from countries other than the former soviet union . the sample interviewed for the israel national health survey was weighted back to the total population to compensate for unequal selection probabilities resulting from disproportionate stratification , clustering effects , and non - response . the weights were adjusted to make sample totals conform to known population totals taken from reliable central bureau of statistics sources . on first personal contact with each potential survey respondent , the interviewer explained the survey and obtained verbal informed consent . overall , 73% of those contacted agreed to be interviewed ( 88% of arab - israelis and 71% of jewish - israelis ) . a total of 4859 face - to - face interviews were conducted in arabic , hebrew or russian at respondents homes from may 2003 to april 2004 . professional survey interviewers , who were trained and supervised by the central bureau of statistics , used a laptop computer and computer - assisted personal interview methods . the human subjects committee based at eitanim - kfar shaul hospital approved the survey and the field procedures in november 2000 . the diagnostic instrument used in the who - wmh was the composite international diagnostic interview ( cidi ) . the survey assessed for : anxiety disorders [ panic disorder , generalized anxiety disorder ( gad ) , agoraphobia without panic disorder , and post - traumatic stress disorder ( ptsd ) ] ; mood disorders ( major depressive disorder , dysthymia , bipolar i and ii disorders ) ; and substance abuse disorders ( alcohol abuse , alcohol dependency , drug abuse , drug dependency ) . the presence of a disorder was determined by whether respondents past or current symptoms met 30 days , 12-month or lifetime diagnostic criteria for a dsm iv disorder . for each disorder , when a respondent endorsed a specific screening item , he or she was asked all the questions in the cidi diagnostic section for that disorder to establish the presence of a current disorder . organic exclusion criteria were taken into account in the determination of the dsm - iv diagnoses . the validity of the who - wmh cidi as a diagnostic tool was assessed in france , italy , spain , and the united states by a clinical reappraisal study which found that the individual - level concordance between the scid and cidi for 12-month prevalence of any mood disorder , any anxiety disorder , and any disorder overall was substantial ( area under the curve in the range of 0.8 to 0.9 . for the analyses reported here , respondents were grouped into those with or without any mood or anxiety disorder , because of a large overlap between the two groups of diagnoses . the present analysis distinguished between respondents with and without mood or anxiety disorder in the 30 days before the interview . the conditions listed were heart attack , heart disease , stroke , high blood pressure , asthma , chronic obstructive pulmonary disorder , emphysema or other lung disease , tuberculosis , diabetes , kidney disease , neurological conditions , thyroid disease , cancer , chronic back or neck pain , arthritis or rheumatism , headaches , or any other chronic pain . in this analysis , respondents with chronic physical conditions were grouped into two categories : those reporting any one of the conditions and those reporting none . methodological research has shown that such checklists provide useful information about treated or currently untreated chronic conditions . the whodas is a disability scale that includes six scales : i ) role functioning , ii ) cognition , iii ) mobility , iv ) self - care , v ) social interaction and vi ) participation . the four questions that assessed role functioning were all frequency questions while other domains consist mostly of severity items . the calculation of the total score followed the method described in buist - bouwman : the resulting total score ranged between a score of 0 indicating no disability and 100 indicating maximum disability with intermediate scores indicating the percentage of the maximum possible score . in the present analysis , the total score was grouped into three categories : maximum disability = 100 , 9% of the entire sample , no disability = 0.47% of the entire sample and partial disability 0 > score < 100 , 44% of the entire sample . the rating of physical , mental and overall health were measured using the standard items how would you rate your . excellent , very good , good , fair , or poor ? since the connotation of good was neither very good nor bad , the present analysis followed others and grouped all three variables into two categories : positive excellent / very good and negative good / fair / poor . the control variables included the socio - demographic characteristics : age groups , gender , marital status , education , income and population groups [ classified as i ) arabs ii ) post-1990 jewish immigrants from the former soviet union iii ) jews and others , including jewish immigrants from countries other than the former soviet union ] . the data were weighted to adjust for the differential probabilities of respondents selection and non - response and for differences between the sample and the adult population in israel . cross tabulation of age groups by positive self rated physical health , positive self rated mental health , presence of chronic physical conditions and presence of any depression or anxiety disorders was done to show how these measures change with age . logistic regression analyses were conducted to estimate the association between dichotomous positive / negative outcomes of self rated health measures and the socio - demographic and health status indicators . estimates of odds ratios ( ors ) , the corresponding standard errors and 95% confidence intervals ( ci ) were also obtained from logistic regression using sudaan . the conditions listed were heart attack , heart disease , stroke , high blood pressure , asthma , chronic obstructive pulmonary disorder , emphysema or other lung disease , tuberculosis , diabetes , kidney disease , neurological conditions , thyroid disease , cancer , chronic back or neck pain , arthritis or rheumatism , headaches , or any other chronic pain . in this analysis , respondents with chronic physical conditions were grouped into two categories : those reporting any one of the conditions and those reporting none . methodological research has shown that such checklists provide useful information about treated or currently untreated chronic conditions . the whodas is a disability scale that includes six scales : i ) role functioning , ii ) cognition , iii ) mobility , iv ) self - care , v ) social interaction and vi ) participation . the four questions that assessed role functioning were all frequency questions while other domains consist mostly of severity items . the calculation of the total score followed the method described in buist - bouwman : the resulting total score ranged between a score of 0 indicating no disability and 100 indicating maximum disability with intermediate scores indicating the percentage of the maximum possible score . in the present analysis , the total score was grouped into three categories : maximum disability = 100 , 9% of the entire sample , no disability = 0.47% of the entire sample and partial disability 0 > score < 100 , 44% of the entire sample . the rating of physical , mental and overall health were measured using the standard items how would you rate your . excellent , very good , good , fair , or poor ? since the connotation of good was neither very good nor bad , the present analysis followed others and grouped all three variables into two categories : positive excellent / very good and negative good / fair / poor . the control variables included the socio - demographic characteristics : age groups , gender , marital status , education , income and population groups [ classified as i ) arabs ii ) post-1990 jewish immigrants from the former soviet union iii ) jews and others , including jewish immigrants from countries other than the former soviet union ] . the data were weighted to adjust for the differential probabilities of respondents selection and non - response and for differences between the sample and the adult population in israel . cross tabulation of age groups by positive self rated physical health , positive self rated mental health , presence of chronic physical conditions and presence of any depression or anxiety disorders was done to show how these measures change with age . logistic regression analyses were conducted to estimate the association between dichotomous positive / negative outcomes of self rated health measures and the socio - demographic and health status indicators . estimates of odds ratios ( ors ) , the corresponding standard errors and 95% confidence intervals ( ci ) were also obtained from logistic regression using sudaan . table 1 presents the distribution of the socio - demographic and health status indicators used in the analysis . we found that the 63% of the total sample rated their mental health as positive , 55% rated their overall health as positive but only 49% rated their physical health as positive . men rated their health consistently better than females : 66.5% of the males rated their mental health as positive compared to 61% of the females ( =14.7 ; p<0.001 ) , 52% of the males rated their physical health as positive compared to 48% of the females ( =11.8 ; p<0.01 ) and 58% of the males rated their overall health as positive compared to 53% of the females ( =11.2 ; p<0.01 ) . immigrants rated their health consistently lower ( 18% , 26% , 16% positive on the overall , mental and the physical health respectively ) than the arabs ( 55% , 61% , 54% ) and the jews and others ( 64% , 73% , 56% ) ( p<0.001 ) . those with high income rated their health consistently better ( 60% , 69% , 54% ) than those with low income ( 49% , 56% , 45% ) ( p<0.005 ) . those in the 21 - 34 age group rated their health consistently better ( 77% , 81% , 73% ) than those in the 65 + age group ( 18% , 35% , 13% ) ( p<0.001 ) . those who never married rated their health consistently better ( 75% , 78% , 71% ) than those who were divorced or separated ( 27% , 38% , 25% ) ( p=0.000 ) and those with high education rated their health consistently better ( 62% , 69% , 54% ) than those with low education ( 36% , 45% , 31% ) ( p<0.005 ) . table 2 presents the associations between health status indicators and the self rated physical health ( hsr ) and mental health ( mhsr ) . the odds ratios presented in the table were adjusted in the logistic regression for age , population groups , income , educational level and disability status . table 2 shows that self rated positive physical health is strongly related to chronic physical conditions but much less to mental disorders . likewise , self rated positive mental health is strongly related to mental disorders , but much less to chronic physical conditions . figure 1 shows how chronic physical conditions , mental disorders and the self rating scales of physical and mental health change with age . figure 1 shows that the percentage of those with chronic conditions goes up from 32% in the 21 - 35 age group to 78% in the 65 + group ( =653.9 ; p<0.001 ) while the poor self rated physical health follows the same pattern with a rise from 27% to 87% =1402.39 ; p<0.001 ) . on the other hand the poor self rated mental health goes up from 19.5% in the 21 - 35 age group to 64.8% in the 65 + group ( =609.98 ; p<0.001 ) while the percentage of those with any mental disorder does not change at all . table 3 presents the associations between self rated overall health ( osr ) and the self rated physical and mental health in two models : with and without the health status indicators . the odds ratios presented here were adjusted in the logistic regression for the variables population groups , age groups and disability level . table 3 shows that self rated mental and physical health are much stronger predictors of osr than the health status indicators of chronic conditions , mental disorders and disability . those with positive self rated mental health have 93 times the odds of reporting good positive overall health whereas those with positive self rated physical health have 40 times the odds of reporting positive overall health . after accounting for the self rated health measures hsr and mhsr , the predictive value of the health status indicators is much smaller : those with no mental disorders are six times more likely to have a positive osr , those with no disability have 2.5 times the odds of reporting positive osr and those with no chronic condition have only 1.33% times the odds of reporting positive osr . yet , the age group is still a significant predictor of osr beyond the self rating measures and the health status indicators . table 3 showed that after accounting for the main health variables , positive self rated mental health was twice as important as positive physical health in the prediction of positive overall health . the odds for positive overall health were 93 higher if the rating of mental health was positive compared to 40 times higher if the rating of physical health was positive . table 2 presents the associations between health status indicators and the self rated physical health ( hsr ) and mental health ( mhsr ) . the odds ratios presented in the table were adjusted in the logistic regression for age , population groups , income , educational level and disability status . table 2 shows that self rated positive physical health is strongly related to chronic physical conditions but much less to mental disorders . likewise , self rated positive mental health is strongly related to mental disorders , but much less to chronic physical conditions . figure 1 shows how chronic physical conditions , mental disorders and the self rating scales of physical and mental health change with age . figure 1 shows that the percentage of those with chronic conditions goes up from 32% in the 21 - 35 age group to 78% in the 65 + group ( =653.9 ; p<0.001 ) while the poor self rated physical health follows the same pattern with a rise from 27% to 87% =1402.39 ; p<0.001 ) . on the other hand the poor self rated mental health goes up from 19.5% in the 21 - 35 age group to 64.8% in the 65 + group ( =609.98 ; p<0.001 ) while the percentage of those with any mental disorder does not change at all . table 3 presents the associations between self rated overall health ( osr ) and the self rated physical and mental health in two models : with and without the health status indicators . the odds ratios presented here were adjusted in the logistic regression for the variables population groups , age groups and disability level . table 3 shows that self rated mental and physical health are much stronger predictors of osr than the health status indicators of chronic conditions , mental disorders and disability . those with positive self rated mental health have 93 times the odds of reporting good positive overall health whereas those with positive self rated physical health have 40 times the odds of reporting positive overall health . after accounting for the self rated health measures hsr and mhsr , the predictive value of the health status indicators is much smaller : those with no mental disorders are six times more likely to have a positive osr , those with no disability have 2.5 times the odds of reporting positive osr and those with no chronic condition have only 1.33% times the odds of reporting positive osr . yet , the age group is still a significant predictor of osr beyond the self rating measures and the health status indicators . table 3 showed that after accounting for the main health variables , positive self rated mental health was twice as important as positive physical health in the prediction of positive overall health . the odds for positive overall health were 93 higher if the rating of mental health was positive compared to 40 times higher if the rating of physical health was positive . data from the israel national health survey based on a representative sample of the adult population was used to investigate the differences between the three self rated measures of health . the general distribution of the self rated measures of health replicates results obtained in previous large population surveys showing that rates of positive self rated health are lower among females compared to males , that older individuals rate their health as less positive compared to younger individuals and that socio demographic variables such as education and income are related to the self rating of mental , physical and overall health . the main findings from the present study show that the three self rating scales represent three different domains of health : the self rating mental health and the self rating physical health maintain their distinctiveness : self rated mental health is not related to chronic physical conditions ( as does self rated physical health ) , and self rated physical health is not related to mental disorders ( as does self rated mental health ) . the self rating of physical health has a monotonic relationship with the objective indicator of physical health . the self rating of mental health does not have a monotonic relationship with the absence of mental illness . the good self rating of mental health goes down with age even though there is no age difference in mental disorders . the self rated physical health and the self rated mental health are both strong predictors of the self rated overall health , independent of the objective measures of health . this was shown when the odds of predicting the self rating of the overall health remained the same regardless of whether the objective measures of health were included in the regression equation . the self rated mental and physical health are 10 times stronger in predicting self rated overall health than any of the objective health indicators . the self rated mental health is two times more important than the self rated physical health in predicting the self rated overall health . the stronger weight of the self rated mental health implies that the mental component in the self rating of overall health is stronger than the physical one . this result reinforces conclusions of previous studies : in a cross - national survey of university students in germany , bulgaria , and poland , the overall self rated health status was assessed along with physical and psychological health as well as with social and socio demographic variables . that study found that psychosomatic complaints were the most important indicator in predicting the self rated health status . a similar finding was reported by ormel et al . from a study using a large sample of late middle - aged and older persons living independently . they found that the unique contribution of depressive symptoms on poor health perception outranked those of the medical conditions . in a survey with a follow - up period of 1 - 5 years found that those who were happier and more energetic at baseline rated their health better in the next 5 years , even after accounting for age , negative health indicators at baseline , disease status and functioning . moreover , positive indicators of functioning ; such as physical activity , work , and exercise ; did not significantly predict future self assessment of health . mental disorder was defined in our study by the presence of any mood or anxiety disorder in the past 30 days and its prevalence was the same in the four age groups . two major surveys checked the one year prevalence of any mood or anxiety and found it to be significantly less prevalent in older age groups . on the other hand , mental health which refers to hedonic well - being : feelings of happiness , satisfaction and interest in life , and to eudemonic well - being optimal functioning and self actualization , was more prevalent in younger age groups . in their review of studies on the concept of mental health , westerhof and keyes found that older age was correlated with lower positive affect , less feeling of personal growth and purpose in life , less meaning in life and less social coherence and social contribution . the empirical separation between mental health and mental illness was found also by weich et al . who used principal component analysis to describe the underlying factor structure of mental wellbeing . they found also that well - being and mental disorders are correlated but independent dimensions . the use of three separate self rating scales for mental health , physical health and overall health enabled us to observe the unique contribution of the mental health component to the self rating of overall health . further studies should investigate prospectively which of the three dimensions better predicts mortality , morbidity , hospitalizations or use of services . a key strength of this study was the utilization of a large representative sample of the entire adult population with a relatively high response rate . trends observed in this type of sample are more likely to appear in other large population samples . the main limitations of this study are that all the health information was self - reported and that the health indicators used may not have covered all the ill health domains . it is not clear whether a more comparative wording compared to your age group would have changed the clear age gradient that was found in this study . our results show a different age trajectory between mental health and mental illness . mental disorder was defined in our study by the presence of any mood or anxiety disorder in the past 30 days and two major surveys checked the one year prevalence of any mood or anxiety and found it to be significantly less prevalent in older age groups . on the other hand , mental health which refers to hedonic well - being : feelings of happiness , satisfaction and interest in life , and to eudemonic well - being optimal functioning and self actualization , was more prevalent in younger age groups . in their review of studies on the concept of mental health , westerhof and keyes found that older age was correlated with lower positive affect , less feeling of personal growth and purpose in life , less meaning in life and less social coherence and social contribution . the empirical separation between mental health and mental illness was found also by weich et al . who used principal component analysis to describe the underlying factor structure of mental wellbeing . they found also that well - being and mental disorders are correlated but independent dimensions . the use of three separate self rating scales for mental health , physical health and overall health enabled us to observe the unique contribution of the mental health component to the self rating of overall health . further studies should investigate prospectively which of the three dimensions better predicts mortality , morbidity , hospitalizations or use of services . a key strength of this study was the utilization of a large representative sample of the entire adult population with a relatively high response rate . trends observed in this type of sample are more likely to appear in other large population samples . the main limitations of this study are that all the health information was self - reported and that the health indicators used may not have covered all the ill health domains . it is not clear whether a more comparative wording compared to your age group would have changed the clear age gradient that was found in this study .

backgroundunlike the widely used self rated health , the self rated mental health was found unsuitable as a proxy for mental illness . this paper analyses the relationships between the self ratings of physical health , mental health and overall health , and their association of with the objective indicators for physical and mental health.design and methodsthe study is a secondary analysis of data from a nationwide representative sample of the non - institutionalized adult residents of israel in 2003 that was collected via computer - assisted personal interview methods [ n=4859].resultsthe self rated physical health and the self rated mental health were strongly related to each other yet the self rated mental health was not related to chronic physical conditions and the self rated physical health was not related to mental disorders . in a multiple logistic regression analysis , those with positive self rated mental health had 93 times the odds of reporting positive overall health whereas those with positive self rated physical health had 40 times the odds of reporting positive overall health.conclusionsthe self rating of mental health presents a qualitatively different dimension from mental illness . the self rated mental health is two times more important than the self rated physical health in predicting the self rated overall healthsignificance for public healththe present study is an original study on the self rated physical , mental and overall health measures . because of the wide range of associations with other health indicators , and the simplicity with which they are collected , self - rated health measures are widely used in large population surveys.the present study questions the automatic assumption that the self rated mental health functions as a proxy measure of psychiatric morbidity , and suggests that the self rated mental health is more closely related to subjective well - being . the results show that self rated mental health predicts self rated general health better than self rated physical health .

Introduction Design and methods Diagnostic assessment Chronic general medical conditions Disability measure Self report of physical health, mental health and general health Statistical analysis Results The relationship between health conditions, and self rated physical and mental health The difference between self rated physical health and self rated mental health The relationship of self rated overall health with the self rated physical and mental health Discussion and conclusions Mental health Strengths and limitations