Datasets:

ronitHF

/

pubmed-10k

like 0

type 2 diabetes is a public health concern across the united states , with certain ethnic groups bearing a disproportionate burden [ 1 , 2 ] . native hawaiians and other pacific islanders ( nh / pi ; e.g. , samoan , chuukese ) have higher type 2 diabetes incidence and prevalence compared to other ethnic groups [ 3 , 4 ] . they are two times more likely to die from diabetes than the general population and suffer from high rates of diabetes - related medical complications and preventable hospitalization [ 5 , 6 ] . addressing the burden of type 2 diabetes is a priority in eliminating health disparities among nh / pi . culturally relevant , diabetes self - management interventions are important in treating type 2 diabetes among nh / pi [ 4 , 8 , 9 ] . found that a culturally adapted diabetes self - management intervention , called partners in care ( pic ) , significantly improved glycemic control and diabetes self - care behaviors in nh / pi compared to a wait - list control . despite the effectiveness of diabetes self - management education intervention , the maintenance of improved glycemic control continues to be a challenge across ethnic groups . the long - term , postintervention maintenance of optimal glycemic control is important in judging an intervention 's effectiveness . diabetes - related social support groups for those with type 2 diabetes have shown promise as a maintenance component for diabetes self - management interventions to improve long - term glycemic control and diabetes - related psychosocial functioning , self - care activities , and quality of life [ 13 , 14 ] . diabetes - related social support can include four types : appraisal support ( e.g. , alternative perspectives of stressors ) , informational support ( e.g. , knowledge ) , emotional support ( e.g. , expression of care ) , and tangible support ( e.g. , providing material help ) . the incorporation of a diabetes - related social support group for nh / pi as a maintenance component to a diabetes self - management intervention is also consistent with their shared ethnocultural values and preferences for group - based interactions . they often rely on their immediate and extended family network ( e.g. , friends and neighbors ) for emotional , physical , and spiritual support and daily decision - making . group participation with other nh / pi offers a safe and supportive environment that can increase the cultural relevance of activities and participation and enhances diabetes self - care . to examine the effects of a diabetes - specific social support maintenance component , the community - academic partnership , the pili 's study conducted another study of pic with an added social support component that emphasized the four types of support . the pop partnership designed a 3-month , 6-session , semistructured support group ( ssg ) to reinforce positive changes made during the 3-month pic intervention . specifically , the maintenance effects of a novel ssg on hba1c control and diabetes self - care behaviors were examined against a control group in a sample of nh / pi with type 2 diabetes who were randomized into these conditions following their completion of pic . the institutional review boards of the native hawaiian health care systems and university of hawaii at mnoa approved this study . community researchers recruited nh / pi from their respective communities and the larger nh / pi population on the island of oahu . eligibility criteria were hba1c > 7% , nh / pi ethnicity , age 18 years , and physician - diagnosed type 2 diabetes . eligible participants provided consent and baseline assessments ( t1 ) were done just prior to starting pic . pic involves 12 , 1-hour weekly group meetings , providing information on diabetes self - management and encouraging participants to work with their diabetes team that includes the individual , their family , physician , and other diabetes experts ( e.g. , certified diabetes educator ) . the intervention is based on the american diabetes association and the national diabetes education program guidelines . pic was culturally adapted for nh / pi based on information from focus groups with nh / pi living with diabetes and nh / pi community leaders as described in sinclair et al . . the community partners included kula no na poe hawaii ( a nonprofit serving urban hawaiian homesteads ) , hawaii maoli ( a nonprofit serving the hawaiian civic clubs ) , ke ola mamo ( the native hawaiian health care system for oahu ) , and kkua kalihi valley ( a health clinic serving low - income pi ) . the community partners recruited participants , delivered the intervention , and conducted the baseline and outcomes assessments at their respective organizations . all participants completed a baseline assessment ( t1 ) , received pic , and underwent a second assessment at 3 months ( t2 ) . the protocol used at each assessment and measures were the same as used by sinclair et al . . following assessment at t2 , participants were randomized , based on a 1 : 1 randomization by site , to either the 3-month ssg or standard follow - up control group . participants randomized to the ssg attended six bimonthly , semistructured group meetings , lasting for about 1 hour , to reinforce skills taught in pic . trained community facilitators ( cf ) led two of the sessions and health professionals ( i.e. , pharmacist , nutritionist , physician , and psychologist ) led the remaining four sessions . community facilitators were instructed to provide appraisal and emotional support ( e.g. , talking through difficulties and encouraging connection between group members ) on how to garner additional support from family / friends for diabetes self - management activities ( i.e. , healthy eating , physical activity , and medication adherence ) . the health professionals concentrated on providing informational and appraisal support around managing diet , medications , diabetes - related complications , and maintaining self - care activities . the control group received only six bimonthly postcards reminding them of performing diabetes self - management activities . all participants underwent a final assessment at t3 after the 3-month maintenance component ( i.e. , six months after t1 ) . clinical measures included hba1c , measured with the bayer dca 2000 via a fingerstick sample of whole blood . the same blood sample was used to measure total cholesterol , high - density lipoprotein ( hdl ) , and low - density lipoprotein ( ldl ) and triglycerides with the cholestech ldx lipid profile system . blood pressure , weight ( kg ) , and height ( cm ) were measured twice at each assessment with the average of the two values used in the analysis . the understanding subscale of the diabetes care profile ( dcp ) measured understanding of diabetes self - care activities . it consists of 12 items with a 1 ( poor understanding ) to 5 ( excellent understanding ) likert - type response scale . the scores for the 12 items were averaged to yield a total score between 1 and 5 . seven of the 11 items from the summary of diabetes self - care activities ( sdsca ) were used to measure the frequency with which participants conducted self - care activities ( e.g. , checked their feet ) during the previous week . the scoring for each item was as follows : 1 ( not at all during the past 7 days ) , 2 ( 2 - 3 days ) , 3 ( 46 days ) , and 4 ( 7 days ) . higher scores indicate greater frequency of self - care activities . the 20-item problem areas in diabetes ( paid ) assessed quality of life such as physical / social functioning and mental / emotional well - being specific to living with diabetes . the possible responses to each item ranged from 0 ( not a problem ) to 4 ( serious problem ) . the total score was the sum of all items multiplied by 1.25 so that scores ranged from 0 to 100 . demographic and clinical measures were summarized by frequencies and percentages for categorical variables and means ( m ) and standard deviations ( sd ) for continuous variables . support and control groups were compared using chi - square or fisher 's exact test when appropriate for continuous and categorical variables . analysis of covariance ( ancova ) was used to test between group differences at t2 and t3 , adjusting for between - group differences at t1 and t2 , respectively . the baseline characteristics for the 47 nh / pi receiving the pic intervention are summarized in table 1 . it indicates that , among the participants , slightly over half were female , married , and native hawaiian and had a high school diploma or its equivalent . participants on average had bmi in the severely obese category ( m = 36.01 6.77 ) , blood pressure in the prehypertensive range ( sbp m = 129.59 mmhg 15.77 ; dbp m = 76.46 mmhg 11.00 ) , and mean hba1c of 9.98 2.23 . although mean total cholesterol ( m = 183.45 mg / dl 43.77 ) and ldl cholesterol ( m = 93.36 mg / dl 38.49 ) were within the recommended range , participants had low hdl cholesterol ( m = 40.72 mg / dl 13.40 ) and high triglyceride levels ( m = 240.59 171.07 ) . table 1 also summarizes participant characteristics by group at 3-month assessment ( t2 ) . at t2 , both the ssg and control group had mean bmis that remained in the severely obese category ( m = 37.27 7.66 and m = 35.42 4.63 , resp . ) . the ssg had slightly higher mean systolic ( m = 137.48 24.81 ) and diastolic blood pressure ( m = 81.72 14.22 ) but lower hba1c ( m = 8.96 1.82 ) compared to the control group ( m = 132.03 21.43 , m = 76.50 12.96 , m = 9.47 2.69 , resp . ) . however , none of these differences between groups at t1 or t2 were statistically significant . data in table 2 shows the mean changes in behavioral and biological measures across three assessment periods and for the combined sample for both the complete case and the intent - to - treat analysis . in the complete case analysis , there were significant improvements in the following variables from t1 to t2 : hba1c ( m = 0.76 1.86 , p < 0.01 ) , dcp ( m = 0.73 0.97 , p < 0.001 ) , paid ( m = 11.1 21.87 , p < 0.001 ) , and sdsca ( m = 2 5.12 , p < 0.01 ) . except for hba1c , significant improvements in these variables were also found from t1 to t3 . examining change between t2 and t3 shows a significant increase in ldl ( m = 13.55 mg / dl 26.42 , p < 0.05 ) , decrease in sbp ( m = 7.62 mmhg 16.6 , p < 0.05 ) , and increase in sdsca ( m = 1.7 4.67 , p < 0.05 ) . the intent - to - treat analysis provided similar results , with the exception of change in hba1c from t1 to t3 , which showed a significant decrease ( m = 0.53 1.80 , p < 0.05 ) . a comparison of the mean changes in variables between t2 and t3 by group is presented in table 3 . at t2 , 25 participants were randomized to the ssg and 22 to the control group , with 22 and 12 participants being retained at t3 , respectively . there were no significant differences in the changes in variables between the ssg and control group from t2 to t3 , controlling for t2 values . there was a statistically significant reduction in sbp in the ssg ( m = 8.36 mmhg 16.22 , p = 0.025 ) but not in the control group ( m = 6.25 mmhg 17.93 , p = 0.253 ) . there were marginally significant improvements in dcp ( m = 0.24 0.55 , p = 0.054 ) and sdsca ( m = 1.41 3.49 , p = 0.072 ) scores in the ssg but not in the control group ( m = 0.12 0.80 , p = 0.621 , and m = 2.27 6.62 , p = 0.281 , resp . ) . type 2 diabetes is a serious threat to the health and well - being of nh / pi as culturally tailored , diabetes self - management interventions , such as pic , can help attenuate . the 12-week pic intervention led to significant improvements in hba1c , diabetes self - care knowledge and activities , and emotional well - being . however , we did not find significant differences in the maintenance of these improvements between participants randomized to either the ssg or control group following completion of pic . participants ' glycemic control at 6 months was not significantly different from their control immediately after pic . this suggests that participants were able to maintain initial improvements from pic with or without the ssg . while not significantly different between groups , the ssg group had a significant within - group decrease in systolic blood pressure from t2 to t3 while the control group did not . the ssg also had improvements in understanding of diabetes and frequency of self - care activities that were marginally significant . although this study did not support the hypothesis that ssg can improve the maintenance of glycemic control after intervention , we did find some improvements in other outcomes ( e.g. , systolic blood pressure ) . to date our results are consistent with other studies that found modest improvements in diabetes understanding and self - care activities but no change in hba1c [ 14 , 22 ] . our results indicate that the social support provided to the ssg may have helped to improve their systolic blood pressure . a similar study in african americans found that despite no improvements in hba1c after a 3-month diabetes self - management intervention , participants randomized to a 12-month social support group had significant improvements in systolic blood pressure while the control group did not . this finding is important given that over time cardiovascular disease risk factors , such as systolic blood pressure , tend to worsen . additionally , the ukpds study found that maintaining blood pressure in the normal range resulted in an 11% decrease in diabetes complications over 10 years . other studies have found that intensive blood pressure control can save approximately $ 2,000 per quality - adjusted life - year in patients with type 2 diabetes . despite mixed findings in the research on the impact of social support on hba1c in patients with diabetes , based on communication with community researchers , there is a belief that social support groups can help to build relationships among community members and encourage interaction outside of the intervention . this could provide participants with a sense of accountability and opportunities to learn from each other , which may increase motivation to maintain positive behavior changes and improve psychosocial functioning [ 14 , 28 ] . also , participants in the control group received bimonthly postcards reminding them of the skills they learned in the pic intervention . these postcards may have been effective at helping participants maintain the self - care activities they initiated during the intervention , lessening any between group differences at t3 . as a rct , participants were randomized after the 12-week pic intervention . due to the fact that several of these groups were small ( e.g. , 8 people ) , the number of people randomized to ssgs was very small , which may have limited the amount of support each group was able to provide . additionally , some participants formed relationships in pic but were separated by randomization into different groups , which possibly decreased the motivation of these participants . the structure of the ssg was set a priori ; however some participants expressed an interest in diabetes - related topics not included and/or in an order different from what was scheduled , which may have caused participants to lose interest . , in which they state that future research on the use of social support groups in improving hba1c and blood pressure is necessary , a belief with which the community agrees . the use of rcts in which participants are randomized at the individual level after intervention may not be an appropriate design in testing support group components . future designs could randomize by community site , allowing relationships built during the intervention to continue during support groups . other recommendations include the use of support groups that occur on an ongoing basis facilitated by health professionals with diabetes expertise . consequently , participants could attend as they feel necessary and exercise control in determining topics discussed . in conclusion , the pic diabetes self - management intervention is effective at decreasing participants ' hba1c and improving their self - management skills .

native hawaiians and other pacific islanders ( nh / pi ; e.g. , samoan and chuukese ) have higher type 2 diabetes prevalence compared to other groups in hawaii . partners in care ( pic ) , a culturally tailored , community - based , diabetes self - management education intervention ( dsme ) , is effective at improving participants ' glycemic control and self - care behaviors . maintenance of improvements is challenging . diabetes - related social support groups ( ssg ) are a promising maintenance component for dsme . this study examined the effects of a diabetes - specific ssg component relative to a control group , after the receipt of the 3-month pic intervention , which was delivered to 47 adult nh / pi with type 2 diabetes . participants were then randomized to either a 3-month , 6-session ssg or a control group . hemoglobin a1c ( hba1c ) , blood pressure , triglycerides , cholesterol , and diabetes self - management knowledge and behaviors were assessed at baseline , 3 months , and 6 months . results indicated significant improvements in hba1c , diabetes - related self - management knowledge , and behaviors from baseline to 3-month assessment . however , no differences between the ssg and control group from 3-month to 6-month assessment suggest that all participants were able to maintain initial improvements . the ssg group had a significant decrease in systolic blood pressure from 3-month to 6-month assessment while the control group did not . study limitations and future directions are discussed .

1. Introduction 2. Methods 3. Results 4. Discussion

chest pa showed superior mediastinal widening and bulging of the right paraspinal interface ( fig . 1 ) . increased opacity of the infrahilar window and thickening of the posterior wall of the bronchus intermedius were seen on the lateral chest x - ray . an oval - shaped mass measuring 9.73.86.0 cm was seen in the left superior mediastinum . a bizarre - shaped vascular structure that was connected to left innominate vein was seen in central area of the mass ( fig . the mass showed insinuating appearance without significant compression of adjacent structures . only the thymus was slightly compressed by the mass . another similarly natured mass was seen in the right paraspinal area , which measured about 4.23.06.6 cm . this mass also contained a bizarre - shaped vascular structure that communicated with the left atrium directly through an anomalous vascular structure ( fig . 2 ) . multiplanar reconstruction ( mpr ) and 3d reformation showed that the contrast directly entered the vascular components of the masses via an abnormal vein originating from the left innominate vein ( fig . the mediastinal window setting of contrast - enhanced ct showed additional multiple small cystic lesions in the middle mediastinum . a two - stage operation was planned due to the fact that the tumors were located bilaterally . first , for the left side tumor resection , posterolateral thoracotomy was performed and a large cystic mass was found in the anterosuperior mediastinum . the content of the cyst was bloody and a large communicating vein to left innominate vein and few small communicating veins to left intercostal veins were found , which were then ligated and divided . the second operation was performed for the right mediastinal mass 45 days after the first surgery . the right paraspinal mass was successfully resected and an anomalous communicating vein to left atrium was identified and divided . the patient recovered completely without any complications such as chylothorax or hemothorax . on gross pathologic examination , the cut surface of the tumor revealed numerous cystic spaces and a cavernous sinus containing bloody contents ( fig . histology of the mass showed combined proliferation of venous vascular channels ( ve ) and lymphatic channels ( ly ) that exhibited infiltration into mediastinal fat pad ( fig . mediastinal lymphangiohemangioma is a very rare venolymphatic malformation containing both vascular and lymphatic elements . direct vascular communication between the lesion and the vena cava system ct images of the mediastinal lymphangiohemangioma are very rarely found in the english literature [ 1 - 4 ] . moreover , neither a case with multiple masses and more than one vascular communication nor a case directly connected to the heart chamber through an anomalous vessel was found in the literature . we report a case of surgicopathologically confirmed mediastinal lymphangiohemangioma that communicated with the left innominate vein and left atrium directly via anomalous vascular structures ( fig . vascular malformations are subcategorized as lymphatic , capillary , venous , arteriovenous , and mixed malformations on the basis of their histologic nature . . therefore , our case can be categorized as low - flow vascular malformations with mixed lymphatic and venous components . slow - flowing blood appears as high signal intensity on t2-weighted images and as intermediate signal intensity on t1-weighted images . most lesions present early in childhood and the most common locations for lymphatic malformations are the neck and axilla . a less common location is the mediastinum , and the anterior mediastinum is the most commonly found mediastinal site . ct scan , the mass showed diffuse low attenuation without calcification , although previous reports showed scattered phleboliths in the mass , which represent calcified emboli in the venous channels . the anomalous vascular structures were enhanced at the same intensity as the systemic venous system and was connected directly to the left innominate vein and left atrium . the peripheral portion of the lesion was not enhanced on all phases of dynamic ct scan , which may be related to the lymphatic components or fibroconnective tissues of the mass . a previous report postulated that the anomalous vein acts not only as a draining vessel but also as a feeding vessel . in our case , only the proximal part of the vascular structure was enhanced on the pulmonary arterial phase , whereas all of the large bizarre - shaped vascular spaces were enhanced on the systemic venous phase ( fig . 2 ) . a delayed ct scan may show delayed clearance of contrast within the anomalous venous channels because of the lack of smooth muscle in these channels . lymphangiohemangiomas are not considered an congenital anomaly but are frequently associated with other vascular malformations , most commonly in the left superior vena cava . in our case , the anomalous vessels connected to the left innominate vein may be considered a left superior vena cava remnant . a lymphangiohemangioma should be included in the list of differential diagnoses of an incidentally found low - attenuating mediastinal mass , especially in young patients . another therapeutic option is percutaneous sclerotherapy using agents such as absolute ethanol , bleomycin , cyclophosphamide , doxycycline , alcohol solution of zein , or ok-432 . recognizing that the lesion is a low - flow vascular malformation is more important than determining whether the lesion is predominantly venous or lymphatic when making treatment decisions . we planned surgical excision of the lesions and successfully excised them without any complications such as hemothorax or chylothorax . for successful surgery , the anomalous vascular pedicle of the mass communicating with the systemic vein or heart chamber should be carefully identified and divided to prevent massive hemothorax .

lymphangiohemangiomas of the mediastinum are exceedingly rare and few cases have been published in the english literature . this report may be the only reported case in which lymphangiohemangiomas were found bilaterally . we report a case of a 7-year - old boy with an incidental finding of an abnormal mediastinal shadow on a chest x - ray . the chest ct showed a large mass in the left superior mediastinum and another in the right posterior mediastinum . the left mass had anomalous venous channels connected to the left innominate vein , and the right mass to the left atrium . we performed an excision of the mass in the left side first and then the right side one month later . anomalous venous channels were dissected carefully and ligated . there were no complications and no signs of recurrence 30 months after the operation .

CASE REPORT DISCUSSION

parkinson disease ( pd ) is a neurodegenerative disease which its prevalence varies by location and ethnicity ( 1 , 2 ) . the correlation between depression and parkinson disease has remained unclear among iranian population . the roles of demographic and disease - related variables are not fully described in the association between depression and pd . depression is highly prevalent among patients with parkinson disease ( 3 , 4 ) and has been demonstrated to reduce quality of life among affected individuals ( 5 , 6 ) . factors like male gender ( 7 ) , cognitive impairment ( 8) , motor symptoms ( left - sided onset tremor ) ( 9 ) , and impulsivity ( 10 ) are shown to be associated with higher risk of developing depression among patients with pd . studies have demonstrated that the association between depression and parkinson disease is not merely a reaction to chronic disease , but a consequence of the neurodegenerative process ( 11 , 12 ) . therefore , multifactorial disease - related variables along with non - pd specific components may affect the prevalence of depression in parkinson disease ( 13 ) . the prevalence of depression and related variables has not yet been described among iranian patients with pd living in kermanshah province . since depression disruptively affect quality of life among patients with pd , determination of its prevalence and appropriate treatment are essential . there is some evidence indicating that depression has been underdiagnosed and undertreated in patients with pd ( 14 ) . studies have shown that depression in pd is more commonly accompanied with somatic and cognitive symptoms ( 15 , 16 ) which may contribute to complexity and underdiagnoses of depression among this population . determination of predictive factors for depression may help clinicians to cautiously consider susceptible patients for treatment . in this investigation , the prevalence of depression and the effect of demographic and disease - related variables were assessed in patients with pd living in kermanshah province , iran . patients with confirmed parkinson disease who were referred to clinics of kermanshah university of medical sciences were invited to participate in this cross - sectional study . exclusion criteria were as follows : history of depression or other psychiatric disorders before onset of pd , existence of other chronic medical conditions , including cancer , endocrinology disease , coronary vascular disease , history of myocardial infarct , and spinal cord injury . patients under treatment with special medications such as glucocorticoid , thyroid hormones , anticonvulsive drugs , heparin , lithium , blood glucose reducing agents , and atorvastatin were also excluded . those with the history of smoking , alcohol , or drug abuse were excluded as well . participation was voluntarily and patients were assured about the confidentiality of their information . during interviews , private locations were provided to respect patient privacy . although an assistant was present at the interviews , the final judgements of subjective assessment of depression were indexed according to the psychologist s interpretations . patients age , gender , educational level , daily medication treatment schedules were asked directly from each individual and indexed in prepared forms during interviews . pd - related variables , including tremor , rigidity , impaired posture , loss of autonomic movement , mask face , speech and writing changes , excessive salvia , and urinary urgency were examined by a neurologist and also indexed . the farsi version of snaith - hamilton pleasure scale has 14 items and each of the items has a set of 5 response categories ( definitely agree , agree , no idea , disagree , and strongly disagree ) which are scored from 1 to 5 . 1 ) i would enjoy my favorite television or radio program , 2 ) i would enjoy being with family or close friends , 3 ) i would find pleasure in my hobbies and pastimes , 4 ) i would be able to enjoy my favorite meal , 5 ) i would enjoy a warm bath or refreshing shower , 6 ) i would find pleasure in the scent of flowers or the smell of a fresh sea breeze or freshly baked bread , 7 ) i would enjoy seeing other people s smiling faces , 8) i would enjoy looking smart when i have made an effort with my appearance , 9 ) i would enjoy reading a book , magazine , or newspaper , 10 ) i would enjoy a cup of tea or coffee or my favorite drink , 11 ) i would find pleasure in small things ; e.g. , bright sunny day , telephone call from a friend , 12 ) i would be able to enjoy a beautiful landscape or view , 13 ) i would get pleasure from helping others , and 14 ) i would feel pleasure when i receive praise from other people ( 18 ) . these items cover 4 domains of hedonic experience : interest / pastimes , social interaction , sensory experience , and food / drink . studies have demonstrated that snaith - hamilton pleasure scale has an internal consistency of 0.91 which shows its validity and reliability to assess hedonic capacity ( 19 ) . beck depression inventory - ii consists of 21 items and the score ranges from 0 to 63 . interpretations of the scores are as follows : 1 - 10 , normal ; 11 - 16 , mild mood disturbance ; 17 -2 0 , borderline clinical depression ; 21 - 30 , moderate depressive mood ; 31 - 40 , severe depressive mood ; and over 40 , extreme depression ( 20 ) . the persian version of bdi - ii has been shown to have acceptable internal consistency ( cronbach = 0.87 ) and test - retest reliability ( r = 0.74 ) ( 21 ) . bdi - ii was checked to be a valid and reliable instrument to assess depression among patients with parkinson disease ( 22 ) . because a weak association between diabetes mellitus type 2 and depression has been reported , the history of diabetes in all patients were recorded and blood samples were taken to measure fasting plasma glucose ( fpg ) . cochran s formula was used to estimate sample size . according to sadeghirad et al . ( 23 ) , the approximate prevalence of major depression in iran is 4.1% . by considering the total population of kermanshah which is about 2000000 , the approximate number of major depression in kermanshah is estimated to be 82000 . using cochran s sample size formula with a margin of error of 5% and confidence interval of 95 , the formula was as follows : similar sample size was determined using morgan s table . we interviewed 412 patients with pd and 62 subjects were excluded according to exclusion criteria . finally , a total of 350 patients participated in this study which is close to estimated sample size . all statistical analysis was performed using spss software version 21 ( ibm corporation , usa ) . categorical variables were described by numbers and percentages whereas continuous variables by mean and standard deviation . comparison of means between groups was done by t test and 1-way analysis of variance ( anova ) . patients with confirmed parkinson disease who were referred to clinics of kermanshah university of medical sciences were invited to participate in this cross - sectional study . exclusion criteria were as follows : history of depression or other psychiatric disorders before onset of pd , existence of other chronic medical conditions , including cancer , endocrinology disease , coronary vascular disease , history of myocardial infarct , and spinal cord injury . patients under treatment with special medications such as glucocorticoid , thyroid hormones , anticonvulsive drugs , heparin , lithium , blood glucose reducing agents , and atorvastatin were also excluded . those with the history of smoking , alcohol , or drug abuse were excluded as well . participation was voluntarily and patients were assured about the confidentiality of their information . during interviews , private locations were provided to respect patient privacy . although an assistant was present at the interviews , the final judgements of subjective assessment of depression were indexed according to the psychologist s interpretations . patients age , gender , educational level , daily medication treatment schedules were asked directly from each individual and indexed in prepared forms during interviews . pd - related variables , including tremor , rigidity , impaired posture , loss of autonomic movement , mask face , speech and writing changes , excessive salvia , and urinary urgency were examined by a neurologist and also indexed . the farsi version of snaith - hamilton pleasure scale has 14 items and each of the items has a set of 5 response categories ( definitely agree , agree , no idea , disagree , and strongly disagree ) which are scored from 1 to 5 . 1 ) i would enjoy my favorite television or radio program , 2 ) i would enjoy being with family or close friends , 3 ) i would find pleasure in my hobbies and pastimes , 4 ) i would be able to enjoy my favorite meal , 5 ) i would enjoy a warm bath or refreshing shower , 6 ) i would find pleasure in the scent of flowers or the smell of a fresh sea breeze or freshly baked bread , 7 ) i would enjoy seeing other people s smiling faces , 8) i would enjoy looking smart when i have made an effort with my appearance , 9 ) i would enjoy reading a book , magazine , or newspaper , 10 ) i would enjoy a cup of tea or coffee or my favorite drink , 11 ) i would find pleasure in small things ; e.g. , bright sunny day , telephone call from a friend , 12 ) i would be able to enjoy a beautiful landscape or view , 13 ) i would get pleasure from helping others , and 14 ) i would feel pleasure when i receive praise from other people ( 18 ) . these items cover 4 domains of hedonic experience : interest / pastimes , social interaction , sensory experience , and food / drink . studies have demonstrated that snaith - hamilton pleasure scale has an internal consistency of 0.91 which shows its validity and reliability to assess hedonic capacity ( 19 ) . beck depression inventory - ii consists of 21 items and the score ranges from 0 to 63 . higher scores indicate more severe depressive moods . interpretations of the scores are as follows : 1 - 10 , normal ; 11 - 16 , mild mood disturbance ; 17 -2 0 , borderline clinical depression ; 21 - 30 , moderate depressive mood ; 31 - 40 , severe depressive mood ; and over 40 , extreme depression ( 20 ) . the persian version of bdi - ii has been shown to have acceptable internal consistency ( cronbach = 0.87 ) and test - retest reliability ( r = 0.74 ) ( 21 ) . bdi - ii was checked to be a valid and reliable instrument to assess depression among patients with parkinson disease ( 22 ) . because a weak association between diabetes mellitus type 2 and depression has been reported , the history of diabetes in all patients were recorded and blood samples were taken to measure fasting plasma glucose ( fpg ) . et al . ( 23 ) , the approximate prevalence of major depression in iran is 4.1% . by considering the total population of kermanshah which is about 2000000 , the approximate number of major depression in kermanshah is estimated to be 82000 . using cochran s sample size formula with a margin of error of 5% and confidence interval of 95 , the formula was as follows : similar sample size was determined using morgan s table . we interviewed 412 patients with pd and 62 subjects were excluded according to exclusion criteria . finally , a total of 350 patients participated in this study which is close to estimated sample size . all statistical analysis was performed using spss software version 21 ( ibm corporation , usa ) . categorical variables were described by numbers and percentages whereas continuous variables by mean and standard deviation . comparison of means between groups was done by t test and 1-way analysis of variance ( anova ) . a total of 412 patients selected based on inclusion criteria were interviewed and 62 subjects were excluded according to exclusion criteria . finally , 350 patients ( 52.9% men and 47.1% women ) participated in this investigation . mean age of the study sample and mean age by the time of pd onset were 64.07 5.08 and 58.46 4.47 years , respectively . the majority of patients were illiterate ( n = 183 , 52.3% ) and only 4.6% of participants had higher education . tremor was observed in 325 ( 92.9% ) patients and rigidity was detected in 291 ( 83.1% ) patients . impaired posture , loss of autonomic movements , changes in speech and handwriting were found in 217 ( 62.0% ) , 256 ( 73.1% ) , 217 ( 62.0% ) , and 163 ( 46.6% ) patients , respectively . only 10.6% of the patients had hyposmia whereas other pd - related variables , including masked face , excessive salvia , and urinary urgency were detected in a higher proportion of patients ( 55.7% , 48% , and 41.1% , respectively ) . anhedonia was assessed by farsi version of snaith - hamilton pleasure scale , which determines hedonic tone in 4 domains . obtained scores in each domain were as follows : interest / pastimes ( 7.89 2.01 ) , social interaction ( 14.0 3.94 ) , sensory experience ( 11.53 3.39 ) , food / drink ( 5.47 1.93 ) ( table 1 ) . female patients were significantly more susceptible to severe and profound depression ( p < 0.0001 ) . high school educational level and academic educations were related to higher incidence of profound depression ( p < 0.0001 ) , whereas 12.5% of illiterate patients and 14.3% of patients with primary educational level had normal mood . patients with familial history of pd experienced more severe depression ( p = 0.019 ) . surprisingly , 40% of patients without tremor had profound depression whereas only 22.7% of individuals with tremor suffered from profound depression ( p = 0.004 ) . however , since only 7.1% of patients did not demonstrate tremor as a pd clinical sign , results on tremor should be interpreted cautiously . rigidity was also a determinant of increased risk of depression ( p < 0.0001 ) . similarly , patients with impaired posture were more likely to have profound depression whereas those with intact posture most commonly experienced borderline clinical depression . furthermore , changes in speech and handwritings were not determinants of depression ( p = 0.095 and 0.062 , respectively ) . profound depression was detected among 40% of patients with masked face whereas only 5% of individuals without masked face showed profound depressive mood . this finding demonstrates that masked face is a significant determinant of depression among patients with pd ( p < 0.0001 ) . hyposmia was also related to higher susceptibility to depression and 50% of patients with hyposmia experienced profound depression ( p = 0.001 ) ( table 2 ) . abbreviation : pd : parkinson disease . patients with diabetes mellitus type 2 ( dm ii ) were more likely to have mild disturbed mood compared with those individuals without history of dm ii ( 25.7% vs. 6.7% ; p < 0.0001 ) . similarly , patients with mild disturbed mood had the highest mean value for fpg ( p = 0.007 ) . mean age of the patients with mild mood disturbance was low compared to other groups ( p < 0.0001 ) . lower scores of all domains of farsi version of snaith - hamilton pleasure scale were related to more severe depression ( p < 0.0001 for all subscales ) ( table 3 ) . p values stand for 1-way analysis of variance ( anova ) for comparison of means between groups . forty - three patients ( 12.3% ) had normal mood ; however , mild disturbance mood was detected in 36 ( 10.3% ) patients ; 70 ( 20.0% ) patients experienced borderline clinical depression ; and 47 ( 13.4% ) patients had moderate depression . severe and profound depression was detected in 70 ( 20.0% ) and 84 ( 24.0% ) patients . the overall estimation of prevalence of severe and profound depression among iranian individuals with pd was 44% . although the association between depression and parkinson disease ( pd ) has been described ( 11 , 12 ) , the role of pd - related variables on the severity of depression is yet unclear . ( 8) demonstrated that increased severity of pd is associated with higher susceptibility to depression . in the present study , we assessed pd - related variables , including clinical features to identify major determinants of depression among iranian individuals with pd . our results show that rigidity , impaired posture , masked face , and hyposmia are commonly related to more severe depression . anhedonia assessed by farsi version of snaith - hamilton pleasure scale was also a major determinant of depression . ( 24 ) showed that prevalence of major depression among patients with pd is about 8.1% . estimation of prevalence of depression in patients with pd varies among different populations according to study methodology , assessment tool , and community characteristics ( 24 ) . our estimation of depression prevalence among iranian patients with pd in kermanshah province is about 44% . using different assessment instrument to assess depression may also contribute to different estimations of depression prevalence in patients with pd . in this regard , williams et al . ( 25 ) compared scales for detection of depression in patients with pd ( beck depression inventory - ii , center for epidemiologic studies depression rating scale - revised , 30-item geriatric depression scale , inventory of depressive symptoms - patient , patient health questionnaire-9 , and unified parkinson disease rating scale - part i ) . their results showed that all mentioned instruments , except for the unified parkinson disease rating scale - part i , were valid screening tools ( 25 ) . however , it seems that proper comparison of depression among nations requires utilization of similar methods . our results demonstrated impaired posture as a determinant of depression . among pd - related variables , hassan et al . ( 26 ) showed that postural instability was correlated with depression among patients with pd which was in line with our findings . furthermore , letvinenko et al . ( 27 ) showed that back pain was correlated with the extent of posture disturbances . since the relationship between pain and depression is also well - documented ( 27 ) , we concluded that impaired posture increases the risk of depression through raising the level of pain . according to recent ninds recommendation ( 28 ) , anhedonia is a specific component of depression in pd . our study illustrates that anhedonia is significantly correlated with more severe depression among patients with pd which is consistent with ninds recommendations ( 28 ) . similarly , the close relationship between anhedonia and depression has been reported in general population ( 29 ) and in adolescents with major depression disease ( 30 ) . this evidence , in line with our study , supports the predictive value of anhedonia in determining depression . on the other hand , there is evidence demonstrating weak discriminating value of anhedonia compared to negative affect and apathy in determining depression in patients with pd ( 16 , 31 ) . in the present study , apathy was not assessed and further investigations are required to compare the discriminating value of apathy and anhedonia as determinants of depression in iranian population with pd in kermanshah . studies have shown that involvement of ventral striatum and prefrontal cortical regions may contribute to the development of anhedonia in depression ( 32 ) . deficits in dopamine generating cells in the substantia nigra of the brain are the underlying pathophysiology of pd . further studies are required to determine whether coincidental involvement of ventral striatum and substantia nigra in pd results in anhedonia among affected individuals . our investigation showed that women with pd are more susceptible to major depression compared to men which is contrary to the results of hsu et al . ( 33 ) reported that depression is more prominent among women with pd in the united kingdom which supports our results . since multifactorial components , including community characteristics should be considered when addressing depression based on gender distribution , further investigations with controlling social and environmental factors are required to clarify the role of gender in the incidence of depression among iranian people with pd . some studies have demonstrated the association of depression with diabetes mellitus ( 34 - 37 ) . however , riederer et al . ( 38 ) showed the association between depression and diabetes mellitus ( dm ) is relatively week among patients with pd . our study did not approve higher severity of depression in patients with coexistence of pd and diabetes . these findings show that dm and fpg may not be direct determinant of depression in pd but they have predictive value in determining a specific subgroup of mild depressive mood . identification of these variables can help give priorities to each patient based on their vulnerability to depression which is the strong point of this study . however , the weak point of this study is the lack of follow - up process . therefore , patients could not be assessed with regard to changes in depressive mood through time . in this study , the prevalence of depression among iranian patients with pd in kermanshah province and the association between depression severity and pd - related variables were assessed . it is estimated that 44% of patients with pd suffer from severe and profound depression . major determinants of depression were female gender , rigidity , impaired posture , masked face , hyposmia , and anhedonia .

background : the factors affecting the correlation between parkinson disease ( pd ) and depression have remained unclear.objectives:we assessed the prevalence of depression among patients with pd and the association between pd - related variables and depression severity.patients and methods : this is a cross - sectional study performed in kermanshah province of iran . sampling was based on recruitment of subjects according to inclusion and exclusion criteria . patients with confirmed parkinson disease who were referred to clinics of kermanshah university of medical sciences participated in this study . depression was evaluated with beck depression inventory - ii ( bdi - ii ) . clinical characteristics of pd , including tremor , rigidity , impaired posture , loss of autonomic movement , changes in speech and handwriting , masked face , and hyposmia were indexed . anhedonia was assessed with farsi version of snaith - hamilton pleasure scale . data were collected between april 2010 and march 2014.results:a total of 350 patients ( 52.9% men and 47.1% women ) participated in this investigation . female gender ( 36.5% in women vs. 13.0% in men , p < 0.0001 ) , impaired posture ( 27.2% in affected individuals vs. 18.8% , p = 0.002 ) , masked face ( 39.0% vs. 5.2% , p < 0.0001 ) , and hyposmia ( 48.7% vs. 21.0% , p = 0.001 ) were associated with higher susceptibility to profound depression . lower scores of all domains of farsi version of snaith - hamilton pleasure scale ( including interest / pastimes , social interaction , sensory experience , and food / drink ) were related to more severe depression ( p < 0.0001 for all subscales ) . severe and profound depression was found in 44% of the participants.conclusions:this study estimated that the prevalence of major depression among iranian individuals with pd living in kermanshah as 44% . major determinants of depression were female gender , rigidity , impaired posture , masked face , hyposmia , and anhedonia .

1. Background 2. Objectives 3. Patients and Methods 3.1. Study Design and Participants 3.2. Demographics and Parkinson Disease-Related Variables 3.3. Beck Depression Inventory-II (BDI-II) 3.4. Laboratory Measurements 3.5. Sample Size Estimation 3.6. Statistical Analysis 4. Results 5. Discussion

fatigue is the most frequent symptom in multiple sclerosis ( ms).1 the multiple sclerosis council defines ms related fatigue as a subjective lack of physical and/or mental energy that is perceived by the individual or caregiver to interfere with usual and desired activities,2 and has recommended evaluation with the 21-item modified fatigue impact scale ( mfis ) to measure fatigue,2 which is a smaller version of the 40-item fatigue impact scale ( fis).3 krupp et al,4 in 1989 , published the unidimensional fatigue severity scale ( fss ) , which is widely used not only in ms , but also in stroke,5 parkinson s disease,5 lung diseases,6 myotonic dystrophy,7 neuroborreliosis,8 hiv infection,9 and cancer,10 and in sleep disorders such as insomnia,11 shift working,12 restless legs syndrome ( rls),13,14 and obstructive sleep apnea.15 the international classification of sleep disorders second edition ( icsd-2 ) mentions exhaustion as a minimal criterion of sleep apnea,16 but in general there are no objective measurements to differentiate fatigue from exhaustion . complaints of fatigue may be as important as those of sleepiness are to obstructive sleep apnea syndrome ( osas ) patients,17 and consequently , continuous positive airway pressure ( cpap ) improves fatigue substantially in osas patients.18 ( interestingly , women suffering from osas appear to have complaints of fatigue more frequently than men with osas).17 hossain et al19 investigated 283 patients by polysomnography in a sleep laboratory . sixty - four percent of referred patients reported pathological fatigue without overlap of sleepiness ( mean fss 5.1 ; mean epworth sleepiness scale [ ess]20 6.9 ) , 19% were highly fatigued and sleepy ( mean fss 5.4 ; mean ess 17.2 ) , 13% did not feel either fatigue or sleepiness ( mean fss 2.1 ; mean ess 5.4 ) , and only 4% reported pathological sleepiness without overlap of fatigue ( mean fss 1.9 ; mean ess 14.5 ) . in summary , fatigue and sleepiness can occur together , but fatigue and sleepiness can be independent manifestations of a sleep disorder;21 there are many patients suffering from sleep disorders with fatigue but without sleepiness . in all likelihood this underemphasis may contribute to the overlooking of treatable sleep disorders , with enormous consequences for misdiagnosed patients . veauthier et al22 performed the first cross - sectional polysomnographic trial in the context of ms - related fatigue . they found a significant relationship between relevant sleep disorders ( including sleep - related breathing disorders [ srbds ] , rls , periodic limb movement disorder [ plmd ] , insomnia , and others ) on the one hand and fatigue measured with the mfis and the fss on the other hand ( mean mfis in fatigued ms patients 42.8 [ standard deviation { sd } 18.3 ] and 20.5 [ sd 17 ] in non - fatigued patients [ p < 0.001 ] ) . after performing a receiver operating characteristic analysis,23 they recommended polysomnographic investigations in all fatigued ms patients , when mfis > 34 or pittsburgh sleep quality index ( psqi)24 > 5 , so as not to overlook treatable sleep disorders.23 two different sleep studies have shown a significant relationship between ms - related fatigue and sleep disorders,22,25 and , in the corresponding follow - up trials , medical sleep treatment led to an improvement of ms - related fatigue.26,27 aside from the abovementioned studies,10,11,19,21 there are only a few polysomnographic studies investigating fatigue measured with the fss,28,29 and there are no other polysomnographic studies investigating fatigue measured with the mfis in the general population . hossain et al described fss mean values from 4.4 ( sd 1.6 ) to 5.1 ( sd 1.0 ) in osas , rls , plmd , depression , narcolepsy , parasomnia , delayed sleep phase syndrome , and insomnia,19 but as there have been , to date , no pathophysiological explanations for fatigue caused by sleep disorders , the question remains : is it caused by reduced sleep efficacy , disrupted sleep , suppressed deep sleep , intensified desaturation , or an increased number of hypopnea / apnea episodes ? the aims of this study were : to describe the mfis values in patients admitted to a sleep laboratory and to investigate which polysomnographic parameters can predict fatigue measured with the mfis and the fss . in this retrospective observational study , all consecutive patients who were admitted to the sleep laboratory of the hanse - klinikum , stralsund , germany between february 1 , 2011 and january 31 , 2012 were included . all patients admitted to the sleep laboratory completed the mfis , fss , ess , and psqi . these whole - night measurements were made after an impedance test and a biosignal test over a period of 8 hours , comprising : c3/c4 electroencephalograph ( eeg ) electrodes to the contralateral mastoid electrode ; ground electrode ; electrooculogram on the ipsilateral mastoid electrode ; bipolar chin electromyogram ( emg ) of the muscle mentalis or muscle submentalis ( according to biosignal testing and anatomical conditions ) ; nasal airflow ( pressure sensor ) ; thoracic and abdominal breathing ( piezoelectric measurement ) ; position sensor ; snoring signal ; pulse oximetry ; pulse , electrocardiogram ; and bipolar two - point emg electrodes on both anterior tibial muscles . the polysomnograph readings were scored according to the criteria of rechtschaffen and kales,30 using 30-sec - ond epochs . the following polysomnographic parameters were included in the analysis : apnea / hypopnea index ( ahi ) per hour of sleep , according to the american academy of sleep medicine;31 minimal desaturation ( spo2% min ) ; sleep efficacy ( ratio total sleep time / time spent in bed ) ; deep sleep ( ratio non - rapid eye movement sleep stage 3 and 4 [ nrem-3/4]/time spent in bed ) ; number of awakenings ; arousal index per hour of sleep ; and sleep latency ( time to first sleep epoch in minutes ) . sleep diagnoses were made according to the icsd-2.16 patients were divided for statistical reasons into different subgroups : ( 1 ) untreated srbds ; ( 2 ) treated srbds ( patients were treated with cpap or bilevel therapy ) ; ( 3 ) plmd and rls ; ( 4 ) insomnia ; ( 5 ) parasomnia ; ( 6 ) other neurological diseases such as narcolepsy , hypersomnia , and ms ( due to a low number of patients and small sample sizes , these patients were classified into one subgroup even though these diseases are quite different ) ; and ( 7 ) patients admitted to the sleep laboratory for tiredness or sleepiness but without pathological findings in the medical sleep investigations ( exclusion of a sleep disorder ) . the results were expressed as mean , sd , and range . following an exploratory analysis of the data and after a ( negative ) check for normality of the underlying distributions , differences between subgroups with respect to mfis , ess , psqi , and fss were ( univariately ) analyzed using the mann spearman correlation coefficients were calculated to assess the relationship between questionnaire results , and polysomnographic parameters and age , and scatter plots were performed to demonstrate these relationships . we defined spearman s rank correlations ( spearman s rho ) as follows : for values between 0.9 and 1 , the correlation is very strong ; for values between 0.7 and 0.89 , the correlation is strong ; values between 0.5 and 0.69 show a moderate correlation ; for values between 0.3 and 0.49 , the correlation is moderate to low ; and for values < 0.3 , the correlation is weak and not important . patients were classified into subgroups by mfis ( mfis greater versus less than or equal to mfis mean ) and fss ( fss greater versus less than or equal to fss mean ) values . afterwards , a logistic regression was performed in order to predict the outcome of these two dependent variables ( greater versus less than or equal to fss mean / mfis mean ) with age , sex , and polysomnographic parameters , including ahi , spo2% min , sleep efficacy , nrem-3/4 , number of awakenings , arousal index , and sleep latency , as predictor variables . this analysis was performed in two steps : first , a univariate analysis with all predictor variables ; subsequently , all significant variables remained in the final model of multiple logistic . all tests should be understood as constituting exploratory data analysis , such that neither previous power calculations nor subsequent adjustments for multiple testing have been made . analysis was performed with spss software ( v19 ; ibm corporation , armonk , ny , usa ) . in this retrospective observational study , all consecutive patients who were admitted to the sleep laboratory of the hanse - klinikum , stralsund , germany between february 1 , 2011 and january 31 , 2012 were included . all patients admitted to the sleep laboratory completed the mfis , fss , ess , and psqi . these whole - night measurements were made after an impedance test and a biosignal test over a period of 8 hours , comprising : c3/c4 electroencephalograph ( eeg ) electrodes to the contralateral mastoid electrode ; ground electrode ; electrooculogram on the ipsilateral mastoid electrode ; bipolar chin electromyogram ( emg ) of the muscle mentalis or muscle submentalis ( according to biosignal testing and anatomical conditions ) ; nasal airflow ( pressure sensor ) ; thoracic and abdominal breathing ( piezoelectric measurement ) ; position sensor ; snoring signal ; pulse oximetry ; pulse , electrocardiogram ; and bipolar two - point emg electrodes on both anterior tibial muscles . the polysomnograph readings were scored according to the criteria of rechtschaffen and kales,30 using 30-sec - ond epochs . the following polysomnographic parameters were included in the analysis : apnea / hypopnea index ( ahi ) per hour of sleep , according to the american academy of sleep medicine;31 minimal desaturation ( spo2% min ) ; sleep efficacy ( ratio total sleep time / time spent in bed ) ; deep sleep ( ratio non - rapid eye movement sleep stage 3 and 4 [ nrem-3/4]/time spent in bed ) ; number of awakenings ; arousal index per hour of sleep ; and sleep latency ( time to first sleep epoch in minutes ) . sleep diagnoses were made according to the icsd-2.16 patients were divided for statistical reasons into different subgroups : ( 1 ) untreated srbds ; ( 2 ) treated srbds ( patients were treated with cpap or bilevel therapy ) ; ( 3 ) plmd and rls ; ( 4 ) insomnia ; ( 5 ) parasomnia ; ( 6 ) other neurological diseases such as narcolepsy , hypersomnia , and ms ( due to a low number of patients and small sample sizes , these patients were classified into one subgroup even though these diseases are quite different ) ; and ( 7 ) patients admitted to the sleep laboratory for tiredness or sleepiness but without pathological findings in the medical sleep investigations ( exclusion of a sleep disorder ) . the results were expressed as mean , sd , and range . following an exploratory analysis of the data and after a ( negative ) check for normality of the underlying distributions , differences between subgroups with respect to mfis , ess , psqi , and fss were ( univariately ) analyzed using the mann spearman correlation coefficients were calculated to assess the relationship between questionnaire results , and polysomnographic parameters and age , and scatter plots were performed to demonstrate these relationships . we defined spearman s rank correlations ( spearman s rho ) as follows : for values between 0.9 and 1 , the correlation is very strong ; for values between 0.7 and 0.89 , the correlation is strong ; values between 0.5 and 0.69 show a moderate correlation ; for values between 0.3 and 0.49 , the correlation is moderate to low ; and for values < 0.3 , the correlation is weak and not important . patients were classified into subgroups by mfis ( mfis greater versus less than or equal to mfis mean ) and fss ( fss greater versus less than or equal to fss mean ) values . afterwards , a logistic regression was performed in order to predict the outcome of these two dependent variables ( greater versus less than or equal to fss mean / mfis mean ) with age , sex , and polysomnographic parameters , including ahi , spo2% min , sleep efficacy , nrem-3/4 , number of awakenings , arousal index , and sleep latency , as predictor variables . this analysis was performed in two steps : first , a univariate analysis with all predictor variables ; subsequently , all significant variables remained in the final model of multiple logistic . all tests should be understood as constituting exploratory data analysis , such that neither previous power calculations nor subsequent adjustments for multiple testing have been made . analysis was performed with spss software ( v19 ; ibm corporation , armonk , ny , usa ) . in sum , 410 patients 20 to 86 years ( 290 men and 120 women ) were investigated . table 1 displays the demographic and polysomnographic data and table 2 shows the questionnaire results . there was a moderate to strong correlation between mfis and fss values in the whole cohort and in all subgroups except for the plmd / rls subgroup . there was a moderate correlation between mfis and psqi in the whole cohort and in srbd patients ( treated and untreated ) and in patients without sleep disorders or with narcolepsy / hypersomnia / ms ( but not in plmd / rls patients nor insomnia patients ) . there was a moderate correlation between fss and psqi in srbd patients ( treated and untreated ) . there was a low correlation between ess values and mfis in untreated srbd patients and a moderate correlation between ess values and fss in patients without sleep disorders . higher age was related to increased psqi values in plmd / rls patients and with increased ess values in patients with narcolepsy / hypersomnia / ms ( table 3 ) . with respect to polysomnographic data , a low correlation could be found between increased ahi and lower minimal desaturation on the one hand and increased psqi values on the other in treated srbd patients . furthermore , there was a low correlation between the number of awakenings and psqi in all patients and untreated srbd patients . similarly , there was a low correlation between an increased arousal index and higher psqi values in treated srbd and insomnia patients . figures 1 and 2 show the relationships between mfis / fss values and polysomnographic parameters by scatter plots . whereas the graphical visualization did not show any correlation between mfis / fss values and ahi , spo2% min , sleep efficacy , sleep latency , or deep sleep , the scatter plots did visualize a correlation between mfis values and the number of awakenings and between fss values and a high arousal index . in the subgroup without sleep disorders , we did find a moderate nonparametric correlation between increased deep sleep ( nrem-3/4 ) and higher mfis and fss values and , similarly , between deep sleep and mfis in plmd / rls patients . in plmd / rls patients , lower sleep latency was correlated with increased ess values . in insomnia patients , higher fss values we introduced the dichotomous variable mfis higher than mfis mean ( 34.2 ) ( yes or no ) and the dichotomous variable fss higher than fss mean ( 4.0 ) the univariate logistic regression showed no significant relationship with spo2% min , sleep efficacy , sleep latency , or deep sleep . a significant relationship could be found with age , sex , and number of awakenings for mfis as well as fss ( table 4 ) . furthermore , there was a significant relationship with arousal index and ahi only for fss . the multiple logistic regression ( table 4 ) investigating the fss , including age , sex , arousal index , number of awakenings , and ahi , demonstrated a significant relationship with age , sex , and arousal index , whereas ahi and number of awakenings were not significant . younger age , female sex , and high arousal index were highly predictive of increased fss scores . in regards to mfis , the multiple logistic regression ( table 4 ) investigating the mfis , including age , sex , and number of awakenings , confirmed the significant relationship with age , sex , and number of awakenings . younger age , female sex , and high numbers of awakenings predicted high mfis values . in sum , 410 patients 20 to 86 years ( 290 men and 120 women ) were investigated . table 1 displays the demographic and polysomnographic data and table 2 shows the questionnaire results . there was a moderate to strong correlation between mfis and fss values in the whole cohort and in all subgroups except for the plmd / rls subgroup . there was a moderate correlation between mfis and psqi in the whole cohort and in srbd patients ( treated and untreated ) and in patients without sleep disorders or with narcolepsy / hypersomnia / ms ( but not in plmd / rls patients nor insomnia patients ) . there was a moderate correlation between fss and psqi in srbd patients ( treated and untreated ) . there was a low correlation between ess values and mfis in untreated srbd patients and a moderate correlation between ess values and fss in patients without sleep disorders . higher age was related to increased psqi values in plmd / rls patients and with increased ess values in patients with narcolepsy / hypersomnia / ms ( table 3 ) . with respect to polysomnographic data , a low correlation could be found between increased ahi and lower minimal desaturation on the one hand and increased psqi values on the other in treated srbd patients . furthermore , there was a low correlation between the number of awakenings and psqi in all patients and untreated srbd patients . similarly , there was a low correlation between an increased arousal index and higher psqi values in treated srbd and insomnia patients . figures 1 and 2 show the relationships between mfis / fss values and polysomnographic parameters by scatter plots . whereas the graphical visualization did not show any correlation between mfis / fss values and ahi , spo2% min , sleep efficacy , sleep latency , or deep sleep , the scatter plots did visualize a correlation between mfis values and the number of awakenings and between fss values and a high arousal index . in the subgroup without sleep disorders , we did find a moderate nonparametric correlation between increased deep sleep ( nrem-3/4 ) and higher mfis and fss values and , similarly , between deep sleep and mfis in plmd / rls patients . in plmd / rls patients , lower sleep latency was correlated with increased ess values . in insomnia patients , higher fss values we introduced the dichotomous variable mfis higher than mfis mean ( 34.2 ) ( yes or no ) and the dichotomous variable fss higher than fss mean ( 4.0 ) the univariate logistic regression showed no significant relationship with spo2% min , sleep efficacy , sleep latency , or deep sleep . a significant relationship could be found with age , sex , and number of awakenings for mfis as well as fss ( table 4 ) . furthermore , there was a significant relationship with arousal index and ahi only for fss . the multiple logistic regression ( table 4 ) investigating the fss , including age , sex , arousal index , number of awakenings , and ahi , demonstrated a significant relationship with age , sex , and arousal index , whereas ahi and number of awakenings were not significant . younger age , female sex , and high arousal index were highly predictive of increased fss scores . in regards to mfis , the multiple logistic regression ( table 4 ) investigating the mfis , including age , sex , and number of awakenings , confirmed the significant relationship with age , sex , and number of awakenings . younger age , female sex , and high numbers of awakenings predicted high mfis values . this is the first study , to our knowledge , to investigate the relationship between sleep disorders and mfis values , and we observed a number of important findings . firstly , this study clearly shows that sleep disorders can lead to high mfis values in sleep - disordered patients who are not suffering from ms . secondly , our results show both high mfis and fss values in sleep - disordered patients without ms and , above all , a strong correlation between mfis and fss for all patients and all subgroups except for plmd / rls patients . ( the fact that this correlation could not be demonstrated in plmd / rls patients could be due to small sample size ) . thirdly , the correlation between psqi and mfis values in all patients ( except for plmd / rls and insomnia patients ) and between psqi and fss in srbd patients , suggests causation of fatigue by sleep disorders ( the lack of correlation in some subgroups may be caused by small sample size ) . this could be confirmed by multiple logistic regressions , showing that a high number of awakenings were in line with a higher risk of developing fatigue measured with the mfis and that a high arousal index increased the risk of developing fatigue measured with the fss . this possible causative role of awakenings and arousals in the pathophysiology of fatigue is of particular interest , and further studies should be performed to elucidate its etiology . guilleminault et al used cyclic alternating pattern ( cap ) to investigate the relationship between sleep instability and fatigue in patients with upper airway resistance syndrome ( uars ) compared with healthy controls.32 they found higher arousal indexes and sleep disturbances measured with cap analysis in patients with uars that correlated with sleepiness and fatigue . feige et al summarized the hyperarousal concept in their review about sleep microstructural differences in chronic insomnia.33 they recommended spectral analysis of the sleep eeg , microarousal , and cap analysis as a research instrument of sleep in insomnia . it would be promising to investigate fatigue as well with these methods in patients without known sleep disorders , in order to find out what drives fatigue . on the other hand , little is known about the impact of arousal on fatigue in sleep disorders . yue et al34 found a significant relationship between emotional fatigue measured with the multidimensional fatigue symptom inventory short form35 and spontaneous movement arousals in untreated osas patients . it is worth noting that previous studies have not shown a significant association between the severity of osas ( ahi , spo2% min ) and fatigue scores.36,37 in our study , there was also no significant relationship between fatigue and ahi or spo2% min after multiple logistic regressions . previous polysomnographic investigations of consecutive ms patients showed a significant association of sleep disorders with fatigue ( fss / mfis),22 but not with sleepiness ( ess ) . supporting this finding , the works by hossain et al19 and aguillard et al21 showed that , in sleep - disordered patients without ms , fatigue and sleepiness can occur independently as well as together . in the present study , there was not a significant relationship between mfis values and ess values ( only untreated srbd patients showed a low correlation between ess values and mfis ) . the fact that we found a strong correlation between ess values and fss values in patients without sleep disorders remains without explanation . we have to note that these patients were not healthy controls , but rather fatigued and sleepy patients without pathological findings either in the primary health care setting or in the sleep laboratory . overall , as we performed multiple logistic regressions only for mfis and fss values , we can not interpret the correlations between ess and psqi values and age or sex or polysomnographic parameters . our study was focused on the relationship between sleep disorders and fss and mfis . in our study , women had a higher risk of suffering from fatigue than men . our results are in line with a previous study,17 suggesting that , in srbd patients , fatigue may be particularly correlated with female sex : in our study , female sex was predictive of high fss and mfis values . currently , we have no explanation for this relationship and further studies are needed to investigate the pathophysiological mechanisms . similarly , we have no explanation for the fact that younger age is predictive of fatigue and further studies are needed to understand this relationship as well . the present study has some methodological limitations : due to the retrospective design and owing to the lack of exclusion criteria , we can not exclude that some patients have other reasons for fatigue as a possible confounder . on the other hand , this study reflects the daily clinical praxis with consecutive patients over 1 year . younger age , female sex , and high number of awakenings and arousals are predictive of fatigue in sleep - disordered patients . this study proves that high mfis and fss values can occur in sleep - disordered patients .

backgroundthe fatigue severity scale ( fss ) is widely used to assess fatigue , not only in the context of multiple sclerosis - related fatigue , but also in many other medical conditions . some polysomnographic studies have shown high fss values in sleep - disordered patients without multiple sclerosis . the modified fatigue impact scale ( mfis ) has increasingly been used in order to assess fatigue , but polysomnographic data investigating sleep - disordered patients are thus far unavailable . moreover , the pathophysiological link between sleep architecture and fatigue measured with the mfis and the fss has not been previously investigated.methodsthis was a retrospective observational study ( n = 410 ) with subgroups classified according to sleep diagnosis . the statistical analysis included nonparametric correlation between questionnaire results and polysomnographic data , age and sex , and univariate and multiple logistic regression.resultsthe multiple logistic regression showed a significant relationship between fss / mfis values and younger age and female sex . moreover , there was a significant relationship between fss values and number of arousals and between mfis values and number of awakenings.conclusionyounger age , female sex , and high number of awakenings and arousals are predictive of fatigue in sleep - disordered patients . further investigations are needed to find the pathophysiological explanation for these relationships .

Introduction Methods Patients Questionnaires Polysomnography Subgroups Statistical analysis Results Demographics, polysomnographic data, and questionnaire results Nonparametric correlation Correlations between different questionnaires Correlations between patient age and questionnaires Correlation between polysomnographic data and questionnaires Univariate and multiple logistic regressions Discussion Conclusion

currently , chronic kidney disease ( ckd ) is one of the most serious public health problems . some recent epidemiological studies have suggested that approximately one million people with end stage renal disease ( esrd ) undergo replacement therapy worldwide . the increased prevalence of ckd in the developed and developing countries threatens to become a global epidemic , as exemplified by the increased number of cases of diabetes mellitus and the increased life expectancy of the population1 . ckd severely affects patients health , lifestyle and wellbeing , compromising their quality of life2 . according ponngeon et al . , ckd patients had sedentary and inactive levels of physical activity on dialysis and non - dialysis days , respectively3 . silva and marinho observed that the level of physical activity of most patients esrd undergoing hemodialysis is poor and that most do not perform exercise regularly4 . the most common comorbidities observed in patients with ckd are diabetes mellitus type 2 , dyslipidemia , coronary heart disease , heart failure5 , 6 , hypertension7 , 8 , respiratory disorders8 , 9 , stress10 , depression10,11,12 , anxiety13 , and obstructive sleep apnea ( osa)14 . osa is a major medical problem , estimated to affect up to 1530% of male adults and up to 515% of female adults15 , 16 . it is characterized by repetitive obstructions of the upper airway during sleep , frequently causing oxygen desaturation . this induces frequent awakenings ( arousals ) , resulting in fragmented sleep and excessive daytime sleepiness . in brazil , according to a recent epidemiological study conducted in so paulo , an osa prevalence of 24.8% in men and 9.6% in women was observed , based on an apnea - hypopnea index ( ahi)15 events / h ; for an ahi5 events / h , this prevalence increased to 40% in men and 26% in women17 . in a recent study involving 2,121 individuals conducted in the city of lausanne in switzerland , a prevalence of 50% in men and 23% in women was observed , based on an ahi15 events / h18 . in another study conducted by oliveira et al . , patients with neuromuscular disorders such as myasthenia gravis were observed to have a poor quality of sleep , excessive daytime sleepiness , presence of restless syndrome , and a high incidence of sleep - disordered breathing ( sdb)19 . the prevalence of sleep disorders among patients with ckd is 4080% , which is higher than that among the general population . among these sleep disorders , the presence of periodic leg movements during sleep and osa has been highlighted20 . the high prevalence ( 50% ) of sdb in patients undergoing hemodialysis ( hd ) can be attributed to compromised upper airway stability ( extracellular fluid volume overload)21,22,23 , ventilatory control instability ( altered central and peripheral chemosensitivity ) , and reduced upper airway muscle tone ( uremia)24,25,26,27,28 . risk factors of sdb in the general population , such as older age , male gender , obesity , smoking , increased neck circumference , and diabetes , are also prevalent in the ckd population29 . sdb has been associated with increased cardiovascular risk , and may contribute to the morbidity and mortality of patients with advanced ( stages 4 to 5 ) ckd or those undergoing hd30 . although numerous studies have shown that a substantial proportion of patients undergoing hd have sleep apnea , these studies were limited by the following factors : very small sample sizes27 , 31,32,33,34 ; the use of partial channel polysomnography ( psg)34,35,36 ; the study of populations with limited generalizability to patients undergoing hd37 ; a selected subpopulation of patients undergoing dialysis , without sleep symptoms38 ; or study samples that were largely composed of symptomatic patients26 , 31 , 39 . hence , a better understanding of the prevalence and risk factors of sdb in ckd patients undergoing hd is critical . therefore , a systematic review that can demonstrate the status of the knowledge is justified . this knowledge may enable health professionals , especially physiotherapists , to devise new strategies to reduce morbidity and mortality and improve the quality of life of ckd patients . the present study aimed to provide a thorough overview of the literature regarding the occurrence of sleep disorders in patients with esrd undergoing hd . two independent reviewers performed a computer - assisted search of the medline , lilacs , and scielo virtual health library medical databases from their inception to november 2015 . a combination of the following medical subject headings ( mesh ) were used in the search ( sleep or sleep disorders or obstructive sleep apnea ) and ( kidney dialysis or hemodialysis or dialysis ) . the first stage of the search identified articles according to the title , abstract , and key words . in the second stage , articles that involved patients > 18 years old , having esrd and undergoing hd , and that used overnight standard psg for the diagnosis of sleep disorders , were included in the final analysis . one thousand one hundred twenty - six articles were identified that met the inclusion criteria . a total of 796 articles were excluded because they were not in english , the patients did not undergo hd , or the studies were not cross - sectional or clinical trials . after an evaluation of the full text , 312 studies were excluded , either because psg was not performed or they were duplicated . the remaining 18 studies , comprising 8 clinical trials and 10 cross - sectional studies , were included for further examination ( fig . 1fig . the results and outcomes of all included studies are summarized in tables 1table 1.cross-sectional studies that used overnight standard polysomnography for the diagnosis of sleep disorders in chronic kidney diseaseauthor . 200136improvement of sleep apnea in patients with chronic renal failure who undergo nocturnal hemodialysispatients who underwent both conventional hd and nocturnal hd ( n=14)ahi decreased during the nocturnal hd phase.nocturnal hd corrects sa associated with chronic renal failure.sanner et al . 200230sleep - related breathing disorders impair quality of life in hemodialysis patientsesrd patients who underwent hd ( n=46)twenty - one patients had clinically significant sleep - related breathing disorders with a median ahi of 13.3 events / h.twenty - seven ( 22.7% ) of the 119 patients had sa with subjective symptoms such as daytime somnolence and snoring.parker et al . 200337daytime sleepiness in stable hemodialysis patientsesrd patients who underwent hd ( n=46)higher indices of sa and brief arousals correlated significantly with increased physiological , but not subjective , sleepiness.daytime sleepiness is common in hd patients , and may be severe despite the absence of obvious clinical risk factors.parker et al . 200333nocturnal sleep , daytime sleepiness , and quality of life in stable patients on hemodialysisesrd patients who underwent hd ( n=46)better sleep quality and less daytime sleepiness were associated with improved qol in stable hd subjects.poor nocturnal sleep and increased daytime sleepiness are associated with decreased qol in hd patients.jung et al . 200532sleep apnea , coronary artery disease , and antioxidant status in hemodialysis patientsesrd patients who underwent hd ( n=26)coronary artery calcification is associated with the severity of sa.oxygen desaturation triggered by sa is associated with severe coronary artery disease.miskowiec et al . 200638prevalence of sleep apnea syndrome in hemodialyzed patients with end stage renal diseaseesrd patients , assessed using psg , on the night before hd ( n=17 ) and on the night after hd ( n=11)seven patients presented with sa on the 2 nights during the psg.hd does not change the prevalence of osa in ckd.tada et al . 200739the predictors of central and obstructive sleep apnoea in haemodialysis patientsesrd patients who underwent hd ( n=30)forty - one patients presented with sa ; 27 had sa with symptoms such as daytime somnolence and snoring.there is a high prevalence of sa in hd patients . 201016nocturnal hypoxemia and periodic limb movement predict mortality in patients on maintenance hemodialysisesrd patients who underwent hd ( n=30)the median ahi and the plm index were 22 and 36.9 events / h , respectively.nocturnal hypoxemia and periodic limb movement during sleep were associated with an increased risk of death in patients with esrd.elias et al . 201240rostral overnight fluid shift in esrd renal disease : relationship with obstructive sleep apneaesrd patients who underwent hd ( n=26)the change in the leg fluid volume was correlated with the apnea hypopnea time and neck circumference.nocturnal rostral fluid shift is associated with the severity of osa in esrd.elias et al . 201341relationship of pharyngeal water content and jugular volume with severity of obstructive sleep apnea in renal failureesrd patients who underwent hd ( n=20)a positive correlation was found among the ahi , the internal jugular vein volume , and the upper airway mucosal water content.fluid overload increases the internal jugular vein volume and the upper airway mucosal water content , contributing to the pathogenesis of osa in esrd patients.ahi : apnea - hypopnea index ; hd : hemodialysis ; esrd : end stage renal disease ; sa : sleep apnea ; qol : quality of life ; osa : obstructive sleep apnea ; ckd : chronic kidney disease ; plm : periodic leg movementand 2table 2.clinical trials that used overnight standard polysomnography for the diagnosis of sleep disorders in chronic kidney diseaseauthor . 200542polysomnographic measures of nocturnal sleep in patients on chronic , intermittent daytime hemodialysis vs those with chronic kidney diseaseesrd patients who underwent hd ( n=16 ) and the ckd patients ( n=8)both groups had reduced total sleep time and sleep efficiency.sleep disorders of ckd patients and those receiving chronic , intermittent daytime hd may have different etiologies.lee et al . 200643a secondary analysis of racial differences in periodic leg movements in sleep and ferritin in hemodialysis patientsesrd african american patients who underwent hd ( n=36 ) ; esrd caucasian patients who underwent hd ( n=10)african american hd patients had higher ferritin and lower plm than caucasians.plm was less common in the african american population , suggesting a differential genetic vulnerability.unruh et al . 200644sleep apnea in patients on conventional thrice - weekly hemodialysis : comparison with matched controls from the sleep heart health studyesrd patients who underwent hd ( n=46 ) and the normal renal function group ( n=137)esrd patients had a higher frequency of arousals per hour and ahi , and greater percentage of the tst below an oxygen saturation of 90%.there was a strong association of hd with severe sdb and nocturnal hypoxemia independent of age , bmi , and a higher prevalence of chronic disease.beecroft et al . 200711pharyngeal narrowing in end - stage renal disease : implications for obstructive sleep apnoeaesrd patients who underwent hd ( n=44 ) and the normal renal function group ( n=41)the pharynx was narrower in patients who underwent hd than in subjects with normal renal function.a narrower upper airway can contribute to the pathogenesis of sleep apnea in dialysis - dependent patients.unruh et al . 200845subjective and objective sleep quality in patients on conventional thrice - weekly hemodialysis : comparison with matched controls from the sleep heart health studyesrd patients who underwent hd ( n=46 ) and the normal renal function group ( n=137)there was no association between psg sleep time and self - reported sleep time or between the ess and the severity of sa in the hd population.kidney failure treated with thrice - weekly hd is significantly associated with poor subjective and objective sleep quality.enomoto et al . 200846clinical characteristics of restless legs syndrome in end - stage renal failure and idiopathic rls patientsuremic rls patients ( n=15 ) and idiopathic rls patients ( n=20)the plm index was significantly higher in the uremic rls group.uremic rls appears to deteriorate faster and to become more severe than idiopathic rls.loewen et al . 200947sleep disruption in patients with sleep apnea and end - stage renal diseaseesrd patients who underwent hd ( n=12 ) and a normal renal function group ( n=18)the prevalence of rls lm - related arousals was higher in esrd patients.the co - existence of plm is an additional source of sleep disruption in patients with esrd and sa.roumelioti et al . 201148sleep - disordered breathing and excessive daytime sleepiness in chronic kidney disease and hemodialysisesrd patients who underwent hd ( n=75 ) , the ckd group ( n=89 ) , and the normal renal function group ( n=224)nocturnal hypoxemia was significantly elevated in the hd group compared with the ckd group.severe sdb and excessive daytime sleepiness are common among advanced ckd and hd patients.esrd : end - stage renal disease ; hd : hemodialysis ; ckd : chronic kidney disease ; plm : periodic leg movement ; sdb : sleep disordered breathing ; psg : overnight standard polysomnography ; ess : epworth sleepiness scale ; sa : sleep apnea ; rls : restless legs syndrome ; tst : total sleep time and are discussed below . thus , a detailed analysis of 18 articles that used overnight psg , which is considered the gold standard method for the diagnosis of sleep disorders , was conducted . flowchart of the study ahi : apnea - hypopnea index ; hd : hemodialysis ; esrd : end stage renal disease ; sa : sleep apnea ; qol : quality of life ; osa : obstructive sleep apnea ; ckd : chronic kidney disease ; plm : periodic leg movement esrd : end - stage renal disease ; hd : hemodialysis ; ckd : chronic kidney disease ; plm : periodic leg movement ; sdb : sleep disordered breathing ; psg : overnight standard polysomnography ; ess : epworth sleepiness scale ; sa : sleep apnea ; rls : restless legs syndrome ; tst : total sleep time the aim of this study was to conduct a systematic review of studies showing the presence of sleep disorders in patients with esrd undergoing hd . the presence of sleep disorders , including sdb , periodic limb movement disorder ( plmd ) and/or restless legs syndrome ( rls ) , which compromise the quality of life and increase the morbidity and mortality rates of patients with ckd , has been documented in the literature50,51,52,53 . seventy percent of esrd patients are believed to have some form of sdb26 , 39 . rls is a common and extremely distressing problem experienced by many patients undergoing hd . it is a neurological condition characterized by an irresistible urge to move the legs and occurs more frequently during inactivity and at night54 , 55 . the prevalence of rls in patients who are under treatment with hd varies across studies performed in broad geographical regions ( 6.668% ) , and recent studies using the international rls study group criteria have suggested a prevalence rate of 33% in esrd patients , which is greater than that in the general population56 . sleep fragmentation and sleep deprivation caused by rls may contribute to cardiovascular complications and infections , often with poor prognosis in patients undergoing hd . according to the literature , patients undergoing hd have a poorer quality of sleep compared to the normal population . the presence of rls and associated sleep disorders , such as daytime sleepiness , insomnia , and poor sleep quality , should be considered a problem that further impairs the quality of life of patients . studies have demonstrated that 4080% of esrd patients undergoing hd suffer from poor sleep quality associated with a poor quality of life57 , 58 . sleep disorders are usually associated with physical , behavioral , and psychological disorders that predispose to cognitive impairment , decline in social performance and interpersonal interactions , and depression59 . sdb is very common among patients with ckd , especially those undergoing hd36 , 60 . some studies have suggested osa has a prevalence of 5060% in esrd patients12 , 61 . depending on the methodology applied , approximately 5080% of ckd patients have some form of sdb26 , 39 . osa is 4 to 10 times more prevalent among ckd patients than in the general population22 , 49 . a more recent study conducted by nicholls et al . involving 254 ckd patients showed a significant increase in the occurrence of sdb ( predominantly osa ) which was related to impairment of renal function , with a prevalence of 57%62 . this study utilized only studies performed using psg , considered the gold standard for the diagnosis of sleep disorders . despite the high prevalence of sleep disorders in the ckd population , there is limited scientific research on the topic , as evidenced by only as shown by 18 studies ( 10 cross - sectional studies and 8 controlled clinical trials ) having been retrieved in this review . this is perhaps explained by the high cost of psg examination , or by a lack of knowledge about the presence of sleep disorders in ckd population . other more viable diagnostic methods , such as pulse oximetry and specific validated sleep questionnaires , could be used as screening tools for the presence of sdb , aiding in the early diagnosis and choice of appropriate treatment with non - invasive ventilatory support . esrd contributes to the emergence and/or development of osa due to factors such as metabolic acidosis , compromised sensitivity of chemoreceptors , uremic toxins , generalized muscle weakness , particularly of the dilator muscles of the pharynx , and narrowing of the upper airway due to fluid accumulation in the interdialytic period . it is known that osa induces ckd due to increased blood pressure , oxidative stress , and repetitive hypoxia . this systematic review verified the status of knowledge regarding the prevalence of sleep disorders in esrd patients undergoing hd . according to the studies analyzed , a high prevalence of plmd , rls , and osa affecting the quality of sleep was observed , which in turn undermined the quality of life of these patients , leading to increased morbidity and mortality . thus , it is very important for healthcare professionals to recognize the signs and symptoms of sleep disorders in ckd patient population , both for accurate diagnosis and an appropriate therapeutic approach . for physical therapists , it is extremely important to identify sdb , particularly osa , so they can institute treatment with continuous positive airway pressure .

the purpose of this study was to conduct a systematic review of the available evidence on sleep disorders in patients with end stage renal disease ( esrd ) undergoing hemodialysis ( hd ) . [ subjects and methods ] two independent reviewers performed a computer - assisted search of the medline , scielo , lilacs , and bireme virtual health library medical databases from their inception to november 2015 . [ results ] one thousand one hundred twenty - six articles were found that met the inclusion criteria . articles were excluded if they were not in english , the patients did not undergo hd , or the studies were not cross - sectional or clinical trials . after reading the full text , a further 300 studies were excluded because they did not use polysomnography . the remaining 18 studies with esrd patients undergoing hd comprised 8 clinical trials and 10 cross - sectional studies . this systematic review followed the criteria outlined by the prisma declaration . [ conclusion ] in this systematic review , a high prevalence of sleep disorders was observed in esrd , including sleep - disordered breathing . this knowledge may enable health professionals to devise new strategies for the diagnosis and treatment of these patients , in order to reduce morbidity and mortality and improve their quality of life .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

autosomal dominant polycystic kidney disease ( adpkd ) is an inherited disorder characterized by the development and growth of cysts in the kidneys and other organs . in adpkd patients , nephrotic range proteinuria is unusual and needs to be investigated further to exclude coexisting glomerular disease . among the anecdotal case reports of adpkd associated with nephrotic syndrome , we report the case of a 26-year - old male with adpkd and concomitant nephrotic syndrome , in which an ultrasound ( us)-guided renal biopsy showed a mesangioproliferative glomerulonephritis . we treated the patient with prednisone 1 mg / kg / day , because of the failure of treatment with angiotensin - converting enzyme inhibitor / angiotensin receptor blocker association . after 6 months of steroid treatment , we observed a stability of his gfr and a reduction of proteinuria . this case report and other cases of the literature underline the importance of a renal biopsy in patients with adpkd and nephrotic syndrome in order to make an accurate diagnosis and an appropriate treatment / prevention of renal function deterioration . autosomal dominant polycystic kidney disease ( adpkd ) , the most common heritable renal disease , with an estimated incidence of 1:800 live births , is a disorder characterized by the development and growth of cysts in the kidneys and other organs . this disease is genetically heterogeneous ; in 85% of the cases , the disease is caused by a mutation localized on chromosome 16 ( pkd1 ) and in 15% by a mutation localized on chromosome 4 ( pkd2 ) , while a few families have been identified in which the disease is caused by a mutation in an unmapped locus . however , within the two identified forms of the disease , there is a remarkable variability in clinical features . proteinuria and microalbuminuria ( ma ) also occur with a highly variable severity and are associated with a more progressive course of the disease [ 3 , 4 ] . mild proteinuria , usually < 2 g/24 h , is a common finding on routine examination in adpkd patients ; however , the association of nephrotic syndrome with adpkd is considered rare [ 4 , 5 ] and needs to be investigated further to exclude coexisting glomerular disease . among the anecdotal case reports of adpkd associated with nephrotic syndrome , we report the case of a 26-year - old male with adpkd and concomitant nephrotic syndrome , in which the renal biopsy showed a mesangioproliferative glomerulonephritis in april 2009 , a 24-year - old man was referred to our hospital with a history of adpkd . the patient 's father had a diagnosis of adpkd and the mother was affected by a membranous nephropathy . at first observation , laboratory studies showed a daily urinary protein excretion of 3.19 g , serum creatinine 106.08 mol / l ( 1.2 mg / dl ) , and egfr ( estimated glomerular filtration rate ) 84.7 ml / min/1.73 m. we thus started therapy with an angiotensin - converting enzyme inhibitor ( acei ) , ramipril 5 mg / day . after 6 months , his proteinuria decreased to 1.13 g / day , so we added an angiotensin receptor blocker ( arb ) , losartan potassium 50 mg / day . his proteinuria remained about 1.82 g / day until the end of 2010 . in july 2011 , urine analysis showed a daily protein excretion of 7.4 g and 15 red blood cells per high power field ; the patient had neither peripheral leg oedema nor other symptoms ; urine culture was sterile ; tests for hbsag and hcvab and anti - nuclear antibodies were negative ; igg , iga , igm , c3 , c4 were normal ; there were no monoclonal bands on immunoelectrophoresis of the serum and no monoclonal light chains were detected in the urine . an abdomen ultrasound ( us ) analysis showed the right kidney measuring 11.4 cm in length with multiple cysts ranging in diameter from 1.6 to 3.2 cm , and the left kidney measuring 13.4 cm in length with multiple cysts . due to the persistent presence of nephrotic - range proteinuria , a us - guided biopsy was performed , the diagnosis of which was mesangioproliferative glomerulonephritis . because of the failure of treatment with acei / arb association , we added prednisone to the antiproteinuric agents at the initial dose of 1 mg / kg / day . after 6 months of steroid treatment , we observed an egfr stability , a gradual reduction of proteinuria until 2 g/24 h and an increase of the serum albumin . proteinuria and ma occur with a highly variable severity in adpkd patients and proteinuria is usually < 2 g/24 h. the frequency of occurrence of proteinuria in adpkd ranges from 14 to 34% in non - uraemic adults to 80% in adults with advanced renal failure , even if a high prevalence of ma was found in normotensive adults and children with adpkd [ 7 , 8 ] . chapman et al . have demonstrated that both overt proteinuria and ma in adpkd patients were associated with a higher mean arterial pressure , lower gfr , larger renal volume , worse renal prognosis and with an increased cardiovascular morbidity . the association of nephrotic syndrome with adpkd is considered rare [ 4 , 5 ] and , when possible , should be investigated by histological studies to exclude the possibility of a superimposed glomerular disease . in 1957 , dalgaard described three instances of nephrotic range proteinuria ( > 5 g / day ) in a report of 122 cases with adpkd ; but renal biopsy data are not available in these series . subsequently , four other adpkd patients with nephrotic syndrome were described without histopatologic diagnosis [ 1113 ] . in 1972 , kida et al . reported the first case of adpkd with nephrotic syndrome due to biopsy - proven minimal change nephrotic syndrome . in 1995 , contreras et al . reviewed 14 cases of adpkd in which the renal lesions had been evaluated by histopathological studies . in 2006 , hiura et al . expanded contreras review adding seven more japanese cases our review of the literature reveals that since 1972 to the present there have been only 29 cases ( including this report ) of adpkd , associated with nephrotic syndrome , in which the renal lesions were evaluated by histopathological studies ( table 1 ) ; but it is reasonable to assume that many other similar cases were not investigated or published . this may be due in part to the reluctance of nephrologists to perform an open renal biopsy in adpkd patients and in part to the real risk and complexity of percutaneous renal biopsy in these patients . since the presence of multiple bilateral cysts has been listed as relative contraindication to percutaneous renal biopsy , due to the presumed risk of complications and difficulties in obtaining suitable tissue for diagnosis , a majority of adpkd patients received an open surgical biopsy . in fact , of the 26 patients whose methodological data were available , only 5 ( including our patient ) received a percutaneous renal biopsy , 1 patient received a computerized tomography ( ct)-guided renal biopsy , in 1 patient the diagnosis of amyloidosis was supposed on the basis of a gingival and intestinal biopsy . table 1.renal histology in patients with adpkd and nephrotic range proteinuriafirst authoragesexrenal biopsyrenal histopathologycontreras et al . 51momes - pgnvisciano ( this report)26mpmes - pgnp , percutaneus biopsy ; o , open surgical biopsy ; ct , computed tomography - guided biopsy ; gr , gingival rectum biopsy ; fsgs , focal segmental glomerulosclerosis ; mcd , minimal change disease ; mn , membranous nephropathy ; igan , iga nephropathy ; cregn , crescentic glomerulonephritis ; idgs , intercapillary diabetic glomerulosclerosis ; mpgn i , membranoproliferative glomerulonephritis type i ; post - inf gn , post infectious mesangial proliferative glomerulonephritis ; mln , membrabous lupus glomerulonephritis ; d - pgn , diffuse proliferative glomerulonephritis ; mespgn , mesangial proliferative glomerulonephritis . renal histology in patients with adpkd and nephrotic range proteinuria p , percutaneus biopsy ; o , open surgical biopsy ; ct , computed tomography - guided biopsy ; gr , gingival rectum biopsy ; fsgs , focal segmental glomerulosclerosis ; mcd , minimal change disease ; mn , membranous nephropathy ; igan , iga nephropathy ; cregn , crescentic glomerulonephritis ; idgs , intercapillary diabetic glomerulosclerosis ; mpgn i , membranoproliferative glomerulonephritis type i ; post - inf gn , post infectious mesangial proliferative glomerulonephritis ; mln , membrabous lupus glomerulonephritis ; d - pgn , diffuse proliferative glomerulonephritis ; mespgn , mesangial proliferative glomerulonephritis . of the 29 cases evaluated by biopsy procedures , focal segmental glomerulosclerosis ( fsgs ) [ 6 , 1720 ] ( 6 patients ) , minimal change nephropathy [ 14 , 2124 ] ( 5 patients ) and membranous nephropathy [ 2529 ] ( 5 patients ) were the dominant diagnoses . next were non - iga mesangial proliferative glomerulonephritis [ 30 , 31 ] , ( with three patients including ours ) , iga nephropathy [ 15 , 32 ] ( with two patients ) and amyloidosis [ 16 , 33 ] ( with two patients ) . other types of glomerulonephritis diagnosed were crescentic glomerulonephritis , diabetic nephropathy , membranoproliferative glomerulonephritis , membranous lupus glomerulonephritis , diffuse proliferative glomerulonephritis and postinfectious mesangial proliferative glomerulonephritis ( each with one patient ) . of the 27 patients whose data were available , 18 were male and 9 were female and only 1 female had a diagnosis of focal segmental glomerulosclerosis ; the mean age was 44 16 years ( 40 15 years for male and 53 15 years for female ) . it is difficult to be certain whether these associations are coincidental or whether they demonstrate a specific pathogenetic relationship with adpkd . the frequency of focal segmental glomerulosclerosis ( 6/29 , 20% ) is higher than the 15% frequency of focal segmental glomerulosclerosis found in the general adult population . in contrast , membranous nephropathy , the most common cause of idiopathic nephrotic syndrome in adults , with a frequency of 25% , was found in 17% ( 5/29 ) of the adpkd patients with nephrotic syndrome , which suggests that fsgs may be more than a coincidental finding and glomerular hyperfiltration could play an important role in the development of fsgs and heavy proteinuria in patients with adpkd . moreover , the coincidence of adpkd and fsgs can be caused by two independent concurrent genetic mutations which are not necessarily related or one single mutation , which is unknown yet . it is possible that different mutations in these patients could clarify the nature of this coincidence . however , in a histological study of kidneys of 12 adpkd patients without nephrotic syndrome , montoyo et al . reported that interstitial fibrosis and tubular atrophy were found to be the main determinants of the development of chronic renal failure in adpkd . in a study of 18 cases , zeir et al . reported interstitial fibrosis and arteriolar sclerosis to be the most important lesions in the kidney of adpkd patients , whereas fsgs was observed in < 5% of the glomeruli . interestingly , in our patient , the severe increase of proteinuria after about 2 years of acei / arb association and the peculiar family history ( father with a diagnosis of adpkd and mother affected by membranous nephropathy ) induced us to perform a us - guided biopsy . we chose the percutaneous biopsy because the lower pole of the left kidney of our patient still had a good representation of the renal parenchyma . although the treatment of mesangioproliferative glomerulonephritis is not well defined , we decided to use corticosteroids for our patient with a good clinical response . in addition to our report , there are two other cases of mesangioproliferative glomerulonephritis in adpkd patients in the literature . in the first one , the data are not available , and in the second one , seyrek et al . described a case of a 56-year - old woman with flank pain , haematuria , proteinuria ( 0.5 g / day ) and normal renal function , in which a kidney biopsy revealed the presence of mesangioproliferative glomerulonephritis . the patient received prednisone 0.5 mg / kg / day and her haematuria and proteinuria improved and during the following years , urinary sediments occasionally showed microscopic haematuria . at the time of kidney biopsy , five years later , a ct diagnosed adpkd , showing two kidneys and the pancreas occupied by numerous cysts ; moreover , the family history revealed that her sister was a haemodialysis patient . of the patients with follow - up information , six were on dialysis therapy from 3 months to 6 years after the nephrotic syndrome was discovered ; six patients presented a reduction of the proteinuria and a stability or an improvement of the renal function after steroid and/or cytotoxic therapy in a follow - up from 2 months to 5 years ; one patient had reduced proteinuria and normalized renal function after salt restriction and antihypertensive medications ( losartan potassium and amlopdipine ) ; two patients showed worsened renal function . this evidence supports the need for performing a renal biopsy in patients with adpkd and nephrotic syndrome . a kidney biopsy is an invasive examination procedure , and should only be indicated on an individual basis , depending on the patient 's characteristics and after careful consideration of the risks and benefits for each particular case , such as the case of an adpkd patient with a nephrotic syndrome . with the use of real - time ultrasonography for guiding the biopsy procedure and the use of automatic biopsy needles , the success rate has improved in 95% of cases . a ct - guided percutaneous renal biopsy is an alternative when the kidneys can not be properly visualized . alternative methods have been attempted for obtaining samples of kidney tissue in patients with contraindications for the percutaneous approach . although open or surgical renal biopsies have been performed for over 40 years as a standard procedure in patients with contraindications for the percutaneous approach , there are other less invasive alternatives . recently , a technique has been proposed which combines the laparoscopic approach with a percutaneous needle biopsy . however , a kidney biopsy allows an accurate diagnosis and an appropriate treatment / prevention of renal function deterioration . the treatment for various histopathological subtypes leading to nephrotic syndrome is different , with corticosteroids beneficial in some conditions and useless in other cases . reaching a firm diagnosis based on histopathology and immunofluorescence studies will help the physician to give an appropriate treatment and to avoid empirical therapy with potentially toxic agents . the enlargement of cysts by compressing normal parenchyma is a central factor in the pathogenesis of chronic renal failure in this disorder . at present , it is impossible to assess the potential benefit of measures leading to a decrease in proteinuria in the progression of adpkd toward end - stage renal disease . the data related to follow - up of the adpkd patients treated with immunosuppressive therapy are too few to evaluate if steroid or other cytotoxic agents may influence the course of the adpkd and if the progression of this disease may depend on the histological subtype of associated glomerulonephritis .

backgroundautosomal dominant polycystic kidney disease ( adpkd ) is an inherited disorder characterized by the development and growth of cysts in the kidneys and other organs . in adpkd patients , nephrotic range proteinuria is unusual and needs to be investigated further to exclude coexisting glomerular disease . among the anecdotal case reports of adpkd associated with nephrotic syndrome , focal segmental glomerulosclerosis occurs most frequently.methodswe report the case of a 26-year - old male with adpkd and concomitant nephrotic syndrome , in which an ultrasound ( us)-guided renal biopsy showed a mesangioproliferative glomerulonephritis . we treated the patient with prednisone 1 mg / kg / day , because of the failure of treatment with angiotensin - converting enzyme inhibitor / angiotensin receptor blocker association.resultsafter 6 months of steroid treatment , we observed a stability of his gfr and a reduction of proteinuria.conclusionthis case report and other cases of the literature underline the importance of a renal biopsy in patients with adpkd and nephrotic syndrome in order to make an accurate diagnosis and an appropriate treatment / prevention of renal function deterioration .

Background Methods Results Conclusion Introduction Case report Discussion

it consists of a pair of cylindrically shaped centrioles surrounded by fibrous pericentriolar material . before or during dna replication in s phase , the centrioles split , and each cylinder serves as a template for the assembly of a new daughter centriole . before mitosis , when cells contain two pairs of centrioles , each pair serves as a nucleation center for microtubules of the spindle apparatus . defects in centrosome assembly or in centrosome separation can result in defective nucleation of spindle microtubules , and in several cases , in the formation of monopolar spindles and mitotic arrest ( sunkel et al . several years ago , evidence was published that defective centrosome assembly can prevent cells from entering s phase . in particular , removal of the centrosome by microsurgery or by laser ablation resulted in a cell cycle arrest , as did inhibition or silencing of several centrosome - associated proteins , such as dynactin , parp-3 , centriolin , or akap450 ( hinchcliffe et al . , 2001 ; khodjakov and rieder , 2001 ; quintyne and schroer , 2002 ; augustin et al . , 2003 ; gromley et al . , 2003 ; keryer et al the mechanism leading to this centrosome - dependent cell cycle arrest in g1 phase has been unclear ; it was proposed that a checkpoint control would prevent those cells with imperfect centrosomes from continuing the cell cycle , to prevent the assembly of defective spindles later in mitosis ( murray , 2001 ) . in this study , we followed cell cycle progress after inhibition of centrosome assembly by depleting the pericentriolar proteins pericentriolar material 1 ( pcm-1 ) and pericentrin . these proteins have been shown to be necessary for the assembly of other centrosomal constituents ( dictenberg et al . , 1998 ; dammermann and merdes , 2002 ; kubo and tsukita , 2003 ) . we found that depletion of pcm-1 or pericentrin activates the p38-dependent stress pathway and the p53-dependent cell cycle checkpoint . we have previously shown that depletion of the protein pcm-1 leads to defects in the assembly of the centrosomal components centrin , ninein , and pericentrin , and to an altered organization of the microtubule network in interphase cells ( dammermann and merdes , 2002 ) . to investigate the consequences of pcm-1 depletion on the cell cycle , we performed rna silencing experiments in primary human fibroblasts , mrc-5 . depleted cells were tested for incorporation of brdu into the nucleus , as an indicator of dna synthesis ( fig . we determined that in pcm-1depleted cells only 15 4% incorporated brdu , as compared with 35 3% in controls , as expected for a normal cycling population ( fig . this is consistent with previous reports on microinjection of pcm-1inhibiting antibodies ( balczon et al . , 2002 ) and on centrosome removal by microsurgery or laser ablation , which prevent cells from entering s phase ( hinchcliffe et al . several years ago , experiments on cells treated with the microtubule drugs colcemid , nocodazole , and taxol indicated that untransformed cells are arrested in g1 phase , when microtubules are depolymerized or when microtubule dynamics are altered ( trielli et al . , 1996 ; di leonardo et al . , 1997 this raises the question of whether dna replication in pcm-1depleted cells is inhibited because of an altered microtubule network , or whether defects at the centrosome itself suffice to induce a cell cycle arrest . 1 a ) , which in contrast to pcm-1 , only slightly reduces microtubule density but seems to have no significant effect on microtubule anchoring at the centrosome ( dammermann and merdes , 2002 ) . consistently , ( a ) immunofluorescence of mrc-5 fibroblasts treated with control rna or sirna against pcm-1 and pericentrin , respectively . graphs depict the percentages of cells lacking pcm-1 or pericentrin expression after treatment with control or silencing rnas . cells were scored as negative if they lacked centrosomal staining of pcm-1 or pericentrin , only displaying diffuse background fluorescence . ( b ) percentages of cells incorporating brdu after treatment with control rna or silencing rna against pcm-1 or pericentrin . data were obtained from cell cultures that were double labeled for brdu and pcm-1 or pericentrin . among cell cultures treated with silencing rna , only cells that were visibly depleted of pcm-1 or pericentrin were scored . ( a ) immunoblots of mrc-5 cells treated with control rna or sirna against pcm-1 , prb , or both pcm-1 and prb simultaneously . blots were probed with antibodies against pcm-1 , cyclin a , the licensing factor mcm3 , the dna replication factor pcna , prb , and -tubulin . ( b ) immunoblots of cells treated with control rna or sirnas against pcm-1 , pericentrin , or both simultaneously . ( c ) mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 and prb simultaneously . the percentages of cells staining positively for the proliferation marker ki-67 or for incorporated brdu are shown . ( d ) flow - cytometric analysis of mrc-5 cells treated with control rna or sirna against pcm-1 . ( e ) immunoblots of mrc-5 cells treated with control rna or sirna against pcm-1 for 48 or 120 h or with sirna against pericentrin for 72 h. blots were probed with antibodies against p53 , -tubulin , or p21 . because these data indicated that cells failed to undergo s phase dependent dna replication when missing the full complement of centrosome proteins , we wanted to test in more detail at what stage cells are arrested . immunoblotting of cell extracts of pcm-1depleted cultures indicated drastic reduction of cyclin a ( fig . 2 a ) , which is normally found expressed in cells during late g1 , s , and g2 phases . furthermore , we detected that pcm-1depleted cells also showed reduced amounts of the proteins minichromosome maintenance deficient 3 ( mcm3 ) and proliferating cell nuclear antigen ( pcna ) acting in licensing and dna replication ( fig . 2 a ) and reduced percentages of cells expressing the cell proliferation marker ki-67 ( fig . altogether , these data indicated that depletion of centrosome proteins reduces the number of cells entering s phase . we verified this hypothesis by comparing profiles of cell cultures analyzed by flow cytometry ( fig . 2 d ) : consistent with our data on brdu incorporation we then wanted to determine whether s phase entry was blocked because of checkpoint activation in cells depleted of pcm-1 or pericentrin . we found that the overall levels of the retinoblastoma protein ( prb ) were reduced to 38 17% and that most of the remaining prb , normally hyperphosphorylated during late g1 and s phase , was present in its faster migrating , hypophosphorylated form ( 77 13% in depleted vs. 38 13% in control cells ; fig . however , was found up - regulated , especially after prolonged depletion of pcm-1 or pericentrin ( fig . in depleted cells , the cdk2 inhibitor p21 was found equally up - regulated ( fig . these data suggested that depletion of the two centrosome - associated proteins pcm-1 and pericentrin leads to the activation of the p53-dependent checkpoint . in the next step , we wanted to determine whether cell cycle progress would be affected if the p53-dependent checkpoint control was abrogated for this purpose , we attempted simultaneous depletion of p53 and pcm-1 by cotransfecting sirna oligomers against both . 3 a shows that p53 levels could not be reduced when pcm-1 was missing . we tried to refine this experiment by sequential depletion of mrc-5 cells , by first depleting > 90% of p53 after 72 h , followed by simultaneous sirna treatment against p53 and pcm-1 . however , we observed that under these conditions , p53 levels increased back to 4050% in three different experiments ( unpublished data ) . we concluded that p53 turnover is altered and that the residual p53 protein might be stabilized in the absence of an intact centrosome . we therefore changed our experimental strategy and compared cell cycle progress after pcm-1 depletion in several cell lines lacking p53 . we used mouse embryonic fibroblasts from p53 knockout mice ( unpublished data ) as well as the human lung carcinoma cell line h1299 . because of the loss of p53 checkpoint control , both lines displayed a relatively high basic rate of dna synthesis ( fig . we found that in both p53/ cell lines , pcm-1 depletion did not inhibit cell cycle progress . , we also tested the effect of pcm-1 depletion in the p53+/+ and p53/ lines of hct116 cells . brdu incorporation in these was reduced from 42% in controls to 33% in partially depleted p53 + cells , whereas p53 cells showed brdu incorporation in 49% after partial pcm-1 depletion . consistently , hela cells with functionally suppressed p53 checkpoint control do not arrest in the absence of centrosomes ( la terra et al . , in contrast to p53 , the removal of prb did not cause resumption of the cell cycle in pcm-1depleted mrc-5 cells , because the percentages of brdu - incorporating cells and ki-67expressing cells remained low , as did the expression of mcm3 protein ( fig . on the other hand , the amounts of cyclin a and pcna were restored to nearly control levels . a possible scenario would be that centrosome defects activate both prb and p53 in parallel , with p53 having feedback effects on prb phosphorylation and prb protein levels but not vice versa . this would be consistent with our observation that prb levels drop after pcm-1 or pericentrin depletion and that depletion of prb itself does not fully restore s phase activity , which is probably blocked because of checkpoint control mechanisms directly dependent on p53 . eventually , loss of prb might be compensated by rb - related pocket proteins , such as p107 or p130 . cell cycle arrest after pcm-1 depletion depends on the checkpoint protein p53 . ( a ) immunoblots of mrc-5 cells treated with control rna or sirnas against pcm-1 , p53 , or both pcm-1 and p53 combined . ( b ) graph depicts brdu incorporation in p53/ h1299 cells treated with control rna or sirna against pcm-1 . ( c ) immunoblots of h1299 and mrc-5 cells treated with control rna or sirna against pcm-1 ( pcm1d ) for 72 h. blots were probed with antibodies against pcm-1 , p53 , pcna , mcm3 , prb , or -tubulin . finally , we addressed the question of how defects in centrosome assembly could activate the p53-dependent checkpoint . it has been reported that p38 mapk is involved in the cell 's response to a range of stress factors , such as uv irradiation , osmotic shock , heat shock , starvation , and cytokine treatment ( zarubin and han , 2005 ) . the response to these stress factors is mediated partly through p53 phosphorylation , which is believed to stabilize p53 and to increase the expression of the cdk inhibitor p21 , thereby blocking the cell cycle ( agarwal et al . , 1998 ) . to assess the involvement of stress - activated p38 mapk in response to centrosome defects , we have treated pcm - depleted mrc-5 cells with the p38 mapk specific inhibitor sb203580 . we found that the inhibitor prevented cell cycle arrest , as indicated by resumption of dna synthesis ( fig . p38 inhibition in pcm-1depleted cells also restored regular levels of cyclin a and hyperphosphorylated prb , as well as expression of ki-67 and mcm3 ( fig . further , the inhibition of p38 led to decreased levels of p21 but only slightly decreased p53 ( fig . this could be explained by a stabilization of p53 after centrosome inactivation , as discussed in the previous paragraph , which might occur independently of p38-dependent p53 activation . alternatively , the centrosome - dependent cell cycle arrest might not simply be a linear consequence of p53 activation via p38 . for example , p53 might be activated by other kinases in addition to p38 . moreover , although p38 has been shown in multiple experiments to mediate cell cycle arrest by phosphorylating various sites of p53 ( bulavin et al . , 1999 ; huang et al . , 1999 ) , p38 is also known to phosphorylate and thereby inactivate cdc25a and cyclin d , which in turn arrests the cell cycle ( lavoie et al . , 1996 ; casanovas et al . , 2000 however , p38 mapk activation in the absence of p53 seems to be insufficient for centrosome - dependent cell cycle arrest because pcm-1 depletion in p53/ cells did not stop the cell cycle . ( a ) immunoblots of mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 together with the p38 inhibitor sb203580 ( pcm-1 + inh ) . blots were probed with antibodies against prb , cyclin a ( cyc a ) , p53 , the cdk inhibitor p21 , active p38 , or -tubulin . ( b ) graphs depicting mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 together with the p38 inhibitor sb203580 ( pcm-1 + inh ) . the staining of brdu incorporation ( after rna treatment for 72 or 96 h ) , ki-67 immunofluorescence ( after rna treatment for 96 h ) , or mcm3 immunofluorescence ( after rna treatment for 72 h ) is shown . in our pcm-1depletion experiments , we observed a significant decrease in the expression of proteins associated with cell proliferation , such as mcm3 , pcna , or ki67 . however , because about half of the depleted cells were still entering s phase , we wanted to test whether centrosome defects only slowed down cell cycle activity , or whether depleted cells were predisposed to a stable arrest that did not affect all cells simultaneously . immunofluorescence of p53 after pcm-1 depletion revealed that p53 levels varied between individual cells , with some cells showing a very high increase but a small increase or no obvious response in others ( fig . 5 a ) . we then tested whether the cells ' response to centrosome inhibition induces exit from the cell cycle via senescence . senescence is marked by the acquisition of a permanent g0 state and an increase of cellular -galactosidase activity ( dimri et al . , 1995 ) . a cytochemical analysis of pcm-1depleted cultures revealed a 10-fold increase of -galactosidase positive cells ( fig . 5 b ) , compared with a basal level of 3% in controls . consistently , we previously reported that cultures of u2os cells died after silencing of pcm-1 for long periods ( dammermann and merdes , 2002 ) , although the experimental conditions varied from the protocol used here . senescence has been characterized as a cellular program activated as a result of physiological stresses preventing further cell proliferation ( ben - porath and weinberg , 2004 ) . instead of a specific centrosome - dependent cell cycle control as proposed by murray ( 2001 ) , the idea of the centrosome as a center for stress - related signaling seems plausible , considering its central location in the focus of the microtubule network and its ability to bind various molecules of signaling pathways and of cell cycle regulation . for example , significant amounts of protein kinase a , polo - like kinase , and protein phosphatases 1 and 2a , as well as cyclin e and p53 , have all been localized to the centrosome ( fry et al . , 2000 ; morris et al . , 2000 ; is mediated by large coiled - coil proteins such as pericentrin , akap450 , or akap220 ( diviani et al . , 2000 ; reinton et al . , 2000 ; diviani and scott , 2001 ) . absence or inhibition of anchoring proteins could therefore disrupt cellular signaling pathways and elicit a stress response . further research will be necessary to investigate the multiple interactions between centrosome proteins , cell signaling , and the complex regulation of the cell cycle . ( a ) fibroblasts treated with control and pcm-1 sirna , stained for pcm-1 ( red ) , dna ( blue ) , and p53 ( green ) . ( b ) -galactosidase assay on control and pcm-1depleted cells 96 h after transfection using 5-bromo-4-chloro-3-indolyl -d - galactopyranoside as a chromogenic substrate . human fetal lung fibroblasts mrc-5 ( european collection of cell cultures ) and h1299 cells ( a gift from b. vojtesek , masaryk memorial cancer institute , brno , czech republic ) were cultured in dme ( invitrogen ) , supplemented with 10% fetal bovine serum ( perbio science ) , 2 mm l - glutamine , and antibiotics . hct116 cells ( a gift from b. vogelstein , johns hopkins university , baltimore , md ) were cultured in mccoy 's medium containing the same supplements . about 3 10 cells from early passages of mrc-5 and 0.5 10 cells of h1299 or hct116 were transfected with 9 or 18 g of sirna oligonucleotides , respectively , in a nucleofector electroporation device , using the appropriate transfection kit ( amaxa ) . the cells were then plated onto two 10-cm petri dishes to obtain a confluency of 3040% on the next day . routinely , sirna treatment was for a total of 72 h before fixation or preparation of cell extracts , unless indicated otherwise . p38 mapk inhibition was performed in cells that were transfected with oligos and cultured overnight before the specific inhibitor sb203580 ( calbiochem ) was added at a concentration of 10 m . inhibitor - treated cells were left in culture for another 48 h and then fixed in methanol or extracted for sds - page . cells were harvested using trypsin - edta , counted , and washed in ice - cold pbs . amounts of extract equal to 200,000 cells were loaded and run on 7.5 , 10 , or 12.5% sds - page gels and blotted onto nitrocellulose . the following antibodies were used for western blot analysis or immunofluorescence : affinity - purified rabbit anti pcm-1 ( dammermann and merdes , 2002 ) , anti - mcm3 mab clone 3a2 ( mbl international corporation ) , anti - prb mab clone 4h1 ( cell signaling ) , anti - pcna mab clone pc-10 ( sigma - aldrich ) , anti cyclin e mab clone he12 ( zymed laboratories ) , anti cyclin a mab clone cy - a1 ( sigma - aldrich ) , anti p53 mab clone do-1 ( novocastra ) , anti - p21 mab clone sx118 ( bd biosciences ) , rabbit anti - activep38mapk polyclonal antibody ( promega ) , anti-tubulin mab clone dm1a ( sigma - aldrich ) , goat anti rabbit igg polyclonal antibody hrp ( ge healthcare ) , rat anti - brdu mab ( harlan ) , anti ki-67 mab clone mm1 ( novocastra ) , rabbit anti - pericentrin polyclonal antibody ( covance ) , donkey anti rabbit or anti mouse igg conjugated with alexa 488 or alexa 594 ( invitrogen ) . quantification of protein levels was performed by scanning immunoblots and analyzed using the photoshop ( adobe ) histogram tool . quantification of cells expressing specific proteins was performed by counting sirna - treated cells that were double stained with pcm-1 antibodies to verify depletion . the following sirna oligomers with dtdt overhangs ( qiagen ) were used : pcm-1.2 , corresponding to human pcm-1 ( ucagcuucgugauucucag ) ; peric , corresponding to human pericentrin ( gcagcugagcugaaggaga ; dammermann and merdes , 2002 ) ; prb ( gcccuuacaaguuuccuag ) ; and p53 ( cuacuuccugaaaacaacg ) . all cells in a culture dish were harvested by trypsinization , washed in ice - cold pbs , and fixed in 80% ice - cold ethanol in pbs . before staining , the cells were spun down in a cooled centrifuge and resuspended in the cold . bovine pancreatic rnase ( sigma - aldrich ) was added at a final concentration of 2 g / ml , and cells were incubated at 37c for 30 min , followed by an incubation in 20 g / ml of propidium iodide ( sigma - aldrich ) for 20 min at room temperature . cells grown on coverslips were fixed in ice - cold methanol and stored at 20c until use . antibody staining was performed using the reagents listed in the previous paragraphs , according to standard protocols . the percentage of cells in s phase was assessed by adding 100 m brdu ( sigma - aldrich ) to the cultures 30 min before fixation . double labeling of brdu and pcm-1 was performed by probing first for pcm-1 , using rabbit anti pcm-1 and fluorescent anti - rabbit antibody , and coverslips were postfixed in pbs containing 3.7% paraformaldehyde , treated with 2 m hcl for 30 min , and stained with rat anti - brdu and fluorescent secondary anti - rat antibody . cells were viewed with a fluorescence microscope ( axioskop 2 ; carl zeiss microimaging , inc . ) equipped with a camera ( axiocam ; carl zeiss microimaging , inc . ) and software ( axiovision ; carl zeiss microimaging , inc . ) . human fetal lung fibroblasts mrc-5 ( european collection of cell cultures ) and h1299 cells ( a gift from b. vojtesek , masaryk memorial cancer institute , brno , czech republic ) were cultured in dme ( invitrogen ) , supplemented with 10% fetal bovine serum ( perbio science ) , 2 mm l - glutamine , and antibiotics . hct116 cells ( a gift from b. vogelstein , johns hopkins university , baltimore , md ) were cultured in mccoy 's medium containing the same supplements . about 3 10 cells from early passages of mrc-5 and 0.5 10 cells of h1299 or hct116 were transfected with 9 or 18 g of sirna oligonucleotides , respectively , in a nucleofector electroporation device , using the appropriate transfection kit ( amaxa ) . the cells were then plated onto two 10-cm petri dishes to obtain a confluency of 3040% on the next day . routinely , sirna treatment was for a total of 72 h before fixation or preparation of cell extracts , unless indicated otherwise . p38 mapk inhibition was performed in cells that were transfected with oligos and cultured overnight before the specific inhibitor sb203580 ( calbiochem ) was added at a concentration of 10 m . inhibitor - treated cells were left in culture for another 48 h and then fixed in methanol or extracted for sds - page . cells were harvested using trypsin - edta , counted , and washed in ice - cold pbs . amounts of extract equal to 200,000 cells were loaded and run on 7.5 , 10 , or 12.5% sds - page gels and blotted onto nitrocellulose . the following antibodies were used for western blot analysis or immunofluorescence : affinity - purified rabbit anti pcm-1 ( dammermann and merdes , 2002 ) , anti - mcm3 mab clone 3a2 ( mbl international corporation ) , anti - prb mab clone 4h1 ( cell signaling ) , anti - pcna mab clone pc-10 ( sigma - aldrich ) , anti cyclin e mab clone he12 ( zymed laboratories ) , anti cyclin a mab clone cy - a1 ( sigma - aldrich ) , anti p53 mab clone do-1 ( novocastra ) , anti - p21 mab clone sx118 ( bd biosciences ) , rabbit anti - activep38mapk polyclonal antibody ( promega ) , anti-tubulin mab clone dm1a ( sigma - aldrich ) , goat anti mouse polyclonal antibody hrp ( promega ) , donkey anti rabbit igg polyclonal antibody hrp ( ge healthcare ) , rat anti - brdu mab ( harlan ) , anti ki-67 mab clone mm1 ( novocastra ) , rabbit anti - pericentrin polyclonal antibody ( covance ) , donkey anti rabbit or anti mouse igg conjugated with alexa 488 or alexa 594 ( invitrogen ) . quantification of protein levels was performed by scanning immunoblots and analyzed using the photoshop ( adobe ) histogram tool . quantification of cells expressing specific proteins was performed by counting sirna - treated cells that were double stained with pcm-1 antibodies to verify depletion . the following sirna oligomers with dtdt overhangs ( qiagen ) were used : pcm-1.2 , corresponding to human pcm-1 ( ucagcuucgugauucucag ) ; peric , corresponding to human pericentrin ( gcagcugagcugaaggaga ; dammermann and merdes , 2002 ) ; prb ( gcccuuacaaguuuccuag ) ; and p53 ( cuacuuccugaaaacaacg ) . all cells in a culture dish were harvested by trypsinization , washed in ice - cold pbs , and fixed in 80% ice - cold ethanol in pbs . before staining , the cells were spun down in a cooled centrifuge and resuspended in the cold . bovine pancreatic rnase ( sigma - aldrich ) was added at a final concentration of 2 g / ml , and cells were incubated at 37c for 30 min , followed by an incubation in 20 g / ml of propidium iodide ( sigma - aldrich ) for 20 min at room temperature . cells grown on coverslips were fixed in ice - cold methanol and stored at 20c until use . antibody staining was performed using the reagents listed in the previous paragraphs , according to standard protocols . the percentage of cells in s phase was assessed by adding 100 m brdu ( sigma - aldrich ) to the cultures 30 min before fixation . double labeling of brdu and pcm-1 was performed by probing first for pcm-1 , using rabbit anti pcm-1 and fluorescent anti - rabbit antibody , and coverslips were postfixed in pbs containing 3.7% paraformaldehyde , treated with 2 m hcl for 30 min , and stained with rat anti - brdu and fluorescent secondary anti - rat antibody . cells were viewed with a fluorescence microscope ( axioskop 2 ; carl zeiss microimaging , inc . ) equipped with a camera ( axiocam ; carl zeiss microimaging , inc . ) and software ( axiovision ; carl zeiss microimaging , inc . ) .

previous evidence has indicated that an intact centrosome is essential for cell cycle progress and that elimination of the centrosome or depletion of individual centrosome proteins prevents the entry into s phase . to investigate the molecular mechanisms of centrosome - dependent cell cycle progress , we performed rna silencing experiments of two centrosome - associated proteins , pericentriolar material 1 ( pcm-1 ) and pericentrin , in primary human fibroblasts . we found that cells depleted of pcm-1 or pericentrin show lower levels of markers for s phase and cell proliferation , including cyclin a , ki-67 , proliferating cell nuclear antigen , minichromosome maintenance deficient 3 , and phosphorylated retinoblastoma protein . also , the percentage of cells undergoing dna replication was reduced by > 50% . at the same time , levels of p53 and p21 increased in these cells , and cells were predisposed to undergo senescence . conversely , depletion of centrosome proteins in cells lacking p53 did not cause any cell cycle arrest . inhibition of p38 mitogen - activated protein kinase rescued cell cycle activity after centrosome protein depletion , indicating that p53 is activated by the p38 stress pathway .

Introduction Results and discussion Materials and methods Cell culture and transfection experiments Antibodies and siRNA oligonucleotides Flow cytometry analysis -Galactosidase assay Immunofluorescence microscopy

a male neonate born to g2 p1l1 mother at term by spontaneous vaginal delivery to iii degree consanguineous marriage was found to have proximal shortening of both upper and lower limbs [ figure 1 ] . the antenatal period was uneventful and antenatal ultrasound was reportedly not done during pregnancy and the mother was referred to our hospital after the onset of labor . apart from rhizomelic shortening , the neonate also had coronal clefts of thoracic vertebrae and stippled epiphysis of femur tibia and humerus on skeletal survey radiograph [ figure 2 ] . based on the above features a provisional diagnosis of rhizomelic chondro - dysplasia punctata ( rcdp ) was made and the prognosis was explained to the parents . the baby developed progressively severe respiratory distress and was discharged at request on day 3 of life as the parents were unable to come to terms with the diagnosis . rhizomelic shortening of upper limb punctate calcification and epiphyseal abnormalities chondrodysplasia punctata is a radiological diagnosis characterized by punctate or stippled calcifications in epiphyseal cartilage and seen in peroxisomal disorders such as zellweger syndrome , neonatal adrenoleukodystrophy , and infantile refsum disease . it may also be inherited as x - linked dominant , x - linked recessive , and autosomal recessive forms . it is classically associated with pex7 gene ( peroxin family of genes ) mutation and has been reported in indian patients too . rcdp is characterized by proximal shortening of the humerus and to a lesser degree the femur , punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities , radiolucent defects ( coronal clefts ) of the vertebral bodies which represents cartilage that are not ossified , cataracts , contractures , microcephaly , characteristic skin changes of icthyosis , facial dysmorphism ( depressed nasal bridge , hypertelorism , hypoplastic midface , anteverted nostrils , full cheeks ) , and developmental impairment . this condition is considered to be lethal and most of the affected fetuses die in utero or soon after birth . only few of them survive beyond infancy with severe physical disability and profound mental retardation in whom , death usually occurs in the first decade of life . diagnosis of rcdp is based on clinical findings and confirmed by clinically available biochemical or molecular genetic testing which includes biochemical tests of peroxisomal function like red cell plasmologen concentration , plasma phytanic acid , and very long chain fatty acid estimation . this case is presented due to its rarity and failure to detect such an abnormality in utero resulting in a wasted pregnancy . the lack of resources ( both money and manpower ) is probably responsible for this tragedy to the parents which could have been prevented by early diagnosis and appropriate counseling . establishing regional genetic labs which are connected with district level hospitals can be of immense help in reducing the burden of genetic diseases by appropriate prenatal diagnosis and counseling .

a male neonate was born with rhizomelic shortening of limbs . skeletal radiograph showed punctate calcification of epiphysis of humerus , femur , and tibia . the diagnosis and a brief review of literature pertaining to the condition with emphasis on antenatal diagnosis and counseling are being reported .

Introduction

radioactive iodine thyroid ablation has been shown to be an inexpensive , safe , and effective treatment for hyperthyroidism . it is the most commonly used method for treating adult patients with graves ' disease . special precautions must be used in women of child - bearing age because of the possible detrimental side effects of fetal exposure . the american college of radiology ( acr ) practice guideline for the performance of therapy with unsealed radiopharmaceutical sources states that pregnancy should be ruled out using one of the following four criteria : ( 1 ) a negative hcg test obtained within 72 hours prior to administration of the radiopharmaceutical , ( 2 ) documented history of hysterectomy , ( 3 ) a postmenopausal state with absence of menstrual bleeding for two years , and ( 4 ) premenarche in a child age of 10 years or younger . the society of nuclear medicine ( snm ) procedure guideline for therapy of thyroid disease with i-131 states that females of child - bearing age should routinely be tested for pregnancy within 72 hours or less before i-131 treatment . when the patient 's history clearly indicates that pregnancy is impossible , the treating physician may omit the pregnancy test . tj ( not the patient 's initials ) is an adult female diagnosed with graves ' disease , which was treated with i-131 therapy in december 2004 . she had been doing well until june 2006 when she presented to the pediatric endocrinology clinic with reoccurrence of her disease . her thyroid function tests showed tsh < 0.03 ( normal 0.325.0 munit / ml ) , free t4 2.80 ( normal 0.711.85 ng / dl ) , and t4 19.1 ( normal 5.012.0 mcg / dl ) . tj was scheduled for a radioactive iodine uptake and scan with subsequent ablation with i-131 . a qualitative urine pregnancy test was performed 24 hours prior to ablation and was negative . a radioiodine uptake and scan revealed a 24-hour uptake of 100% ( normal 10%30% ) . informed consent for i-131 therapy was obtained . tj verified that she was not pregnant and was given an activity of 19.8 mci of i-131 . approximately four months later , after slipping and falling at work , tj presented to her physician with a complaint of low back pain . magnetic resonance imaging ( mri ) of her lumbar spine revealed an intrauterine pregnancy . it was estimated that the fetus was eight to ten days old at the time of i-131 treatment . neonatal thyroid function tests revealed suppressed tsh ( < 0.02 , normal 0.325.0 munit / ml ) , elevated t4 ( 24.4 , normal 5.012.0 mcg / dl ) , and free t4 ( 4.54 , normal 0.581.64 ng / dl ) . in addition , the infant had an elevated thyroid receptor antibody ( trab ) titer of 82% ( negative < 10% , intermediate 10%15% , positive > 15% ) . based on the laboratory evaluation , because he was asymptomatic , a decision was made not to treat but to monitor him closely . over the next six months his thyroid function tests normalized with tsh 0.73 munit / ml , t4 10.3 mcg / dl , free t4 1.11 ng / dl , and trab < 15% . thyroid embryogenesis is largely completed by 1012-week gestation . at 10-week gestation , the thyroid gland is able to trap and concentrate iodine and synthesize thyroid hormones thyroxine and triiodothyronine . after 10-week gestation , significant exposure to the fetal thyroid can occur from therapeutic doses to the mother , resulting in hypothyroidism and cretinism . there have been no reports of birth defects or childhood malignancy in children born to the mothers who received radioactive iodine for graves ' disease before the 10th week of pregnancy . we believe the infant 's thyroid gland was not affected by the i-131 therapy because he was exposed prior to 10-week gestation . quantifying the exact absorbed dose by the embryo in this case is difficult and depends on many variables . this calculation likely overstates the actual absorbed dose , as the model assumes that i-131 crosses the placenta . in this case , due to the placenta being in the early stages of development during the second week of gestation it is estimated that the embryo absorbed dose with i-131 treatment in early pregnancy is 0.072 mgy / mbq . our patient received a dose of 19.8 mci ( 732.6 mbq ) , which corresponds to an absorbed dose of approximately 5.3 rads after converting from gy to rads . deterministic effects are those that are known to occur at a given radiation threshold . for example , if a patient were to receive an acute dose of 2 gy to the lens of the eye , the patient will develop a cataract . stochastic effects are those that can theoretically occur at any radiation dose . for example , any radiation dose could potentially induce a cancer in the future . the probability of a stochastic effect increases as dose increases , but there is no radiation threshold dose below which one can say a stochastic effect will not occur . therefore , stochastic effects can theoretically occur with any radiation dose . the only known deterministic effect of radiation at an absorbed dose of less than 10 rads is possible spontaneous abortion at 114 days postconception . based on the data above , this dose level ( 10 rads ) was not reached in this patient . on the other hand , thus , the radiation dose to any developing embryo should be minimized , and it is reasonable to ascertain an accurate pregnancy test prior to the use of i-131 therapy . studies have demonstrated that the risk of congenital effects have been negligible at doses of 5 rads or less when compared to other risks of pregnancy . in addition , the risk of malformation only significantly increases at doses above 15 rads . mental retardation has been shown to occur in the offspring of pregnant mothers ; however , it is at doses greater than 20 rads and generally after the eighth week of gestation . a screening study of thyroid cancer among individuals exposed to in utero i-131 from the chernobyl fallout , however , did demonstrate an increased risk of thyroid carcinoma approximately 20 years after the accident . thus , our estimation that the infant was exposed to approximately 5 rads supports that no deterministic effects should have occurred , but one can not exclude the future potential for stochastic effects . as previously stated , the acr practice guideline for the performance of therapy with unsealed radiopharmaceutical sources states that pregnancy should be ruled out using one of the following four criteria : ( 1 ) a negative hcg test obtained within 72 hours prior to administration of the radiopharmaceutical , ( 2 ) documented history of hysterectomy , ( 3 ) a postmenopausal state with absence of menstrual bleeding for two years , and ( 4 ) premenarche in a child age 10 or younger . the snm procedure guideline for therapy of thyroid disease with i-131 states that females of child - bearing age should routinely be tested for pregnancy within 72 hours or less before i-131 treatment . when the patient 's history clearly indicates that pregnancy is impossible , the treating physician may omit the pregnancy test . neither of the above guidelines specifies whether the pregnancy tests should be quantitative or qualitative . typically , serum pregnancy tests are more sensitive than standard urine pregnancy tests because the serum concentration of hcg is significantly higher than its urine concentration . detection of hcg in maternal serum is evident only after implantation and vascular communication has been established with the decidua by the syncytiotrophoblast , which occurs 810 days following conception . serum hcg can be detected in about 5% of patients eight days after conception and about 98% of patients by 11 days postconception . in contrast , urine pregnancy tests will be positive 1517 days after conception in 98% of patients [ 14 , 16 ] . this rule suggests that radioactive iodine therapy only be administered during the 10 days after the onset of the menstrual period . however , this protocol may not be effective if the patient has irregular menstrual cycles . one possible suggestion is to incorporate the ten day rule protocol into the current guidelines for patients who have regular 28-day menstrual cycles . for patients with irregular cycles or who require immediate ablation , quantitative serum hcg pregnancy tests on the day of the treatment should be considered . because serum hcg is detected in 98% of pregnant patients by day 11 , recommending the patients to abstain from sexual activity for at least two weeks prior to i-131 therapy may be suggested . this abstinence would cover the gap from the time of conception to the time the serum hcg test becoming positive . however , the physician would have to rely on the patient for providing an accurate menstrual cycle and sexual history . it is imperative to rule out pregnancy prior to the administration of radioactive iodine therapy due to the potential detrimental side effects of fetal exposure . the dose of i-131 in this particular case would be unlikely to result in any deterministic events . however , under the premise that any unnecessary exposure to radiation is important in preventing any potential stochastic events , an accurate pregnancy screening protocol may be warranted in preventing inadvertent i-131 treatment in early pregnancies of women with graves ' disease . the current acr and snm guidelines only mandate a hcg test being obtained within 72 hours prior to the treatment . this approach may miss a small number of pregnancies as a serum or urine pregnancy test does not become positive until implantation occurs , which happens 810 days postconception . though we recommend re - evaluating the acr and snm guidelines for future clarifications , it is possible that despite combining the patient 's history , the ten day rule and the hcg screening , an unsuspected pregnancy may be missed .

graves ' disease is a thyroid - specific autoimmune disorder in which the body makes antibodies to the thyroid - stimulating hormone receptor leading to hyperthyroidism . therapeutic options for the treatment of graves ' disease include medication , radioactive iodine ablation , and surgery . radioactive iodine is absolutely contraindicated in pregnancy as exposure to i-131 to the fetal thyroid can result in fetal hypothyroidism and cretinism . here we describe a case of a female patient with recurrent graves ' disease , who inadvertently received i-131 therapy when she was estimated to be eight days pregnant . this was despite the obtaining of a negative history of pregnancy and a negative urine pregnancy test less than 24 hours prior to ablation . at birth , the infant was found to have neonatal graves ' disease . the neonatal graves ' disease resolved spontaneously . it was suspected that the fetal thyroid did not trap any i-131 as it does not concentrate iodine until 10 weeks of gestation .

1. Introduction 2. Case Report 3. Discussion 4. Conclusion

ischemic heart disease is the first leading cause of death among the world and caused 62.6 million disability adjusted life years in 2004 . cardiovascular diseases ( cvds ) accounts for 17.7 million annual deaths in world - wide . cvds are increasing in developing countries as they half of deaths and 80% of the related global burden occur in these countries . cvds are the main cause of death and its covers 38% of total mortality in iran as well . recent studies have indicated that primary prevention to reduce cvds death is four times more effective than other levels of prevention . knowledge of the magnitude of cvds related avoidable burden resulting from different risk factors regarding their own significance in codifying the prevention and priority setting by policy makers is absolutely essential . the contribution of every risk factor to the avoidable / attributable burden of diseases can be calculated by a measure entitled potential impact fraction ( pif ) . the pif ( also called the generalized attributable fraction ) was introduced by walter in 1980 and morgenstern and bursic in 1982 as a measure that generalizes the population attributable fraction ( attributable risk ) . it is defined as the fractional reduction of a disease resulting from changing the current distribution of a risk factor to some modified distribution or to incomplete elimination of exposure . the concept of avoidable / attributable burden and such modified levels , which considered to some alternative distribution of exposure in the counterfactual analysis have previously been reported elsewhere . there are according to the authors knowledge , few published studies that consider the joint effect of multiple risk factors on avoidable burden of cvds . accordingly , this study was aimed to estimate the joint effect of avoidable burden of multiple risk factors to cvds in iran . estimates of the avoidable burden were made using world health organization comparative risk assessment ( cra ) methodology . the reason for choosing the cra methodology was the ability of considering the effects of intervention on observed exposure distribution to other distribution , rather than a single reference level such as non - exposed . pif is an epidemiological measure of effect that calculates the proportional change in average disease incidence ( or prevalence or mortality ) after a change in the exposure of a related risk factor . the pif is given by the following equation 1 : where rr is the measure of effect at a given exposure level , p is the prevalence of risk factor , and n is the maximum exposure level . in this study , scenario 1 corresponds to the theoretical minimum risk levels and based on the reduction of the prevalence of a specific risk factor to zero . plausible minimum risk level indicates the distribution of a risk factor at imaginable level in iran . more details about this methodology and the pif as a measure to estimate avoidable / attributable burden is explained elsewhere . authors used aggregates data and reported above and mentioned reference for achievement the objectives of the study ; hence ethical considerations in performance of the project were observed . accordingly to estimate the pif measure , the prevalence of each risk factor , the corresponding measures of effect and alternative prevalence of counterfactual levels is required as follows . diabetes is defined as either newly diagnosed diabetes mellitus ( ndm ) and known diabetes mellitus ( kdm ) . ndm is defined as individuals who had fasting plasma glucose 126 mg / dl . those people who if a health - care professional had ever told them to have diabetes were considered as kdm . hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or use of anti - hypertensive drugs . central obesity and hypercholesterolemia were defined as waist circumstance 88 cm in females and 102 cm in males according to adult treatment panel iii criteria , total cholesterol 240 mg / dl , respectively . prevalence of above mentioned risk factors among iranian adults were obtained from the third national surveillance of risk factors of non - communicable diseases-2007 , conducted in 2007 . in this study , the available and updated prevalence rates of risk factors in the iranian population have been presented . in present study , theoretical minimum risk levels for selected risk factors were considered as zero in the 1 scenario . plausible minimum risk level , the 2 scenario , for selected risk factors were determined different levels . contribution of the selected risk factors to the avoidable burden of cvds by sex data on corresponding measures of effect were derived from the tehran lipid and glucose study ( tlgs ) . the tlgs is a long - term integrated community - based program for prevention of non - communicable disorders ( ncd ) by development of a healthy life - style and reduction of ncd risk factors . the study begun in 1999 , is ongoing , to be continued for at least 20 years . corresponding rr , which measured association between cvds and selected risk factors were shown in table 1 . in our work , we used multivariate adjusted hazard ratios for estimating pifs . since , obesity did not have a significant hazard ratio for cvds , so its contribution was not estimated in the present study . uncertainties for the pifs were considered using calculation their own values based on lower and upper levels of the prevalence of each risk factor and its related measures of effects . estimates of the avoidable burden were made using world health organization comparative risk assessment ( cra ) methodology . the reason for choosing the cra methodology was the ability of considering the effects of intervention on observed exposure distribution to other distribution , rather than a single reference level such as non - exposed . pif is an epidemiological measure of effect that calculates the proportional change in average disease incidence ( or prevalence or mortality ) after a change in the exposure of a related risk factor . the pif is given by the following equation 1 : where rr is the measure of effect at a given exposure level , p is the prevalence of risk factor , and n is the maximum exposure level . in this study , scenario 1 corresponds to the theoretical minimum risk levels and based on the reduction of the prevalence of a specific risk factor to zero . plausible minimum risk level indicates the distribution of a risk factor at imaginable level in iran . more details about this methodology and the pif as a measure to estimate avoidable / attributable burden is explained elsewhere . authors used aggregates data and reported above and mentioned reference for achievement the objectives of the study ; hence ethical considerations in performance of the project were observed . accordingly to estimate the pif measure , the prevalence of each risk factor , the corresponding measures of effect and alternative prevalence of counterfactual levels is required as follows . diabetes is defined as either newly diagnosed diabetes mellitus ( ndm ) and known diabetes mellitus ( kdm ) . ndm is defined as individuals who had fasting plasma glucose 126 mg / dl . those people who if a health - care professional had ever told them to have diabetes were considered as kdm . hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or use of anti - hypertensive drugs . central obesity and hypercholesterolemia were defined as waist circumstance 88 cm in females and 102 cm in males according to adult treatment panel iii criteria , total cholesterol 240 mg / dl , respectively . prevalence of above mentioned risk factors among iranian adults were obtained from the third national surveillance of risk factors of non - communicable diseases-2007 , conducted in 2007 . in this study , the available and updated prevalence rates of risk factors in the iranian population have been presented . prevalence of selected risk factors in both sexes is shown in table 1 . in present study , theoretical minimum risk levels for selected risk factors plausible minimum risk level , the 2 scenario , for selected risk factors were determined different levels . data on corresponding measures of effect were derived from the tehran lipid and glucose study ( tlgs ) . the tlgs is a long - term integrated community - based program for prevention of non - communicable disorders ( ncd ) by development of a healthy life - style and reduction of ncd risk factors . the study begun in 1999 , is ongoing , to be continued for at least 20 years . corresponding rr , which measured association between cvds and selected risk factors were shown in table 1 . in our work , we used multivariate adjusted hazard ratios for estimating pifs . since , obesity did not have a significant hazard ratio for cvds , so its contribution was not estimated in the present study . uncertainties for the pifs were considered using calculation their own values based on lower and upper levels of the prevalence of each risk factor and its related measures of effects . in addition , table 2 shows the 95% uncertainty interval for all of the risk factors related pifs at both theoretical ( scenario 1 ) and plausible minimum risk level ( scenario 2 ) . about 9.3% of attributable burden to cvds ( 95% uncertainty interval : 6.07 - 12.81 ) in males and 14.74% ( 95% uncertainty interval : 9.31 - 20.20 ) in females are avoidable after changing the current prevalence of hypertension to 14% in both sexes . uncertainty intervals for pifs based on estimated uncertainty ranges around point estimate of selected risk factors the pifs for other risk factors at theoretical minimum risk level are shown in table 1 . moreover , modifying the current distribution of the diabetes , central obesity and hypercholesterolemia to plausible minimum risk lead to avoided 3.4 ( 95% uncertainty interval : 2.0 - 4.4 ) , 3.1 ( 95% uncertainty interval : 0.9 - 5.5 ) and 2.9% ( 95% uncertainty interval : 1.4 - 4.8 ) of burden , which attributed to cvds in males and 6.6 ( 95% uncertainty intervals : 4.3 - 9.2 ) , 14.6 ( 95% uncertainty interval : 7.7 - 21.53 ) , and 2.9% ( 95% uncertainty interval : 0.09 - 6.25 ) in females , respectively . contribution of the diabetes , hypertension , central obesity , and hypercholesterolemia to the avoidable burden of cvds at both theoretical and plausible minimum risk levels has been depicted in figure 1 . contribution of the selected risk factors to the avoidable burden of cardiovascular diseases at both theoretical and plausible minimum risk levels ( a ) theoretical minimum risk level ( b ) plausible minimum risk level table 3 shows the joint effect of the contribution of the selected risk factors including diabetes , hypertension , central obesity , and hypercholesterolemia to the avoidable burden of cvds by sex . as it has been shown , at the theoretical minimum risk level the joint effect of diabetes , hypertension , central obesity , and hypercholesterolemia to the cvds avoidable burden equals to 37.1% among iranian men and 59.4% in adult women . the corresponding values at the plausible minimum risk level were 17.8% and 34.0% , respectively [ table 3 ] . joint effect of the contribution of the selected risk factors to the avoidable burden of cvds by sex our findings indicated the highest portion of pif among females was central obesity and after that hypertension , diabetes , and hypercholesterolemia . however , among adult men hypertension , diabetes , hypercholesterolemia , and central obesity were ranked with importance respectively at theoretical minimum risk level . the corresponding values at plausible minimum risk level were different among both males and females . moreover , the attributable burden to the joint effects of the above risk factors in females is also higher than in males . central obesity , unrelated to bmi , increases the risk of the prevalence of cvds ; and previous studies indicated that it is a strong predictor in the prevalence of cvds . recent studies have shown that the prevalence of central obesity is increasing in the united states . moreover , the estimated prevalence of central obesity in iran is high , too ; and among females , it is higher that of males . in this study , central obesity for females is the most important risk factor at theoretical minimum risk level and secondary risk factor at plausible minimum risk level . these researchers in a case - control studied an estimated 15152 cases and 14820 controls in 52 countries and calculated the odds ratio and population 's attributable risk for tobacco usage , hypertension , diabetes , waist - hip ratio , dieting , physical activity , and alcohol usage . high prevalence of central obesity in iranian females can be caused by changes in lifestyle pattern , inactivity , and modernization of the community . by reducing this factor , which has the first priority among females another important risk factor which was assessed in this study is hypertension , which results showed that it is of particular importance in both sexes . with the increase of 10 unit of diastolic hypertension or 20 unit of the systolic hypertension , we will have a double increase in the risk of cvds . a study conducted in australia in 2003 showed that 17% of deaths and 7.6% of burden of cvds attributed to hypertension . yusuf et al . estimated that 17.9% of burden of myocardial infarction attributed to hypertension . nilsson et al . suggested that 14% of females cvds and 23% of males cvds are attributable to hypertension . in the present study , hypertension is the most important factor among males and the secondary factor among females at theoretical minimum risk level . the pif for hypertension among females is higher comparing to males in both levels , which is consistent with other studies . a study in spain showed that 2800 deaths attributed to cvds ( about 6% of the total mortality of cvds ) attributed to diabetes in spanish adults . in addition , 2% of deaths in males and 1.6% of deaths in females due to cvds and 10.4% and 3.4% due to stroke are attributed to diabetes for females and males respectively . yusuf et al . indicated that the contribution of diabetes is 9.9% of burden of cvds . the results of a study , which was conducted to quantify population - level effects of all higher - than - optimum concentrations of blood glucose on mortality from ischemic heart disease and stroke world - wide found that higher - than - optimum blood glucose is a leading cause of cardiovascular mortality in most world regions and reported that in addition to 959,000 deaths directly assigned to diabetes , 1,490,000 deaths from ischemic heart disease and 709,000 from stroke were attributable to high blood glucose , accounting for 21% and 13% of all deaths from these conditions . 792,000 ( 53% ) of deaths from ischemic heart disease and 345,000 ( 49% ) from a stroke that were attributable to high blood glucose were in men . largest numbers of deaths attributable to this risk factor from ischemic heart disease were in low- and - middle - income countries of south asia ( 548,000 ) and europe and central asia ( 313,000 ) , and from stroke in south asia ( 215,000 ) and east asia and pacific ( 190,000 ) . bradshaw et al . that of south africans aged equals or greater than 30 years , 5.5% had diabetes which increased with age and about 14% of ischaemic heart disease , 10% of stroke , 12% of hypertensive disease and 12% of renal disease burden in adult males and females ( 30 + years ) were attributable to diabetes . furthermore , diabetes was estimated to have caused 22,412 ( 95% uncertainty interval 20,755 - 24,872 ) or 4.3% ( 95% uncertainty interval 4.0 - 4.8% ) of all deaths in south africa in 2000 . our results showed females approximately twice as much avoidable burden as males due to diabetes , which is consistent with other studies . different criteria were used for hypercholesterolemia in different studies , so comparing their results are difficult . reported 11.6% of death and 6.2% of burden of cvds attributed to hypercholesterolemia . in this study , hypercholesterolemia has been forth and lesser importance than among other risk factors in both sexes at theoretical and plausible minimum risk levels . whereas , european studies estimated attributable contribution for this risk factors higher than of hypertension that this variation may be caused to different prevalence in variation within communities . furthermore , it should be consider to prescription of the statin drug , which is one of the lipid lowering drugs . according to higher avoidable burden to cvds in females , policy makers should be more focused on women for preventive interventions toward remove or reduce these risk factors , particularly central obesity and hypertension that itself would be the key strategy to reducing morbidity and mortality of cvds .

background : there are few published studies that consider the joint effect of multiple risk factors on avoidable burden of cardiovascular diseases ( cvds ) . this study aimed to estimate the joint effect of avoidable burden of multiple risk factors to cvds.methods:estimates of avoidable burden to cvds were made using potential impact fraction ( pif ) . in order to calculate pif , data on the prevalence of the risk factors include diabetes , hypertension , central obesity , and hypercholesterolemia were obtained from 3rd national surveillance of risk factors of non - communicable diseases-2007 in iran and data on corresponding measures of effect were derived from a cohort study with multivariate adjusted hazard ratios . then , joint effect of risk factors was calculated.results:about 37% ( 95% uncertainty interval : 21.7 - 50.2 ) of attributable disability adjusted life years ( dalys ) to cvds in adult males and 59.4% ( 95% uncertainty interval : 30 - 76 ) in adult females due to selected risk factors are avoidable in theoretical minimum risk levels . after changing the current prevalence of these risk factors to the plausible minimum risk levels , 17.8% ( 95% uncertainty interval : 10.1 - 25.1 ) of cvds attributable dalys among adult males and 34% ( 95% uncertainty interval : 20 - 46.7 ) in adult females can be avoided.conclusions:to better priority setting as well as reporting the magnitude of avoidable dalys rather than the percentage of avoidable burden , pif should be applied to updated and revised burden of cvds .

INTRODUCTION METHODS Estimates of avoidable burden Definition of risk factors and source of their prevalence Source of measure of effect of disease occurrence given exposure Sensitivity analyses RESULTS DISCUSSION CONCLUSIONS

a 56-year - old female presented with best corrected visual acuity ( bcva ) of 20/120 and nuclear sclerosis ( nuclear opacity 3 , nuclear color 2 using lens opacification classification system iii ) in the left eye ( le ) . the surgery was performed using proparacaine drops ( paracain ophthalmic solution 0.5% , sunways pvt . ltd . , a foldable iol of + 22.5 d of the sensar ar40e variety [ abbott medical optics inc ( amo ) , 1700 e. st . andrew place , santa ana , ca 92705 usa ] was loaded into the emerald c cartridge ( lot ch00841 of amo inc . , usa ) by the first assistant outside the field of the operating microscope to save the surgical time . the cartridge was inserted in the injector and the loaded injector was handed to the surgeon . the tip of the cartridge was just inserted snugly by slight rotatory motion into the anterior chamber through the 2.8-mm incision . however , while removing the injector system , it was noticed that there was a gross downward beaking of the bevelled anterior end of the cartridge [ fig . immediately , the incision site was inspected under the operating microscope and a descemet 's tear was detected with a rolled out flap of about 2 mm in length . the viscoelastic was meticulously washed out and the main incision wound and the two side port entries were carefully hydrated and an air bubble was injected into the anterior chamber . downward beaking of the beveled anterior end of the emerald c cartridge ( lot ch00841 of advanced medical optics , inc . , usa ) on the first postoperative day , the patient 's le had an uncorrected va of 20/60 with a small rolled out descemet 's flap and adjacent descemet 's striae at the site of the main clear corneal incision ( temporally ) [ fig . a corneal opacity remained at the deeper corneal layers with mild surrounding edema , even at the time of last check - up at 4 weeks post - op , with a bcva of 20/30 [ fig . a small rolled out descemet 's flap and adjacent descemet 's striae ( left eye of the reported case on the first postoperative day ) corneal opacity at the deeper corneal layers with mild surrounding edema ( left eye of the reported case at 4 weeks post - op ) damage to iols as a consequence of passage through various injector systems includes marks or scratches , stress fractures , cracks and tear lines . damage to descemet 's membrane can occur due to various factors during cataract surgery , including engaging of descemet 's membrane by the leading haptic during iol implantation or with the irrigation / aspiration device ( when mistaken as an anterior capsular remnant ) or due to inadvertent injection of viscoelastic between descemet 's membrane and corneal stroma . repair techniques include manual repositioning , repositioning with viscoelastic or air , suturing of descemet 's membrane to the peripheral cornea or use of sf6 or c3f8 . our case report describes injury to the corneal endothelium and descemet 's membrane intraoperatively due to frayed and beaked tip of the amo emerald c cartridge . the case has been followed up for a period of about 4 weeks as on the day of reporting , and as the visual axis was not completely involved , the vision is maintained , although the descemet 's stria and mild surrounding edema remains . we have reported only a single case ; however , a damaged amo emerald c cartridge has been found in a few subsequent cases in our institute . in cases where a back - up cartridge was not available , the size of the clear corneal incision was increased to 3.2 mm at least to protect the entry wound architecture and the corneal endothelium , while injecting the iol using the damaged cartridge . the cause of the damaged nature of the amo emerald c cartridges appears to be a manufacturer 's oversight which has been duly informed to the concerned authorities , who have assured speedy correction of the defect . these cartridges are delivered in sterile transparent cases and the tip can be easily examined under the slit lamp beforehand without opening the casing . this should be made a routine practice as this will allow any damaged cartridge to be replaced before starting the surgery by ordering a fresh one from the manufacturer . we suggest loading of the foldable iol should be done by the surgeon himself under the operating microscope . the speed of the surgery should never compromise the quality of the surgery and/or the final visual outcome . with the advent of newer techniques like the microincision cataract surgery ( mics ) , surgeons also can not compromise on the incision size or wound integrity and architecture . the onus is on the various manufacturing companies to provide surgeons with precision instruments that are both safe and durable for the patient 's eyes . and more importantly , every instrument entering the patient 's eye should undergo careful preoperative microscopic inspection by the operating surgeon himself so that a microscopic manufacturing defect can be identified and immediate rectification of the situation can be done .

foldable intraocular lens ( iol ) implantation using an injector system through 2.8-mm clear corneal incision following phacoemulsification provides excellent speedy postoperative recovery . in our reported case , a sensar ar40e iol ( abbott medical optics , usa ) was loaded into emerald c cartridge , outside the view of the operating microscope , by the first assistant . the surgeon proceeded with the iol injection through a 2.8-mm clear corneal incision after uneventful phacoemulsification , immediately following which he noted a descemet 's tear with a rolled out flap of about 2 mm near the incision site . gross downward beaking of the bevelled anterior end of the cartridge was subsequently noticed upon examination under the microscope . we suggest careful preoperative microscopic inspection of all instruments and devices entering the patient 's eyes to ensure maximum safety to the patient .

Case Report Discussion

cytoscape 1 , 2 provides an environment for the visualization and analysis of networks and associated annotations . the primary audience for cytoscape is the biological community and cytoscape supports a number of standard use cases for analyzing and visualizing biological data . many of these use cases involve the selection of a number of nodes or edges based on some analysis or annotation and either performing an action on that selection or comparing those nodes or edges to a different set of nodes or edges that resulted from alternative analyses or analyses based on alternative annotations . the core capabilities for cytoscape provide some tools to facilitate these types of comparisons but they can be counterintuitive or complicated to use . setsapp is a cytoscape 3 application that provides a general set of tools for users and developers to define and maintain sets of nodes or edges and compare those sets using the standard set operations of union , intersection , and difference . in this paper , we present the implementation of setsapp , in particular , how setsapp integrates with the cytoscape command system , and then present a sample biological workflow using setsapp . cytoscape provides two approaches to implementing apps : a simple app and a bundle app . simple apps are implemented using the same general approach as in cytoscape 2.8 , but at the cost of significant flexibility . bundle apps utilize open service gateway initiative ( osgi ) interfaces through apis provided by cytoscape to interact with the cytoscape core functionality . there are three main components to the setsapp implementation : the user interface , the command interface , and the underlying data model for maintaining sets of nodes and edges . the setsapp user interface consists of menu items in the main apps menu , node and edge context menus , and a panel added to the control panel ( left or west ) section of the cytoscape user interface . the main feature of the sets panel is the list of currently defined sets . each set can be expanded to see all of the nodes or edges within that set , and context menus provide the ability to select , deselect , rename , or remove sets . when multiple sets are selected , the set operations buttons are enabled . this allows users to create new sets based on the union , intersection , or difference of other sets . note that the results of a union or intersection are well - defined for multiple sets , but the difference operation is order dependent . if more than two sets are selected , the order is the order of selection , so care must be taken when attempting to create a difference set of more than two sets . sets can be created from the currently selected nodes or edges , or based on a particular node or edge attribute . when creating sets from attributes , the user will need to supply a prefix for the sets to be created and choose the attribute ( currently only string attributes are supported ) from a list . in addition to having menu items to manage sets , the user may select all set members in the network , or if the set is expanded , individual members . this functionality presents an easy way for users to visualize the results of set operations and to perform interactive exploratory analysis . the menus provided through the top - level apps menu offer the same functionality as the create set from menu in the setsapp control panel with the addition of a menu to import a set from a file . node and edge context menus provide the user with the ability to add or remove the corresponding node or edge from sets . in addition to the standard user interface described above , setsapp provides a number of commands . these commands may be used for scripting purposes or by other cytoscape apps that wish to take advantage of the setsapp functionality . a command is made available to cytoscape by creating a standard cytoscape taskfactory with two new properties in the org.cytoscape.work package : serviceproperties.command_namespace , which is always set to setsapp ; and serviceproperties.command , which is the command name ( e.g. addto ) . the command arguments are implemented as tunables within the task called by the designated taskfactory . because there is no guarantee that the task will be executed within the context of a gui , care should be taken to make sure that the appropriate tunable types are used . for example , the nodelist tunable allows the command - line user to enter a list of nodes rather than assuming that the user will have selected nodes interactively . for another cytoscape app to use any of these commands , it would need to call one of the cytoscape taskmanagers and provide it org.cytoscape.command.commandexecutortaskfactorys createtaskiterator method with the appropriate argument map , command , and command namespace . getservice ( synchronoustaskmanager . class ) ; commandexecutortaskfactory cetf = serviceregistrar . getservice ( commandexecutortaskfactory . class ) ; map < string , object > argmap = new hashmap < string , object > ( ) ; argmap.put ( " name " , " newset " ) ; // selected is a special keyword for the nodelist tunable argmap.put ( " nodelist " , " selected " ) ; // the current network argmap.put ( " network " , " current " ) ; // assumes that this implements taskobserver tm.execute(cetf.createtaskiterator ( " setsapp " , " createset " , argmap , this ) , this ) ; the main model object for a node or edge set is the set object , which stores a map of all of the nodes or edges in this set . the setsmanager also serves the critical function of serializing the information about sets to the default hidden table ( see cynetwork.hidden_attrs ) for nodes or edges ( depending on the type of the set ) . each set is created as a boolean column in the hidden table which is set to true if the corresponding node or edge is in that set . by storing values in the default hidden tables , the information about sets is automatically saved in cytoscape sessions and restored when sessions are reloaded . setsmanager implements sessionreloadedlistener and recreates the sets from the information stored in the hidden table columns . the setsapp user interface consists of menu items in the main apps menu , node and edge context menus , and a panel added to the control panel ( left or west ) section of the cytoscape user interface . the main feature of the sets panel is the list of currently defined sets . each set can be expanded to see all of the nodes or edges within that set , and context menus provide the ability to select , deselect , rename , or remove sets . when multiple sets are selected , the set operations buttons are enabled . this allows users to create new sets based on the union , intersection , or difference of other sets . note that the results of a union or intersection are well - defined for multiple sets , but the difference operation is order dependent . if more than two sets are selected , the order is the order of selection , so care must be taken when attempting to create a difference set of more than two sets . sets can be created from the currently selected nodes or edges , or based on a particular node or edge attribute . when creating sets from attributes , the user will need to supply a prefix for the sets to be created and choose the attribute ( currently only string attributes are supported ) from a list . in addition to having menu items to manage sets , the user may select all set members in the network , or if the set is expanded , individual members . this functionality presents an easy way for users to visualize the results of set operations and to perform interactive exploratory analysis . the menus provided through the top - level apps menu offer the same functionality as the create set from menu in the setsapp control panel with the addition of a menu to import a set from a file . node and edge context menus provide the user with the ability to add or remove the corresponding node or edge from sets . in addition to the standard user interface described above , setsapp provides a number of commands . these commands may be used for scripting purposes or by other cytoscape apps that wish to take advantage of the setsapp functionality . a command is made available to cytoscape by creating a standard cytoscape taskfactory with two new properties in the org.cytoscape.work package : serviceproperties.command_namespace , which is always set to setsapp ; and serviceproperties.command , which is the command name ( e.g. addto ) . the command arguments are implemented as tunables within the task called by the designated taskfactory . because there is no guarantee that the task will be executed within the context of a gui , care should be taken to make sure that the appropriate tunable types are used . for example , the nodelist tunable allows the command - line user to enter a list of nodes rather than assuming that the user will have selected nodes interactively . for another cytoscape app to use any of these commands , it would need to call one of the cytoscape taskmanagers and provide it org.cytoscape.command.commandexecutortaskfactorys createtaskiterator method with the appropriate argument map , command , and command namespace . getservice ( synchronoustaskmanager . class ) ; commandexecutortaskfactory cetf = serviceregistrar . getservice ( commandexecutortaskfactory . class ) ; map < string , object > argmap = new hashmap < string , object > ( ) ; argmap.put ( " name " , " newset " ) ; // selected is a special keyword for the nodelist tunable argmap.put ( " nodelist " , " selected " ) ; // the current network argmap.put ( " network " , " current " ) ; // assumes that this implements taskobserver tm.execute(cetf.createtaskiterator ( " setsapp " , " createset " , argmap , this ) , this ) ; the main model object for a node or edge set is the set object , which stores a map of all of the nodes or edges in this set . the setsmanager also serves the critical function of serializing the information about sets to the default hidden table ( see cynetwork.hidden_attrs ) for nodes or edges ( depending on the type of the set ) . each set is created as a boolean column in the hidden table which is set to true if the corresponding node or edge is in that set . by storing values in the default hidden tables , the information about sets is automatically saved in cytoscape sessions and restored when sessions are reloaded . setsmanager implements sessionreloadedlistener and recreates the sets from the information stored in the hidden table columns . a simple example use case might be the exploration of the data set from ideker et al . , 2001 , which measured the change in expression for 331 genes after a systematic deletion of genes known to be involved in the saccharomyces cerevisiae switch to galactose metabolism . this data was combined with known protein - protein and protein - dna interactions to explore the biological response to deletions in the presence ( the g in the column names ) or absence of galactose in the medium . this data set is now included as a sample with cytoscape downloads ( galfiltered.cys ) . in our workflow we use cytoscape s select panel to select all proteins that are underexpressed ( gal1rgexp < -0.5 fold change ) in the deletion of gal1 ( figure 2 ) . that selection is saved as a set named gal1- ( apps setsappcreate node set ) . we then select all of the proteins that are overexpressed ( gal1rgexp > 0.5 fold change ) in the deletion of gal1 and save that selection as a set named gal1 + . repeating this for gal4 ( column gal4rgexp ) and gal80 ( column gal80rexp ) results in 6 sets altogether : gal1 + , gal1- , gal4 + , gal4- , gal80 + , gal80- ( figure 3 ) . note that the data for gal1 and gal4 is in the presence of galactose , but the data for gal80 is in the absence of galactose since gal80 is a known repressor of gal4 . given those six sets of genes , we can explore the data sets by looking at combinations of the sets . for example , we could look at the intersection of all of the underexpressed proteins by selecting each of gal1- , gal4- , and gal80- in the sets panel and pressing the intersection button in the set operations box near the bottom of the panel . if we name the resulting set gal- we see that it contains a single gene : arg1 . in this data set of 331 genes , only this one gene is repressed for all three of the deleted gal genes . in the absence of galactose when gal80 is deleted , arg1 is underexpressed , and in the presence of galactose when either gal1 or gal4 are deleted the gene is also underexpressed . looking at the expression significance values in the node table panel of cytoscape ( gal1rgsig , gal4rgsig , and gal80rsig ) this is a highly significant result , although there is no direct correlation between the galactose switch and arginine biosynthesis regulation that we were able to find in the literature . on the other hand , arg1 is regulated by the gcn4 activator which is known to repress protein synthesis during periods of stress or starvation , which explains the significant down - regulation of arg1 . we can perform a similar analysis to understand the consistent up - regulation of the five genes in the gal+ set : gip1 , nce103 , yig1 , pot1 , and icl1 . gal+ and gal- were created by performing the intersection of all of the + and - sets , respectively . there are many cytoscape workflows that could take advantage of the features of setsapp . any workflow that might want to look for groups of nodes or edges that share multiple traits , or that explicitly do not share those traits . while it is possible to duplicate many of the final results enabled by setsapp by using cytoscape 3.1 s new select panel , a user would need to know in advance exactly the combination of features that were biologically interesting . setsapp provides an alternative that allows users to explore various combinations of nodes and edges and to save such selections for later uses . in the workflow we developed above , we combined the functionality of cytoscape s select panel with setsapp to explore combinations of sets of genes based on shared properties . there are many more sophisticated apps available to cytoscape users that could be used to do a more thorough analysis of this data set including jactivemodules , clustermaker and rinalyzer , however , the workflow above demonstrates the utility of a simple set - oriented approach to exploring networks . source code as at the time of publication : https://github.com/f1000research/setsapp archived code as at the time of publication : http://www.dx.doi.org/10.5281/zenodo.10424 license : lesser gnu public license 3.0 : https://www.gnu.org/licenses/lgpl.html

setsapp ( http://apps.cytoscape.org/apps/setsapp ) is a relatively simple cytoscape 3 app for users to handle groups of nodes and/or edges . it supports several important biological workflows and enables various set operations . setsapp provides basic tools to create sets of nodes or edges , import or export sets , and perform standard set operations ( union , difference , intersection ) on those sets . the sets functionality is also exposed to users and app developers in the form of a set of commands that can be used for scripting purposes or integrated in other cytoscape apps .

Introduction Implementation User interface Command interface Data model Results Conclusions Software availability

each year , 200 000 inhospital cardiac arrests ( ihca ) occur in the united states , with overall survival rates of 18% to 20% . however , the extent to which hospitals vary in survival rates for ihca remains poorly understood , as prior studies have largely reported aggregate survival rates at the patient level or have had a limited sample of hospitals , and most studies have lacked detailed information on patient factors to ensure adequate casemix adjustment . furthermore , the extent of sitelevel variation in neurologic status among survivors an outcome of great importance to many patients , their family members , and providers remains unknown . defining variability in survival rates , and examining the degree to which variation persists even after adjusting for patient casemix , would provide important insights into which hospitals could improve resuscitation care and offer opportunities to identify best practices at these hospitals . if significant variability in survival exists even after adjusting for patient casemix , this may suggest that resuscitation process factors ( eg , time to defibrillation , quality of cardiopulmonary resuscitation ) and quality improvement initiatives may be the primary reasons for substantially higher survival rates in topperforming hospitals . moreover , it would suggest a greater urgency to develop appropriate research methodology to identify which factors are associated with best practices at hospitals with the highest ihca survival . accordingly , within the american heart association 's get with the guidelinesresuscitation ( gwtgr ) , a large national inhospital cardiac arrest registry , we examined the extent to which hospitals varied in rates of survival to discharge among patients with ihca . gwtgr is an ideal data source , as it contains ihca data from over 400 us hospitals and collects detailed information on a number of patient and cardiac arrest characteristics to ensure robust casemix adjustment in a specific patient cohort . this was a multicenter cohort study using data from gwtgr to calculate hospital riskadjusted survival rates for ihca . gwtgr is sponsored by the american heart association ( aha ) and is a large , comprehensive , prospective national database of ihca in the us . this dataset also has information from outcome , a quintiles company which is the data collection and coordination center for the gwtgr program . data are collected from participating acute care hospitals according to standardized utstein definitions for ihca . specially trained research coordinators at each facility routinely abstract detailed data from the medical chart about resuscitation events if the event elicits an inhospital emergency resuscitation response and a code record is generated . these data include pre , intra , and postarrest variables , as well as survival at discharge . the aha provides rigorous quality control and oversight for all gwtgr data collection , analysis , reporting , and research studies . the study population included all adult patients 18 years of age or older enrolled within the registry between january 1 , 2001 and december 31 , 2010 . we excluded ihca events in individuals who were not hospital patients , including hospital visitors or employees ( n=293 ) . since patients may have had recurrent ihca events , we focused on the index ihca and excluded 26 190 recurrent arrests . as our study objective was to examine hospital variation in survival outcomes , we excluded 872 ihca events from 94 hospitals with a case volume of fewer than 20 ihcas . this figure illustrates the exclusion and inclusion criteria applied to the get with the guidelinesresuscitation dataset . these factors are important to control for , as older and sicker patients are known to have worse outcomes after inhospital arrest . therefore , the following patientlevel factors were evaluated for model inclusion : age , sex , race , residence prior to hospitalization , and prearrest comorbidities ( neurologic conditions , arrhythmia , myocardial infarction , congestive heart failure , diabetes , pneumonia , respiratory insufficiency , hepatic insufficiency / failure , renal insufficiency / failure , hypotension / hypoperfusion , hematology / oncology conditions , major trauma , and septicemia ) . additionally , available arrest characteristics were collected in gwtgr and included arrest etiology , presenting rhythm , event location , prearrest inplace interventions , and time and day of arrest . several hospital factors have previously been identified as important predictors of ihca outcomes yet these factors are not often accounted for in multicenter studies of ihca . modifiable hospitallevel factors that are associated with outcomes are particularly important as they can reveal opportunities for improvement . structural variables included in our analysis were : bed size ( small ; 6 to 99 beds , medium ; 100 to 400 , and large ; greater than 400 ) , academic status , and urban compared with rural location . these variables are included in gwtgr and are adapted from the american hospital association annual survey . the primary outcome measure was survival at hospital discharge . in this study , we calculated riskadjusted hospital rates for these outcomes . moreover , since several hospital factors have previously been identified as important predictors of ihca outcomes , we examined how ( patientlevel ) riskadjusted survival rates varied by hospital bed size , academic status , and urban designation . the unadjusted ihca survival rate for each hospital was calculated , and hospital variation in unadjusted rates of survival was examined by deciles . we then used multivariable hierarchical regression models to calculate riskadjusted hospital rates of survival to discharge . these included the previously described demographic variables ( age , race , gender , residence prior to admission ) , comorbidities , intraarrest factors ( eg , initial rhythm , inplace interventions ) , and arrest factors ( eg , etiology , location , time ) . the year of arrest was also included to control for temporal trends in survival . from the model , we used the model coefficients to calculate the predicted survival probability for each patient . these probabilities were summed within each hospital to then produce a hospital survival rate . for illustrative purposes , the survival rates for hospitals in each decile were compared . moreover , we examined survival rates ( riskadjusted for patient level factors ) across hospital deciles after stratifying the sample by bed size , academic status , and urban designation . finally , we quantified the extent of variation in riskadjusted survival across hospitals in the registry using the median odds ratio ( mor ) , which was derived from the hierarchical model after adjusting for patient factors as follows : the mor is estimated from hierarchical models and includes only patientlevel factors . the mor describes the likelihood that patients with similar measured covariates would have different outcomes at randomly chosen hospitals . a mor of 1.5 suggests that a patient would have a 50% greater odds of a particular outcome at a randomly identified hospital when compared with a similar patient . this was a multicenter cohort study using data from gwtgr to calculate hospital riskadjusted survival rates for ihca . gwtgr is sponsored by the american heart association ( aha ) and is a large , comprehensive , prospective national database of ihca in the us . this dataset also has information from outcome , a quintiles company which is the data collection and coordination center for the gwtgr program . data are collected from participating acute care hospitals according to standardized utstein definitions for ihca . specially trained research coordinators at each facility routinely abstract detailed data from the medical chart about resuscitation events if the event elicits an inhospital emergency resuscitation response and a code record is generated . these data include pre , intra , and postarrest variables , as well as survival at discharge . the aha provides rigorous quality control and oversight for all gwtgr data collection , analysis , reporting , and research studies . the study population included all adult patients 18 years of age or older enrolled within the registry between january 1 , 2001 and december 31 , 2010 . we excluded ihca events in individuals who were not hospital patients , including hospital visitors or employees ( n=293 ) . since patients may have had recurrent ihca events , we focused on the index ihca and excluded 26 190 recurrent arrests . as our study objective was to examine hospital variation in survival outcomes , we excluded 872 ihca events from 94 hospitals with a case volume of fewer than 20 ihcas . this figure illustrates the exclusion and inclusion criteria applied to the get with the guidelinesresuscitation dataset . these factors are important to control for , as older and sicker patients are known to have worse outcomes after inhospital arrest . therefore , the following patientlevel factors were evaluated for model inclusion : age , sex , race , residence prior to hospitalization , and prearrest comorbidities ( neurologic conditions , arrhythmia , myocardial infarction , congestive heart failure , diabetes , pneumonia , respiratory insufficiency , hepatic insufficiency / failure , renal insufficiency / failure , hypotension / hypoperfusion , hematology / oncology conditions , major trauma , and septicemia ) . additionally , available arrest characteristics were collected in gwtgr and included arrest etiology , presenting rhythm , event location , prearrest inplace interventions , and time and day of arrest . several hospital factors have previously been identified as important predictors of ihca outcomes yet these factors are not often accounted for in multicenter studies of ihca . modifiable hospitallevel factors that are associated with outcomes are particularly important as they can reveal opportunities for improvement . structural variables included in our analysis were : bed size ( small ; 6 to 99 beds , medium ; 100 to 400 , and large ; greater than 400 ) , academic status , and urban compared with rural location . these variables are included in gwtgr and are adapted from the american hospital association annual survey . the primary outcome measure was survival at hospital discharge . in this study , we calculated riskadjusted hospital rates for these outcomes . moreover , since several hospital factors have previously been identified as important predictors of ihca outcomes , we examined how ( patientlevel ) riskadjusted survival rates varied by hospital bed size , academic status , and urban designation . the unadjusted ihca survival rate for each hospital was calculated , and hospital variation in unadjusted rates of survival was examined by deciles . we then used multivariable hierarchical regression models to calculate riskadjusted hospital rates of survival to discharge . these included the previously described demographic variables ( age , race , gender , residence prior to admission ) , comorbidities , intraarrest factors ( eg , initial rhythm , inplace interventions ) , and arrest factors ( eg , etiology , location , time ) . the year of arrest was also included to control for temporal trends in survival . from the model , we used the model coefficients to calculate the predicted survival probability for each patient . these probabilities were summed within each hospital to then produce a hospital survival rate . for illustrative purposes , the survival rates for hospitals in each decile were compared . moreover , we examined survival rates ( riskadjusted for patient level factors ) across hospital deciles after stratifying the sample by bed size , academic status , and urban designation . finally , we quantified the extent of variation in riskadjusted survival across hospitals in the registry using the median odds ratio ( mor ) , which was derived from the hierarchical model after adjusting for patient factors as follows : the mor is estimated from hierarchical models and includes only patientlevel factors . the mor describes the likelihood that patients with similar measured covariates would have different outcomes at randomly chosen hospitals . a mor of 1.5 suggests that a patient would have a 50% greater odds of a particular outcome at a randomly identified hospital when compared with a similar patient . we evaluated a total of 135 896 inhospital cardiac arrest events at 468 hospitals ( figure 1 ) . of these , 78 787 ( 58% ) were men , 93 945 ( 74% ) were of white race , and 112 877 ( 83% ) were over 50 years of age ( table s1 ) . two in 5 ihca events had ventricular tachycardia or ventricular fibrillation ( vf / vt ) as the presenting rhythm and 86 672 ( 64% ) occurred in an intensive care unit . half , 52% ( 245 ) of all study hospitals were academic teaching hospitals ( 245 ) , 89% ( 419 ) were in urban settings , and 278 ( 59% ) had at least 100 beds . unadjusted rates of survival to discharge varied markedly across hospitals , with a median unadjusted rate for the bottom decile of 8.3% ( range : 0% to 10.7% ) and for the top decile of 31.4% ( range : 28.6% to 51.7% ) ( figure 2 ) . using hierarchical regression , we identified 36 predictors of inhospital survival to discharge ( table 1 ) . among the predictors were key demographic factors including age , female sex ( or 1.10 ; 95% ci : 1.06 to 1.13 , p<0.01 ) , and black race ( or 0.93 ; 95% ci : 0.87 to 0.99 , p=0.03 ) , comorbidities such as arrhythmia ( or 1.24 ; 95% ci : 1.20 to 1.28 , p<0.01 ) and myocardial infarction ( or 1.19 ; 95% ci : 1.14 to 1.24 , p<0.01 ) , and intraarrest factors including cardiac etiology ( or 1.18 ; 95% ci : 1.14 to 1.23 , p<0.01 ) and initial rhythm of vf or vt ( or 3.14 ; 95% ci : 3.02 to 3.27 ) . model predictors for survival to discharge ci indicates confidence interval ; icd , implanted cardioverter defibrillator ; or , odds ratio ; vf / vt , ventricular fibrillation / ventricular tachycardia . this figure illustrates inhospital cardiac arrest ( ihca ) rates ( yaxis ) across hospitals . rates are adjusted for the patientlevel factors identified in table 1 . after applying the model coefficients to patients in the sample , we calculated riskadjusted survival rates for ihca for each hospital . the median adjusted rate was 12.4% ( range : 0% to 15.6% ) for the bottom decile and 22.7% ( range : 21.0% to 36.2% ) for the top decile . of note , of the 46 hospitals in the top decile for ihca survival before risk adjustment , only 24 ( 52% ) remained in the top decile after risk adjustment . to illustrate the extent of hospital variation in rates of survival to discharge , we determined that the median or was 1.42 ( 95% ci : 1.37 to 1.46 ) , which suggests that there was a 42% greater odds of patients with identical covariates surviving to hospital discharge at one randomly selected hospital compared with another . after multivariable adjustment , the median adjusted survival rate was 11.9% ( range : 0% to 14.8% ) for the bottom decile of academic hospitals and 22.8% ( range : 20.8% to 36.2% ) for the top decile . similar patterns of hospital variation were observed for nonacademic hospitals and by hospital bed size and rural versus urban status ( table 2 ) . stratified ( bottom and top decile ) survival rates by hospital type max indicates maximum ; min , minimum . unadjusted rates of survival to discharge varied markedly across hospitals , with a median unadjusted rate for the bottom decile of 8.3% ( range : 0% to 10.7% ) and for the top decile of 31.4% ( range : 28.6% to 51.7% ) ( figure 2 ) . using hierarchical regression , we identified 36 predictors of inhospital survival to discharge ( table 1 ) . among the predictors were key demographic factors including age , female sex ( or 1.10 ; 95% ci : 1.06 to 1.13 , p<0.01 ) , and black race ( or 0.93 ; 95% ci : 0.87 to 0.99 , p=0.03 ) , comorbidities such as arrhythmia ( or 1.24 ; 95% ci : 1.20 to 1.28 , p<0.01 ) and myocardial infarction ( or 1.19 ; 95% ci : 1.14 to 1.24 , p<0.01 ) , and intraarrest factors including cardiac etiology ( or 1.18 ; 95% ci : 1.14 to 1.23 , p<0.01 ) and initial rhythm of vf or vt ( or 3.14 ; 95% ci : 3.02 to 3.27 ) . model predictors for survival to discharge ci indicates confidence interval ; icd , implanted cardioverter defibrillator ; or , odds ratio ; vf / vt , ventricular fibrillation / ventricular tachycardia . this figure illustrates inhospital cardiac arrest ( ihca ) rates ( yaxis ) across hospitals . . rates are adjusted for the patientlevel factors identified in table 1 . after applying the model coefficients to patients in the sample , we calculated riskadjusted survival rates for ihca for each hospital . the median adjusted rate was 12.4% ( range : 0% to 15.6% ) for the bottom decile and 22.7% ( range : 21.0% to 36.2% ) for the top decile . of note , of the 46 hospitals in the top decile for ihca survival before risk adjustment , only 24 ( 52% ) remained in the top decile after risk adjustment . to illustrate the extent of hospital variation in rates of survival to discharge , we determined that the median or was 1.42 ( 95% ci : 1.37 to 1.46 ) , which suggests that there was a 42% greater odds of patients with identical covariates surviving to hospital discharge at one randomly selected hospital compared with another . after multivariable adjustment , the median adjusted survival rate was 11.9% ( range : 0% to 14.8% ) for the bottom decile of academic hospitals and 22.8% ( range : 20.8% to 36.2% ) for the top decile . similar patterns of hospital variation were observed for nonacademic hospitals and by hospital bed size and rural versus urban status ( table 2 ) . stratified ( bottom and top decile ) survival rates by hospital type max indicates maximum ; min , minimum . in a large national registry of ihca , we found substantial variation in survival across hospitals . this variability was not explained by differences in patient casemix or hospital characteristics . given that survival outcomes are of immense importance to patients with ihca , these findings raise questions about the quality of resuscitation care at hospitals in the lower deciles and offer important opportunities to identify best practices at hospitals in the upper deciles . our study extends the work of prior studies of ihca , which largely focused on patientlevel aggregate rates of survival . while important , most of these studies have not examined the influence of the hospital in affecting survival . by employing multilevel hierarchical models to identify patient predictors in this study , we were able to derive robust riskadjusted survival rates for each hospital , which allowed us to examine the extent of sitelevel variation . indeed , we found that the hospital at which one is admitted may influence one 's odds of survival by 42% , an enormous effect considering that this is a hard clinical end points . however , the reason for these large variations in outcomes across hospitals is less clear . these variations in survival may suggest that significant differences in highquality resuscitation care exist among hospitals . top performing hospitals may have better response times for defibrillation , chest compressions , and initiation of acute cardiac life support medications ( eg , epinephrine , vasopressin ) , or may provide higherquality cardiopulmonary resuscitation ( eg , adequate depth , positioning and rate , minimal interruptions ) . these hospitals may also excel in postresuscitation care ( eg , therapeutic hypothermia ) , which arguably is an equally important determinant of survival after ihca . moreover , top performing hospitals may differ in structural variables ( eg , nursing staff ratios ) , training variables ( eg , routine resuscitation simulations , debriefing after ihca events ) , and hospital culture ( eg , leadership , emphasis on quality improvement , differences in duration of cpr)all of which may improve ihca survival outcomes . a second reason for significant variation in hospital survival may be related to differences in care prior to cardiac arrest . it is possible that top performing hospitals were able to achieve high rates of survival because their prearrest systems of care were able to detect physiological decline in patients earlier rather than later . as a result , their ability to respond and treat patients who developed ihca was more timely and effective . presence or absence of rapid response teams and the structure and function of these teams may also be a contributing factor to acrosshospital variation in outcomes . alternatively , it is plausible that hospitals with the highest rates of ihca survival do so because they have a high cardiac arrest incidence rate . therefore , they only appear to perform well with cardiac arrest survival because some patients go on to develop ihca when the event could have been prevented . as the relationship between incidence and outcomes is likely nonlinear , and there are multiple ways that incidence could impact outcomes , this variable was not included in this analyses but could be modeled in future work . finally , hospital differences in ihca survival and may be due to differential application of donotresuscitate orders for all admitted patients . thus , it is possible that the top performing hospitals have higher rates of donotresuscitate orders which would be a good outcome in the right patient and therefore would only appear to have better resuscitation outcomes . in order to better understand the determinants of hospital variation in ihca outcomes , these approaches will require onsite qualitative interviews with hospital administrators and medical and nursing staff to better understand a given site 's resuscitation practices , strategies to monitor and prevent ihca , and hospital culture and leadership . moreover , these analyses can provide insights into whether the success of higher performing hospitals is largely due to more liberal use of donotresuscitate orders . in the past , a mixedmethods approach was critical in differentiating hospitals with better doortoballoon times for stelevation myocardial infarction and identifying core components of top performing hospitals . needed are clear guidelines and policies that hospitals can implement to measure their performance , provide feedback to providers , and modify hospitalwide practices . in order to move the field of inhospital resuscitation science forward , future studies will need to shift from describing hospital variation to identifying and proscribing best practices at top performing hospitals . although our riskadjusted rates were able to control for multiple confounders , the presence of residual confounding in affecting ihca outcomes exists . if rates of unmeasured confounders differed markedly across hospitals , this could affect the magnitude of our hospital variation findings . there may also be additional , more granular patientlevel differences ( eg , laboratory values : prearrest creatinine , prearrest hematocrit , liver function tests ) or differences in data collection between hospitals that are not measurable in the gwtgr registry but may be important to consider in interpreting our reported results . patient and family preferences regarding endoflife care were not collected in gwtgr , nor did we have rates of donotresuscitate orders ( and timing or reason for these orders ) for all hospital admissions . therefore , some of the observed variation in ihca survival may be due to systematic differences in how aggressively hospitals offered guidance to patients on endoflife care . additionally , systematic validated information about neurologic status is not available for all patients in the gwgtr dataset . there may be significant variability in hospitals ' survival to discharge rates and survival to discharge with favorable neurologic outcomes , which could be identified . a better understanding of this important clinical outcome would be important for future work evaluating hospital variability in ihca outcomes . finally , gwtgr is a voluntary registry of hospitals ; therefore , our findings may not be generalizable to all us hospitals . although our riskadjusted rates were able to control for multiple confounders , the presence of residual confounding in affecting ihca outcomes exists . if rates of unmeasured confounders differed markedly across hospitals , this could affect the magnitude of our hospital variation findings . there may also be additional , more granular patientlevel differences ( eg , laboratory values : prearrest creatinine , prearrest hematocrit , liver function tests ) or differences in data collection between hospitals that are not measurable in the gwtgr registry but may be important to consider in interpreting our reported results . patient and family preferences regarding endoflife care were not collected in gwtgr , nor did we have rates of donotresuscitate orders ( and timing or reason for these orders ) for all hospital admissions . therefore , some of the observed variation in ihca survival may be due to systematic differences in how aggressively hospitals offered guidance to patients on endoflife care . additionally , systematic validated information about neurologic status is not available for all patients in the gwgtr dataset . there may be significant variability in hospitals ' survival to discharge rates and survival to discharge with favorable neurologic outcomes , which could be identified . a better understanding of this important clinical outcome would be important for future work evaluating hospital variability in ihca outcomes . finally , gwtgr is a voluntary registry of hospitals ; therefore , our findings may not be generalizable to all us hospitals . although ihca is associated with low survival , significant variation in survival exists across hospitals , even after adjustment for patient casemix . further research is needed to investigate additional patientlevel factors and identify best practices at top performing hospitals so that ihca outcomes can improve at all hospitals .

backgroundinhospital cardiac arrest ( ihca ) is common and often fatal . however , the extent to which hospitals vary in survival outcomes and the degree to which this variation is explained by patient and hospital factors is unknown.methods and resultswithin get with the guidelinesresuscitation , we identified 135 896 index ihca events at 468 hospitals . using hierarchical models , we adjusted for demographics comorbidities and arrest characteristics ( eg , initial rhythm , etiology , arrest location ) to generate riskadjusted rates of inhospital survival . to quantify the extent of hospitallevel variation in riskadjusted rates , we calculated the median odds ratio ( or ) . among study hospitals , there was significant variation in unadjusted survival rates . the median unadjusted rate for the bottom decile was 8.3% ( range : 0% to 10.7% ) and for the top decile was 31.4% ( 28.6% to 51.7% ) . after adjusting for 36 predictors of inhospital survival , there remained substantial variation in rates of inhospital survival across sites : bottom decile ( median rate , 12.4% [ 0% to 15.6% ] ) versus top decile ( median rate , 22.7% [ 21.0% to 36.2% ] ) . the median or for riskadjusted survival was 1.42 ( 95% ci : 1.37 to 1.46 ) , which suggests a substantial 42% difference in the odds of survival for patients with similar casemix at similar hospitals . further , significant variation persisted within hospital subgroups ( eg , bed size , academic).conclusionsignificant variability in ihca survival exists across hospitals , and this variation persists despite adjustment for measured patient factors and within hospital subgroups . these findings suggest that other hospital factors may account for the observed sitelevel variations in ihca survival .

Introduction Methods Study Database Study Population Study Design and Variables HospitalLevel Factors Outcomes Statistical Analyses Results Variation in Hospital Survival Rates Discussion Limitations Conclusion

according to the world health organization ( who ) classification of tumors , a grading scheme , which represents a malignancy scale and a key factor influencing the choice of therapies , has been successfully applied to astrocytomas , the most common type of glioma . glioblastoma is the most frequent type of brain tumor and the median survival time is 2 years after diagnosis . at present , no effective treatment has been developed for glioblastoma patients . molecular biomarkers are typically indicators of exposure , effect , or susceptibility . known risk factors , high - dose ionizing radiation , and smoking , account for only a small proportion of cases . recently , genome - wide association studies determined that inherited variants in some chromosomal regions , such as chromosomes 20q13.3 , 5p15.3 , and 11q23.3 , have a significant association with the risk of glioma . although genome - wide association studies ( gwas ) found that some sites have relationships with glioma , these studies are mainly limited to the european populations and there were significant differences between europeans and chinese in genetic background . therefore , we investigated whether the gene polymorphisms contribute to glioblastoma risk in a chinese han population from northwestern china . from october 2011 to september 2012 we recruited 72 gbm patients into an on - going molecular epidemiological study at the department of neurosurgery of the tangdu hospital affiliated with the fourth military medical university in xian , china . tumor histological type and grade were determined based on the who criteria and we successfully genotyped 72 gbm cases for further study . as controls we randomly selected 320 unrelated healthy individuals from the medical center of tangdu hospital from june 2011 to july 2012 according to standard recruitment and exclusion criteria . detailed recruitment and exclusion criteria were used . subjects with chronic diseases and conditions involving vital organs such as the heart , lung , liver , kidney , and brain , and/or had severe endocrinological , metabolic , or nutritional diseases were excluded from this study . all of the control subjects were generally healthy without diseases related to the vital organs and serum levels of alpha - fetoprotein and plasma carcinoembryonic antigen were within normal range . we excluded 18 samples because of missing information , resulting in successful genotyping of 302 healthy control subjects . we obtained demographic and personal data through a face - to - face interview via a standardized epidemiological questionnaire , which including age , sex , ethnicity , residence , smoking status , alcohol drinking , education status , and family history of cancer . in addition , patient clinical information was obtained through a medical record review or consulting treating physicians to understand the patient s condition . the use of human blood sample and the protocol in this study strictly conformed to the principles expressed in the declaration of helsinki and were approved by the institutional ethics committees of tangdu hospital and northwest university . written informed consent was obtained from all participants before their participation in the study . according to the previous glioma association analysis and snps with minor allele frequency ( maf ) greater than 0.05 in the hapmap chb ( han chinese in beijing , china ) population , we picked 29 snps from 21 genes . in genome - wide association studies , if the maf < 5% , some loci variants could not be detected in the samples , so the snps with minor allele frequency ( maf ) greater than 0.05 were used . we isolated genomic dna samples from the whole blood with goldmag - mini purification kit ( goldmag co. ltd . xian city , china ) , and concentrations were measured using a nanodrop 2000 device ( thermo scientific , waltham , massachusetts , usa ) . massarray assay design 3.0 software ( sequenom , san diego , ca , usa ) was used to design the pcr assay and iplex single - base extension primers for the multiplexed snp massextend assay . the snp genotypes were obtained according to the iplex protocol provided by sequenom massarray rs1000 ( sequenom . san diego , california , usa ) and the sequenom typer 4.0 software was used for data analysis . the chi - squared test was used to compare the differences in frequency distributions of genotypes and alleles between cases and controls . hardy - weinberg equilibrium was assessed using a pearson chi - squared test only among controls at the 1% level . odds ratios ( ors ) and corresponding 95% confidence intervals ( 95% ci ) were obtained by binary logistic regression analysis , which adjusted for age and sex . the possibility of sex differences was evaluated by a genotype test for each tsnp in males and females separately . we adopted the snp stats ( website software from http://bioinfo.iconcologia.net/snpstats/start.htm ) to analyze the association of certain single - nucleotide polymorphism loci contributed to the glioblastoma risk under variant models . we used the akaike s information criterion ( aic ) and bayesian information criterion ( bic ) to select the best - fit model for each snp . all p values presented were calculated based on a 2-sided test , and p<0.05 was considered significant . from october 2011 to september 2012 we recruited 72 gbm patients into an on - going molecular epidemiological study at the department of neurosurgery of the tangdu hospital affiliated with the fourth military medical university in xian , china . tumor histological type and grade were determined based on the who criteria and we successfully genotyped 72 gbm cases for further study . as controls we randomly selected 320 unrelated healthy individuals from the medical center of tangdu hospital from june 2011 to july 2012 according to standard recruitment and exclusion criteria . detailed recruitment and exclusion criteria were used . subjects with chronic diseases and conditions involving vital organs such as the heart , lung , liver , kidney , and brain , and/or had severe endocrinological , metabolic , or nutritional diseases were excluded from this study . all of the control subjects were generally healthy without diseases related to the vital organs and serum levels of alpha - fetoprotein and plasma carcinoembryonic antigen were within normal range . we excluded 18 samples because of missing information , resulting in successful genotyping of 302 healthy control subjects . we obtained demographic and personal data through a face - to - face interview via a standardized epidemiological questionnaire , which including age , sex , ethnicity , residence , smoking status , alcohol drinking , education status , and family history of cancer . in addition , patient clinical information was obtained through a medical record review or consulting treating physicians to understand the patient s condition . the use of human blood sample and the protocol in this study strictly conformed to the principles expressed in the declaration of helsinki and were approved by the institutional ethics committees of tangdu hospital and northwest university . written informed consent according to the previous glioma association analysis and snps with minor allele frequency ( maf ) greater than 0.05 in the hapmap chb ( han chinese in beijing , china ) population , we picked 29 snps from 21 genes . in genome - wide association studies , if the maf < 5% , some loci variants could not be detected in the samples , so the snps with minor allele frequency ( maf ) greater than 0.05 were used . we isolated genomic dna samples from the whole blood with goldmag - mini purification kit ( goldmag co. ltd . xian city , china ) , and concentrations were measured using a nanodrop 2000 device ( thermo scientific , waltham , massachusetts , usa ) . massarray assay design 3.0 software ( sequenom , san diego , ca , usa ) was used to design the pcr assay and iplex single - base extension primers for the multiplexed snp massextend assay . the snp genotypes were obtained according to the iplex protocol provided by sequenom massarray rs1000 ( sequenom . san diego , california , usa ) and the sequenom typer 4.0 software was used for data analysis . the chi - squared test was used to compare the differences in frequency distributions of genotypes and alleles between cases and controls . hardy - weinberg equilibrium was assessed using a pearson chi - squared test only among controls at the 1% level . odds ratios ( ors ) and corresponding 95% confidence intervals ( 95% ci ) were obtained by binary logistic regression analysis , which adjusted for age and sex . the possibility of sex differences was evaluated by a genotype test for each tsnp in males and females separately . we adopted the snp stats ( website software from http://bioinfo.iconcologia.net/snpstats/start.htm ) to analyze the association of certain single - nucleotide polymorphism loci contributed to the glioblastoma risk under variant models . we used the akaike s information criterion ( aic ) and bayesian information criterion ( bic ) to select the best - fit model for each snp . all p values presented were calculated based on a 2-sided test , and p<0.05 was considered significant . table 1 shows the basic information of candidate snps in our study such as chromosome position and minor allele frequency in case and control groups . we used the chi - squared test to assess the influence of gene polymorphism of gbm risk in the allele model , and found that 2 snps significantly increased gbm risk : rs2297440 [ rtel1 ( regulator of telomere elongation helicase 1 ; omim 608833 ) , or=1.72 , 95% ci : 1.172.52 , p<0.01 ] and rs6010620 [ rtel1 , or=1.72 , 95% ci : 1.182.52 , p<0.01 ) ] ( table 1 ) . genetic model analysis found that the variant genotype tt of rs17748 in treh ( a , a - trehalose-1-d - glucohydrolase ; trehalase ) phldb1 ( pleckstrin homology - like domain , family b , member 1 ) decreased the risk of gbm in the recessive model ( or=0.24 , 95% ci : 0.061.05 , p=0.02 ) ( table 2 ) . the variant genotype tt of rs498872 in phldb1 also correlated with a decreased risk in the recessive model ( or=0.14 , 95% ci : 0.021.09 , p=0.01 ) ( table 2 ) . conversely , individuals carrying the variant cc genotype of rs2297440 in rtel1 had higher gbm risk than those carrying tt and tc genotype in the recessive model ( or=7.46 , 95% ci : 2.9119.12 , p<0.01 ) . the genotype gg of rs6010620 in rtel1 also showed an increased risk in the recessive model ( or=7.72 , 95% ci : 3.0619.51 , p<0.01 ) ( table 2 ) . we further sought to determine whether any of the 29 snps had a sex - specific effect on gbm risk , and found that allele c of rs17748 in treh increased gbm risk in males ( or=4.10 , 95% ci : 1.968.59 , p=0.04 ) in the dominant model ( table 3 ) . in this case - control study we genotyped 29 snps in the han chinese population and identified rtel1rs2297440 and rs6010620 , trehrs17748 and phldb1 rs498872 are potentially associated with gbm . c of rs17748 in the treh gene showed an increased risk in males in the dominant model . rtel1 encodes a dna helicase that plays a crucial role in regulating telomere length in mice . based on these observations , rtel1 dysfunction appears to be closely related to the incidence of cancer . moreover , rtel1 plays an important role in maintaining genomic stability by suppressing homologous recombination and is a key protein in the repair of double - strand breaks ( dsbs ) through direct involvement in the dsb repair ( dsbr ) pathway . dsbr plays a prominent role in cell survival , maintenance of genomic integrity , and prevention of tumorigenesis . our results suggest that polymorphisms of the rtel1 gene may influence the risk of gbm in the han chinese population . moreover , genome - wide association studies have shown that rs6010620 and rs2297440 in 20q13.33 ( rtel1 ) are related to glioma risk in the european population . reported that rs6010620 is associated with susceptibility to high - grade glioma , and egan et al . showed that snps of rtel1 are associated with both low- and high - grade astrocytic tumors . thus , rtel1 may play complex roles in the development of gliomas of different origins . 20 phldb1 was expressed in all tissues examined , with the highest expression in ovary , brain , lung , and kidney . phldb1 protein contains an n - terminal phosphorylation - dependent forkhead - associated protein interaction domain , a central chromosome segregation atpase domain , and a c - terminal pleckstrin homology ( ph ) domain . studies have shown that the ph domain can bind pi(3,4,5)p3 and that phldb1 functions in adipocytes as a positive regulator of akt activation , where it is required for optimal insulin - induced glucose transport and glut4 translocation . it has been reported that phldb1 is an insulin - responsive protein and enhances akt activation . however , there are few studies of its potential regulatory or growth promoting activities with respect to glioma genesis . this snp was also reported to be associated with a change in diastolic blood pressure . in our study , we also found that phldb1 rs498872 is associated with gbm in the han chinese population . in support of this , association between glioma risk and rs498872 was recently identified in a genome - wide association study . this association was confirmed in other studies , including a previous study in a chinese han population [ 2224 ] . therefore , although phldb1 is associated with low - grade glioma , there is currently no direct functional evidence for a role of phldb1 in initiation of gbm . research on the properties of renal and urinary human trehalase found that expression of trehalase increased damage to renal tubes . therefore , it is a useful marker of renal proximal tubular damage . to the best of our knowledge , the present study is the first to show a relationship between treh rs17748 and gbm susceptibility . our findings and those of previous studies suggest that polymorphisms of particular genes play a role in gbm development . these findings should be taken into consideration in future research of genes causing disease susceptibility . due to the low incidence , based on the limitation of the present study , larger - sample studies are warranted to confirm our findings . the exact functions of these genes in gbm and the regulatory mechanisms for gene expression have not been elucidated and need to be further investigated .

backgroundglioblastoma ( gbm ) is a highly invasive , aggressive , and incurable brain tumor . genetic factors play important roles in gbm risk . the aim of this study was to elucidate the influence of gene polymorphism on gbm susceptibility.material/methodsin this case - control study , we included 72 gbm patients and 320 healthy controls to analyze the association between 29 single - nucleotide polymorphisms and gbm cancer risk in the chinese han population . the single - nucleotide polymorphisms were determined by sequenom massarray rs1000 and statistical analysis was performed using spss software and snpstats software.resultsusing the 2 test , we found that rs2297440 and rs6010620 in rtel1 increased risk of gbm . in the recessive model , we also found that the genotypes cc of rs2297440 and gg of rs6010620 in rtel1 significantly increased gbm risk . the variant tt genotype of treh rs17748 and the variant tt genotype of phldb1 rs498872 decreased gbm risk in the recessive model . we also found that the treh rs17748 variant c allele showed an increased risk in males in the dominant model.conclusionsour results suggest a significant association between the retl1 , treh , and phldb1 genes and gbm development in the han chinese population .

Background Material and Methods Study participants SNP selection and genotyping Statistical analysis Results Discussion Conclusions

caregiver is an individual who has the responsibility of meeting the physical and psychological needs of the dependent patient . psychiatric patients need assistance or supervision in their daily activities and this often places a major burden on their caregivers , thereby placing the caregiver at a great risk of mental and physical health problems . the term caregiver burden is used to describe the physical , emotional and financial toll of providing care . as the disease progresses , it carries with it a tremendous increase of burden on the caregiver who does the caregiving . the burden perceived by caregivers of patients with psychiatric illness is a fundamental prognostic aspect as the caregiver burden is reportedly a critical determinant for negative caregiving outcomes . the burden upon caregivers for a mentally ill patient living at home was first acknowledged by grad and sainbury in the early 1960s . the most common mental health consequences identified are depression , anxiety and burnout which occurs when a caregiver slips beyond exhaustion or depression . studies conducted showed that caregivers reported burden in different areas including effects on family functioning , social isolation , financial problems , and health . most of the notable community - based studies proved that 1847% of caregivers land in depression . it is also known that caring for someone with psychiatric illness is associated with a higher level of stress than caring for someone with functional impairment from other chronic medical illnesses . many authors opine that the level of burden does not correlate with the duration of illness , but has enough variability with age , gender and educational status . a previous study concluded that poor social support and severity of illness have major role in determining the amount of burden on a caregiver . the burden perceived by caregivers of patients with psychiatric illness is a fundamental prognostic aspect in the history of the disease , and the caregiver burden is reportedly a critical determinant for negative caregiving outcomes . caregiver burden is categorized in terms of objective burden ( ob ) , subjective burden ( sb ) and demand burden ( db ) . ob is defined as the extent of disruptions or changes in various aspects of the caregivers life and household . sb is defined as the caregivers attitude or emotional reactions to the caregiving experience . db measures the extent to which the caregiver feels the responsibilities are overly demanding . the assessment of burden has become a challenging task for most researchers because cultural , ethical , religious and other personal values may influence perceptions of meaning and consequences of burden . there is a paucity of data comparing the caregiver burden of psychiatric patients to that of chronic medical illness . the objective of this study is to evaluate the contrast between the caregiver burden of psychiatric and chronic medical illness patients and to study the association between demographic factors like age , gender , duration of care - giving and caregiver burden . the study sample consisted of caregivers of psychiatric inpatients admitted in the government hospital for mental care who were diagnosed as per the guidelines given in icd-10 . the psychiatric sample included schizophrenia ( 22 cases ) , mood disorder ( 16 cases ) and substance abuse ( 14 cases ) , and caregivers of patients suffering from chronic medical illnesses such as refractory tuberculosis , chronic bronchial asthma , diabetes mellitus , rheumatoid arthritis , and lodged in the king george hospital and tuberculosis , chest disease hospitals located in visakhapatnam . the caregivers were classified as group 1 ( g1 ) consisting of 50 caregivers of psychiatric patients and group 2 ( g2 ) consisting of appropriately matched caregivers of patients suffering from chronic medical illness . caregivers aged more than 20 years and who were staying with the patient since the onset of illness were included . the caregivers aged less than 20 years and those who were not blood related to the patients were excluded from the study . the caregivers were subjected to the montgomery borgatta caregiver burden scale questionnaire which was applied as a self - administered questionnaire in english to those who could understand it , and to the rest of the participants it was administered by interview technique in which the interviewer translated the questionnaire into the vernacular language in which both the patient and the interviewer were well versed . this is a 14-item questionnaire with 5 item responses to each question ; each response was given a score from 0 to 5 . of the 14 items in the questionnaire , a set of 6 questions measure ob , 4 questions measure sb and 4 questions measure db . montgomery borgatta caregiver burden scale the obtained data were tabulated and analyzed with descriptive statistics , levene 's test for equality of variance and t test ( spss software version 13.0 ) . caregivers aged more than 20 years and who were staying with the patient since the onset of illness were included . the caregivers aged less than 20 years and those who were not blood related to the patients were excluded from the study . the caregivers were subjected to the montgomery borgatta caregiver burden scale questionnaire which was applied as a self - administered questionnaire in english to those who could understand it , and to the rest of the participants it was administered by interview technique in which the interviewer translated the questionnaire into the vernacular language in which both the patient and the interviewer were well versed . this is a 14-item questionnaire with 5 item responses to each question ; each response was given a score from 0 to 5 . of the 14 items in the questionnaire , a set of 6 questions measure ob , 4 questions measure sb and 4 questions measure db . the obtained data were tabulated and analyzed with descriptive statistics , levene 's test for equality of variance and t test ( spss software version 13.0 ) . of the 100 caregivers included in the study , 44 were males and 56 were females , with an age range of 2060 years . tables 2 and 3 show the distribution of sample in demographic variables such as literacy level and duration of care giving respectively . the two samples that is psychiatric illness and chronic medical illness have almost similar characteristics in the literacy rate and duration of care giving . literacy level of care givers duration of care giving the montgomery borgatta caregiver burden scale scores in the caregivers of psychiatric patients were significantly higher than that of chronic medical illness caregivers with a p value of less than 0.0001 ( p<0.0001 ) in all the categories of caregiver burden , i.e. ob , sb and db [ table 4 and figure 1 ] . comarision of various care giver burdens categories psychiatric illness burden categories caregiver burden in psychiatric illness was observed to increase with the age of the caregiver except in db which increased up to a certain age and then decreased . the difference in caregiver burden among different age groups of psychiatric patient and chronic medical illness caregivers is also statistically significant with p value of less than 0.0001 ( p<0.0001 ) [ table 5 and figure 2 ] . association of care giver burden with age of care giver psychiatric illness caregiver burden with age of caregiver there was a minor caregiver burden variation with the gender of caregiver , with the burden being higher among females ( n=44 ) for sb and ob and among males for db ( n=56 ) . the difference observed is not statistically significant with p=0.4694 for ob , p=0.3851 for sb and p=0.7319 for db [ table 6 ] . association of care giver burden with gender the caregiver burden in objective domain for psychiatric illness patients was observed to increase with the duration of care - giving till a certain period and then decreased . the difference in caregiver burden for various duration categories among psychiatric illness and chronic medical illness is statistically significant with p value less than 0.0001 ( p<0.0001 ) [ table 7 and figure 3 ] . our analysis shows that caregiver burden in our population is less as the ob which measures the disruption of the caregiver 's life and the db which measures the extent to which the caregiver feels care responsibilities are overly demanding do not cross the reference high value in the given scale , whereas sb which measures the emotional impact of caregiving responsibilities on a caregiver is on the higher side . a study conducted in 2004 by erie county department of senior service caregiver resource centre showed very high values of burden than those in this study . these observations can be explained by the presence of intimate family relations and social support in the indian culture . the results of this study comparing caregiver burden for caregivers of psychiatric illness patients and chronic medical illness patients are in agreement with those of other similar studies and show more caregiver burden for caregivers of psychiatric illness patients . these observations may be due to the varied nature of psychiatric illness and the bizarre and inappropriate behavior of the psychiatrically ill , as these factors disrupt the relation between the caregiver and the patient . in spite of the adequate care , affection and support given by the caregiver moreover , in some cases , the patient may even suspect the motives of the caregiver . these aspects of psychiatric illness further take a toll and worsen the burden on the caregiver . the varied mood swings , disturbed sleep pattern , aggressive and violent outbursts are some other aspects of illness that may further worsen the burden of caregiver . lastly , the personal , social and occupational deterioration in the patient 's life may reflect negatively on the burden experienced by the caregiver . surprisingly , the level of burden did not correlate with the gender of caregiver , but had enough variability with the age of caregiver and duration of caregiving . in this study , the results show that caregiver burden in objective and subjective domains increases with increase in age of the caregiver . the ability of the caregiver to cope up with the physical and mental stress starts diminishing with increase in age due to added responsibilities of the caregivers related to their career , family and their own health , whereas the db increases to a certain age and then decreases as the caregiver understands the disease process better after a certain age and is better adapted to the demands of the patient and his / her illness . this study shows that there is only little difference in caregiver burden among female and male caregivers , with the ob and sb being higher in females while the db is slightly higher in males , but these observations are not statistically significant . the caregiver burden in terms of ob was observed to increase with the duration of caregiving up to a certain extent but subsequently it decreased as the caregivers became less sensitive and began to modify their lifestyle . the sb which mainly measures the emotional impact on caregivers increased with the duration of illness , and db also showed a similar pattern of increase with the duration of illness . as all people in the sample were not educated and there was no rating scale measuring caregiver burden in vernacular language , the scale had to be translated into local language , which can be a confounding factor . the sample did not include dementia in which the caregiver burden is very high . as all people in the sample were not educated and there was no rating scale measuring caregiver burden in vernacular language , the scale had to be translated into local language , which can be a confounding factor . the caregiver burden in families of psychiatric clients is statistically higher than that of caregivers of other medical illnesses . the caregiver burden increases with the duration of illness as well as with the age of caregivers . the caregiver burden in our population was less as the ob and db did not cross the reference higher value in the given scale , whereas the emotional impact measured by sb was on the higher side . the various means to reduce ob are to improve home care , adult day care , routine friendly visits and use of assistive equipment . sb can be reduced by professional counselling and by the assistance of support groups , while db can be lowered by professional counselling and educating more about the disease .

background : caregivers of individuals suffering from psychiatric illness are at risk of being subjected to mental health consequences such as depression , anxiety and burnout . community - based studies proved that 1847% of caregivers land in depression . the caregiver burden can be quantified into objective , subjective and demand burdens . there is paucity of data comparing the caregiver burden of psychiatric patients and that of chronic medical illness patients.aims and objectives:(1 ) to compare the caregiver burden in psychiatric illness and chronic medical illness . ( 2 ) to study the association of caregiver burden with demographic factors like age , gender , duration of caregiving.materials and methods : the study included two groups of caregivers , each of 50 members . group 1 consisted of caregivers of psychiatric patients and group 2 consisted of caregivers of chronic medical illness patients . the montgomery borgatta caregiver burden scale was used to assess the burden in terms of objective , subjective and demand burdens.results and conclusion : the caregiver burden scores in the caregivers of psychiatric patients were significantly higher than that of chronic medical illness ( p<0.0001 ) . the caregiver burden was found to increase with the duration of illness as well as with the age of caregiver . the caregiver burden in the sample population was less as the objective and demand burden did not cross the reference higher value in the given scale , whereas the emotional impact given by the subjective burden was on higher side .

INTRODUCTION MATERIALS AND METHODS Inclusion and exclusion criteria Statistical analysis RESULTS DISCUSSION Limitations CONCLUSION

anesthesia providers routinely care for patients undergoing magnetic resonance imaging ( mri ) , and the implications for patient care are well known . however , there is scant literature on the occupational hazards of mri for health care workers . it is well known in the radiology community that exposure to a magnetic field of sufficient strength from an mri scanner can cause vertigo , though the practical considerations for health care workers involved in direct patient care are not well established.1 in the 3 months following introduction of a 3 t mri scanner ( replacing a 1.5 t scanner ) at our institution , there were three incidents of vertigo reported by our anesthesia providers , unseen during years of standard mri anesthesia practice . herein , we describe one such case of an anesthetist experiencing acute vertigo while caring for a patient undergoing a scan in a 3 t mri machine . we then discuss the incidence , mechanism , risk factors , and practical implications of this phenomenon . a 52-year - old male nurse anesthetist with no significant past medical history was caring for a patient undergoing an mri in a 3 t scanner ( magnetom skyra ; siemens healthcare , erlangen , germany ) under sedation with a propofol infusion . on two occasions , he had to approach and lean toward the mri bore to assess the patient s airway patency . during these events , there was no headache , ocular complaint , tinnitus , or other subjective neurologic deficit . he did not lose his balance or become nauseated though the vertigo was so intense that he felt he needed to sit down . the sensation lasted for 1520 seconds and resolved when he stopped moving and sat down in a chair . the anesthetist had no history of vertigo , inner or middle ear dysfunction , or recent respiratory infection . the vertigo was attributed to exposure to the mri , and no further evaluation or treatment was required . the anesthetist felt that the intensity of the vertigo was such that it impaired his ability to provide safe care and he requested that he not be assigned to the mri in the future . multiple authors have reported transient sensory effects , including vertigo , nausea , dizziness , metallic taste , and visual phosphenes , in subjects exposed to static magnetic fields.1 despite being a well - known phenomenon , there are only limited data about the incidence and contributing factors of mri - induced vertigo . in a survey of workers in an mri scanners manufacturing department , 22% reported experiencing vertigo while at work.2 wilen and de vocht3 published the results of a questionnaire , about health complaints , given to nurses working with mri scanners . in that study , 47% of the nurses surveyed reported at least one health complaint , but only 15% attributed the symptoms to mri exposure . seven percent reported vertigo or dizziness specifically , 12% reported an illusion of movement , and 14% reported a ringing sensation in the head . in a recent observational study of 361 clinical and research employees working in mri facilities , 5.6% of study subjects exposed to a static magnetic field reported vertigo.4 the vestibular system in the inner ear is the peripheral organ that is primarily responsible for the sensation of balance as well as movement in one s environment . it is composed of the six ( three on each side ) semicircular canals that detect angular acceleration , in addition to the connected structures known as the utricle and the saccule that detect linear acceleration ( figure 1 ) . these structures are filled with fluid known as endolymph that moves or flows when the head moves in space . this fluid movement causes deflections of tiny stereocilia attached to specialized neural structures within the vestibular apparatus , known as hair cells , which respond to these movements by firing neural impulses to the brain that in turn are ultimately interpreted as the perception of movement ( figure 2 ) . as a result , the vestibular system can become activated through hydrodynamic pressure changes in the endolymph , direct deflection of stereocilia , or neurostimulation via electrical currents . however , the precise mechanism through which magnetic vestibular stimulation occurs is unclear , with some proposed mechanisms including electromagnetic induction ( ie , voltage induced by a changing magnetic field ) and magnetic susceptibility differences between vestibular organs and surrounding fluid.5 in 2011 , roberts et al6 published compelling evidence that the static magnetic field produced by the mri scanner is the primary cause of vertigo caused by interaction with the vestibular system in the inner ear . the authors contend that the magnetic field induces an electrical perturbation in the potassium - rich endolymph within the semicircular canals , which stimulates the hair cells in the vestibular system , thereby causing an abnormal sensation of movement . this work was later refined by providing more - detailed calculations of the lorentz forces and resulting pressures within the vestibular system in strong static magnetic fields ( figure 3).7 more recently , stationary exposures to a static 7 t mri field were found to be associated with the presence of vertigo and nystagmus , and the reversal of symptoms following withdrawal from the field was taken as evidence for adaptation to continuous vestibular input caused by the static magnetic field.8 a separate body of work further confirms that these effects should be more pronounced with stronger magnetic fields that are encountered with higher - field - strength mri scanners and in closer proximity to the epicenter of the mri scanner bore ( ie , on the patient undergoing the mri ) . de vocht et al2 reported an increase in the incidence of symptoms with higher - strength magnets ( 1.0 t and higher ) and increased exposure time ( > 20 minutes ) . wilen and de vocht3 reported that the majority of symptoms in the study subjects were observed after exposure to higher - strength magnets ( 1.5 t and 3.0t).3 there is evidence that the measured velocity of nystagmus in mri - exposed volunteers increases in proportion to the strength of the magnetic field,9 and schaap et al4 have found a positive correlation between scanner strength and reported symptoms in health care and research workers using 1.5 t , 3 t , and 7 t systems . given that the fringe magnetic field declines exponentially with distance from the mri scanner , the anesthetist in the current case would have experienced the largest static magnetic field when peering into the end of the bore to evaluate the sedated patient , which corresponded to symptom onset ( figure 4 ) . although variable depending on the exact position of the anesthetist s head relative to the magnetic flux isolines of the 3 t scanner , it is likely that the anesthetist s head was experiencing a magnetic field on the order of 2 t . although the static magnetic field appears to play the strongest role in magnetic vestibular stimulation , the induction of electrical current within a time - varying magnetic field may still be contributory . however , these are much smaller in magnitude than the static magnetic field , so the net changes in the fringe magnetic field felt by anesthesia staff outside of the bore are rather small . the second form of time - varying magnetic field occurs when moving through a magnetic field , such as when the patient is advanced into and out of the mri scanner bore . this becomes applicable to health care workers as they move through the magnetic field in the mri scanner room , which includes both linear ( walking ) and angular ( head rotation ) movement . laakso et al10 modeled head movement in the vicinity of a 3 t mri scanner and found that induced eddy currents are within the same order of magnitude as currents used to electrically stimulate the vestibular apparatus . furthermore , faster motion through the magnetic field will produce stronger electrical currents and thus , in theory , more frequent or intense vertigo . in fact , de vocht et al11 reported a much higher incidence of vertigo in subjects who were defined as fast movers as opposed to slower - moving subjects . in addition , head position in relation to the mri bore is an important factor , mainly because the strength of the static magnetic field is stronger within the mri bore . furthermore , if a person s head is within the bore , he or she may be exposed to the gradient and radiofrequency magnetic fields that are usually confined to the patient , and this may in theory increase the likelihood of vertigo.12 it is unknown whether there are any subject - specific factors , such as age , gender , body weight , or other medical conditions ( in particular preexisting vertigo disorders ) , that predispose a person to experiencing vertigo when exposed to an mri scanner . currently , there are no known long - term sequelae from mri - induced vertigo or , for that matter , from mri exposure in general . clinical experience suggests that the symptoms of vertigo are mild and transient , disappearing when exposure to the magnetic field ceases . preliminary data also suggest that low - dose diphenhydramine may help lessen symptoms,13 which may be useful for awake and symptomatic patients undergoing mri but is not practical for workers because of the drug s sedating effects . interestingly , there is substantial evidence that exposure to mri can adversely affect measurable neurobehavioral functions such as hand eye coordination and visual tracking tasks when subjects move their heads within a static magnetic field of 1.53.0 t . there is some theoretical concern that higher - strength magnets , in particular , could pose some safety and performance issues for health care providers by causing disequilibrium , poor hand eye coordination , nausea , or falls.1 regulations regarding occupational exposure to high - field - strength mri scanners have been deficient in some countries and misleading in others . the european union issued the physical agents ( emf ) directive in 2004 , which was primarily intended to limit the exposure of electrical power and telecommunications workers to electromagnetic fields , or emfs as they are known . however , this legislation had the unintended consequence of potentially constraining the clinical use of mri , particularly at 3 t field strengths , which have become part of standard - of - care imaging.15 according to the guidelines on the limits of exposure to static magnetic fields , published in 2009 by the international commission on non - ionizing radiation protection ( icnirp ) , head and neck exposure to static magnetic fields should not exceed 2 t due in large part to concerns about symptoms of vertigo and nausea.1 the most recent icnirp guidelines published in 2014 further distinguish between controlled and uncontrolled exposures.16 in general , health care workers operating in the vicinity of an mri scanner would be considered to be in a controlled environment because they have training on the biologic effects of high - field - strength mri and they typically can control their movements when exposed to the magnetic field . as such , the workers can decrease the likelihood of experiencing vertigo by maximizing the distance between themselves and the mri scanner ( to reduce the effect of the static magnetic field ) and limiting their motion to maintain the magnetic flux density below 2 t for any 3-second period ( ie , to decrease the potential for motion - induced electrical currents ) . in directive 2013/35/eu , the european union established new standards for exposure to static and time - varying magnetic fields but largely exempted the use of mri equipment in the health sector . this begs the question of what are the occupational exposure limits for health care workers in the us ? anesthesiologists are exposed to mri more than most other clinicians , but the major anesthesiology organizations have not declared an official stance on mri exposure . the american society of anesthesiologists practice advisory on anesthetic care for magnetic resonance imaging , published in 2009 , does not address vertigo or other potential health effects of mri exposure.17 in fact , occupational exposure is not addressed at all in those guidelines . in a letter to the editor of anesthesiology in 2010 , bryan et al18 expressed concerns about the lack of both adequate tracking and standard exposure limits to electromagnetic fields among health care personnel . clearly , as scanners become stronger , anesthesia providers and other health care personnel may be exposed to much stronger magnetic fields . in the absence of clear guidelines for exposure limits and safe practices , we suggest that local institutions educate anesthesia providers about the risks of vertigo induced by mri exposure and formulate standard practices to prevent and manage those symptoms . recent data from schaap et al19 confirm that workers with the same job demonstrate significant variability in exposure levels to both static magnetic fields and motion - induced time - varying magnetic fields . this inconsistency suggests that education and behavioral modification have the potential to reduce exposure and potentially decrease the incidence and severity of vertiginous symptoms . in our institution obviously , limiting exposure altogether is the ideal practice , so if it is feasible , the anesthesia provider should simply remain outside of the mri room and remain inside the mri room for as little time as possible . in cases where the anesthesia provider must be close for monitoring or needs to actively attend to a patient , the practitioner should be advised to avoid rapid head movements and to avoid leaning directly into the scanner bore . furthermore , if the symptoms become too intense or begin to interfere with safe work practice , the anesthetist should notify the mri technician and call for immediate assistance . finally , our anesthetists have been encouraged to obtain an evaluation by occupational medicine and can opt out of practicing in the mri environment if health concerns are significant . since the initiation of an educational program and these practice recommendations , we have had no problems with vertigo among our anesthesia providers .

vertigo induced by exposure to the magnetic field of a magnetic resonance imaging ( mri ) scanner is a well - known phenomenon within the radiology community but is not widely appreciated by other clinical specialists . here , we describe a case of an anesthetist experiencing acute vertigo while providing sedation to a patient undergoing a 3 tesla mri scan . after discussing previous reports , and the evidence surrounding mri - induced vertigo , we review potential etiologies that include the effects of both static and time - varying magnetic fields on the vestibular apparatus . we conclude our review by discussing the occupational standards that exist for mri exposure and methods to minimize the risks of mri - induced vertigo for clinicians working in the mri environment .

Introduction Case report Discussion

this has caused widespread concern , considering the associations between obesity and a range of adverse health conditions . there is a widely held view that the increasing rates of obesity will lead to an epidemic of diabetes , other chronic conditions , and a subsequent reduction in life expectancy . however the picture is complicated . since the 1960s all - cause and cardiovascular - specific mortality rates have decreased steadily in most developed countries , and life expectancy has consistently increased . the aim of this paper is to suggest several reasons for the discrepancy between increasing levels of obesity and gains in life expectancy , and those factors may be masking the effects of obesity on life expectancy . a better understanding of the way in which obesity affects health and longevity will help determine the most appropriate response to increasing levels of excess body weight and assist our understanding of the likely impact of obesity on the health of individuals and the future burden on the health care system . this is considered to have led to an epidemic of type ii diabetes . the progression of this epidemic , in tandem with cardiovascular disease and several other morbidities associated with obesity , is predicted to slow or reverse the decline in mortality that has been noted in most western countries over the past 3040 years . the data accumulated to date have provided relatively little evidence in support of this view . levels of obesity have been increasing since the 1950s ( albeit slowly , initially ) in the usa and other developed countries . over the same period , life expectancy has continued to increase at an undiminished rate , and cardiovascular - specific mortality rates have also decreased continually . ( 1 ) improvement in other risk factorsit is possible that the deleterious impact of obesity is outweighed by other factors favourably influencing life expectancy . ( 2010 ) have reported that in the united states three of the six major risk factors for chd total cholesterol , prevalence of smoking , and physical activity levels improved between 1988 and 2003 . the rate of decline of all - cause and cvd mortality might be faster still if it was not for the increasing prevalence of diabetes [ 5 , 6 ] , for which there is a clear association with heart disease . examples of factors driving mortality down include population - wide changes such as reductions in the prevalence and intensity of smoking 2009 ) have predicted that over the next decade the negative effects of increasing levels of obesity will outweigh the benefits from reductions in the prevalence of smoking . however , peto et al . ( 2010 ) critiqued this finding , suggesting that stewart et al . ( 2009 ) have overestimated the hazards of obesity and underestimated the hazards of smoking . it is possible that the deleterious impact of obesity is outweighed by other factors favourably influencing life expectancy . ( 2010 ) have reported that in the united states three of the six major risk factors for chd total cholesterol , prevalence of smoking , and physical activity levels improved between 1988 and 2003 . the rate of decline of all - cause and cvd mortality might be faster still if it was not for the increasing prevalence of diabetes [ 5 , 6 ] , for which there is a clear association with heart disease . examples of factors driving mortality down include population - wide changes such as reductions in the prevalence and intensity of smoking . ( 2009 ) have predicted that over the next decade the negative effects of increasing levels of obesity will outweigh the benefits from reductions in the prevalence of smoking . however , peto et al . ( 2010 ) critiqued this finding , suggesting that stewart et al . ( 2009 ) have overestimated the hazards of obesity and underestimated the hazards of smoking . ( 2 ) pharmacological treatmentthere is the possibility of improved medical interventions in some of the pathways linking obesity to cvd and all - cause mortality . for example , improved control of hypertension and better management of dyslipidaemia may blunt the impact of obesity on adverse health outcomes [ 3 , 9 ] . hypertension has been fairly well controlled in recent years , and there has been increased use of statins , angiotensin pathway inhibitors , and aspirin , all of which may be contributing to the limited effect of rising obesity levels . there is the possibility of improved medical interventions in some of the pathways linking obesity to cvd and all - cause mortality . for example , improved control of hypertension and better management of dyslipidaemia may blunt the impact of obesity on adverse health outcomes [ 3 , 9 ] . hypertension has been fairly well controlled in recent years , and there has been increased use of statins , angiotensin pathway inhibitors , and aspirin , all of which may be contributing to the limited effect of rising obesity levels . ( 3 ) prevalence of more extreme obesitythe impact of obesity may have been overestimated because its principal adverse effects are experienced by a minority of the population . the most robust estimates of the association between bmi and mortality , from the prospective studies collaboration of 900,000 adults in 57 prospective studies , suggests that the mortality risk from excess body weight increases from a bmi of 25 but is not substantial until bmi exceeds 3235 . it is a significant proportion but nevertheless a clear minority of the population , at least currently . although significant increases in the prevalence of severe obesity ( bmi > 40 ) have been reported in a number of countries [ 11 , 12 ] , the risk for this group is outweighed by the considerably less significant risks associated with body weight in the majority of the population ( figure 1 ) . the impact of obesity may have been overestimated because its principal adverse effects are experienced by a minority of the population . the most robust estimates of the association between bmi and mortality , from the prospective studies collaboration of 900,000 adults in 57 prospective studies , suggests that the mortality risk from excess body weight increases from a bmi of 25 but is not substantial until bmi exceeds 3235 . it is a significant proportion but nevertheless a clear minority of the population , at least currently . although significant increases in the prevalence of severe obesity ( bmi > 40 ) have been reported in a number of countries [ 11 , 12 ] , the risk for this group is outweighed by the considerably less significant risks associated with body weight in the majority of the population ( figure 1 ) . ( 4 ) reversal of relationship in old agein old age those of low body weight are at higher risk of disability ( limitations to activities of daily living ) and mortality . the relationship between obesity and health appears to reverse in old age . 1988 ) found little relationship between bmi and mortality in older adults , except for those of very low body weight , who had a higher mortality than others . it is likely , however , that this reversal of the obesity and health relationship in older people is due to weight loss in old age due to health problems or disease . in old age those of low body weight are at higher risk of disability ( limitations to activities of daily living ) and mortality . ( 1988 ) found little relationship between bmi and mortality in older adults , except for those of very low body weight , who had a higher mortality than others . it is likely , however , that this reversal of the obesity and health relationship in older people is due to weight loss in old age due to health problems or disease . ( 5 ) body weight per se not associated with mortalityit is possible that body weight is not a significant risk factor for mortality . body weight may act simply as a surrogate for a constellation of attributes of lifestyle , in particular diet , physical activity level , and genetic factors . if this were the case , obese individuals would represent a heterogeneous group of high body weight due to a variety of reasons , some of which may not be so strongly related as others to morbidity or mortality . body weight may act simply as a surrogate for a constellation of attributes of lifestyle , in particular diet , physical activity level , and genetic factors . if this were the case , obese individuals would represent a heterogeneous group of high body weight due to a variety of reasons , some of which may not be so strongly related as others to morbidity or mortality . ( 6 ) latency period and cohort effectit is possible that the deleterious impact of recent obesity trends has not yet affected life expectancy due to a considerable latency period between onset of obesity and disease . recent cohorts of the us population are experiencing a greater magnitude and duration of obesity over their lifetime . the duration of exposure to obesity has been reported to have an important impact on disease and mortality . thus , it is possible that the adverse impact of obesity is a function of both severity and duration , and that with more recent cohorts the deleterious impact of obesity on life expectancy will be observed . indeed , recent mortality statistics ( 2008 ) in the us demonstrate , for the first time in over 25 years , a slight decline in us life expectancy . nevertheless , in this same report diabetes and cardiovascular mortality rates maintain a continual decline . furthermore , in an assessment of overweight and obesity on the risk of cardiovascular disease and mortality in middle - aged men , arnlov et al . additionally , the positive effects of weight loss after bariatric surgery on conditions such as diabetes , hypertension , and dyslipidemia have occurred in a much shorter period ( less than two years ) . it is possible that the deleterious impact of recent obesity trends has not yet affected life expectancy due to a considerable latency period between onset of obesity and disease . recent cohorts of the us population are experiencing a greater magnitude and duration of obesity over their lifetime . the duration of exposure to obesity has been reported to have an important impact on disease and mortality . thus , it is possible that the adverse impact of obesity is a function of both severity and duration , and that with more recent cohorts the deleterious impact of obesity on life expectancy will be observed . indeed , recent mortality statistics ( 2008 ) in the us demonstrate , for the first time in over 25 years , a slight decline in us life expectancy . nevertheless , in this same report diabetes and cardiovascular mortality rates maintain a continual decline . furthermore , in an assessment of overweight and obesity on the risk of cardiovascular disease and mortality in middle - aged men , arnlov et al . additionally , the positive effects of weight loss after bariatric surgery on conditions such as diabetes , hypertension , and dyslipidemia have occurred in a much shorter period ( less than two years ) . ( 7 ) the obesity paradoxthere is the obesity paradox in which survival from acute events such as myocardial infarction , heart failure , and dialysis for renal failure is improved in patients with overweight and obesity [ 2022 ] . the mechanism for this observation is not known but is unlikely to be simply that more severely ill patients have lost weight on account of the severity of their illness . it is also possible that diseases such as hypertension and diabetes may be more aggressive and of a different origin in lean individuals than when they are associated with obesity . for example , among patients with a history of hypertension and coronary artery disease , uretsky et al . ( 2007 ) found that overweight and obesity ( classes i to iii ) were associated with a lower risk of morbidity and mortality compared with normal - weight patients , despite poorer blood pressure control . there is the obesity paradox in which survival from acute events such as myocardial infarction , heart failure , and dialysis for renal failure is improved in patients with overweight and obesity [ 2022 ] . the mechanism for this observation is not known but is unlikely to be simply that more severely ill patients have lost weight on account of the severity of their illness . it is also possible that diseases such as hypertension and diabetes may be more aggressive and of a different origin in lean individuals than when they are associated with obesity . for example , among patients with a history of hypertension and coronary artery disease , uretsky et al . ( 2007 ) found that overweight and obesity ( classes i to iii ) were associated with a lower risk of morbidity and mortality compared with normal - weight patients , despite poorer blood pressure control . thus , considerations such as lag time , duration of exposure to obesity , and increasing proportions of the population with severe obesity suggest that obesity may in the future have a considerable impact on life expectancy . however there are also important reasons improved control of hypertension , shape of bmi - mortality relationship , and body weight as a surrogate marker of lifestyle why obesity may not be strongly linked to life expectancy , except at the extremes of the weight distribution . rather , the principle impact of obesity may be on disability - free life expectancy . several studies suggest an association between body weight and a higher risk of becoming disabled [ 2325 ] , although others dispute this [ 3 , 26 ] . thus , considerations such as lag time , duration of exposure to obesity , and increasing proportions of the population with severe obesity suggest that obesity may in the future have a considerable impact on life expectancy . however there are also important reasons improved control of hypertension , shape of bmi - mortality relationship , and body weight as a surrogate marker of lifestyle why obesity may not be strongly linked to life expectancy , except at the extremes of the weight distribution . rather , the principle impact of obesity may be on disability - free life expectancy . several studies suggest an association between body weight and a higher risk of becoming disabled [ 2325 ] , although others dispute this [ 3 , 26 ] . several reasons explain why the impact of obesity on life expectancy may be more complex than is commonly recognised . it is possible that the principal impact of obesity is on disability - free life expectancy rather than on life expectancy itself . it is also possible that health and life expectancy gains could be even greater if it was not for the increasing prevalence of extreme obesity . it is important to understand why life expectancy is generally continuing to improve despite a high and increasing prevalence of obesity . further research in this area and careful monitoring of recent cohorts and future trends will assist policy makers with determining the most appropriate response to increasing levels of obesity . if only those with more extreme obesity are facing substantial health and mortality risks , this will help inform as to the appropriate mix of population and high - risk ( targeting people already obese , or at risk of significant weight gain , e.g. ) approaches to obesity reduction . if the principle impact of obesity is on disability - free life expectancy rather than on life expectancy itself , this has substantial implications for the heath of individuals and the future burden on the health care system .

background . increasing levels of obesity over recent decades have been expected to lead to an epidemic of diabetes and a subsequent reduction in life expectancy , but instead all - cause and cardiovascular - specific mortality rates have decreased steadily in most developed countries and life expectancy has increased . methods . this paper suggests several factors that may be masking the effects of obesity on life expectancy . results . it is possible that health and life expectancy gains could be even greater if it was not for the increasing prevalence of extreme obesity . it is also possible that the principal impact of obesity is on disability - free life expectancy rather than on life expectancy itself . conclusion . if the principal impact of obesity were through disability - free life expectancy rather than on life expectancy itself , this would have substantial implications for the health of individuals and the future burden on the health care system .

1. Introduction 2. Population Trends 3. Conclusion

although the peripheral nervous system has the ability to regenerate axons following injury , when nerve gaps are larger than 12 cm , bridging strategies are required for repair . in such cases , autologous nerve grafts have been used as the gold standard ( deumens et al . , 2010 ; pfister et al . , . however , there are limited numbers of suitable sites for harvesting nerve grafts , because of the adverse effects to donor sites , such as the loss of motor and sensory function . in order to overcome these issues , scaffold bridging materials that may be synthetic , absorbable or non - absorbable have been studied vigorously . through these studies , several criteria were suggested to be necessary for better results , as follows : 1 ) the bridging conduit is necessary to maintain adequate mechanical support of separated nerve ends , in addition to preventing the diffusion of neurotrophic and neurotropic factors secreted by transected stumps ( deumens et al . , 2010 ) ; 2 ) nerve scaffolds should be biocompatible in order to eliminate undesirable influences on neural cells / tissues , such as immune rejection ( avitable et al . , 2001 ) ; 3 ) it should be degradable and/or absorbable in the appropriate duration in vivo ( de ruiter et al . , 2009 ) ; 4 ) it must have sufficient permeability for nutrient and gas exchange ( she et al . , 2008 ) ; and 5 ) it must have a biomechanical flexibility to allow bending at the graft site , without kinking the transected nerve stumps ( gu et al . , 2011 ) . for longer nerve gap injuries , scaffolds with a single hollow lumen represent the basic structure , but this has been refined using various biosynthetic materials in order to mimic the nerve - graft structure and to facilitate axonal re - extension . the multi - luminal substructure ( de ruiter et al . , 2008b ) and the filament - filled structure ( bunting et al . ; hu et al . , 2008 ) are typical cases ; the former shows no significant benefit , but the latter shows improved nerve regeneration , as compared to the single lumen scaffold . intraluminal surface coating with extracellular matrix ( ecm ) components , such as laminin , fibronectin and collagen , has been also attempted to promote active axonal re - growth . first , this was attempted using a single hollow conduit , and several positive effects were obtained ( kauppila et al . , 1993 ; the use of conduits of biological origin , such as acellular conduits , which have preserved ecm components , but are decellularized and immunosuppressed , was another approach ( frerichs et al . , 2002 ; hudson et al . , 2004a ) . however , use of this hollow - type conduit shows non - significant effects on nerve regeneration across long gaps ( pfister et al . , 2011 ) . in contrast , conduits including laminin - coated collagen fibers were able to support the regeneration of long sciatic nerve gaps of over 80 mm in dogs ( matsumoto et al . , 2000 ) . at this point , the filament - filled conduit with laminin coating is likely to be the best alternative method . importantly , these efforts have been performed to expect alternative effects of laminin - coated fibers in the conduit , similar to the basal lamina sheet in the individual endoneurium of the healthy nerve fibers . laminin coating may exert supportive effects for the migration , proliferation and orientation of preserved schwann cells , similarly to formation of bands of bungner , which normally occurs in the case of axonotmesis ( deumens et al . furthermore , application of growth factors into the conduit is another method to mimic native conditions . for example , supply of several factors into the conduit , such as nerve growth factor ( ngf ) , brain - derived neurotrophic factor ( bdnf ) , glial cell line - derived neurotrophic factor ( gdnf ) , ciliary neurotrophic factor ( cntf ) , basic fibroblast growth factor ( bfgf ) and insulin - like growth factor-1 ( igf-1 ) , has also been performed , and favorable effects on axonal growth and nerve regeneration have been confirmed ( rich et al . , 1989 ; nachemson et al . , 1990 ; fine et al . , 2002 ; all of the applications described above were based on the notion of simulating the healthy nerve graft condition . in this regard , transplantation of schwann cells with the conduit is considered to be the best method as the alternative for nerve grafting . acellular conduits have thus been used with several cell sources , including schwann cells and/or schwann - like cells induced from cultivated bone morrow stromal cells ( dezawa et al . , 2005 ) , olfactory ensheathing cells ( radtke et al . , 2011 ) and adipose tissue - derived cells ( kingham et al . , 2007 ) , but it is unlikely that these cells would match or exceed the performance of auto nerve grafts . although schwann cells play a central role in peripheral nerve regeneration , the formation of endoneurium and/or perineurium by endoneurial fibroblasts and perineurial cells is also important because of their protective role in axons with schwann cells and myelin sheath . in particular , the perineurium plays an important role in preventing the passage of large molecules from the epineurium into perineurial fascicles , which is also known as the blood - nerve - barrier system ( weerasuriya and mizisin , 2011 ) . furthermore , reconstitution of vascular networks is also an inevitable factor in tissue reconstruction . in this regard , cell sources that can give rise to schwann cells and cells associated with the formation of perineurium / endoneurium and blood vessels are considered to be the best source for peripheral nerve regeneration . recently , we reported preferential and comprehensive reconstitution of severely damaged sciatic nerve using 7-day cultivated murine skeletal muscle - derived multipotent stem cells ( sk - mscs ; tamaki et al . , 2014 ) . in this treatment , engrafted donor cells preferentially differentiated into schwann cells and perineurial / endoneurial cells , and formed myelin sheath and perineurium / endoneurium , encircling the regenerated axons . donor cell - derived perineurium also had tight - junctions , which play a key role in the blood - nerve - barrier system ; thus , suggesting functional reconstitution . stem cells showing suitable multipotency to cover all peripheral nerve support cells in damaged nerve - specific niche have not been reported previously , although cultivated bone morrow stromal cells ( mbcss ; dezawa et al . , 2005 ) , olfactory ensheathing cells ( radtke et al . , 2011 ) and adipose tissue - derived cells ( kingham et al . , 2007 ) we directly compared the contribution to damaged nerve reconstitution among cultivated sk - mscs and bmscs , and freshly isolated cells derived from damaged sciatic nerve ( sndc - d ) ( tamaki et al . , the results showed that sk - mscs have a significantly greater engraftment ratio when compared with the other two groups , and the values in the latter two groups were similar . in addition , there was no definitive formation of peripheral nerve supporting cells or incorporation into blood vessels in bmsc transplantation , whereas sk - mscs and sndc - d showed typical differentiation into all support cells . in addition , engrafted sk - mscs contributed to increased vascular formation , which is favorable for blood supply and waste product excretion . facilitation of blood vessel formation in sk - mscs was also confirmed in damaged skeletal muscle ( tamaki et al . , 2005 ; 2007b ; 2013 ) and urethra ( hoshi et al . , 2008 ) , as well as in and around the bladder wall ( nitta et al . , 2010 expression of key neurotrophic and nerve / vascular growth factor mrnas was also confirmed ; in particular , ngf ( rich et al . , 1989 ) , bdnf ( lewin et al . , 2009 ) , gdnf ( fine et al . , 2002 ) , galectin-1 ( horie et al . , 1999 ) , ninjurin ( araki and milbrandt , 1996 ) , cntf ( dubovy et al . , 2011 ) , lif ( wang et al . , 2009 ) , sox10 ( bremer et al . , 2011 ; britsch et al . , 2001 ; finzsch et al . , 2010 ) , bfgf ( timmer et al . , 2003 ) and igf-1 ( nachemson et al . , 1990 ) are important for nerve regeneration , while vgef ( ferrara , 2004 ) and hgf ( schroder et al . , 2011 ) are important for blood vessels . some of these are redundant and/or primarily involved in the recipient nerve regeneration process ( campbell , 2008 ) ; however , sufficient expression of these factors in the damaged / transplantation site may induce paracrine effects on both recipient and donor cells as an adjuvant for nerve regeneration . using sk - mscs , we examined the therapeutic capacity in a long transected nerve gap on the mouse sciatic nerve via an acellular conduit ( 1.52.0 10 cells / nerve ) , and demonstrated 94% reconstitution of the number of axons , 60% recovery of myelin , and a 9.1-fold increase in blood vessels through the conduit ( tamaki et al . , 2014 ) . features and immunohistochemical properties of regenerated nerve at 8 weeks after bridging with sk - mscs transplantation are shown in figure 1 . thick gfp tissues were evident throughout the conduit ( figure 1a ) , and a large number of gfp multi - luminal substructures , such as perineurium / endoneurium , were also apparent in histological sections ( figure 1b and c ) . importantly , regenerated axons in the conduit were encircled by engrafted gfp perineurium / endoneurium ( figure 1b ) , having myelination ( figure 1c ) , thus suggesting that regenerating axons extended along the endoneurial / perineurial substructures with supporting schwann cells . the bridging acellular conduit also includes a large number of blood vessels ( figure d ) ; thus , favorable blood supply and waste product excretion are expected . these relationships between gfp tissues and regenerated axons were confirmed in longitudinal sections ( figure 1e ) , and gfp multi - luminal substructures also possessed the basal lamina sheath ( figure 1f and g ) . these results clearly indicated that our nerve treatment method using the sk - mscs with acellular conduits meet all of the above criteria , making it useful for nerve regeneration . in addition , we also demonstrated the greater therapeutic potential of sk - msc treatment as compared to case of healthy nerve grafts using the same mouse model ( tamaki et al . , 2014 ) . typical structure of engrafted gfp skeletal muscle - derived multipotent stem cells ( sk - mscs ) in acellular bridging conduit at 8 weeks after transplantation . ( a ) macroscopic features of regenerated sciat - ic nerve with engrafted gfp tissues . ( b ) cross - sectional profile of the bridging conduit filled with donor - derived gfp perineurium / endoneu - rium . ( c ) cross - sectional profile of bridging conduit filled with do - nor - derived gfp perineurium / endoneurium . ( d ) same portion of panel ( c ) is stained with cd31 ( vascular endothelial cell marker ) . gfp perineurium / endoneu - rium show continuously elongated features having axons ( red ) inside . ( f ) longitudinal view of gfp peri - neurium / endoneurium in the conduit , and ( g ) laminin staining ( red ) . gfp perineurium / en - doneurium also has basal lamina sheets , which are detected by anti - laminin staining . skeletal muscle is the largest organ in the body , comprising approximately 4050% of total body mass , and presumably allowing donor cells to be obtained with relative ease and safety . therefore , sk - mscs represent a novel / suitable alternative cell source for healthy nerve autografts . skeletal muscle - derived stem cells have been used by many researchers for various purposes ; however , our isolation method of sk - mscs differs from others ( tamaki et al . , 2002 ; 2010 ) , and this is potentially crucial to our results after transplantation ( tamaki et al . , 2005 , 2007a , b ) . in future research , the potential of human skeletal muscle - derived cells needs to be clarified . we are currently investigating the optimal isolation , fractionation and expansion culture conditions for human cells in order to maximize the nerve regeneration potential . in vivo evidence of the differentiation and reconstruction capacities of human sk - mscs is also important . we used the acellular conduit from the wild - type mice esophageal submucous membrane ( mainly longitudinal muscle layer ) separated after 3 days of 70% ethanol dehydration . in the human case , use of an appropriate size vein may be a candidate cellular or acellular conduit . however , from the viewpoint of minimizing invasiveness , biosynthetic tubes that are a good match for sk - mscs treatment need to be identified . application of sk - msc treatment for the total regeneration of multi - branched nerve transections may also be useful in the case of surgical nerve damage .

long gap peripheral nerve injuries usually reulting in life - changing problems for patients . skeletal muscle derived - multipotent stem cells ( sk - mscs ) can differentiate into schwann and perineurial / endoneurial cells , vascular relating pericytes , and endothelial and smooth muscle cells in the damaged peripheral nerve niche . application of the sk - mscs in the bridging conduit for repairing long nerve gap injury resulted favorable axonal regeneration , which showing superior effects than gold standard therapy -- healthy nerve autograft . this means that it does not need to sacrifice of healthy nerves or loss of related functions for repairing peripheral nerve injury .

Introduction Development of nerve bridging conduit Combination with cell transplantation Comprehensive regeneration with all nerve support cells/tissues Future perspectives

when the gallbladder is not visualized in its normal location , the possibility of its ectopic location should be considered . a case of incidentally detected anomalous position of gall bladder causing confounding problem in interpretation of pet - ct is described . a 70-year - old man , with h / o chronic liver disease and suspected of hepatocellular carcinoma [ serum alpha - fetoprotein ( afp ) 5024 ng / ml ] was subjected to fluorine-18 fluorodeoxyglucose positron emission tomography ( f-18 fdg pet)/computed tomography ( ct ) imaging . rest of the liver revealed non - fdg avid lesions in segments iii and viii . on viewing the fused pet / ct images , the radiotracer accumulation was localized to the anomalously placed suprahepatic gallbladder . magnetic resonance ( mr ) images of the same patient confirmed the presence of the suprahepatic gallbladder [ figure 1 ] . ( a ) transaxial view of pet image showing suprahepatic subdiaphragmatic gallbladder with tracer uptake ; ( b ) coronal view of pet image ; ( c ) sagittal view of pet image ; ( d ) transaxial view of ct image ; ( e ) coronal view of ct image ; ( f ) sagittal view of ct image ; ( g ) transaxial view of post - contrast t1-weighted mri image ; ( h ) coronal view of post - contrast t1-weighted mri image ; ( i ) transaxial view of t2 fat saturated mri image shows gallbladder as a bright structure routine imaging of the gallbladder demonstrates a wide array of imaging variants , including anomalies in location , number , and configuration . an awareness of these normal variants would prevent misdiagnosis and aid in the assessment of differential diagnostic possibilities . normally , the gallbladder is situated adjacent to the inferior surface of the liver , in the plane of the interlobar fissure , with the gallbladder neck maintaining a constant relationship to porta hepatis . the gallbladder is generally found in the right upper quadrant , but may be seen in other parts of the abdomen . while anomalous positions are rare , the most common of these are ( 1 ) under the left hepatic lobe , ( 2 ) intrahepatic , ( 3 ) transverse , and ( 4 ) retroplaced ( retrohepatic or retroperitoneal ) . the lesser common of these are ( 1 ) supradiaphragmatic and ( 2 ) suprahepatic . gallbladder is intrahepatic during the embryonic period and becomes extrahepatic only later . an intrahepatic gallbladder ( usually a congenital anomaly ) this poses a problem for scintigraphy , as an intrahepatic gallbladder can cause a focal defect ( pseudo space - occupying lesion ) ; ultrasonography can be helpful in these cases . the suprahepatic region is among the rarest sites , and very few reports have appeared in either the surgical or radiological literature.[35 ] of the very few reports on the suprahepatic gallbladder , one refers to a normally inserted organ that rotated 180 upward to an intrathoracic position after eventration of the diaphragm . in two other cases , an abnormally mobile gallbladder was found trapped between the chest wall and the upper border of the liver ; this became symptomatic and caught the attention of the clinician and the imageologist . faintuch et al . reported three cases of suprahepatic gallbladder with hypoplasia of the right hepatic lobe and upward migration of the gallbladder . gansbeke reported a case of suprahepatic gallbladder which was associated with hepatomegaly due to macronodular cirrhosis complicating existing hepatitis . kabaroudis reported a case of floating gallbladder associated with hypoplasia of the right hepatic lobe , whereas maeda had reported a similar case associated with hypoplasia of left hepatic lobe . pet - ct is found to be useful in diagnosing this rare anatomical variant of ectopically located gall bladder and predicting its functional implication .

the purpose of this study was to appraise the imageologists of a possible mislocalization of tracer accumulation to anomalously placed gallbladder during positron emission tomography - computed tomography ( pet / ct ) examination . pet / ct is increasingly playing an important role in staging and restaging of the disease process in cancer patients . with the advent of fusion imaging , the tracer accumulation can be correctly localized to a structure or lesion on ct . we did a staging pet / ct scan of a patient with hepatocellular carcinoma for liver transplant evaluation . fluorine-18 fluorodeoxyglucose ( f-18 fdg ) was used as a tracer and the scan was performed on seimens biograph - mct pet / ct machine . we noted the tracer accumulation at the superior surface of liver , which was localized to the anomalously placed gallbladder in suprahepatic subdiaphragmatic location . the anomalously placed gallbladder can create localization confusion . keeping the possibility of ectopically placed gallbladder in mind , the imageologist can better localize the tracer uptake .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

digital intraoral radiographic systems have several advantages compared with conventional film - based radiography . these advantages , in endodontics , include the potential of a lower radiation exposure to the patient and faster image display . moreover , it was introduced the opportunity of evaluating the progression of periapical bone loss by digital tools as the pixel values . radiographs do not always reflect the extent of the destructive process in the periapical tissues and generally under - represent the size of a lesion . studies have suggested that pathologic involvement of the cortical plate , or at least junctional trabeculae , is a prerequisite for radiographic detection of periapical pathoses . nevertheless , periapical lesions confined to cancellous bone could be detected radiographically using pixel values using one of the tools of the digital image , the histogram . only a few studies employing animal models or human biopsies have compared the diagnostic and quantifying accuracy of radiographs to the gold standard represented by the histology . the aim of this study was to induce periapical disease in rats to assess the pixel values in different experimental periods to evaluate the bone loss progression . this study was approved by the animal research ethics committee of the bauru school of dentistry , university of so paulo . the experimental groups were composed of 27 wistar rats ( rattus novergicus ) , divided into three groups with nine animals each , according to the sacrifice date , group 1 : 2 days , group 2 : 15 days , group 3 : 30 days . , a cavity was made on the occlusal face of the mandibular first molar on the right side with a spherical burr size 1/4 , at high speed without cooling . the material for study was obtained after euthanizing the animal with an anesthetic overdose . the right and left hemi - mandibles of each rat were separated and radiographed with two phosphor plates ( psps/ digora - soredex - tuusula , finland ) . the exposition was performed according to the parameters : 70 kvp , 7 ma , focus - film distance of 30 cm , exposure time of 0.09 s. a standard aluminum stepwedge was set in each image , and an acrylic plate measuring 0.3x0.4x0.2 cm was positioned over the hemi - mandibles to simulate soft tissue . the stepwedge was used as a standard image technique , which is essential for control of day - to - day variations in the sensitivity of the detector . the radiographic evaluation was performed using the public domain software image j ( version 1.33 , national institute of health , washington , dc ) a region of interest ( roi/252 pixels ) was opened in the periapical region of the every tooth , closest to the mesial root , without touching it . only the periapical bone was enclosed in the roi . using the histogram tool , the normalized pixel values of the images ( npi ) were then obtained by using the following equation : npi = pi / cr . where pi is the mean pixel intensity of the roi , and cr is the pixel intensity of the roi of the standard aluminum stepwedge . the pixel value of zero corresponded to black and the pixel value of 255 to white . hemi - mandibles were fixed in formalin 10% , decalcified in edta and processed histologically . five semi - serial sections of each hemi - mandible with 5 m thickness were cut and stained with hematoxylin and eosin . all histological sections were identified with a random numerical sequence and periapical tissues were histomorphometrically analyzed for both test and control sites . in the test site it was noted whether the tooth had pulpitis , necrosis or presented any sign of inflammation , and whether or not there was presence of periapical bone resorption . the percentages of bone tissue in the apical region of the root , soft tissue ( connective tissue and inflammatory infiltrate , when present ) , bone marrow and inferior alveolar nerve were obtained in a digital image analysis system , composed of a zeiss axioskop ii microscope , ccd - iris rgb - sony camera ( sony dxc-151a rgb video camera - sony corporation , tokyo , japan ) and kontron ks300 software ( kontron electronic gmbm , munich , germany ) . for this purpose , an image was captured at 10x objective from each histologic slice , which contained the apical portion of the mesial root perpendicular to the alveolar nerve , positioned centrally . the area ( in pixels ) was measured to quantify the area occupied by bone tissue in the apical region of the root , soft tissue ( connective tissue and inflammatory infiltrate , when present ) , bone marrow and inferior alveolar nerve . this study was approved by the animal research ethics committee of the bauru school of dentistry , university of so paulo . the experimental groups were composed of 27 wistar rats ( rattus novergicus ) , divided into three groups with nine animals each , according to the sacrifice date , group 1 : 2 days , group 2 : 15 days , group 3 : 30 days . , a cavity was made on the occlusal face of the mandibular first molar on the right side with a spherical burr size 1/4 , at high speed without cooling . the material for study was obtained after euthanizing the animal with an anesthetic overdose . the right and left hemi - mandibles of each rat were separated and radiographed with two phosphor plates ( psps/ digora - soredex - tuusula , finland ) . the exposition was performed according to the parameters : 70 kvp , 7 ma , focus - film distance of 30 cm , exposure time of 0.09 s. a standard aluminum stepwedge was set in each image , and an acrylic plate measuring 0.3x0.4x0.2 cm was positioned over the hemi - mandibles to simulate soft tissue . the stepwedge was used as a standard image technique , which is essential for control of day - to - day variations in the sensitivity of the detector . the radiographic evaluation was performed using the public domain software image j ( version 1.33 , national institute of health , washington , dc ) a region of interest ( roi/252 pixels ) was opened in the periapical region of the every tooth , closest to the mesial root , without touching it . only the periapical bone was enclosed in the roi . using the histogram tool , the normalized pixel values of the images ( npi ) were then obtained by using the following equation : npi = pi / cr . where pi is the mean pixel intensity of the roi , and cr is the pixel intensity of the roi of the standard aluminum stepwedge . the pixel value of zero corresponded to black and the pixel value of 255 to white . hemi - mandibles were fixed in formalin 10% , decalcified in edta and processed histologically . five semi - serial sections of each hemi - mandible with 5 m thickness were cut and stained with hematoxylin and eosin . all histological sections were identified with a random numerical sequence and periapical tissues were histomorphometrically analyzed for both test and control sites . in the test site it was noted whether the tooth had pulpitis , necrosis or presented any sign of inflammation , and whether or not there was presence of periapical bone resorption . the percentages of bone tissue in the apical region of the root , soft tissue ( connective tissue and inflammatory infiltrate , when present ) , bone marrow and inferior alveolar nerve were obtained in a digital image analysis system , composed of a zeiss axioskop ii microscope , ccd - iris rgb - sony camera ( sony dxc-151a rgb video camera - sony corporation , tokyo , japan ) and kontron ks300 software ( kontron electronic gmbm , munich , germany ) . for this purpose , an image was captured at 10x objective from each histologic slice , which contained the apical portion of the mesial root perpendicular to the alveolar nerve , positioned centrally . the area ( in pixels ) was measured to quantify the area occupied by bone tissue in the apical region of the root , soft tissue ( connective tissue and inflammatory infiltrate , when present ) , bone marrow and inferior alveolar nerve . the radiographic analysis showed that the pixel values in the three experimental periods increased on the test side in comparison with the control side , indicating bone loss in a similar manner both psps plates used . the student 's t test showed a statistically significant difference between control and test sites for the three groups tested ( p<0.05 ) ( table 1 ) . the influence of the time on periapical disease was studied using one - way anova and tukey 's tests . anova showed no statistically significant variation for any of the time intervals in plate 1 ( p>0.05 ) , as well as for the control side of plate 2 ( p>0.05 ) . this variation was only shown to be significant in plate 2 ( p<0.05 ) between the test groups 2 and 3 ( figures 1a , d , g , j ) . means and standard deviation of the pixel values on the test and control sides for the digora system phosphorus plates 1 and 2 , in the rats of groups i , ii and iii mean pixel value from 9 animal samples . control group : a ) radiographic image of hemi - mandible ; b - c ) photomicrograph of the left first molar showing healthy pulp ( black arrow ) and periapical tissues with cementum ( ce ) , fibers of periodontal ligament ( li ) and alveolar bone ( ab ) . group 1 : d ) radiographic image of hemi - mandible similar at the control group ; e - f ) photomicrograph of the right first molar exhibiting inflammatory cells ( black arrow ) in the periapical region . group 2 : g ) radiographic image of hemi - mandible showing radiolucent area in the periapical region ; h - i ) photomicrograph of the right first molar showing extensive bone ( b ) resorption by osteoclasts ( red arrow ) and connective tissue ( ct ) . group 3 : j ) radiographic image of hemi - mandible exhibiting extensive radiolucent area in the periapical region ; k - l ) photomicrography of the right first molar showing abscess ( red arrow ) , increase of connective tissue area ( ct ) and decrease of bone tissue ( b ) in relation to the other groups the histological analysis of the left first molars of the rats , which served as control , showed no alterations in the pulp or periapical tissues , and evidenced that 100% of these teeth presented healthy pulp and periapical tissues ( figures 1b , c ) . the teeth submitted to coronal opening in group 1 , showed in 100% of the cases , necrosis in the coronal region and pulp inflammation with the presence of inflammatory cells and increased vascularization in the medial and apical thirds . it was possible to observe inflammatory cells and small bone and cementum resorption in the periapical region ( figures 1e , f ) . group 2 showed necrosis in the coronal and middle radicular pulp and extensive inflammatory process in the apical third . in the periapical region exhibited increase of bone resorption and replaced by conjunctive tissue rich in inflammatory cells ( figures 1h , i ) . the group 3 showed total pulp necrosis , extensive area of abscess and bone , cementum and dentine resorption and few bone trabeculae surrounded by conjunctive tissue in the apical portion ( figures 1k , l ) . the total numbers of pixels obtained for each of the measured regions in the control and tests sides , in the various experimental periods are presented in table 2 . two - way anova and tukey 's tests showed statistically significant difference between the test and control sides and among the experimental periods as well . mean and standard deviation of the total number of pixels of each structure present in the periapical region of the mesial root of the mandibular first molar in the control and test groups in the experimental periods mean pixel value from 9 animal samples . the radiographic analysis showed that the pixel values in the three experimental periods increased on the test side in comparison with the control side , indicating bone loss in a similar manner both psps plates used . the student 's t test showed a statistically significant difference between control and test sites for the three groups tested ( p<0.05 ) ( table 1 ) . the influence of the time on periapical disease was studied using one - way anova and tukey 's tests . anova showed no statistically significant variation for any of the time intervals in plate 1 ( p>0.05 ) , as well as for the control side of plate 2 ( p>0.05 ) . this variation was only shown to be significant in plate 2 ( p<0.05 ) between the test groups 2 and 3 ( figures 1a , d , g , j ) . means and standard deviation of the pixel values on the test and control sides for the digora system phosphorus plates 1 and 2 , in the rats of groups i , ii and iii mean pixel value from 9 animal samples . control group : a ) radiographic image of hemi - mandible ; b - c ) photomicrograph of the left first molar showing healthy pulp ( black arrow ) and periapical tissues with cementum ( ce ) , fibers of periodontal ligament ( li ) and alveolar bone ( ab ) . group 1 : d ) radiographic image of hemi - mandible similar at the control group ; e - f ) photomicrograph of the right first molar exhibiting inflammatory cells ( black arrow ) in the periapical region . group 2 : g ) radiographic image of hemi - mandible showing radiolucent area in the periapical region ; h - i ) photomicrograph of the right first molar showing extensive bone ( b ) resorption by osteoclasts ( red arrow ) and connective tissue ( ct ) . group 3 : j ) radiographic image of hemi - mandible exhibiting extensive radiolucent area in the periapical region ; k - l ) photomicrography of the right first molar showing abscess ( red arrow ) , increase of connective tissue area ( ct ) and decrease of bone tissue ( b ) in relation to the other groups the histological analysis of the left first molars of the rats , which served as control , showed no alterations in the pulp or periapical tissues , and evidenced that 100% of these teeth presented healthy pulp and periapical tissues ( figures 1b , c ) . the teeth submitted to coronal opening in group 1 , showed in 100% of the cases , necrosis in the coronal region and pulp inflammation with the presence of inflammatory cells and increased vascularization in the medial and apical thirds . it was possible to observe inflammatory cells and small bone and cementum resorption in the periapical region ( figures 1e , f ) . group 2 showed necrosis in the coronal and middle radicular pulp and extensive inflammatory process in the apical third . in the periapical region exhibited increase of bone resorption and replaced by conjunctive tissue rich in inflammatory cells ( figures 1h , i ) . the group 3 showed total pulp necrosis , extensive area of abscess and bone , cementum and dentine resorption and few bone trabeculae surrounded by conjunctive tissue in the apical portion ( figures 1k , l ) . the total numbers of pixels obtained for each of the measured regions in the control and tests sides , in the various experimental periods are presented in table 2 . two - way anova and tukey 's tests showed statistically significant difference between the test and control sides and among the experimental periods as well . mean and standard deviation of the total number of pixels of each structure present in the periapical region of the mesial root of the mandibular first molar in the control and test groups in the experimental periods mean pixel value from 9 animal samples . in the present study , the periapical inflammation was induced by coronal opening of the mandibular right first molar and confirmed that only coronal opening and pulp contact with the oral cavity were sufficient for inducing periapical disease . various other studies have described this technique for induction of pulpal and periapical inflammatory reactions in rat teeth . the inflammatory process was observed in the pulp region in the experimental period of 2 days . this is in agreement with the findings of a previous study that showed that pulp inflammation is already observed 6 h after the operative procedure . in the present study , pulp necrosis was observed in the experimental periods of 15 and 30 days . this is also in agreement with a previous study that showed the presence of complete pulp necrosis between the 8 and 20 days . ( 1995 ) affirmed that bone resorption is present from the 3 day after the operative procedure . bone resorption in the present study , although very subtle , could already be observed in the group 1 . resorptive bone activity was actively present on the 15 day ( group 2 ) . some authors affirmed that this activity begins to diminish from then on , with a decrease in the number of osteoclasts . although the lesion appeared to be stabilized , with diminished bone resorption , new bone formation did not occur due to the presence of aggressive factors . in the 30-day experimental period , a large area of resorption the amount of periapical bone was minimal , and it was replaced by inflammatory tissue . statistical analysis showed a significant difference between test and control sides in the 3 experimental periods , except for the root region , in which this difference was not significant between the test and control sides , in the 2-day period , and between the experimental periods of 15 and 30 days . this was probably because resorption in periapical disease is greater in the bone region than in the root region , which was not very evident . the present study confirmed radiographically the presence and intensity of bone resorption observed by the histological study . ( 2003 ) removed medullar bone from cadaver mandibles , radiographed the areas to measure the pixel value respectively . these studies showed that it is possible to detect bone loss in the mandibular region by analyzing the pixel value , even if it is not yet visible radiographically . conversely , studies that compared images obtained by conventional radiographs ( without pixel value analysis ) and bone resorption seen microscopically , showed that this relationship is not established with precision de rossi , et al . ( 2007 ) concluded that although image digitization could not improve the detection of the early stages of periapical lesions , it provides valuable quantitative assessment of extensive periapical lesions . in order to diminish the noise level in the images captured directly , the phosphorus plates were covered by a protective envelope , as they are sensitive to light . the images were always downloaded immediately after the radiograph was taken , as the time between taking the radiograph and downloading the plates also influences the pixel values . in the direct photostimulable phosphorus plate systems , such as digora , there is a correlation between the radiation dose and the quantity of capture plate luminescence . the capture plates present less noise and a better quality image than the other direct systems , in addition to being more sensitive to small variations of the exposure source in comparison with conventional films , and should be used when small differences in contrast are important . the noise and coefficient of variability of pixel value calculations showed low noise and small variation in the images in this study . in spite of resistance by many professionals , the high cost of the technology and the ethical implications because of the risk of manipulating the images , the use of digital imaging has increased and is constantly being perfected . the methodology applied was efficient for causing pulpitis and pulpal necrosis in the studied rats . teeth with pulpitis microscopically presented periapical bone resorption , but the teeth with necrosis presented greater resorption . the control teeth presented healthy pulp , without signs of periapical bone resorption . the means of the pixel values in the areas of periapical disease induced in rats indicated greater bone resorption than the means of these values on the control side for the three experimental periods ( p<0.05 ) . even small periapical bone resorption was already sufficient for determining changes in the pixel values of that area in the direct digital method , when compared to their respective controls .

objectivethis study evaluated experimentally - induced periapical bone loss sites using digital radiographic and histopathologic parameters . material and methodstwenty - seven wistar rats were submitted to coronal opening of their mandibular right first molars . they were radiographed at 2 , 15 and 30 days after the operative procedure by two digital radiographic storage phosphor plates ( digora ) . the images were analyzed by creating a region of interest at the periapical region of each tooth ( imagej ) and registering the corresponding pixel values . after the sacrifice , the specimens were submitted to microscopic analysis in order to confirm the pulpal and periapical status of the tooth . resultsthere was significant statistically difference between the control and test sides in all the experimental periods regarding the pixel values ( two - way anova ; p<0.05 ) . conclusionsthe microscopic analysis proved that a periapical disease development occurred during the experimental periods with an evolution from pulpal necrosis to periapical bone resorption .

INTRODUCTION MATERIAL AND METHODS General and radiographic procedures Radiographic analysis Histomorphometrical analysis RESULTS Radiographic analysis Histopathological analysis DISCUSSION CONCLUSIONS

carcinoid tumors develop from stem cells of the bronchial epithelium known as kulchitsky cells , which have neuroendocrine activity . these neuroendocrine cells can develop tumors in many different organs with most common being the lungs , the appendix , the small intestine ( duodenum ) , the rectum and the pancreas.1 the most recent classification system from the world health organisation categorized neuroendocrine pulmonary tumors in four types : typical carcinoid ; atypical carcinoid ( atc ) ; large cell neuroendocrine carcinoma ; and small cell lung cancer.2 carcinoid bronchopulmonary tumors represent approximately 25% of all carcinoid tumors and 1%2% of all lung neoplasms.3 approximately 70% of these tumors are located centrally in the large bronchial tubes leading to the lung , while 10%20% , known as peripheral carcinoids , develop in the pulmonary periphery.4 typical carcinoid pulmonary tumors manifest nine to ten times more often than atc tumors . typical carcinoid tumors are seen in younger patients more often than atcs and appear to be the most frequent pulmonary neoplasms during childhood and puberty.5,6 atc lung tumors have a more aggressive histologic appearance and a greater tendency to metastasize than typical carcinoid lung tumors . these tumors are more frequent in males , and the average age of onset is 46 years.7 unlike most lung cancers , the development of carcinoid pulmonary tumors is not related to smoking or other environmental causes ( eg , tobacco smoke , air pollution , or asbestos ) . the detection of carcinoid tumorlets in lung biopsies led to speculation that carcinoid tumors may grow from these cells.1 however , further research needs to be conducted as this association has not been yet determined . a 26-year - old female presented with wheezing episodes , cough and mild dyspnea . after a chest x - ray revealed normal findings and spirometry showed mild restriction ( table 1 ) , she was commenced on bronchodilators and inhaled corticosteroids . two years later , the symptoms were not entirely relieved and she had developed hemoptysis of approximately 10 ml/24 hours . therefore , she was referred to the pulmonary department for further examinations . during clinical examination the patient had reduced respiratory whistling and mild wheezing in the upper left pulmonary field . the results of the exams revealed normal blood tests , a mild restrictive spirometry ( table 1 ) , a negative mantoux and a left perihilar shadow in the chest radiograph ( figure 1a and b ) . a chest high resolution computed tomography was performed showing a nodule in the left primary bronchus causing its partial obstruction ( figure 2 ) . the suspicion of malignancy was established and the patient underwent a bronchoscopy ( olympus bf - p240 ; 6 mm insertion tube , biopsy channel 2.6 mm , 55 cm working length , [ olympus corp , tokyo , japan ] ) . the findings showed exophytic damage with increased vascularization in the left primary bronchus 5 cm from the carina . the biopsy demonstrated a typical carcinoid and the patient underwent pelvic and cerebral computed tomography , which both showed normal findings . in an effort to avoid pneumonectomy , and to produce rapid palliation of hemoptysis and immediate tumor debulking , a rigid bronchoscopy was inserted into the trachea under general anesthesia using a 7.5 mm storz rigid bronchoscope ( karl storz gmbh and co , tuttlingen , germany ) . electrocautery ( power setting of 40 watts , blend mode , normal coagulation , electrosurgical monopolar unit psd-20 , with foot switch , flexible monopolar electrocautery blunt probe olympus cd-6c-1 , loop snare , [ olympus , tokyo , japan ] ) was performed on the exophytic tumor tissue followed by mechanical removal . this intervention fully re - opened the obstructed left main bronchus and the upper subsegment of the left upper lobe . the remaining tissue in the obstructed lower subsegment of the left upper lobe was treated by surgical resection , performing a lobectomy to remove the tissue entirely . during this procedure , the final report stated that there was no expanding malignancy affecting the pleural cavity or the lymph nodes . the patient was not given chemotherapy but was followed up with regular medical monitoring combined with imaging studies ( ie , chest x - ray , chest computed tomography ) . five years after surgical treatment , the patient was asymptomatic with normal chest radiographs and normal spirometry ( table 1 ; figure 1c ) . 8 the severity and variety of symptoms depend on the size of the carcinoid pulmonary tumor and the production of hormones . in symptomatic patients with central carcinoids , the most common symptoms are : persistent cough , asthma - like wheezing , chest pain , dyspnea , hemoptysis and obstructive pneumonitis.9 a number of studies have reported that a mistaken diagnosis of asthma is frequent in these cases , delaying early diagnosis . occasionally , carcinoid pulmonary tumors may initiate an excessive hormonal secretion causing various neuroendocrine syndromes such as carcinoid syndrome and cushing syndrome.9,10 the most common symptoms of carcinoid syndrome are : facial flushing , sweating , diarrhea , rapid cardiac beats and wheezing . even more rarely , patients with cushing syndrome caused by the abnormal overproduction of cortisol can develop muscle weakness , obesity in the upper body , high blood pressure , high blood sugar and increased body and facial hair . almost 90% of typical carcinoid tumors are diagnosed at an early stage while more than 50% of atc tumors are diagnosed at stage ii or iii.11 the diagnosis of carcinoid pulmonary tumor is established on the basis of the patient s symptoms combined with imaging examination such as chest radiography , computed tomography and magnetic resonance imaging.12 to verify the histologic type of the pulmonary tumor detected , there are several biopsy options including bronchoscopic biopsy , needle biopsies and surgical biopsies ( eg , thoracotomy).13 however , it has been reported that bronchoscopic biopsy has a risk of hemorrhage , especially in cases of partial or total removal of vascular tumors.14 the primary and most effective treatment for all pulmonary carcinoid tumors is surgical resection as long as no contraindications to surgery exist ( eg , widespread metastatic disease).15 chemotherapy and radiotherapy have no therapeutic contribution and there is no verified optimal therapy for unresectable carcinoid lung tumors.16 there are a variety of resection techniques that treat lung carcinoids effectively.13 presently , the most commonly utilized resection procedure is lobectomy . for smaller tumors located in the periphery or within a pulmonary segment , surgeons may perform segmental resection or wedge resection . , a bilobectomy or pneumonectomy may be required due to the size or the location of the tumor . postoperatively , the most common complications are excessive bleeding , atelectasis and prolonged air leak.13 interventional therapeutic bronchoscopies such as laser bronchoscopy , electrocautery therapy , cryotherapy , endobronchial brachytherapy , photodynamic therapy and airway stents may also be performed in certain cases.17,18 nd - yag lasers and electrocautery , together with mechanical tumor removal , are more appropriate for rapid palliation and immediate tumor debulking.19 in particular , electrocautery therapy , as applied in our case , can achieve immediate relief of the symptoms resulting from obstructed airways in 55%75% of patients . its advantages over laser treatment include cost effectiveness , higher availability , and faster removal of tumors and components resistant to laser coagulation . 18 moreover , in a study evaluating the degree of damage and bronchial wall healing after photodynamic , nd - yag laser , and electrocautery therapy , electrocautery produced the least amount of airway scarring and subepithelial fibrosis.19 in another study , the amount of mucosal damage visualized after electrocautery was correlated with histologic tissue damage . the investigators concluded that this is a potential advantage of electrocautery compared to other therapies , where the real histologic damage may be more severe than what is visualized after the therapy.20 side effects of electrocautery therapy include burn , haemorrhage , and inadvertent electrical shock to the endoscopist or the patient , but there are no reports of treatment - related deaths or respiratory failure episodes.18,21 these bronchoscopic techniques are usually used for palliative management of bronchial obstruction , for mass reduction prior to surgery , or for patients unsuitable for formal surgery.18 a number of studies of endobronchial resection have confirmed that bronchoscopic techniques are successful modalities of treatment.22 several therapeutic modalities used in conjunction may be essential to achieve the best management of the disease , rather than a single invasive approach.23 in a recent review , even though 50% of patients underwent a lung resection after a single bronchoscopic resection , the authors reported that the inability to remove the remaining tumor was entirely due to the inaccessibility of the tumor.2426 some experts believe that tumor reduction by this method may result in a more conservative surgical resection.15 our study confirms these findings as the use of bronchoscopic electrocautery followed by surgical lobectomy not only removed the tumor entirely but also avoided pneumonectomy . among pulmonary malignancies , carcinoid tumors have the highest prognostic rates . the 5-year survival rate reaches 92%100% for typical lung carcinoids and only 61%88% for atcs.27 previous studies have shown that lymph node involvement as well as the presence of tumorlets , have significant negative effects on prognoses.28 early suspicion , combined with imaging examination and biopsy , is the key to diagnosis . improved surgical techniques allow smaller incisions resulting in shorter hospitalization and less postoperative pain.19 many studies suggest that the use of endobronchial management techniques not only improve clinical symptoms and quality of life , but also increase overall survival.21,23 therefore , performing less invasive procedures should be considered throughout the management of lung cancer patients , provided no poor prognostic factors exist.29 series utilizing this mode of therapy must be reported in order to determine long - term outcomes . it is very important that scientists continue to investigate and publish results from such cases so that new information about the etiology and treatment of the disease can be made available .

carcinoid bronchopulmonary tumors represent approximately 25% of all carcinoid tumors and 1%2% of all lung neoplasms . the most common symptoms are : persistent cough , asthma - like wheezing , chest pain , dyspnea , hemoptysis and obstructive pneumonitis . we present a case of a young adult diagnosed with a typical carcinoid tumor . the diagnosis was established on the basis of imaging examination and bronchoscopic biopsy . the patient was treated with bronchoscopic electrocautery therapy to relieve the obstructed airway , followed by surgical lobectomy in order to entirely remove the exophytic damage . this approach was not only a palliative management to bronchial obstruction but also avoided pneumonectomy . recent studies support the use of such interventional resection methods , as they may result in a more conservative surgical resection .

Introduction Case report Discussion

familial mediterranean fever ( fmf ) is a genetic , autosomal recessive disease affecting primarily non - ashkenazi jews , turks , arabs , and armenians . this disease is characterized by acute , short episodes of serosal membrane inflammation , and fever . the fmf gene , called as mediterranean fever ( mefv ) gene that encodes pyrin / marenostrin , is mapped to the short arm of chromosome 16 . although il-1 plays a fundamental role in pathogenesis of fmf , tumor necrosis factor - alpha ( tnf- ) , soluble il-2 receptor , il-6 , and il-8 have also been shown to stimulate this process . patients have an increased erythrocyte sedimentation rate ( esr ) , c - reactive protein ( crp ) , serum amyloid a ( saa ) , and fibrinogen levels during these attacks and usually , this increase returns to normal values in attack - free periods . however , it is now known that subclinical inflammation may continue in attack - free periods of fmf patients . this type of inflammation may lead to developing of amyloidosis , which is the most devastating complication of fmf . neutrophil to lymphocyte ratio ( nlr ) and mean platelet volume ( mpv ) were used to show the inflammation in both cardiac and noncardiac disorders before . , we aimed to investigate whether nlr and mpv could be used to indicate the subclinical inflammation in pediatric fmf patients . ninety of the patients were in attack - free period , and seventy were in attack period . criteria . attack - free period was described as at least 2 weeks from the end of an fmf attack according to the symptoms and acute phase reactants levels . control group was selected from the patients who had no acute or chronic disease that could cause inflammation and who were attended to pediatric clinics of our hospital for other reasons . patients and controls having any other systemic disease or infection and using medication other than colchicine were excluded from the study . laboratory data such as esr , crp , hemoglobin level , white blood cell count , platelet count , and mpv were noted using the electronic patient database of the last visit . the analyses were performed with the same analyzer ( beckman coulter , lh 780 ) in our center . nlr was calculated as a simple ratio between the absolute neutrophil count and absolute lymphocyte count . as this study represents a retrospective chart review , however , all patients signed an informed consent that allows our institution to use their clinical data . chi - square statistics was used for the comparisons of categorical variables between independent groups . the normal distributions of the numerical variables were evaluated by the shapiro wilk test . wallis nonparametric analysis of variances test was used for the comparisons of numerical variables between more than two independent groups , and mann whitney u - test was used for the comparisons between two groups . results for qualitative variables were presented as percentages , and quantitative variables were presented as mean and standard deviation . when a statistically significant difference was found by kruskal wallis test , then , post hoc pairwise comparisons were performed using mann whitney u - test . the associations between the numerical variables of the study were evaluated using spearman nonparametric correlation analysis . the type - i error level was accepted as 5% in the study , and all statistical analyses were performed as two - tailed . for the statistical analysis of the data , the statistical package for the social sciences 17.0 ( spss inc . , ninety of the patients were in attack - free period , and seventy were in attack period . criteria . attack - free period was described as at least 2 weeks from the end of an fmf attack according to the symptoms and acute phase reactants levels . control group was selected from the patients who had no acute or chronic disease that could cause inflammation and who were attended to pediatric clinics of our hospital for other reasons . patients and controls having any other systemic disease or infection and using medication other than colchicine were excluded from the study . laboratory data such as esr , crp , hemoglobin level , white blood cell count , platelet count , and mpv were noted using the electronic patient database of the last visit . the analyses were performed with the same analyzer ( beckman coulter , lh 780 ) in our center . nlr was calculated as a simple ratio between the absolute neutrophil count and absolute lymphocyte count . as this study represents a retrospective chart review , however , all patients signed an informed consent that allows our institution to use their clinical data . chi - square statistics was used for the comparisons of categorical variables between independent groups . the normal distributions of the numerical variables were evaluated by the shapiro wilk test . wallis nonparametric analysis of variances test was used for the comparisons of numerical variables between more than two independent groups , and mann whitney u - test was used for the comparisons between two groups . results for qualitative variables were presented as percentages , and quantitative variables were presented as mean and standard deviation . when a statistically significant difference was found by kruskal wallis test , then , post hoc pairwise comparisons were performed using mann whitney u - test . the associations between the numerical variables of the study were evaluated using spearman nonparametric correlation analysis . the type - i error level was accepted as 5% in the study , and all statistical analyses were performed as two - tailed . for the statistical analysis of the data , the statistical package for the social sciences 17.0 ( spss inc . , chicago , il , usa ) there were 160 participants ( 68.4% ) in the patient group and 74 participants ( 31.6% ) in the control group . ninety of patients ( 38.5% ) were in attack - free period , and 70 ( 29.9% ) were in attack period . the male / female distribution in the groups was 29 ( 41.4%)/41 ( 58.6% ) in fmf attack group , 35 ( 38.9%)/55 ( 61.1% ) in attack - free group , and 38 ( 51.4%)/36 ( 48.6% ) in control group . the statistical analyses revealed that the sex distribution between groups was similar ( p = 0.25 ) . ages according to the groups were 11.56 4.3 years in attack period , 12.81 3.88 years in attack - free period , and 10.74 4.01 years in the control group . the general group comparisons revealed that hemoglobin ( p < 0.001 ) , leukocyte ( p < 0.001 ) , thrombocyte ( p = 0.016 ) , crp ( p < 0.001 ) , mpv ( p < 0.001 ) , neutrophil ( p < 0.001 ) , and lymphocyte ( p < 0.001 ) levels were significantly differed between study groups . we found that mpv values of attack patients and attack - free patients had no significant difference ( p = 0.07 ) . mpv values of attack patients were significantly higher than the control group ( p < 0.001 ) , and mpv values of attack - free patients were also significantly higher than the control group ( p < 0.001 ) [ table 1 ] . we also found a negative correlation between mpv and thrombocyte count in all groups and it was significant in attack and attack - free periods ( p = 0.002 and p < 0.001 , respectively ) . complete blood count parameters in study groups the values of nlr in study groups are presented in table 2 . according to this , general group comparisons revealed a statistically significant difference between groups ( p < 0.001 ) , and post hoc pairwise comparisons showed that the highest values of nlr were found in the patients at attack period . the patients in attack - free period and the participants in control group had similar levels of nlr ( p = 0.45 ) , and they had lower ratios than the patients did at attack period ( p < 0.001 for both ) . correlations between the neutrophil / lymphocyte ratio and the other parameters in the study groups are summarized in table 3 . there were positive weak correlation between crp and nlr levels in attack ( r = 0.049 , p = 0.68 ) and attack - free patients ( r = 0.086 , p = 0.07 ) , but they were not statistically significant . neutrophil / lymphocyte ratios in study groups correlations between neutrophil / lymphocyte ratio and the other parameters in study groups the distribution of mefv gene mutations are summarized in table 4 . patients carrying m694v ( either homozygous or heterozygous ) were compared with patients carrying other mutations . nlr and mpv values did not have significant difference between different mutation groups ( p = 0.30 and p = 0.37 ) . only patients with m694v homozygous and m694v / m680i compound heterozygous mutations have higher crp levels ( p < 0.001 ) . mediterranean fever gene mutation analysis the colchicine usage was evaluated in attack and attack - free periods . accordingly , the patients in attack period used colchicine with a mean dose of 1.03 0.34 mg / day , and the patients in attack - free period used colchicine with a mean dose of 1.09 0.29 mg / day . the difference of colchicine usage between groups was not statistically significant ( p = 0.25 ) . the main aim of our study is to determine the subclinical inflammation in pediatric fmf patients using mpv and nlr . fmf is an autoinflammatory disease caused by abnormalities confined to the innate immune system and the result of reduced or complete loss of pyrin function . pyrin mutations and fmf link have been well established before . both pro- and anti - inflammatory roles pyrin is an important element of inflammasome and mutations in pyrin result in increased inflammation . this activates caspase-1 and the processing and release of active il-1. il-1 with other cytokines il-6 and tnf- results in high levels of acute phase reactants . esr , crp , fibrinogen , and saa are all used as markers for acute phase response in fmf . these acute phase proteins increase during attack period and usually return to normal in attack - free period . subclinical inflammation continues in up to 30% of the fmf patients during attack - free period . at this point , persistent elevation of acute phase proteins is important as it reflects the subclinical inflammation , which has the key role in the development of amyloidosis and other complications such as anemia , splenomegaly , and osteopenia . as a result , nlr was shown as a useful indicator of clinical outcome and disease severity in diseases having malign and inflammatory components . they also found that nlr was significantly higher in patients with amyloidosis than in amyloidosis - free patients . concluded that in fmf patients nlr can be used as an acute phase response such as crp . they found that nlr of fmf patients during attack period was significantly higher than those of attack - free patients and control group . uluca et al . found that nlr levels were higher in patients in attack - free period and they concluded that nlr may be an indicator for attack period but not attack - free period . zer et al . also reported nlr values of pediatric symptom - free fmf patients and healthy controls . however , in this study , they did not compare the nlr values of patients in attack period and attack - free period . our results provide evidence which supports the thought that nlr may be a parameter to show the inflammation in attack period . however , it may not be useful to define the subclinical inflammation according to our study groups since there was no significant difference between attack - free patients and control group . as it is cost - effective , available and can be calculated easily , nlr could be used to predict systemic inflammation in pediatric fmf patients during attack period . mpv has been investigated many times before to show disease activity , inflammatory load , and systemic inflammation in diseases . mpv is an easily available and cost - effective test that can show thrombocyte activation and function . most of them have found higher mpv levels in fmf patients , while others have reported lower mpv values . published two studies discussing the relationship between mpv and atherosclerosis in fmf patients . in the first study , they found that mpv values were similar in fmf patients and healthy controls . they concluded that mpv did not predict atherosclerosis risk in pediatric fmf patients . in the later study , they compared the mpv values and epicardial adipose tissue thickness in children with fmf . they found significantly greater epicardial adipose tissue thickness and higher mpv values in children with fmf . they concluded that mpv values might indicate an increased risk of atherosclerosis in fmf . in our study , both attack and attack - free patients had significantly higher mpv values compared to control group similar to most of the literature results . however , there were no significant differences between mpv values of attack and attack - free periods . therefore , we concluded that mpv is not useful to show the attack periods in fmf , but it may be valuable to show the risk of atherosclerosis and subclinical inflammation in pediatric fmf patients . many studies have reported that m694v mutation is related with high disease activity and amyloidosis in fmf . although we could not find any significant difference of nlr and mpv values between fmf patients carrying m694v mutation , patients with m694v homozygous and heterozygous mutations had higher crp values . a possible limitation of our study is that all of our study groups were under colchicine treatment , which may reduce inflammation . in addition , our study was performed in one center , so our results do not reflect all pediatric fmf population . the mean age of the patients differ significantly between study groups ; however , this should be accepted as a drawback rather than a positive finding as we did not perform an age - matched analysis . in addition , parameters were evaluated by cross - section , and no other follow - up values were measured . however , our results did not support that mpv might show attack and attack - free period . there were conflicting results in the literature about the role of mpv and nlr in inflammation and subclinical inflammation . ob contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.nu contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.bac contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.fa contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.nc contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work ob contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . nu contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . bac contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . fa contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . nc contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work

background : blood neutrophil to lymphocyte ratio ( nlr ) and mean platelet volume ( mpv ) both have been used as a simple marker of inflammation in many disorders . here , we aimed to investigate the relationship between nlr , mpv , and familial mediterranean fever ( fmf).materials and methods : in this retrospective study , the files of fmf patients in pediatric rheumatology outpatient clinic were reviewed . there were 160 participants ( 68.4% ) in the fmf patient group and 74 participants ( 31.6% ) in the control group . ninety of patients were in attack - free period , and 70 were in attack period.results:the highest values of nlr were found in the patients at attack period . patients in attack - free period and the participants in control group had similar levels of nlr ( 1.71 0.83 and 1.91 1.86 respectively ) ( p = 0.457 ) , and they had lower ratios than the patients did at attack period ( 4.10 3.11 ) ( p < 0.001 for both ) . there was no significant difference between mpv values of attack patients ( 8.35 4.91 ) and attack - free patients ( 8.43 1.15 ) ( p = 0.074 ) . mpv values of attack patients and attack - free patients were significantly higher than control group ( 7.99 0.81 ) ( p < 0.001 for both).conclusion : nlr ratio may indicate fmf attack period . since there was no significant difference between attack - free patients and control groups , nlr ratio can not be used as a subclinical inflammation marker . however , nlr could be a useful predictor of inflammation in fmf patients . on the other hand , since our attack and attack - free patients have similar mpv values and both had greater mpv values than control group , we suggest that mpv may be used to show subclinical inflammation .

INTRODUCTION MATERIALS AND METHODS Study design, participants, and variables assessment Statistical analyses RESULTS DISCUSSION CONCLUSIONS Financial support and sponsorship Conflicts of interest AUTHORS CONTRIBUTION

cone beam computed tomography ( cbct ) was introduced to the dental field to replace the cumbersome , expensive , and high - radiation producing medical ct scans around a decade ago suomalainen et al . the american association of oral and maxillofacial radiology has stated that cross - sectional views are recommended for planning dental implants , and this in combination with the easy accessibility , easy handling , and low - radiation dose of cbct imaging will lead to the widespread use of cbct imaging in implantology . considering the dose of radiation from other image acquisition modalities such as multislice computed tomography ( msct , e.g. , maxmand ct scan : effective dose of 2100 according to the 1990 recommendations of the international commission on radiological protection ( icrp ) ) and panoramic radiography ( e.g. , panoramic orthophos plus : effective dose of 6.3 and 13.3 according to icrp 1990 and 2005 , respectively ) , cbct has lesser radiation than msct and 10 times more radiation than a panoramic x - ray . the dose of radiation should be reported in millisievert ( msv ) or microsievert ( sv ) to express the effective dose ( e ) . as ludlow stated , the e of radiation has been recommended by the icrp as a means of comparing the detriment of different exposures to ionizing radiation to an equivalent detriment produced by a full - body dose of radiation . the e should be calculated using the equation e = pwt_ht , where wt = weighting factor , ht = equivalent dose . the ht should be calculated using the equation ht = pwr_dt , where wr = radiation weighting factor ( which is 1 in the case of x - ray radiation ) , dt = absorbed dose . benefits of cbct are three - dimensional ( 3d ) dataset , real - size data , the potential for generating all 2d images ( e.g. , orthopantomogram , lateral cephalogram , imaging of the temporomandibular joint ( tmj ) ) , potential for vertical scanning in a natural seated position , isotropic voxel size , high - resolution ( e.g. , bone trabeculae , periodontal ligament ( pdl ) , root formation ) imaging , lower dose of radiation than msct , less disturbance from metal artifacts , reduced costs compared with msct , easier accessibility , in - office imaging , easier handling , small footprint , digital imaging and communications in medicine ( dicom ) compatiblity , user - friendly postprocessing and viewing software , and better saving of energy compared with msct . limitations are low contrast range , limited detector size causing limited field of view and limited scanned volume , limited inner soft tissue information , increased noise from scatter radiation and concomitant loss of contrast resolution , movement of artifacts affecting the whole dataset , truncation artifacts ( caused by the fact that projections acquired with the region of interest selection do not contain the entire object ) , and that they can not be used for estimation of hounsfield units ( hus ) . hus represent the relative density of body tissues according to a calibrated gray - level scale , based on normalized hu values for air ( 1000 hu ) , water ( 0 hu ) , and dense bone ( + 1000 hu ) . hus are standard numbers originating from conventional msct imaging . despite the advantages of cbct compared with msct imaging , the latter is still considered a better choice for the analysis of bone density using an hu scale . the fan - shaped x - ray beam associated with less scattering and artifact production may explain the better accuracy of intensity values in an msct than in a cbct scanner which is a cone - shaped x - ray beam , and its higher amount of scattering and artifacts may explain the inaccuracies of their intensity values . in both technologies , the accuracy of intensity values can be affected by the beam - hardening phenomenon , which causes artifacts on the reconstructed images . in the posterior mandibular region , a deep lingual undercut is a common finding and can be difficult to manage , especially when a lingual plate perforation is suspected . it is essential to check the angulations and positioning of the drills or implant fixtures via radiographs and clinical detection of a possible perforation in the osteotomy site . for preoperative implants , cts are preferred because cross - sectional views bring a clearer visualization of the anatomy of the surgical site [ figure 1 ] . the major potential risks of encountering a lingual plate perforation are massive hemorrhage of submental and sublingual arteries , airway obstruction , and a perforation above the mylohyoid ridge might injure the lingual nerve . if the extruded implant is left unattended , the infection might spread to the parapharyngeal and retropharyngeal space , leading to more severe complications , such as mediastinitis , mycotic aneurysm formation with possible subsequent rupture of the internal carotid artery , and internal jugular vein thrombosis with septic pulmonary embolism or upper airway obstruction . the experimental site has to have sufficient vertical bone height ( 12 mm from the alveolar crest to the superior border of the inferior alveolar nerve canal ( ian ) ) to possibly place a 10 mm implant and a minimum gap of 2 mm between the tip of implant and mandibular canal . mandibular cross - sectional imaging at the edentulous first molar region shows three types of morphologies . the undercut ridge type ( type u , 66% ) is a ridge with a narrow base that expands bucco - lingually to a wider crest with a prominent point ( point p ) on the lingual plate , giving rise to a lingual undercut . the parallel ridge type ( type p , 20.4% ) ridge generally has a more or less parallel ridge form ; no lingual undercut is seen . the convergent ridge type ( type c , 13.6% ) ridge is one where the base of the ridge is wider than its crest ; no obvious undercut is seen [ figure 2 ] . cone beam computed tomography image demonstrating the possibility of lingual plate perforation by an implant three types of cross - sectional posterior mandibular morphology : ( a ) c type , ( b ) p type , and ( c ) u type ; line a represented a reference line 2 mm coronal to the inferior alveolar nerve canal watanabe et al . classified the cross - sectional mandibular morphology based on the outlines of the lingual and buccal plates , round on the buccal side and concave on the lingual side ( type a ) , concave on the buccal side and round on the lingual side ( type b ) , and round shape on both sides ( type c ) . they reported that at the posterior region , type c ( round ) was the most commonly found ( 59 - 61% ) , followed by type a ( lingual concavity ) ( 36 - 39% ) . the width of the mandible 5 - 20 mm from the inferior border of the mandible ranged from 10.5 to 15.8 mm , with no significant differences between genders . panoramic radiographs have an inherent magnification ranging from 10 to 30% , with the horizontal magnification being more variable and thus less reliable . marginal loss of bone and loss of bone - to - implant contact ( e.g. , by marsupuilization ) may indeed negatively influence success of the implant . most of these studies suggest an acceptable average of marginal loss of bone ( bone loss of 2 mm after the first year ) and the absence of a peri - implant radiolucency as a criterion of radiological success . the mandibular canal and mental foramen involve the inferior alveolar artery and inferior alveolar nerve . because images of the accessory mental foramina and bony canal to the accessory mental foramen overlap in various trabecular bone patterns . it was reported that the presence of the bifid mandibular canal in the mandibular ramus region was observed more frequently with cbct images , in 65% of patients compared with rotational panoramic radiographs , with a range from 0.08 to 0.95% . the accessory mental nerve communicated with branches of the facial and buccal nerves . so , it was indicated that surgical complications might be attributed to the existence of a mandibular incisive canal with a true neurovascular supply , and potential risks might also be related to the presence of the lingual foramen and anatomic variations , such as an anterior looping of the mental nerve [ figure 3 ] . measurement between the accessory mental foramen and point of bifurcation from the mandibular canal : ( a ) two - dimensional cone beam computed tomography image of the accessory mental foramen and point of bifurcation from the mandibular canal ; ( b ) linear distance between the accessory mental foramen and point of bifurcation from the mandibular canal ; ( c ) schematic drawing of 2d cbct image ( a ) the nasopalatine canal is usually described as being located in the midline of the palate , posterior to the central maxillary incisors . the funnel - shaped oral opening of the canal in the midline of the anterior palate is known as the incisive foramen , and is usually located immediately below the incisive papilla . the canal divides into two canaliculi on its way to the nasal cavity , and terminates at the nasal floor with an opening ( known as the foramina of stenson ) at either side of the septum . the canal contains the nasopalatine ( incisive ) nerve and the terminal branch of the descending nasopalatine artery , as well as fibrous connective tissue , fat , and even small salivary glands . contact of the implant with neural tissue may result in failure of osseointegration or lead to sensory dysfunction . the anatomic variants of the canal are differentiated into three groups [ figures 4 and 5 ] . classification of anatomic variations of the nasopalatine canal:(a ) a single canal ; ( b ) two parallel canals ; ( c ) variations of the y type of canal , with one oral / palatal opening ( incisive foramen ) and two or more nasal openings ( foramina of stenson ) type a nasopalatine canal ( a single canal ) type b nasopalatine canal ( two separate canals ) as evaluated in a coronal cone beam computed tomography image type c nasopalatine canal ( y configuration of canal ) with one oral / palatal opening and two nasal openings dimensional alterations occur on the alveolar process following tooth extraction . after the healing process is completed , loss of bone at the facial aspect of the marginal one - third of the socket is more pronounced than in the palatal / lingual aspect . this difference in the healing outcome maybe related to the fact that the buccal bone wall is thinner than its palatal counterpart . the thinner the facial bone wall , the more extensive the loss of facial bone . following tooth removal / loss , the entire marginal , buccal bone plate be lost , but an additional 2 mm of the original socket dimension may disappear during the process of socket healing and site adaptation . in the posterior mandibular region , a deep lingual undercut is a common finding and can be difficult to manage , especially when a lingual plate perforation is suspected . it is essential to check the angulations and positioning of the drills or implant fixtures via radiographs and clinical detection of a possible perforation in the osteotomy site . for preoperative implants , cts are preferred because cross - sectional views bring a clearer visualization of the anatomy of the surgical site [ figure 1 ] . the major potential risks of encountering a lingual plate perforation are massive hemorrhage of submental and sublingual arteries , airway obstruction , and a perforation above the mylohyoid ridge might injure the lingual nerve . if the extruded implant is left unattended , the infection might spread to the parapharyngeal and retropharyngeal space , leading to more severe complications , such as mediastinitis , mycotic aneurysm formation with possible subsequent rupture of the internal carotid artery , and internal jugular vein thrombosis with septic pulmonary embolism or upper airway obstruction . the experimental site has to have sufficient vertical bone height ( 12 mm from the alveolar crest to the superior border of the inferior alveolar nerve canal ( ian ) ) to possibly place a 10 mm implant and a minimum gap of 2 mm between the tip of implant and mandibular canal . mandibular cross - sectional imaging at the edentulous first molar region shows three types of morphologies . the undercut ridge type ( type u , 66% ) is a ridge with a narrow base that expands bucco - lingually to a wider crest with a prominent point ( point p ) on the lingual plate , giving rise to a lingual undercut . the parallel ridge type ( type p , 20.4% ) ridge generally has a more or less parallel ridge form ; no lingual undercut is seen . the convergent ridge type ( type c , 13.6% ) ridge is one where the base of the ridge is wider than its crest ; no obvious undercut is seen [ figure 2 ] . cone beam computed tomography image demonstrating the possibility of lingual plate perforation by an implant three types of cross - sectional posterior mandibular morphology : ( a ) c type , ( b ) p type , and ( c ) u type ; line a represented a reference line 2 mm coronal to the inferior alveolar nerve canal watanabe et al . classified the cross - sectional mandibular morphology based on the outlines of the lingual and buccal plates , round on the buccal side and concave on the lingual side ( type a ) , concave on the buccal side and round on the lingual side ( type b ) , and round shape on both sides ( type c ) . they reported that at the posterior region , type c ( round ) was the most commonly found ( 59 - 61% ) , followed by type a ( lingual concavity ) ( 36 - 39% ) . the width of the mandible 5 - 20 mm from the inferior border of the mandible ranged from 10.5 to 15.8 mm , with no significant differences between genders . panoramic radiographs have an inherent magnification ranging from 10 to 30% , with the horizontal magnification being more variable and thus less reliable . marginal loss of bone and loss of bone - to - implant contact ( e.g. , by marsupuilization ) may indeed negatively influence success of the implant . most of these studies suggest an acceptable average of marginal loss of bone ( bone loss of 2 mm after the first year ) and the absence of a peri - implant radiolucency as a criterion of radiological success . the mandibular canal and mental foramen involve the inferior alveolar artery and inferior alveolar nerve . because images of the accessory mental foramina and bony canal to the accessory mental foramen overlap in various trabecular bone patterns . it was reported that the presence of the bifid mandibular canal in the mandibular ramus region was observed more frequently with cbct images , in 65% of patients compared with rotational panoramic radiographs , with a range from 0.08 to 0.95% . the accessory mental nerve communicated with branches of the facial and buccal nerves . so , it was indicated that surgical complications might be attributed to the existence of a mandibular incisive canal with a true neurovascular supply , and potential risks might also be related to the presence of the lingual foramen and anatomic variations , such as an anterior looping of the mental nerve [ figure 3 ] . measurement between the accessory mental foramen and point of bifurcation from the mandibular canal : ( a ) two - dimensional cone beam computed tomography image of the accessory mental foramen and point of bifurcation from the mandibular canal ; ( b ) linear distance between the accessory mental foramen and point of bifurcation from the mandibular canal ; ( c ) schematic drawing of 2d cbct image ( a ) the nasopalatine canal is usually described as being located in the midline of the palate , posterior to the central maxillary incisors . the funnel - shaped oral opening of the canal in the midline of the anterior palate is known as the incisive foramen , and is usually located immediately below the incisive papilla . the canal divides into two canaliculi on its way to the nasal cavity , and terminates at the nasal floor with an opening ( known as the foramina of stenson ) at either side of the septum . the canal contains the nasopalatine ( incisive ) nerve and the terminal branch of the descending nasopalatine artery , as well as fibrous connective tissue , fat , and even small salivary glands . contact of the implant with neural tissue may result in failure of osseointegration or lead to sensory dysfunction . the anatomic variants of the canal are differentiated into three groups [ figures 4 and 5 ] . classification of anatomic variations of the nasopalatine canal:(a ) a single canal ; ( b ) two parallel canals ; ( c ) variations of the y type of canal , with one oral / palatal opening ( incisive foramen ) and two or more nasal openings ( foramina of stenson ) type a nasopalatine canal ( a single canal ) type b nasopalatine canal ( two separate canals ) as evaluated in a coronal cone beam computed tomography image type c nasopalatine canal ( y configuration of canal ) with one oral / palatal opening and two nasal openings dimensional alterations occur on the alveolar process following tooth extraction . after the healing process is completed , loss of bone at the facial aspect of the marginal one - third of the socket is more pronounced than in the palatal / lingual aspect . this difference in the healing outcome maybe related to the fact that the buccal bone wall is thinner than its palatal counterpart . the thinner the facial bone wall , the more extensive the loss of facial bone . following tooth removal / loss , the entire marginal , buccal bone plate be lost , but an additional 2 mm of the original socket dimension may disappear during the process of socket healing and site adaptation .

cone beam computed tomography ( cbct ) scanners for the oral and maxillofacial region were pioneered in the late 1990s independently by arai et al . in japan and mozzo et al . cbct has a lower dose of radiation , minimal metal artifacts , reduced costs , easier accessibility , and easier handling than multislice computed tomography ( msct ) ; however , the latter is still considered a better choice for the analysis of bone density using a hounsfield unit ( hu ) scale . oral implants require localized area of oral and maxillofacial area for radiation exposure ; so , cbct is an ideal choice . cbct scans help in the planning of oral implants ; they enable measurement of the distance between the alveolar crest and mandibular canal to avoid impingement of inferior alveolar nerve , avoid perforation of the mandibular posterior lingual undercut , and assess the density and quality of bone , and help in planning of the oral implant in the maxilla with special attention to the nasopalatine canal and maxillary sinus . hence , cbct reduces the overall exposure to radiation .

I Mandibular lingual undercut and inferior alveolar canal Accessory mental foramen Nasopalatine morphology Alveolar process

male young adult ( 4 - 6 weeks of age ) c57bl/6 ( charles river ) , drd1a tdtomato bac transgenic ( d1-tdtomato , gift of n. calakos , duke university , durham , nc ) , drd2egfp bac transgenic ( d2-egfp ) , oxtrtm1.1wsy homozygous ( cotr ko , jackson laboratory ) , or otr venus neo/+ ( otr - venus , gift of l.j . young , emory university , atlanta , ga ) mice backcrossed to c57bl/6 were used for all experiments . all procedures complied with the animal care standards set forth by the national institutes of health and were approved by stanford university s administrative panel on laboratory animal care . experimenters were blind to the treatment condition when subjective criteria were used as a component of data analysis , and control and test conditions were interleaved for all experiments . the protocol for social conditioned place preference ( scpp ) was shortened to 2 days of conditioning ( fig . animals were weaned ( or delivered from charles river ) at 3 weeks of age into home cages containing 3 - 5 cage - mates , and housed on corncob bedding ( bed - ocobs , 1/8 , pharmaserv ) . one to two weeks later , animals were subjected to experimental manipulations and returned to their home cage ( all cage - mates were of the same genotype and received the same experimental manipulation ) . animals were then placed in open field activity chamber ( env-510 , med associates ) equipped with infrared beams and a software interface ( activity monitor , med associates ) that monitors the position of the mouse . the apparatus was divided into two equally sized zones using a clear plastic wall , with a 5 cm diameter circular opening at the base ; each zone contained one type of novel bedding ( alpha - dri , pharmaserv , alpha chip , pharmaserv ; bed - ocobs , 1/4 , pharmaserv ; or kaytee soft granule , petco ) . the amount of time spent freely exploring each zone was recorded during 30-minute test sessions . after an initial test ( pre - conditioning trial ) to establish baseline preference for the two sets of bedding cues , mice were assigned to receive social conditioning ( with cage - mates ) for 24 hours on one type of bedding , followed by 24 hours on the isolate bedding cue ( without cage - mates ) on the other type of bedding . 24 hours later , animals received a 30-minute post - conditioning trial to establish preference for the two conditioned cues . animals were excluded ( pre - established criteria ) if they exhibited a pre - conditioning preference score > 1.5 or < 0.5 ( for an unbiased procedure ) ; pre - conditioning versus post - conditioning social preference scores were considered significant if paired student s t - test p values were < 0.05 . comparisons between experimental conditions were made using both normalized social preference scores ( time spent in social zone post over pre ) , and subtracted social preference scores ( time spent in social zone post minus pre ) ; these were considered significant if unpaired student s t - test ( two conditions ) , or anova ( three conditions , supplementary fig . 6 ) p values were < 0.05 . for cocaine - conditioned place preference ( ccpp ) , the apparatus was divided into two equally sized zones using plastic floor tiles with distinct visual and tactile cues ( grey & smooth or white & rough ) . after 5 days b.i.d . saline injections for habituation in the home cage , the amount of time spent freely exploring each zone was recorded during 30-minute test sessions . after an initial test to establish baseline preference for the two sets of cues , mice in each of the two treatment groups ( i.p . otr - a ) were randomly assigned in a counterbalanced fashion to receive cocaine ( 20 mg / kg ) or saline in the presence of one set of cues ( i.e. , an unbiased design ) . the second conditioning session was conducted 24 hours later in the presence of the other set of cues . the post - conditioning test session was conducted 24 hours after the second conditioning session to determine time spent in the presence of the cocaine versus saline associated cue . isolation and socially housed animals were not different in terms of ccpp so they were pooled for further analysis . pre - conditioning , post - conditioning , subtracted , and normalized cocaine preference scores were calculated as in scpp . briefly , probes consisted of a reservoir ( polypropylene luer hub ) attached to a double cannula guide ( c235gs , 26ga , c / c distance 2.0 mm , 5 mm pedestal , cut 4 mm below pedestal , custom specified for mouse bilateral nac coordinates , plastics one inc ) . polyimide tubing ( 40 awg , 0.0031 " i d , 0.0046 " od , 0.00075 " wall , small parts ) was threaded through the stainless steel tubing of the cannula guide on one end , and out of a hole drilled into the luer hub to act as a flush outlet ( outflow tube ) on the other end . the dialysis membrane ( spectra / por , 13 kd molecular weight cut - off , spectrum labs ) was then threaded over the outflow tube and through the cannula guide ; ends were cut such that 500 m of dialysis membrane was exposed below the cannula guide and above the sealed end . junctions were sealed with bio - compatible epoxies ( epo - tek 730 , epo - tek 301 , epoxy technologies ) . in this design , a pharmacological agent could be intracranially delivered rapidly , continually , and concurrently to all members of the social group , without anesthesia . at postnatal day 35 - 40 , probes were implanted into the nac of male mice following bilateral craniotomy ( bregma 1.54 mm ; lateral 1.0 mm ) and attached to the skull using dental acrylic . previous reports indicate that for complete pharmacological effect , drug concentration in the reservoir must be 500 times the dose used for direct injections , thus otr and 5htr1b antagonists were applied at 10 mm ( l-368,899 ) and 85 mm ( nas-181 ) in a volume of 25 l saline . probe placement and competency was verified by post - hoc application of concentrated fluorescein sodium salt ( sigma - aldrich ) to reservoir prior to intracardial pfa perfusion and histology ( supplementary fig . 1f ) . rabies virus ( rbv ) was generated from a full length cdna plasmid containing all components of rbv ( sad l16 ; gift from dr . we replaced the rabies virus glycoprotein with egfp ( rbv - egfp ) , tdtomato ( rbv - tdtomato ) or cre - egfp to generate rbv expressing cre - egfp ( rbv - cre - egfp ) , egfp ( rbv - egfp ) or tdtomato ( rbv - tdtomato ) . to rescue rbv from this cdna we used a modified version of a published protocol . briefly , hek293 t cells were transfected with a total of 6 plasmids ; 4 plasmids expressing the rbv components ptit - n , ptit - p , ptit - g , and ptit - l ; one plasmid expressing t7 rna polymerase ( pcaggs - t7 ) , and the aforementioned glycoprotein - deleted rbv cdna plasmid expressing cre - egfp , egfp or tdtomato . for the amplification of rbv , the media bathing these hek293 t ( atcc ) cells was collected 3 - 4 days posttransfection and moved to baby hamster kidney ( bhk ) cells stably expressing rbv glycoprotein ( bhk - b19 g ) . after three days , the media from bhk - b19 g cells was collected , centrifuged for 5 min at 3,000 x g to remove cell debris , and concentrated by ultracentrifugation ( 55,000 x g for 2 hr ) . the adeno - associated viruses ( aavs ) used in this study were produced by the stanford neuroscience gene vector and virus core . briefly , aav - dj was produced by transfection of aav 293 cells ( agilent , inc ) with three plasmids : an aav vector expressing cre - egfp , aav helper plasmid ( phelper , agilent , inc ) , and aav rep - cap helper plasmid ( prc - dj , gift from mark kay , stanford ) . at 72 h after transfection , the iodixanol was diluted and the aav was concentrated using a 100 kda molecular weight cutoff ultrafiltration device . stereotaxic injection of viruses into nac was performed under general ketamine - medetomidine anesthesia using a stereotaxic instrument ( david kopf ) . a small volume ( 1 l ) of concentrated virus solution was injected bilaterally into nac core ( bregma 1.54 mm ; lateral 1.0 mm ; ventral 4.0 mm ) , unilaterally into the dorsal raphe ( drph ; bregma -3.3 mm ; lateral 0.0 mm ; ventral 3.35 mm ) , bilaterally into the ventral subiculum ( vsub ; bregma -2.95 mm ; lateral 3.1 mm ; ventral 4.35 mm ) , or bilaterally anterior cingulate ( acc ; bregma 1.0 mm ; lateral 0.3 mm ; ventral 1.25 mm ) at a slow rate ( 100 nl / min ) using a syringe pump ( harvard apparatus , ma ) . injection sites and viral infectivity were confirmed in all animals post - hoc by preparing sections ( 50 m ) containing the relevant brain region ( supplementary fig . briefly , after intracardial perfusion with 4% paraformaldehyde in pbs ( ph 7.4 ) , the brains were post fixed overnight in this same solution and the following day 50 m coronal , sagittal , or horizontal sections were prepared . primary antibodies were used at the following concentrations : mouse anti - oxytocin - neurophysin ( ot - np , 1:50 ; gift of harold gainer , nih bethesda , md ) ; rat anti - green fluorescent protein ( gfp , 1:1000 ; nacalai ) ; rabbit anti - parvalbumin ( parv , 1:750 ; swant ) ; rabbit anti - neuronal nitric oxide synthase ( nnos , 1:100 ; bd transduction laboratories ) ; rabbit anti - glial fibrillary protein ( gfap , 1:80 ; sigma - aldrich ) ; rabbit anti - choline acetyltransferase ( chat , 1:100 ; millipore ) ; rabbit anti - dopamine receptor protein ( darp , 1:100 , millipore ) ; sheep anti - tryptophan hydroxylase ( tryph , 1:100 millipore ) diluted in a solution containing 1% horse serum , 0.2% bsa , and 0.5% triton x-100 in pbs . after overnight incubation in primary antibody ( rt , shaker ) , slices were washed four times in pbs and then incubated with appropriate secondary antibody diluted at 1:750 for 2 h in pbs containing 0.5% triton x-100 . subsequently , slices were washed 5 times and mounted using vectashield mounting medium ( vector laboratories ) . to identify cells expressing gfp or tdtomato due to the injection of rbv - egfp or rbv - tdtomato into the nac , image acquisition was performed with a confocal microscope ( zeiss lsm510 ) using a 10x/0.30 plan neofluar and a 40x/1.3 oil dic plan apochromat objective . parasagittal slices ( 250 m ) containing the nac core were prepared from c57bl/6 and d1-tdtomato / d2-egfp bac transgenic mice on a c57bl/6 background using standard procedures . briefly , after mice were anesthetized with isoflurane and decapitated , brains were quickly removed and placed in ice - cold low sodium , high sucrose dissecting solution . slices were cut by adhering the two sagittal hemispheres brain containing the nac core to the stage of a leica vibroslicer . slices were allowed to recover for a minimum of 60 min in a submerged holding chamber ( 25c ) containing artificial cerebrospinal fluid ( acsf ) consisting of 119 mm nacl , 2.5 mm kcl , 2.5 mm cacl2 , 1.3 mm mgso4 , 1 mm nah2po4 , 11 mm glucose and 26.2 mm nahco3 . slices were then removed from the holding chamber and placed in the recording chamber where they were continuously perfused with oxygenated ( 95% o2 , 5% co2 ) acsf at a rate of 2 ml per min at 26 2c . for epsc recordings , bicuculline ( 20 m ) for ipsc recordings , dl-2-amino-5-phosphonovalerate ( dapv , 10 m ) and 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide ( nbqx , 5 m ) dissolved in dmso were added to block nmda and ampa receptors respectively . whole - cell voltage - clamp recordings from msns were obtained under visual control using a 40x objective . d1- and d2 msns in the nac core were identified by the presence of tdtomato and egfp , respectively , that were excited with uv light using bandpass filters ( hq545/30x ex for tdtomato ; hq470/40x ex for egfp ) . recordings were made with electrodes ( 3.56.5 m ) filled with 115 mm csmeso4 , 20 mm cscl , 10 mm hepes , 0.6 mm egta , 2.5 mm mgcl , 10 mm na - phosphocreatine , 4 mm na - atp , 0.3 mm na - gtp , and 1 mm qx-314 . excitatory and inhibitory afferents were stimulated with a bipolar nichrome wire electrode placed at the border between the nac core and cortex dorsal to the anterior commissure . recordings were performed using a multiclamp 700b ( molecular devices ) , filtered at 2 khz and digitized at 10 khz . epscs were evoked at a frequency of 0.1 hz while msns were voltage - clamped at 70 mv . input resistance and access resistance were monitored continuously throughout each experiment ; experiments were terminated if these changed by > 15% . summary ltd graphs were generated by averaging the peak amplitudes of individual epscs in 1 min bins ( 6 consecutive sweeps ) and normalizing these to the mean value of epscs collected during the 10 min baseline immediately before the ltd - induction protocol . oxytocin ( ot , tocris biosciences , 1 m , 10 minute ) was bath applied following the collection of baseline for induction of ot - ltd . for experiments examining the blockade of ot - ltd , slices were pre - incubated in antagonist ( otr - a , 1 m l-368,899 hydrochloride or 5htr1b - a , 20 m nas-181 ; tocris biosciences ) for at least 30 minutes prior to recording . for experiments examining the reversal of ot - ltd , 30 - 40 minutes following the collection of stable baseline epscs , 5ht1b - ltd was induced by 10 minute bath application of 2 m cp-93129 dihydrochloride ( tocris biosciences ) as described previously . for experiments examining the occlusion of ot - ltd , after stabilization of 5ht1b - ltd ( at 30 - 40 minutes post induction ) , miniature epscs were collected at a holding potential of 70 mv in the presence of ttx ( 0.5 m ) . 2 minutes after break - in ( sweep number 5 , 30s sweeps ) , thirty second blocks of events ( total of 200 events per cell ) were acquired and analyzed using mini - analysis software ( synaptosoft ) with threshold parameters set at 5 pa amplitude and <3 ms rise time . slices were incubated in the appropriate drug ( dissolved in acsf - bicuculline ) for 10 minutes prior to recording , and cross - cell comparisons were made . paired - pulse ratios ( ppr ) were acquired by applying a second afferent stimulus of equal intensity , 50 ms after the first stimulus , and then calculating the ratio of epsc2/epsc1 . coefficient of variance ( cv ) was calculated from the standard deviation divided by the average ( stdev / avg ) of 10-minute blocks ( minutes 0 - 10 , pre ; minutes 40 - 50 , post ) . comparisons between different experimental manipulations were made using a two- tailed , students t - test ( paired or unpaired , as appropriate ) with p < 0.05 considered significant . all statements in the text regarding differences between grouped data indicate that statistical significance was achieved , assuming normal distribution and equal variance . male young adult ( 4 - 6 weeks of age ) c57bl/6 ( charles river ) , drd1a tdtomato bac transgenic ( d1-tdtomato , gift of n. calakos , duke university , durham , nc ) , drd2egfp bac transgenic ( d2-egfp ) , oxtrtm1.1wsy homozygous ( cotr ko , jackson laboratory ) , or otr venus neo/+ ( otr - venus , gift of l.j . young , emory university , atlanta , ga ) mice backcrossed to c57bl/6 were used for all experiments . all procedures complied with the animal care standards set forth by the national institutes of health and were approved by stanford university s administrative panel on laboratory animal care . experimenters were blind to the treatment condition when subjective criteria were used as a component of data analysis , and control and test conditions were interleaved for all experiments . the protocol for social conditioned place preference ( scpp ) was shortened to 2 days of conditioning ( fig . animals were weaned ( or delivered from charles river ) at 3 weeks of age into home cages containing 3 - 5 cage - mates , and housed on corncob bedding ( bed - ocobs , 1/8 , pharmaserv ) . one to two weeks later , animals were subjected to experimental manipulations and returned to their home cage ( all cage - mates were of the same genotype and received the same experimental manipulation ) . animals were then placed in open field activity chamber ( env-510 , med associates ) equipped with infrared beams and a software interface ( activity monitor , med associates ) that monitors the position of the mouse . the apparatus was divided into two equally sized zones using a clear plastic wall , with a 5 cm diameter circular opening at the base ; each zone contained one type of novel bedding ( alpha - dri , pharmaserv , alpha chip , pharmaserv ; bed - ocobs , 1/4 , pharmaserv ; or kaytee soft granule , petco ) . the amount of time spent freely exploring each zone was recorded during 30-minute test sessions . after an initial test ( pre - conditioning trial ) to establish baseline preference for the two sets of bedding cues , mice were assigned to receive social conditioning ( with cage - mates ) for 24 hours on one type of bedding , followed by 24 hours on the isolate bedding cue ( without cage - mates ) on the other type of bedding . 24 hours later , animals received a 30-minute post - conditioning trial to establish preference for the two conditioned cues . animals were excluded ( pre - established criteria ) if they exhibited a pre - conditioning preference score > 1.5 or < 0.5 ( for an unbiased procedure ) ; pre - conditioning versus post - conditioning social preference scores were considered significant if paired student s t - test p values were < 0.05 . comparisons between experimental conditions were made using both normalized social preference scores ( time spent in social zone post over pre ) , and subtracted social preference scores ( time spent in social zone post minus pre ) ; these were considered significant if unpaired student s t - test ( two conditions ) , or anova ( three conditions , supplementary fig . 6 ) p values were < 0.05 . for cocaine - conditioned place preference ( ccpp ) , the apparatus was divided into two equally sized zones using plastic floor tiles with distinct visual and tactile cues ( grey & smooth or white & rough ) . after 5 days b.i.d . saline injections for habituation in the home cage , the amount of time spent freely exploring each zone was recorded during 30-minute test sessions . after an initial test to establish baseline preference for the two sets of cues , mice in each of the two treatment groups ( i.p . otr - a ) were randomly assigned in a counterbalanced fashion to receive cocaine ( 20 mg / kg ) or saline in the presence of one set of cues ( i.e. , an unbiased design ) . the second conditioning session was conducted 24 hours later in the presence of the other set of cues . the post - conditioning test session was conducted 24 hours after the second conditioning session to determine time spent in the presence of the cocaine versus saline associated cue . isolation and socially housed animals were not different in terms of ccpp so they were pooled for further analysis . pre - conditioning , post - conditioning , subtracted , and normalized cocaine preference scores were calculated as in scpp . briefly , probes consisted of a reservoir ( polypropylene luer hub ) attached to a double cannula guide ( c235gs , 26ga , c / c distance 2.0 mm , 5 mm pedestal , cut 4 mm below pedestal , custom specified for mouse bilateral nac coordinates , plastics one inc ) . polyimide tubing ( 40 awg , 0.0031 " i d , 0.0046 " od , 0.00075 " wall , small parts ) was threaded through the stainless steel tubing of the cannula guide on one end , and out of a hole drilled into the luer hub to act as a flush outlet ( outflow tube ) on the other end . the dialysis membrane ( spectra / por , 13 kd molecular weight cut - off , spectrum labs ) was then threaded over the outflow tube and through the cannula guide ; ends were cut such that 500 m of dialysis membrane was exposed below the cannula guide and above the sealed end . junctions were sealed with bio - compatible epoxies ( epo - tek 730 , epo - tek 301 , epoxy technologies ) . in this design , a pharmacological agent could be intracranially delivered rapidly , continually , and concurrently to all members of the social group , without anesthesia . at postnatal day 35 - 40 , probes were implanted into the nac of male mice following bilateral craniotomy ( bregma 1.54 mm ; lateral 1.0 mm ) and attached to the skull using dental acrylic . previous reports indicate that for complete pharmacological effect , drug concentration in the reservoir must be 500 times the dose used for direct injections , thus otr and 5htr1b antagonists were applied at 10 mm ( l-368,899 ) and 85 mm ( nas-181 ) in a volume of 25 l saline . probe placement and competency was verified by post - hoc application of concentrated fluorescein sodium salt ( sigma - aldrich ) to reservoir prior to intracardial pfa perfusion and histology ( supplementary fig . rabies virus ( rbv ) was generated from a full length cdna plasmid containing all components of rbv ( sad l16 ; gift from dr . we replaced the rabies virus glycoprotein with egfp ( rbv - egfp ) , tdtomato ( rbv - tdtomato ) or cre - egfp to generate rbv expressing cre - egfp ( rbv - cre - egfp ) , egfp ( rbv - egfp ) or tdtomato ( rbv - tdtomato ) . to rescue rbv from this cdna we used a modified version of a published protocol . briefly , hek293 t cells were transfected with a total of 6 plasmids ; 4 plasmids expressing the rbv components ptit - n , ptit - p , ptit - g , and ptit - l ; one plasmid expressing t7 rna polymerase ( pcaggs - t7 ) , and the aforementioned glycoprotein - deleted rbv cdna plasmid expressing cre - egfp , egfp or tdtomato . for the amplification of rbv , the media bathing these hek293 t ( atcc ) cells was collected 3 - 4 days posttransfection and moved to baby hamster kidney ( bhk ) cells stably expressing rbv glycoprotein ( bhk - b19 g ) . after three days , the media from bhk - b19 g cells was collected , centrifuged for 5 min at 3,000 x g to remove cell debris , and concentrated by ultracentrifugation ( 55,000 x g for 2 hr ) . the adeno - associated viruses ( aavs ) used in this study were produced by the stanford neuroscience gene vector and virus core . briefly , aav - dj was produced by transfection of aav 293 cells ( agilent , inc ) with three plasmids : an aav vector expressing cre - egfp , aav helper plasmid ( phelper , agilent , inc ) , and aav rep - cap helper plasmid ( prc - dj , gift from mark kay , stanford ) . at 72 h after transfection , the iodixanol was diluted and the aav was concentrated using a 100 kda molecular weight cutoff ultrafiltration device . stereotaxic injection of viruses into nac was performed under general ketamine - medetomidine anesthesia using a stereotaxic instrument ( david kopf ) . a small volume ( 1 l ) of concentrated virus solution was injected bilaterally into nac core ( bregma 1.54 mm ; lateral 1.0 mm ; ventral 4.0 mm ) , unilaterally into the dorsal raphe ( drph ; bregma -3.3 mm ; lateral 0.0 mm ; ventral 3.35 mm ) , bilaterally into the ventral subiculum ( vsub ; bregma -2.95 mm ; lateral 3.1 mm ; ventral 4.35 mm ) , or bilaterally anterior cingulate ( acc ; bregma 1.0 mm ; lateral 0.3 mm ; ventral 1.25 mm ) at a slow rate ( 100 nl / min ) using a syringe pump ( harvard apparatus , ma ) . injection sites and viral infectivity were confirmed in all animals post - hoc by preparing sections ( 50 m ) containing the relevant brain region ( supplementary fig . briefly , after intracardial perfusion with 4% paraformaldehyde in pbs ( ph 7.4 ) , the brains were post fixed overnight in this same solution and the following day 50 m coronal , sagittal , or horizontal sections were prepared . primary antibodies were used at the following concentrations : mouse anti - oxytocin - neurophysin ( ot - np , 1:50 ; gift of harold gainer , nih bethesda , md ) ; rat anti - green fluorescent protein ( gfp , 1:1000 ; nacalai ) ; rabbit anti - parvalbumin ( parv , 1:750 ; swant ) ; rabbit anti - neuronal nitric oxide synthase ( nnos , 1:100 ; bd transduction laboratories ) ; rabbit anti - glial fibrillary protein ( gfap , 1:80 ; sigma - aldrich ) ; rabbit anti - choline acetyltransferase ( chat , 1:100 ; millipore ) ; rabbit anti - dopamine receptor protein ( darp , 1:100 , millipore ) ; sheep anti - tryptophan hydroxylase ( tryph , 1:100 millipore ) diluted in a solution containing 1% horse serum , 0.2% bsa , and 0.5% triton x-100 in pbs . after overnight incubation in primary antibody ( rt , shaker ) , slices were washed four times in pbs and then incubated with appropriate secondary antibody diluted at 1:750 for 2 h in pbs containing 0.5% triton x-100 . subsequently , slices were washed 5 times and mounted using vectashield mounting medium ( vector laboratories ) . to identify cells expressing gfp or tdtomato due to the injection of rbv - egfp or rbv - tdtomato into the nac , image acquisition was performed with a confocal microscope ( zeiss lsm510 ) using a 10x/0.30 plan neofluar and a 40x/1.3 oil dic plan apochromat objective . parasagittal slices ( 250 m ) containing the nac core were prepared from c57bl/6 and d1-tdtomato / d2-egfp bac transgenic mice on a c57bl/6 background using standard procedures . briefly , after mice were anesthetized with isoflurane and decapitated , brains were quickly removed and placed in ice - cold low sodium , high sucrose dissecting solution . slices were cut by adhering the two sagittal hemispheres brain containing the nac core to the stage of a leica vibroslicer . slices were allowed to recover for a minimum of 60 min in a submerged holding chamber ( 25c ) containing artificial cerebrospinal fluid ( acsf ) consisting of 119 mm nacl , 2.5 mm kcl , 2.5 mm cacl2 , 1.3 mm mgso4 , 1 mm nah2po4 , 11 mm glucose and 26.2 mm nahco3 . slices were then removed from the holding chamber and placed in the recording chamber where they were continuously perfused with oxygenated ( 95% o2 , 5% co2 ) acsf at a rate of 2 ml per min at 26 2c . for epsc recordings , bicuculline ( 20 m ) was added to the acsf to block gabaa receptor mediated inhibitory synaptic currents . for ipsc recordings , dl-2-amino-5-phosphonovalerate ( dapv , 10 m ) and 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide ( nbqx , 5 m ) dissolved in dmso were added to block nmda and ampa receptors respectively . whole - cell voltage - clamp recordings from msns were obtained under visual control using a 40x objective . d1- and d2 msns in the nac core were identified by the presence of tdtomato and egfp , respectively , that were excited with uv light using bandpass filters ( hq545/30x ex for tdtomato ; hq470/40x ex for egfp ) . recordings were made with electrodes ( 3.56.5 m ) filled with 115 mm csmeso4 , 20 mm cscl , 10 mm hepes , 0.6 mm egta , 2.5 mm mgcl , 10 mm na - phosphocreatine , 4 mm na - atp , 0.3 mm na - gtp , and 1 mm qx-314 . excitatory and inhibitory afferents were stimulated with a bipolar nichrome wire electrode placed at the border between the nac core and cortex dorsal to the anterior commissure . recordings were performed using a multiclamp 700b ( molecular devices ) , filtered at 2 khz and digitized at 10 khz . epscs were evoked at a frequency of 0.1 hz while msns were voltage - clamped at 70 mv . input resistance and access resistance were monitored continuously throughout each experiment ; experiments were terminated if these changed by > 15% . summary ltd graphs were generated by averaging the peak amplitudes of individual epscs in 1 min bins ( 6 consecutive sweeps ) and normalizing these to the mean value of epscs collected during the 10 min baseline immediately before the ltd - induction protocol . oxytocin ( ot , tocris biosciences , 1 m , 10 minute ) was bath applied following the collection of baseline for induction of ot - ltd . for experiments examining the blockade of ot - ltd , slices were pre - incubated in antagonist ( otr - a , 1 m l-368,899 hydrochloride or 5htr1b - a , 20 m nas-181 ; tocris biosciences ) for at least 30 minutes prior to recording . for experiments examining the reversal of ot - ltd , 30 - 40 minutes post induction , otr - a was bath applied for 10 minutes . following the collection of stable baseline epscs , 5ht1b - ltd was induced by 10 minute bath application of 2 m cp-93129 dihydrochloride ( tocris biosciences ) as described previously . for experiments examining the occlusion of ot - ltd , after stabilization of 5ht1b - ltd ( at 30 - 40 minutes post induction ) , miniature epscs were collected at a holding potential of 70 mv in the presence of ttx ( 0.5 m ) . 2 minutes after break - in ( sweep number 5 , 30s sweeps ) , thirty second blocks of events ( total of 200 events per cell ) were acquired and analyzed using mini - analysis software ( synaptosoft ) with threshold parameters set at 5 pa amplitude and <3 ms rise time . slices were incubated in the appropriate drug ( dissolved in acsf - bicuculline ) for 10 minutes prior to recording , and cross - cell comparisons were made . paired - pulse ratios ( ppr ) were acquired by applying a second afferent stimulus of equal intensity , 50 ms after the first stimulus , and then calculating the ratio of epsc2/epsc1 . coefficient of variance ( cv ) was calculated from the standard deviation divided by the average ( stdev / avg ) of 10-minute blocks ( minutes 0 - 10 , pre ; minutes 40 - 50 , post ) . comparisons between different experimental manipulations were made using a two- tailed , students t - test ( paired or unpaired , as appropriate ) with p < 0.05 considered significant . all statements in the text regarding differences between grouped data indicate that statistical significance was achieved , assuming normal distribution and equal variance .

social behaviors in species as diverse as honey bees and humans promote group survival but often come at some cost to the individual . although reinforcement of adaptive social interactions is ostensibly required for the evolutionary persistence of these behaviors , the neural mechanisms by which social reward is encoded by the brain are largely unknown . here we demonstrate that in mice oxytocin ( ot ) acts as a social reinforcement signal within the nucleus accumbens ( nac ) core , where it elicits a presynaptically expressed long - term depression of excitatory synaptic transmission in medium spiny neurons . although the nac receives ot receptor - containing inputs from several brain regions , genetic deletion of these receptors specifically from dorsal raphe nucleus , which provides serotonergic ( 5-ht ) innervation to the nac , abolishes the reinforcing properties of social interaction . furthermore , ot - induced synaptic plasticity requires activation of nac 5-ht1b receptors , the blockade of which prevents social reward . these results demonstrate that the rewarding properties of social interaction in mice require the coordinated activity of ot and 5-ht in the nac , a mechanistic insight with implications for understanding the pathogenesis of social dysfunction in neuropsychiatric disorders such as autism .

METHODS Animals Behavioral Assays Andalman probes Virus Generation Stereotaxic injections Immunohistochemistry Electrophysiology Supplementary Material

mutagenesis was performed on age - synchronized l4 animals using ethyl methanesulfonate ( ems ) according to standard protocols . briefly , when the animals reached the l4 stage , a large number of synchronized wild - type animals carrying the wyis85 transgene were suspended in a buffer solution and 20mmems ( sigma - aldrich ) for a period of four hours . following the incubation , these p0 animals were allowed to grow to adults , and once the f1 progeny from these animals became adults , the f2 offspring were age - synchronized . f2 embryos were obtained by bleaching f1 adults using a solution containing about 1% naocl and 0.1 mnaoh , washed in m9 buffer , and cultured for 24 hours . animals were then transferred and cultured on nematode growth medium ( ngm ) plates seeded with e. coli op50 until l4 stage . the strains used in this project included xa7810 : n2 , wyis85 ( pitr-1 pb::gfp::rab-3 ) ; xa7812 : lin-44(n1792)i , wyis85(pitr-1 pb::gfp::rab-3 ) . for imaging and screening , animals were washed and suspended in m9 solution containing 0.01 volume% triton x100 ( sigma - aldrich ) . after washing animals off of the plates , animals were allowed to settle , the supernatant removed and additional m9 added . animals were screened under a compound microscope using a 40 ( na=1.4 ) oil objective using the microfluidic chips . sorting decisions were made based on differences in the reporter expression pattern or intensity ; potential animals of interest were sorted into the mutant outlet and were collected directly from tubing connected to the mutant outlet with m9 solution containing 0.01% triton x100 . the equipment utilized during our experiments includes the following : peltier cooler ( pjt-5 30 mm square and pjt-6 40 mm square peltier coolers ) , copper heat exchanger ( custom designed and machined ) , peristaltic pump for coolant : 400 f / a ( watson marlow ) , digital i / o card ( pacdrive from ultimarc ) , solenoid valves and manifold ( 3-way 10 mm solenoid valve , 188 series , asco valve ) , microscope ( leica dm4500 ) with lens ( 63x oil , na=1.4 ) . and camera ( infinity 3 - 1 , lumenera ) . although manipulation and imaging of multicellular model organisms are an important part of modern biology , most methods are still labor intensive and time - consuming . recent work , largely through multiwell plate methods , and a modified flow cytometer ( copas ) , has made significant improvements in sample handling and low - resolution imaging of c. elegans , and d. rerio and d. melanogaster embryos . recently , microfluidic approaches have improved the throughput of high - resolution imaging of caenorhabditis elegans , but sorting has been based on user input or simplistic criteria , such as the local intensity . to date , all c. elegans screens , both automated and manual , have required human intervention to set the sorting boundaries , and the few automated screens have only been performed at very low resolution . thin glass capillary tubes have recently been used to image and then ablate axons in d. rerio , but image processing and ablation was performed manually using user input . similarly , microfluidic traps have been employed to align d. melanogaster embryos to enable highly controlled imaging conditions . automation of information extraction has largely been focused on post - processing of data acquired during an experiment . within multicellular model organisms , this has focused on understanding animal behavior and interactions , and with lineage tracking of cell fates . tracing of cell lineages from early to late embryogenesis has allowed tracking of c. elegans embryos through many divisions . a digital atlas of c. elegans cell locations , and methods to identify them , performing image processing to identify quantitative information in near real time during a screen , however , requires a framework that places a significantly higher value on speed and throughput . the framework provided in this work can be extended to tackling these problems for real - time screening of other model organisms . included on the website is software used during screening . because of differences in equipment this is primarily intended as a guide for development of customized code for the end user . the code contains functions used to operate the microfluidic device , as well as that to extract relevant information from the fluorescent images . the optimized feature extraction and phenotypical parameters can be modified to focus on identification of other small , fluorescent objects . the device is a standard two - layer pdms device , similarly to our previous work , fabricated using a rapid prototyping method and thermal bonding between layers ( sfig 4b ) . rather than using conventional fullclosure valves that rely on a curved cross - section of the flow - layer , although valves incapable of fully closing are typically considered drawbacks in microfluidic devices , in this case they could be used advantageously to simplify the design . because the valves always allow a small amount of flow ( supplementary fig . 2c ) , the device was designed using partial closure valves to position animals in the imaging channels , instead of suction channels . in addition to the development of a microfluidic device for screening , external systemic components were required to allow for automated sorting . this required a closed loop control system and the development of specific hardware to interface with and control the on - chip components . creating external components that would allow computerized control of on - chip components was necessary ( supplementary fig . because we needed to run the system for a very long period during the screen , a comprehensive framework was developed for handling errors robustly ( supplementary fig . this includes an external macroscale control components to be integrated with the microfluidic device to allow closed - loop control , an error handling routines to reduce the need for operator intervention for the closed loop control , and optimization of the operational sequence to minimize the amount of time spent per animal . external calls were to the machine learning libraries and a dll for valve control operation . due to potential stability issues with matlab operation , however , it could be advisable for future efforts to focus on the open microscopy environment and code in a more robust language such as java . the screening methodology was optimized to maximize the number of independent f2 animals screened , and to minimize the likelihood of screening clonal siblings . this was done by pooling f2 animals from a number of f1 mothers , and then screening a subset of this group . due to the screening methodology of the number of haploid genomes can not be directly calculated , but several assumptions have to be made regarding the sampling from f2 population . this results in approximately 1,500 f1 animals per plate , or 3,000 haploid genomes . given that f1 animals are a / b , we can assume that half of the animals are homozygous ( a / a or b / b ) , and the nave assumption is that for every 2 f2 animals screened , we have screened 1 haploid genome . on average , 500 f2 animals were screened from each of these populations , resulting in 250 haploid genomes . given that we were sampling from a larger population of animals , there is the possibility that an f2 animal could be homozygous for the same genome present in an animal that was previously screened . the probability of this occurring was calculated as 1(29993000)250=0.08 . given there were 3,000 haploid genomes present , we screened 0.08 * 3,000 = 240 . this yields a ratio of 240500=0.48 , implying that because we have screened a total of ~40,000 animals , that corresponds to nearly 20,000 haploid genomes . following screening , the animals identified were cloned and then verified by reimaging . once the identified mutants have been cloned and decontaminated , furthermore , because genetic validation by sequencing is such a slow and time consuming process , it is important to visually confirm that each of the animals to be mapped or sequenced indeed have an altered synaptic expression . validation was done using standard worm protocols using a worm - slide and sodium azide for immobilization . a small population ( ~1520 ) of animals of each genotype was imaged , and these images were used to determine whether the animals were actual mutants , and thus the accuracy of the screening . some of the mutants were phenotyped with larger numbers , and were characterized in greater detail to predict the potential pathway that was affected ( supplementary table 2 ) . each of the genotypes classified as mutants of interest were phenotyped . for the purpose of these results , animals that were sorted as mutants but failed to produce any offspring that could be used to verify whether the animals were correctly or incorrectly sorted , were removed from the results . to determine the accuracy of the screening protocol , images of all processed animals were collected and analyzed to determine whether animals were correctly or incorrectly sorted as wild - type animals . the false negative rate was determined by comparing the manual scores to the computer scores to determine the accuracy of the algorithm . the screen using the discriminative classifier resulted in a false positive rate of 69% , a false negative rate of 9% , and a theoretical enrichment of 6,000% . the screen using the outlier detection approach resulted in a false positive rate of 74% , a false negative rate of 7% , and an enrichment of 6,000% . the marginally higher false negative rate could be a result of the discriminative classifier not recognizing some mutant phenotypes , or merely the sample size . the false positive rates of these classifiers are similar to or better than the manual methods due to animal - to - animal variations and the manual method s subjectivity in scoring the phenotypes . these false positive animals also do not pose an issue in these rare - sort problems since it is a very small number of candidate mutants that need to be characterized in the following steps . false positives were calculated using the following equation where animals sterile animals were removed from the denominator : fp = wildtype sorted as mutantsanimals sorted as mutants . the false negative rate was calculated using the following equation : fn = mutants sorted as wildtypemutants sorted as mutants+mutants sorted as wildtype . the upper bound of the enrichment was calculated using the equation : enrichment = mutants correctly sorted / number of animals sorted as mutantsmutants in starting population / animals in starting population .

morphometric studies in multicellular organisms are mostly performed manually because of the complexity of multidimensional features and lack of appropriate tools for handling these organisms . here we present an integrated system to autonomously ( i.e. without human supervision ) identify and sort mutants with altered subcellular traits in real - time . we performed self - directed screens of synapse formation 100 faster and found both novel genes and phenotypic classes previously unidentified in extensive manual screens .

None Materials and Equipment Automation, Handling of Multicellular Organisms, and System Design Genetic Screening Supplementary Material

the emerging field of optofluidics explores new possibilities to combine optical detection techniques with micro- and nanofluidics to develop miniaturized optical sensors with improved performance . the analytical techniques commonly used include surface plasmon resonance ( spr ) , surface - enhanced raman spectroscopy ( sers ) , and fluorescence imaging . sers , a powerful technique for biosensing and chemical identification , largely depends on the drastic enhancement of weak raman signal obtained from analyte molecules , upon their interaction with optical near - fields of metallic nanostructures . as an analytical technique , sers combines the benefits of label - free sensing , high sensitivity , and chemical specificity . an important aim is to further improve the capabilities of sers for diverse applications such as healthcare and environmental monitoring using substrates that can be fabricated reproducibly and have a uniform geometry . as the enhancement of electromagnetic fields occurs in nanoscale regions , termed as plasmonic hotspots , integration of microfluidics capable of directing the analyte flow and resultant concentration toward these hotspots can improve the sensitivity and reduce the detection time for sers . among various options , we explore metallic nanohole arrays fabricated in suspended silicon nitride ( si3n4 ) membranes because they provide a unique option to integrate sers with flow - through sensing , which has yet to be shown experimentally . nanohole arrays in thin metallic films can act as plasmonic substrates with multifarious applications . enhancement of the electromagnetic field and extraordinary optical transmission ( eot ) through the nanoholes has led to their application in plasmonic sensing . primarily , they have been used as a platform for spr refractive - index sensing . while groups have demonstrated nanohole - enhanced raman spectroscopy , the reported raman enhancement factors ( below 10 ) are weaker than that of other sers substrates . these previous experiments relied on low - throughput fabrication techniques such as focused ion beam ( fib ) or electron - beam lithography to pattern nanoholes in a metal film . suspended nanohole arrays have been utilized for spr sensing , but have not been utilized for sers . flow - through suspended nanoholes have been utilized for overcoming diffusion - limited transport in spr sensing . most of these methods , however , require external sources for generating pressure gradients , which can often damage the fragile membrane , and microfluidic tubing or an external power supply for creating an electric field . a simple and robust sample delivery mechanism is needed for flow - through sensing . in this work , nanoimprint lithography ( nil ) is used to fabricate periodic ag nanohole arrays over a millimeter - sized suspended silicon nitride ( si3n4 ) membrane with high throughput and reproducibility . to improve the raman enhancement factor ( ef ) on these large - area substrates , plasmon resonances of suspended nanohole arrays we report a high raman ef of up to 10 for silver - coated suspended nanoholes using this technique . furthermore , suspended nanohole arrays are capable of fast flow through the nanoholes driven by surface tension forces , which promote adsorption of the analytes toward the plasmonic hotspot and further boost the sers signal by 50 times compared to diffusion - limited transport . using this optofluidic sers substrate , we detect a 100 pm 4-mercaptopyridine ( 4-mp ) sample . suspended nanohole arrays were fabricated over a region of 1 mm in size using nanoimprint lithography ( nil ) , as shown in figure 1a c . low - stress silicon nitride ( 200 nm ) was deposited on both sides of single - sided polished ( 100 ) silicon wafers using low - pressure chemical vapor deposition ( lpcvd ) . these wafers were then patterned using photolithography and dry etching such that some regions on the back of the wafers had nitride removed , exposing the silicon . a nanoimprint mold was carefully placed on the resist so that it aligned well with patterns etched on the back of the wafer . the mold used for nanoimprinting had pillars with a 200 nm diameter , 500 nm periodicity , and 300 nm pillar height over a 1 cm 1 cm area . the sample was further processed to etch the nanohole arrays into the top nitride layer . the etching was done for a fixed time period such that the holes go about two - thirds of the way into the nitride . the nanoimprint resist was then cleaned off , and samples were placed in a koh bath for anisotropic etching . the samples were further dry - etched to remove the remaining nitride from the bottom of the nanoholes and obtain suspended open - ended nanoholes . silver ( 120 nm ) was then deposited on the top of the samples using an electron - beam evaporator . ( a ) a silicon chip after 200 nm low - stress nitride deposition and photolithography to expose desired regions on the backside . ( b ) nanoimprinting and dry etching was performed to transfer the nanohole array pattern to the top nitride membrane . ( c ) anisotropic koh etching of silicon was used to obtain the suspended nitride membrane . a final dry etch removed the remaining nitride from the bottom of the holes . the nanoimprinted region further has a 1 mm 1 mm suspended membrane in the center ( circled ) . for raman measurements of benzenethiol ( bzt ) and 4-mp solutions , a quartz cuvette with a 1 mm path length was used . a 785 nm diode laser with an incident power of 10 mw was loosely focused onto the sample using a 10 objective . the raman scattered light was collected in transmission mode using a 50 objective ( na 0.5 ) and passed onto a spectrometer ( ocean optics qe65000 ) through a multimode fiber after removing the excitation light with a notch filter . the acquisition time was 30 s. neat bzt ( 10 m ) and 0.6 m 4-mp solution were used to acquire the raman spectra . for formation of a self - assembled monolayer ( sam ) , chips were placed in 1 mm bzt ( eth . ) or 1 mm 4-mp ( aq . ) overnight . they were then rinsed thrice with ethanol ( bzt samples ) or deionized ( di ) water ( 4-mp samples ) over a period of 30 min . the parameters used for calculation of the enhancement factor are described in the supporting information . the chips were placed on a nikon eclipse lv 100 upright microscope stage with a 10 objective , and a fiber - optic spectrometer was used to record transmission spectra through the nanoholes . sucrose solutions of desired concentrations ( 01.5 m ) were used to tune the transmission spectra . data plots were prepared using matlab ( mathworks , inc . ) and graphpad prism version 5.04 ( graphpad software , inc . ) . three - dimensional ( 3d ) finite - difference time - domain ( fdtd ) simulations around the suspended nanoholes were performed using fullwave simulation software . a single hole was simulated with periodic boundary conditions on the faces intersected by the metal film to represent an infinite hole array and absorbing boundary conditions on the final two faces . a grid size of 3 nm was used around the hole in all dimensions . the index of refraction for the nitride was set at 2 , the optical constants for silver were measured via ellipsometry , and the refractive indices of materials surrounding the hole array were varied . a 30 nm thick sio2 film was deposited on the back of the samples using an electron - beam evaporator . using this directional deposition technique , the sidewalls of the nanoholes , which lie parallel to the direction of evaporation , were coated with a much thinner layer of silica . the desired volume of aqueous solution was then added to the top surface of the chips , as shown in figure 4 . fluorescent polystyrene beads were obtained from bangs laboratories ( poly(styrene/2%divinylbenzene / vinyl - cooh ) , mean diameter : 2.19 m ) and were used at a final concentration of 10 beads / ml in di water . a 10 l solution containing beads was added on the top of the chips for the three cases i , ii , and iii , as shown in figure 5 . the samples were left undisturbed until the solution was consumed through evaporation or flow . the top was then imaged using a fluorescence microscope to monitor accumulation of particles . for sers measurements , a 4-mp solution of desired concentration and volume was added to the top of the chips and allowed to completely flow through . sucrose solution was used to obtain the optimized sers signal from the chips , as discussed earlier . in the case of loss in the volume of sucrose from the top of the chip due to flow - through , suspended metallic nanohole arrays were fabricated on low - stress silicon nitride ( si3n4 ) membranes using nil ( figure 1a c ) . one such chip with a 1 cm 1 cm area of imprinted nanohole arrays is shown in figure 1d . the suspended membrane region , approximately 1 mm 1 mm defined by koh wet etching of si , consisting of open - ended nanoholes is also indicated . a scanning electron micrograph ( sem ) an sem image at higher magnification shows individual nanoholes in the silicon nitride membrane ( figure 1f ) . the holes are approximately 200 nm in diameter , and the array has a periodicity of 500 nm . silver ( thickness 120 nm ) was deposited over the chips using electron - beam evaporation . optimization of sers signal requires tuning of the plasmon resonances of the metallic substrate such that , for a given laser wavelength , there is maximum enhancement of electromagnetic field around nanoholes . generally , modification of the design of the plasmonic substrate such as changing the periodicity of nanohole arrays or altering the wavelength of the laser source is used for this tuning . here , we present a simple method to achieve desired plasmon resonance conditions on suspended nanohole arrays using refractive - index - based tuning . it has been established that surface - plasmon - mediated transmission can be modulated by the refractive index at the metal in fact , the shift in transmission peaks of nanohole arrays due to change in refractive index close to the sensor surface has been used for biosensing . we utilized this intrinsic property of metallic nanohole arrays to tune the resonance peaks . here , we used sucrose solutions of appropriate concentration on the nanohole array surface to shift the transmission spectra as desired and tested the evolution of the sers signal . sugars like glucose and sucrose have been reported to be very difficult to detect using sers owing to their small normal cross section and negligible adsorption to bare metal surfaces . this property makes them suitable to be used on a sers substrate without adding unwanted raman peaks . the schematic for sers measurement and the steps for signal optimization from the suspended nanohole array chips are illustrated in figure 2a . bzt and 4-mp were used to characterize the sers response of the chips as these molecules are known to have large scattering cross sections and can easily form self - assembled monolayers ( sams ) owing to thiol metal bonding on gold or silver . chips with 4-mp sam layers were used for the results shown in figure 2 . by increasing the concentration of the added sucrose solution , upon addition of approximately 1 m sucrose solution , the transmission peak at 600 nm corresponding to the ( 1,0 ) silver air interface was shifted to 785 nm ( figure 2b ) . ( a ) schematics showing the process of obtaining a sers signal from chips with air as dielectric media , resonance tuning using sucrose to improve the signal , and index matching to further optimize the signal . ( b ) figure showing normalized transmission maxima at around 600 nm corresponding to ( 1,0 ) metal air interface shifts to 785 nm after addition of the desired concentration of sucrose . ( c ) sers signal obtained from the same spot on the chip with the transmission peak tuned to different wavelengths . ( d ) sers signal obtained from the same spot before and after index matching . ( e ) sers signal obtained from 4-mp sam layers on suspended nanohole arrays as compared to fib milled dead - ended nanoholes . the signal from suspended nanoholes is about 50 times higher than that obtained from dead - ended samples . sers spectra were obtained from the sample with variation in the position of the transmission peak of the nanoholes ( figure 2c ) . these measurements were taken from the same spot on the sample to avoid any other sources of variation in signal . as expected , the maximum sers signal was obtained when the peak transmission wavelength of the nanoholes matched the laser wavelength at 785 nm . upon adding the same sucrose solution to the backside cavity of the suspended nanohole array membrane , a further increase ( up to 300% ) in the sers signal was observed ( figure 2d ) . it has been known that surface - plasmon - enhanced transmission through nanoholes can be enhanced up to an order of magnitude by matching the refractive index on either side of the metal film . three - dimensional ( 3d ) finite - difference time - domain ( fdtd ) simulations were performed to demonstrate the increase in the plasmonic field around the nanohole arrays with refractive - index - based tuning ( figure 3 ) . in the first case , air was used as the refractive index medium and weak plasmonic hotspots can be observed at the edges of the nanoholes ( figure 3a ) . with the addition of sucrose and filling of the nanoholes such that the transmission maxima is in resonance with the excitation wavelength ( 785 nm ) , more than an order of magnitude enhancement of the plasmonic field at the hotspots can be observed ( figure 3b , c ) . a further increase in electric field was obtained with sucrose present on both sides of the sample as well as inside the nanoholes ( figure 3d ) . the increase in electric field observed in these fdtd simulations correlates qualitatively with the measured increase in sers signal ( figure 2c , d ) . for further comparison , samples with dead - ended hole arrays were prepared using fib milling ; 120 nm thick silver was deposited on suspended nitride membranes and nanoholes with diameter 200 nm and periodicity 500 nm were milled through the silver but not through the nitride membrane . these samples were also placed in a solution of 4-mp overnight to form a sam layer . to measure the sers signal from the dead - ended hole array samples , a drop of sucrose solution was added to the substrate such that the transmission peak matches the laser wavelength . the sers signal obtained from an fib milled dead - ended hole array sample as compared to the signal obtained from the suspended nanohole array under optimized transmission conditions is shown in figure 2e . the signal obtained from suspended nanoholes was approximately 50 times higher as compared to dead - ended samples ( figure 2e ) . this difference could be attributed to a combination of a number of factors , including refractive index matching between the top and bottom sides of the suspended nanoholes , improved transmission , and nanoscale variations in geometry of the nanohole edges ( hotspots ) obtained via nanoimprinting as compared to ion milling . three - dimensional fdtd simulations for suspended nanohole arrays with an excitation wavelength of 785 nm . electric field intensity with ( a ) air as the dielectric medium around and inside the suspended nanoholes . ( c ) sucrose present on the top silver surface and filling top half of the nanoholes , whereas air is present elsewhere . concentration of sucrose is adjusted such that the transmission maxima through the nanoholes matches the excitation wavelength ( 785 nm ) . raman signals obtained from neat solutions of 4-mp and bzt were used to calculate enhancement factors for the chips . the vibration bands used for this calculation correspond to the in - plane ring breathing mode coupled to the c s stretching for the bzt and 4-mp samples . when bzt adsorbed to the silver surface , the vibration band was observed to shift from 1092 to 1072 cm . similarly for 4-mp , the vibration band shifted from 1115 cm in aqueous solution to 1099 cm upon adsorbing to the silver surface . enhancement factors of 10 were obtained for the suspended nanoholes for both 4-mp and benzenethiol samples . these numbers were obtained repeatedly over multiple spots on different samples using both bzt and 4-mp as analytes . in comparison , previous studies on nanohole array sers have reported efs in the range of 1010 . this improvement in the ef values ( 100 times ) obtained by our system confirms that suspended nanohole arrays can be used as excellent sers substrates . nanohole - based biosensors with integrated flow - through fluidics can provide one route to overcome diffusion - limited transport of analytes , improving the detection time and detection limit of the sensor . to facilitate the flow - through process , silica ( 30 nm ) , which is hydrophilic , as this deposition technique is highly directional , the sidewalls of the nanoholes , which lie parallel to the direction of evaporation , were coated with a much thinner layer of silica . the addition of the silica layer on the opposite side of sample injection drastically altered the flow properties of the chip . figure 4 shows the schematic of chips with silica on the backside , and a hydrophobic top surface . when an aqueous solution of analyte or particles was placed on the top of the chip , flow through the nanoholes was initiated as soon as the solution came into contact with the hydrophilic inner walls . figure 4c e shows snapshots of the flow in process , where a 2 l drop of water disappears through the nanohole membrane within 2 min . for membranes of size 1 mm , we obtained an approximate flow rate of 1 l / min . the top metal surface is hydrophobic , whereas the silica layer within the holes and on the backside of the chip is hydrophilic . ( b ) hydrophilic nanohole sidewalls suck in the solution , driving the flow toward the back of the chip ( shown as red arrows ) . ( c e ) bright - field images showing flow of a 2 l drop of water through the suspended nanohole array within 2 min . the water drop shrinks as it is sucked in through the hydrophilic nanohole sidewalls . the effect of flow - through concentration as compared to diffusion - limited adsorption or evaporation - driven concentration over suspended nanoholes was visualized using fluorescent 2 m polystyrene beads . in figure 5 , we compare the accumulation of polystyrene beads ( 10 beads / ml ) in three cases : ( i ) where the holes were dead - ended ; ( ii ) where the holes were open and concentration was driven by evaporation through the open - end of the nanoholes ; and ( iii ) holes were open and silica was deposited on the backside , leading to flow and concentration . schematics for the cross section of a single nanohole accompany the fluorescence images for each of the three cases in figure 5(a c ) . during the evaporation of a liquid drop on a surface , evaporation of solution from the pinned outer edges generates an outward flow and concentrates particles at the edges . this phenomenon , known as the coffee stain effect , is clearly visible in images ( a ) and ( b ) in figure 5 . the particles were randomly distributed within the area of the drop , as shown in figure 5a , as their position was determined by diffusion and the outer flow . in case ii , open - ended holes with no silica also promoted evaporation - based localized flow and accumulation of particles over the nanohole array was obtained . there was no significant difference in the time scales of evaporation for cases i and ii . for case iii ( open - ended holes with silica ) , the flow was based on surface tension and the time scale was an order of magnitude less than evaporation - based methods . this case demonstrates a significantly higher concentration as most of the solution was directed to flow through the nanoholes , improving particle aggregation over the holes ( figure 5c ) . the absence of a prominent outer ring for the drop indicates the dominance of nanohole directed flow and the relatively shorter time scale of the process . surface plots revealing the intensity of fluorescence for these three cases are shown in figure 5(d f ) . the average fluorescence from the accumulated beads over the suspended membrane area was calculated over three rounds of experiments and is shown in figure 5 g . bead concentration and time taken for consumption of solution over nanohole arrays for three cases . ( a ) case i : accumulation of 2 m polystyrene beads after evaporation of a 10 l drop over dead - ended nanohole arrays . the schematic shows cross section of a single dead - ended nanohole for this case . ( b ) case ii : the same experiment performed over suspended nanohole arrays with metal - coated ( hydrophobic ) sidewalls . ( c ) case iii : these samples had silica deposited on the back surface and sidewalls , resulting in surface - tension - directed flow . ( d f ) surface plots corresponding to ( a c ) representing the intensity of fluorescence over the suspended membrane . ( g ) average fluorescence intensity calculated from beads accumulated over the suspended membranes after 3 rounds of experiments . these results demonstrate that case iii surface - tension - induced flow - through promotes the most effective concentration of particles over the nanoholes and is an order of magnitude faster than purely evaporation - driven concentration . these results illustrate that surface - tension - induced flow through nanoholes promotes the most efficient concentration of particles and is at least an order of magnitude faster as compared to evaporation - based techniques . this principle can also be utilized for overcoming diffusion - limited interaction of analytes with the nanoholes for plasmonic sensing . for small analyte molecules , the passive flow generated by surface tension forces drives them to pass within less than 100 nm ( radius of the nanoholes ) of the hotspot , i.e. , edge of the nanoholes and the nanohole sidewalls . this short distance can be easily overcome by diffusion of analyte molecules increasing the probability of the analytes adsorbing on or close to the plasmonic hotspots , which can lead to enhancement of the raman signal of analytes . the 4-mp molecules , which have a thiol group , can be captured on the nanohole array substrate through formation of covalent thiol silver bonds . the molecules may also get physically adsorbed to silica layered regions inside the nanoholes through van der waals forces . to demonstrate the advantage of flow through the nanoholes over diffusion - based transport for sers sensing , we performed experiments where the nanohole substrates were prepared in two different ways . in the first case , 20 l of 100 nm 4-mp solution was allowed to completely flow through suspended nanoholes in about 20 min . for diffusion - based adsorption , substrates were submerged in a reservoir containing identical 4-mp solution for the same amount of time . samples with surface - tension - induced flow gave about 50 times higher signal as compared to diffusion - limited adsorption . the experiment was repeated over multiple sets of samples and similar results were observed ( figure s3 , supporting information ) . to demonstrate detection of low concentration samples , 50 l of 4-mp at a concentration of 100 pm ( i.e. , 5 fmol of 4-mp ) was allowed to flow through the sample for about an hour . the sers signal collected from this sample shown in figure 6b demonstrates the capability of the method to detect low concentrations of analyte molecules . the high sensitivity in this case results from the combination of two factors : large raman enhancement factor of the nanohole array substrate and flow - through - based concentration of molecules at the hot spot . ( a ) comparison of sers spectra obtained from flow - through of 100 nm 4-mp ( red spectrum ) as compared to diffusive transport ( blue ) . ( b ) sers spectra obtained after flow - through of 100 pm 4-mp for an hour . the limit of detection of the setup , in terms of 4-mp concentration , would depend on the duration of time the solution is allowed to flow through the nanoholes . however , it can be estimated in terms of number of molecules of 4-mp in solution . using the peak at 1099 cm in the sers signal shown in figure 6b , the signal - to - noise ( s / n ) ratio was calculated to be approximately 55 . assuming a linear concentration vs signal response ( figure s2 , supporting information ) , and calculating for a final s / n ratio of 3 , gave us a limit of detection of approximately 272 amol of 4-mp molecules in solution . we have demonstrated the fabrication of millimeter - sized suspended metallic nanohole arrays using nil and their potential for flow - through sers . refractive - index - based tuning with sucrose solution was implemented on this suspended nanohole array substrate for optimized sers . this tuning method was utilized to match the plasmon resonance peaks with the excitation laser wavelength . sucrose solution was used because it has a very weak intrinsic raman signal and , therefore , does not contribute detectable background to the measurements . this simple tuning method can also be utilized for plasmon - enhanced fluorescence where the plasmon resonance can be tuned based on the excitation or emission spectra of the fluorescent species . furthermore , this technique can easily be translated to other plasmonic substrates utilizing the principle that , by changing the refractive index of the dielectric medium around the metal , plasmon resonance conditions can be changed to optimize the detection of the optical signal from analyte molecules . the suspended ag nanohole arrays have a sers enhancement factor on the order of 10 , which is 2 orders of magnitude greater than those reported previously for nanohole arrays and compares well with other commonly used sers substrates . our demonstration of high sers enhancement factor from nanohole arrays can open up many possibilities , because the nanohole geometry enables trapping of biomolecules and small particles , formation of model membranes such as suspended lipid bilayers , as well as flow - through sensing to overcome the diffusion limit . to combine nanohole - enhanced sers with flow - through sensing , we have demonstrated surface - tension - induced passive flow and concentration of particles over the nanohole arrays . passive flow rates of around 1 l / min were obtained using this technique . this passive flow allowed us to overcome diffusion - limited transport of analytes and reduced the time required to consume the solution while bringing the analyte molecules closer to the plasmonic hotspots . our device design utilizing passive flow obviates the use of a bulky external pump and fluidic interconnects , thus improving the simplicity and portability of the process . thus , the simple and novel resonance tuning as well as passive flow - through technique discussed here on a suspended nanohole array platform can help alleviate the mass transport limitations and benefit wide applications in optofluidics .

we present metallic nanohole arrays fabricated on suspended membranes as an optofluidic substrate . millimeter - sized suspended nanohole arrays were fabricated using nanoimprint lithography . we demonstrate refractive - index - based tuning of the optical spectra using a sucrose solution for the optimization of sers signal intensity , leading to a raman enhancement factor of 107 . furthermore , compared to dead - ended nanohole arrays , suspended nanohole arrays capable of flow - through detection increased the measured sers signal intensity by 50 times . for directed transport of analytes , we present a novel methodology utilizing surface tension to generate spontaneous flow through the nanoholes with flow rates of 1 l / min , obviating the need for external pumps or microfluidic interconnects . using this method for sers , we obtained a 50 times higher signal as compared to diffusion - limited transport and could detect 100 pm 4-mercaptopyridine . the suspended nanohole substrates presented herein possess a uniform and reproducible geometry and show the potential for improved analyte transport and sers detection .

Introduction Experimental Methods Results and Discussion Conclusion

dialysis - related amyloidosis ( dra ) diagnosed in patients with advanced renal insufficiency on maintenance hemodialysis often manifests as signs and symptoms of carpal tunnel syndrome ( cts ) , chronic arthropathy , presence of subchondral cysts and pathological fracture tendency . increased levels of beta-2-microglobulin ( bmg ) in the plasma of dialyzed patients plays an essential role in the pathogenesis of dra . cts is the most common complaint in dra , caused by pressure on the median nerve from complexes of amyloid , the main component of which is bmg . diagnosis of cts is based on signs and symptoms verified by nerve conduction [ 14 ] . the aim of this study was to evaluate the incidence of cts and identify factors influencing the development of cts in patients on maintenance hemodialysis , as well as results of its surgical treatment . the study included 386 patients ( 285 patients from the department of nephrology , university hospital , cracow , and 101 patients from the dialysis unit , st . patients were hemodialysed 3 times per week , for 45 hours each time , using cuprophane membranes ; while in the last 10 years cellulose or polysulphone , low - flux type dialyzers were used . diagnosis of cts was initially based on signs and physical symptoms verified by nerve conduction examination . clinical cts diagnosis was based on numbness , nocturnal pain in the median nerve distribution , and positive stimulating tests , particularly the tinel sign . a prolonged sensory and/or motor latency from the wrist to digits innervated by the median nerve the following parameters were evaluated : patient age , sex , duration of dialysis therapy , etiology of renal insufficiency , presence of anti - hcv antibodies , localization of av fistula , and presence of cysts and joint pain . concentrations of urea and creatinine before and after dialysis and potassium , calcium , and phosphorus were measured monthly . statistical analysis using the non - parametric mann - whitney test for unassociated variables compared age and duration of dialysis therapy for the groups of patients with cts and without cts . initial analysis of cts by sex , presence of anti - hcv antibodies and location of av fistula were verified using the chi - square test . carpal tunnel syndrome was diagnosed and verified using nerve conduction examination in 40 patients , who comprised 10.4% of the studied patient population on maintenance hemodialysis . causes of terminal renal insufficiency in cts patients were as follows : glomerulonephritis ( 45% ) , degenerative polycystic kidney disease ( 12.5% ) , chronic pyelonephritis ( 10% ) , diabetic nephropathy ( 5% ) , amyloidosis nephropathy ( 2.5% ) , lupus nephritis ( 2.5% ) , hypertensive nephropathy ( 2.5% ) , and renal cirrhosis of unknown origin ( 20% ) . patients with cts were aged between 36 and 83 years ( mean 54.5 years ) , while the asymptomatic patient group was aged 18 to 100 years ( mean 56.48 years ) ( figure 1 , table 1 ) . dialysis therapy in the patient group with cts ranged from 430 years ( mean 16.05 years ) ; while dialysis duration among patients without cts ranged from 0.216.4 years ( mean 4.51 years ) ( figure 2 , table 1 ) . statistical analysis showed that patients with cts were hemodialysed significantly longer ( p<0.00001 ) ( mann - whitney test ) . surgical release procedure was required in 5 patients ( 100% ) with cts on maintenance dialysis treated for a long period ( from 2530 years ) . in patients hemodialysed from 2024 years , cts developed in 5 patients ( 100% of the sub - group ) . in the group of patients less than half of the patients hemodialysed from 1014 years were operated on due to complaints in the course of cts ; they comprised 42.1% of this subpopulation ( 16 patients ) . four patients dialyzed for fewer than 10 years were found to have cts ( 1.6% ) ( table 2 ) . biopsies performed at the time of cts surgery confirmed dra . histological examination of biopsy specimens was performed in 21 out of 40 patients ( 52.5% ) , and all of these 21 biopsied patients presented with signs of amyloid deposits . among patients with cts , the majority were males ( m : f , 2:1 ) ( 27 males , 13 females ) , which did not reflect the ratio of both sexes in the studied population ( 229 males , 157 females ) . no statistically significant differences in incidence of cts by sex ( chi - square test , p = ns ) was noted . in the studied population , 43 patients were found to have positive anti - hcv antibodies . in the group of patients with cts , 19 patients were found to have positive anti - hcv antibodies , which equaled 47.5% of patients of this subgroup . in the group of 346 patients without cts , incidence of cts was statistically significantly higher in patients with positive anti - hcv antibodies ( chi - square test , p<0.00001 ) ( table 3 ) . all patients with cts complained of numbness , tingling and pain in the first 3 radial digits . the symptoms of paresthesia were more pronounced at night , causing insomnia and frequent waking . in 21 patients , these problems increased during dialysis . in some cases the diagnosis of cts was supported by positive tinel sign . in a number of patients muscle weakness , hypoesthesia and thenar hypotrophy nerve conduction studies showed prolonged distal sensory and motor latencies from the wrist to digits , innervated by the median nerve ( table 4 ) . regression of sensory and motor deficiencies was much slower and took 46 months . in 14 patients , cts developed in the wrist where the av fistula was located ; in 3 patients on the opposite side , and bilaterally in 23 patients ( 57.5% ) . no statistical differences were noted between the development of cts requiring surgical release procedure and location of the av fistula ( chi - square test , p = ns ) . a total of 72 surgical procedures of the median nerve release were performed in 40 patients with cts , in 9 patients due to recurrence of cts , and 23 on the opposite hand . the traditional surgical method was implemented where the transverse carpal ligament was severed , which later released the median nerve . during the surgical procedure , tumor - like changes were found in tendons and synovial membranes ; sometimes fibrotic adhesions , segmental tendon fragmentation of the finger flexors , or deep changes in the synovial membrane were also found . in 24 patients , such changes were found in the acetabulum of the hip joint , in the head of the femoral bone , radial and humeral bone , patella and the wrist bone . six patients had hip replacement performed ( endoprosthesis implantation ) . in patients with signs and symptoms of cts , nerve conduction and electromyography no statistically significant differences were noted in concentrations of the following biochemical parameters : urea , creatinine , potassium , calcium , phosphorus , sodium and liver parameters in patients with cts and the group of patients without cts . the frequency of clinical symptoms of cts in patients on chronic hemodialysis ranges between 2% and 31% . this is probably due to the number and characteristics of the evaluated patient group ; and to the degree to which diagnostic criteria is employed . most patients require surgical release procedure [ 58 ] . among the studied group of 386 patients on maintenance hemodialysis , the mean age of patients with cts was lower ( 54.5 ) than the mean age of patients without cts ( 56.48 years ) . others investigators noted statistically significant dependence between the age of hemodialysed patients and the occurrence of cts . the group of patients with cts was characterized by a 2-fold higher number of males ( 27 males , 13 females ) , which did not reflect the ratio of both sexes in the study population ( 229 males , 157 females ) . this data differs from the results of other authors ( ratio of m : f=1:1 ) or relates to other studies ( 67% of males in the group with cts ) . in the non - dialyzed patient population , cts is definitely more frequently diagnosed in females ( f : m=3:1 ) . the decreased percentage of females with cts in hemodialysed patients is supposedly due to common abnormalities that accompany terminal renal failure or to the fact that these patients do not perform as much movement of the wrist due to decreased physical activity . in the analyzed group of patients , no difference was noted between incidence of cts and patient sex . among the 40 patients with cts , , no connections have been found between the etiology of terminal renal failure and incidence of cts in dialyzed patients , except for schwarz et al , who found an increased incidence of cts in dialyzed patients after analgetic nephropathy . duration of dialysis therapy in the group of patients with cts was significantly longer ( mean 16.05 years ) in comparison with dialysis duration among patients without cts ( mean 4.51 years ) . this correlates with observations of other authors . all patients dialyzed for more than 20 years underwent surgical release procedure of the wrist ; whereas surgical procedures in cts patients dialyzed for less than 10 years were very rare . duration of dialysis therapy was the only statistically significant risk factor for cts . in the analyzed population of 386 hemodialysed patients , 43 were found to be anti - hcv positive ( 11.1% ) ; whereas in the subgroup of patients without cts only 24 patients were found to be hcv positive ( 6.9% ) . there were 19 patients with cts that had anti - hcv antibodies , which is 47.5% of this subgroup . hemodialysed patients with cts were found to have anti - hcv antibodies significantly more often . such a correlation has not been commonly noted by researchers , and is probably due to the fact that the percentage of patients with positive anti - hcv antibodies depends on the duration of dialysis therapy . one can speculate that this relationship may be due to stimulation of the liver by the inflammatory process to produce beta-2-microglobulin , and this in turn plays an essential role in the pathogenesis of dialysis - related amyloidosis . in the pre - erythropoietin era , hepatitis c infection was common in chronic dialysis patients when blood transfusions were routine . cts developed in 14 patients in the wrist with the av fistula , in 3 patients that had the av fistula on the opposite side , and in 23 patients bilaterally ( 57.5% ) . prevalence of cts in the wrist where the av fistula was located did not fulfill the criteria for statistical significance . a relationship between cts and the av fistula location has been postulated in many publications [ 6,13,1618 ] . vascular factors associated with the av fistula and mechanisms due to amyloid deposition must be considered , along with the substantial increase in venous pressure in the region of the av fistula , which , together with periodic patient water overload , generates pressure on the median nerve . clinical signs and symptoms such as paresthesia , increasing pain during the night and during dialysis , insomnia , and frequent waking during the night decrease patient quality of life . pharmacological therapy as symptomatic treatment only transiently decreases complaints . in 40 patients with cts , 72 surgical release procedures were performed ; 9 were due to recurrences after using the traditional surgical procedure ( surgically severing the transverse carpal ligament ) , and in 23 patients due to second hand localization . after the operative procedures , rapid relief of paresthesia and pain symptoms were observed ; return of sensory and motor deficits took 34 months longer . these results is in agreement with the findings of other authors , and indicate that recurrences of cts in dialyzed patients are more common in comparison to the non - dialyzed population . in the treatment of cts recurrences , excluding synovectomy , resection of the thickened tendinous sheaths of the finger flexor is recommended [ 12,17,1921 ] . duration of dialysis therapy is an independent and statistically significant risk factor in the development of cts . cts occurs significantly more often in anti - hcv - positive patients , which may be related to the longer period on dialysis .

summarybackgroundcarpal tunnel syndrome ( cts ) is the most common complication of dialysis - related amyloidosis ( dra ) developing in patients on long - term dialysis therapy . the aim of this study was to evaluate the incidence of cts and identify factors influencing the development of cts in patients on maintenance hemodialysis , as well as results of its surgical treatment.material/methodsthe study included 386 patients , among whom cts was diagnosed in 40 patients ( 10.4% ) on the basis of signs and physical symptoms , as well as by nerve conduction . the group of patients with cts and the group of patients without cts were compared according to age ( mean 54.50 vs. 56.48 years ) and duration of dialysis treatment . initial analysis of cts incidence by sex , presence of anti - hcv antibodies , and location of arterio - venous fistula ( av fistula ) was undertaken.resultsduration of dialysis treatment was the statistically significant risk factor for the development of cts ( 16.05 vs. 4.51 years ; p<0.0001 ) . among patients treated for a long period on hemodialysis ( 2030 years ) , 100% required surgical release procedures , while 66.66% of those treated for 1519 years , 42.1% of those treated for 1014 years , and 1.6% of those treated for less than 10 years . cts was diagnosed more often in anti - hcv - positive patients as compared with anti - hcv - negative patients ( 47.5 vs. 6.9% ; p<0.0001 ) . no significant differences were found when comparing cts incidence by sex or between the development of cts requiring surgical release intervention and location of the av fistula.conclusionssurgical release procedure of the carpal tunnel gave good treatment results in patients with cts .

Background Material and Methods Results Discussion Conclusions

the prevalence of obesity is on the increase globally , both in developed and developing nations . in the united states , it is estimated that approximately 64.5% of adults can be classified as overweight or obese individuals . in addition to the morbidity associated with obesity , approximately 325,000 deaths in the united states each year among nonsmokers are attributable to obesity . bakari et al . evaluated obesity rates using body mass index ( bmi ) and waist - to - hip ratio ( whr ) among type 2 diabetic hausa - fulanis . among this group , 35% and 5% were overweight and obese , respectively , whereas 95% had central obesity when gender - specific whr was used . , in a study on type 2 diabetic patients in enugu , southeast nigeria , reported central obesity [ determined by waist circumference ( wc ) ] in 22.8% of the subjects studied . the use of different indices to determine or measure obesity clearly explains why the prevalence rates of obesity differ globally . among 6208 type 2 diabetic subjects seen in india , over 50% were found to be overweight or obese when bmi of > 25 kg / m was used , whereas 59.66% and 95.57% of men and women , respectively , had central obesity when gender - specific whr cut - off points of > 0.95 and > 0.85 , respectively , were used . insulin resistance with compensatory hyperinsulinemia has been suggested to underlie the clustering of cardiovascular risk factors , including glucose intolerance , hypertension , elevated serum triglycerides , low serum high density lipoprotein cholesterol and central obesity . central obesity has been shown to worsen the degree of insulin resistance . in the earlybird study , wc correlated significantly with homa - ir in both genders , while bmi correlated significantly with homa - ir in girls only . similarly , wc seems to be particularly associated with the risk for non - communicable diseases as shown by many other studies.[810 ] recently , the international diabetes federation ( idf ) proposed the use of ethnic - specific cut - off values for wc , having made it a compulsory criterion in its definition of the metabolic syndrome . several indices such as wc , whr , waist to height ratio ( whtr ) and sagittal abdominal diameter ( sad ) have been used as clinical measures of central obesity . magnetic resonance imaging ( mri ) and computed tomography ( ct ) are however considered the gold standard methods for determining the quantity of subcutaneous abdominal adipose tissue ( saat ) and intra - abdominal adipose tissue ( iaat ) . this gold standard , however , can not be routinely used in a clinic setting to measure these indices . wc is a simple and valid measure that may be used independently as an estimate of abdominal fat and it has been found to be more strongly associated with cardiovascular health risk . in this study , we compared the performances of two measures of central obesity , namely , wc and whr , in predicting the presence of cardiovascular risk markers in an apparently healthy nigerian population . this study was a cross - sectional descriptive survey of the inhabitants of enugu ( urban ) . it was formerly the capital of the former eastern nigeria and is currently the capital city of enugu state .. the state is one of the five states in the southeast geopolitical zone of nigeria . it is geographically located between longitude 726 e and 730 e and latitude 625 n and 628 n. enugu city is predominantly an urban christian community with a population of 722,664 people out of the total population of 3,257,298 for the whole state ( 2006 population census figure ) . its work force consists mainly of civil servants , business men , industrialists , farmers and students . the town is richly endowed with large deposits of coal which served as a major revenue source for nigeria before the era of oil boom . ethical clearance for the study was obtained from the ethics committee of the university of nigeria teaching hospital ( unth ) , and consent was obtained from all the participants . the subjects comprised apparently healthy individuals ( not known hypertensive or diabetic patients ) who were residents of enugu ( urban ) . a total of 1000 subjects aged 1870 years and who were of the igbo tribe were recruited through a multi - stage sampling procedure . subjects who were physically challenged ( either wheelchair bound or unable to stand ) and female subjects who were pregnant , based on their date of last menstrual period , were excluded . in stage one , five areas of the town , namely , emene , abakpa , trans - ekulu , asata and ogui layout , were selected by simple random sampling ( using the balloting technique ) . in the second stage , 200 participants were selected from among those who reported and got registered on the day of recruitment in each of the five areas . these subjects were invited for registration following health awareness campaigns executed in some of the churches within the five selected areas . those who were not selected were not interviewed but had their anthropometric indices measured and medical advice given based on the individual 's cardiovascular risk status . a total of 898 subjects ( 318 males and 580 females ) were used for analysis after cleaning up of the data . data collection and physical measurements were based on world health organization ( who ) 's steps instrument . it is a simple , standardized method for collecting and analyzing data for chronic disease risk factors in who member countries . it involves a sequential process which starts with gathering information on key behavioural risk factors ( step 1 ) and then moving to simple physical measurements ( step 2 ) . the physical measurements undertaken included height ( measured to the nearest 0.1 cm ) , weight ( recorded to the nearest 0.1 kg ) , wc and hip circumference ( recorded to the nearest 0.1 cm ) using non - stretching flexible linear tapes , and blood pressure ( recorded to the nearest whole number in mmhg ) using mercury sphygmomanometers ( accosons , essex , england ) . the landmark for the measurement of wc was the midpoint between the lowest rib and the iliac crest , as recommended by who . measurement was done at the end of expiration , with the arms by the side and patient standing with the feet together . both wc and hip circumference were measured in privacy with the subject in light clothing . the 1 and 5 korotkoff sounds were used to mark the systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) respectively . generalized obesity was defined as bmi 30 kg / m , while central obesity was defined according to the international diabetes federation ( idf ) ethnic - specific criteria as wc 94 cm and 80 cm for males and females , respectively . blood pressure was classified using the jnc 7 classification . risk category was defined using the hypertensive category ( sbp 140 mmhg and/or dbp 90 mmhg ) . comparison of means between two groups was done using the independent t - test while test of association / independence between categorical variables was performed using chi - square test of independence . the receiver operating characteristic ( roc ) analysis was used to compare the performance of wc and whr ( measures of central obesity ) as determined by the area under the curve ( auc ) . data analysis was conducted using statistical package for social sciences for windows ( spss ) version 10 ( chicago , il , usa ) . the subjects comprised apparently healthy individuals ( not known hypertensive or diabetic patients ) who were residents of enugu ( urban ) . a total of 1000 subjects aged 1870 years and who were of the igbo tribe were recruited through a multi - stage sampling procedure . subjects who were physically challenged ( either wheelchair bound or unable to stand ) and female subjects who were pregnant , based on their date of last menstrual period , were excluded . in stage one , five areas of the town , namely , emene , abakpa , trans - ekulu , asata and ogui layout , were selected by simple random sampling ( using the balloting technique ) . in the second stage , 200 participants were selected from among those who reported and got registered on the day of recruitment in each of the five areas . these subjects were invited for registration following health awareness campaigns executed in some of the churches within the five selected areas . those who were not selected were not interviewed but had their anthropometric indices measured and medical advice given based on the individual 's cardiovascular risk status . a total of 898 subjects ( 318 males and 580 females ) were used for analysis after cleaning up of the data . data collection and physical measurements were based on world health organization ( who ) 's steps instrument . it is a simple , standardized method for collecting and analyzing data for chronic disease risk factors in who member countries . it involves a sequential process which starts with gathering information on key behavioural risk factors ( step 1 ) and then moving to simple physical measurements ( step 2 ) . the physical measurements undertaken included height ( measured to the nearest 0.1 cm ) , weight ( recorded to the nearest 0.1 kg ) , wc and hip circumference ( recorded to the nearest 0.1 cm ) using non - stretching flexible linear tapes , and blood pressure ( recorded to the nearest whole number in mmhg ) using mercury sphygmomanometers ( accosons , essex , england ) . the landmark for the measurement of wc was the midpoint between the lowest rib and the iliac crest , as recommended by who . measurement was done at the end of expiration , with the arms by the side and patient standing with the feet together . both wc and hip circumference were measured in privacy with the subject in light clothing . the 1 and 5 korotkoff sounds were used to mark the systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) respectively . generalized obesity was defined as bmi 30 kg / m , while central obesity was defined according to the international diabetes federation ( idf ) ethnic - specific criteria as wc 94 cm and 80 cm for males and females , respectively . risk category was defined using the hypertensive category ( sbp 140 mmhg and/or dbp 90 mmhg ) . comparison of means between two groups was done using the independent t - test while test of association / independence between categorical variables was performed using chi - square test of independence . the receiver operating characteristic ( roc ) analysis was used to compare the performance of wc and whr ( measures of central obesity ) as determined by the area under the curve ( auc ) . data analysis was conducted using statistical package for social sciences for windows ( spss ) version 10 ( chicago , il , usa ) . males were older than females and had higher whr and dbp , whereas females had higher wc , bmi and sbp . the gender differences observed in all the variables except for sbp and dbp were significant [ table 1 ] . general characteristics of the subjects central obesity was more prevalent when whr ( 76.9% ) was used than when wc ( 66.5% ) was used . chi - square analysis showed that central obesity determined using both whr ( ( 1 ) = 5.15 ; p < 0.05 ) and wc ( ( 1 ) = 185.6 ; p < generalized obesity was found in 190 ( 21.2% ) subjects , while 339 ( 37.8% ) were overweight [ figure 1 ] . six ( 0.7% ) persons were undernourished ( bmi < 18.5 kg / m ) . weight categorization among the subjects according to body mass index using the jnc 7 classification , 430 ( 47.9% ) , 324 ( 36.1% ) and 144 ( 16% ) subjects were classified as having hypertension , pre - hypertension and normal blood pressure , respectively . greater proportion ( 42.7% ) of individuals had hypertension when sbp was used alone compared to 30.8% when dbp was used ( ( 1 ) = 9.2 ; p = 0.0024 ) . the auc showing the performances of wc and whr in predicting the presence of cardiovascular risk ( generalized obesity , hypertension and both obesity and hypertension ) is shown in figures 24 , respectively . receiver operating characteristic curve for waist circumference and waist - to - hip ratio for generalized obesity receiver operating characteristic curve for waist circumference and waist - to - hip ratio for hypertension receiver operating characteristic curve for waist circumference and waist - to - hip ratio for obesity and hypertension the values of the auc for each of the indices for generalized obesity , hypertension and hypertension / obesity are summarized in table 2 . based on its higher auc , areas under the curve for predicting the presence of obesity , hypertension , and obesity / hypertension the auc showing the performances of wc and whr in predicting the presence of cardiovascular risk ( generalized obesity , hypertension and both obesity and hypertension ) is shown in figures 24 , respectively . receiver operating characteristic curve for waist circumference and waist - to - hip ratio for generalized obesity receiver operating characteristic curve for waist circumference and waist - to - hip ratio for hypertension receiver operating characteristic curve for waist circumference and waist - to - hip ratio for obesity and hypertension the values of the auc for each of the indices for generalized obesity , hypertension and hypertension / obesity are summarized in table 2 . based on its higher auc , areas under the curve for predicting the presence of obesity , hypertension , and obesity / hypertension in this study , the performances of wc and whr were compared using roc analysis . roc curves are frequently used in several medical disciplines such as biomedical informatics , clinical chemistry and radiology . the roc curve plots sensitivity versus ( 1 specificity ) of a test as the threshold varies over its entire range . each data point on the plot represents a particular setting of the threshold , and each threshold setting defines a particular set of true - positive ( tp ) , false - positive ( fp ) , true - negative ( tn ) and false - negative ( fn ) frequencies , and consequently a particular pair of sensitivity and ( 1 specificity ) values . it was originally developed for radar applications in the 1940s , but roc analysis became widely used in medical diagnostics , where complex and weak signals needed to be distinguished from a noisy background . the area under an roc curve is equal to the probability that a randomly selected positive case will receive a higher score than a randomly selected negative case . the roc curve area is a good summary measure of test accuracy because it does not depend on the prevalence of disease or the cut points used to derive the curve . it is however suggested that once a test has been able to classify patients as either having a disease or not , the performance of the test for particular uses such as diagnosis or screening needs to be evaluated . as regards its use when comparing the accuracies of two tests as in this study , caution should be exercised as the roc curve area may be misleading if the curves cross each other . this study revealed that wc had higher aucs compared to whr in subjects who were classified as having generalized obesity alone , hypertension alone or both . the higher aucs therefore suggest that wc may be more useful and reliable than whr in predicting the presence of generalized obesity and hypertension or cardiovascular risk . in a similar study by pouliot et al . , sagittal abdominal diameter ( sad ) was identified to be better than other clinical measures or determinants of abdominal obesity wc among the various measures of central adiposity is very easy to measure and perhaps more time saving in a routine clinic setting . it is neither cumbersome at all compared to the gold standards ( ct , mri ) nor labourious requiring further measurements and calculations . the simplicity of its measurement and its relation to both body weight and fat distribution as a major advantage over bmi and waist - to - hip circumference ratio was highlighted by lean et al . studies have shown that anthropometric measures , such as bmi , whr , and wc cut - off levels , are not comparable across different racial populations . apart from the fact that wc is a good indicator of both the degree of obesity and the accumulation of visceral adipose tissue , the threshold values of wc corresponding to critical amounts of visceral adipose tissue do not appear to be influenced by sex or by the degree of obesity . taylor et al . , in a screening for regional fat distribution among adult women , found that wc significantly classified the subjects better than whr . al - sendi et al . also reported that wc is useful in identifying children ( 1217 years of age ) at risk of developing hypertension . among 768 middle - aged men from the olivetti heart study , wc was the strongest predictor of blood pressure , and also was related to heart rate , insulin concentrations , and insulin sensitivity . in this study , the aucs for both wc and whr for the subjects who had only hypertension were smaller when compared to those represented by obesity alone and by both obesity and hypertension . this can be explained by the fact that bmi is better related to body fat than hypertension though they can cluster in a single individual . this association is evidenced by the degree of relationships shown by the correlation coefficients ( not shown in the results ) . though the aucs were smaller in the hypertension group , wc still performed better than whr in this group . with respect to gender comparisons , females had a higher mean wc and bmi values , whereas the reverse was the case for whr . this pattern had earlier been observed among diabetic patients in the same ethnic region of nigeria and in cuban female scholars . hormonal differences particularly involving the adrenal and sex steroids have also been noted to influence body fat distribution.[3234 ] these gender patterns also appear to be established in childhood , especially with pubertal development . though the role of obesity as a health hazard in adults has been well recognized , its presence in adolescence has been associated with obesity in adulthood , thus emphasizing the importance of early detection and intervention directed at its treatment to avert the long - term consequences of obesity and development of cardiovascular diseases . adipose tissue is mostly distributed as subcutaneous fat ( 85% of total adipose tissue mass ) and then a smaller amount as intra - abdominal fat ( 15% ) in lean and obese persons . the relative contribution of intra - abdominal fat mass to total body fat is influenced by sex , age , race - ethnicity , physical activity , and total adiposity . the term visceral fat is commonly used to describe intra - abdominal fat , and intra - abdominal fat is made up of both intraperitoneal fat ( mesenteric and omental fat ) , directly draining into the portal circulation , and retroperitoneal fat , draining into the systemic circulation . currently , there is no universally accepted site for measuring intra - abdominal ( iaat ) and subcutaneous adipose ( saat ) tissue distributions . this remains a source of variation in data obtained from different studies and needs to be harmonized for effective comparison of data . abdominal circumference as measured by wc , actually measures the fat contributed by subcutaneous tissue which is under the skin of the abdomen and that deposited intra - abdominally . both saat and iaat have been found to correlate with insulin resistance . despite the obvious strengths of wc over whr and bmi , it is to be noted that adoption of different landmarks for its measurement may pose some limitations on the comparison of wc data generated from different studies . though some studies on wc involving subjects of african descent have been reported , characterization of wc among african populations still appears to be deficient , especially as it relates to diagnostic indices and threshold values . wc provides a unique indicator of body fat distribution , which can identify patients who are at increased risk of central obesity - related cardiometabolic disease , above and beyond the measurement of bmi . from this study , being a simpler index to measure , less time consuming and devoid of any calculations , we propose that clinicians will find wc a reliable means of assessing individuals cardiovascular risk status especially in a busy routine clinic setting .

objective : to compare the performance of waist circumference ( wc ) and waist - to - hip ratio ( whr ) in predicting the presence of cardiovascular risk factors ( hypertension and generalized obesity ) in an apparently healthy population.materials and methods : we recruited 898 apparently healthy subjects ( 318 males and 580 females ) of the igbo ethnic group resident in enugu ( urban ) , southeast nigeria . data collection was done using the world health organization stepwise approach to surveillance of risk factors ( steps ) instrument . subjects had their weight , height , waist and hip circumferences , systolic and diastolic blood pressures measured according to the guidelines in the step 2 of steps instrument . generalized obesity and hypertension were defined using body mass index ( bmi ) and jnc 7 classifications , respectively . quantitative and qualitative variables were analyzed using t - test and chi - square analysis , respectively , while the performance of wc and whr was compared using the receiver operating characteristic ( roc ) analysis . p value was set at < 0.05.results:the mean age of the subjects was 48.7 ( 12.9 ) years . central obesity was found in 76.9% and 66.5% of subjects using whr and wc , respectively . wc had a significantly higher area under the curve ( auc ) than whr in all the cardiovascular risk groups , namely , generalized obesity ( auc = 0.88 vs. 0.62 ) , hypertension alone ( auc = 0.60 vs. 0.53 ) , and both generalized obesity and hypertension ( auc = 0.86 vs. 0.57).conclusion : wc performed better than whr in predicting the presence of cardiovascular risk factors . being a simple index , it can easily be measured in routine clinic settings without the need for calculations or use of cumbersome techniques .

I M Materials Definition of risk factors Statistical analyses R Performance of the indices of central obesity D C

with over 100 different molecular targets , curcumin is the archetypal pleiotropic dietary agent,1 and is currently at the forefront of biomedical research , as cogently testified by the over 5150 entries for curcumin in pubmed , ie , about 10% of those for aspirin , the best known drug . the redundancy of targets makes it difficult to decipher the clinical translation of the biochemical signature of curcumin , but there is general agreement that the most important clinical targets of curcumin are transcription factors ( nf - kb , stat3 , nrf2 ) , and that curcumin can exert beneficial effects by modulating the genomic and cell - signaling pathways involved in the inflammatory response.1,2 for this reason , the effects of curcumin are not expected to be immediately measurable but rather to develop gradually.1 the dismally low oral bioavailability of curcumin has long hampered the clinical translation of its medicinal potential,3 but this issue has now been substantially improved by various formulation strategies , with dispersion in lecithin , as in meriva ( indena spa , milan , italy ) being the best documented in terms of comparative pharmacokinetics4 and clinical efficacy.59 during a series of recent clinical studies of meriva for various chronic diseases,59 a rapid analgesic effect was observed within 12 hours of ingestion by some patients . similar anecdotal observations were reported by other users , raising the issue of the significance of these findings . these reports , and the recent discovery that curcumin can desensitize or inhibit a series of transient receptor potential ion channels involved in the generation of painful stimuli , ie , transient receptor potential cation channel 1 ( trpa1 ) and transient receptor potential cation channel subfamily v member 1 ( trpv1),1012 provided a rationale to investigate the activity of meriva in the mitigation of acute pain . here we report a pilot comparative study of the analgesic properties of meriva and two popular analgesic drugs , acetaminophen and nimesulide . the mechanism of action of acetaminophen has long been elusive , but has recently been related to the desensitization , by its quinone metabolite , of spinal trpa1,13 an ion channel that is also sensitive to the desensitizing activity of curcumin.10,11 as a powerful and rapidly acting cyclo - oxygenase 2 inhibitor,14 nimesulide outperforms curcumin as a direct inhibitor of this enzyme but is nevertheless largely devoid of the genomic capacity to downregulate inflammatory cytokines , as shown by curcumin.15 patients were excluded if they had a history of heart , renal , hepatic , or autoimmune disease , cancer , or gastroduodenal pathology . the lower and upper age limits for eligibility were 18 and 70 years , respectively . all patients signed a written informed consent before entering into the study , in accordance with the declaration of helsinki . the subjects received four tablet containers , containing nimesulide 100 mg in the first container , acetaminophen 500 mg in the second container , and meriva 500 mg in the third and fourth containers . the composition of meriva is curcumin ( 20% ) , phosphatidylcholine ( 40% ) , and micro - crystalline cellulose ( 40% ) . participants were blinded to the product contained in the pills , that were simply named as a ( nimesulide ) , b ( acetaminophen ) , and c and d ( meriva ) . meriva was supplied by indena spa , and nimesulide and acetaminophen were from commercial sources . the sequence of treatment was selected accordingly to the number of tablets to be taken , ie , one for nimesulide , two for acetaminophen , and three ( first cycle ) or four ( second cycle ) for meriva . the subjects were instructed to take one tablet of a on the first day of pain after enrollment , followed , after 48 hours of discontinuance , by two tablets of b , and , after further 24 hours of discontinuance , by three tablets of c. this protocol comprised the first cycle . in the protocol for the second cycle , subjects took one tablet of a on day 4 , followed by two tablets of b and four tablets of d , always with the same 2448-hour discontinuance cycle between treatments . the discontinuance between treatments was included in order to allow washout of the parent compound and/or active metabolites before intake of further treatment . this was of particular importance for nimesulide , which has an half - life of 25 hours but generates an active metabolite , ie , 4-hydroxynimesulide . therefore , a 48-hour washout was always observed between treatments a and b and of 24 hours between treatments b and c. fourteen subjects participated in the first cycle and 15 participated in the second cycle ; the difference in patient numbers was due to the fact that one patient , on antibiotic therapy for dental pain caused by pulpitis , was enrolled when the first cycle of the study had already been completed . all participants were allowed to take a second dose of the same product if pain perception was still significant 12 hours after the first dose . this opportunity was not utilized in practice , except for meriva , which has a shorter duration of action than the two other agents . after each intake of medication , the subjects completed a questionnaire , with the assistance of a clinician , canvassing the following items : pain perception , estimated according to the five - point visual analog scale devised by scott - huskisson ( 0 , nil ; 1 , slightly perceptible ; 2 , mild ; 3 , severe ; 4 , intolerable ) ; tolerability on the day of treatment ( poor , fair , good , excellent ) ; compliance ( poor , fair , good , very good ) ; and adverse events on the day of treatment and during the two following days . pain perception scores were analyzed according to a randomized block factorial design , and comparison between mean values were done using the tukey - kramer test . correspondence analysis and the pearson chi - square test were used to assess tolerability , compliance , and presence of adverse events . the subjects received four tablet containers , containing nimesulide 100 mg in the first container , acetaminophen 500 mg in the second container , and meriva 500 mg in the third and fourth containers . the composition of meriva is curcumin ( 20% ) , phosphatidylcholine ( 40% ) , and micro - crystalline cellulose ( 40% ) . participants were blinded to the product contained in the pills , that were simply named as a ( nimesulide ) , b ( acetaminophen ) , and c and d ( meriva ) . meriva was supplied by indena spa , and nimesulide and acetaminophen were from commercial sources . the sequence of treatment was selected accordingly to the number of tablets to be taken , ie , one for nimesulide , two for acetaminophen , and three ( first cycle ) or four ( second cycle ) for meriva . the subjects were instructed to take one tablet of a on the first day of pain after enrollment , followed , after 48 hours of discontinuance , by two tablets of b , and , after further 24 hours of discontinuance , by three tablets of c. this protocol comprised the first cycle . in the protocol for the second cycle , subjects took one tablet of a on day 4 , followed by two tablets of b and four tablets of d , always with the same 2448-hour discontinuance cycle between treatments . the discontinuance between treatments was included in order to allow washout of the parent compound and/or active metabolites before intake of further treatment . this was of particular importance for nimesulide , which has an half - life of 25 hours but generates an active metabolite , ie , 4-hydroxynimesulide . therefore , a 48-hour washout was always observed between treatments a and b and of 24 hours between treatments b and c. fourteen subjects participated in the first cycle and 15 participated in the second cycle ; the difference in patient numbers was due to the fact that one patient , on antibiotic therapy for dental pain caused by pulpitis , was enrolled when the first cycle of the study had already been completed . all participants were allowed to take a second dose of the same product if pain perception was still significant 12 hours after the first dose . this opportunity was not utilized in practice , except for meriva , which has a shorter duration of action than the two other agents . after each intake of medication , the subjects completed a questionnaire , with the assistance of a clinician , canvassing the following items : pain perception , estimated according to the five - point visual analog scale devised by scott - huskisson ( 0 , nil ; 1 , slightly perceptible ; 2 , mild ; 3 , severe ; 4 , intolerable ) ; tolerability on the day of treatment ( poor , fair , good , excellent ) ; compliance ( poor , fair , good , very good ) ; and adverse events on the day of treatment and during the two following days . pain perception scores were analyzed according to a randomized block factorial design , and comparison between mean values were done using the tukey - kramer test . correspondence analysis and the pearson chi - square test were used to assess tolerability , compliance , and presence of adverse events . compliance with treatment was very good for nimesulide and acetaminophen , good for meriva 1.5 g ( corresponding to 300 mg of curcumin ) and fair to good for meriva 2 g ( corresponding to 400 mg of curcumin , table 2 ) . the latter observation can be explained by the fact that intake of four pills was uncomfortable for some subjects . in general , all treatments were well tolerated ( table 3 ) , with tolerability being excellent for acetaminophen and meriva 1.5 g , poor to fair for nimesulide , and fair to good for meriva 2 g. no side effects were noticed for acetaminophen and meriva 1.5 g , but a few subjects reported gastrointestinal discomfort ( strong heartburn and gastroesophageal reflux , requiring antacid therapy ) with nimesulide . meriva 2 g also induced stomach heaviness , nausea , and heartburn in some participants , mostly those who had previously reported these side effects with nimesulide ( table 4 ) . however , unlike the gastric discomfort associated with nimesulide , that induced by meriva had an early onset , so was possibly nonspecific , being related , apart from an increased sensitivity to gastric injury , to the sheer challenge of ingestion of four pills . to study the time course of analgesic activity , pain intensity was evaluated by the visual analog scale before and 0.5 , 2 , 3 , 4 , 6 , 8 , 12 , and 24 hours after administration . the efficacy and safety results obtained for nimesulide and acetaminophen are consistent with those reported in the literature . a significant reduction in pain perception was observed 13 hours after taking nimesulide and 24 hours after taking acetaminophen . conversely , meriva 1.5 g had a statistically significant effect only after 3 hours , with an overall analgesic effect significantly lower than that of the other two drugs . in this cycle , nimesulide showed the highest and long - lasting analgesic effect , followed by acetaminophen . while the results for nimesulide and acetaminophen were not markedly different from those observed in the first cycle , the higher dose of meriva ( 2 g ) reduced pain perception after 2 hours . the analgesic effect of meriva 2 g lasted 4 hours , and a second dose was then necessary in some cases ( after 68 hours for headache , 8 hours for neuropathic pain , and 12 hours for neuralgia and pain from osteoarthritis ) . the analgesic effect of this meriva dose was lower than that of nimesulide , but higher than that associated with acetaminophen . curcumin can attenuate thermal hyperalgesia associated with diabetic neuropathic pain by inhibition of tumor necrosis alpha and nitric oxide release,16 have an antihyperalgesic effect in a formalin - induced orofacial pain model in rats,17 and decrease trpv1-mediated pain hypersensitivity.12 further , intrathecal administration of curcumin significantly decreased the sensitivity of rats in the formalin test.18 the relatively quick onset of these activities is at odds with the mainly genomic anti - inflammatory mechanism(s ) of curcumin , suggesting a direct activity on the mechanism of translation of inflammatory stress into a painful sensation , a process where thermal transient receptor potential play a critical role.19 curcumin behaves as a combined trpv1 inhibitor12 and trpa1 desensitizer,10,11 and this direct action is complemented by that mediated via inflammatory mediators , a major class of thermal transient receptor potential modulators.19 however , the clinical relevance of these observations has not yet been evaluated . to fill this gap in our knowledge , we carried out a pilot comparative study of curcumin ( formulated as meriva to improve its poor oral absorption)4 and two popular analgesic drugs ( acetaminophen and nimesulide ) . at a dose of 2 g ( corresponding to 400 mg of curcumin ) , meriva had a clear analgesic effect in subjects affected by acute pain , confirming anecdotal reports of the pain - relieving properties of this curcumin formulation . at this dose , the activity was higher than that associated with 500 mg of acetaminophen , while a lower dose of meriva ( 1.5 g , corresponding to 300 mg of curcumin ) gave only transient and often unsatisfactory relief of pain , indicative of suboptimal therapeutic plasma concentrations . the analgesic effect of meriva achieved significance only 2 hours after administration , as observed for acetaminophen . conversely , nimesulide was more rapidly acting , with strongest pain - relieving properties being reported one hour after administration . at both doses used , the tolerability of meriva was substantially better than that of nimesulide , which often requires concomitant administration of antacids to alleviate the gastric irritation associated with its use . the similarity of action of curcumin and acetaminophen supports the view that these compounds share the same mechanism of action , while nimesulide is a powerful inhibitor of cyclo - oxygenases,14 a class of enzymes only modestly inhibited by curcumin in a direct way . taken together , our results show that preclinical data on the analgesic properties of curcumin have a clinical translation , at least at a dose of 2 g as in the meriva formulation . while this dose of meriva is significantly higher than that used to relief chronic inflammatory conditions ( 11.2 g / day),8 its pain - relieving activity could benefit from general down - regulation of the inflammatory response induced by curcumin , given that transient receptor potential - mediated mechanisms of analgesia are magnified by attenuation of inflammation . overall , this would translate into better control of chronic pain , providing a rationale for the inclusion of meriva in protocols of treatment for acute pain of various origins .

in addition to its anti - inflammatory activity , meriva , a proprietary lecithin formulation of curcumin , has been anecdotally reported to decrease acute pain in patients with various chronic diseases . given that curcumin can desensitize transient receptor potential a1 , a nociceptor seemingly also mediating the analgesic effect of acetaminophen , as well as inhibiting and downregulating the expression of cyclo - oxygenase 2 , the selective target of nimesulide , a nonsteroidal anti - inflammatory agent , we carried out a pilot comparative study of the acute pain - relieving properties of these three agents . at a dose of 2 g ( corresponding to 400 mg of curcumin ) , meriva showed clear analgesic activity , comparable with that of a standard dose ( 1 g ) of acetaminophen , but lower than that of a therapeutic ( 100 mg ) dose of nimesulide . the analgesic activity of lower ( 1.5 g ) doses of meriva was less satisfactory , and the onset of activity was longer than that of nimesulide for both doses . on the other hand , gastric tolerability was significantly better than that of nimesulide and comparable with that of acetaminophen . taken together , our results show that the preclinical analgesic properties of curcumin have clinical relevance , at least at a dose of 2 g as the meriva formulation . while this dose is significantly higher than that used to relieve chronic inflammatory conditions ( 11.2 g / day ) , its pain - relieving activity could benefit from the general downregulation of the inflammatory response induced by curcumin , considering that the transient receptor potential channel - mediated mechanisms of analgesia are magnified by attenuation of inflammation . in patients on treatment with meriva , this would also translate into better control of acute pain , providing a rationale for the analgesic properties associated with this curcumin formulation .

Introduction Materials and methods Treatment and evaluation Statistical analysis Results Discussion

the posttraumatic immune response is characterized by a complex set of pro- and anti - inflammatory reactions in order to restore homeostasis and was shown to be organ and cell specific [ 2 , 3 ] . splenic immune response and cellular immunity are known to be depressed after trauma - hemorrhage leading to an increased susceptibility to infectious complications [ 4 , 5 ] . several studies have demonstrated that splenocyte functions , such as proliferative and cytokine production capacity as well as macrophage antigen presentation function are suppressed following trauma hemorrhage [ 69 ] . in regards to t - cell function , a posttraumatic shift from splenic th1 cytokine ( il-2 , ifn- , and tnf- ) to th2 cytokine ( il-4 , il-5 , il-10 ) production has been reported [ 1015 ] . these splenic immune alterations are well described in rodent trauma models consisting of laparotomy and hemorrhagic shock [ 3 , 1619 ] and appear already 2 hours after insult induction [ 12 , 15 , 2023 ] . simple hemorrhage and laparotomy alone were demonstrated to result in a marked depression of splenic immune function , and no differences were seen in the extent of depression in the early stage , if these two insults were combined . however , a prolonged splenic immunodepression of 7 days was seen after combined trauma hemorrhage , whereas splenic immune suppression only persists up to 3 days following isolated hemorrhage or laparotomy . with a later onset at day 7 , splenic immune alterations following femoral fracture and hemorrhage seem to differ from the aforementioned trauma models . however , results are inconsistent due to different study designs ( e.g. , animal gender , genetic strain , and protocol of fracture induction ) . data regarding the role of isolated femur fracture in early stage splenic immune alterations are lacking , but are of special clinical interest as femoral fracture itself as well as the stabilization by femoral nailing seems to have a significant impact on the inflammatory response and the susceptibility to infectious complications . furthermore , it is still controversially discussed whether interleukin ( il)-6 , produced by many different cell types ( e.g. , macrophages , endothelial , and t cells ) , exerts pro- or anti - inflammatory effects in the posttraumatic immune response . il-6 seems to have both , pro- and inflammatory effects , depending on whether it is acting in a paracrine or endocrine manner . additionally , the effects of il-6 seem to be influenced by the stimulus and the model of inflammation used in experimental studies . the aim of the present pilot study was to investigate whether a femoral fracture with or without hemorrhagic shock has an impact on the splenic cytokine production capacity at an early posttraumatic stage ( 4 hours ) and to observe the effects of il-6 under these conditions . prior to initiation , the study was approved by the animal welfare committee of the state of lower saxony . the experiments were performed in 18 male c57bl/6 il-6 knockout ( il-6 ) mice aged 810 weeks and weighing 22.0 3.0 g. as a control 18 male c57bl/6 mice of similar weight ( wild type ; wt ) were used . the animals were bred and raised under specific pathogen - free conditions in the central animal facility of our institution . throughout the study period , wt and il-6 animals were randomly assigned into sham groups ( s ) ( each of 6 animals , only anaesthesia ) and 2 experimental groups , in which either an isolated femur fracture or a combination of hemorrhage and femoral fracture were induced . all procedures were performed after deeply anesthetizing the animals with 2.2 0.3 mg of ketamine ( ketanest 100 mg / kgbw ) and 0.33 0.045 mg of xylazine ( rompun 15 mg / kgbw ) . a standardized femur fracture was induced in experimental groups using a blunt guillotine device with a weight of 500 g as previously described . this resulted in an a - type femoral fracture combined with a moderate soft - tissue injury . a hemorrhagic shock was induced by withdrawing 60% of the total blood volume ( body weight ( in g ) x 0.04 ml ) via puncturing the orbital plexus . resuscitation using sterile ringer 's lactate was performed with four times the shed blood volume in the tail vein after 1 hour . experimental animals were sacrificed four hours after induction of hemorrhage and fracture , whereas sham mice were four hours after the first anaesthesia . splenocytes were isolated as previously described . in brief , spleens were gently ground between frosted microscope slides to produce a single cell suspension . the erythrocytes were lysed with lysis buffer and the remaining cells were washed with pbs by centrifugation ( 300 g , 15 min , 4c ) . after centrifugation , cells were resuspended in rpmi 1640 ( gibco ) containing 10% heat inactivated fbs and antibiotics ( 50 u / ml penicillin , 50 g / ml streptomycin and 5 g / ml gentamycin , all from gibco ) to get a final concentration of 110 cells / ml . the splenocytes were then cultured in the presence of 10 g / ml lps ( lps from e.coli 0111:b4 , sigma - aldrich inc . , steinheim , germany ) at 37c , 95% humidity , and 5% co2 for 24 hours . after incubation , the cell free suspension cytokine concentrations in cell - free supernatants were determined with cytokine bead array inflammatory kits using flow cytometry according to the manufacturer 's instructions ( bender medsystems , vienna , austria ) . statistical analysis was performed using spss computer software ( spss 11.5 , chicago , il ) . . comparisons between groups were performed using one - way analysis of variances ( anova ) , student 's t - test or the rank - sum test ( mann - whitney u - test ) . the tnf- secretion of stimulated splenocytes was significantly reduced following isolated femoral fracture in wt and in il-6 mice compared to sham animals ( figure 1 ) . in il-6 mice , the decrease of the tnf- release was significantly attenuated in comparison to wt animals ( p < 0.05 ) . in sham groups , no significant differences concerning the tnf- secretion were observed between wt and il-6 mice ( p > 0.05 ) . combined hemorrhage and femoral fracture resulted in a further significant decrease of the tnf- release in wt as well as in il-6 mice compared to animals with an isolated femoral fracture ( p < 0.05 ) . again , a significantly attenuated depression of the tnf- production was demonstrated in il-6 mice compared to wt animals ( p < 0.05 ) as shown in figure 1 . the il-6 productive capacity of stimulated splenocytes was significantly decreased after femoral fracture compared to sham animals ( p < 0.05 ) . the combination of hemorrhagic insult and femoral fracture resulted in an additional significant suppression of the il-6 release ( p < 0.05 ) as shown in figure 2 . in il-6 mice , the mean il-6 secretion was < 6 pg / ml in all study groups due to the lacking il-6 gene . therefore , no significant differences in il-6 release between different study groups were observed in il-6 mice ( p > 0.05 ) . in wt mice , femoral fracture with or without hemorrhagic shock did not result in a significant increase of the il-10 production of splenocytes compared to sham animals ( p > 0.05 ) . in il-6 mice , the il-10 release of stimulated splenocytes was significantly decreased in all study groups compared to wt animals ( figure 3 ) . thereby , the il-10 production was significantly decreased following femoral fracture with or without hemorrhagic shock compared to the sham group ( p < 0.05 ) . no significant differences concerning the il-10 release were demonstrated between il-6 mice with an isolated femoral fracture and animals with an additional hemorrhagic shock ( p > 0.05 ) . trauma results in a significant impairment of splenic immune functions which has been supposed to increase the susceptibility to septic complications as a result of depressed cellular immunity [ 3337 ] . operative stabilization of major fractures ( e.g. , femoral fractures ) is supposed to additively enhance the trauma - induced inflammatory changes [ 38 , 39 ] , which has resulted in an ongoing discussion about the optimal timing of definitive fracture stabilization . despite the important role of the spleen in the immune response after trauma , the effects of a femoral fracture as an isolated injury or in combination with hemorrhagic shock on the early - stage splenic cytokine production has yet not been investigated . furthermore , the role of il-6 within these splenic immune alterations has not been elucidated . in this context , it is well described that systemic cytokines are mainly released by kupffer cells as the largest population of tissue macrophages after trauma hemorrhage and infectious stimulus [ 2 , 40 ] . as the pathophysiological role of splenic il-6 has been discussed controversially , we focused on the importance of splenocytes and locally generated il-6 in the posttraumatic inflammatory response . an isolated femoral fracture resulted in a significantly depressed cytokine production capacity of splenocytes at an early stage of the posttraumatic course . the depression of splenic cytokine release was enhanced in case of an additional hemorrhagic shock . the splenic immunodepression in terms of reduced tnf- secretion of splenocytes was significantly attenuated in the absence of il-6 . the production capacity of splenocytes for il-10 was suppressed in the absence of il-6 in all study groups . in contrast to wt animals , splenic il-10 release was significantly decreased following femoral fracture with and without hemorrhagic shock . in the present study , we were able to show that femoral fracture with and without hemorrhage results in a marked alteration of splenic cytokine production capacity at an early posttraumatic stage ( 4 h ) . in accordance , several studies reported a splenic immunodepression 2 h and 4 h following laparotomy and hemorrhagic shock [ 12 , 15 , 2023 , 41 , 42 ] . in contrast , splenic immune depression after femoral fracture and hemorrhage seems to appear later in the posttraumatic course . described that the typical splenic th1/th2 shift was evident at day 7 , but not at day 1 after trauma hemorrhage . further studies reported comparable results with marked alterations of splenic cytokine release in response to femoral fracture and hemorrhage at day 7 after insult induction [ 4346 ] . on the other hand , monroy et al . as well as stapleton et al . found no significant alterations in splenic cytokine secretion seven days after combined femoral fracture and hemorrhage . several studies used female animals in different estrus cycle status , which probably have a marked impact as splenic immune response exhibits a gender dimorphic pattern . additionally , we induced a closed femoral shaft fracture , which was shown have an greater impact in terms of splenic immune suppression compared to open femoral fracture used in other studies . as previous studies described an association between the extent of splenic immune depression and the posttraumatic susceptibility to infectious complications [ 12 , 13 , 15 , 49 , 50 ] , the enhanced depression of splenic cytokine production capacity following combined femoral fracture and hemorrhagic shock might have clinical implications in the setting of multiple trauma in terms of priority and timing of definite fracture stabilization . however , the transfer of our results to the clinical setting is limited as measuring the cytokine production capacity of splenocytes only reflects a part of the t cell ( namely , cd4 + t - cells ) and splenic immune function . based on our data , we could not make any statement concerning cd8 + t - cell function and proliferation capacity of splenocytes . furthermore , it is not possible to differentiate whether depressed cytokine release is caused by a decreased production capacity of cd4 + t - cells , splenic macrophages , and/or dendritic cells as we measured cytokine secretion in the overall splenocyte culture . as the splenic immune response after trauma hemorrhage has been reported to result in a shift from th1 to th2 cytokines , we would have expected an increased production capacity of splenocytes for il-10 . in contrast , we only observed a nonsignificant increase of splenic il-10 release following femoral fracture and hemorrhage in wt animals . this might be explained by the fact that we used c57bl6 mice , which were shown to be hyporesponsive to trauma hemorrhage compared to animals of the c3h / hen strain used in other studies . moreover , it might be argued that femoral fracture and hemorrhage does not result in a th1/th2 shift because of the missing effect on the th2 cytokine release in our study . in this context , it might be suggested that the depression of splenic tnf- and il-6 release results from a decreased production capacity of splenic macrophages rather than cd4 + t cells . in order to clarify this point separate isolation of splenic macrophages and/or assessment of more cd4 + t - cell - specific mediators ( il-2 , inf- , il-4 , and il-5 ) furthermore , significant differences in the splenic il-10 release may not become apparent already 4 hours after trauma hemorrhage . also for answering the question when the splenic immune function is restored after femoral fracture and hemorrhage , further studies with additional time points ( e.g. , 24 hours , day , 3 days , and 7 days ) based on our results , it could be assumed that il-6 might exert anti - inflammatory effects on the splenic immune function after trauma - hemorrhage . in the present study , we observed the principle depressive effect of femoral fracture and hemorrhagic shock on the splenic tnf- release in wt and il-6animals . however , the depression of cytokine release was significantly attenuated in the absence of il-6 . the increased tnf- levels might be explained by a potentially anti - inflammatory role of il-6 in order to restore tnf- production ( negative feedback mechanism ) , which itself has been described as a potent inductor of il-6 synthesis [ 51 , 52 ] . the significance of this observation on immune competent cells in other tissue compartments as well as on the incidence of infectious complications and outcome after trauma has to be clarified in further studies . in the present study , the secretion of il-10 was significantly lower in il-6 mice in all study groups , again pointing towards an anti - inflammatory effect of il-6 on splenocytes , possibly by inducing il-10 synthesis . for mucosal cells , where only a little or no increase of il-10 mrna was observed in il-6 mice after hemorrhage , whereas a marked increase in wt mice was found . in the same study , in contrast , after a septic insult significantly increased il-10 plasma levels were observed in il-6 mice compared to wt animals . due to the results of the present studies and the observations made in the literature it might be assumed that the kind of the initiating inflammatory stimulus as well as the observed body compartment might be essential for the net effect of il-6 . it has been postulated that the net effect of il-6 on the host inflammatory response reflects a balance of two opposing effects , a paracrine effect of il-6 that promotes inflammation , and an endocrine effect of il-6 that diminishes inflammation . as il-6 mice were used in the present study , the results have to be interpreted carefully . in il-6 mice , there might be a functional redundancy in the regulation of the immune response following a traumatic insult [ 1 , 55 , 56 ] . in il-6-deficient mice , other proinflammatory mediators may take over effects of il-6 resulting in an only partially impaired inflammatory response compared to wt animals . furthermore , the present study is limited by the fact that facs analyses of cell free supernatants were done only once . this may lead to a significant variation of data as shown by the standard deviations in the present study . the depression of splenic cytokine production capacity after femoral fracture with and without hemorrhagic shock at an early posttraumatic stage underlines the importance of adequate treatment strategies and identification of high risk patients in order to prevent posttraumatic complications . the absence of il-6 results in significant changes of posttraumatic splenic cytokine release indicating that the posttraumatic modulation of il-6 synthesis might be a potential target for therapeutic interventions . however , further studies especially with an additional infectious stimulus are needed to identify the relevance of such therapies .

splenic immune function is known to be depressed following hemorrhage . the present study investigates the effects of femoral shaft fracture , isolated or in combination with hemorrhage , on early stage cytokine production capacity of splenocytes and observes the role of il-6 under these conditions . male il-6 knockout ( il-6/ ) and wild - type mice ( wt ) were randomly divided into three groups : sham ( s ) , isolated femoral fracture ( fx ) , and femoral fracture + volume controlled hemorrhage ( th - fx ) ( n = 6 per group ) . animals were sacrificed four hours after induction of hemorrhage and fracture . cytokine release ( tnf- , il-6 , and il-10 ) of isolated and lps - stimulated splenocytes was determined by cytometric bead array . femoral fracture with or without hemorrhage caused a suppression of in vitro cytokine production capacity of splenocytes at an early posttraumatic stage in wt and il-6/. in the absence of il-6 , the profile of splenic cytokine secretion is significantly altered , identifying this cytokine as a potential therapeutic target to modulate the posttraumatic immune response .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

lipoma is the most common soft tissue mesenchymal neoplasm in adults , which is located in any part of the body . the majority occurs in the upper - half of the body , particularly the trunk , head , and neck region , and it is rarely described in the oral cavity . conventional lipoma has been divided into three forms according to the origin of the localization : superficial lipoma ( arise within subcutaneous tissue ) , deep lipoma ( arise within deep soft tissue ) and parosteal lipoma ( arise within the surfaces of bone ) . the histological characteristics and types vary , which include angiolipoma , angiomyolipoma , myolipoma , osteolipoma and chondrolipoma . both osteolipomas and chondrolipomas are rare entities.[24 ] however , occurrence of osteolipomas or in other term lipomas with oseous and cartilagenous metaplasia are less common than other subtypes of lipomas . the term of osteochondrolipoma has been used for the lipomas containing both cartilage and bone which , are very rarely seen and generally associated with a paraosteal localization . to our knowledge , a 64 year old male patient with painless mass on his mandibulary symphysis region , was referred to the department of oral and maxillofacial surgery , faculty of dentistry on september , 2007 . the lesion had been first noticed 2 months prior of the presentation to the clinic with no significant enlargement . clinical examination of the oral cavity revealed a well demarcated , firm , round and exophitic lesion of approximately 2 cm in diameter at the symphysis region of the left mandible . the lesion was firmly attached to the bone in the clinical examination and the overlying mucosa was intact and of normal color . radiographically , at the site of the lesion some degree of radioopacity was observed [ figure 1 ] . under local anesthesia , the patient was taken to the operating room and the lesion was completely excised with an intraoral approach . during the surgical intervention , the encapsulated lesion was not adherent to the underlying periosteum and overlying mucosa , thus the lesion was dissected and removed easily [ figure 2 ] . the surgical specimen was histopathologically evaluated for final diagnosis at department of oral pathology , faculty of dentistry , gazi universitys . the 6-month postoperative follow - up showed healing of the oral mucosa without any recurrency . preoperative panoromic radigoraph exhibiting the dense radioopacity ( arrow ) in the symphysis region of the mandible intraoperative view of the lesion with encapsulation macroscopically , the gross specimen was a 2.7 1.8 1.4 cm encapsulated mass mostly comprising of adipose tissue with a few number of encapsulated nodular structures . on section , focal areas of hyaline chondroid structures and lamellar bone with fatty marrow were seen throughout the lesion . both islands of bone and cartilage were surrounded with well defined fibrous tissue [ figure 3 ] . there was no histological evidence of malignancy , such as mitosis , cellular atypia , necrosis , and hemorrhage . histochemistry with alcian blue periodic acid - schiff stain showed acid mucopolysaccaride presence in chondroid tissue ; hence , this was hyaline chondroid . on immunohistochemistry , adipocytes were positively stained with vimentin antibody , while both adipocytes and chondrocytes were positive for s-100 protein [ figure 4 ] . histopathological features of osteochondrolipoma showing mature adipose tissue containing cartilage islands and lamellar bone trabecules ( h and e , 40 ) chondrocytes and adipocytes demonstrating positivity for s 100 protein ( immunoperoxidase , 40 ) however , they are relatively uncommon in the oral cavity with incidence of 14% . variants of lipoma especially osteolipoma and chondrolipoma are very rare lesions which are located in the oral cavity . furthermore , intaoral lipoma with both osteoid and cartilaginous metaplasia has been reported just in two cases . we presented an osteochondrolipoma case that differed from the typical arrangement by two rare alterations . first , the lesion showed well - defined cartilaginous and osseous areas within lipoma that is also considered as osseous and cartilaginous metaplasia . in the a study of fregnani et al . , fibrolipoma was reported as the dominant subtype in 46 lipoma cases , in which neither osteolipoma nor chondrolipoma was found . two lipomas with cartilaginous or osseous metaplasia was reported out of 125 lipoma cases in another study , whereas none of the cases represented osteochondrolipoma . although , any case in the name of oral osteochondrolipoma has not been reported , lipoma with osteoid and cartilaginous metaplasia has been represented by two cases in the oral region . the osteochondrolipoma is the specific term of the lipoma with mature cartilaginous and osseous differentiation ; thus , both terms represents the same entity . some authors consider such type of lipoma as a benign mesenchymoma due to consisting of two or more mesenchymal elements such as lipocytes , chondrocytes , osteocytes , and fibroblasts . jones et al . stated that the term of benign mesenchymoma should be used strictly to describe an unencapsulated neoplasm composed of two or more mature mesenchymal tissues not ordinarily associated with each other , excluding fibrous connective tissue . in the present case , as the tumor is well demarcated and partially encapsulated and moreover the prominent component is mature adipose tissue , the tumor is considered as osteochondrolipoma . second alteration that took part in this case , was the parosteal localization of the lesion . the parosteal lipoma which is defined as lipoma exhibits a conguous relationship with the periosteum , usually demonstrating some form of attachment to periosteum with an underlying osseous reaction , is rarely seen in the oral cavity . various types of osseous cortical responses from a reactive overproduction of bone to cortical erosion can be seen underlying bone . the radiopacity in our case may reflect either the reactive bone production of underlying bone or the density of cartilagenous and ossous component of the tumor . multipotent cells of mesenchyme , different cell lines and metaplastic differentiation of the adipose tissue are three hypothesis regarding the origin of the tumor . however , considering its parosteal location , histological findings of well - formed cartilage and bone tissue within the adipose tissue neoplasm , it is decided to be a true neoplasm of mesenchymal tissue stem cells showing characteristics of three different tissues originating from the mesenchyme .

osteochondrolipoma is a rare benign soft tissue neoplasm . it is occasionally considered to be a variant of adipose tissue neoplasm lipoma showing multiple differentiation pathways of pluripotent stem cells . as with the lipomas they can be seen at any location and show cartilagenous and osteoid differentiation when located parosteally . we present a case of osteochondrolipoma located at the symphysis of the mandible . to our knowledge , this is the first reported case of an oral osteochondrolipoma associated with parosteal localization .

INTRODUCTION CASE REPORT DISCUSSION

electrostatic interactions comprise one of the principle interatomic forces , along with exchange - repulsion , dispersion , and polarization or induction . the importance of electrostatic interactions is paramount at long range and for polar molecules . much development effort has been focused on computational treatment of long - range electrostatics , e.g. , the development of particle - meshed ewald ( pme ) methods . electrostatic interactions at short range have received less consideration until recently . at close distances , a spherical approximation of atomic charge distributions is insufficiently accurate and use of atomic multipole expansions provides much greater flexibility in modeling complex electrostatic potentials near a molecular surface , an insight which inspired the development of the amoeba force field . nonetheless , at very close interatomic distances , when electron clouds overlap , a point multipole approximation becomes inadequate . the electrostatic potential within a spherical electron cloud no longer behaves as a simple 1/r interaction potential at small separation distances . such deviation from a simple coulomb potential is referred to as a penetration effect . while the charge penetration effect leads to a negative correction to energy at typical molecular interaction distances , where the electron electron penetration is dominant , it can be repulsive at very short range . a recent study by lewis and co - workers reported the counterintuitive result that any ring substitutions of the benzene dimer ( parallel ) with electron - withdrawing or electron - donating groups yield more favorable electrostatic contributions than the unsubstituted benzene benzene dimer itself . this result is contrary to the conventional thought that such interactions are correlated with the ability to withdraw or donate electrons to the cloud as described by the hunter sanders rules . sherrill and co - workers suggested this is because the electrostatic interactions in such systems at the stacking distance exhibit a significant charge penetration effect . the multipole model , which the hunter sanders rules are based upon , can not correctly account for such effects . moreover , in a recent study of aromatic crystals , a charge penetration corrected amoeba - like model predicted better crystal properties than the uncorrected model . it was shown that point atomic multipoles consistently predict positive ( repulsive ) electrostatic interactions between stacked or t - shaped benzene dimers while symmetry - adapted perturbation theory ( sapt ) suggests an opposite trend toward attractive interactions . the current amoeba force field seemingly compensates for penetration with a less repulsive van der waals interaction , so the total interaction energy is reasonable at certain dimer configurations . however , explicit incorporation of the penetration effect provides much better anisotropy in crystal packing and makes the overall force field more transferable . in another study of organochlorine compounds using the amoeba model , it was found that the transferability of chlorine van der waals parameters was unsatisfactory , likely due to lack of an explicit penetration correction . there have been previous attempts to incorporate the charge penetration effect into implicit solvent models , multipole - based electrostatic models , charge - density - based ( including gaussian multipole ) models , and combined quantum and molecular mechanics ( qm / mm ) models . generally , the charge penetration correction involves breaking the atom - centered point charge into an effective core and a valence electron density , as suggested by gordon et al . and piquemal et al . in this way , the electrostatic interaction between two atoms is described as a sum of interactions between core and valence charge densities , which can be modeled with empirical exponential functions . alternatively , rigorous integration over the two charge densities can be used to model short - range electrostatic interactions , with a significantly greater expenditure of computational effort . others have explored incorporating charge penetration effects into the qm / mm framework , using either screened molecular mechanics ( mm ) charges or simple empirical damping corrections . such screened mm charges are typically parametrized for qm / mm applications and may be not directly applicable in full mm calculations , e.g. , to reproduce the attractive sapt electrostatic energy in a stacked benzene benzene conformation , unless an explicit term for interactions of the valence charge densities is included , as in the model recently proposed by wang and truhlar . in this study , the charge is revisited , implemented , and extensively tested in the context of the amoeba force field and using a new parametrization strategy . the charge penetration corrected amoeba point multipole model ( multipoles + cp ) is developed using a comprehensive set of small molecule complexes , and the parameters are determined for h , c , n , o , p , s , f , cl , and br to cover the elements commonly found in organic and biological molecules . to facilitate model development in this and future studies , a new database of sapt2 + decomposed quantum mechanical energies constructed for 101 small molecule pairs , each at 7 different intermolecular distances ( the s1017 database ) , is presented . in order to systematically examine the electrostatic and other components of intermolecular forces , the s101 and s1017 databases of homo- and heterodimers of common organic molecules have been constructed . the first 66 pairs , which cover the majority of the typical organic interactions of h , c , n , and o atoms , are taken from the s66 database from hobza et al . in addition , 15 complexes containing halogen atoms ( f , cl , and br ) , six complexes containing sulfur , and four complexes containing phosphorus have been added . furthermore , 10 monomer water complexes , which encompass amino acid side chain analogs ( including the charged ones ) missing in the s66 data set , have also been added , yielding a total of 101 pairs . to construct the s1017 database , definitions of the intermolecular distance vectors from the s668 database of hobza et al . were used . unlike s668 , each of the 101 model complexes were placed at seven separation distances , corresponding to 0.70 , 0.80 , 0.90 , 0.95 , 1.00 , 1.05 , and 1.10 times the equilibrium intermolecular distances . compared against the s668 database , the s1017 set includes more dimer configurations at very short separations , which have been rarely investigated but are essential to the study of penetration effects and exchange repulsion interactions . we have selected 0.7 times the equilibrium distance as the lower bound because the sapt calculations below show that at this close distance the electrostatic energy is about 50% of the exchange repulsion energy or higher ; i.e. , both electrostatic and van der waals ( vdw ) components are important in the total interaction energy . as these short distances are being sampled in molecular dynamics simulations at room temperature and even more so at higher temperatures , their contributions to the simulated bulk properties are nonnegligible . thus , it is essential to ensure the charge penetration model behaves correctly at these short distances . the newly added structures among the 101 complexes were optimized at the mp2/cc - pvtz level of theory with counterpoise correction using the gaussian09 program . for each of the resulting 707 dimer configurations , the interaction energy has been decomposed using sapt2 + analysis provided by the psi4 program . the sapt2 + calculation returns electrostatic , exchange repulsion , induction , and dispersion energies , all to second order with respect to intramolecular electron correlation . exact definitions of each component can be found in figure 1 of sherrill et al . it should be noted that dispersion energy can only be separated from other effects in long range when two molecules do not overlap . thus , at van der waals distances , it may be more appropriately to refer to this as dispersion - like or damped dispersion energy . this should be kept in mind even though for simplicity the term dispersion is used throughout the discussion . all sapt calculations were carried out using dunning s correlation consistent basis sets at both aug - cc - pvdz and aug - cc - pvtz levels . the complete basis set ( cbs ) limits of the sapt2 + energies were also estimated . ( data can be found in the supporting information ) schematic view of monomers and dimers in the s101 data set . different configurations of the same dimers , e.g. , menh2water , phenol water , benzene benzene , and mecl mecl , are included in the data set to take into account the orientational effect . a two - point extrapolation strategy has been used to estimate the complete basis set limit of the exchange repulsion and dispersion energy at the sapt2 + level of theory . this is similar to helgaker s scheme but with an optimized p value ( eq 1 ) . such a protocol has previously been applied to extrapolate the dispersion energy of dft - sapt calculation in earlier study.1 different p values , 3.0 for exchange repulsion and 4.3 for dispersion energy , were obtained using the small pairs and subsequently applied for extrapolation over the full s1017 database . since the truncated terms in the sapt2 + dispersion energy make a considerable contribution to the total interaction energy , dispersion energies obtained at the sapt2+/cbs level are scaled by a factor f in order to match the sapt total interaction energy to those obtained at the ccsd(t)/cbs level of theory ( eq 2).2 by minimizing eq 2 using the 66 pairs in the s66 data set , a scale factor of f = 0.89 has been determined and used to construct the s1017 database . in order to model the charge penetration effect , the method of piquemal et al . is revisited . their original model corrects the charge charge and charge dipole interactions . here , we propose to retain the charge , each atomic point charge is divided into an effective core and a damped valence electron distribution . thus , the electrostatic energy between two atomic charges can be written as3where r is the interatomic distance ; z is the positive effective core charge , which is set to be equal to the number of valence electrons of each atom ; q is the net charge of the atom , thus ( z q ) can be considered as the magnitude of the ( negatively charged ) electron cloud ; and and are two parameters controlling the magnitude of the damping of the electron cloud when the atom is interacting with the core and with electrons from other atoms , respectively . thus , the total electrostatic energy between two atoms now involves three components , the core the first method involves fitting the damped potential to the qm electrostatic potential at short range , near or within the molecular surface . by considering a probe charge of + 1e as a particle with an effective core charge of + 1e and having no valence electrons , ( z2 thus , the electrostatic potential can be written as4 once z and q are determined , can be obtained easily by fitting eq 4 to the qm electrostatic potential . in the second method , is intuitively set to be the same as the number of valence electrons ( except the hydrogen atom):5 when z and are fixed in eq 3 , the electrostatic energy is more attractive when is greater . this is in accordance with the intuition that atoms having a larger electron cloud may exhibit a stronger penetration effect . although the final parameters for h , c , n , o , p , s , f , cl , and br were derived based on the second method , the performance of both methods is examined for h , c , n , and o containing molecules in later sections . as the distance between two atoms increases , thus , the electrostatic interaction at medium and long distances can still be accurately modeled via a multipole expansion , as the penetration correction diminishes rapidly with distance . as the data will show , the penetration correction is only significant when atomic separation is shorter than the sum of atomic van der waals radii and thus does not affect the reciprocal space portion of an ewald summation approach such as particle mesh ewald ( pme ) . in addition , to ensure the continuity between the real and reciprocal space , a switching function is used near the real space ewald cutoff distance ( typically 7 for atomic multipole pme ) to ensure the penetration correction completely disappears:6where r is the interatomic distance and rl and ru are the lower and upper bounds of the switching function . quadrupole interactions . following previously detailed procedures , an initial set of atomic multipole moments for each molecule was obtained from distributed multipole analysis ( dma ) at the mp2/6 - 311 g * * level of theory . then the dipole and quadrupole moments were further optimized by fitting to the electrostatic potential calculated at the mp2/aug - cc - pvtz level . the same strategy has been used in developing the amoeba force field for small molecules , proteins , and organochloroine compounds previously . with the addition of the penetration correction described here , monopole monopole ( charge charge ) interactions are calculated using eq 3 while all other terms in the amoeba retain their original form . the sapt and amoeba multipole based intermolecular interaction energies were compared on exactly the same dimer structures . since h , c , n , and o are the most common elements in organics and biomolecules , their parameters were determined first within the new charge penetration formalism . a training set of 357 molecule pairs was used , consisting of 157 pairs of hydrogen - bonded complexes , 127 pairs of dispersion - dominant complexes , and 87 pairs with mixed features of both . for example , an initial set of parameters for sp or sp carbon , nonpolar hydrogen , and hydrogen attached to sp c were obtained by selecting a smaller number of pairs ( e.g. , 87 ) from the dispersion - dominant and mixed complexes . similarly , other parameters such as those for sp oxygen and polar hydrogen were obtained initially from water dimers . then , one or more sets of initial parameters for all h , c , n , and o atom types were optimized together using the entire training set . once the parameters for these four elements were finalized , further parametrization for p , s , f , cl , and br was carried out using the subsets in s1017 . in each of these subsets , an 80/20 ratio for the training and testing complexes was maintained to ensure a sufficient amount of data points for each atom type . an optimization program written in python , using the quasi - newton and nelder mead simplex methods from the scipy library , was applied to all of the parametrization work . the first derivative of the sum of unsigned errors with respect to each parameter was calculated numerically . in order to examine the convergence of the sapt2 + energy toward the basis set limit , five small molecule pairs were selected and calculated using the aug - cc - pvxz ( x = d , t , q , or 5 , abbreviated as axz in the following paragraphs ) basis sets . ethyne ( t - shaped ) , and ethyne water ( cho ) . the energy difference between different axz ( x = d , t , q , and 5 ) basis sets for the total interaction energy and each energy component , including electrostatic , induction , exchange repulsion , and dispersion energy , are compared . in general , a steady decrease in the energy gaps between adz the difference between aqz and a5z basis sets of all of the energy components as well as the total interaction energy are already well below 0.05 kcal / mol . in particular , the differences in electrostatic and induction energies are even smaller , at 0.003 and 0.005 kcal / mol , respectively . this implies that the difference between a5z and a bigger basis set , e.g. , a6z , should be even smaller and negligible . therefore , the results obtained using the a5z basis set were used to approximate the complete basis set limit . since sapt2 + calculations are computationally expensive , the practical size of the basis set has been limited to aug - cc - pvtz for most molecule pairs in the s101 database . to obtain an estimate of the sapt2 + energy at the cbs limit , extrapolation as shown in figure 2 , the electrostatic and induction energy components converge quickly to the cbs limit ( approximated by a5z results ) . the mean unsigned errors between atz and a5z of five pairs are 0.018 and 0.010 kcal / mol for the two components , respectively . therefore , for electrostatic and induction energies , the results obtained with the atz basis set are considered a reasonable approximation of the cbs limit . for exchange repulsion and dispersion energy , a two - point scheme was applied to extrapolate the energy calculated at adz and atz to the cbs limit . difference between the sapt2 + energy components calculated using aug - cc - pvxz ( x = d , t , and q ) basis set with the value obtained using aug - cc - pv5z . as mentioned in the previous section , different energy components converge at different rates with respect to the basis set size . electrostatic and induction energies calculated using the atz basis set are sufficiently converged , while the exchange repulsion and dispersion energy terms are not . thus , a two - point extrapolation scheme is used to extrapolate the exchange repulsion and dispersion energy at atz basis set to the complete basis set limit . the extrapolated dispersion energy is further scaled by a factor of 0.89 to compensate for higher order dispersion terms missing in the sapt2 + approach ( refer to methods for details of the extrapolation and scale factor determination ) . then the total sapt2 + interaction energy is obtained by summing up the individual energy components . finally , the quality of the sapt2 + interaction energy at different basis set levels was examined by comparing with the ccsd(t)/cbs interaction energy of the s66 data set ( figure 3 ) . in general , the sapt2+/cbs estimates with scaled dispersion energy ( which will be referred to as sapt2+/cbs / scaled to distinguish from the sapt2+/cbs values without scaling ) have the smallest mean unsigned error ( mue ) among tested combinations , given mue values of 0.16 , 0.68 , 0.47 , and 0.17 kcal / mol ( and rmse of 0.25 , 0.80 , 0.56 , and 0.21 kcal / mol ) for sapt2+/cbs / scaled , sapt2+/cbs , sapt2+/atz , and sapt2+/adz , respectively . it is not surprising that the sapt2+/adz combination yields very reasonable total interaction energy as this is consistent with a previous report . however , the small error in the total interaction energy of sapt2+/adz is due to the error cancellation of individual energy components . to best estimate individual energy components , sapt2+/cbs / scaled results remain the most accurate choice in this study . however , for the larger systems where aug - cc - pvtz calculations are not practical , sapt2+/adz may be considered as an alternative . for all 707 pairs in the s1017 database reported in this study , the same strategy ( sapt2+/cbs / scaled ) is applied to calculate the individual energy components . errors of sapt2 + interaction energy compared to ccsd(t)/cbs estimation for dimers in the s66 data set . sapt2+/aug - cc - pvdz energy is shown in solid circles , sapt2+/cbs is shown in triangles , and sapt2+/cbs / scaled is shown in hollow circles . the electrostatic interaction energy due to amoeba point multipoles as well as the charge penetration correction ( multipoles + cp ) are calculated and compared with sapt2 + data for the s1017 data set ( excluding 77 complexes containing an ethyne molecule due to a lack of amoeba parameters ) ( supporting information table s3 ) . in our current model , the parameters z and for each atom are uniquely determined by the element type . is set equal to z , or if z is less than 2 , then is set to 2 . the only parameter to be determined for the penetration correction is in eq 3 . for each of the h , c , n , and o elements , carbon , nitrogen , and oxygen all have three values representing sp , sp , and aromatic cases . for sulfur , distinct values are used for sulfide and sulfur iv , while p , f , cl , and br have only a single value per element in current parametrization . in general , after fitting of parameters , the new electrostatic model with charge penetration correction shows excellent agreement with the sapt2 + results ( figure 4 ) . taking the valence- parameter set as an example , for dimers near the equilibrium distances ( rmin ) , i.e. , 0.90 , 0.95 , 1.00 , 1.05 , and 1.10 of rmin , the mean unsigned error ( mue ) of the original point multipoles is 3.16 kcal / mol , which is reduced about 5-fold to 0.57 kcal / mol after inclusion of the charge penetration correction ( table 3 ) . for the dimers at very short separation , i.e. , 0.70 and 0.80 of rmin , the mues for the corrected and uncorrected electrostatic energy are 3.28 and 19.16 kcal / mol , respectively . as shown in figure 4 , it is striking that point - multipole - based electrostatic energy alone yields very large errors for dimers in close contact , and the simple charge penetration correction applied here is able to systematically improve agreement with sapt - derived electrostatics . based upon the mean unsigned errors , the charge penetration corrected model results in a percentage error of 13.6% and 13.4% at near - equilibrium and very short separations , respectively . in contrast , the uncorrected model has errors of 53% and 69% for these same two distance ranges . it is clear the charge penetration corrected model not only reduces the magnitude of absolute and relative errors compared to sapt but also provides consistent performance over a range of distances . in the uncorrected model , the percentage of error at very short distances is larger than at near - equilibrium distances , due to the increased effect of short - ranged charge penetration . plots of multipole electrostatic energy ( kcal / mol ) against the reference sapt2+/aug - cc - pvtz calculation for ( a ) near - equilibrium ( 0.90 , 0.95 , 1.00 , 1.05 , and 1.10 ) complexes taken from the s1017 data set , ( b ) expanded plot of the boxed region in a , and ( c ) short - range ( 0.70 and 0.80 ) complexes in the s1017 data set . the uncorrected amoeba point multipole energy ( multipoles only ) is shown in red circles , and the charge penetration corrected point multipole energies using the valence- parameter set ( multipoles + cp ) are denoted by blue crosses . charge penetration corrected model using the fitted- parameter set . for s66 dimers at near - equilibrium separations and using uncorrected amoeba multipoles , the hydrogen - bonded complexes exhibit the largest mean unsigned error of 4.41 kcal / mol , compared to mues of 3.08 and 2.08 kcal / mol for dispersion - dominant and mixed complexes ( table 4 ) . this is not surprising since the hydrogen - bonded complexes generally have the strongest electrostatic interactions . however , in terms of relative errors , the dispersion - dominant complexes carry the largest error at 105% , while the hydrogen - bonded and mixed complexes have the mean percentage of errors of 30% and 58% , respectively . it is somewhat surprising the dispersion - dominant complexes have such absolute and relative errors , as they are normally considered to have the weakest electrostatic interaction among the three types . charge penetration corrected model using the fitted- parameter set . to help understand why dispersion - dominant complexes have such large relative errors , the electrostatic energies of benzene dimers and stacked and t - shaped complexes , as well as hydrogen - bonded water dimers , are shown in figure 5 . for the uncorrected amoeba model , the calculated electrostatic energy is positive for the benzene pairs yet qm calculations suggest the interaction is attractive with a negative electrostatic energy . taking the electrostatic energy for this pair at the equilibrium distance as an example , the sapt2+/cbs / scaled calculation yields a value of 2.6 kcal / mol , while the uncorrected amoeba multipoles give + 1.0 kcal / mol , an error of 3.6 kcal / mol or 138% . for the t - shaped benzene dimer , the sapt2+/cbs / scaled and the uncorrected amoeba multipoles have values of 2.2 and 0.4 kcal / mol , respectively . the unsigned error is 1.8 kcal / mol or 82% of the sapt values , both somewhat less than for the complex . in contrast , although the hydrogen - bonded water dimer has the larger electrostatic energy of 7.2 kcal / mol , the uncorrected model has an unsigned error of 1.6 kcal / mol and a relative error of only 22% . this trend is in accordance with the averaged errors reported in table 4 and suggests the electrostatic interaction in dispersion - dominant complexes is the most charge penetration dependent . first , in the nonpolar molecules , the electron distribution is more balanced ; i.e. , there is more electron density on the hydrogen atoms , hence a stronger penetration effect for hydrogens . second , in the stacked benzene dimer , interactions between heavier atoms , carbon carbon for example , suffer stronger charge penetration effect , thus weight more in electrostatic energy . for hydrogen - bonded pairs , although the percentage of error is relatively low for the uncorrected atomic multipoles , the absolute error remains significant . therefore , a correction is still necessary in order to achieve better accuracy in the force field . it is notable that , after the charge penetration correction , the mean unsigned errors of all three types of complexes are reduced to 0.50.6 kcal / mol near the equilibrium distances , which is approaching the possible error of the qm calculation itself . plots of the electrostatic energy profiles of water water and benzene benzene dimer complexes . the valence- parameter set was used in calculations of the charge penetration corrected model ( multipoles + cp ) . the vertical line indicates the equilibrium distance . as mentioned in methods , an alternative way to derive the parameter is to fit the penetration - damped electrostatic potential ( eq 4 ) to the target qm values . an attempt to use this fitting strategy has been also made , and the resulting parameters have been compared . the parametrization of is restricted to a single unique value for each element type , as before . a brute force scanning of the parameter using a grid size of 0.1 was used to search for the global minimum since the parameter is less sensitive than . all 13 monomers ( excluding ethyne ) in the s66 data set were used in fitting of the for h , c , n , and o elements . then parameters were determined as before with values fixed to their potential - fitted values . the penetration parameter set obtained this way will be referred to as the fitted- set , while the parameter set with based on eq 5 will be referred as the valence- set . with the fitted- parameters , the rmse of the electrostatic potential of the 13 monomers calculated using eq 4 is greatly reduced to 0.07 kcal / mol , compared to an rmse of 0.95 kcal / mol for the valence- ( see supporting information table s2 ) . the performance of the two sets of parameters has been compared using the s101 data set . the overall performance of the two parameter sets is very similar to mean unsigned errors of 1.35 and 1.33 kcal / mol for the valence- and fitted- sets , respectively ( table 3 ) . for near - equilibrium pairs , the valence- set has a marginally better mue of 0.57 kcal / mol against 0.72 kcal / mol for the fitted- set . for short - ranged pairs , the fitted- set with a mue of 2.84 kcal / mol yet is slightly better than a mue of 3.28 kcal / mol of the valence- set . similar trends in rmses of the two sets of parameters are also observed . however , the valence- parameter set tends to have more balanced performances for hydrogen - bonded , dispersion - dominant , and mixed complexes , giving the mues of 0.50 , 0.53 , and 0.61 kcal / mol for the three groups , respectively ( table 4 ) . in contrast , the fitted- set , with a mue of 0.47 kcal / mol for the hydrogen - bonded complexes , shows subtly better agreement with sapt results yet has slightly worse performances for the aromatic compounds . the mues of the dispersion - dominant and mixed complexes are 0.69 and 0.74 kcal / mol , respectively ( electrostatic energy of individual pairs can be found in table s3 in the supporting information ) . nonetheless , the two sets of parameters all have excellent agreement with the sapt results for the whole s1017 database , while the fitted- set yields better electrostatic potential than the valence- set . the charge penetration model also exhibited good transferability during the fitting of parameters . although three atom types are used for h , c , n , and o in the current parametrization , restriction to a single for each element also results in reasonable accuracy . simply applying the arithmetic mean of the three parameters in valence- parameter set for each element ( supporting information table s1 ) increases the mue by only 0.1 to 0.65 kcal / mol for the near - equilibrium pairs in the s66 set ( table 5 ) . for pairs with shorter distances , the mue increases by 0.8 to 3.52 kcal / mol in the same set . only marginal improvements in mues were found after optimizing the parameters for each element starting from the averaged value . we believe this demonstrates the robustness and transferability of the charge penetration correction and the parametrization strategy . for the purpose of retaining flexibility , we recommend the use of three atom types for each of the h , c , n , and o elements in our final model . an additional set of parameters which has a unique for each element is also presented . the charge penetration effect is usually overlooked in molecular mechanical models and traditional force fields . our results show that dma - derived point multipoles systematically underestimate the sapt electrostatic interaction energy at typical molecular interaction distances based on the 1017 dimers studied here ( see the supporting information ) . an exponential damping function providing a simple charge charge penetration model suitable for force field incorporation has been revisited , along with a new parametrization strategy . the s1017 sapt - decomposed quantum mechanical energy database is developed as a reference for parameter training and for use in future force field comparison . the database is an extension of the s66 and s668 data set previously developed by hobza and co - workers , with additional prototype molecular complexes . the decomposed energies are calculated at the sapt2+/aug - cc - pvtz level of theory , with exchange the dispersion energy is further scaled to compensate for missing higher order terms in the sapt2 + method . the total sapt interaction energy is in excellent agreement with ccsd(t)/cbs results , which are currently considered to be the gold standard for estimation of intermolecular interactions , with a mean unsigned error of 0.16 kcal / mol for the s66 data set . thus , the sapt results should provide a reliable reference for force field development . by replacing the idealized charge charge ( coulomb ) interaction with the charge penetration corrected model ( eq 3 ) in the amoeba framework , the accuracy of calculated electrostatic energies for the s1017 database is improved by 5-fold . for the five distance pairs near the equilibrium distances ( i.e. , 0.901.10 times the equilibrium distance ) , the mean unsigned error of the charge penetration corrected and uncorrected point multipole models are 0.57 and 3.16 kcal / mol , respectively ; for the extremely close distance separations ( i.e. , 0.70 and 0.80 times the equilibrium distance ) , the mean unsigned errors of the two models are 3.28 and 19.16 kcal / mol , respectively . the improvement for the corrected model is significant and shows a consistent agreement with the quantum mechanics data at both long and short distances . the robustness and transferability of this model is also reflected in the use of very limited ( element - based ) parameters . the charge penetration correction is short - ranged and rapidly converges to the classical coulomb interaction beyond 67 . thus , it can be completely incorporated into the real space of ewald summation without any additional computational cost in reciprocal space . because simulations including penetration correction are clearly feasible , there is ongoing work dedicated to the optimization of parallel scaling the coupled penetration / smooth particle mesh ewald approach . quadrupole penetration ) are also possible and have been implemented in models such as sibfa . nonetheless , the simple empirical charge penetration model presented in this work provides us with an efficient approach to achieve accurate electrostatic energy that is systematically modeled after sapt quantum mechanical energy decomposition . the change in the electrostatic component requires re - examination of the van der waals interaction to arrive at a balanced representation of the total energy . overall we expect this improvement in the electrostatic component will alleviate the need for error compensation via other components and lead to more balanced and transferable potential energy functions in general . the comprehensive sapt database we developed in this work will also be useful for many others who are interested in understanding intermolecular forces or evaluating different empirical models .

classical molecular mechanics force fields typically model interatomic electrostatic interactions with point charges or multipole expansions , which can fail for atoms in close contact due to the lack of a description of penetration effects between their electron clouds . these short - range penetration effects can be significant and are essential for accurate modeling of intermolecular interactions . in this work we report parametrization of an empirical charge charge function previously reported ( piquemalj .- p . ; j. phys . chem . a2003 , 107 , 1035326313624 ) to correct for the missing penetration term in standard molecular mechanics force fields . for this purpose , we have developed a database ( s1017 ) of 101 unique molecular dimers , each at 7 different intermolecular distances . electrostatic , induction / polarization , repulsion , and dispersion energies , as well as the total interaction energy for each complex in the database are calculated using the sapt2 + method ( parkert . m. ; j. chem . phys.2014 , 140 , 09410624606352 ) . this empirical penetration model significantly improves agreement between point multipole and quantum mechanical electrostatic energies across the set of dimers and distances , while using only a limited set of parameters for each chemical element . given the simplicity and effectiveness of the model , we expect the electrostatic penetration correction will become a standard component of future molecular mechanics force fields .

Introduction Methods Results Conclusion

anterior cervical spine fusion and stabilization is a well established procedure for cervical myelopathy , radiculopathy , neoplasms , and cervical trauma2 ) . although injuries to the pharynx and esophagus are known complications of anterior cervical spine surgery , delayed pharyngeal or esophageal perforation is rare7,9,10 ) . here , we describe a rare but potentially life - threatening complication after anterior cervical spine fusion and plating . the authors highlight this issue by presenting this case , which had no associated morbidity , and include a review of the relevant literature . a 43-year - old man was admitted to our institute with a 3-month history of dysphagia and neck pain with swelling . he was paraplegic due to a c6 - 7 fracture and dislocation and has been operated on 8 years previously . initial surgical treatment included anterior corpectomy of c7 and anterior iliac crest graft placement using a plate and screws . hematological studies including erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) were normal . a simple lateral radiograph and a computed tomography scan showed partial anterior migration of the lower screw . a hydro - soluble contrast swallow image confirmed esophageal perforation ( fig . the loose screw was removed and esophageal perforation was found during surgery and repaired directly by a cardiovascular team(fig . the patient was fed using a nasogastric tube for 3 weeks and subsequently oral feeding was gradually resumed . further progress was favorable , and a contrast study performed at 3 weeks postoperatively showed no evidence of fistula . anterior cervical fusion and plate fixation is an effective procedure for the treatment of cervical myelopathy or radiculopathy and cervical spine trauma . plating has been reported to achieve a fusion rate of up 98% , and to result in early mobilization , reduced graft - related complications ( especially for multilevel fusion ) , and to avoid late deterioration of the cervical spine alignment obtained at surgery1,4 ) . the complication rate after anterior cervical plating is generally low and decreases with surgeon 's experience . according to zeidmann14 ) , the overall complication rate associated with anterior cervical spinal fusion is approximately 5% , and pharyngo - esophageal perforation is uncommon , but nevertheless of the utmost importance because of the possibility of graft infection leading to osteomyelitis , mediastinitis , sepsis , and death6 ) . acute injury can be caused iatrogenically during surgical approach due to inappropriate placement or dislodgement of sharp - toothed retractor blades in the esophagus . retraction is particularly dangerous when a nasogastric tube is positioned because the wall of the hypopharynx or esophagus may be " trapped " by a high - pressure claw between the retractor and the tube , causing ischemic injury and secondary perforation8 ) . delayed esophageal injuries are due to chronic compression or contact and subsequent necrosis , abscess formation , and perforation due to graft dislodgement or screw migration with or without plate failure4,7 ) . screw dislodgement often follows a benign course and is completely asymptomatic , due to the small diameters of the screws used and slow migration from the external to the internal mucosa , which permits spontaneous tissue repair of the defect caused repetitive friction between the retropharyngo - esophageal wall and the plating system(normally positioned with adhesion ) , traction - type pseudodiverticulum , and perforation are other causes of delayed injury11 ) . the complications of esophageal perforation range from asymptomatic with local infection to mediastinitis and death . the clinical course depends on the etiology , location , and timing of the perforation . asymptomatic perforation has as well been reported as incidental oral extrusion of screw even years after anterior cervical spine stabilization5 ) . patients generally present with swallowing difficulty , regional swelling , neck pain , dysphagia , weight loss , dysphonia , subcutaneous emphysema , and fever ; our patient presented with dysphagia and neck pain with regional swelling12,13 ) . conservative treatment may be preferred for small , contained defects of less than 1 cm , and consists of the elimination of oral feeding , tube feeding to restore fluid and nutritional balance , and intravenous antibiotics . some cases need surgical repair , such as , perforation closure with a primary suture or sternocleidomastoid or pectoralis major flap repair13 ) . we operated on our patient to remove the offending screw due to evident fistula confirmed by esophagography and esophagoscopy . direct repair was effective in achieving a successful perforation repair of the esophageal perforation with an early return to oral feeding . we report a rare case of delayed esophageal perforation caused by screw displacement after anterior cervical spine plating . careful periodic follow - up is necessary , and when encountered , early surgical closure following removal of the offending screw is mandatory .

although anterior approaches to the cervical spine are popular and safe , they cause some of complications . esophageal perforation after anterior spinal fusion is a rare but potentially life - threatening complication . we present a rare case of delayed esophageal perforation caused by a cervical screw placed via the anterior approach . a 43-year - old man , who had undergone surgery for complete cord injury at another orthopedic department 8 years previously , was admitted to our institute due to painful neck swelling and dysphagia . radiological studies revealed a protruding screw and esophageal perforation . the perforation was found during surgery and was successfully repaired . this case emphasizes the need for careful long - term follow - up to check for delayed esophageal perforation in patients that have undergone anterior cervical spine plating .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

acute ophthalmia neonatorum ( on ) continues to play an important role in causing severe ocular problems of newborns in countries where primary health care coverage is insufficient , as in the case of angola . unfortunately , in most clinical obstetric wards of luanda , the nation 's capital , there is no regular plan of on prophylaxis , nor is there any capacity for determining the microorganisms involved in the etiology of this entity . therefore , most of the acute conjunctivitis cases in the newborns are empirically diagnosed as on and treated without having information on the causative agent . although prenatal screening and treatment of pregnant women are very effective for the prevention of on , this approach can be difficult to implement in developing countries . in some african countries , at the time of delivery , a large percentage of expectant mothers have had little or no prenatal care . in industrialized countries , on prophylaxis was performed by silver nitrate eyedrops and currently by topical erythromycin , tetracycline ointment , and others . in other developed countries , emphasis is placed on maternal surveillance , and there is no systematic prophylaxis of on . the use of povidone - iodine ( p - i ) has been advocated for the less developed countries , but few well - designed prospective , randomized , and controlled clinical studies have been performed with this agent . even while doubts remain regarding the real efficacy of p - i for prevention of on caused by either chlamydia trachomatis ( ct ) or neisseria gonorrhoeae ( ng ) [ 4 , 5 ] , this substance is well tolerated , has a broader spectrum than other anti - infectious agents , does not induce resistance , and is more effective than some antibiotics that are more expensive for prophylaxis [ 6 , 7 ] . after the civil war in angola ( 19742002 ) , , we conducted a pilot study structured as a maternity ward prospective series and found that 12% of the newborns had signs of acute bilateral conjunctivitis . an additional problem was the inability to determine the microorganisms involved [ 911 ] because microbiological studies were not routinely performed at either maternity wards or eye centers . based upon these existing conditions , we decided to evaluate different tests that could provide necessary microbiological information to the ophthalmologists and then select the best one for implementation in a nationwide on prophylaxis program . our initial attempt was to use the simplest available diagnostic tool , standard staining of conjunctival swabs by giemsa and gram stains . however , this provided little useful information regarding the active on agent(s ) . following this , we attempted to use multiplex polymerase chain reaction ( pcr ) of maternal endocervical and neonatal conjunctival specimens for microorganism identification . the pcr assay has been previously validated with conjunctival and endocervical samples collected from this study ( manuscript accepted ) . in brief , we demonstrated that this technique could be used to identify the three major microorganisms , for example , ct , ng , and mycoplasma genitalium ( mg ) , involved in sexually transmitted infections ( stis ) . this was successful not only in endocervical samples , but also in conjunctival smears , where it never had been used . therefore , our recommendation for angola 's health authorities was to provide this kind of microbiological identification technique . the primary purpose of this work was to analyze the efficacy , limitations , and obstacles of 2.5% p - i eyedrops for the prophylaxis of on in angola . these data are intended to provide the local health authorities with enough information to develop a national prophylactic campaign against on based on the routine use of p - i eyedrops for every newborn . a secondary objective was to provide additional data on the etiological agents both in conjunctival smears from newborns and in endocervical samples from their mothers and the possible relationship of these agents with clinical risk factors . an interventional , randomized , and prospective study with a blinded , randomized control group was designed . the study was conducted at the general augusto n'gangula specialized hospital ( hgeag ) and the health center of samba ( css ) , both in luanda , angola . approval was provided by the ethical commission of the faculty of medicine of the agostinho neto university ( luanda , angola ) . after the explanation of the objectives and methodology of the investigation the study was performed in accordance with the ethical standards from the 1964 declaration of helsinki and its later amendments . the target population for this study consisted of 317 mothers and their newborns from the hgeag ( 173 ) and the css ( 144 ) , recruited from 7 december 2011 to 22 november 2012 . the inclusion criteria consisted of healthy children weighing at least 2.3 kg and a gestation period of at least 37 weeks . newborns not meeting the inclusion criteria and those with respiratory distress at birth were excluded . additionally , because of the possible deleterious effect of iodine , newborns were excluded if their mothers were diagnosed with thyroid disease according to clinical data contained in her medical record . maternal data were collected through a questionnaire that included age , race , education , parity , number of prenatal visits , pathology during pregnancy , and duration of rupture of the amniotic sac . neonates were randomly distributed into two groups , a and b , by blocked randomization with a fixed block size of 4 . newborns in group b received instillation of a drop of p - i 2.5% in the bottom of the lower sac of both eyes immediately after a basic eye examination and the collection of conjunctival smears within 3 hours of birth . custom 2.5% p - i eyedrops were prepared by a certified spanish pharmacy ( carreras , barcelona , spain ) following the standards of good manufacturing practices . ocular samples were obtained from both eyes of the newborns by vigorous swabbing across the inferior tarsal conjunctiva . all samples were taken by ophthalmologists and medical personnel previously trained in these procedures by an expert microbiologist from spain ( pm ) . samples were collected with flocked swabs in universal transport medium ( copan italia s.p.a . , brescia , italy ) , stored at 70c , and shipped to the department of microbiology and immunology at the hospital clnico universitario of valladolid , valladolid , spain . dna extraction was performed according to routine laboratory standards with the gxt dna / rna reagents in a genoxtract extractor ( hain lifescience , nehren , germany ) . a multiplex pcr assay that coamplified dna sequences of ct , ng , mg , and an internal control was performed using the bio - rad dx ct / ng / mg kit ( bio - rad , hercules , ca , usa ) , according to manufacturer 's instructions . the ophthalmologist responsible for the study ( ia ) administered the p - i eyedrops . the basic eye examination given to all newborns included pupil light responses , eyelid position and movement , appearance of the conjunctiva , corneal size and transparency , iris appearance and symmetry , lens transparency , quality and symmetry of retinal red reflex ( brckner test ) , and the size , position , and shape of the pupil . an information sheet with explanations about the signs of ophthalmia / acute conjunctivitis ( red eye and ocular secretions and/or eyelid edema ) was given to all participating mothers . they were also given instructions to return with their children for observation after discharge from the maternity ward in any case , even if their baby did not show these signs . the mobile phone number of each mother was noted ( only two mothers gave no indication of telephone contact ) . between the 5th day and 7th day postpartum , phone calls were made to the mothers to bring their infants for observation , especially if they presented ocular signs of on or any other ocular alterations . the minimum sample size was calculated taking in consideration the suspected prevalence of on detected in our previous study and with an expected reduction of on in at least 30% in the prophylaxis group ( group b ) . to detect a 8% difference between treatment groups with a significance level of 5% and power of 80% , infection rates of the different on bacteria in the endocervical samples of the mothers and in the conjunctival samples of their newborns and the presence of clinical risk factors were compared by test . the mean age of the 317 participating mothers was 25 years ( range : 1452 years ) , with the majority between 14 and 24 years . some of the mothers , 28% , had a basic level of education and 2.2% were illiterate and the remainders have good reading skill . parity varied from 0 to 9 births , with 82% of the mothers having had 3 previous deliveries . the number of prenatal consultations of the mothers ranged from 0 to 9 , with an average of 4 consultations . thirty - eight cases ( 1.2% ) did not have any prenatal consultation , and 112 cases ( 35% ) had less than four . a total of 96 mothers ( 30.4% ) referred some pathology during pregnancy , predominately urinary infection in 81 mothers ( 25.6% ) and vulvovaginitis in 13 others ( 4.1% ) . a total of 70 mothers ( 22% ) presented with premature rupture of membrane ( prom ) . thirty - one of them had more than 6 hours before delivery , and 39 had less than 6 hours . data were collected from 317 children , but a total of 72 newborns were excluded ( 22.6% ) from the study for low weight , respiratory distress , death , or transfer of the mother to a more specialized center for dystocic delivery ( table 1 ) . newborns , 123 females and 118 males , had a gestational age of 36 to 40 weeks , and an average weight of 3.260 kg . a total of 42 ( 17.1% ) had ocular pathology at the time of delivery , including 31 ( 12.6% ) with conjunctival hyperemia and 11 ( 4.4% ) with on signs , including conjunctival hyperemia plus eyelid edema and/or purulent secretion . three out of the 11 suspected on cases were born from mothers with urinary infections during pregnancy . for five of the newborns with signs of on , the amniotic sac did not rupture prematurely . for the other six due to technical difficulties in the preparation of the samples for transport to spain for pcr analysis , there was no information available regarding the presence or absence of ct , mg , and ng for 6 maternal endocervical samples and 13 newborn conjunctival smears . a total of 543 valid samples were analyzed , 232 from conjunctival smears and 311 from endocervical samples ( table 2 ) . the most common etiologic agent in newborns was ct ( n = 4 ) , followed by mg ( n = 2 ) and then ng ( n = 1 ) . pcr gave positive results in 28 mothers , with a predominance of mg ( n = 19 , 6.1% ) , followed by ct ( n = 8 , 2.1% ) and ng ( n = 2 , 0.5% ) . eleven of the 28 mothers ( 39.3% ) who were infected with ct , mg , or ng presented risk factors for mother - to - child transmission . the factors included prom at delivery time ( n = 6 , all positive for mg ) , vulvovaginitis ( n = 3 ) , urinary tract infection ( n = 1 ) , and urinary tract infection plus vaginitis ( n = 1 ) . of the cases with prom with > 6 hours of labor , one had ng and 3 had mg . the mother - to - child transmission rates were 50% for both ct and ng and 10.5% for mg ( manuscript accepted ) . chi - square analysis showed no significant correlation between cases with external signs of acute conjunctivitis and the presence of urinary or vaginal infections in the mother at the time of delivery . the newborns were randomly distributed into group a , in which the newborns received no ocular prophylactic treatment ( n = 130 ) , and group b , in which the newborns received p - i prophylaxis in both eyes ( n = 115 ) . despite the efforts made with every mother to perform a follow - up visit within 7 to 10 days after delivery , only 16 children were evaluated , nine from group a and seven from group b. ten children , 7 from group a ( controls ) and 3 from group b ( p - i treated ) , did not show any ocular pathology . two ( one from each group ) had acute bilateral conjunctivitis after the third day postpartum . one from group a had a small conjunctival hemorrhage in one eye , and another , from group b , had jaundice of both conjunctivas . the nearly complete disappearance of on in developed countries has been the result of a combination of factors , including prophylactic measures and , above all , better prenatal care [ 13 , 11 , 13 ] . however , currently in angola and other west african nations , no prophylactic measures are used , and it is routinely very difficult to identify the pathogenic agents . thus , diagnosis of on is based on clinical signs , and systematic follow - up of children after birth is almost impossible . ng and ct are currently the most common on etiologic agents , accounting for 60% of all cases in countries without neonatal prophylaxis [ 1416 ] . although gonococcal infection is less common in developed countries , it continues to be a problem in developing countries such as kenya where on has an incidence as high as 4% of live births for ng and 8% for ct can infect the fetus by ascending from the vagina to the uterus and can be present in the newborn at birth as an acute conjunctivitis ; however , other agents usually have an incubation period of 414 days before clinical signs . the aim of this study was to evaluate the efficacy of intervening at birth by providing p - i as a prophylactic agent for on . the weak response of mothers returning for a second ophthalmic examination for their newborns prevented the achievement of this goal . maternal ignorance about the implications of on and cultural factors resulted in poor cooperation of mothers in the follow - up evaluations . even after careful oral and written explanations were given to mothers about the signs and symptoms of on and the ocular and systemic risk for the affected children , and even after most of the mothers were personally contacted by mobile phone , only a very small number of children , 5.7% of the global sample , returned for a second examination . these kinds of problems have been recognized by other authors [ 6 , 7 , 14 ] . since 1990 , p - i has been considered as a potential prophylactic agent of on . several studies have established that p - i has broad spectrum of action and is effective against most agents of on , unlike other prophylactic agents previously used [ 1621 ] . p - i does not induce bacterial resistance , has low toxicity , is of very low cost , and is stable for several months after opening . even more , the transient brownish staining of the ocular surface after instillation could be useful as an indicator of its effective application . in 2002 , isenberg reported that 2.5% p - i was not irritating to the eye . overall , the studies showed that when trained personnel applied p - i after hygienic and general care of the newborn , the results are superior to the other prophylactic agents [ 16 , 19 ] . nevertheless , a number of arguments have been raised against its use as a prophylactic agent , including the possibility that it could be confused with a detergent , the lack of effect of p - i against viruses , and lack of studies proving that it is safe in newborns [ 15 , 19 ] . our study also shows for the first time the frequency of mg infection and some associated clinical findings in a cohort of angolan mothers and their newborns ( manuscript accepted ) . mg is an emerging cause of stis and has been implicated in urogenital infections of men and women worldwide . mg has a prevalence of 7.3% and 2% in high- and low - risk populations , respectively . there is also evidence that this microorganism has the potential to cause ascending infection and may play an important role in the on [ 22 , 23 ] . besides the fact that on is a potential cause of blindness , it can also result in serious systemic complications when nasopharyngeal colonization during vaginal delivery evolves to otitis , pneumonitis arthritis , sepsis , and meningitis [ 13 , 15 , 24 ] . risk factors associated with on are genitourinary infection and prom [ 10 , 13 , 15 ] . in this study , a total of 108 mothers ( 34.1% ) presented some of these risk factors . according to world health organization recommendations , prenatal care of mothers should include identification and management of infections including hiv , syphilis , and other stis . regular screening for stis is not routine in prenatal care in angola although the majority of mothers included in this study did have the prenatal appointments recommended by who . most of them had 4 or more prenatal visits , and the percentage of mothers without prenatal care was considerably lower than the one obtained by our group in the same maternity ward three years before ( 1.2% versus 14.7% ) , showing an improvement of the health system of the country . prenatal studies in mothers of similar age as in this study are very important because the age group between 15 and 25 years of age is considered to be at risk of stis . actually , genital ct ( serotype d - k ) and ng infections are especially common in this age group of african women ; therefore , their neonates are also a risk group for on and systemic complications [ 10 , 13 , 15 ] . our data show that the prevalence of ct in our population was relatively low when compared to previous studies in angola and other african populations . other studies of pregnant women have shown prevalence rates from about 6% in tanzania to 13% in cape verde . the prevalence in our study was much lower , which confirms the relatively low presence of ct in angola . ng and ct infections have common clinical features in women . both produce silent clinical infections , are transmitted efficiently to newborns , and can lead to sterility or chronic infection . both generate silent carriers , causing severe clinical consequences over time . according to historical data , around 3% of newborns with ng ophthalmia will develop complete blindness if untreated , and 20% will have some degree of corneal damage . in africa , the prevalence rate of ng among pregnant women ranges from 0.02% in gabon to 7.8% in south africa . our results showed a lower prevalence of ng , 0.5% , among mothers , confirming our previous results ( manuscript accepted ) . the results of the present study also allow us to estimate the rates of mother - to - child transmission which were 50% for ct and ng and 10.5% for mg . to our knowledge , this is the first study that estimates the rate of mg transmission in angola . in our cohort , a total of 12 newborns presented signs of acute conjunctivitis at the first ophthalmic evaluation , although laboratory tests were positive for mg only in one case . on the other hand , there were six cases that did not show signs of acute conjunctivitis at the first observation but were nevertheless positive for ct , mg , or ng . neonatal infections are of great epidemiological importance , so focused screening efforts should be made to reduce the number of infected pregnant women and thereby the rate of vertical transmission . to a similar extent as seen for other major stis in africa , our work clearly shows a mirror effect when considering matches between infected newborns and their mothers . this result also indicates the need to locally improve public information about primary health care particularly that oriented to eye care . without this knowledge , the participation of community members in studies like ours will not be effective . in summary , we determined the prevalence and incidence of ct , ng , and mg , which are all implicated in angolan cases of newborn on . we also determined that the mother - to - child transmission rates of ct and ng were 50% and 10.5% for mg , which was identified for the first time in angolan newborns . unfortunately , due to low compliance in follow - up clinical assessments , we were unable to achieve the original goal of testing the efficacy and safety of p - i systematic prophylaxis for preventing on .

purpose . to determine the efficacy of povidone - iodine ( p - i ) prophylaxis for ophthalmia neonatorum ( on ) in angola and to document maternal prevalence and mother - to - child transmission rates . methods . endocervical samples from mothers ( n = 317 ) and newborn conjunctival smears ( n = 245 ) were analysed by multiplex polymerase chain reaction ( pcr ) for chlamydia trachomatis ( ct ) , neisseria gonorrhoeae ( ng ) , and mycoplasma genitalium ( mg ) . newborns were randomized into a noninterventional group and an interventional group that received a drop of p - i 2.5% bilaterally after conjunctival smear collection . mothers were trained to identify signs of on and attend a follow - up visit . results . forty - two newborns had ocular pathology , and 11 ( 4.4% ) had clinical signs of on at the time of delivery . maternal pcr was positive for mg ( n = 19 ) , ct ( n = 8) , and ng ( n = 2 ) . six newborns were positive for ct ( n = 4 ) , mg ( n = 2 ) , and ng ( n = 1 ) . mother - to - child transmission rates were 50% for ct and ng and 10.5% for mg . only 16 newborns returned for follow - up . conclusions . lack of maternal compliance prevented successful testing of prophylactic p - i efficacy in on prevention . nevertheless , we documented the prevalence and mother - to - child transmission rates for ct , ng , and mg . these results emphasize the need to develop an effective angolan educational and prophylactic on program .

1. Introduction 2. Material and Methods 3. Results 4. Discussion

this work was supported , in whole or in part , by the one hundred person project of sun yat - sen university ( xz ) , national natural science foundation 81302262 ( xz ) , the basser research center for brca ( lz ) , the national institutes of health r01ca142776 , r01ca190415 , p50ca083638 ( lz ) , the ovarian cancer research fund ( lz and xh ) , the breast cancer alliance ( lz ) , department of defense ( lz ) , and the marsha rivkin center for ovarian cancer research ( lz ) .

long non - coding rnas ( lncrnas ) are defined as rna transcripts larger than 200 nucleotides that do not appear to have protein - coding potential . accumulating evidence indicates that lncrnas are involved in tumorigenesis . our work reveals that lncrna fal1 ( focally amplified lncrna on chromosome 1 ) is frequently and focally amplified in human cancers and mediates oncogenic functions .

Disclosure of Potential Conflicts of Interest Acknowledgments Funding

the indications for our approach were as follows : ( 1 ) isolated pcl avulsion fracture ; and ( 2 ) posterior tibial sag present at 90 of knee flexion . intra - articular lesions except pcl avulsion fracture were excluded using preoperative magnetic resonance image because of posteromedial approach and the consequential prone position . a c - arm device was used to avoid the penetration of growth plate by the anchors in pediatric or adolescent patients . patients were placed in the prone position , with the knee flexed 20 to 30. an oblique incision of < 10 cm was made between semitendinosus tendon and medial head of the gastrocnemius ( fig . the medial head of the gastrocnemius was held laterally to expose the posterior capsule of the knee joint . capsulotomy with an l - shaped incision was made longitudinally and then extended laterally to expose the fracture site ( fig . after debridement of fracture site , 2 suture based anchors ( 3.5 mm ; biomet sports medicine , warsaw , in , usa ) were inserted into the superomedial and superolateral region of the fracture site . each suture limb from the proximal row was placed through the hole at the end of the push - lock device ( 3.5 mm ; bio - pushlock , arthrex inc . , naples , fl , usa ) . pilot holes for the push - lock device were created using a punch just inferior to the distal edge of the fracture site . after the device was fully engaged in the pilot hole , the sutures were cut . the use of a knotless anchor provides a compressive force and consequently fixes the reduced avulsion fragment strongly to the fracture bed ( fig . if the patients were children , the anchors were inserted so as not to penetrate a physeal plate . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20-year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig . 2 ) . a 13-year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20-year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig . a 13-year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . currently , open reduction or arthroscopic fixation is more commonly used in treatment of displaced pcl tibial bony avulsion.3456 ) the latter has both advantages and disadvantages . since the site of attachment of the pcl to the tibia is located deep within the posterior tibial plateau , multiple arthroscopic sutures and tunnels are required , making the procedure more challenging and difficult . furthermore , some authors reported that arthroscopic fixation using suspensory device needs a sizeable drill hole that may break thinner bone fragments.9 ) open reduction can be performed with a traditional s - shaped approach , but this incision is associated with injury to adjacent neurovascular structures . in contrast , we used a less invasive posteromedial approach , which had several advantages , including exposure of the posterior capsule through the gap between the medial head of the gastrocnemius and the semitendinosus muscle . with the approach in this study , it is possible to minimize risks of damage to vessels and nerves , as well as providing satisfactory exposure of the fracture site . similar methods using posteromedial approach with suture anchors are previously reported.6 ) these studies used 2 suture anchors and fixed bony fragment by knotting with the sutures of 2 suture anchors . the most important advantage of the present suture bridge fixation technique with posteromedial incision , is its indication for use regardless of the thickness , size , and comminution of bony fragment . this technique is similar to the double - row , trans - osseous equivalent or suture bridge techniques for rotator cuff repair or internal reduction and fixation of greater tubercle fractures of the humerus . it allows for a simple reproducible anatomic reduction and compression of the fracture fragment , even though the fragment is small or comminuted . furthermore , suture anchor is relatively small , as compared to other fixation devices , such as cannulated screws , wires , sutures , and absorbable screws . the anchor also offers strong purchase , and the attached suture can resist strong tension , resulting in reliable fixation . previous study on anterior cruciate ligament avulsion fracture , reported that suture bridge construct provides superior fixation with regard to ultimate load , as compared with standard screw fixation and suture fixation in biomechanical analysis of suture bridge fixation for tibial eminence fractures.10 ) similarly , the suture bridge mattress fixation in this study may provide enough ultimate load and compressive force to the avulsed fragment and thus maximize the surface area for bony healing . furthermore , there is no risk of causing comminution . in conclusion , the results of the study indicated that the posteromedial approach , combined with suture anchors , is a suitable treatment for isolated tibial avulsion fractures of the pcl .

we presented a surgical technique including a suture bridge technique with relatively small incision for the reduction and fixation of posterior ligament avulsion fractures . a suture anchor was used to hold the avulsed fragment and a knotless anchor was used to continuously compress the bony fragment into the fracture site , thereby maintaining reduction during healing .

TECHNIQUE Postoperative Rehabilitation Case 1 Case 2 DISCUSSION

cichlid fishes have undergone spectacular radiations in different parts of the world . in particular , the species flocks of the east african great lakes are well - known examples for rapid evolution and speciation [ 15 ] . tanganyika , malawi , and victoria is inhabited by hundreds of mostly endemic cichlid species [ 6 , 7 ] . notably , most of the diversity is found in the littoral habitat , whereas reduced species richness in the deep benthal and pelagial seems to be a common phenomenon in all east african great lakes [ 710 ] . at least three factors may have contributed to this pattern : ( i ) reduced niche diversity in the pelagic and in deepwater benthic zones , ( ii ) a narrow ambient light spectrum consisting only of short - wavelength blue light and hence less promotive of diversification mechanisms contingent on color perception than the shallow clear - water habitats [ 1114 ] , and ( iii ) the absence of strong barriers to gene flow . indeed , deepwater cichlid species often have lake - wide distributions with very low , if any , population genetic structure over large geographic distances [ 10 , 15 , 16 ] ( see also the lake tanganyika clupeid limnothrissa miodon and the centropomid lates stappersii ) . on the other hand , high levels of genetic differentiation , sometimes accompanied by phenotypic divergence on small geographic scales , are characteristic for the species - rich guild of stenotopic rock - dwelling cichlid species [ 1931 ] . however , allopatric diversification in the fragmented littoral zone was not necessarily accompanied by the evolution of pre- or postzygotic isolation , so that secondary contact imposed by lake level fluctuations has often led to hybridization or introgression between previously allopatric taxa [ 3235 ] . even today , substrate breeders of the tribe lamprologini can be found in mixed - species pairs , and interspecific fertilizations occur in communally nesting , shell - breeding lamprologines . indeed , phylogenetic analyses of predominantly littoral cichlid lineages revealed that interspecific hybridization has played , and still plays , an important role in the evolution of these fish [ 32 , 34 , 3641 ] . thus , in the majority of recent molecular studies on species relationships within littoral tribes , especially when comparing mitochondrial and nuclear phylogenies , the explanation for the tree topologies involved the claim of introgression and hybridization between established lineages in addition to incomplete lineage sorting ( reviewed in ) . we hypothesize that this is not the case in tribes composed of deepwater species . lacking the geographic structure introduced by littoral habitat heterogeneity , deepwater species may still be spatially separated by distance , by segregation of breeding grounds , by variable hydrological conditions [ 16 , 43 , 44 ] , or by large - scale fragmentation of the lake basin during major droughts [ 45 , 46 ] . generally , however , the potential barriers to gene flow for deepwater species are less insurmountable than those met by stenotopic littoral cichlids . specifically in lake tanganyika , the evolution of stenotopy regarding depth , bottom type , or light intensity may have been prohibited by the seasonal upwelling of anoxic waters . we postulate that given the high potential for gene flow , diversification of lineages will either be curtailed ( as suggested by the relative species paucity ) or be attended by strong reproductive isolation right from the start . this would imply that introgression following cladogenesis occurred at much lower rates , if at all , in the deepwater species than in littoral cichlids . we test this hypothesis in the deepwater cichlid tribe bathybatini by comparing phylogenetic trees based on mitochondrial sequence data with trees obtained with nuclear multilocus aflp data , an approach which has previously revealed hybridization in littoral cichlids and other contexts [ 34 , 36 , 37 , 39 , 40 , 4854 ] . moreover , in several studies , phylogenetic inference on species relationships has benefited from the use of multilocus genetic data , and we expect that the aflp data collected in the present study will also contribute to the resolution of intergeneric relationships within the bathybatini , which are still debated due to conflicting or ambiguous molecular and morphological evidence [ 46 , 5559 ] . the tribe bathybatini ( sensu takahashi ) comprises 17 species in three genera : ( 1 ) the genus bathybates comprises six large ( 3040 cm ) , piscivorous species preying mainly on pelagic freshwater clupeids ( b. fasciatus and b. leo ) , benthic cichlids ( b. graueri , b. vittatus , and b. ferox ) , or undefined prey ( the rare , elusive b. horni ) , in addition to the small ( 20 cm ) b. minor , which is a specialized clupeid hunter . in accordance with their trophic niches , coulter distinguished three morphotypes among the bathybates species , the fast - swimming fusiform predators b. fasciatus , b. leo , and b. horni , the generalized shape of the benthic feeders b. graueri , b. vittatus , and b. ferox , and the small clupeid - mimicking b. minor , which mingles with its prey and accompanies the diurnal clupeid migrations . based on trawl net and gill net catches , b. minor were classified as pelagic , b. fasciatus and b. leo as chiefly bathypelagic and the remaining four species ( b. graueri , b. vittatus , b. ferox , and b. horni ) as chiefly benthic . except for b. minor , which was never found below 70 m , bathybates species descend to depths of 150200 m. ( 2 ) the member of the monotypic genus hemibates , h. stenosoma , is an abundant benthic species on the muddy bottom of southern lake tanganyika feeding on fish and shrimps mainly at depths between 100 and 200 m . ( 3 ) the small - bodied ( < 15 cm ) species of the genus trematocara ( formerly assigned to the genera trematocara and telotrematocara , ) comprise nine benthic and bathypelagic species feeding on a variety on invertebrate prey , fish larvae , and phytoplankton . they are found at maximum depths of 75 to 200 m . following the upward movement of zooplankton , some species release their fry in shallow areas , but overall , data on bathybatine breeding behaviour is anecdotal or lacking [ 43 , 60 ] . the species are sexually dimorphic , with males of bathybates and hemibates exhibiting species - specific patterns of dark stripes , bars and dots on a silver background and egg - spots on the anal fins , and males of the silvery trematocara with dark dorsal fin markings . all bathybatini have large eyes , which promote not only the detection of prey and predators but possibly also mate - recognition in the dark depths . in line with the latter , the monochromatic patterning of males may be viewed as adaptation to the short - wavelength dominated visual environment , in contrast to the colourful patterns of the mouthbrooding cichlids in the shallow , light - flooded littoral . a recent phylogenetic study based on three mitochondrial genes supported the monophyly of bathybates as well as of the species therein and indicated a polytomy of three equidistant lineages representing bathybates , hemibates , and trematocara . within bathybates , b. minor appeared ancestral to a radiation of the six large species , which showed a basal split of b. graueri and low statistical support for the branching order of the remaining species ( figure 1 ) . the short internal branches among the large bathybates species supported a rapid radiation at approximately 2.32.7 mya , coinciding with the rapid diversification of other lake tanganyika cichlids [ 28 , 45 , 62 ] . competition and resource partitioning as well as potential geographic isolation during an extreme low - stand of the lake were proposed as promoters of bathybates speciation . this study is based on a total of 38 specimens , representing all seven bathybates species , hemibates stenosoma as well as trematocara unimaculata and t. macrostoma ( table 1 ) . all specimens were obtained between 1999 and 2011 from local fishermen at lake tanganyika and identified to species by s. koblmller . unfortunately , it was not possible to obtain a comprehensive taxon sampling for the genus trematocara as , because of their small size and hence low market value , these fish ( except for the largest species t. unimaculatum ) are not caught by local fishermen . fin clips or white muscle tissue were preserved in ethanol and dna was isolated using a proteinase k digestion / high salt precipitation method . the ten primer combinations used for selective amplification were ecori - aca / msei - caa , ecori - aca / msei - cag , ecori - aca / msei - cac , ecori - aca / msei - cat , ecori - act / msei - cat , ecori - act / msei - caa , ecori - act / msei - cag , ecori - act / msei - cac , ecori - acc / msei - caa , and ecori - acc / msei - cac . selective amplification products were visualized using an abi 3130xl automated sequencer ( applied biosystems ) along with an internal size standard ( genescan-500 rox ; applied biosystems ) . polymorphic positions were initially identified using genemapper 3.7 software ( applied biosystems ) in a range of 50500 bp . in order to adjust misaligned bins and avoid size homoplasy , bins containing ambiguous low intensity peaks in a large proportion of the samples and entire profiles with short read - lengths or very low peak heights were deleted . these preprocessed , un - normalized peak - height data were analyzed with aflpscore 1.4a , which optimizes thresholds for locus retention and phenotype calling based on estimated error rates . phenotype calling thresholds were set as absolute or relative depending on the number of retained loci and the achieved error rates obtained with each option . 20 replicate samples were included to calculate the mismatch error rate for all unique loci . a neighbour joining ( nj ) tree based on nei and li 's distances was constructed in paup 4.0b5 . bootstrap values from 1000 pseudoreplicates were used as standard measure of confidence in the inferred tree topology . although accurate models for bayesian tree construction using aflp datasets do exist ) , the high demands for processing power make them unfeasible to use [ 67 , 68 ] . thus , bayesian phylogenetic inference ( bi ) was conducted in mrbayes 3.1.2 , employing the restriction site model with the noabsencesites coding bias correction [ 68 , 70 ] . the dirichlet prior for the state frequencies was set to ( 2.44 , 1.00 ) matching the actual 0/1 frequencies in the dataset . posterior probabilities were obtained from metropolis - coupled markov chain monte carlo simulations ( 2 independent runs ; 10 chains with 8,000,000 generations each ; chain temperature : 0.2 ; sample frequency : 1,000 ; burn - in : 4,000,000 generations ) . chain stationarity and run parameter convergence were checked in tracer 1.5 . to test for homoplasy excess introduced by hybridization , we conducted a tree - based method as outlined by seehausen by removing single species from the dataset and observing the change in bootstrap values in the nj tree ( see also [ 34 , 40 ] ) . in theory , the inclusion of a hybrid taxon in a multilocus phylogeny introduces homoplasy with clades that contain its parental taxa . hybrid taxa should be intermediate to the parental taxa since they carry a mosaic of parental characteristics . thus , decreasing the amount of homoplasy in the dataset by removing the hybrid taxon should increase the bootstrap support for the clades that include the parental taxa or their descendants , whereas removing nonhybrid taxa should have no effect on the statistical support of other nodes ( figure 2 ) . testing for consistency between mtdna- and aflp - based tree topologies employed two different strategies . in a first test we evaluated whether our aflp - nj - topology can be explained by the mtdna data of koblmller et al . . using the mitochondrial sequences , we inferred the log likelihood of the aflp - nj - topology data by constraining maximum likelihood ( ml ) tree search to a topology identical to the species tree suggested by the nj analyses of our aflp data , applying the substitution model used in this previous study ( hky+i+g ) . to test for significant differences between the unconstrained and constrained mtdna topology we performed an ml - based shimodaira - hasegawa ( sh ) test ( full optimization , 1,000 bootstrap replicates ) in paup . in a second test we evaluated by means of a bayes factors approach whether the mtdna tree can be explained by our aflp data , and whether the aflp - nj and bi trees differ significantly from each other . we performed bi searches constraining the topology to that of the mtdna - topology and the interspecific relationships implied by the aflp - nj - tree in mrbayes 3.1.2 employing the same settings as above . bayes factor comparison using the harmonic means of the likelihood throughout different runs [ 77 , 78]among the three alternative phylogenatic hypotheses was performed in tracer 1.5 . values of 2 ln bf ( two times the difference between the harmonic means of the two models ) > 10 are considered strong evidence for support of one model over another . the final aflp dataset consisted of 659 unique loci with a mismatch error rate of roughly 3% , which falls within the acceptable limit for mismatch error rates as defined by . both the nj and bi analysis yielded largely congruent and well - supported topologies with only minor differences between them ( figures 3(a ) and 3(b ) ) . whereas all species were monophyletic in the nj tree , bathybates graueri was not resolved as a monophylum in the bi tree , but as paraphylum including the well - supported clade of the other large bathybates species ( figure 3(b ) ) . despite this minor topological difference , bayes factor comparison strongly supports the bi tree over the nj tree ( 2 ln bf = 26.828 ; figure 3(c ) ) . we note , however , that the two - state model implemented in mrbayes does not fully cover the complex genetic process of aflp evolution and thus provides accurate phylogenetic inference less likely than distance methods [ 67 , 79 , 80 ] . hence , the observed differences between aflp and nj tree topologies might be attributed to this problem . both the nj and bi analyses support the monophyly of all three genera with the genus trematocara representing the most ancestral branch ( figures 3(a ) and 3(b ) ) . within the genus bathybates , the small and morphologically most distinct member of the genus , b. minor , was sister taxon to the remaining large bathybates species . branch lengths among the large bathybates species are rather short and some received rather low statistical support , indicating a period of rapid cladogenesis . nevertheless , both nj and bi analyses revealed a largely consistent phylogenetic pattern within the large bathybates species . both sh - test and bayes factor comparison revealed significant differences between mtdna and aflp phylogenies ( sh - test : ln l of 9505.385 versus 9585.142 for mtdna versus aflp - nj - topology - constraint , p < 0.001 ; bayes factors : 2 ln bf of 88.576 between mtdna and aflp - bi - topology and 61.748 between mtdna and aflp - nj - topology , figure 3(c ) ) . the homoplasy excess test provided no evidence for introgressive hybridization ( data not shown ) . in the original classification of lake tanganyika cichlid tribes by poll , bathybates and hemibates were included in a tribe bathybatini as sister group to the trematocarini ( equivalent to the genus trematocara ) , a hypothesis supported both by lepidological as well as allozyme data . in contrast , based on morphological characteristics , stiassny and takahashi proposed a sister group relationship of bathybates and trematocara . currently , all three genera , bathybates , hemibates , and trematocara , are united in the tribe bathybatini . a previous mtdna phylogenetic study remained equivocal with regard to the two competing morphological classifications and suggested that bathybates , hemibates , and trematocara diverged rapidly from their common ancestor . in the present aflp phylogeny , the length differences between the most ancestral branches favour poll 's original classification with trematocara as sister group to hemibates + bathybates [ 55 , 57 , 58 ] . consistent with the mitochondrial phylogeny , the aflp data confirm the split between bathybates minor and the larger members of the genus bathybates with b. graueri as their most basal representative and identifies a period of rapid cladogenesis at the onset of the diversification of the large bathybates species . however , mtdna and aflp phylogenies differ significantly with respect to the branching pattern among the remaining large bathybates species . introgressive hybridization ( including the possibility of complete mtdna replacement ) and ancient incomplete lineage sorting are two alternative sources of topological disagreement between nuclear and mitochondrial trees [ 40 , 41 , 8183 ] , resulting in similar phylogenetic patterns that are difficult to resolve by strict hypothesis testing . circumstantial inference can be based on the fact that lineage sorting is expected to lag behind rapid cladogenetic events , such that the rapid radiation of the large bathybates species predisposes this clade to mitonuclear phylogenetic incompatibilities without implying postcladogenetic introgression [ 72 , 73 ] . likewise , monophyly of species in both mitochondrial and nuclear trees ( excepting the paraphyly of b. graueri in bayesian aflp tree ) and negative tests for homoplasy excess in the aflp data do not indicate the presence of hybrid taxa in the genus bathybates . these findings support our hypothesis that deepwater species are less prone to introgressive hybridization and hybrid speciation than littoral species , but reservations arise on the one hand from the possibility that events of introgression were not detected in our samples and data and given the power of our analyses , and on the other hand from the small number of species in the phylogeny . principally , rates of interspecific introgression may not differ between littoral and deepwater cichlids , but will nonetheless lead to higher incidences of introgression in the species - rich groups than in a less speciose clade . if this was the case , the lack of a signal of introgression in bathybates and hemibates would be fully explained by the low diversification rate of the lineage and hence limited opportunity for interspecific hybridization , without implying the evolution of complete reproductive isolation early on during diversification . the branching order of hemibates and the basal bathybates species , which is reconstructed congruently by mtdna and aflp markers , suggests repeated transitions between benthic and bathypelagic feeding mode ( ecological data from ) . the basal h. stenosoma represents a benthic generalist feeding on shrimps and various species of fish . the next split led to the specialized pelagic clupeid hunter b. minor , which mimics its prey in size and coloration and stages surprise attacks from within the sardine shoals . then , b. graueri took a step back to the benthic habitat , specialized on cichlid prey and evolved a large body size . the chronology of the following radiation of the large bathypelagic clupeid hunters and benthic cichlid hunters remains unresolved , but involved at least one transition from benthic to bathypelagic habitat preferences . depth preferences may vary between these species , such that speciation may have involved both niche and spatial segregation . the apparent ecological differentiation among lineages may have reduced the fitness of hybrids [ 8587 ] and may have promoted the evolution of a mate recognition system , perhaps based on the species - specific melanic patterns of male hemibates and bathybates . the efficacy of monochromatic black , silvery , and white body and fin patterns in mediating assortative mating in the dark , short - wavelength dominated environment has recently been demonstrated for deepwater cichlid species of lake malawi . these sympatric and morphologically similar species differ primarily in male nuptial patterns and their reproductive isolation is corroborated by genetic differentiation estimates . however , there is increasing evidence that color pattern is not the only cue for mate recognition in cichlids fish and it is possible and likely that auditory and olfactory cues play a role in mediating assortative mating in deepwater species , too . in concert with previous mitochondrial data , the present study provides an informative phylogeny of the species in the deepwater genera hemibates and bathybates . as far as the branching pattern can be resolved the rapid radiation within bathybates mirrors a burst of speciation observed in several other cichlid tribes of lake tanganyika and reveals a congruent cladogenetic pattern across vastly different habitats , which suggests some kind of synchronization by environmental factors [ 27 , 45 , 46 , 62 ] . consistent with the hypothesis that lineages evolving in the weakly structured deepwater habitat would develop stronger reproductive isolation than the allopatric lineages of the fragmented littoral , our data provided no evidence for the presence of hybrid taxa in the deepwater dwelling genus bathybates . in further support of the hypothesis , introgressive hybridization is also not indicated by the mitochondrial and aflp phylogenies of the lake tanganyika cichlid genus xenotilapia , which includes several deepwater - dwelling species comprising the prey of the benthic bathybates and hemibates . an increased sample size to evaluate this pattern will be attained by the analyses of additional open - water and deepwater species , for example , the tribe limnochromini and the genus trematocara .

hybridization among littoral cichlid species in lake tanganyika was inferred in several molecular phylogenetic studies . the phenomenon is generally attributed to the lake level - induced shoreline and habitat changes . these allow for allopatric divergence of geographically fragmented populations alternating with locally restricted secondary contact and introgression between incompletely isolated taxa . in contrast , the deepwater habitat is characterized by weak geographic structure and a high potential for gene flow , which may explain the lower species richness of deepwater than littoral lineages . for the same reason , divergent deepwater lineages should have evolved strong intrinsic reproductive isolation already in the incipient stages of diversification , and , consequently , hybridization among established lineages should have been less frequent than in littoral lineages . we test this hypothesis in the endemic lake tanganyika deepwater cichlid tribe bathybatini by comparing phylogenetic trees of hemibates and bathybates species obtained with nuclear multilocus aflp data with a phylogeny based on mitochondrial sequences . consistent with our hypothesis , largely congruent tree topologies and negative tests for introgression provided no evidence for introgressive hybridization between the deepwater taxa . together , the nuclear and mitochondrial data established a well - supported phylogeny and suggested ecological segregation during speciation .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Summary and Conclusions

huge economic losses have been seen in livestock production causing problems in animals and humans . the use of chemotherapeutic drugs to control internal and external parasites is a widespread practice in livestock production and several broad - spectrum anthelmintics are available in the market for the control of helminthosis . currently , failure of anthelmintics and reduced efficacy due to resistance of nematodes in sheep and goats are becoming a threat in some countries and are of increasing importance in certain african countries [ 2 , 3 ] . according to waller , most of the nematodes of domestic animals have shown resistance to common anthelmintics especially in warm and humid parts of the world and this has been suspected to be due to frequent dosing and poor therapeutic strategies [ 58 ] . drug resistance was first reported in the late 1950 's [ 9 , 10 ] and early 1960 's [ 1114 ] . by the nineties , recently , lots of works have been done on this within and outside of africa [ 1522 ] . this has led to the search for a more eco - friendly anthelmintic that can tackle the resistance issue . v. amygdalina has been shown to have potentials as an anthelmintic in some animal species and humans [ 2325 ] . adediran et al . worked on v. amygdalina as an anthelmintic on goats though it was the stalk and leaves that were fed raw to the goats . a comparison to establish the efficacy of this plant relative to well known and established synthetic anthelmintics to which resistance has been reported is therefore needed . we investigated the response of anthelmintic - naive goats that have acquired helminth infections naturally to treatment with three commonly used anthelmintics and v. amygdalina in southwest nigeria . faecal egg count reduction test ( fecrt ) , the commonest nematicide evaluation means [ 26 , 27 ] , has some shortcomings primarily due to the fact that egg count does not correspond to worm burdens . the fecrt can however be standardized by randomization of animals into treatment groups for even dispersion of egg counts and drug effectiveness , accurate dosing to make sure no administered drug is lost , and proper tagging of animals in each treatment group to ensure correct sampling . our study was conducted with strict adherence to the standardisation method to ensure accuracy of our data on the drugs we evaluated . the objective of this study was to evaluate resistance in west african dwarf goats to levamisole , albendazole , and ivermectin and v. amygdalina . the goat owners were interviewed before purchase to establish the treatment history of the herd . they were allowed to stabilize by giving feed , water , and mineral lick supplement . after two weeks , the animals were divided into four treatment groups ( group a , ivermectin treatment , group b , levamisole treatment , group c , albendazole treatment , and group d , v. amygdalina treatment and group e was untreated reference group ) . the drugs ( ivermectin , levamisole , and albendazole ) were acquired from a veterinary drug store located in the study area while the plant , v. amygdalina , was collected from the environment and taken for authentication at the department of botany in the institution . the v. amygdalina leaves after identification were taken to the laboratory where the aqueous extract was prepared . two kilograms of v. amygdalina leaves was hand - washed in two litres of distilled water and passed through a 2 mm sieve and the filtrate was used within one hour . each animal in group a was given a dose of ivermectin injection of 0.2 mg / kg body weight subcutaneously individually . each animal in group b was given levamisole injection at a dose rate of 8.0 mg / kg body weight subcutaneously ; albendazole bolus was administered orally to each animal in group c at a dose rate of 10 mg / kg while the animals in group d were drenched with 5 mls per kg body weight of the plant aqueous extract . faecal samples were collected fresh from the rectum of the animals pretreatment and posttreatment in air - tight bags and taken to the laboratory for analysis . posttreatment samples were collected on days 1 , 2 , 4 , 7 , and 14 . the samples were then subjected to the faecal egg counts using the mcmaster method described by . the faecal culture , floatation , and sedimentation techniques of faecal examination faecal egg counts , helminth ova , and larvae identified were recorded . the percentage reduction in faecal egg count was calculated for each treatment group using the arithmetic mean of the egg count for each group at day 7 with the fecr version 4 software . resistance to an anthelmintic was considered to be present if the percentage reduction in egg count was less than 95% , and the lower 95% confidence limit is less than 90 . the helminth ova identified during pretreatment faecal examination were haemonchus contortus , trichostrongylus spp . , ostertagia ostertagi , oesophagostomum spp . , chabertia sp . , , ostertagia ostertagi , oesophagostomum spp . , charbetia sp . , and strongyloides were identified at larva culture . h. contortus was identified in 70% of the goats , trichostrongylus in 61% , oesophagostomum in 56% , chabertia in 15% , and strongyloides in 10% . posttreatment , h. contortus larvae were the most common followed by trichostrongylus spp . and oesophagostomum spp . the percentage reduction in faecal egg count was 96% for each of ivermectin , levamisole , and albendazole and 100% for v. amygdalina . the statistical analysis showed a lower 95% confidence limit ( cl ) of 89 for ivermectin and levamisole and 91 for albendazole ( table 1 ) . this result implies that there is low resistance in nematodes of goats to ivermectin and levamisole while there is susceptibility to albendazole and v. amygdalina . the arithmetic means of the faecal egg count for the different groups are presented in figure 1 . anthelmintic drugs such as albendazole , ivermectin , and levamisole are used to treat parasitic infection in ruminants . the regular use of these drugs and sometimes improper use make the issue of resistance inevitable . according to , it has been observed that frequent use of the same group of anthelmintic , use of anthelmintics in suboptimal doses , prophylactic mass treatment of domestic animals , and frequent and continuous use of a single drug have contributed to the widespread development of anthelmintic resistance in helminths . research reports of anthelmintic resistance in goats in africa have been relatively few although this is more likely to be as a result of low number of studies carried out in this area and not because cases of resistance were not observed . this present study showed that there is a measure of resistance to ivermectin and levamisole in nigerian wad goats while albendazole is still an effective drug . also v. amygdalina has been shown to be an alternative source of treating helminths in goats . it is recommended to keep animals on dry lot for 12 to 24 hours after deworming to ensure that eggs and larvae that survive the anthelmintics are not deposited on safe pasture . this presupposes that 24 hours after treatment there should not be viable helminth eggs ; therefore , the hatching of viable eggs seven days after treatment in our study is an indication that the worms survived . ivermectin , being the most widely used because of its effect against ectoparasites , has been grossly overused ; hence it is highly susceptible to resistance development . this is corroborated by the works of who worked in howell et al . in the united states . our results however differ from the works of who worked on ivermectin in sheep nematodes in oyo state , nigeria , but did not record any resistance . this is possibly as a result of the different assays used and the species of small ruminant involved . ademola used sheep and the larval development assay ( lda ) while goats were used in this study and the fecrt was used as the assay . although goats and sheep have similar genera of nematodes , it has been reported that nematodes in goats herd usually develop anthelmintic resistance more rapidly . also , the fecrt we used is an in vivo assay while lda is an in vitro assay which according to may be useful as a supplement to fecrt . in ethiopia , the reports [ 3439 ] that albendazole , ivermectin , and levamisole were effective in goats though resistance to albendazole was suspected are also at variance with the results in this study . difference in location , brand of drug available , and breed of goat used for experiments and level of resistance already developed by helminths are likely reasons for the disparity . levamisole in goats has been known to produce adverse reactions such as muscle tremors and hyperesthesia with irritability even at recommended doses ; subsequently the subcutaneous administration inducing a lower blood peak of the drug is often preferred in goats . based on the adverse reactions in goats , levamisole is therefore often administered with caution using the lower dose range which may at times result in suboptimal dosing when given through the subcutaneous route , resulting in the gradual development of resistance . the 100% efficacy recorded for v. amygdalina is also corroborated by an earlier report by . the implication of this is that the plant could be a good alternative to the commonly used synthetic anthelmintics . the plant is also readily available and it is found as a shrub in most rural backyard gardens in developing countries to which nigeria belongs . the study has shown that the common anthelmintics used in west african dwarf ( wad ) goats in nigeria are still effective although low level of resistance was recorded for ivermectin and levamisole . however , the presence of any degree of resistance is of concern to small ruminant production . also , we conclude that vernonia amygdalina presents a ready alternative that would likely take care of anthelmintic resistance in common goat nematodes . strategies recommended to control helminths include a better use of existing drugs , use of vaccines for helminths , growth regulators , and biological control . however , maintaining parasites in refugia and not exposing them to anthelmintics have been identified as key in controlling and delaying the development of resistance because susceptible genes are preserved . according to chiejina and behnke , the wad goats should be explored for their unique resilience and genetic improvement and looked into reducing the use of chemical anthelmintics . in line with these recommendations , better drug - use and control as well as targeted and planned treatment routines should be carried out to keep resistance low and ensure adequate control of helminth parasites in wad in southwest nigeria . use of ethnoveterinary plants like v. amygdalina as an alternative source for effective anthelmintic treatment is also highly recommended . the plant presents an environmentally friendly alternative that will essentially reduce reliance on use of chemicals .

anthelmintic drug resistance has led to the search for alternatives in controlling helminth infections . fifty west african dwarf goats without history of anthelmintic treatment were divided equally into five groups . group a was treated with ivermectin injection subcutaneously , group b with levamisole subcutaneously , group c with albendazole orally , and group d with aqueous extract of vernonia amygdalina and group e was untreated control . faecal samples were collected before treatment from each animal and larval culture was carried out . faecal egg count reduction ( fecr ) test was carried out for each group and the data analysed using fecr version 4 to calculate percent reduction in faecal egg count . predominant helminth infections from larval culture were haemonchus contortus ( 70% ) , trichostrongylus spp . ( 61% ) , and oesophagostomum spp . ( 56% ) . mixed infection was present in all the animals . from the fecr test vernonia amygdalina extract was more effective against helminths ( 100% ) , compared to ivermectin 96% , levamisole 96% , and albendazole 99% . the lower 95% confidence limit was 89 for ivermectin and levamisole and 91 for albendazole . there is low resistance to ivermectin and levamisole and susceptibility to albendazole while v. amygdalina has great potentials that could be explored for the treatment of helminth diseases in goats .

1. Introduction 2. Material and Method 3. Results 4. Discussion 5. Conclusion

maca ( lepidium meyenii walp . ) is an endemic highland crop of the central andes which is grown from central peru to bolivia and northwestern argentina [ 1 , 2 ] . this plant has great potential as an adaptogen and appears to be promising as a nutraceutical in the prevention of several diseases . maca roots have been traditionally used to increase the rate of fertility in both humans and livestock . over the past 20 years , commercial maca products have gained popularity as dietary supplements for aphrodisiac purposes and for increasing fertility and stamina . recently , maca industry develops fast in yunnan province , china . in yunnan , until the end of 2010 , maca growing and promotion areas reached 175 hm and maca yield achieved 780 t , taking up to 90% and 93% , nationwide . mineral elements in food are very important because the quality of many functional foods and medicines depends on the content and type of minerals . in the us , national surveys show that micronutrient inadequacies are widespread and mineral supplement helps fulfill micronutrient requirements in adults and children . up to now , only limited studies on selected elements in maca from different origins have been carried out [ 10 , 11 ] . moreover , in some studies , no reference material had been certified for elemental analysis , so there has been doubt about accuracy of the determination . in the present study , inductively coupled plasma optical emission spectroscopy ( icp - oes ) was used to determine the contents of eight elements ( b , co , cr , cu , li , na , ni , and zn ) in maca samples , and a comparison was made between the samples from china and peru . standard sample solutions of b , co , cr , cu , li , na , ni , and zn obtained from standard material center of china were used to make a mixed calibration curve in the range of 0400 g ml . ten maca samples were collected from four places of yunnan , china , and four samples were from peru . these samples were washed with deionized water thoroughly , dried to a constant weight , grounded into powder using an agate mortar , passed through a 60-mesh sieve , and stored in the plastic bags . 500 mg of each maca sample was weighed into an acid washed teflon digestion tube . 8 ml of hno3 , 2 ml of h2o2 , and 1 ml ultrapure water were added to the vessel . samples were digested in a microwave dissolver ( ethos one , milestone , italy ) equipped with ptfe vessels . the extract was transferred into a cuvette and made up to 25 ml with ultrapure water . simultaneous multielement detection of b , co , cr , cu , li , na , ni , and zn was performed with icp - oes ( icpe-9000 , shimazu , japan ) . the optimal instrumental conditions for icp - oes are shown in table 2 . blank experiments were prepared in the same way . to ensure the precision of the experiment , the certified reference material gbw10028 ( dried herb powder astragalus membranaceus ) was used for validation of the method ( table 4 ) . the relative standard deviation ( rsd ) was found to be below 8% , and the recoveries range from 92% to 109% , which proved that this method was accurate and precise . contents of b , co , cr , cu , li , na , ni , and zn in maca samples are shown in table 5 . boron affects fat and lipid metabolism , minerals and mineral metabolism , vitamin d , and bone development . our b values in maca from china and peru were 8.121 mg kg dw and 6.612 mg kg dw , respectively , which were in agreement with that reported in the literature ( 8.8 mg kg dw ) . cobalt is an essential micronutrient in the form of vitamin b12 , but cobalt is toxic in larger doses or long - term exposure at a low level . the adverse effects of cobalt relate to various organs and tissues and may include a possible carcinogenic potential . the contents ( mg kg dw ) of co , cr , and li were , respectively , < 0.023 , < 1.13.5 , and 0.0200.17 for the samples from china and < 0.023 , < 1.12.3 , and 0.0350.063 from peru . up to now , there was no other report on the contents of co , cr , and li in maca . its compounds show vast array of biological actions , such as anti - inflammatory , antiproliferative , and biocidal activities . cu contents in the samples from china ( 2.531 mg kg dw ) were higher than the samples from peru ( < 2.1 mg kg dw ) . published data available on cu in maca from china were 4.032 mg kg dw [ 10 , 11 , 13 , 18 ] , while those from peru were 1.562 mg kg dw [ 10 , 11 , 1922 ] . 302600 mg kg dw which is similar to the value ( 672400 mg kg dw ) in maca from china in literatures [ 11 , 13 , 18 ] . however , our data on na in the samples from peru ( < 3041 mg kg dw ) are lower than the values reported ( 110190 mg kg dw ) in the literatures [ 11 , 1922 ] . the contents of ni in the samples were 0.0854.5 mg kg dw from china and 0.681.7 mg kg dw from peru . however , higher value ( 11.3 mg kg dw ) was found in the literature on the maca from china . zinc is essential for a number of physiological functions and plays a significant role in many enzyme actions in the living systems . zn contents in samples were found to be 1939 mg kg dw from china and 2739 mg kg dw from peru , which were in accordance with the values for maca in literature available ( 2589 mg kg dw from china and 1658 mg kg dw from peru ) [ 10 , 11 , 13 , 1822 ] . cu contents in all of the maca samples from china , as well as na contents in two samples from china , were remarkably higher than those values in other samples .

contents of eight mineral elements in maca ( lepidium meyenii walp . ) from china and peru were determined by inductively coupled plasma optical emission spectroscopy . cu contents in maca samples from china ( 2.531 mg kg1 dry weight , dw ) were higher than the samples from peru ( < 2.1 mg kg1 dw ) . na in two samples from china was found to be significantly of high content ( 2400 and 2600 mg kg1 dw ) . the contents ( mg kg1 dw ) of b , co , cr , li , ni , and zn were , respectively , 8.121 , < 0.023 , < 1.1~3.5 , 0.0200.17 , 0.0854.5 , and 1039 for the samples from china , while being 6.612 , < 0.023 , < 1.1~2.3 , 0.0350.063 , 0.681.7 , and 2739 for the samples from peru .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusions

myrtle ( myrtus communis l. ) is an evergreen shrub belonging to the family of mirtaceae that grows spontaneously throughout the mediterranean area . in italy it grows along the coast and in the inner hills , and it is spread especially in the islands , where it is one of the most characteristic species . myrtus communis had history in the popular and traditional medicine : the essential oil obtained from leaves and , sometimes , flowers and berries has been used for its tonic and balsamic properties , and it is used in flavour and fragrance industries . in sardinia natural formations are still the main source for the production of a traditional liqueur , that every year reaches 3 million bottles . essential oils are gaining remarkable interest for their potential multipurpose use as antioxidant , antibacterial , and antiseptic agent [ 14 ] ; the essential oil obtained from the leaves was used in the past for the treatment of lung disorders . the isolation of essential oils from myrtus communis leaves is usually obtained by hydrodistillation method with a clevenger - type apparatus , according to the italian official pharmacopoeia . the chemical composition of the essential oils , analysed by gas / cromatography ( g / c ) , generally exhibits -pinene , 11% ; 1,8-cineole , 16% ; linalool , 12% ; -terpineol , 7% ; and limonene , 5% . the sardinian myrtle oil is characterized by the lack of myrtenyl acetate and by a higher content of limonene . . showed the biological activities of tannins , including anticancer and antioxidant . in our previous studies ( data not published ) the antimicrobial properties of myrtus essential oil against several clinical strains and in particular against helicobacter pylori were studied , and we obtained encouraging results . considering these results , in this study , we have used this essential oil towards strains of m. tuberculosis and strains of mycobacterium avium subsp . in this study we investigated the antimicrobial properties of the essential oil of myrtus communis against two reference strains : m. tuberculosis h37rv ( virulent strain ) and m. tuberculosis h37ra ( avirulent strain ) and 8 clinical isolates of m. tuberculosis resistant to one or more drugs , collected in the department of biomedical sciences , microbiology of the university of sassari , italy . we also studied the antimicrobial properties of the essential oil towards two human strains of mycobacterium avium subsp . the antibacterial activity of the oil was assessed by the proportional method used for mycobacterium tuberculosis as described in nccls - national committee for clinical laboratory standards . briefly , isolate suspensions of m. tuberculosis in 7h9 broth were adjusted to an optical density of 1 mcfarland , and two dilutions , 10 and 10 , were plated onto 7h10 agar with a different concentration of essential oil ( 16% , 14% , 12% , 10% , 8% , 4% , 2% , 1% , and 0.17% v / v ) . we also investigated the antimicrobial properties of some components of m. communis and , in particular , limonene , 1 - 8 cineole and -pinene , using the proportional method . in table 1 we report the data obtained with the essential oil in toto . towards all the strains of m. tuberculosis , including the extensively drug - resistant ( xdr ) , the oil of m. communis tested showed an mic of 0.17% ( v / v ) , whereas against the two m. paratuberculosis strains showed an mic of 2% ( v / v ) . subsequently we tested each different compound ( limonene , 1 - 8 cineole , -pinene ) to see if it had different antimicrobial properties . as far as limonene concerned , it showed towards all the strains an mic of 2% ( v / v ) ; about 1 - 8 cineole , for 4 strains , including h37rv , the mic was of 2% ( v / v ) , while the mic shown for other 4 strains was of 16% ( v / v ) ; -pinene showed an mic of 1% ( v / v ) for 3 strains , and for one strain an mic of 2% ( v / v ) , for 3 others an mic of 8% ( v / v ) , and for only one mic was of 16% ( v / v ) ( table 2 ) . limonene and -pinene are monoterpenic that , according to the literature , are used as expectorant , antalgic , revulsive , antitussive , mucolitic , and decongestant ; about 1 - 8 cineole it is an oxide used as expectorant , mucolitic , and decongestant . we compared the activity of our essential oil with four standard antitubercular drugs : streptomycin , isoniazid , rifampin , and ethambutol , performing according to international protocols . two clinical strains were rifampicin resistant , three strains were resistant to 2 drugs ( one streptomicin and rifampicin resistant , one streptomicin and isoniazid resistant , and one isoniazid and rifampicin resistant ) , one was resistant to 3 drugs ( streptomicin , isoniazid , and ethambutol ) . the essential oils screened in toto have a better antimicrobial activity than each single compound against all mycobacteria tested . the results presented here may contribute to the knowledge of the antimicrobial properties of myrtle and our aim is to carry on further studies . the chemical composition of the essential oil of m. communis exhibited qualitative differences that depended on different geographical areas and from the season in which the leaves were picked up . the essential oil that we used for antimicrobical in vitro assay contained a high quantity of monoterpenic and oxide that , according to literature , do not have antimicrobical activity . from our studies emerged that the essential oil in toto might have a good activity towards m. tuberculosis , although the individual compounds ( except -pinene ) showed in all the strains a higher mic . the results from the myrtle oil in toto showed a good activity towards m. tuberculosis but not toward m. paratuberculosis . the mic registered against m. tuberculosis was 0.17% ( v / v ) in comparison with an mic of 2% ( v / v ) observed toward m. paratuberculosis . a limit of our study is the small amount of the essential oil that did not allow to perform the mic towards all the strains used . testing and large clinical studies are necessary to verify the potential use of the essential oils of myrtle as antitubercular drug . given the excellent results that we obtained in this study , we would expand the research with further studies , to value the possible cytotoxic effects , and eventually to perform tests using in vivo mouse model .

mycobacterium tuberculosis is the etiological agent of tuberculosis . the world health organization has estimated that 8 million of people develop active tb every year and the situation is complicated by an increase of mycobacterium tuberculosis strains resistant to drugs used in antitubercular therapy : mdr and xdr - tb . myrtle leaf extracts , used as an antiseptic in sardinian traditional medicine , have strong antibacterial activity as several investigations showed . in this study we investigated the antimicrobial properties of the essential oil of myrtus communis against clinical strains of m. tuberculosis and m. paratuberculosis .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusions

additional supporting information may be found in the online version of this article at the publisher 's web site .

this report describes that a regular positive electrospray ionization mass spectrometry ( ms ) analysis of terpendoles often causes unexpected oxygen additions to form [ m + h + o]+ and [ m + h + 2o]+ , which might be a troublesome in the characterization of new natural analogues . the intensities of [ m + h + o]+ and [ m + h + 2o]+ among terpendoles were unpredictable and fluctuated largely . simple electrochemical oxidation in electrospray ionization was insufficient to explain the phenomenon . so we studied factors to form [ m + h + o]+ and [ m + h + 2o]+ using terpendole e and natural terpendoles together with some model indole alkaloids . similar oxygen addition was observed for 1,2,3,4-tetrahydrocyclopent[b]indole , which is corresponding to the substructure of terpendole e. in tandem ms experiments , a major fragment ion at m / z 130 from protonated terpendole e was assigned to the substructure containing indole . when the [ m + h + o]+ was selected as a precursor ion , the ion shifted to m / z 146 . the same 16 da shift of fragments was also observed for 1,2,3,4-tetrahydrocyclopent[b]indole , indicating that the oxygen addition of terpendole e took place at the indole portion . however , the oxygen addition was absent for some terpendoles , even whose structure resembles terpendole e. the breakdown curves characterized the tandem ms features of terpendoles . preferential dissociation into m / z 130 suggested the protonation tendency at the indole site . terpendoles that are preferentially protonated at indole tend to form oxygen addition peaks , suggesting that the protonation feature contributes to the oxygen additions in some degrees . 2014 the authors . journal of mass spectrometry published by john wiley & sons , ltd .

Supporting information

the mesenchymal tumors of the gastrointestinal ( gi ) tract have been called as various names including stromal tumor of unknown malignant potential ( stump ) , gastrointestinal stromal tumors ( gist ) , gastrointestinal autonomic nervous tumors ( gant ) and gastrointestinal pacemaker cell tumors ( gipact ) ( 1 , 2 ) . after stem cell kinase receptor cd117 ( c - kit ) was introduced , the gists presumed to derive from stem cells differentiating to the gi pacemaker cells , known as interstitial cells of cajal ( icc ) , because nearly all gists are implicated with c - kit gene abnormality and cd117 ( c - kit ) overexpression ( 1 ) . even though the new entity of gist were initially introduced from the ultrastructural observation , the number of ultrastructural studies on gists ( 3 - 5 ) have been limited , compared to the quite a few ultrastructural reports of gants ( 6 - 8 ) . gists can occur primarily in every intraabdominal site including omentum , mesentery or peritoneum in addition to gi tract . cd117 is being demonstrated increasingly in a wide variety of tumors including inflammatory myofibroblastic tumors , intraabdominal desmoids ( 9 ) , angiomyolipoma and perivascular epithelioid cell tumors ( 10 ) , and malignant peripheral nerve sheath tumor ( 11 ) , which give rise to quite confusion . we investigated the gist and gant ultrastructurally to identify the specific ultrastructure of these tumors , any clue of their histogenesis and the comparison of the gists and gants . fifteen cases of gists including 2 cases of gants were surgically resected at the ilsan paik hospital , inje university from february 2000 to may 2003 . among them , thirteen cases had been carried out the electron microscopic studies . the preservation and quality of processing of all cases were excellent or enough for evaluation . the pathologic diagnoses and grading of gists were made by 3 pathologists , based on morphology and immunohistochemistry with miettinen et al . 's grading system of gists , which recommended the grading by tumor size and mitotic rate along with the location ( 12 ) . we excluded c - kit negative pure smooth muscle tumors , schwannomas and other gastrointestinal mesenchymal tumors . age range was 24 to 76 yr old ( mean : 58.4 yr old ) . the size range was 0.3 cm to 39 cm in greatest diameter ( mean : 9.1 cm ) . eight cases were located in the stomach , 5 cases were in the small intestine , one in the mesocolon and one in the liver . the last one was late recurrent gist 10 yr after resection of primary gastric gist . after sampling for electron microscopic ( em ) study , tumor tissue was fixed in 10% neutral formalin solution . for em study the tissue fixed in 3.0% glutaraldehyde was washed in cold 0.1 m phosphate buffer ( ph 7.4 ) and postfixed in 1% osmium tetroxide , buffered with 0.1 m phosphate . sections were cut with an ultramicrotome , stained with uranyl acetate and lead citrate , and examined by em ( jeol , japan ) . for immunohistochemical study , all representative formalin ( cold 10% buffered ) fixed and paraffin - embedded tumor tissues were cut to 2 - 3 m thickness . all antigens used here including c - kit , cd34 , vimentin , smooth muscle actin ( sma ) , desmin , s100 protein , synaptophysin , cd56 and ki67 ( mib-1 ) were summarized in table 2 . after deparaffinization and rehydration , the sections were subjected to high temperature antigen unmasking in a citrate buffer in the autoclave ( 121 ) for 20 min . after blocking in 2% skimmed milk , the sections were incubated with primary antibodies with ideal dilution for 60 min at room temperature . the sections were incubated with biotinylated secondary antibody , which is polyvalent and universal ( prediluted , immunotech , marseille , france ) , and the expression was detected using the peroxidase labeled streptavidin biotin complex technique according to the manufacturer 's recommendations . normal small intestine and resident mast cells were served as the positive tissue control for all used antibodies . for antibody control , most tumors were large and ranged from 0.3 cm to 17.5 cm ( mean : 9.1 cm ) . the cut surfaces of the tumors showed pinkish gray fish flesh to granular appearance with some hemorrhage and necrosis . the tumors were mainly located in the muscular wall of the intestine with or without involvement of the mucosa and serosa . one case of the small intestinal gists showed overt multiple mesenteric metastatic nodules . among thirteen cases of gists , focal cytoplasmic vacuolization was often seen . no signet ring - like or oncocytic cells or cells with a clear cytoplasm generally mitotic counts were low but various in each case from 0/50 to 40/50 hpf . eleven cases were pure gist , 2 cases were gist with smooth muscle differentiation and 2 cases were gant . according to the miettinen et al . report ( 2002 ) , two cases were malignant having metastasis , six cases were probably malignant , three cases were low malignant potential and two cases were categorized as probably benign . all of the fifteen gists including two gants were robustly positive for vimentin ( 100% ) and cd117 ( c - kit ) ( 100% ) ( fig . 1 - 3 ) . 1 ) , strongly but focally . gants revealed strong but focally positive for s-100 protein and neurofilament ( nf ) ( fig . synaptophysin was only focally and less intensely immunoreactive in one case of gants ( fig . p53 was positive in 61.5% ( 8/13 cases ) of gists and 100% ( 2/2 cases ) of gants . in normal adults stomach and intestine , well - developed c - kit immunoreactive icc were present around the myenteric plexus and muscle layers ( fig . icc had well developed cytoplasmic organelles such as endoplasmic reticulum , mitochondria , golgi apparatus and caveolae . the polygonal cells usually had rich interdigitating cytoplasmic processes and most of them were villous ( filopodia - like ) ( fig . the nuclei were oval to irregularly elongated and generally heterochromatic , but some nuclei were exceptionally euchromatic ( fig . 5 , 6 ) . there were also abundant wavy intermediate filaments , which were generally dispersed in the cytoplasm . the cytoplasmic organelles were abundant , smooth and rough endoplasmic reticulum , mitochondria , lysosomes and golgi apparatus . there were desmosome or hemidesmosome - like junctions as well as a few gap junctions ( fig . a discrete external lamina was usually absent but incontinuous external lamina material was present in half of the gists ( fig . caveolae or pinocytotic vesicles were rarely seen . a case with focal immunohistochemical smooth muscle differentiation showed ultrastructual differentiation toward smooth muscle , such as cytoplasmic myofilaments ( fig . small round dense core neurosecretory granules were observed in gants , measuring 40 - 150 nm in diameter ( fig . 7 ) , but gists also had electron dense granules , favor lysosomes , which could be confused with neurosecretory granules . no definite synaptic junction , synaptic vesicles or microtubles most tumors were large and ranged from 0.3 cm to 17.5 cm ( mean : 9.1 cm ) . the cut surfaces of the tumors showed pinkish gray fish flesh to granular appearance with some hemorrhage and necrosis . the tumors were mainly located in the muscular wall of the intestine with or without involvement of the mucosa and serosa . focal cytoplasmic vacuolization was often seen . no signet ring - like or oncocytic cells or cells with a clear cytoplasm generally mitotic counts were low but various in each case from 0/50 to 40/50 hpf . eleven cases were pure gist , 2 cases were gist with smooth muscle differentiation and 2 cases were gant . according to the miettinen et al . report ( 2002 ) , two cases were malignant having metastasis , six cases were probably malignant , three cases were low malignant potential and two cases were categorized as probably benign . all gants were probably malignant . all of the fifteen gists including two gants were robustly positive for vimentin ( 100% ) and cd117 ( c - kit ) ( 100% ) ( fig . 1 - 3 ) . 1 ) , strongly but focally . gants revealed strong but focally positive for s-100 protein and neurofilament ( nf ) ( fig . synaptophysin was only focally and less intensely immunoreactive in one case of gants ( fig . p53 was positive in 61.5% ( 8/13 cases ) of gists and 100% ( 2/2 cases ) of gants . in normal adults stomach and intestine , well - developed c - kit immunoreactive icc were present around the myenteric plexus and muscle layers ( fig . in normal controls , the myenteric icc had heterochromatic and lobulated nuclei with slender cytoplasmic processes ( fig . icc had well developed cytoplasmic organelles such as endoplasmic reticulum , mitochondria , golgi apparatus and caveolae . the polygonal cells usually had rich interdigitating cytoplasmic processes and most of them were villous ( filopodia - like ) ( fig . the nuclei were oval to irregularly elongated and generally heterochromatic , but some nuclei were exceptionally euchromatic ( fig . 5 , 6 ) . there were also abundant wavy intermediate filaments , which were generally dispersed in the cytoplasm . the cytoplasmic organelles were abundant , smooth and rough endoplasmic reticulum , mitochondria , lysosomes and golgi apparatus . there were desmosome or hemidesmosome - like junctions as well as a few gap junctions ( fig . a discrete external lamina was usually absent but incontinuous external lamina material was present in half of the gists ( fig . immunohistochemical smooth muscle differentiation showed ultrastructual differentiation toward smooth muscle , such as cytoplasmic myofilaments ( fig . small round dense core neurosecretory granules were observed in gants , measuring 40 - 150 nm in diameter ( fig . 7 ) , but gists also had electron dense granules , favor lysosomes , which could be confused with neurosecretory granules . no definite synaptic junction , synaptic vesicles or microtubles were found in gants . in all two cases of gants , in 1983 , mazur and clark first introduced the vague term ' gastrointestinal stromal tumor ' because many mesenchymal tumors of the gastrointestinal tract did not express the known markers of the smooth muscle or schwann cell ( 13 ) . perineurial or mesenchymal nerve sheath cells of myenteric plexus were thought as a possible origin of these stromal tumors ( 13 ) . after that , owing to lots of efforts to clarify these tumors , a new entity of gists and its pathogenesis have been established . gists are most commonly occurred in the stomach ( 60 - 70% ) and the small intestine ( 20 - 30% ) . in addition , the tumors arose in the esophagus , colon , rectum , omentum and mesentery have been reported less than 10% . for predicting prognosis , ma et al . ( 14 ) graded the gists into benign ( < 5 cm in size and < 5 mitosis/50 hpf ) , malignant ( > 5 mitosis/50 hpf ) , and borderline lesions ( > 5 cm in size but < 5 mitosis/50 hpf ) regardless of site . however , several reports suggested that stromal tumors should be analysed as a site - specific fashion because tumors from different location brought out different growth patterns and prognosis . according to suggestion of miettinen et al . in the grading ( 12 ) , 2 of our gists were malignant having metastasis , 6 were probably malignant , 3 were low malignant potential and 2 were probably benign . all 2 gants were probably malignant . for making a diagnosis of gists , immunohistochemical stainings of the cd117 and ultrastructural examination are required , because morphological heterogeneity of the gists gives rise to quite confusion . except rare cases , the diagnosis of the gist should apply to the neoplasm displaying c - kit immunoreactivity ( 15 ) . the exceptions were very clearly described in the paper of christopher et al . ; including fixation artifact , technical error of immunostaining , sampling error , cessation of kit expression perhaps following sti-571 therapy and very rare cases ( 2% ) with real lack of kit mutation and/or kit expression ( 15 ) . gists can show focal differentiation to autonomic nerve or smooth muscle , but pure smooth muscle or schwann cell derived tumors , such as leiomyoma , leiomyosarcoma and schwannoma are not gists . morphological heterogeneity of gists such as extreme epithelioid or spindle shape of the tumor cells or marked myxoid or cystic changes are well known . tumors of our cases also showed variable histology , but immunohistochemically , our cases were compatible with gists or gants based on expression of vimentin ( 100% ) , cd117 ( 100% ) , and cd34 ( 66.7% ) . two cases with focal immunoreactivity for sma , were diagnosed as gists with smooth muscle differentiation . gants showed variable immunoreactivity for s-100 protein , nf , synaptophysin in addition to cd117 . besides a tumor size over 5 cm , mitotic rate still seems to be the best predictor for prognosis of gist . also mib-1 proliferation index above 4% and p53 positivity indicate a more aggressive course ( 17 , 18 ) . however , cunningham et al . found no relationship between p53 immunoreactivity and survival ( 19 ) . in our series , p53 was positive in high percentage ( 69.2% , 9/13 cases ) of gists and 100% ( 2/2 cases ) of gants , reflecting the high percentage of high - grade tumors . until now , the ultrastructural reports of gists ( 3 - 5 ) were rare than those of gants ( 6 - 8 ) . gists may originate from the pluripotent precursor cells of the icc ( 5 ) . according to the electron microscopic study on kitw - lacz/+ transgenic mice , kit - expressing cells in the outer parts of the musculature had scattered caveolae , inconspicuous basal lamina and numerous mitochondria , whereas those in the submuscular region they had more pronounced myoid features . the iccs are located in most parts of the digestive system , especially in myenteric plexus , submucosal meissner 's plexus and third plexus . iccs demonstrate species- , region- , and location - dependent variations in the ultrastructures ( 20 ) . they are communicated each other or with smooth muscle by peg and socket or gap junctions . its cytoplasm characteristically possesses cisternae of smooth endoplasmic reticulum and intermediate filaments ( 21 ) . in present study , normal iccs present in the myenteric plexus had the similar ultrastructures as the previously reported ones . in the gists , the polygonal shaped neoplastic cells usually had rich interdigitating or villous cytoplasmic processes , but spindle shaped cells rarely showed villous processes . the tumor cells were closely apposed each other in all cases but spindle cells had more interstitium , which was fibrous . in our cases , small round neurosecretory granules were definitely found in gants , measuring 40 - 150 nm in diameter . interestingly , gists also had many small electron dense granules , which were compatible with lysosomes . the prominent cytoplasmic organelles were quite a few smooth and rough endoplasmic reticulum , and some mitochondria , lysosomes and golgi apparatus . abundant intermediate filaments were dispersed in the cytoplasm and cytoplasmic processes . in 2 cases , desmosome - like or hemidesmosome - like junctions as well as one of our cases was a recurrent gist occurred in the liver 10 yr lag period after resection of gastric gist , which was previously diagnosed as leiomyosarcoma . in all 15 cases , the caveolae were rarely seen except one case , which showed smooth muscle differentiation . all of these features were comparable with ultrastructure of icc cells except reduced caveolae and gap junctions ( 20 - 22 ) . described that ultrastructural site - specific similarities and differences of the gists ( 4 ) , however , our cases showed different ultrastructures according to the cell shape , i.e. , whether it is epithelioid or spindle , irrespective of location . lee et al . described that the clinicopathologic , histologic , immunohistologic , and molecular features of gants were similar to gists , indicating that gants merely represents a phenotypic variant of gists ( 23 ) . in the ultrastructural level , although gists and gants have overlapping features , the ultrastructural characteristics of gants were dense core neurosecretory granules and skenoid fibers . neurosecretory granules and skenoid fibers are not specific for gant because the latter can be seen in smooth muscle tumors and the former are present in various neuroendocrine tumors and small cell carcinomas . however , when we differentiate gants from the gists , identification of these two features may be very helpful . in our case from exclusion diagnosis of smooth muscle or schwannian tumors on the base of absence of hallmarks of these tumors and inclusion diagnosis of gists and gants can be easily made from electron microscopic examination . the most common and important ultrastructural features of gists were rich villous cytoplasmic processes and dispersed intermediate filaments and those of gants were neurosecretory granules and skenoid fibers . ultrastructural analysis gives much benefit for identification of the lineage differentiation of neoplastic cells and differential diagnosis from other mesenchymal tumors and between gist and gant .

gastrointestinal stromal tumors ( gists ) are the most common mesenchymal tumors in the gastrointestinal tract ( git ) . although interstitial cells of cajal has been suggested as origin of this tumor , the cytological and ultrastructural features of gists are heterogeneous and unclear . a total 10 cases of normal gastrointestinal tissue ( control ) , 13 gists of the stomach ( 8) , small intestine ( 3 ) , mesocolon ( 1 ) and liver ( 1 ) , and 2 gastrointestinal autonomic nervous tumor ( gant ) of small intestine were ultrastructurally studied . normal interstitial cells of cajal ( icc ) were abundantly present around the myenteric plexuses or individually scattered through the wall of git . icc was characterized by slender cytoplasmic processes , well - developed endoplasmic reticulum ( er ) , mitochondria , golgi apparatus , caveolae and intermediate filaments . the gists and gants had overlapping ultrastructures . the most common and important ultrastructural features of gists were rich villous cytoplasmic processes , dispersed intermediate filaments and abundant ser , and those of gants were neurosecretory granules and skenoid fibers . compared with icc , the gists and gants had remarkably reduced caveolae and gap junctions . our study suggested that ultrastructural analysis gives much information to investigate lineage differentiation of neoplastic cells and make a differential diagnosis of these tumors from other mesenchymal tumors and between gists and gants .

INTRODUCTION MATERIALS AND METHODS RESULTS Gross findings Light microscopic findings Immunohistochemical findings Ultrastructural findings DISCUSSION

the asian tropopause aerosol layer is composed of sulfate , primary organics , and secondary organics the north american tropospheric aerosol layer is mostly composed of sulfate and secondary organics aerosol optical depth of asian tropopause aerosol layer increases by 0.002 from 2000 to 2010 the asian tropopause aerosol layer is composed of sulfate , primary organics , and secondary organics the north american tropospheric aerosol layer is mostly composed of sulfate and secondary organics aerosol optical depth of asian tropopause aerosol layer increases by 0.002 from 2000 to 2010 recently , a layer of enhanced aerosol scattering associated with the asian summer monsoon was observed by stratospheric aerosol and gas experiment ii ( sage ii ) [ thomason and vernier , 2013 ] and calipso [ vernier et al . , 2011a ] . the observed enhancement , referred to as the asian tropopause aerosol layer ( atal ) , occurs during june - july - august in the broad region bounded by 0160e , 1545n . calipso backscatter observations show that the atal has been present since calipso observations began in 2006 . show that the atal existed since 1999 in sageii data but was not detected prior to 1998 . the asian monsoon circulation transports asian pollution from the boundary layer to the stratosphere , where satellites observe strong enhancements of carbon monoxide , hcn , and h2o [ park et al . , 2009 ; randel et al . , however , in the first modeling study of the atal , neely et al . show that the atal may originate from emissions over a wide region , including both europe and asia . the results of neely et al . also suggest that the atal was likely present before 1998 , but observations were most likely obscured by volcanic aerosol ( i.e. , from the pinatubo eruption in 1991 ) . one caveat of the neely et al . both sage ii [ thomason and vernier , 2013 ] and calipso [ vernier et al . , 2011a ] observe a similar aerosol layer over north america , the north american tropospheric aerosol layer ( natal ) , which is weaker than the atal . the natal is associated with the north american monsoon located in the southwestern united states and mexico [ adams and comrie , 1997 ] . the sources , composition , and physical properties of the natal are likely to differ from the atal since the underlying lower tropospheric chemistry is greatly different . for example , the natal does not exhibit enhanced stratospheric co [ park et al . the transport mechanisms in the natal are also likely somewhat different than in the atal . show that both the atal and natal are regions in which water vapor enters the stratosphere in june - july - august ( jja ) ; however , the isotopic composition of the water differs . aerosol that is pumped into the stratosphere may affect climate significantly by scattering sunlight back to space and absorbing radiation locally [ stocker et al . therefore , aerosol layers in upper troposphere and lower stratosphere ( utls ) may be important if they persist or their particles are transported into the stratosphere . the properties of the atal and the natal remain unclear due to limited in situ measurements . the composition and size distribution of the particles are important properties to determine since they control the impact of the aerosol on the radiation field . this study will address the composition , source , and optical properties of the atal and natal using a sectional aerosol model . we analyze the properties of the atal and natal using a general circulation model ( community earth system model version 1 ( cesm1 ) ) coupled with a sectional aerosol microphysics model ( community aerosol and radiation model for atmospheres ( carma ) ) [ toon et al . , 1988 ; bardeen et al . , 2008 ] . cesm1/carma includes primary emitted organics , secondary organics , dust , sea salt , black carbon , and sulfate . in carma , we track two types of aerosol in two sets of radius bins . one type consists of sulfuric acid particles formed through nucleation and condensation of water and sulfur acid vapor , which primarily occurs locally . the other set of bins includes particles containing mixtures of organics , black carbon , sea salt , dust , and condensed sulfate . gas phase sulfur chemistry is modeled using the algorithms described in english et al . . carma includes formation of cloud - borne sulfate through aqueous chemistry as well as so2 formation from dimethyl sulfide as simulated by model for ozone and related chemical tracers ( mozart ) [ emmons et al . , mozart [ emmons et al . , 2010 ] tracks five species of volatile organic compounds as precursors of secondary organic aerosol ( soa ) . to better quantify the formation of soa , carma applies a volatility - basis - set approach that was introduced in pye et al . . the aerosol scavenging schemes are from rasch et al . and barth et al . the scavenging coefficient below cloud is dependent on aerosol size and precipitation rate , similar to henzing et al . . the core is composed of black carbon and dust , while the shell is composed of a combination of all other materials that are possibly in a liquid state including sulfate , organics , salt , and condensed water . this radiative information is then coupled to the dynamics of cesm1 through its radiation code . the simulations are carried out with 2 horizontal resolution and 56 vertical levels . in the region from 13 to 18 km altitude the simulations use about seven vertical levels . a 5 year spin - up run was first carried out so that the lower stratospheric aerosol layer reached a quasi - equilibrium state . then two sets of ensembles are carried out for the years 2000 and 2010 with prescribed sea surface temperature , respectively . organic emission rates , including primary particles and gases that form secondary particles , are taken from amann et al . and the global fire emission database ( gfed version 3 ) [ van der werf et al . : anthropogenic so2 emission rates come from edgar - ft2000 ( http://www.mnp.nl/edgar/ ) , with the exception that asian emission inventories are taken from the regional emission inventory for asia [ ohara et al . , 2007 ] . so2 emissions from biomass burning are estimated by gfed ( version 2 ) [ van der werf et al . , 2006 ] and biogenic emissions of volatile organic compounds ( vocs , including isoprene and monoterpenes ) are estimated by guenther et al . . model results are compared to the limited in situ aerosol measurements in the asian utls . caribic ( civil aircraft for the regular investigation of the atmosphere based on a instrument container ) provides observations of trace gases and aerosols since 1997 through intercontinental flights at 912 km altitude , which is at the lower edge of the atal [ brenninkmeijer et al . , 2007 ] . 2014 ] from 2005 to 2014 collected during 330 flights from frankfurt in germany to east asia ( guangzhou , china ) , southeast asia ( bangkok , thailand ) , and the indian subcontinent ( chennai , india ) . detailed sampling and elemental analysis methods are described in nguyen et al . and martinsson et al . . figure1 shows the simulated aerosol extinction ratio , defined as the total extinction ( i.e. , aerosol extinction plus molecular extinction ) divided by the molecular extinction , at a wavelength of 1000 nm averaged from 15 to 45 n , over the period june , july , and august 2000 . a layer of enhanced aerosol scattering , box 1 , extends from 14 km to 18 km vertically , and from 0 to 120e . the location and shape of the simulated layer of enhanced scattering is consistent with sage ii observations from thomason and vernier . however , our model simulation also predicts an aerosol enhancement mainly composed of mineral dust extending from the surface up to 13 km above africa , box 2 , which is not seen in the calipso [ vernier et al . , 2011a ] or sage ii [ thomason and vernier , 2013 ] observations . thomason and vernier used a filter for eliminating the effects of clouds on their observations , which depends on the aerosol absolute extinction and the extinction ratio at two wavelengths ( 1000 nm and 525 nm ) . when we apply the same filter , the layer over africa disappears , which suggests that the cloud filter used in thomason and vernier may mask a fraction of aerosol that has relatively big particles with high extinction coefficients . aerosol extinction ratio at 1000 nm averaged between 15 and 45n during jja seasons using emissions from 2000 . in addition to simulating the atal , our model also predicts a weaker , less extended aerosol layer near 15 km over north america centered at 100w longitude , box 3 , consistent with the location of the north american monsoon [ adams and comrie , 1997 ] . [ vernier et al . , 2011a ; thomason and vernier , 2013 ] and modeled by neely et al . . the simulated natal peak extinction ratio is only 48% of that of the simulated atal . below the natal , another aerosol enhancement region extending up to 13 km is also predicted by the model , box 4 . this lower layer is mainly composed of soa over north america where copious biogenic vocs are known to be emitted . similarly , the atal is adjacent to a lower layer extending downward and eastward centered around 120e , box 5 . both layers associated with asia are composed of materials transported from the surface . however , those in the atal are pumped up by the asian summer monsoon and confined into the anticyclone . the simulated peak value of the atal extinction ratio is about 3 times that observed by sage ii [ thomason and vernier , 2013 ] . relative humidity is high and extinction increases strongly with high humidity . in reality , however , particles may not grow due to the low temperatures in the utls . sensitivity tests with no hygroscopic growth in the upper troposphere and above shows up to 30% decrease in the extinction of the atal , which still leaves the model a factor of 2 higher than observations . it is also conceivable that sage ii - derived products preferentially exclude aerosol with high extinctions that are colocated with cloud due to filtering that attempts to remove cirrus cloud [ thomason and vernier , 2013 ] . in situ data if , in fact , particles do not grow when relative humidity increases at low temperatures , it would be important for theories of cirrus cloud formation [ koop et al . , 2000 ] . in addition , the model may overestimate the aerosol loading in the atal region possibly due to an underestimation of wet scavenging . the ratio of the extinction at 525 nm to 1020 nm in the model is centered at 33.5 , while from sage ii it is 44.5 [ thomason and vernier , 2013 ] , which is consistent with the model overestimating size , or the sage ii retrieval algorithm rejecting larger aerosols . the modeled particle effective radius is between 0.1 and 0.2 m in the atal region . unfortunately , there are no in situ data to compare the model results to in this region . show the tropical tropopause layer ( ttl ) contains sulfate and organic particles in roughly equal proportions based on two campaigns over tropical central america . in addition , while english et al . and neely et al . show that sulfates alone can not explain the extinction in the ttl observed by sage ii below about 20 km , brhl et al . show that in addition to sulfates , organics contribute to the aerosol extinction in the ttl observed by sage ii . caribic provides data on the sulfur - to - carbon mass ratio in the upper troposphere over europe and asia , as shown in figure2 . simulated values are averaged from 200 to 300 mb , pressures which are below the atal . because the caribic data ( circles ) are from samples take during individual flights over a period of time , actual meteorological conditions produce some variability . both simulations and observations show a strong decline of the sulfur - carbon ratio from higher latitudes ( e.g. , europe , 5070% sulfur - to - carbon ( s / c ) ) to lower latitudes ( e.g. , chennai , bangkok , and guangzhou , 1020% s / c ) . part of the reason for the decline in the s / c ratio as latitude decreases is that the tropopause is lower at higher latitudes so that more stratospheric sulfate is present along planes of constant pressure as shown in figure2 . in addition , more organics are emitted over india and china than over europe , which are transported upward in the asian summer monsoon . cesm1/carma simulations ( not shown in this paper ) suggest that the s / c ratio does not vary by more than 10% from 14 to 16 km in the middle to upper troposphere but increases rapidly in the lower stratosphere . sulfur - to - carbon ( s / c ) mass ratio of jja shown in the panel averaged from 200 to 300 mb using 2010 emissions . the simulation results shown in figure3 suggest the atal to be mostly composed of organics ( roughly 60% by mass ) and sulfate ( roughly 40% ) given 2010 emissions . the simulated atal and natal is mostly composed of sulfate and organics , which is consistent with froyd et al . who showed that the aerosol composition over central america is also a mixture of organics and sulfate . simulations also suggest that the effective radius of mixed particles ( mostly composed of organics at 100 mb ) is between 0.2 and 0.3 m in both atal and natal , while the effective radius of pure sulfate particles ( 33% of total sulfate mass is in pure sulfates , leaving 67% of sulfate in the mixed particles ) is below 0.1 m , indicating pure sulfates were been formed locally to the layers . ( a ) simulated organic mass ( g / m ) between 100 mb to 230 mb ; ( b ) simulated sulfate . according to the cesm1/carma results shown here , primary organic aerosol ( poa ) and secondary organic aerosol ( soa ) make comparable contributions to the atal ( figure4 ) . ( top ) poa and ( bottom ) soa mass mixing ratios ( ppb ) simulated by cesm1/carma in the atal during the jja season . in addition to the atal and natal ( see figure1 ) , this study finds other aerosol enhancement features in the upper troposphere that are not currently recognized in observations . these aerosol features extend downward and eastward from both the atal and the natal ( an additional enhancement due to dust is found over africa ) . the layer downward and eastward of the natal is also composed of soa associated with strong biogenic emission from the surface . , 2011 ; vernier et al . , 2011b ] . using a conservative method to remove ice clouds in sageii and calipso data , vernier et al . show the aerosol optical depth ( aod ) at 525 nm of the atal has increased from 0.003 in year 2000 to roughly 0.005 in year 2010 . suggest recent anthropogenic increases in so2 from asia can not explain a global stratospheric aerosol increase since 2000 , which is largely due to small volcanic eruptions . here we explore the contribution of asian emissions to the aerosol in the utls by completing two sets of simulations with ensembles of three members each . one set of ensembles uses emissions for the year 2000 and the other emissions for the year 2010 . the emissions in midlatitudes , especially anthropogenic so2 and vocs vary between 2000 and 2010 over asia , europe , and north america . figure5 shows column aod ( from 13 to 18 km ) at 532 nm averaged from 15n to 45n in jja of 2010 ( red curve ) and 2000 ( blue curve ) , respectively . error bars denote data variability ( standard deviation ) inside ensemble runs ( three members with slightly different initial conditions ) . the modeled aod of the atal is up to a factor of 2 higher than reported in vernier et al . as discussed in the context of figure1 . this test suggests that the aod was generally higher in 2010 for latitudes from 15 to 45n at all longitudes . aod changes at other longitudes including the natal ( 70w120w ) are within data variability inside ensembles . this study suggests the emission increase in asia between 2000 and 2010 has lead to an increase in the optical depth of the atal region by about 0.002 on average , which is similar to that the estimate by vernier et al . . the sulfate mass fraction in the atal is similar between 2000 and 2010 ( roughly 40% ) ; the growth in optical depth comes from increased emissions of so2 ( increasing by 13% ) , primary organics ( 7.3% ) , and anthropogenic soa ( 30% ) in the region of atal ( 1545n , 0120e ) . column aod ( from 13 to 18 km , at 532 nm ) averaged from 15 to 45n in jja . a three - dimensional climate model coupled with a sectional aerosol model ( cesm1/carma ) is used to analyze the composition and optical properties of the atal and the natal . the modeled aerosol extinction ratio peaks in the utls over asia in a layer extending from 14 to 18 km , which is consistent with sage ii observations [ thomason and vernier , 2013 ] and calipso observations [ vernier et al . , 2011a ] . the simulations reproduce the s / c ratio established by in situ measurements of the caribic observatory [ martinsson et al . , 2014 ] from 200 mb to 300 mb over europe and asia . the s / c ratio decreases from higher latitudes to lower latitudes , which possibly results in part from more organics emitted over india and china than over europe . according to the simulations , the atal is mostly composed of mixed organics and sulfates with an effective radius of 0.20.3 m , and in situ generated sulfate particles with an effective radius below 0.1 m . due to the high occurrence of cirrus clouds over india and china , aerosol measurements from satellite - based remote sensing instruments are difficult . we predict larger extinctions in the atal than observed , which could be due to satellites failing to detect the aerosol in high humidity , cloudy regions . alternatively , the hygroscopic growth of the aerosols in our model may be too great , which may be of importance to theories of cirrus cloud nucleation . or , our model may overpredict aerosol mass or size in the atal . our simulations reproduce the natal with weaker intensity compared with the atal during the jja season as observed . while the atal has a strong poa contribution , the simulated natal is mostly composed of biogenic soa . simulations also suggest recent increased anthropogenic emission of so2 as well as organic aerosols and gases in asia lead to an increase in optical depth of the atal region by 0.002 on average between 2000 and 2010 .

recent studies revealed layers of enhanced aerosol scattering in the upper troposphere and lower stratosphere over asia ( asian tropopause aerosol layer ( atal ) ) and north america ( north american tropospheric aerosol layer ( natal ) ) . we use a sectional aerosol model ( community aerosol and radiation model for atmospheres ( carma ) ) coupled with the community earth system model version 1 ( cesm1 ) to explore the composition and optical properties of these aerosol layers . the observed aerosol extinction enhancement is reproduced by cesm1/carma . both model and observations indicate a strong gradient of the sulfur - to - carbon ratio from europe to the asia on constant pressure surfaces . we found that the atal is mostly composed of sulfates , surface - emitted organics , and secondary organics ; the natal is mostly composed of sulfates and secondary organics . the model also suggests that emission increases in asia between 2000 and 2010 led to an increase of aerosol optical depth of the atal by 0.002 on average which is consistent with observations.key points the asian tropopause aerosol layer is composed of sulfate , primary organics , and secondary organics the north american tropospheric aerosol layer is mostly composed of sulfate and secondary organics aerosol optical depth of asian tropopause aerosol layer increases by 0.002 from 2000 to 2010

Key Points 1. Introduction 2. Methods 3. Results 4. Discussion 5. Summary

californium-252 is an artificial element with a half - life of 2.645 years , and it decays via either alpha emission ( 96.9% ) or spontaneous fission ( 3.1% ) . cf emits both photons and neutrons ( 2.3110 n / s/g ) of varied energy with potential for both clinical brachytherapy and neutron capture therapy ( nct ) applications . the relatively high neutron yield and long half - life , when compared to other spontaneous fissioning isotopes , clinical successes with cf sources are undoubtedly due in part to the theoretical advantages inherent in treating tumors with fast neutrons in general and with cf in particular . the effectiveness of cf might further be improved by augmenting the cf dose to tumor with an additional dose by neutron capturer loading to the tumor itself . fast neutrons emitted by the cf source scatter in tumor tissue and lose their energy by multiple scattering to eventually become thermal . increasing the probability of occurrence thermal neutron capture by neutron capturer cases dose rate enhancement in tumors loaded with these materials . materials such as b , gd and s have been proposed as agents for neutron capture . indeed , the combination of cf brachytherapy and neutron captures may improve tumor dose noticeably . following the capture by b ( bnct ) , high linear energy transfer ( let ) alpha particles and li nuclei are released . these heavy particles deposit their energy in the range of 5 - 9 mm ( tumor cell limit ) and therefore , the destructive effects of the resulted particles are limited to boron loaded cells . the method gadolinium neutron capture therapy ( gdnct ) is a recently proposed therapy modality , mainly based on the action of auger and internal conversion electrons generated by gd after neutron capture . the capture reaction in gd has the form of gd ( n , )gd and the emitted gamma rays make dose enhancement . the potential effect of enhancing nct near the surface of the target volume by addition of s has been proposed as well . the neutron capture reaction for s has the form of s(n , )si and has its most important resonance at 13.5 kev . in a study by porras , an enhancement of the neutron absorbed dose by s was observed in a high concentration of s ( between 1 and 10 mg / g ) , for a monoenergetic neutron source of 13.5 kev and for tumors at small depths . the purpose of this study is to evaluate the dose distribution in the presence of uniform distribution of neutron capturer materials and to determine the effect of these materials on dose rate enhancement in brachytherapy with cf source . therefore , careful analysis of different components of the radiation field and a detailed characterization of dose distributions in the absence and presence of neutron capturer materials must be carried out . in this study , neutron - ray flux and energy spectra , neutron and gamma dose rates and dose enhancement factor are determined in the vicinity of a cf source in water phantom with and without same concentration ( 200 ppm ) of b , gd and s using monte carlo mcnp5 code in the present study , a cf applicator tube ( at ) source available from oak ridge national laboratory ( ornl ) was modelled . the geometry of cf source is shown in figure 1 . the cylindrical active core is made of californium oxide , cf2o3 with 12 g / cm density . the length and radius of the active cylinder is 1.5 and 0.615 cm , respectively , which is located in a primary capsule of pt / ir-10 percentage mass , with inner and outer diameters of 1.35 and 1.75 mm , respectively , and inner and outer lengths of 15.50 and 17.78 mm , respectively . the secondary capsule has inner and outer diameters of 1.80 and 2.80 mm , respectively , and inner and outer lengths of 17.82 and 23.14 mm , respectively . further , the 0.635 mm diameter bodkin eyelet through the secondary capsule is also included in the source geometry of cf at source the monte carlo simulation of radiation therapy allows accurate prediction of radiation dose distribution delivered to a patient . in the present work , a complete dosimetric data set for the cf at source in water , in the absence and presence of neutron capture materials was obtained using monte carlo mcnp5 code . the source was positioned in the center of a 15 cm radius spherical phantom filled with water of 0.998 g / cm3 mass density , or capture materials - water mixture for uniform distribution of b , gd and s capture materials throughout the water phantom . the dose rate was determined in a cylindrical annulus 0.2 cm thick0.2 cm deep positioned along the transverse axis at distances ranging from 0.25 to 10 cm from the source center . assuming kerma equality with absorbed dose at different distances , f6 tally was used to calculate the particle dose of all components including thermal neutrons , epithermal neutrons , fast neutrons , induced gamma rays and source gamma rays . the neutron dose , source gamma ray and induced gamma ray doses were calculated separately . to calculate particle flux , particle fluence was calculated with f4 tally and then was multiplied by 2.3110 , since the calculations were performed assuming one microgram of cf source . the capture product dose ( absorbed dose by capture materials ) resulted from the capture of thermal neutrons by b , gd and s was calculated using the fluence - to - kerma conversion factors . the neutron dose is the sum of source fast neutron dose resulted from elastic scattering of fast neutrons in water and the capture product dose which is resulted from thermal neutron capture by b , gd and s. the neutron energy spectrum for cf source was assumed to be maxwellian spectrum with an average energy of 2.1 mev and the most probable energy of ~0.7 mev . photon spectrum of the cf source was taken from the study by fortune , and has photon energies in the range of 0.019.79 mev . the thermal neutron region was defined to be below 0.5ev , the epithermal neutron region is from 0.5ev to 10 kev and the fast neutron region is over 10 kev . the s(, ) thermal neutron scattering library ( lwtr.01 t ) was used in order to calculate the transport of low energy neutrons . in the present study , a cf applicator tube ( at ) source available from oak ridge national laboratory ( ornl ) was modelled . the geometry of cf source is shown in figure 1 . the cylindrical active core is made of californium oxide , cf2o3 with 12 g / cm density . the length and radius of the active cylinder is 1.5 and 0.615 cm , respectively , which is located in a primary capsule of pt / ir-10 percentage mass , with inner and outer diameters of 1.35 and 1.75 mm , respectively , and inner and outer lengths of 15.50 and 17.78 mm , respectively . the secondary capsule has inner and outer diameters of 1.80 and 2.80 mm , respectively , and inner and outer lengths of 17.82 and 23.14 mm , respectively . further , the 0.635 mm diameter bodkin eyelet through the secondary capsule is also included in the source geometry of cf at source the monte carlo simulation of radiation therapy allows accurate prediction of radiation dose distribution delivered to a patient . in the present work , a complete dosimetric data set for the cf at source in water , in the absence and presence of neutron capture materials was obtained using monte carlo mcnp5 code . the source was positioned in the center of a 15 cm radius spherical phantom filled with water of 0.998 g / cm3 mass density , or capture materials - water mixture for uniform distribution of b , gd and s capture materials throughout the water phantom . the dose rate was determined in a cylindrical annulus 0.2 cm thick0.2 cm deep positioned along the transverse axis at distances ranging from 0.25 to 10 cm from the source center . assuming kerma equality with absorbed dose at different distances , f6 tally was used to calculate the particle dose of all components including thermal neutrons , epithermal neutrons , fast neutrons , induced gamma rays and source gamma rays . the neutron dose , source gamma ray and induced gamma ray doses were calculated separately . to calculate particle flux , particle fluence was calculated with f4 tally and then was multiplied by 2.3110 , since the calculations were performed assuming one microgram of cf source . the capture product dose ( absorbed dose by capture materials ) resulted from the capture of thermal neutrons by b , gd and s was calculated using the fluence - to - kerma conversion factors . the neutron dose is the sum of source fast neutron dose resulted from elastic scattering of fast neutrons in water and the capture product dose which is resulted from thermal neutron capture by b , gd and s. the neutron energy spectrum for cf source was assumed to be maxwellian spectrum with an average energy of 2.1 mev and the most probable energy of ~0.7 mev . photon spectrum of the cf source was taken from the study by fortune , and has photon energies in the range of 0.019.79 mev . the thermal neutron region was defined to be below 0.5ev , the epithermal neutron region is from 0.5ev to 10 kev and the fast neutron region is over 10 kev . the s(, ) thermal neutron scattering library ( lwtr.01 t ) was used in order to calculate the transport of low energy neutrons . to validate our monte carlo simulation , the computed dose rates were compared with experimental and simulated values published in the literature . figure 2 and 3 show a comparison between our simulated neutron and total gamma ray dose rates ( total gamma ray dose is the sum of source gamma - ray dose and induced gamma ray dose ) with the experimental measurements of colvett and the simulated calculations of krishnaswamy . there is a good agreement between values with small discrepancies at distances close to the source . these discrepancies might be explained by different modelled energy spectra for neutron and gamma rays emitted from cf source in simulation studies . also , in the regions close to the source , the dose gradient is extremely steep , and experimental measurement values depend on the accuracy and sensitivity of the measurement device to rapidly changing radiations dose . simulated and experimental neutron dose rates for the water phantom comparison of total gamma - ray dose rates for the water phantom after validation , the validated computer code was applied to evaluate the effect of neutron capturers on dose rate distribution . figure 4 shows the behavior of the cf neutron energy spectra calculated at the same distance along the transverse direction of the source in water phantom in the absence and presence of capturer materials . as it is seen in this figure , in the presence of gd and b capturer materials , neutron flux has decreased in the thermal energy region while it is not seen at the epithermal and fast energy regions . the reduction of thermal neutron flux in the media containing gd and b is the direct result of thermal neutron capture process by these materials and hydrogen in water . difference in the rate of this reduction depends on the magnitude of thermal neutron capture cross - section of these materials . the no - change in the neutron energy spectrum in the presence of s may be resulted from both neutron spectrum of cf source with varied energy and low concentration of s in this study . neutron energy spectrum at 3 cm distance from the source , in water phantom with and without the presence of capture materials figure 5 and 6 show the flux of fast , epithermal and thermal neutrons at different distances from the source in water phantom with and without the presence of capture materials . obtained result shows that the effect of capture materials on the epithermal and fast neutron fluxes is impalpable . in figure 6 , the thermal neutron flux increases as afterwards , there is a dramatic decrease due to the absorption of thermal neutrons by capture materials and hydrogen . there is a neutron flux ( neutron flux is the sum of thermal , epithermal and fast neutron flaxes ) depression of about 57% in b , 80% in gd and 0.0005% in s loadings . it can be concluded that this depression emanates from the thermal neutron flux depression due to thermal neutron capture by the capture materials . epithermal and fast neutron fluxes in water phantom in the absence and presence of capture materials thermal neutron flux in water phantom in the absence and presence of capture materials figure 7 shows neutron dose rate as a function of distance in water phantom with and without the presence of capture materials . there is significant enhancement of neutron dose in the presence of gd and b. it can be concluded that the difference in the amount of this enhancement given that the neutron dose is the sum of source fast neutron ray dose and capture product dose which is resulted from difference in capture product dose rate . in other words , enhancement rate of neutron dose in the presence of capture materials depends on the type of capture products . neutron dose rate distributions in the absence and presence of capture materials at different distances from the source figure 8 provides the comparison between capture product doses in terms of distance from the source . we notice that there is a resemblance and relation between the increase of capture product dose in figure 8 and depression of thermal neutron flux in figure 6 , with increasing distance from the source . the increase rate of capture product dose resulting from depression of thermal neutron flux is maximum for gd and is minimum for s. in other words , the difference in the amount of capture product dose is a direct result of difference in magnitude of the thermalization process of neutrons by these capture materials . capture material dose rate distribution for 200-ppm concentrations at different distances from the source figure 9 shows the source and the induced gamma ray doses calculated in water phantom with and without the presence of capture materials at different distances from the source . we notice that the existence of capture materials does not alter source gamma dose rate but does reduce the induced gamma dose rate . induced gamma rays are produced by thermal neutron capture reactions of 1h(n,)2h in water . the reduction of induced gamma dose in the capture material loading is a result of hydrogen proportion reduction in capture material loaded media compared to only water medium which results in occurrence reduction of thermal neutron capture reactions of 1h(n,)2h and , consequently , to reduction of induced gamma dose rate . contrary to neutron dose , the induced gamma dose in media containing gd is lower than b because of higher ability of gd toward b in thermal neutron capture which results in fewer thermal neutrons existing to be captured by hydrogen and , induced gamma dose increases in a lower trend in media containing gd . in other words , contribution of induced gamma dose in enhancing total dose rate is further in media containing b toward gd . source and induced gamma ray dose as a function of distance figure 10 shows the total dose rate as a function of distance in water phantom in the absence and presence of capturer materials . the enhancement rate of total dose in media containing gd is more than that of b and s. the reason for it will be due to higher neutron dose and lower induced gamma dose in media containing gd compared to b and s as higher amount of gd product dose than b and s. total dose rate versus distance away from the source to determine the effect of capture materials on dose enhancement rate , dose enhancement factor ( def ) is used which is defined as the ratio of total dose in a tumor containing the capture material to total dose in the same tumor without the presence of capture material . dose enhancement factor values for different capture materials are presented in table 1 . according to data of this table , the value of def increases with increasing distance from the source and reaches its highest value equal to 3.258 and 1.476 for gd and b , respectively at the distance of roughly 8 cm from the source center , and after that decreases . in other words , the effectiveness rate of gd and b capture materials in enhancing dose rate depends on the tumor distance from the source . increase in the value of def with increasing distance from the source despite the decline in ray intensity is due to both decrease neutron average energy in the effect of attenuation , and increasing the less energetic scattered rays arrived to depth that makes increase the occurrence probability of thermal neutron capture by capture materials and subsequently dose rate enhancement . enhancement rate of total dose in the presence of s is not significant since its def is equivalent to one . dose enhancement factor at different distance from the source for b , gd , and s in this study , a detailed characterization of dose distribution in the absence and presence of b , gd and s neutron capturers has been carried out for cf brachytherapy source using monte carlo simulation . obtained result shows that tumor loading with gd and b neutron capturers in neutron brachytherapy with cf source makes significant dose enhancement due to the increase in occurrence probability of thermal neutron capture by these materials . the results also show that the magnitude of dose augmentation with this therapy design will depend not only on the capture product dose , but also on the tumor distance from the source . this dependence is resulted from both difference in the magnitude of thermalization process of neutrons by these materials and the decrease of neutron average energy due to attenuation that make increase the occurrence probability of thermal neutron capture . s is not a suitable agent for dose increase by neutron capture in brachytherapy with cf source . in other words , s makes dose enhancement under specific conditions in which these conditions depend on neutron energy spectra of source , the s concentration in tumor and tumor distance from the source .

background : in neutron interaction with matter and reduction of neutron energy due to multiple scatterings to the thermal energy range , increasing the probability of thermal neutron capture by neutron captures makes dose enhancement in the tumors loaded with these materials . objective : the purpose of this study is to evaluate dose distribution in the presence of 10b , 157gd and 33s neutron capturers and to determine the effect of these materials on dose enhancement rate for 252cf brachytherapy source . methods : neutron - ray flux and energy spectra , neutron and gamma dose rates and dose enhancement factor ( def ) are determined in the absence and presence of 10b , 157gd and 33s using monte carlo simulation . results : the difference in the thermal neutron flux rate in the presence of 10b and 157gd is significant , while the flux changes in the fast and epithermal energy ranges are insensible . the dose enhancement factor has increased with increasing distance from the source and reached its maximum amount equal to 258.3 and 476.1 cgy / h/g for 157gd and 10b , respectively at about 8 cm distance from the source center . def for 33s is equal to one . conclusion : results show that the magnitude of dose augmentation in tumors containing 10b and 157gd in brachytherapy with 252cf source will depend not only on the capture product dose level , but also on the tumor distance from the source . 33s makes dose enhancement under specific conditions that these conditions depend on the neutron energy spectra of source , the 33s concentration in tumor and tumor distance from the source .

Introduction Materials and Methods Source Geometry Monte Carlo Simulation Results and Discussion Conclusion

the transposable element ( te ) was first described by mcclintock as a controlling element that jumps from one position to another in the maize chromosome in the mid-1940s , long before the discovery by watson and crick of the double helix structure of dna as a genetic element . it was a time when , after the rediscovery of mendel 's law of heredity in 1900 , the cytogenetic study of chromosomes was at the forefront of genetics and when genes were thought to be beads on a string located on the chromosome . it was in the late 1970s and early 1980s when insertion sequence ( is ) elements and transposons ( tn ) were discovered and found to be similar to mcclintock 's controlling elements , and her ac / ds elements were confirmed at the dna sequence level as a te . salient features of dna transposable elements ( dtes ) , including terminal inverted repeats ( tirs ) , target site duplication ( tsd ) , the transposase gene , and simple and replicative transposition mechanisms have been well established by extensive molecular biology and biochemistry studies . then , retrotransposable elements ( rtes ) , including long terminal repeat ( ltr)-retrotransposons , non - ltr - retrotransposons , and other retro - elements , were being added to the repertoire since the 1980s to make the picture diverse and complicated . many new families of tes are being added , especially from eukaryotes , even by computational screening in the post - genome era , which has necessitated a new classification based on their structures and mechanisms of transposition . the presence of foldback intercoil ( fbi ) dna was first reported by kim in 1985 and shown by a space filling model to mediate intra - molecular homologous recombination of inversions and deletions . it was further shown in 1987 that fbi dna can mediate inter - molecular dna rearrangements , such as site - specific insertions , at the foldback tip and dna transpositional integration at the intercoil end of the detached dte . it will be examined in this review how fbi dna mediation of transposition can be extended to different classes and families of rtes . readers are suggested to refer to many good reviews available on the classification , structures , genetic contents , and function of the gene products and on the mechanisms of transposition with excellent diagrammatic illustrations [ 5 , 9 , 10 , 11 , 12 ] . this review will minimize duplicate descriptions and focus on the mechanistic features that are relevant to the application of fbi dna to the mechanisms of dna transposition . to build the basis for comparison and understand transposition mechanisms , it is necessary to consider te structures based on the presence or absence of the following factors : 1 ) rna intermediates before transposition , 2 ) tirs or ltrs , 3 ) transposase or reverse transcriptase ( rt ) and other proteins related to autonomous or non - autonomous transposition , 4 ) tsd , and 5 ) other features , like dna replication modes , hairpin structure , and enhancers . transposition of dtes involves direct movement of the dte intermediate either by a simple cut - and - paste mechanism , as in tn5 , tn7 , and tn10 , or by replicative transposition , in which case one copy stays in the original site and a daughter dte copy appears in a distant location [ 16 , 17 , 18 ] . step - wise description of the transposition events includes the requirement and pairing of both dte ends [ 13 , 19 ] , binding of the transposase proteins to the terminal sequences , double - strand breaks ( dsbs ) of the dte terminals and target ends , ligation of the 3'-oh donor end and the 5'-p target end , and gap repair of the single - strand gaps on the target that were generated by dsb . in the case of the mu bacteriophage , the gap can be repaired while the entire transposon gets replicated in a cointegrate mechanism [ 21 , 22 ] . transposition of rtes involves an rna intermediate that is reverse - transcribed by rt into a cdna . this double - stranded linear dna functions as the direct precursor for integration by an integrase protein into a new location in the host chromosome in a ' copy and paste ' manner , as in the ' cut - and - paste ' transposition reaction in dtes [ 20 , 23 ] . tirs are a hallmark of dtes , as ltrs have been that of rtes until they were joined by non - ltr retrotransposons , which have a 5'-untranslated region ( 5 ' utr ) and 3 ' utr , as typified by line-1 ( l1 ) , or which has neither of the terminal elements , as typified by the alu element . it becomes clear that the presence of terminal repeats in the tes is no longer a common requirement for the transposition reaction . the description of the protein factors above will suffice for this review , except for the long interspersed nuclear element ( line ) open reading frames ( orfs ) . the retrotransposition and integration of line have been viewed as a coupled process , called target - primed reverse - transcription [ 5 , 24 ] . however , this model has recently been enhanced by the finding that l1 reverse - transcription does not require base pairing between the primer and template . therefore , the cdna that was reverse - transcribed from the mrna expressed from the genomic copy of line is inserted into the host genome . tsds are generated in almost all classes and families of tes , except for the helitron dte superfamily [ 6 , 9 , 10 ] . the size of the tsd varies from 2 to 11 , but the sequences are not conserved . the ubiquitous presence of tsds , which are generated by gap fillings ( gfs ) after te integration on the target , reflects the unity in transposition reactions , regardless of dte or rte , and the presence or absence of terminal repeats . yet , the meaning of the small oligomer size of the duplicated target is seldom discussed in terms of dna structure . helitron , a eukaryotic dte , is considered , together with polintons , a third class of tes for many unique aspects . they contain 16 - 20-bp hairpins 10 - 12 nucleotides inside of the 3'-end and transpose precisely between the 5'-a and t-3 ' with no tsd generation . helitrons indiscriminately capture and mobilize gene sequences and may impact hybrid vigor or heterosis in maize . since the hairpin sequence corresponds to the fbi dna motif , it will be interesting to consider whether it can not only serve as a terminator or rolling circle replication but also serve as a replication origin for its own replication and for frequent gene capture activities , which the helitron is capable of . polinton is 15 - 20 kb long , with a 6-bp tsd and 100 - 1,000-bp tir at both ends . polintons code up to 10 proteins , including a family of b dna polymerases ( polbs ) , a retroviral - like integrase , an a transposase , and an adenoviral - like cysteine protease . polintons , however , with their structural characteristics and presence of tsd , should follow non - homologous end - joining ( nhej ) with the gf transposition mechanism , as ordinary dtes . what makes it unique is the presence of a self - encoded polb and a short 1 - 3-bp terminal tandem repeat that supports a protein - primed self - synthesis mechanism for polinton propagation . this mechanism calls for an extrachromosomal single - stranded polinton intermediate that forms a racketlike structure and follows polb - mediated replication to become double - stranded before being integrated into the host genome . it has been proposed that eukaryotic dtes follow three types of transposition mechanisms according to different replication modes : cut - and - paste for most dtes , rolling circle replication for helitrons , and synthetic replication for polintons . in fact , there seems to be many different cases of transposon - related replication that need to be clarified in the future . as mentioned earlier , continuation of dna replication of an inserted te molecule , like in mu co - integration , may also fill the gap to generate tsds . it should be emphasized that dna transposition has been grouped in two : simple , conservative , or ' cut - and - paste ' mechanism and replicative transposition [ 16 , 17 , 29 ] . in tn5 , at the outer ends , ori - c - like 9-bp sequences are found , which may serve to direct host replication functions to the ends of the element during transposition . a synthetic mechanism is proposed for polinton propagation to explain protein - primed replication of a racket - like structure of a single - stranded polinton . if it gets to be understood that the heteroduplex structure that is derived from fbi dna may serve as the template of dna replication , many of the diverse cases of dna replication may be clarified ( see below ) . fbi dna is formed by the folding back at one point of a non - helical parallel track of double - stranded dna at as sharp as 180 and the intertwining of the bent helixes within each other 's major groove to form an intercoil with a diameter of 2.2 nm ( fig . fbi dna could be considered a double - stranded version of a hairpin or stem - and - loop structure of rna and single - stranded dna . but , such sharp bending and formation of a four - stranded intercoil are not considered possible with a double helical b - dna with a diameter of 2.0 nm . in an extended definition , fbi dna may contain a loop and a much longer stem under biological conditions . intercoil dna is designated to distinguish itself from supercoil dna , which is thicker than 2.2 nm . intercoil dna is also termed to avoid the use of four - stranded dna , which has the connotation of four - stranded base pairing among homologous repeats . it needs to be emphasized that intercoil dna is formed by two intertwining duplexes of any sequence , but when homology is met at a certain region , homologous recombination may proceed via heteroduplex formation with the help of the proper enzymes involved . fbi dna was first formulated based upon a rare but unique electron microscopy ( em ) configuration of plant mitochondrial dna ( mtdna ) molecules and space - filling models [ 7 , 8 ] . once the fbi dna structure was realized with the space filling model , it was possible to perform homologous recombination with direct contact of the repeat sequences . the intra - molecular homologous recombination of a deletion and inversion occurs via 1 ) synapsis of the repeats in the intercoil , 2 ) heteroduplex formation by 90 base flipping , and 3 ) nick - and - close resolution of the sugar phosphate backbone crossing over . inter - molecular homologous recombination , known as site - specific insertion , on the other hand , is mediated by direct contact between the attp site at the tip of the fbi dna and the attb site on the target dna . perpendicular approach of the foldback tip onto the target site effectively resolves the year - long topological puzzle encountered in four - stranded base pair winding of two circular dna molecules and explains that 6- or 7-bp attp and attb sites correspond to the diameter of the approaching fbi dna tip and the target width . dna transposition is explainable by the perpendicular approach of the detached transposon ends in intercoil form to the host target , as described in detail below . transposition of a dte molecule in fbi dna configuration is tested by a space filling model , as presented in fig . 1 and as a detailed diagram in fig . 2 . the te molecule , detached from the host by a dsb in a blunt end cut , approaches , as shown in the diagram , at a perpendicular angle to the target site . both 3'-oh ends of the te ligate with the 5'-p ends of the staggered - cut target , leaving the overhang target ends single - stranded , which would be repaired by gap filling . as shown in the diagram ( fig . 2 ) , when the te ends approach the target on the minor groove side , the target size would be 5 bp on the minor groove side and 7 bp on the major groove side . this explains the meaning of the average size of the 5 - 7-bp target duplication , as it matches the diameter of the incoming intercoil dna , 2.2 nm . in reality , the target sizes vary between 2 to even over 10 bp in a te superfamily - specific manner . this tsd size variation could be explained by several factors - namely , local squeeze and stretch of the dna double helix ; unequal cutting positions of the te ends , as exemplified in tn7 by the 3-nt overhang by staggered dsb ; the characteristics of the endonucleases involved ; and even temporary loosening of the intercoil end during a very elaborate and concerted coordination of the transpososome structure . in earlier days , when is and tn , and even the ltr retrotransposons , were the major players of transposition , it was the presence of terminal repeats that attracted attention for explaining the transpositional mechanism , as in homologous recombination . therefore , it was somewhat puzzling to explain the cases of non - ltr retrotransposons with asymmetric termini sequences . but , it is now tsd that attracts attention as a common factor for the transposition mechanism of all tes , except for helitrons . it is the structural nature of the intercoil , which is formed by intertwining duplexes , regardless of the homology between the two termini . when both ends of a te synapse in the form of an intercoil , are cut by a dsb off the host duplex strand , and approach the target in perpendicular direction , their 3'-oh ends ligate to the staggered 5'-p ends of the broken target . the resulting overhang single - strand dna gaps on both flanking ends of the target are repaired to generate the accompanying tsd . the significance of the terminal repeats is then the homologous recombination that is required for further transactions of recombination , replication , and transcription . the enhancer is a cis element of dna that affects , as a third factor , dna transactions , such as transcription , homologous recombination , and transposition [ 31 , 32 , 33 , 34 ] . it has remained somewhat of an enigma , because the presence of an enhancer element and its binding proteins at a distance in a sequence and orientation non - specific manner enhances the efficiency of the reaction by 1,000 times . rather unique configurations of rigid rod - like dna with a big protein complex at one end [ 35 , 36 fig . 4 - 2 ] may shed light on the enhancer concept and give us an idea of what actually happens under cellular conditions ( fig . 3 ) . folding back of a dna duplex at a distant point would bring an enhancer site into juxtaposition with the base of a te , which has also branched out as fbi dna ( figs . 4 and 5 ) . proteins binding to the enhancer site and to both ends of the te and any other additional factors together would form a tight dna - protein complex , called a transpososome . this transpososome would provide a tight and stable surgical platform for a series of highly concerted precision cut - and- paste reactions : namely , dsb of the te termini , sealing of the host duplexes by nhej , staggered cuts on the target site , nhej of the te 3'-oh ends and target 5'-p ends , and finally , gap - filling of the 5 - 7-nucleotide single - strand portions to flank the transposed te . in replicative transposition ( fig . first , the gap - filling reaction during tsd may continue on to the te molecule by displacement or polarized replication , even though the direction of replication may be reversible . second , as shown in the diagram , tirs in the fbi dna configuration may transform into heteroduplexes and serve as primers for bidirectional replication of the internal te , thus keeping one copy at the original site and depositing the other copy to the target site in juxtaposition . inversion of the replicated te may result from homologous recombination , as predicted [ 7 , 16 ] . tsd serves as a common landmark of unity on transposition mechanisms for both dtes and rtes . the only exception so far is the helitron superfamily , which lacks tsd and employs a rolling circle replication model . as long as a tsd is generated during te integration into the host chromosome , it indicates that the immediate intermediate of integration is in a double - stranded dna form , regardless of rna or single - stranded dna being the initial intermediate . from the em pictures of fbi and rigid rod configurations of native dna ( fig . it becomes apparent that vertical insertion of the dsb ends of the te in an intercoil alignment is probably the best - fitting mechanism of dna transposition . small sizes of the target , around 6 - 7 bp , encountered in tsd as well as in attp and attb in site - specific insertion all point to the fact that they correspond to the diameter of fbi dna 2.2 nm . the transpososome , made of fbi dna configurations of the te and the enhancer element , may effectively abolish lingering mechanistic puzzles about keeping four broken strands of the te and the host from flying apart and answer how a te molecule jumps onto a new target site at a distance . replicative transposition is explained likewise , even utilizing the terminal homology as a possible origin of replication . it would be , however , difficult , if not impossible , to reproduce such a transpososome complex in vitro by fbi dna configuration , which is critically needed for em observations and crystallography analysis . there are four main modes of transactions by which the fbi dna motif may be utilized in dna functions in the cell : alpha deletion , omega inversion , needle point site - specific insertion , and nhej - gf integration of te . with such an abundant presence in strategically important positions in the genome and very dynamic functional roles , it is hoped that fbi dna receives the proper recognition and interpretation for a better understanding of the life process .

foldback intercoil ( fbi ) dna is formed by the folding back at one point of a non - helical parallel track of double - stranded dna at as sharp as 180 and the intertwining of two double helixes within each other 's major groove to form an intercoil with a diameter of 2.2 nm . fbi dna has been suggested to mediate intra - molecular homologous recombination of a deletion and inversion . inter - molecular homologous recombination , known as site - specific insertion , on the other hand , is mediated by the direct perpendicular approach of the fbi dna tip , as the attp site , onto the target dna , as the attb site . transposition of dna transposons involves the pairing of terminal inverted repeats and 5 - 7-bp tandem target duplication . fbi dna configuration effectively explains simple as well as replicative transposition , along with the involvement of an enhancer element . the majority of diverse retrotransposable elements that employ a target site duplication mechanism is also suggested to follow the fbi dna - mediated perpendicular insertion of the paired intercoil ends by non - homologous end - joining , together with gap filling . a genome - wide perspective of transposable elements in light of fbi dna is discussed .

Introduction Structures of TEs and Mechanisms of Transposition FBI DNA DNA Transposition Explained by FBI DNA FBI DNA and Enhancer Concept for DNA Transposition Conclusions and Perspectives

smoking is a major risk factor associated with the development and progression of a variety of cancers . smoking is estimated to account for approximately 4 - 5 million deaths worldwide and approximately 443,000 deaths each year in the united states alone [ 2 , 3 ] . sufficient evidence has accumulated to conclude that tobacco smoking caused cancers not only of the lung , but also of the lower urinary tract including the renal pelvis and bladder , upper aero - digestive tract including oral cavity , pharynx , larynx , and esophagus , and pancreas [ 2 , 4 ] . recent lines of evidence have showed that smoking tobacco can also cause cancers of the nasal cavity , paranasal sinus , nasopharynx , stomach , liver , kidney , cervix , uterus , breast , adenocarcinoma of the esophagus , and myeloid leukemia . of the thousands of chemicals in tobacco smoke , polycyclic aromatic hydrocarbons and nicotine - derived nitrosamines have been identified as the major and potent carcinogens [ 5 , 6 ] . the metabolites of these agents form dna adducts and cause mutations in vital genes like rb , p53 , and k - ras in smokers [ 79 ] . while the induction of these cancers is mediated by tobacco - specific nitrosamines as well as other carcinogens present in the tobacco smoke , it is becoming clear that signaling through the nicotinic acetylcholine receptors contribute to the growth , progression , and metastasis of a variety of cancers . nicotine , which is the major addictive component of tobacco smoke , acts through nicotinic acetylcholine receptors ( nachr ) [ 911 ] , but is not thought to be carcinogenic . the expression of nachrs in central and peripheral nervous system is associated with smoking dependence and addiction . it was generally believed that nachrs are only expressed in nervous system and at neuromuscular junctions ( muscle type nachrs ) . however , the discovery of widespread expression of nachrs in mammalian cells , including cancers , suggested its direct role in cancer progression [ 1315 ] . this paper deals with certain aspects of nicotinic receptor signaling in nonneuronal cells that lead to increased cell proliferation and survival , angiogenesis , tumor growth , and metastasis . nachrs are a complex of five subunits forming hetero- or homopentamers to form a central ion channel [ 16 , 17 ] . the neuronal nachrs can be homomeric composed of 7 , 8 , or 9 subunits or with the combinations of 26 or 10 subunits with 24 subunits ( heteromeric nachrs ) . the muscle type nachrs may be comprised of combinations of 1 subunits with 1 , , , or subunits . both neuronal as well as muscle nachr higher binding to 42-nachrs results in desensitization of the receptor , which could be the reason that 7-nachr is the major stimulator of cancer development and progression in vivo . in addition to nicotine , tobacco - specific nitrosamines such as 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone ( nnk ) can also bind to 7-nachr , and n - nitrosonornicotine ( nnn ) binds to heteromeric -nachrs . the affinity of nnk for the 7-nachr was found to be 1,300 times higher than nicotine , whereas the affinity of nnn for heteromeric -nachrs was 5,000 times higher than that of nicotine [ 21 , 22 ] . since the discovery of ubiquitous presence of nachrs in mammalian cells , studies from many laboratories have linked nachrs with various pathological conditions including tumor growth and angiogenesis [ 13 , 23 ] . in earlier studies , nicotine was found to stimulate endothelial - cell proliferation via nachr at concentrations lower than those obtained in blood after smoking . as described in the later part of this paper , many studies have correlated the exposure of nicotine or other tobacco smoke components with induction of pathological neovascularization through the activation of nachr [ 23 , 25 ] . studies from our laboratory have suggested that nicotine can enhance the growth and metastasis of pre - established lung tumors . altogether , these studies proposed the involvement of tobacco smoke components in various aspects of tumorigenesis and vascular dysfunctions in smokers . extensive research by many groups has successfully associated the physiological effect of nicotine and its derivatives with the direct activation of nachrs . small cell lung carcinoma ( sclc ) pulmonary neuroendocrine cells ( pnecs ) and sclc cells express high levels of the 7-nachr , whereas heteromeric nachrs were undetectable [ 27 , 28 ] . at the same time , both hetero- and homomeric nachrs are found to be expressed in nonsmall cell lung carcinoma cells of different histologic subtypes [ 19 , 29 ] . recently , differential expression pattern of achr subunit gene was studied in nsclc patients who were smokers or never smokers . higher expression of chrna6 and chrnb3 combination was correlated with nsclcs in nonsmokers , whereas lower expression was correlated with nsclcs in smokers . additionally , increased expression of chrna1 , chrna5 , and chrna7 subunit genes was correlated with short - term exposure to nicotine . human biopsies of mesothelioma as well as of normal pleural mesothelial cells were found to express functional 7-nachr [ 31 , 32 ] . studies from the russo laboratory have shown that inhibition of nachrs by -cobratoxin ( -cbt ) can inhibit the growth of a549 tumors in immunocompromised mice . these findings strengthen the hypothesis that modulation of nachrs upon chronic exposure to tobacco may contribute to the development and progression of cancer . in the following sections , we will summarize the findings to support the hypothesis . attempts have been made to elucidate the molecular events that mediate nicotine - induced cell proliferation . activation of nachr through nicotine or nnk has been found to activate protein kinase c ( pkc ) , the serine / threonine kinase raf-1 , the mitogen - activated kinases erk1 and erk2 , and the transcription factors fos , jun , and myc through the selective activation of 7-nachr in sclc . it has been reported that ( )-nicotine stimulated tumor cell proliferation via secretion of the neurotransmitter serotonin , and the growth stimulatory effect of nicotine or nnk could be blocked by selective serotonergic receptor antagonists [ 27 , 35 , 36 ] . in a recent report , the effects of acute and repetitive exposure to nicotine was shown to induce a neuronal - like appearance in n417 sclc cell line , which produced bigger and more vascularized tumors in mice through activation of cxcr4/cxcl12 axis . a prominent increase in the expression of cxcr4 nsclc cell lines from large - cell carcinoma , squamous - cell carcinoma , and adenocarcinoma , all showed the activation of pi3k - akt pathway and nf-b activation in response to nicotine or nnk treatment [ 38 , 39 ] . in addition , frequent loss of the tumor suppressor gene foxo3a was reported in carcinogen - induced lung adenocarcinoma . in nnk - treated lung cancer cells , restoration of foxo3a in foxo3a - deficient cells increases sensitivity to apoptosis caused by a dna - damaging intermediate of nnk . this study proposed that foxo3a might play a role in lung adenocarcinoma suppression by providing a protective response to carcinogenic stress . experiments from our laboratory have shown that nicotine stimulation affects various components of cell cycle regulatory machinery [ 26 , 29 , 41 ] . exposure to nicotine resulted in activation of raf-1 , induction of cyclin d and cyclin e - associated kinase activity as well as rb phosphorylation , which led to the dissociation of e2f1 from rb . further , it was observed that stimulation with nicotine caused the dissociation of rb from e2f - responsive proliferative promoters ( cdc6 and cdc25a ) , while there were increased amounts of e2f1 bound to them . these molecular events were correlated with increased proliferative effects of nicotine in nsclc cell lines a549 ( human bronchioalveolar carcinoma ) , nci - h23 , nci - h441 ( lung adenocarcinoma ) , and nci - h226 ( pleural effusion squamous cell carcinoma ) as well as on primary normal human bronchial epithelial cells ( nhbes ) , small airway epithelial cells ( saecs ) , human aortic endothelial cells ( haecs ) , and human microvascular endothelial cells from lung ( hmec - ls ) . the mitogenic effects of nicotine were abrogated by 7 subunit antagonists , -bungarotoxin , and methylallyl aconitine ( maa ) , whereas it was unaffected by -lobeline ( 42 subunit inhibitor ) or dihydro -erythoidine ( dhe ; 32 and 42 subunit inhibitor ) , suggesting that 7 subunits primarily mediated the mitogenic effects of nicotine in nsclc cells . we have further illustrated that upon nicotine stimulation , the scaffolding protein -arrestin-1 forms a complex with nonreceptor tyrosine kinase - src and gets recruited to the nachrs . these results suggested that 7-nachr - mediated stimulation of cell proliferation is through a -arrestin-1-src signaling axis in nsclc ; ( see also figure 1 ) . other than lung cancer , activation of 7-nachr and heteromeric nachrs expressing 3 and 5 subunits have been reported in oral and esophageal keratinocytes . similar to lung cancer cells , nnk was found to bind with high affinity to 7-nachr , whereas nnn was found to bind to heteromeric nachrs with higher affinity . esophageal cancer - het-1a cells stimulated with nnk or nnn showed increased mrna transcripts and expression of pcna and bcl-2 , and transcription factors gata3 , nf-b , and stat1 . however , induction of ras - raf - erk1-erk2 cascade , the jak2-stat3 pathway and nf-b activation was associated with enhanced cell proliferation through these nitrosamines in immortalized oral epithelial cells . in addition , chronic exposure of nicotine or environmental tobacco smoke on oral keratinocytes selectively upregulated 5- and 7-nachr subunits , resulting in intensified signaling responses to nicotine . the secreted mammalian ly-6/urokinase plasminogen activator receptor - related protein-1 ( slurp-1 ) is recently identified as an endogenous ligand for the 7 subunit of the nicotinic acetylcholine receptor ( nachr ) . the expression levels of slurp1 and slurp2 ( secreted mammalian ly-6/urokinase plasminogen activator receptor - related protein-2 ) transfection of the cells with slurp1 or slurp2 cdna reduced the nitrosamine - induced colony formation in soft agar while inhibiting the growth of nnk - transformed keratinocytes in mouse xenografts . slurp1 bound to 7-nachr and slurp2 bound to nachrs expressing the 3 subunit [ 22 , 43 ] . similar results were demonstrated recently where ht-29 human colon cancer cells treated with nicotine resulted in increased cell proliferation and a marked reduction in the protein expression of slurp1 via 7-nachrs activation . recently , nicotine mediated upregulation of foxm1 expression was found in primary oral keratinocytes which was associated with induction of genomic instability . a centrosomal protein cep55 as well as a dna helicase and putative stem cell marker hells , were found to be novel targets of nicotine - induced foxm1 expression and correlated with oral cancer progression . experiments with human mammary epithelial - like mcf10a or cancerous mcf7 cells revealed that treatment of these cells with nicotine enhances the activity of protein kinase c ( pkc ) alpha with cdc42 as a downstream target for nicotine - induced proliferation and migration . it has also been suggested that nicotine - induced proliferation of human breast cancer cell is dependent on 9-nachr and cyclin d3 expression . the effects of nicotine on a population of cancer stem cells in mcf-7 human breast cancer cells were examined , using aldehyde dehydrogenase ( aldh ) as a stem cell marker . this study found that nicotine increases the stem cell population via 7-nachr and the pkc - notch dependent pathway . apart from direct responses through nachrs , indirect signaling events may also contribute to nicotine - induced tumor growth and survival . since nachrs are cation channels , it can stimulate signaling cascades by the influx of ca2 + through the opened 7-nachr . ca2 + channel blockers are shown to significantly reduce dna synthesis in response to nicotine or nnk in sclcs . also , nachr - mediated systemic increase in stress neurotransmitters , adrenaline , and noradrenaline , which are -adrenergic agonists , are also shown to stimulate -adrenergic receptor - initiated camp signaling and transactivation of egfr cascade through egf secretion in nnk - treated small airway epithelial cells [ 50 , 51 ] . nicotine is found to induce systemic or cellular increase in noradrenaline and significantly enhance the growth and angiogenesis of pancreatic , gastric , and colon cancer - xenografts with increased expression of erk1-erk2 , cox2 , prostaglandin e2 , vegf , and transactivation of -adrenergic as well as egfr signaling in colon cancer cells [ 5255 ] . activation of erk1-erk2 and stat3 in response to nicotine has also been reported in bladder cancer cells downstream of nachrs and -adrenergic receptors . importantly , apart from nachrs , direct interaction of nnk with -adrenergic receptor has been proposed as a novel mechanism , which may significantly enhance the high cancer - causing potential of these nitrosamines [ 50 , 57 ] . similar to the activation via neurotransmitters , nnk binding to -adrenergic receptor was also found to activate adenylyl cyclase - camp - pka - creb cascade and transactivation of efgr . additionally , an additive effect of estrogen receptors and nachrs was also demonstrated in promoting the growth of a549 tumors in athymic nude mice . cotreatment of nicotine and estradiol resulted in increased cell proliferation as well as vegf secretion from cancer cells , leading to increased tumor growth as well as microvascular density within the tumor . recently , the chronic exposure to estrogen and nnk was shown to have synergistic effects on cell proliferation and production of noradrenaline and adrenaline , by upregulating 7-nachrs in immortalized small airway epithelial cells . in addition to the effect on tumor growth , epidemiological and clinical data implicate that in patients with cancer , continued smoking causes resistance to therapy by blocking the induction of apoptosis . various studies have linked the activation of nachr resulting in inhibition of apoptotic pathways . in sclc cells , nnk was shown to phosphorylate bcl-2 at ser70 which promoted its interaction with c - myc that significantly enhanced the half - life of the c - myc protein . this functional cooperation of bcl2 and c - myc resulted in promoting cell survival and proliferation . this effect could be blocked by the pkc inhibitor staurosporin , the erk1-erk2 inhibitor pd98059 or silencing of myc [ 61 , 62 ] . additionally , mesothelioma cells also showed nicotine - stimulated proliferation through 7-nachr - mediated ca - dependent activation of the erk1-erk2 cascade and inhibited apoptosis by induction of nf-b and phosphorylation of bad at ser112 ( bcl-2 antagonist of cell death ) . in nsclcs , constitutive activation of akt similarly , nicotine or nnk exposure displayed akt - mediated growth and nf-b - mediated resistance to apoptosis in human airway epithelial cells as well as lung cancer cells [ 38 , 39 ] . treatment of cells with the phosphatidylinositol 3-kinase ( pi3k ) inhibitor ly294002 or specific depletion of akt was shown to block both nicotine - induced bax phosphorylation and cisplatin resistance in nsclc cells . in addition to these signaling events , results from our laboratory revealed a significant role for the iap proteins xiap and survivin in nicotine - mediated chemoresistance in nsclcs in vitro . chromatin immunoprecipitation assays demonstrated that nicotine stimulation caused an increased recruitment of e2f1 and concomitant dissociation of retinoblastoma tumor suppressor protein ( rb ) from survivin promoter in nsclc cells . moreover , ablation of e2f1 levels caused abrogation of survivin expression and protective effects of nicotine against cisplatin - induced apoptosis in a549 cells . in the above study , chemoprotective effect of nicotine was found to be mediated through 3/4-nachr activation and could be abrogated by agonists of these subunits . it was also found that nicotine stimulation enhanced the levels of xiap at the protein level . nicotine induces the activation of akt , which is known to phosphorylate xiap and prevent its proteasome - mediated degradation . in agreement with this , an akt inhibitor could abrogate the antiapoptotic effects of nicotine in a549 cells . in other studies , the cooperative effect of nicotine and nnk was investigated for their transforming ability in various lung epithelial or cancer cells . exposure to nicotine or the combination of nicotine and nnk for one week augmented bcl-2 expression , accompanied by an increased resistance to cisplatin - induced apoptosis . this study also showed that the combination treatment promoted cell proliferation and anchorage - independent growth as compared to nnk exposure alone . in another study , nicotine - induced mcl-1 phosphorylation significantly enhanced the half - life of mcl-1 , which conferred long - term survival potential . specific depletion of mcl-1 by rna interference blocked nicotine - stimulated survival and enhanced apoptotic cell death . nicotine - mediated activation of 7-nachr has also been linked with the expression of ppar/ protein by inhibiting ap-2 protein expression and dna binding activity to the ppar/ gene promoter . antagonist and short interfering rna against 7-nachr as well as inhibitors of phosphatidylinositol 3-kinase ( pi3k ; wortmannin and ly294002 ) and mammalian target of rapamycin ( mtor ; rapamycin ) blocked the expression of ppar/ protein demonstrating a novel mechanism by which nicotine could promote human lung carcinoma cell growth . these studies show that signaling through the nachrs could promote cell proliferation and survival , utilizing multiple signaling cascades . angiogenesis , the formation of new blood vessels from pre - existing vasculature , is a complex multistep process involved in a number of physiological processes such as wound healing , embryogenesis and reproduction . in addition , angiogenesis is necessary for the sustained growth of the primary tumor as well as metastatic dissemination . the proangiogenic activity of nicotine is mediated by nicotinic acetylcholine receptors , particularly 7 subunit . the pioneering study by villablanca ( 1998 ) demonstrated the ability of nicotine to induce endothelial cell proliferation . this observation was followed by the elegant studies from the john cooke 's laboratory suggesting a cholinergic pathway for nicotine - induced angiogenesis where they demonstrated complete inhibition of endothelial network formation using nonselective nachr antagonist mecamylamine in an in vitro angiogenesis model . although several nachr isoforms are expressed on endothelial cells , a similar inhibition was obtained only with the selective 7-nachr antagonist -bungarotoxin , confirming the specific involvement of 7-nachr . further , in vivo pharmacological inhibition of nachr and a genetic disruption of 7-nachr expression significantly inhibited inflammatory angiogenesis and reduced ischemia - induced angiogenesis and tumor growth . they also provided anatomic and functional evidence for nicotine - induced angiogenesis and arteriogenesis when they observed that nicotine accelerated the growth of tumor and atheroma in association with increased neovascularization . nicotine increased endothelial - cell growth and tube formation in vitro , and accelerated fibrovascular growth in vivo . in a mouse model of hind - limb ischemia , nicotine increased capillary and collateral growth , and enhanced tissue perfusion . these effects of nicotine were mediated through nicotinic acetylcholine receptors at nicotine concentrations that are pathophysiologically relevant and suggested a possible role for the endothelial production of nitric oxide , prostacyclin , and vascular endothelial growth factor [ 7074 ] . nicotine has been demonstrated to stimulate postnatal angiogenesis , having an antiapoptotic effect on endothelial cells . it was observed that nicotine stimulated postnatal vasculogenesis on endothelial progenitor cells ( epcs ) . furthermore , the antiapoptotic effect of nicotine was blocked completely by nicotinic acetylcholine receptor ( nachr ) antagonist hexamethonium bromide . recent studies have shown that apart from cigarette smoking , exposure to secondhand smoke also could induce angiogenesis . a positive correlation between secondhand smoke exposure and concentrations of nicotine in the body further , it was found that the levels of nicotine exposure from secondhand smoke were comparable to those of active smokers . in a mouse model where lewis lung cancer cells were implanted subcutaneously into mice , which were then exposed to sidestream smoke ( shs ) or clean room air and administered vehicle or mecamylamine ( an inhibitor of nachr ) ; shs significantly increased tumor size , weight , capillary density , vegf , and mcp-1 levels , and circulating endothelial progenitor cells ( epc ) . mecamylamine partially inhibited the effects of shs on these angiogenic processes and nearly abolished the effects of shs on tumor capillary density suggesting that nicotine mediated the effects of shs on tumor angiogenesis and growth . several recent studies have implicated that nicotine - induced angiogenesis could be mediated by growth stabilization and transmigration of endothelial progenitor cells ( epc ) [ 75 , 78 , 79 ] . nicotine accelerated the growth of syngenic colon cancer cmt93 cells when grown subcutaneously in mice by inducing angiogenesis via bone marrow derived epcs . to determine if the angiogenic effects of nicotine is mediated by epc mobilization , heeschen et al . used a model of mouse parabiosis and found that nicotine enhances epc mobilization into the vasculature of the ischemic tissue . this effect may be due to the direct actions of nicotine on epc proliferation , migration and/or mobilization as suggested by in vitro models and plasma markers used in the investigation . they also noticed that in the absence of acute ischemia , nicotine did not stimulate epc mobilization . the activation of nachrs in response to ischemia induced the release of proangiogenic factors like vegf and stem cell derived factor-1 , both of which are regulated by hypoxia , which in turn facilitates epc mobilization . evidence from another study also demonstrated that nicotine promotes angiogenesis via stimulation of nachr - dependent endothelial cell migration . nachr antagonism not only abolished nicotine - induced human microvascular endothelial cells ( hmvec ) migration but also abolished migration induced by bfgf and attenuated migration induced by vegf . transcriptional profiling identified gene expression programs which were concordantly regulated by all 3 angiogens ( nicotine , vegf , and bfgf ) , a notable feature of which includes corepression of thioredoxin - interacting protein ( txnip ) , endogenous inhibitor of the redox regulator thioredoxin . furthermore , interestingly , nachr antagonism abrogates growth factor ( vegf- and bfgf- ) mediated induction of thioredoxin activity suggesting the requirement of nachr activation in endothelial cell migration , a key angiogenesis event . the proangiogenic effects of nicotine have been found to be mediated by 7-nachr on endothelial cells by activating erk / map kinase pathway , pi3 kinase / akt pathway , and nf-b [ 23 , 25 , 83 , 84 ] . further , nicotine has been shown to induce the proangiogenic factors like vegf and hif-1 in nsclc cell lines . pharmacologically blocking nachr - mediated signaling cascades , including the ca2+/calmodulin , src , protein kinase c , pi3k / akt , mapk / erk1/2 , mtor pathways , significantly attenuated nicotine - induced upregulation of hif-1. these proangiogenic and invasive effects of nicotine were partially abrogated by depleting hif-1 using sirna techniques . nicotine also enhanced the activity of matrix metalloproteinase 2 and 9 and expression of plasminogen activators in a cox2 and vegfr2-dependent manner . the proangiogenic effect of nicotine has been shown to be dependent on src activity by our laboratory . the inhibition of src , using chemical inhibitors or sirna has been shown to inhibit endothelial cell proliferation , migration , and angiogenic tubule formation on matrigel . as mentioned earlier , studies from our laboratory suggest that the scaffolding protein -arrestin-1 causes the activation of src . oligomeric complex comprising of nachr , -arrestin-1 , and src is vital for nachr signaling . in addition , depletion of -arrestin-1 caused abrogation of endothelial cell proliferation and angiogenic tubule formation [ 29 , 41 ] . these data suggest that nicotine behaves in a manner analogous to growth factors and induces cell cycle progression in endothelial cells . epithelial to mesenchymal transition ( emt ) is a biological process that allows a polarized epithelial cell , which normally interacts with the basement membrane through its basal surface , to undergo multiple biochemical changes with a signature of more advanced and less differentiated cancer that allow it to assume a mesenchymal phenotype . this enhanced migratory capacity , invasiveness , resistance to apoptosis , and greatly increased production of ecm components [ 8789 ] . this process results in degradation of basement membrane and the formation of a mesenchymal like cell , which can migrate away from the epithelial layer in which it originated . epithelial to mesenchymal transition ( emt ) is involved in tumor progression from noninvasive tumor cells into metastatic carcinomas . recent studies from our laboratory demonstrated that nicotine can induce invasion and migration in cell lines derived from lung cancer , breast cancer , and pancreatic cancer via 7-nachr - mediated signal transduction pathways . the proinvasive effects of nicotine were mediated by 7-nachr in lung cancer cells while 7-nachr and dhe sensitive nachrs mediated invasion of breast cancer cells . long - term treatment of lung cancer and breast cancer cells with nicotine was found to diminish levels of epithelial markers namely -catenin and e - cadherin and upregulate mesenchymal proteins like fibronectin and vimentin , indicative of disruption of cell - cell contacts and increased motility . in addition to facilitating emt , nicotine and nnk have been shown to affect various aspects of tumor cell invasion and migration . for example , both nicotine and nnk are shown to promote the invasion of nsclc by phosphorylation of and m - calpains . several lines of evidence show that calpain - mediated proteolysis mediates various aspects of cell physiology including cell migration and invasion . nicotine was found to induce phosphorylation of both and m - calpains via 7-nachr ; the binding of nicotine to 7-nachr in turn was found to activate src and pkc - iota , leading to enhanced invasion and migration of nsclc cell line h1299 . similarly , nnk also could promote invasion and migration through phosphorylation of and m - calpains in a 7-nachr - dependent fashion . several observations in patients suggest that those exposed to tobacco carcinogens are more likely to develop larger , more vascularized tumors with a high propensity for metastatic spread and resistance to chemotherapy . about 30% of lung cancer patients who are smokers continue to smoke after they have been diagnosed , which might result in increased adverse medical consequences such as increased tumor progression , development of a second cancer , greater recurrence , greater cancer - related mortality and reduced quality of life [ 92 , 93 ] . while these studies demonstrate a role for tobacco carcinogens in the initiation , growth , and progression of cancers , the relative contribution of nicotine by itself to these processes is not well explored . a recent study from our laboratory demonstrated that nicotine by itself can induce the growth and metastasis of tumors in immunocompetent mice , independent of other tobacco carcinogens . nicotine administered either intraperitonially or by commercially available transdermal patches could substantially promote tumor growth . similar effects were observed on implanted tumors as well as tumors induced by tobacco carcinogen , nnk . furthermore , mice exposed to nicotine showed significantly enhanced lung metastasis as well as tumor recurrence after surgical removal of the primary tumor , indicating that nicotine can enhance the growth and metastasis of pre - established lung tumors . as mentioned earlier , repetitive exposure to nicotine on sclc - n417 cells resulted in neuronal - like appearance along with increased adhesion to the extracellular matrix . these changes were accompanied by enhanced migration through collagen matrices and adhesion to and transmigration across lymphatic endothelial cell monolayers . accumulating evidence from epidemiological studies suggest a strong association between smoking and pulmonary metastatic disease in women with breast cancer . in a murine model of metastatic mammary cell cancer , cigarette smoke exposure was associated with an increase in the total pulmonary metastatic burden providing experimental support for an adverse effect of smoking on the metastatic process and suggesting a possible mechanism for smokers ' increased breast cancer mortality . in addition , it was observed that cigarette smoking was correlated with increased lymph node metastases at mastectomy in women older than 50 years of age suggesting that tobacco usage may potentiate the early spread of malignant disease . although numerous studies have indicated the role of nicotine exposure in tumor promotion , little is known about the molecular mechanisms by which nicotine promoted breast tumor development , especially on the metastatic process of breast cancer . at least four different subunits of nachrs including 5 , 7 , 9 , and 4 are shown to be expressed in breast cancer cells . it has been demonstrated that in addition to proliferative effect , nicotine promoted migration of breast cell lines ( mammary epithelial cell line mcf10a and breast cancer cell line mcf7 ) through a signaling cascade involving pkc activation and its downstream effector cdc42 . exposure to nicotine has shown to increase the expression of 9-nachr in breast cancer cells [ 47 , 97 ] . studies using a soft agar transforming assay and a mouse xenograft model demonstrated that noncancerous human breast epithelial cell line , mcf10a , could be neoplastically transformed by exposure to either a cigarette smoke condensate or the tobacco specific carcinogen , nnk [ 98 , 99 ] . in a recent study , 9-nachr expression was silenced in mda - mb-231 breast cancer cells which resulted in reduced proliferation and tumorigenic potential in both in vitro and in vivo assays , indicating the role of 9-nachr in breast carcinogenesis . cigarette smoking has recently been recognized as a risk factor for gastric cancer and long - term exposure of nicotine - induced emt like changes in gastric cancer cell lines by activating erk/5-lox signaling pathway . a study on the association between cigarette smoking and pancreatic cancer showed that smokers had a significantly higher risk ( 70% ) of developing pancreatic cancer compared to nonsmokers [ 103105 ] . accumulating evidence suggests that nicotine induces expression of osteopontin , a secreted phosphoprotein that confers on cancer cells a migratory phenotype and activates signaling pathways that induce cell survival , proliferation , invasion , and metastasis . rats exposed to cigarette smoke showed a dose - dependent increase in pancreatic osteopontin expression . in addition , analysis of cancer tissues from invasive pancreatic ductal adenocarcinoma ( pda ) patients , the majority of whom were smokers , showed the presence of significant amounts of osteopontin in malignant ducts and the surrounding pancreatic acini . further studies suggested that nicotine contributes to pda metastasis by inducing mmp9 and vegf expression and osteopontin mediated these effects . an osteopontin isoform , opnc , is selectively inducible by nicotine and is highly expressed in pda tissues from smokers which induced the expression of monocyle chemoattractant protein ( mcp-1 ) indicating a proinflammatory role of nicotine . altogether , these results suggest that nicotine plays a key role in the regulation of the complex cellular cascades that modulate cell adhesion , invasion , and migration leading to metastasis . as summarized in figure 1 , nicotine , the principal addictive component of tobacco smoke , as well as other nitrosamines have been found to act through nachrs on nonneuronal cells to facilitate tumor growth , angiogenesis , metastasis , survival , and chemoresistance by regulating diverse signaling pathways . binding of agonist to nachr facilitates the complex formation between the receptor , scaffolding protein -arrestin and tyrosine kinase src . activation of src was found to be important for cancer as well as endothelial cell proliferation and angiogenic tube formation in vitro . proliferative effect of nachr - activation was also supported by indirect stimulation of -adrenergic receptor ( -ar ) signaling . further , chemotherapy - induced apoptosis was found to be blocked by nicotine - induced survivin expression as well as nf-b activation . activation of nachr is also correlated with emt - like changes and metastatic dissemination of primary tumor cells . given the ability of nicotine to affect various aspects of tumor growth and metastasis , antagonists of nachr signaling might be beneficial in controlling the growth and progression of tumors . recently , alpha cobratoxin ( -cbt ) has been shown to block the growth of a variety of nsclc and mesothelioma cell lines both in vitro and in vivo [ 109 , 110 ] . the most striking effect of -cbt was its ability to effectively inhibit the metastatic potential of lung cancer cells transplanted into nude mice , indicating the possibility of using nachr antagonists as adjuvant therapy in preventing metastatic spread . at the same time , the potential side effects of nachr antagonists on the brain and central nervous system need to be investigated before using them as a viable drug for combating lung cancer . moreover , the direct role of nicotine alone on several aspects of tumorigenesis raises the need to revisit the potential tumor promoting effects of nicotine - replacement therapy . also , the modulation effects of secondhand smoke on nachrs require detailed investigation in the future .

cigarette smoking is highly correlated with the onset of a variety of human cancers , and continued smoking is known to abrogate the beneficial effects of cancer therapy . while tobacco smoke contains hundreds of molecules that are known carcinogens , nicotine , the main addictive component of tobacco smoke , is not carcinogenic . at the same time , nicotine has been shown to promote cell proliferation , angiogenesis , and epithelial - mesenchymal transition , leading to enhanced tumor growth and metastasis . these effects of nicotine are mediated through the nicotinic acetylcholine receptors that are expressed on a variety of neuronal and nonneuronal cells . specific signal transduction cascades that emanate from different nachr subunits or subunit combinations facilitate the proliferative and prosurvival functions of nicotine . nicotinic acetylcholine receptors appear to stimulate many downstream signaling cascades induced by growth factors and mitogens . it has been suggested that antagonists of nachr signaling might have antitumor effects and might open new avenues for combating tobacco - related cancer . this paper examines the historical data connecting nicotine tumor progression and the recent efforts to target the nicotinic acetylcholine receptors to combat cancer .

1. Introduction 2. Nicotinic Acetylcholine Receptor Expression in Nonneuronal Cells 3. nAChRs Signaling in Tumor Growth and Survival 4. nAChRs Signaling in Cell Survival and Resistance to Apoptosis 5. nAChRs and Tumor Angiogenesis 6. nAChRs in EMT and Tumor Metastasis 7. Discussion and Conclusions

ischemic mitral regurgitation can be defined as moderate to severe mitral leak precipitated by acute myocardial infarction . valve repair is now the procedure of choice , but some cases can pose difficult anatomy . most patients with ischemic mitral regurgitation have predominant annular dilatation at the posterior commissure and require only ring annuloplasty . if papillary muscle elongation or rupture occurs , gore - tex artificial chordal replacement performs well . with ischemic mitral regurgitation accompanying posterior ventricular aneurysms , standard trans - atrial mitral repair provides the best results , with associated aneurysms being repaired concurrently . surgical approaches and technical outcomes of mitral repair in ischemic mitral regurgitation are illustrated in 5 patients using operative images and echocardiograms . each method is illustrated , including ring annuloplasty , pericardial leaflet augmentation , artificial chordal replacement , and ventricular aneurysm repair . using these techniques , virtually all ischemic mitral regurgitation can be repaired , with consequential patient benefits , even in the most complex anatomy . ischemic mitral regurgitation has been shown to have better outcomes when managed with valve repair . using combinations of annular , leaflet , and chordal procedures , even complex ischemic mitral regurgitation can undergo autologous reconstruction with excellent long - term results . several divergent concepts currently exist about the prognosis and management of ischemic mitral regurgitation ( imr ) . they range from little can be done to modify the dismal prognosis - to mitral repair can cure the disorder ; from mitral repair should be uniform - to prosthetic replacement achieves more certain results . one problem is that conclusions have been based on multiple different surgical approaches between centers , and also , statistical techniques often have been suboptimal . thus , it is likely that outcome benefits did vary between institutions , with differences in surgery and other factors , accounting for the divergent conclusions . the goal of this paper is to review repair techniques for imr used over the past 25 years at duke university medical center and to document observed outcome characteristics . imr can be defined as mitral regurgitation precipitated by myocardial infarction , with essentially normal leaflet and chordal support . imr usually is associated with myocardial necrosis , rather than reversible ischemia , and the infarction is usually inferior . fact , mitral valve competence requires the integrated function of all five aspects of the valve - annulus , leaflets , chordae , papillary muscles , and ventricular wall . as defined in george burch s classic 1966 papillary muscle dysfunction paper , most cases involve predominant posterior annular dilatation , but others experience leaflet tethering due to infarct expansion . rarely , papillary muscles can elongate or rupture , producing leaflet prolapse . the common type of imr involves the posterior wall , usually is caused by right and/or circumflex coronary occlusion , produces moderate posterior - lateral left ventricular ( lv ) dysfunction , and usually will not reverse with revascularization alone . as described in the 1980 s , the decision to repair the valve should be based on the appearance of moderate or severe imr on the intra - operative transesophageal echo ( tee ) , sometimes with provocative volume loading from the pump before bypass . surgical techniques . posterior annular dilatation is an important mechanism of imr , and has been almost uniformly corrected in our practice with a true - sized full rigid or semi - rigid ring . it has been shown that fixed reduction in anterior - posterior annular geometry is extremely important in this entity . these patients often have minor leaflet abnormalities , such as fetal commissural cusps or clefts , predisposing them to opening up the valve with ischemic posterior annular dilatation . occasionally , leaflets can be tethered by infarct expansion , contributing to lack of valve closure . as langer showed , a posterior leaflet autologous pericardial patch can be used to compensate for the tethering , and this approach provides a large margin of safetylong - term , especially if further geometric changes occur . for leaflet prolapse due to elongated or ruptured papillary muscles , gore - tex artificial chords can be placed to a viable papillary muscle , adjusting chordal lengths after ring placement , as we have described . the first patient is a 77 year old man , experiencing an acute circumflex infarct that produced acute moderate to severe mitral regurgitation ( mr ) and congestive heart failure . on tee ( figures 1 a , b ) , there is loss of valve coaptation at the posterior commissure ( red arrow ) , due to annular dilatation from a large posterior lateral infarct ( green arrow ) . this produced the characteristic loss of coaptation area and a central mr jet , but both leaflets are at the annular plane and not tethered or prolapsed ( figure 1c ) . after simple insertion of a full rigid ring , the valve is entirely competent ( figure 1d ) . panel a is a short axis view of the left ventricle , showing an expanded posterior - lateral wall infarct ( green arrow ) . panel b shows a gap in mitral coaptation at the posterior commissure during systole ( red arrow ) , producing a central regurgitant jet ( panel c ) , but the leaflets are at the annular plane . this is the most common echocardiographic appearance of ischemic mitral regurgitation . in panel d , the second patient is a 55 year old obese diabetic who experienced a right coronary infarct and imr 6 months earlier that were treated with right coronary artery ( rca ) stenting . despite revascularization , imr and she then developed an in - stent stenosis in the rca and an additional left anterior descending coronary artery ( lad ) lesion , and her ventricle showed residuals of the inferior infarct , with generalized dilatation . there was loss of central mitral coaptation , due to annular dilatation , a hint of tenting and leaflet tethering ( figure 2a ) , and moderate to severe mr with a central jet ( figure 2 b).when the valve was inspected , however , the posterior leaflet seemed fine with good closure and minimal tethering on valve testing by ventricular distension with cold saline ( figure 2c ) . therefore , the valve is repaired by simple placement of a carpentier ring , with good recovery of competence , and no residual leak ( figure 2d ) . so , most ischemic mitral regurgitation ( mr ) can be repaired with full ring annuloplasty alone , which achieves excellent results , with a documented 2% late reoperation rate , 9% late moderate mr recurrence rate , and quite satisfactory echocardiographic results . clinical images in a patient with chronic ischemic mitral regurgitation . panel a shows a hint of leaflet tethering ( green arrow ) , with both leaflets slightly below the annular plane . in panel c , the posterior leaflet seems to coapt well ( red arrow ) with no evidence of tethering during valve testing with cold saline injection . therefore , a simple ring annuloplasty was performed , and in panel d , the valve is completely competent . the third patient is a frail elderly female presenting with an acute circumflex infarct and severe imr , treated initially with percutaneous coronary intervention ( pci ) . unlike the first 2 patients , she had prominent posterior leaflet tethering by echocardiography ( figure 3a ) , and severe lv dysfunction , mainly in the lateral wall due to the infarct . on emergency angiography , she had an occluded circumflex artery , but also lad and rca stenoses . the circumflex was stented , but the imr persisted , the heart failure remained severe , and the ejection fraction continued at a 0.20 level . a magnetic resonance viability study was performed . in imr patients with low ejection fractions , we will operate if 2 of the 3 regions appear viable . in fact , this patient seemed to have good residual myocardium everywhere . upon inspecting the valve , the right aspect of the posterior leaflet was tethered , and the posterior leaflet would nt coapt , even with saline distension . in figure 3b , one can see the posterior leaflet pulled down into the ventricle with tethering from infarct expansion . a gluteraldehyde - fixed autologous pericardial patch was inserted into the posterior leaflet to compensate for the tethering , and the valve became nicely competent . most of what is seen in figure 3c is patch , with the posterior leaflet moving down into the ventricle to become the entire coaptation area , and the valve is entirely competent ( figure 3d ) panel a shows both leaflets tented into the ventricle and not closing properly due to tethering ( green arrow ) . direct inspection in panel b reveals taught posterior leaflet chords at the posterior commissure , inhibiting valve closure ( red arrow ) . after insertion of an autologous pericardial patch into the posterior leaflet and placement of a carpentier ring ( panel c ) , the valve is entirely competent with a large coaptation area ( panel d ) . the margin of safety provided by the patch may reduce later imr recurrence with further infarct expansion , or other problems . a transthoracic echocardiogram , obtained 6 months postoperatively , showed good valve opening , and only trivial residual leak . the fourth patient is a 57 year old man who had a major right coronary infarct , producing severe mr , a posterior lv aneurysm , and severe heart failure . he also had lad disease , and - there was a large posterior wall aneurysm ( figure 4a ) . the aneurysm was resected and closed primarily , approximating viable aneurysm edge to viable edge and removing all non - contractile scar . upon inspecting the valve , he had a chronically ruptured posterior papillary muscle at the posterior commissure , with severe prolapse that was not appreciated on the echo ( figure 4b ) . a 2 - 0 gore - tex artificial chord was placed to a viable papillary muscle and stuffed into the ventricle for later retrieval . after ring placement , after repair , the valve was nicely competent ( figure 4c ) , with no residual leak ( figure 4d ) . panel a is the left ventriculogram from a patient with severe ischemic mitral regurgitation and a large posterior wall aneurysm ( green arrow ) . in panel b is shown an associated chronically ruptured papillary muscle producing prolapse of a posterior commissural cusp ( red arrow ) . in panel c , an artificial chord has been placed to the commissural cusp , along with a carpentier ring , and the valve is completely competent ( panel d ) . combined chords and patches . the last patient is a 61 year old man with a remote coronary bypass for an inferior infarction , and severe persistent imr due to simultaneous leaflet tethering and prolapse - a rare combination . in figure 5a , one can see 2 separate jets of imr , with the posterior leaflet tethered down into the ventricle ( figure 5b ) and a segment of anterior leaflet prolapsing ( figure 5c ) . thus , the patient had simultaneous posterior leaflet tethering from infarct expansion , and anterior leaflet prolapse due to papillary muscle elongation . with a patch to the posterior leaflet and an artificial chord to the anterior leaflet , the valve was completely competent with good leaflet position and no residual leak ( figure 5d ) . this case illustrates that some varieties of imr can be quite complex , but with various combinations of full rings , pericardial patches , and artificial chords , the vast majority can be effectively repaired . intraoperative transesophageal echo frames from an ischemic mitral regurgitation patient with both posterior leaflet tethering and anterior leaflet prolapse . after repair of both lesions with a posterior leaflet pericardial patch and a chord to the anterior leaflet , the valve is fully competent ( panel d ) . outcome characteristics of mitral repair.from several sources , it is now clear that the generally poor prognosis after mitral valve repair for imr ( a 56% 5-year unadjusted survival in our series ) is due primarily to the adverse patient profiles that are characteristic of this population , such as advanced age , numerous co - morbidities , and left ventricular dysfunction . if these baseline risk factors are taken into account with a cox model ( figure 6 ) , valve repair seems to restore these patients to an adjusted survival that is similar to standard coronary bypass . also of note in this analysis , is the average 14% better risk - adjusted survival with valve repair , as compared to prosthetic valve replacement , which is consistent with most recent analyses . survival curves over 15 years of follow - up adjusted with a cox proportional hazards model for differences in all important baseline patient characteristics . the blue curve represents adjusted survival characteristics for 16,209 patients having coronary bypass alone without intraoperative transesophageal ( group 1 ) . the red curve represents adjusted survival for 3,181 patients with mild - to - moderate intraoperative transesophageal treated with coronary bypass alone ( group 2a ) . the green curve is adjusted survival for 416 patients with moderate - to - severe intraoperative transesophageal managed with mitral valve repair ( group 2b ) . and finally , the brown curve represents adjusted survival of 106 patients with moderate - to - severe intraoperative transesophageal receiving mitral valve replacement ( group 2c ) . mitral repair for moderate - to - severe intraoperative transesophageal restored adjusted survival to levels equivalent to standard coronary bypass patients with similar risk profiles . mitral valve replacement achieved an average 14% lower risk - adjusted survival over 15 years , as compared to valve repair . in summary , the pathophysiology of ischemic mr can be complex , with aspects involving the annulus , leaflets , chords , papillary muscles , and ventricular wall . based on our clinical experience , mitral valve repair should be the procedure of choice for moderate or worse imr , as encountered in the coronary disease population . finally , effective mitral repair restores imr patients to a prognosis that is similar to standard coronary bypass , for a given patient s age and co - morbidities , and repair seems superior to valve replacement in all subsets .

introductionischemic mitral regurgitation can be defined as moderate to severe mitral leak precipitated by acute myocardial infarction . valve repair is now the procedure of choice , but some cases can pose difficult anatomy . this review will illustrate current techniques for repairing complex ischemic mitral regurgitation.methodsmost patients with ischemic mitral regurgitation have predominant annular dilatation at the posterior commissure and require only ring annuloplasty . full rigid rings are used preferentially . with leaflet tethering , adjunctive autologous pericardial patches are effective in restoring leaflet coaptation . if papillary muscle elongation or rupture occurs , gore - tex artificial chordal replacement performs well . with ischemic mitral regurgitation accompanying posterior ventricular aneurysms , standard trans - atrial mitral repair provides the best results , with associated aneurysms being repaired concurrently.resultssurgical approaches and technical outcomes of mitral repair in ischemic mitral regurgitation are illustrated in 5 patients using operative images and echocardiograms . each method is illustrated , including ring annuloplasty , pericardial leaflet augmentation , artificial chordal replacement , and ventricular aneurysm repair . using these techniques , virtually all ischemic mitral regurgitation can be repaired , with consequential patient benefits , even in the most complex anatomy.conclusionsischemic mitral regurgitation has been shown to have better outcomes when managed with valve repair . using combinations of annular , leaflet , and chordal procedures , even complex ischemic mitral regurgitation can undergo autologous reconstruction with excellent long - term results .

Introduction Methods Results Conclusions Introduction Conclusion

a dna sequence contains six potential open reading frames ( orfs ) , three on one strand and three on the reverse strand . however , typically only one of the six is actually expressed because it is associated with appropriate genetic signals that specify the dna strand and the reading frame to be transcribed and translate . exceptions occur in which more than one open reading frame is translated into a protein , as has long been observed in the case of viral genes , where it was suggested that this property permitted a high packing density of information ( 1 ) . however , analysis of the coding potential of 481 prokaryotic genomes revealed the surprisingly high frequency of alternate orfs of annotated genes especially in high g + c rich genomes , where almost every annotated orf exhibits an alternative orf that could potentially encode a protein of 100 amino acids or more ( 2 ) . the frequency of alternate open reading frames in high g + c genomes gives rise to the possibility that this property could be exploited to evolve novel genetic information and it is important to be able to detect this potential . however , this high frequency also provokes serious problems of gene annotation , where the incorrect orf may inadvertently be mis - annotated as the coding sequence . this potential for error is especially problematic when automatic gene prediction programs are used to annotate genomes , but errors can also slip by human annotators . the problem is exacerbated if an alternative orf is mis - annotated and the error is propagated in subsequent genome annotations . alterorf provides a searchable database of all possible alternative orfs in sequenced prokaryotic genomes that are potentially capable of encoding proteins of 100 amino acids or more . the objectives are 2-fold : to improve genome annotation by indicating possible errors in orf identification and , perhaps more important in the long term , to predict instances of genes that potentially could give rise to more than one protein . annotated protein coding genes were extracted from completely sequenced prokaryotic genomes in the genome database of ncbi . all alternative orfs , potentially encoding 100 amino acids or more , were extracted from each gene sequence using perl scripts and the bioperl application programming interface ( api ) ( 3 ) . using the standard genetic code , the in silico translated amino acid sequence of each alternative orf was searched for similarity in completely sequenced prokaryotic genomes ( 4 ) and for conserved domains and motifs using cdd ( 5 ) , pfam ( 6 ) , cog ( 7 ) , kog ( 8) , smart ( 9 ) and uniprot . ( 10 ) . hierarchical clustering using the software hcluster_sg developed as part of the treefam project ( 11 ) was used to build sequence families with the alternate orfs . blast e - values were normalized from 0 to 100 ( with 100 corresponding to e - value 0.0 ) . the resulting information was stored in a relational database built with microsoft sql server 2005 . release 1.0 ( september 2007 ) contains approximately 1.5 million annotated genes from 481 organisms and about 3 million alternate orfs . of these 942 856 ( 33% ) occur in frame 1 , 621 306 ( 21% ) in frame 2 , 322 284 ( 11% ) in frame 3 , 350 805 ( 12% ) in frame + 2 and 675 525 ( 23% ) in frame + 3 . the following are provided for each alternate orf sequence : ( i ) conserved domains and motifs including cdd ( 5 ) , pfam ( 6 ) , cog ( 7 ) , kog ( 8) , smart ( 9 ) and uniprot . ( 10 ) and ( ii ) blast results with annotated sequences in completely sequenced prokaryotic genomes and alternate orfs identified in alterorf . the cross genera conservation of some alternate orfs suggests that they might represent new protein families or domains and hierarchical clustering ( 11 ) was used to build sequence families from conserved alternate orfs . the alterorf database can be accessed through a simple and easy to use web interface at www.alterorf.cl . the database can be searched by protein i d ( derived from ncbi ) , by organism and by sequence using a sequence search service . in addition , an option is provided to analyze complete genome sequences not present in the database . searching by protein i d : a protein i d can be used to recover the original annotated gene that appeared in the database ( e.g. genbank ) , and also any alternate orf(s ) associated with that gene . if alternate orfs are detected , tables providing information regarding domains , motifs and protein family are displayed with links to further information . searching by organism : the user can select an organism from a pulldown menu or index for a pre - analyzed list of annotated protein coding genes with alternate orfs . searching by protein sequence : a search using a protein sequence can be carried out against all sequences stored in alterorf using wu - blast ( blast.wustl.edu/ ) . downloading data : all data in the alterorf database can be freely downloaded by ftp . additional information on the use of alterorf can be found in the faqs and tutorial sections .

alterorf is a searchable database that contains information regarding alternate open reading frames ( orfs ) for over 1.5 million genes in 481 prokaryotic genomes . the objective of the database is to provide a platform for improving genome annotation and to serve as an aid for the identification of prokaryotic genes that potentially encode proteins in more than one reading frame . the alterorf database can be accessed through a web interface at www.alterorf.cl

INTRODUCTION DATABASE CONSTRUCTION DATABASE CONTENTS WEB INTERFACE AND SERVICES

cardiovascular disease is the leading cause of death in end - stage renal disease ( esrd ) patients receiving long - term peritoneal dialysis ( pd ) therapy . data from the canada and united states ( canusa ) peritoneal dialysis study showed that nearly half of the mortality in pd patients was due to cardiovascular disease . according to data from the united state renal data system ( usrds ) , this trend has remained more or less the same in the recent years . vascular / valvular calcifications are important and highly prevalent complications in esrd patients including those receiving pd therapy and very much contributed to the exceedingly high cardiovascular mortality in this population . numerous observational cohort studies demonstrated the prognostic importance of vascular / valvular calcification in esrd patients . using plain radiographs to estimate number of arterial sites with calcification including carotid artery , abdominal aorta , and iliofemoral axis , both the presence and extent of vascular calcifications are strong predictors of cardiovascular and all - cause mortality in the esrd patients . abdominal aortic calcification detected nonquantitatively using plain lateral abdominal radiographs has also been shown to be an independent predictor of all - cause mortality and cardiovascular death in hemodialysis patients . using multislice computed tomography ( msct ) that enables quantification of calcification , block et al . demonstrated a significant mortality effect of the severity of coronary artery calcium score in incident hemodialysis patients . cardiac valvular calcification , detected using echocardiography , also predicts all - cause mortality and cardiovascular death in chronic pd patients . notably , patients with both aortic and mitral valvular calcification showed the highest risk of mortality and cardiovascular death compared to those with either heart valve calcification or no valve calcification . these data suggest that the presence of vascular or valvular calcification , irrespective of the sites involved , is indicative of a poor prognosis in the dialysis population including patients on pd . in this paper , we reviewed the prevalence , significance , contributing factors , and emerging mechanisms for this important complication in the pd population . furthermore , we discussed therapeutic strategies that may be useful in retarding calcification burden in the pd patients . the reported prevalence of coronary artery calcification in the esrd patients ranged from 40% to nearly 100% [ 714 ] . there are very little data in pd patients but the available evidence suggest that vascular and valvular calcification is an equally highly prevalent complication in the pd population . in two small surveys , at least 60% to 80% of the pd patients , were complicated with coronary artery calcification [ 15 , 16 ] . the prevalence of cardiac valvular calcification ranges from 32% to 47% in pd patients [ 17 , 18 ] , in contrast to 19% to 84% in hemodialysis patients [ 1924 ] . in the general population , coronary artery calcium score provides a quantitative estimate of total atherosclerotic plaque burden and correlates with obstructive coronary artery disease . in nondialysis chronic kidney disease ( ckd ) patients , similar association was observed between the severity of coronary artery calcium score and obstructive coronary artery disease . study in hemodialysis patients demonstrated a close relation between the severity of coronary artery calcification and prevalence of atherosclerotic vascular disease . this is in keeping with recent similar analysis in pd patients showing that the severity of coronary artery calcium score was associated with the prevalence of atherosclerotic vascular disease ( unpublished observation ) . on the other hand , the severity of coronary artery calcium score is predictive of arterial stiffening in patients with ckd and is associated with increased risk of left ventricular hypertrophy . unlike in the general population , where calcification occurs mainly in the intimal layer and reflects atherosclerotic disease burden , vascular calcification in esrd patients typically occurs both in the intimal and medial layer . the medial calcification , known as monckeberg 's medial calcinosis is also prominent in patients with diabetes . medical calcification promotes arterial stiffening and is associated with increased risk of left ventricular hypertrophy and impaired coronary perfusion . while both medial and intimal type of calcifications predict mortality and cardiovascular death in esrd patients , intimal calcification was associated with worse survival compared to medial calcification . on the other hand , cardiac valvular calcification is a marker reflecting generalized atherosclerosis and calcification in the pd patients . . showed in a cohort of young hemodialysis adults of rapid progression in coronary artery calcification over a mean follow - up period of 20 months . in the subsequent study by block et al . , patients who had baseline coronary artery calcifications showed significant progression in coronary calcification while those without baseline calcification remained free from calcification during follow - up . these data suggest that preexisting coronary artery calcification is one of the key factors predicting further progression of vascular calcification in esrd patients . our recent analysis also reported similar finding in pd patients ( unpublished observation ) in that pd patients without significant baseline vascular calcification remained relatively free of calcification with time on dialysis . these data raised the possibility of some protective mechanisms or genetic factors in play that prevent patients from developing vascular calcification . the high incidence of vascular / valvular calcification in pd patients is contributed by both traditional and so - called nontraditional or kidney disease - related risk factors . age is one of the major clinical factors associated with vascular / valvular calcification in dialysis patients [ 7 , 10 , 17 , 33 ] . some studies showed that the degree of coronary or valvular calcification increased with increasing duration of dialysis [ 7 , 8 , 17 ] . disturbed mineral metabolism with resulting hyperphosphatemia has been suggested to play a major contributing role for vascular / valvular calcification in esrd patients [ 8 , 10 , 12 , 17 ] . according to a retrospective analysis from the usrds , an elevated serum phosphorus or an elevated calcium phosphorus product predicts all - cause mortality as well as cardiovascular mortality in hemodialysis patients . notably , patients with a high serum phosphorus 6.5 mg / dl was associated with an increased risk of death from coronary artery disease , sudden death , infection or other causes , compared with the low phosphorus group . the netherlands cooperative study on the adequacy of dialysis ( necosad ) study compared hemodialysis and pd patients and showed that hyperphosphatemia with resulting high calcium phosphorus product had similar predictive value for mortality in pd and hemodialysis patients . having a serum phosphorus level > 1.78 mmol / l was associated with a time - dependent adjusted hazard ratios of 1.6 and 1.4 for all - cause mortality in pd and hemodialysis patients , respectively . these data clearly indicated that optimizing phosphorus control is equally important in pd as in hemodialysis patients . in vitro study showed that inorganic phosphate induced an osteoblastic phenotypic change in vascular smooth muscle cells which led to the deposition of calcium and phosphate - containing apatite crystals . this is in keeping with cross - sectional studies demonstrating an association between hyperphosphatemia and vascular calcification in esrd patients [ 8 , 10 , 12 , 33 ] . hyperphosphatemia is also associated with an increased risk of valvular calcification in patients on pd . previous longitudinal study showed a significant association between serum phosphorus and calcium phosphorus product with changes in coronary artery calcification over 1 year in pd patients , providing further evidence to support the involvement of hyperphosphatemia in vascular / valvular calcification in pd patients . as in hemodialysis patients , pd patients have a high prevalence of hyperphosphatemia . according to the necosad study , around 40% of the long - term pd patients had serum phosphorus level above the kidney disease outcome quality initiative ( k / doqi ) target of 1.78 this is very similar to our survey showing that around 40% of chinese pd patients had serum phosphorus level above the k / doqi target . one of the major clinical factors associated with hyperphosphatemia in pd patients was dietary protein intake . residual renal function is the other significant factor associated with serum phosphorus control in pd patients . on the other hand , among anuric pd patients , serum phosphorus showed the strongest correlation with pd clearance followed by normalized dietary protein intake . additionally , a total urea clearance of at least 2.0 and creatinine clearance of at least 60 l / wk per 1.73 m appeared to be optimal clearance targets that maintain serum phosphorus below 5 mg / dl in continuous ambulatory pd patients . given that it is extremely difficult to achieve a total weekly creatinine clearance of over 60 l with pd alone , these data suggest potential limitation of pd alone to achieve adequate phosphorus control in anuric pd patients . in keeping with these observations , our recent study demonstrated an increased prevalence of valvular calcification among anuric pd patients and was partly mediated via an increased calcium phosphorus product . apart from alterations in phosphorus metabolism , some of the therapeutic strategies for abnormal mineral metabolism and renal bone disease have been suggested to have the potential of worsening vascular calcification in esrd patients [ 8 , 40 ] . the use of very high doses of calcium - based binders for phosphorus control as well as the administration of large doses of vitamin d analogs for control of secondary hyperparathyroidism may contribute to episodes of hypercalcemia and/or hyperphosphatemia and may thus aggravate vascular calcification . chertow and coworkers have shown in a longitudinal study that calcium - based phosphate binders are especially associated with progressive coronary artery and aortic calcification in hemodialysis patients when mineral metabolism is poorly controlled . patients with low bone activity appeared to be particularly susceptible to worsening of vascular calcification and stiffening when exposed to an excess calcium load . this may be due to the inability of adynamic bone to incorporate extra calcium load and thus increases the risk of extraskeletal calcification . vascular / valvular calcification is now recognized to be an active , cellular - mediated process involving an osteogenic phenotypic change of vascular smooth muscle cells along with the dynamic interactions between calcification inducers and inhibitors . this is first evident by the accumulation of macrophages and t - lymphocytes other than low - density lipoprotein and lp(a ) lipoprotein in early aortic valve calcification [ 43 , 44 ] . subsequent study from our group showed an important link between inflammation and valvular calcification in pd patients . among patients with high calcium phosphorus product , the presence of both inflammation and malnutrition increased the prevalence of valvular calcification as compared to those with no evidence of inflammation and malnutrition . notably , even among patients with normal calcium phosphorus product , the presence of inflammation and malnutrition was associated with at least twofold increase in the prevalence of valvular calcification as compared to those with no inflammation or malnutrition at all . these data suggest that inflammation is predictive of an increased risk of valvular calcification independent of calcium phosphorus product . the presence of inflammation also predicts a more adverse clinical outcome among pd patients with valvular calcification . histopathological study showed markedly increased expression of c - reactive protein messenger ribonucleic acid ( mrna ) in the coronary vessels of renal patients compared to nonrenal patients in both calcified and noncalcified parts of arteries , suggesting that uremia itself was associated with increased vascular inflammation and that may mediate the development of vascular calcification . this is further supported by in vitro data showing that pooled uremic serum can induce accelerated calcification of vascular smooth muscle cells , regardless of the level of phosphorus . however , the exact uremic toxins that increase vascular calcification are currently not clear . in hemodialysis patients , c - reactive protein showed similar association with annualized change in coronary artery calcium score and has been associated with progression of abdominal calcification . inflammation has also been inversely related to circulating fetuin - a or alpha - heremans - schmid glycoprotein ( ahsg ) in both hemodialysis and pd patients [ 48 , 49 ] . these data add circumstantial evidence to support possible causal link between inflammation and calcification and warrant further investigation . circulating calcification inhibitors are increasingly recognized to play an important role in modifying the calcification risk of esrd patients . the presence of extensive calcification in various organs including the kidneys , lungs , myocardium , skin , and blood vessels in ahsg or fetuin - a deficient mice being fed a mineral and vitamin d rich diet provides novel evidence to support a crucial role of fetuin - a in inhibiting ectopic calcification . even though some studies suggested higher fetuin - a levels in pd than hemodialysis patients , lower serum fetuin - a was linked to an increased risk of all - cause mortality and cardiovascular death in both hemodialysis and pd patients . lower fetuin - a was associated with more inflammation and valvular calcification in pd patients and was inversely related to more aortic calcification in pediatric dialysis patients . all these data lent supporting evidence that fetuin - a may be involved in inhibiting vascular and valvular calcification . other circulating inhibitor such as pyrophosphate has recently been shown to be inversely related to the severity of coronary artery calcification and its circulating level did not seem to be affected by the severity of kidney disease , the modality of dialysis or inflammatory activity . matrix gla - protein ( mgp ) belongs to a family of the n - terminal -carboxylated ( gla ) proteins that require a vitamin k - dependent -carboxylation for their biological activation . the development of spontaneous vascular calcification in mgp - deficient mice was novel evidence to support a key role of mgp in inhibiting vascular calcification . a study in the general population indicated an inverse correlation between blood mgp levels and coronary artery calcification . however , the assay measured total blood levels of mgp without differentiating between undercarboxylated ( uc ) and carboxylated ( cmgp ) and without taking into account of tissue deposition . more recently , study showed that serum total uc - mgp was significantly reduced in hemodialysis patients compared to nonrenal failure population and markedly reduced in patients with calciphylaxis . serum total uc - mpg level was inversely correlated with serum phosphate but positively associated with serum fetuin - a . in a very recent study , lower circulating levels of dephosphorylated - carboxylated mgp ( de - cmgp ) patients with lower dp - cmgp level were also associated with more calcifications as denoted by a composite semiquantitative calcification score . however , it remains further elucidation whether circulating mgp directly reflects the biologically active mgp in the vasculature and may play a causative role in vascular calcification . osteoprotegerin ( opg ) belongs to the tumor necrosis factor - receptor gene superfamily and serves as a soluble decoy receptor for the receptor activator of nf--ligand ( rankl ) . the demonstration of medial calcification of the aorta and renal arteries in opg knockout animal suggests opg and its signaling pathway may play a role in medial arterial calcification . in the general population , serum opg was positively related to the extent and severity of coronary artery disease . serum opg was higher in dialysis patients than healthy controls and was independently associated with the severity of abdominal aortic calcification in hemodialysis patients . furthermore , both serum c - reactive protein and opg were higher among rapid progressors of abdominal calcification compared to slow progressors . further study will be required to investigate the exact role of opg in vascular calcification in esrd patients . other potential mechanisms of vascular calcification include vascular smooth muscle cells apoptosis and fgf-23 and klotho activity . there is in vitro evidence that chronic mineral dysregulation is capable of triggering vascular smooth muscle adaptation and release of matrix vesicles and that ultimately culminates in vascular smooth muscle cell apoptosis and vascular calcification [ 63 , 64 ] . the fibroblast growth factor-23 ( fgf-23)klotho activity plays an important role in the systemic regulation of phosphate homeostasis [ 65 , 66 ] . studies have shown that both fgf-23 and klotho knockout mice develop extensive vascular and soft tissue calcification [ 67 , 68 ] . serum calcium and 1,25 hydroxyvitamin d levels increased sodium phosphate cotransporter activity in both fgf23 and klotho ablated mice increases renal phosphate reabsorption which in turn can facilitate calcification . very recent study showed that klotho may exert direct effects on vascular smooth muscle cells and its deficiency may directly induce vascular calcification in uremia , suggesting that klotho may act as a novel circulating inhibitor of vascular calcification . current therapeutic strategies for vascular / valvular calcification in the esrd population are largely linked to management of mineral bone disorder associated with ckd such as control of hyperphosphatemia , avoiding , hypercalcemia and control of secondary hyperparathyroidism . a recent prospective analysis comparing 3555 patients who began treatment with phosphorus binders during the first 90 days after initiating hemodialysis versus 5055 patients who remained untreated clearly showed that the early use of phosphorus binders was independently associated with better survival . so far , there are no data as to whether the type of phosphorus binders may affect progression of vascular calcification in pd patients . study in pd patients showed that sevelamer hydrochloride provides a similar reduction in serum phosphorus compared to calcium - based binders as in hemodialysis patients . a number of prospective open - label randomized controlled trials in hemodialysis patients including the treat to goal study , and the renagel in new dialysis patients ( rind ) study , comparing sevelamer versus calcium - based binders suggested a slower progression of coronary artery calcification with sevelamer hydrochloride as compared to calcium - based binders . notably , in both studies [ 11 , 32 ] , sevelamer and calcium - based binders - treated patients achieved comparable serum phosphorus control , but serum calcium was significantly lower in calcium - based binder - treated patients versus sevelamer - treated patients . the reduced calcium load with resulting lower serum calcium may partly contribute to the slower progression of vascular calcification in sevelamer - treated patients . in the extended followup of the rind study , a significant survival benefit was observed in the sevelamer - treated patients as compared to patients treated with calcium - based binder . on the other hand , the calcium acetate renagel evaluation-2 ( care 2 ) study reported similar progression of coronary artery calcification with sevelamer and calcium acetate when statins were used to achieve a similar serum ldl - cholesterol in hemodialysis patients . in the dialysis clinical outcomes revisited ( dcor ) study , no significant difference was observed in the overall all - cause mortality between sevelamer and calcium - based binder treated hemodialysis patients . however , there is some suggestion that sevelamer treatment may be associated with lower overall mortality but not cardiovascular - related mortality among elderly patients . there is no data on the effect of lanthanum carbonate or other newer phosphorus binders on the progression of vascular calcification as compared to calcium - based binders in dialysis patients . given the current available evidence , the kidney disease improving global outcome ( kdigo ) guideline suggests restricting the dose of calcium - based binders in patients with stage 5d ckd including those on pd , in the presence of persistent or recurrent hypercalcemia , arterial calcification , adynamic bone disease , and persistently low parathyroid hormone . vitamin d receptor activator ( vdra ) has been the standard treatment for secondary hyperparathyroidism in patients with ckd . there is animal data to suggest that different vdras have differential effects on vascular calcification in uremia . in the study by mizobuchi et al . , paricalcitol , a selective vdra , showed no effects on serum calcium , phosphorus and aortic calcium content in uremic animals in contrast to other vdra such as calcitriol or doxercalciferol which increased serum calcium , phosphorus , and aortic calcium content . in addition , doxercalciferol treatment increased mrna and protein expression of bone - related markers runx2 and osteocalcin in the aorta , while paricalcitol did not . similar data suggest differential effects of paricalcitol and calcitriol on aortic wall remodeling in uninephrectomized apo - e knockout animals . there are observational data to suggest that use of paricalcitol was associated with survival advantage over calcitriol in hemodialysis patients . randomized controlled trials will be required to determine whether paricalcitol may be associated with less progression of vascular calcification compared to other vdra in the dialysis population . cinacalcet hydrochloride is a calcimimetic agent that inhibits parathyroid hormone secretion from the parathyroid cells by activation of the ca receptor and emerges as a novel therapeutic agent for the treatment of secondary hyperparathyroidism in patients with ckd . previous double - blind randomized placebo - controlled trial showed that cinacalcet had comparable efficacy in both hemodialysis and pd patients and effectively reduced calcium , phosphorus , and parathyroid hormone . in the more recent 33-week achieve study that randomized hemodialysis patients to receive either cinacalcet and low - dose vitamin d analog or flexible vitamin d analog , a more significant reduction in parathyroid hormone ( pth ) ( median percent change , 47% versus 11% ) , calcium , and phosphorus was observed in the cinacalcet and low - dose vitamin d analog treatment group as compared to flexible vitamin d analog group . studies in uremic animal models showed that calcimimetic is capable of inhibiting vascular calcification in contrast to calcitriol which induces vascular calcification [ 81 , 82 ] . in the advance trial , a prospective , randomized , controlled trial that evaluated the progression of vascular and cardiac valve calcification in 360 prevalent adult hemodialysis patients with secondary hyperparathyroidism after receiving treatment with cinacalcet plus low - dose vitamin d sterols versus flexible doses of vitamin d sterols alone , a trend towards less progression of coronary artery agatston calcium score was observed in the cinacalcet - treated group after 52 weeks versus the flexible vitamin d sterol group but did not reach statistical significance . the difference in the corresponding changes in volume scores between the two groups were , however , of statistical significance . furthermore , increases in calcium scores were consistently less in the aorta , aortic valve and mitral valve among subjects treated with cinacalcet plus low - dose vitamin d sterols versus the flexible vitamin d sterol group , and the differences were significant at the aortic valve . these data suggest that the use of cinacalcet may be associated with slower progression of vascular / valvular calcification as compared to flexible vitamin d sterol - treated patients . we await the results of another randomized trial , namely , the evolve ( evaluation of cinacalcet hcl therapy to lower cardiovascular events ) study to investigate whether cinacalcet treatment may confer survival benefit in hemodialysis patients with secondary hyperparathyroidism . there is so far no randomized controlled study in pd population that addresses the issue of vascular / valvular calcification and clinical outcomes in relation to vdra or cinacalcet . studies in in vitro cell culture model or ex vivo model suggested that aortic calcification requires the elevation of both calcium and phosphorus and that calcium rather than phosphate appears to have a more profound effect on aortic calcification [ 63 , 84 ] . however , in pd patients , a low calcium pd fluid may be associated with exacerbation of secondary hyperparathyroidism . thus , to help reduce calcium loads yet without exacerbating secondary hyperparathyroidism , the previous k / doqi guideline suggested that the dialysate calcium concentration in hemodialysis or pd should be maintained at 2.5 meq / l ( 1.25 mmol / l ) . the more recent 2009 kdigo guideline suggested that the dialysate calcium concentration in hemodialysis or pd patients should be between 2.5 ( 1.25 mmol / l ) and 3 meq / l ( 1.5 mmol / l ) . a dialysate calcium concentration above 3 meq / l ( 1.5 mmol / l ) is not recommended in dialysis patients as it results in positive calcium balance and increased risk of hypercalcemia . therefore , maintaining a neutral calcium balance appeared a reasonable goal in managing pd patients . there is so far very little data on the effect of dialysate calcium concentration on vascular calcification in pd patients . a small nonrandomized study suggested that patients receiving pd fluid of high calcium concentration , namely 1.75 mmol / l showed an increase in arterial stiffening as compared to those using low calcium concentration pd fluid which showed no change . these preliminary data suggest that high calcium exposure through pd solution may play a role in progressive arterial stiffening through an increase in vascular calcification and warrant further investigation . vascular and valvular calcifications are equally highly prevalent in esrd patients receiving pd treatment as in hemodialysis patients and are predictive of an increased mortality and adverse cardiovascular outcomes . current therapeutic strategies that may be of use in limiting progressive vascular / valvular calcification in pd patients are largely linked to management of mineral bone disorder associated with ckd including control of hyperphosphatemia , avoiding hypercalcemia , and control of secondary hyperparathyroidism . randomized controlled trials will be required to determine whether these strategies may reduce calcification burden and clinical outcomes in the pd population .

cardiovascular disease accounts over half of the total mortality in peritoneal dialysis ( pd ) patients . in addition , there is an increasing recognition of a high prevalence of vascular and valvular calcification that may contribute to the increased all - cause and cardiovascular mortality in the pd patients . disturbed mineral metabolism in association with chronic kidney disease has been suggested as one of the major contributing factors to the increased vascular / valvular calcification in this population . in this paper , we provide an overview of the prevalence and importance of this complication in the pd patients . in addition , we review the contributing factors and some emerging mechanisms for this complication . furthermore , we discuss some therapeutic strategies that may be useful in limiting the progression of vascular / valvular calcification in the pd population .

1. Introduction 2. Prevalence of Vascular and Valvular Calcification in PD Patients 3. Significance of Vascular/Valvular Calcification in PD Patients 4. Clinical Course of Vascular/Valvular Calcification in Long-Term PD Patients 5. Contributing Factors to Vascular/Valvular Calcification in PD Patients 6. Pathogenesis of Vascular/Valvular Calcification 7. Limiting the Progression of Vascular or Valvular Calcification in PD Patients 8. Conclusions

with the development of chemotherapy , control of metastatic colorectal cancer has increased in recent years . aggressive resection of distant metastases , local recurrence , or peritoneal dissemination has been performed , and good results have been reported [ 1 , 2 ] . particularly , aggressive resection has been recommended for hematogenous metastasis ; however , in pulmonary resection , the presence of mediastinal lymph node recurrence has been reported as a poor prognostic factor . recommendations for the resection of distant lymph node metastasis are lacking , but it is thought that solitary metastatic lesions should be resected . the development of various diagnostic imaging such as pet / ct has contributed enormously to performing preoperative staging and detecting postoperative recurrence . here , we present the case of a patient who had a solitary swollen mediastinal lymph node with high accumulation on pet / ct after primary resection of rectal cancer . however , histopathological results showed no metastasis , and he was diagnosed with reactive lymphadenitis . we report 1 case study of false - positive diagnosis on pet / ct and compare our findings with previous literature . a 60-year - old patient presented with positive fecal occult blood and was subsequently diagnosed with rectal cancer ( rs ) . histopathological examination revealed moderately differentiated adenocarcinoma , and the pathological stage was pt3n1m0 , pstage iiia ( fig . the oral fluoropyrimidine agent s-1 ( 80 mg / m per day , administered for 4 weeks with a 2-week resting period ) was administered for adjuvant chemotherapy . on postoperative day 239 , a ct scan revealed a solitary swollen mediastinal lymph node ( fig . 2a ) . the patient reported no symptoms of common cold , no palpable lymph nodes , and no murmur in the chest . laboratory data , including blood count , biochemical findings , and c - reactive protein , were within normal range . the serum cea level was also normal ( 1.8 ng / ml ; normal value , < 5.0 ng / ml ) ; before primary surgical treatment , it was 5.8 ng / ml . t2-weighted mri showed iso - high intensity , and diffusion - weighted mri showed a high signal at the tracheal bifurcation ( fig . pet / ct was performed , and abnormal f - fdg uptake appeared in the tracheal bifurcation . thoracoscopic mediastinal lymph node resection was performed in the prone position on postoperative day 281 . the surgical procedure was as follows : ( 1 ) a 12-mm port was inserted into the fifth intercostal space on the posterior axillary line with an 8-mm hg pneumothorax ; ( 2 ) a 12-mm camera port was inserted into the ninth intercostal space on the lower scapula line ; ( 3 ) a 5-mm port was inserted into the seventh intercostal space on the posterior axillary line . on histopathological examination , the resected specimen measuring 33 22 mm in diameter showed enlarged germinal centers without an epithelial component . immunostaining was performed to detect follicular lymphoma ; bcl-2 was negative , and the patient was diagnosed with reactive lymphadenitis ( fig . oral capecitabine ( xeloda , 3,600 mg per day , administered for 2 weeks with a 1-week resting period ) was administered for 6 months . imaging follow - up was performed 2 months after thoracoscopic lymph node resection by ct scan . we confirmed that the suspicious lymph node was resected and other recurrent lesions did not appear . the patient is alive at more than 15 months after his second surgery and is being followed up closely . since the publication of colorectal cancer treatment guidelines in japan , providing appropriate treatment for these patients has become mandatory . therefore , accurate preoperative diagnosis is important , and postoperative recurrence must be evaluated accurately by various methods of diagnostic imaging . given the advent of fdg- pet and pet / ct in recent years , pet imaging has become essential for improving the detection rate . studies have reported that pet imaging is more useful than mri or multidetector - row ct ( mdct ) [ 4 , 5 ] . however , in colorectal cancer , the diagnostic capability for lymph node metastasis ( reported as 2951% sensitivity , 85100% specificity , and 6775% diagnostic accuracy ) is insufficient compared to that for the primary tumor [ 6 , 7 , 9 ] . especially for sensitivity , diffusion - weighted mri is more useful than fdg - pet . in our hospital , the diagnosis rate of lymph node metastases using preoperative pet / ct for 42 patients with colorectal cancer tended to be lower in specificity ( 77% sensitivity , 71% specificity , and 74% accuracy ) . generally , local inflammation , abscess formation , inflammatory diseases , and lymphomas may be considered as the causes of false - positive lymph nodes on pet . although false - positive para - aortic lymph nodes are occasionally identified on pet , to our knowledge , pet false - positive cases associated with colorectal cancer in mediastinal lymph nodes have not been found . the use of pet / ct for identification of mediastinal lymph nodes has been reported . physiological accumulation is often observed in hilar lymph nodes and has the following features : ( 1 ) nearly equal accumulation intensity on both sides , and ( 2 ) no swollen lymph nodes in the mediastinum on ct . on the other hand , solitary mediastinal lymph node metastases of cases of colorectal cancer the present case did not meet the features of physiological accumulation in hilar lymph nodes and showed a solitary enlarged lymph node , high suvs , and high intensity on diffusion - weighted mri . therefore , we diagnosed the patient with mediastinal lymph node metastasis of colorectal cancer and performed surgical treatment . on the other hand , less invasive surgery is desirable for surgical treatment , and advances in video - assisted surgery have been remarkable in recent years . thoracoscopic esophagectomy has become widespread because it provides a magnified view and an easier approach to the mediastinum . the biggest advantage of the prone position is a good view of the surgical field without displacing the heart and right lung because of gravity and artificial pneumothorax . our case maximized the benefits of the prone position , and the patient had a good postoperative course . even though histopathological findings showed lymphadenitis , the patient had no distinct physical findings and inflammatory response . the possibility of viral infection can not be ruled out , although it was difficult to diagnose correctly before surgical treatment . in cancer treatment , it is necessary to decide the appropriate strategy on a case - by - case basis with due consideration of the limits of various methods of diagnostic imaging . moreover , evaluations of pre- and postoperative colorectal cancer recurrence and metastasis using integrated fdg pet / contrast - enhanced ct have been reported . kitajima et al . reported 170 postoperative cases , with 93.2% sensitivity , 95.8% specificity , and 94.7% accuracy . there is no consistent strategy for appropriate treatment of solitary lymph node metastasis in colorectal cancer patients . especially for pet - positive lesions , both sensitivity and specificity may be insufficient . mediastinoscopy and needle biopsy with bronchoscopy are useful methods ; however , the possibility of disseminated cancer cells remains . in conclusion , our case report suggests that it is necessary to understand the limits of the diagnostic accuracy of pet / ct in determining the indication for surgical treatment . additionally , the thoracoscopic approach in the prone position is one of the easy - to - use approaches to the mediastinum .

18f - fluorodeoxyglucose ( fdg ) positron emission tomography and computed tomography ( integrated fdg pet / ct ) has been used to diagnose recurrence and differentiate postoperative changes from lymph node metastasis in colorectal cancer , although its accuracy is questionable . we report a prone thoracoscopic surgery for a rectal cancer patient in which false - positive mediastinal lymph nodes were found on fdg - pet / ct . a 60-year - old man underwent a laparoscopic high anterior resection and d3 lymph node dissection for rectal cancer . the histopathological diagnosis was moderately differentiated adenocarcinoma of the rectum , stage iiib ( pt3n1m0 ) , necessitating oral fluoropyrimidine agent s-1 . after the primary surgery , a solitary mediastinal lymph node measuring 30 mm in diameter was detected , and abnormal accumulation was confirmed by fdg - pet / ct ( suvmax , 11.7 ) . thoracoscopic resection was performed in the prone position , but histopathological results showed no metastasis . he was subsequently diagnosed with reactive lymphadenitis . the patient was discharged on postoperative day 4 in good condition and is alive without recurrence 12 months after surgery . pet / ct is useful for the detection of colorectal cancer recurrence ; however , it does have a high false - positive rate for mediastinal lymph nodes . there is a limit to its diagnostic accuracy , and one must determine the indication for surgical treatment carefully . surgery in the prone position is a useful and minimally invasive approach to the mediastinum and allows aggressive resection to be performed .

Introduction Case Report Discussion Conclusions Disclosure Statement

colistin belongs to the polymyxin class of antibiotics which is a group of cationic polypeptides . however , the popularity rapidly faded in 1970s because of significant renal and neurological toxicity and was replaced with less toxic antibiotics with a comparable or broader antibacterial spectrum such as aminoglycosides . with the recent emergence of multi drug - resistant ( mdr ) gram - negative organisms , in particular pseudomonas aeruginosa , acinetobacter baumannii , and klebsiella pneumonia , colistin has been reconsidered as a potential therapeutic agent for the past 10 - 15 years . this has not only increased the clinical usage of this ancient drug , but has also increased the prevalence of all the toxicities related to colistin . neurotoxicity is the second most common toxicity after nephrotoxicity following colistin therapy . among the various manifestations of its neurotoxicity , several cases of respiratory failure due to colistin were reported in the previous era . however , a 31-year - old white female with history of spina bifida , paraplegia , hydrocephalus status post ventriculo - peritoneal shunt , osteomyelitis of the left hip status post left leg amputation , and chronic sacral decubitus ulcer presented with foul smelling discharge from her sacral wound for 2 weeks . the culture from the wound grew two biotypes of pseudomonas aeruginosa : one was resistant to all antibiotics except for colistin while the other was resistant to all antibiotics except for colistin and imipenem . in addition , methicillin - resistant staphylococcus aureus ( mrsa ) grew from the intraoperative bone culture . she was started on colistimethate sodium ( cms ) 200 mg intravenously every 12 hours for her mdr p. aeruginosa . she was then discharged to a sub - acute rehabilitation center on cms and vancomycin . after three days , she was noted to have sudden respiratory distress in the sub - acute rehabilitation center for which emergency medical service ( ems ) was called . on arrival she was immediately started on bag - valve mask ventilation ( bvm ) and was taken to the emergency room ( er ) . in the er , she was noted to have oxygen saturation at 80s on bvm and was emergently intubated . shortly after resuscitation , her arterial blood gas analysis revealed ph of 7.45 , paco2 of 25 , and pao2 of 280 mmhg ( on fio2 of 100% ) . her labs were significant for leukocytosis with white cell count of 20,000/mm and an acutely elevated creatinine of 2.2 mg / dl ( baseline creatinine was 0.9 mg / dl at the time of discharge ) with metabolic acidosis with bicarbonate of 18 mmol / l secondary to her renal failure . on further inquiry , there was no exposure to any narcotics or muscle relaxants that might have contributed to her respiratory depression . she was in a supervised unit prior to the presentation , which deterred the possibility of any toxic exposure to the patient . two sets of blood cultures were negative while the wound culture revealed the same biotypes of mdr p. aeruginosa . neurological workup was unrevealing and ventilation / perfusion scan ( v / q scan ) for pulmonary embolism was low probability . colistin was stopped as it was thought to be the cause of renal failure and respiratory failure and the patient was started on imipenem . her respiratory and neurological status remained stable during hospitalization and tolerated imipenem and vancomycin for her osteomyelitis and chronic decubitus ulcer infection . our patient developed acute respiratory failure requiring intubation and mechanical ventilation 6 days after initiation of colistin . respiratory muscle paralysis , as depicted , is one of the manifestations of the neurotoxic effect of colistin . we applied the naranjo adverse drug reaction probability scale to our case , which indicated a probable relationship . the case is limited with the unavailability of arterial blood gas prior to the event as she was emergently intubated on presentation . also , since colistin is reserved for severely ill patients with multiple co - morbidities , it may be difficult to establish direct causal relationship for acute respiratory failure and colistin . colistin was most likely to be the culprit of her respiratory failure from the timing of apnea as well as rapid recovery after stopping colistin . acute renal failure leading to presumed high concentration of serum colistin may be another contributory factor for her respiratory failure . she had a chronic deep vein thrombus which is unlikely to cause acute respiratory failure since low probability for pulmonary embolism by v / q scan and she recovered within 24 hours without any intervention . reported cases of respiratory paralysis associated with polymyxin / colistin use since 1960 to present colistin is also called polymyxin e and is a part of polymyxin family which is a group of polypeptide antibiotics . it exerts its bactericidal effect by displacing the divalent cations magnesium and calcium , which stabilize anionic lipopolysaccharide molecules in the outer membrane of gram - negative bacteria . however , they were gradually abandoned in most parts of the world because of nephrotoxicity and neurotoxicity . the emergence of mdr gram negative bacteria led to the revival of polymyxins in more recent era as a valuable therapeutic option . in the last decade , intravenous polymyxins , particularly in the form of cms , have been used to treat serious p. aeruginosa and a. baumannii infections of various types , including pneumonia , bacteremia , and urinary tract infections . the major manifestations of colistin induced neurotoxicity include dizziness , weakness , facial and peripheral paresthesias , vertigo , visual disturbances , confusion , ataxia , and neuromuscular blockade . koch - weser et al . , reported the incidence of the neurotoxic manifestations to be about 7% , paresthesias being the most common . the proposed mechanism is a non - competitive myoneuronal presynaptic blockade of acetylcholine release , in contrast to the competitive blockade by most other antibiotics like neomycin , kanamycin , and streptomycin . a total of 32 cases of colistin / polymyxin - induced respiratory failure were found in the literature . recent studies have depicted the toxicities associated with colistin use to be less frequent than previously described . the most important risk factor known to be associated with respiratory failure with polymyxin use is the renal disease , which was present in 24 out of 29 patients reported . patients with preexisting renal insufficiency had a greater likelihood of developing nephrotoxicity during colistin therapy , compared to patients with normal baseline renal function . concomitant drug therapies also play a major role in potentiating the effect of neuromuscular blockade , which was noted in 11 out of 29 patients . this includes use of other neurotoxic drugs ( anesthetics , aminoglycosides , and paralytics ) , corticosteroids , narcotics and/or muscle relaxants . most of the cases had other neuromuscular symptoms like circumoral tingling , paresthesias , and restlessness prior to the development of respiratory failure . the duration of apnea lasted from few hours up to several days , maximum noted to be 11 days and 20 out of 29 patients recovered , indicating reversibility of the blockade . the number of doses prior to the respiratory failure seems to be variable and range from a single dose to 45 doses [ table 1 ] . the management of patient with respiratory failure induced by colistin involves discontinuation of the drug and respiratory support . intermittent monitoring of unassisted tidal volumes and forced vital capacity using a bedside spirometer will help determine recovery . monitoring arterial blood gas more importantly , one should be alert for the possibility of respiratory paralysis in any patients receiving this antibiotic and particularly in those patients with renal abnormality and with concomitant neurotoxic drug use . careful observation , regular neurological monitoring , and early appreciation of the symptoms of neuromuscular toxicity especially of dyspnea and restlessness may prevent respiratory arrest . neostigmine is not indicated in polymyxin or colistin - induced neurotoxicity and may be contraindicated as seen in earlier experiments that the blocking action of polymyxin b was shown to be neostigmine resistant . animal studies have noted the ability of polymyxin b to discharge histamine from tissue mast cells , which lead to deposition of chelated calcium along the nerve sheaths , leading to toxicity . higginbotham also reported use of heparin prevents death from respiratory arrest in mice receiving colistin . the use of antihistamines and heparin in polymyxin induced respiratory failure has not been studied in human subjects . as the use of colistin increased in recent years for treatment of life - threatening mdr infections , there are more reports of associated toxicities . clinicians should be aware of colistin - related adverse reactions , especially nephrotoxicity and neurotoxicity . since the formulation of the drug itself has changed , it has necessitated new data with the new formulation . regular monitoring of renal function as well as development of a tool to monitor neurological toxicity is essential to prevent and manage the toxicities associated with colistin use .

the emergence of multi - drug - resistant gram negative bacillary infections has regained popularity of ancient drugs such as polymyxins . we report a case of acute respiratory failure induced by use of intravenous colistimethate , which is one of the forms of polymyxin . the patient is a 31 year old female with paraplegia due to spina bifida who underwent excisional debridement of large lumbosacral decubitus ulcer with osteomyelitis infected with pan - resistant pseudomonas aeruginosa and mrsa . six days after initiation of intravenous colistimethate and vancomycin , she developed acute respiratory failure requiring mechanical ventilation . pan - culture was negative including a chest radiograph . v / q scan showed low probability for pulmonary embolism . echocardiogram showed normal right ventricle with no strain or pulmonary hypertension . colistimethate was discontinued . within 24 hours , she was extubated . in the early years after introduction of polymyxin , there were several reports of acute respiratory paralysis . the mechanism is thought to be noncompetitive myoneuronal presynaptic blockade of acetylcholine release . though a direct causal relationship for respiratory failure is often difficult to establish in current era with multiple co morbidities , the timeframe of apnea , acuity of onset as well as rapid recovery in our case clearly point out the causal relationship . in addition , our patient also developed acute renal failure , presumably due to colistimethate induced nephrotoxicity , a possible contributing factor for her acute respiratory failure . in summary , colistimethate can induce acute neurotoxicity including respiratory muscular weakness and acute respiratory failure . clinicians should consider its toxicity in the differential diagnosis of acute respiratory failure especially in critically ill patients .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

variations in time , temperature , concentration , ph , and relative humidity may affect the sporicidal activity of various agents . accordingly , and especially for real - world situations , attention must be paid simultaneously to more than one controllable or uncontrollable factor . in tables 1 and 2 and in the discussion , we address some of the key ancillary factors . spores in liquid suspension exposed to flowing steam at 100c . rh , relative humidity ; conversions : 1 ppm = 1 mg / l ; mol / l = gram molecular weight / l ; 1 rad = 100 ergs / g ; and 1 watt = 10 ergs / s . boiling water for > 10 minutes , for example , can reduce b. anthracis spore counts by at least 10 ( table 1 ) . variations in time and temperature conditions required to reduce spore counts listed in table 1 can be attributed to differences in experimental conditions , strains of b. anthracis tested , or inoculum size . the u.s . environmental protection agency indicates that use of sodium hypochlorite as a sporicide is applicable under an emergency exemption ( section 18 : crisis exemption ; federal insecticide , fungicide , and rodenticide act ) ; as such , sodium hypochlorite may be used under the conditions specified ( 32 ) . given these conditions , the sporicidal effectiveness of hypochlorite solutions depends on the concentration of free available chlorine and ph . common household bleach ( sodium hypochlorite ) has a ph of 12 to prolong its shelf life . to achieve effective sporicidal activity , bleach must be diluted with water to increase the free available chlorine and acetic acid to change the ph of the solution to 7 ( 11 ) . ethylene oxide penetrates into porous material ( absorbed strongly by rubber and many plastics ) ; thus vapors are not readily eliminated by brief aeration . residual spores were not completely killed after a 30-minute exposure to chlorine dioxide at a relative humidity of 20% to 40% , whereas all spores were killed after a 15-minute exposure to chlorine dioxide with the addition of prehumidification at a relative humidity of 70% to 75% ( 21 ) . the amount of contamination , level of cleanliness of surfaces , and relative humidity will contribute to peracetic acid vapor s effectiveness as a sporicide ( 24 ) . the sporicidal property of ozone is affected by relative humidity : as relative humidity decreases , the time required for killing organisms increases ( 27 ) . decontamination of buildings from intentional release of b. anthracis is a new problem , and no accumulated scientific knowledge exists on the subject . two areas of prior scientific research may be relevant : food processing and laboratory decontamination . with modification based on further study , direct information on killing b. anthracis spores in foods by cooking is scarce , and the complexity of food matrices precludes easy extrapolation of the laboratory data into nonfood matrices . however , information on inactivating spores of bacterial species more resistant to environmental conditions than b. anthracis can provide guidance . the spores of clostridium botulinum are more resistant to heat inactivation than are b. anthracis spores ( 4 ) . the commercial retort process of canning achieves a 12-log reduction of c. botulinum spores , and by extension , should achieve a similar killing rate for b. anthracis spores . further research in this area is needed . historically , formaldehyde solution or gas has been used both as a disinfectant and chemical sterilant . formaldehyde was used to disinfect as early as the late 1880s and is still used to reprocess hemodialyzers for reuse on the same patient and to decontaminate biologic safety cabinets and laboratories ( 3537 ) . formaldehyde gas has been used for fumigation in the poultry industry and for disinfection of biologic safety cabinets and laboratories ( 38,39 ) . data from controlled experiments with b. globigii nctc 10073 spores have demonstrated the effect of humidity on formaldehyde concentration ( mg / m ) to obtain a > 8-log reduction in viable spores ( 15 ) . / l ) has also been used to treat a textile mill contaminated with b . gamma radiation was used in the 1960s and 1970s to disinfect b. anthracis contaminated imported bailed goat hair . a study by horne et al . suggested that a dose of 1.5 megarads from a 200,000-rad / hour cobalt source was sufficient to kill most resistant spores when mixed with goat hair ; after the intentional release of b. anthracis through the postal system in 2001 , pursuing a decontamination method for the undelivered mail was essential . gamma radiation was used to decontaminate all mail from contaminated facilities on the basis of these data . multiple technologies may be needed to decontaminate buildings and their contents . as in a laboratory , where some items are wiped , some items are autoclaved , and some spaces are treated with gas , more than one method may be required for decontamination . also , for certain decontamination tasks , e.g. , cleaning small heat - proof and water - proof objects , more than one option will be available . further , even within the context of one type of application ( e.g. , walls ; ducts for heating , ventilating , air conditioning , and refrigeration ; carpet ; and small objects ) , potentially conflicting priorities exist between bioefficacy , logistics , and safety . although transferring the methods used to decontaminate or sterilize laboratory or food industry settings to decontaminating buildings may be useful , this transfer of methods has not been scientifically tested . also , much of the data available is based on other bacillus species ; more testing with or correlation to b. anthracis contamination is suggested . second , choosing between technologies is a complex issue , and a formal decision process would be useful . various parties in the public and private sector have suggested numerous , sometimes disparate , methods for the inactivation of b. anthracis spores in contaminated environments . further research is needed regarding improved methods for remediation of environments contaminated with b. anthracis spores , and the literature summarized here provides a basis for that effort .

after the intentional release of bacillus anthracis through the u.s . postal service in the fall of 2001 , many environments were contaminated with b. anthracis spores , and frequent inquiries were made regarding the science of destroying these spores . we conducted a survey of the literature that had potential application to the inactivation of b. anthracis spores . this article provides a tabular summary of the results .

Review Discussion Summary

deep brain stimulators ( dbs ) are increasingly used to treat carefully selected cases of movement disorders , pain , and psychiatric disorders that respond poorly to medical therapy . anaesthesiologist may be involved in the implantation procedure or more frequently when these patients present for non - related medical or surgical illnesses . patients with long standing parkinson disease ( pd ) with dbs for surgery pose significant challenges to the anaesthesiologist in view of primary pathology , multisystem involvement , potential drug interactions , and risk of dbs malfunction by interference with monitoring and therapeutic electromagnetic devices . on reviewing the literature , we did not find any published report of shoulder arthroscopic surgery in a patient of pd with dbs and report the same . fifty - nine - year - old female presented to our hospital for arthroscopic repair of rotator cuff tear of right shoulder caused by a fall . she was a known case of pd since last 20 years with the history of slowing of movements , stiffness , speech disturbance , and tremors controlled only after the implantation of dbs 8 years back . she gave the past history of snoring , mild gastro - oesophageal reflux , depression , laparoscopic cholecystectomy , and three surgeries related to dbs . her medical therapy included tablet l - dopa plus carbidopa , bromocriptine , clonazepam , escitalopram , and trihexyphenidyl . patient weighed 80 kg , 155 cm tall ( body mass index 32 kg / m ) with a mouth opening of 4.5 cm , removable complete artificial denture , mallampati grade 3 , limited neck extension , and a thyromental distance of 6.2 cm . her pulse rate was 96/min , noninvasive blood pressure ( nibp ) 135/84 mmhg , breath holding time 20s , and chest auscultation was normal . examination of central nervous system revealed cog - wheel rigidity , short shuffling gait , and mild tremors . chest radiograph showed ipg with leads of dbs on the left side , which was otherwise normal [ figure 1 ] . she was assessed by a neurologist , dbs was interrogated , a procedure where battery life and device settings are evaluated and manipulated noninvasively . she was taken up for shoulder arthroscopy with informed high risk consent in view of long standing pd and dbs , kept nil per oral after midnight , and advised to continue all her medications till the morning of surgery along with tablet ranitidine 150 mg . operation room ( or ) and drugs were prepared ; difficult airway cart was kept ready . after placing standard monitors we gave iv midazolam 1 mg and oxygen by facemask . right - sided brachial plexus block by the interscalene approach using a peripheral nerve stimulator ( pns ) was given using 21 g , 50 mm insulated pns needle with 25 ml of 0.25% bupivacaine after eliciting contraction of muscles at and below shoulder at a current of 0.4 ma . after observing for 10 min , she was placed in ramp position ; general anaesthesia was induced with iv fentanyl 100 g , propofol 100 mg , vecuronium 8 mg and trachea was intubated . patient was placed in left lateral position taking care to pad all the pressure points including dbs skin site , eye , and breast care . anaesthesia was maintained with nitrous oxide ( 50% ) and isoflurane ( 0.6 - 0.8% ) in oxygen , iv fentanyl and vecuronium . her baseline heart rate was 80 beats per minute ( bpm ) and remained between 68 - 80 bpm throughout the procedure . baseline bp was 140/80 mm hg , sbp was maintained between 110 - 140 mm hg , dbp was maintained between 66 - 84 mm hg intraoperatively . thirty minutes after the onset of surgical procedure , patient 's bp rose to 190/90 mm hg which was controlled with nitroglycerine infusion ( 0.7 - 1 g / kg / min ) after ensuring adequate analgesia and muscle relaxation . postinduction iv dexamethasone 8 mg for prophylaxis of ponv and diclofenac sodium 75 mg was administered towards the end of surgery . surgeons used 26 1 ( litres ) of normal saline for irrigation of shoulder joint using arthroscopic infusion pump at a pressure of 70 mm hg . arthroscopic repair and subacromial decompression lasted 1.5 h. before closure of arthroscopic ports , fluid was vented out . after turning the patient supine , neck circumference was measured and was same as preoperatively . dbs was turned on by the trained personnel , reprogrammed to its original setting was functional . at return of spontaneous respiratory efforts , patient was conscious , haemodynamically stable and followed verbal commands with a visual analog score of 4 for pain . fifty - nine - year - old lady with pd with dbs in situ with complete rotator cuff tear was successfully managed using general anaesthesia with interscalene approach of brachial plexus block for arthroscopic repair . in contrast to the neurodestructive procedures practiced earlier like thalamotomy and palladotomy , the dbs offers the advantages of reversibility , adjustability , nondestructive nature , and long - term treatment . the high suppressive frequency ( 130 - 180 hz ) of dbs suppresses the overactivity in the pallidum , subthalamic nuclei or thalamus in pd patients . when these patients present for coincidental surgery , functionality of dbs should always be assessed in the preoperative period , precautions should be taken to prevent dbs malfunction intraoperatively and its function should be reassessed postoperatively . technical problems such as wire breakage , migration after insertion , twiddler syndrome ( malfunction of a device due to manipulation of either implantable generator or pacing leads ) should be ruled out . shoulder arthroscopy for the rotator cuff tear requires expansion of glenohumeral and subacromial area by irrigating large amounts of fluids for good visualization . as the subacromial area is uncapsulated , it communicates well via various anatomical planes to the soft tissues of the neck and chest with the risk of fluid extravasation into these areas . it can even cause external compression on the larynx and trachea with life - threatening airway obstruction . in our patient , dbs battery with its leads was located in close vicinity of the operative site . in the absence of the published literature , as an added precaution to prevent dbs malfunction we decided to switch off the dbs after inducing the patient to sleep as she had disabling tremor that was physically and psychologically distressing in the absence of dbs . , pns can be used safely for neuromuscular block assessment and for peripheral nerve blocks . an alternative is ultrasound - guided nerve block , but this modality was not available to us . interscalene block probably contributed to reduction of general anaesthetics as our patient required no vecurinium top - ups and minimal isoflurane . it also contributes to good surgical field with use of lesser amounts of irrigating fluids at a lower pressure , quick emergence from anaesthesia , and good postoperative analgesia . continuous delivery of antiparkinsonian medications during perioperative period is desirable to avoid off symptoms and increased peri- and postoperative complications . alternative routes of administration for continuous drug delivery such as nasogastric or intraduodenal levodopa , iv amantadine , subcutaneous apomorphine , transdermal rotigotine patch may be resorted to in situations where patients are not going to be started orally in the immediate postoperative period . drugs with extrapyramidal side effects such as metoclopramide , phenothiazines , and butyrophenones should be avoided . autonomic dysfunction in our patient with longstanding pd probably contributed to intraoperative rise of blood pressure in our patient . in the view of the presence of dbs , preoperative shoulder injury evaluation of our patient was done by ultrasound rather than mri that is the usual practice . powerful electromagnetic fields of mri can produce heating effects , movement of neurostimulator , induced stimulation , or dbs malfunction . ct scans , fluoroscopy , and plain x - rays can be performed as usual . defibrillator paddles and ground plate of unipolar diathermy should be placed as far from the neurostimulator as possible and perpendicular to it with use of lowest clinically appropriate energy output . after use of diathermy and external defibrillator , adequate function of neurostimulator should be confirmed . in our patient , radiofrequency ablation ( bipolar device ) was used for surgical haemostasis . as the number of patients with dbs are increasing , they can present even for emergency surgery when there is limited time and resources available for assessing the dbs . successful management of a patient of pd with dbs requires meticulous preoperative assessment , planning , continuation of antiparkinsonian drugs , avoidance of drugs precipitating parkinsonian symptoms , and adherence to precautions to avoid dbs malfunction . combination of general anaesthesia with interscalene approach brachial plexus block provides ideal conditions for these patients undergoing shoulder arthroscopy .

we describe the anaesthetic management of arthroscopic repair for complete rotator cuff tear of shoulder in a 59-year - old female with parkinson 's disease ( pd ) with deep brain stimulator ( dbs ) using a combination of general anaesthesia with interscalene approach to brachial plexus block . the dbs consists of implanted electrodes in the brain connected to the implantable pulse generator ( ipg ) normally placed in the anterior chest wall subcutaneously . it can be programmed externally from a hand - held device placed directly over the battery stimulator unit . in our patient , ipg with its leads was located in close vicinity of the operative site with potential for dbs malfunction . implications of dbs in a patient with pd for shoulder arthroscopy for anaesthesiologist are discussed along with a brief review of dbs .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

the diagnoses of these disorders are primarily based on history , clinical features , and histopathology . the oral mucocutaneous lesions cause diagnostic problems , as these lesions resemble each other , and routine tissue biopsies may only offer a diagnosis of non - specific inflammation.1 for the past few years , immunofluorescence techniques emerged as an important tool in detecting the pathogenesis and diagnosis of oral mucocutaneous lesions ( and vesiculobullous disorders ) . two types of immunofluorescence techniques that commonly followed are direct immunofluorescence ( dif ) and indirect immunofluorescence ( iif ) . in some diseases , iif studies have revealed circulating autoantibodies2,3 whereas dif studies have revealed immunoglobulins , complement components and other protein substances within the affected tissue.4 these circulating and tissue - bound substances may have a role in the immunopathogenesis of these diseases . in addition detection of these immune reactive substances by dif aids in the diagnosis of many skin and mucosal diseases.1 the presence of characteristic fluorescent patterns in dif can definitely establish the diagnosis of pemphigus and pemphigoid and strongly indicate the likelihood of lichen planus ( lp ) and lupus erythematosus . the absence of these fluorescent patterns rules out these conditions , thereby strengthening the diagnosis of other oral mucosal diseases . the results of dif are sufficiently useful in the diagnosis of chronic ulcerative diseases of the oral mucosa.1 based on these facts , a prospective study of oral mucocutaneous lesions was designed to evaluate the consistency of the histopathology with dif . a retrospective analysis of the prevalence of oral mucocutaneous lesions namely oral lp ( olp ) , discoid lupus erythematosus ( dle ) , pemphigus vulgaris ( pv ) , and mucous membrane pemphigoid ( mmp ) were also studied with regards to demographic details and histopathological features ( hematoxylin and eosin stained sections ) that are characteristic of each disease were evaluated . twenty consecutive subjects in each of olp , dle , pv , and ten consecutive subject of mmp ( total 70 subjects ) were retrieved from the oral pathology files of tamil nadu govt . dental college and reviewed for salient features including age , gender , and intraoral site of the lesion . hematoxylin and eosin ( h and e ) stained sections of all the 70 subjects were reviewed , and the histopathological patterns were evaluated ( retrospective study ) . twelve subjects with chronic or recurrent ulcerative or erosive or vesiculobullous diseases of the oral mucosa were included for the prospective study . specimens were examined by routine histopathological methods ( h and e ) and dif . specimens for dif study were quickly washed in normal saline and stored immediately in michel s media and transported to the laboratory . the retrospective study comprised of 70 subjects - 20 subjects in each of olp , dle , and pv and 10 subjects of mmp . eleven males affected against 9 females ( 1:0:81 ) . fifth decade was predominantly involved - 30% ( 6 subjects ) . youngest involved was 11 years , and oldest was 72 years , mean age - 42.05 years . histopathologically , basal cell degeneration and subepithelial band of chronic inflammatory cells were seen in 100% of subjects . seven males affected against 13 females , sixth decade was predominantly involved - 45% ( 9 subjects ) . youngest individual was 33 years , and oldest was 78 years mean age - 52 years . histopathologically , epithelium ulcerated in 40% of subjects , intact basal cells attached to connective tissue seen in 100% of subjects , acantholytic ( tzanck ) cells seen in 85% of subjects and dense chronic inflammatory cells seen in the connective tissue in 55% subjects . seven males affected against 3 females ( 1:0.42 ) fifth and sixth decades were predominantly involved - 60% ( 6 subjects ) . youngest individual was 33 years , and oldest was 70 years , mean age - 48 years . histopathologically , subepithelial split was seen in 100% of the subjects , 40% showed inflammatory cells and red blood cells in the split , diffuse chronic inflammatory cells seen in the connective tissue in 90% of subjects and increased vascularity seen in 50% of subjects . five males affected against 15 females ( 1:3 ) , third and fourth decades were predominantly involved - 45% ( 9 subjects ) . youngest individual was 17 years , and oldest was 70 years mean age - 42 years . histopathologically , basal cell degeneration was seen in 80% and perivascular chronic inflammatory cells in 85% of subjects . histopathology showed 3 cases of lp , 4 cases of mmp and 5 cases were diagnosed as non - specific chronic inflammatory lesions . in dif study - 5 subjects were negative . 3 were reported as olp ( figure 1 ) , 2 were interpreted as pv ( figure 2 ) and 1 each of mmp ( figure 3 ) and lp pemphigoides ( figure 4 ) . histopathological diagnosis consistent with dif in 8 cases ( 66% ) ( 3 olp , 1 mmp and 4 non - specific inflammation ) . ( lichen planus ) , ( a ) hyperkeratosis , basal cell degeneration of epithelium along with subepithelial band of chronic inflammatory cells ( h and e , 10 ) , ( b ) direct immunofluorescence showing fibrin deposition along the basement membrane zone . ( pemphigus vulgaris ) ( a ) supra basal cleft with tzanck cells and intact basal layer ( h and e , 40 ) , ( b ) direct immunofluorescence showing intercellular space deposition of immunoglobulin g in the epithelium . ( mucous membrane pemphigoid ) ( a ) subepithelial cleft between epithelium and connective tissue ( h and e , 10 ) , ( b ) direct immunofluorescence showing smooth , linear , and continuous band of c3 deposit along the basement membrane zone . ( lichen planus pemphigoides ) direct immunofluorescence showing linear deposit of c3 along the basement membrane zone . the histopathological diagnosis and dif study were not consistent in four subjects in which one case diagnosed histopathologically as non - specific chronic inflammatory lesion showed positivity for lp pemphigoides in dif . among the other three cases , one diagnosed histopathologically as mmp was negative in dif and two cases which were diagnosed as mmp histopathologically were found to show positivity for pv in dif ( table 2 ) . the retrospective study comprised of 70 subjects - 20 subjects in each of olp , dle , and pv and 10 subjects of mmp . eleven males affected against 9 females ( 1:0:81 ) . fifth decade was predominantly involved - 30% ( 6 subjects ) . youngest involved was 11 years , and oldest was 72 years , mean age - 42.05 years . histopathologically , basal cell degeneration and subepithelial band of chronic inflammatory cells were seen in 100% of subjects . seven males affected against 13 females , sixth decade was predominantly involved - 45% ( 9 subjects ) . youngest individual was 33 years , and oldest was 78 years mean age - 52 years . histopathologically , epithelium ulcerated in 40% of subjects , intact basal cells attached to connective tissue seen in 100% of subjects , acantholytic ( tzanck ) cells seen in 85% of subjects and dense chronic inflammatory cells seen in the connective tissue in 55% subjects . seven males affected against 3 females ( 1:0.42 ) fifth and sixth decades were predominantly involved - 60% ( 6 subjects ) . youngest individual was 33 years , and oldest was 70 years , mean age - 48 years . histopathologically , subepithelial split was seen in 100% of the subjects , 40% showed inflammatory cells and red blood cells in the split , diffuse chronic inflammatory cells seen in the connective tissue in 90% of subjects and increased vascularity seen in 50% of subjects . five males affected against 15 females ( 1:3 ) , third and fourth decades were predominantly involved - 45% ( 9 subjects ) . youngest individual was 17 years , and oldest was 70 years mean age - 42 years . histopathologically , basal cell degeneration was seen in 80% and perivascular chronic inflammatory cells in 85% of subjects . histopathology showed 3 cases of lp , 4 cases of mmp and 5 cases were diagnosed as non - specific chronic inflammatory lesions . in dif study - 5 subjects were negative . 3 were reported as olp ( figure 1 ) , 2 were interpreted as pv ( figure 2 ) and 1 each of mmp ( figure 3 ) and lp pemphigoides ( figure 4 ) . histopathological diagnosis consistent with dif in 8 cases ( 66% ) ( 3 olp , 1 mmp and 4 non - specific inflammation ) . ( lichen planus ) , ( a ) hyperkeratosis , basal cell degeneration of epithelium along with subepithelial band of chronic inflammatory cells ( h and e , 10 ) , ( b ) direct immunofluorescence showing fibrin deposition along the basement membrane zone . ( pemphigus vulgaris ) ( a ) supra basal cleft with tzanck cells and intact basal layer ( h and e , 40 ) , ( b ) direct immunofluorescence showing intercellular space deposition of immunoglobulin g in the epithelium . ( mucous membrane pemphigoid ) ( a ) subepithelial cleft between epithelium and connective tissue ( h and e , 10 ) , ( b ) direct immunofluorescence showing smooth , linear , and continuous band of c3 deposit along the basement membrane zone . ( lichen planus pemphigoides ) direct immunofluorescence showing linear deposit of c3 along the basement membrane zone . the histopathological diagnosis and dif study were not consistent in four subjects in which one case diagnosed histopathologically as non - specific chronic inflammatory lesion showed positivity for lp pemphigoides in dif . among the other three cases , one diagnosed histopathologically as mmp was negative in dif and two cases which were diagnosed as mmp histopathologically were found to show positivity for pv in dif ( table 2 ) . mucocutaneous disorders ( lp , dle , pv , and mmp ) usually present themselves as chronic recurring ulcerations or vesiculobullous lesions , causing patients to seek diagnosis and treatment . though histopathology remains the gold standard for the diagnosis , in the past few year immunofluorescent techniques emerged as a valuable tool in the diagnosis of ulcerative and vesiculobullous mucocutaneous disorders.1 lp is predominantly a disease of the middle - aged and elderly with age ranging between 30 and 70 years.5 in the present study also , 65% of the patients were in the same age groups . lp affects both the sexes , although occasionally some survey have suggested a male predominance , majority suggested a female predilection.6,7 the slight male predilection in the present study ( m : f=1:0.81 ) may be due to the small sample size . similar to the most of the studies in the literature,5 the present study also showed buccal mucosal predominance . similar to most of the studies,6 histopathology of the present study also showed hyperorthokeratosis , basal all degeneration , and subepithelial band of chronic inflammatory cells in 60% , 100% , and 100% of the subjects , respectively . it is also considerably more common in women than men.6,8 the present study also showed most of the subjects in the third and fourth decades ( 45% ) with a male : female ratio of 1:3 . as with the other studies,8,9 lip is the most common site of involvement in the present study ( 85% ) . a survey of literature showed that dle lesions are characterized by hyperkeratosis , basal cell degeneration , perivasular lymphocytic infiltrate , and band like inflammatory cells in the lamina propria.10 the present study also showed basal cell degeneration , subepithelial band of chronic inflammatory cells , and perivascular chronic inflammation in 80% , 55% , and 85% , of the subjects , respectively . epithelial atrophy alternating with hyperplasia showed a high diagnostic value for dle against lp.10 this feature was seen in 35% subjects of the present study . pv predominantly seen between third and seventh decades and females were commonly involved . in the present study also 96% of the subjects were between third and seventh decades and female to male ratio was 1:0.53 . as with the majority of the studies6,8,11 in the present study also buccal mucosa was affected in 60% of the subjects . the formation of bulla is entirely intraepithelial just above the basal layer,8 tzanck cells and intact basal cells attached to connective tissue were seen in 80% , 85% , and 100% of the subjects , respectively . in contrast to other studies,8,11 present study showed dense chronic inflammatory cells infiltrate in 55% of subjects . mmp usually affects older persons ( fifth - eighth decade ) , females are commonly involved ( f : m : 2:1)6 in the present study also 70% of the patients were in the age group of fifth to eighth decades . more number of males ( 70% ) affected in the present study may be attributed to the small sample size . gingiva is the most common site of involvement followed by buccal mucosa.8,12 in the present study also gingiva was involved in 60% of subjects and the sub epithelial split and diffuse chronic inflammatory cell infiltrate were seen in 100% and 90% of the subjects , this is in accordance with the previous studies.8,12 in our prospective study of 12 subjects of oral mucosal lesions by dif , 5 were negative , 3 were lp , 2 were pv , and one each of mmp and lp pemphigoides . histopathological diagnosis was consistent with dif in 66% of subjects , and this was in accordance with the previous studies by daniels and carmen.1 histopathological and dif results were similar in 3 cases of olp , and one case of mmp and 4 subjects which were found to be non - specific inflammation were also found to be negative in dif study . negative results in dif will help us to rule out those diseases which produces specific fluorescent patterns and thereby strengthening the diagnosis of other oral mucosal lesions . though in some cases histopathology is not consistent with dif both were able to offer diagnosis in 2/3 of the subjects . early diagnosis of mmp is important since the prevalence of concurrent eye lesions is greater with oral lesions . dif is more specific and sensitive than histopathology and electron microscopy in diagnosing mmp.13 - 15 immunofluorescence analysis is also a helpful tool in monitoring therapeutic responses of these lesions by analyzing the lesion specific autoantibodies.16 although the histopathology remains the gold standard for the diagnosis of most of the diseases , it is inferred from this study that not all lesions are amenable to a definitive diagnosis . due to the accuracy of dlf study in diagnosing diseases , its report is taken as the final diagnosis , which ascertains the course and prognosis of the disease . however , the consistency of the dlf in this study can not be substantiated due to the limited sample size which is attributed to cost effectiveness of the dlf technique .

background : oral mucosa is often affected by many diseases including mucocutaneous disorders . the diagnoses of these disorders are primarily based on history , clinical features , and histopathology . for the past few years immunofluorescence techniques emerged as an important tool to study the pathogenesis and in the diagnosis of oral mucocutaneous and vesiculobullous disorders . the present study was designed to carry out retrospective and prospective analysis of oral mucocutaneous lesions to elucidate the clinicopathologic features and its immunofluorescence findings.materials and methods : a total of 70 subjects with oral mucocutaneous lesions were retrieved from the oral pathology files of tamil nadu govt . dental college and their clinical features were evaluated , and the histopathology was also evaluated with the help of hematoxylin and eosin stained sections . for the prospective study , biopsy from 12 subjects with oral mucocutaneous lesions was subjected to routine histopathological examination and dif to evaluate the consistency of the methods.results:in the retrospective analysis of 70 subjects with oral mucocutaneous lesions in relation to clinical features and histopathology , most of the findings were similar to the previous studies except for few criteria like male predilection in lichen planus and mucous membrane pemphigoid ( mmp ) and more prevalence of pemphigus vulgaris than mmp ( 2:1 ) . in the prospective analysis of 12 subjects , the histopathological diagnosis was consistent with dif study in 66% of cases.conclusion:the diagnostic efficiency of oral mucocutaneous lesions can be improved by modern tools like dif studies in addition to traditional methods like clinical and histopathology .

Introduction Materials and Methods Results Retrospective evaluation OLP PV MMP DLE Prospective evaluation Discussion Conclusion

coevolutionary theories in the study of host parasite interactions indicate that antagonistic reciprocal selection pressures will lead to an arms race with a series of adaptations and counter - adaptations by the host and parasite ( thompson 1994 ) . such antagonistic interactions actually accelerate molecular evolution compared to selection pressures of environmental changes ( paterson et al . the evolutionary dynamics of a host parasite coevolution can lead to a relatively stable relationship , that is , fitness optimality for the host and/or the parasite , by means of a natural selection process ( schmid - hempel 2010 ) . the ectoparasitic mite , varroa destructor ( fig . 1 ) , causes relatively little harm to its original host the asian honey bee , apis cerana , as behavioral and physiological traits of the host limit the mite population growth ( reviewed in rath 1999 ) . varroa mites were introduced to the western honey bee , apis mellifera , over 30 years ago and has since become the largest threat to honey bees and apiculture around the world . the mite is in part responsible for the recent global honey bee colony losses that have caused ecological and economical pressures on plant biodiversity and crop production , respectively ( potts et al . 2010 ) . the coevolutionary process required for establishing a coexisting relationship between this parasite and its new host is lacking , both in time and in selective pressures because the selective disadvantage of being virulent is removed by apicultural practices aiming to control this damaging new mite pest . varroa destructor mite on the thorax of a male european honey bee ( apismellifera ) . the varroa mite is a highly specific parasite that relies completely on its host biology for its own survival and propagation . the mite feeds on bee hemolymph and reproduces in the brood cells of pupating bees . moreover , the mite is an important component in the virulence of certain honey bee viruses , additional microparasites in this complex system of host parasite interactions . in the absence of varroa mites , honey bee viruses can occur as symptomless covert infections within a colony but when varroa mites are present , a new transmission route is provided by this biological vector ( martin 2001 ; shen et al . 2005 ; gisder et al . according to theories in evolutionary epidemiology , vector - borne transmission often results in more virulent infections ( ewald 1994 ) . as the mite population grows within a colony , increasing opportunities for transmission will lead to the development of overt viral infections that ultimately result in colony mortality within one to three years if the mite population is not reduced by beekeepers ( martin 2001 ; boecking and genersch 2008 ) . therefore , the virulence of the mite is considered an indirect measure of its ability to vector these viruses . consequently , the viruses with a newly acquired vectorial transmission route will become more virulent , as their virulence is in general a measure of mite abundance . apis mellifera races in africa , a. m. scutellata , and in south and central america , of african origin ( africanized bees ) , are exceptions to the eventual mortality associated with mite infestation ( rosenkranz 1999 ; allsopp 2006 ) . wild and feral colonies under natural selective pressures in these populations have evolved resistance and are able to pass traits to managed colonies through natural mating events ( rosenkranz 1999 ) . wild and feral colonies are rare in europe and north america since the introduction of the mite ; however , a few subset populations of european honey bee races have been exposed to natural selective pressures of long - term mite infestation , as opposed to apicultural pressures or selective breeding programs . remarkably , these natural populations have been sustainably surviving mite infestation for extended periods , some over 10 years , without mite control treatments ( de jong and soares 1997 ; rinderer et al . 2001 ; kefuss et al . 2004 ; fries et al . 2006 ; le conte et al . 2007 ; seeley 2007 ) . parasite coevolution between european honey bees and varroa , though such studies have been lacking . recently , the long - term survival despite mite infestation of one such population on the island of gotland , sweden , has been confirmed to be a host adaptation rather than reduced virulence of the mite ( fries and bommarco 2007 ) and reduced mite reproductive success has been observed in this european honey bee populations have developed resistance to varroa mites and if so , has the same mechanisms of adaptive resistance occurred . the ability of a host to suppress the reproductive success and ultimately the population growth rate of a parasite has a strong adaptive value that would be an effective strategy toward establishing host resistance . successful mite reproduction requires the maturation of at least two eggs laid by a reproducing mother mite inside the brood cell : a male mite and a sister female mite , which must mate before bee eclosion ( rosenkranz et al . the male mite offspring will die when the bee hatches from the cell but any mated daughter mites will enter the colony 's mite population along with their mother to find a new brood cell for reproduction . this population has survived mite infestation without mite control treatment for an extended period of time ( i.e. , over 10 years ; le conte et al . varroa mite reproductive parameters are compared to findings of a previous study on the gotland population in sweden by locke and fries ( 2011 ) to determine whether adaptive strategies to resist varroa were similar or differed between geographically and genetically separate populations that are experiencing similar selective pressures . mite reproductive success is defined here as the ability of the mother mite to produce at least one viable mated female offspring before the developing bee pupa hatches as an adult . within a mite 's reproductive phase , a mother mite that lays no eggs , lays only one egg , produces no male offspring , or begins egg - laying too late in relation to larval development data for the avignon population that has survived since 1999 were collected in september 2009 and july 2010 in france . data from the mite - surviving population in gotland , sweden , used for comparison with the french population , were collected in july and august in both 2008 and 2009 ( locke and fries 2011 ) . both populations were compared first with mite - susceptible control colonies in the same location to determine any significant differences in the mite reproductive parameters . these control colonies were of different genetic background and receiving regular beekeeping management including varroa population control treatment during the autumn before experimentation . detailed descriptions of the methods for investigating mite reproductive success are found in locke and fries ( 2011 ) . in short , worker bee pupae older than approximately 190 h ( brown eyes and yellow body stage ) , but before pupal eclosion at approximately 280 h ( martin 1994 ) , were carefully removed in the laboratory . the developmental stage of each pupa was recorded based on the appearance description given by martin ( 1994 ) . complete mite families from cells infested with a single mother mite were removed using a fine brush , examined with a stereo - microscope and recorded . in france , 430 cells infested by a single mother mite were examined in 16 varroa - surviving colonies , and 211 such cells were examined in eight varroa - susceptible control colonies . in sweden , 614 cells were examined in 23 surviving colonies , and 592 cells were examined in 21 control colonies . observations were most often of 30 cells per colony but varied between 10 and 35 cells with lower numbers for those colonies where not enough mite - infested cells were found . within each pupal cell , the following parameters were recorded : the fertility ( whether the mother mite laid eggs ) ; the fecundity ( number of eggs laid ) ; the presence or absence of male offspring ; the number of dead offspring ; and the incidence of delayed egg - laying by mother mites ( identified by relating the developmental stage of mite offspring to the developmental appearance , and thus the determined age , of the infested pupa ) . the yellow thorax stage of the pupae , that is , the earliest stage of pupal exocuticle sclerotization , is the longest stage ranging from approximately 190230 h old . however , the male mite typically does not become an adult until the pupal age is around 210 h ( martin 1994 ) . therefore , to eliminate biased recordings , any yellow thorax stage infested pupa where no adult male mite was observed was recorded as uncertain since immature male mites are extremely difficult to distinguish from early stage immature female mite offspring . individual mite reproductive parameters recorded from france were compared to the results obtained in sweden ( locke and fries 2011 ) . a mixed - effects model ( sas proc mixed ) was used to test the effects that surviving colonies compared to control colonies had on the proportion of successfully reproducing mites and individual mite reproductive parameters ( = 0.05 ) . this model was also used to compare the mite reproductive parameters between the avignon and gotland populations . the random effects included in the model were date and location and a linear repeated - measures factor was used with the covariance structure selected according to aikaike 's information criteria ( littell et al . the assumption of normality and equal variance was verified by analysis of residuals ( littell et al . 1996 ) . the average proportion of successfully reproducing varroa mites was significantly lower in surviving colonies compared to control colonies in both avignon , france ( f1,21.9= 116.25 , p < 0.0001 ; fig . 2 ) , and in gotland , sweden ( f1,41.4= 75.78 , p < 0.0001 ; fig . 2 ) . interestingly , a similar between - colony difference in mite reproductive success was found in avignon ( surviving vs. control colonies ( ) 0.59 0.02 vs. 0.90 0.02 , respectively ) and in gotland ( 0.48 0.02 vs. 0.78 0.02 for surviving vs. control colonies , respectively ; fig . 2 ) . the random effects included in the statistical model , that is , date and location did not render significant differences in any of the comparisons . mean proportion of successfully reproducing mother mites in the varroa mite - surviving colonies and the mite - susceptible control colonies in avignon , france , compared to gotland , sweden , with standard error bars . investigations of the individual parameters involved in the mite 's overall reproductive success also revealed differences between surviving and control colonies at each location , as well as differences between the two mite - surviving populations ( table 1 ) . although all the parameters rendered statistically significant differences between groups in each location , a few are highly significant and biologically interesting . in avignon , the significantly high rates of infertility and secondly the high proportion of mites with delayed egg - laying seemed to be the most influential parameters in reducing the mite 's reproductive success ( table 1 ) . in gotland however , the proportion of mites with delayed egg - laying was the parameter most significantly different from control colonies with a high proportion of mite offspring mortality a secondary significant factor . fecundity was lower in the surviving colonies in both locations but this parameter does not necessarily contribute to the mite 's ability to reproduce successfully . instead , it represents only the number of eggs laid without accounting for the age of the offspring or the likelihood of them reaching maturity . therefore , fecundity may not be independent from the incidence of delayed egg - laying since any mother mite that begins laying eggs late may consequently lay fewer eggs . mean values and standard errors ( se ) of the different mite reproductive parameters investigated along with probability values of significant differences between the surviving colonies ( sc ) and control colonies ( cc ) within locations for each parameter investigated and probability values of significant differences between all surviving colonies and control colonies ( between locations ) . mite reproductive success was higher in the surviving population in avignon than in the surviving population in gotland ( f1,17.8= 17.57 , p= 0.0006 ; fig . however , comparing the two populations together shows significantly higher infertility rates and a lower mean fecundity in avignon than in gotland ( table 1 ) . the mite reproductive success was also higher in the control colonies in avignon than in the control colonies in gotland ( f1,26= 12.41 , p= 0.0016 ; fig . 2 ) and only delayed egg - laying was slightly significantly different in control colonies between locations . this result highlights that the surviving colonies in avignon and in gotland are unique from regular honey bee colonies and are distinctive from each other regarding the parameters involved in reduced mite reproductive success . in host parasite interactions , host tolerance is defined as the ability to reduce the effect of the parasite , while host resistance is the ability to reduce the fitness of the parasite ( schmid - hempel 2010 ) . until recently , the avignon and gotland populations have been considered tolerant to v. destructor since mites were still present but the damage of infestation was limited . in other words , colony mortality did not occur but the mechanisms behind the colonies survival were not understood . our study presents two honey bee populations that have in fact evolved resistant traits enabling them to reduce the mite 's fitness , measured as reproductive success . nevertheless , in most cases , resistance and tolerance are correlated ( lipstich et al . 1996 ; schmid - hempel 2010 ) . varroa mites are still present in these colonies at rates near the normal colony mortality thresholds and likely both tolerance and resistance may operate simultaneously to enable the long - term survival of these honey bee populations . in avignon , france and in gotland , sweden , varroa mite - resistant honey bee colonies reduce the average reproductive success of their infesting mites by about 30% compared to local control colonies . although these resistant populations are genetically unrelated and separated by over 2000 km , natural selection has in both cases resulted in the reduce reproductive success of this parasitic mite . the main cause of colony mortality related to high mite infestation is the virus infections vectored by the mite , particularly deformed wing virus for its close association with varroa ( martin 2001 ; boecking and genersch 2008 ) . the ability to suppress the mite 's reproductive success would delay or limit the mite 's population growth within the colony . this would consequently also limit the virus infections to less effective transmission pathways that rarely lead to colony mortality , such as vertical transmission through infected honey bee eggs and/or horizontal transmission to larvae by nurse bees through infected food ( chen et al . it is unknown what the observations from this study might mean for the evolution of the viruses . from an evolutionary perspective , the varroa mite 's strict dependence on its host 's biology causing a reduction in host fitness from parasitic infestation has imposed strong selective pressures leading to a coevolutionary arms race . in most cases of coevolution , parasites will have an evolutionary advantage above their host due to their faster evolution caused by a shorter generation time ( hafner et al . however , in this particular system , v. destructor is of clonal origin in europe with low genetic variation ( solignac et al . 2005 ) . in addition , the honey bee has 10 times higher genetic recombination levels than any higher order eu - karyote analyzed thus far ( beye et al . these aspects may have provided the honey bee with an evolutionary advantage in the arms race with v. destructor , an arms race that possibly is in the hosts favor , with mite adaptations limited . a counter - adaptation could be expected according to co - evolution theory ( thompson 1994 ; schmid - hempel 2010 ) but with the lack of genetic diversity among mites this may take a long time . on the other hand , the adapted resistance in these two honey bee populations has evolved incredible fast by natural selection . both the avignon and gotland populations have experienced similar selection pressures of natural mite infestation that is unique compared to most other european honey bee populations due to apicultural management and both have evolved a similar colony - level mite - resistant trait . however , these populations have different life - history traits and different environmental factors that would also be involved in their adaptive responses to the mite pressure . the evolved mechanisms behind the ability to suppress reproductive success of mites may differ between these two distinct populations . in general , one may expect different traits to be favored in different populations living in distinct environments even with similar natural selection pressures , especially in traits involved in coevolutionary relationships ( thompson 1999 ) . although the two populations have clearly both evolved the ability to reduce mite reproductive success , the between - population differences are less clear . therefore , more detailed investigations are necessary to identify and tease apart the possible mechanistic differences . a suggested mechanism involved in reducing the mite 's reproductive success could be for example , the adult bee behavior known as varroa - sensitive hygiene ( vsh ) , which involves the uncapping or removal of mite - infested brood ( harbo and harris 2005 ; ibrahim and spivak 2006 ) . it has been shown that bee colonies expressing this behavioral trait may selectively remove pupae with reproducing mites resulting in the remaining infested cells having a misrepresented higher proportion of infertile mites ( harbo and harris 2005 ; ibrahim and spivak 2006 ) . this could potentially be a mechanism of the avignon population , in light of the observed high mite infertility rates . since the gotland population does not demonstrate hygienic behavior ( locke and fries 2011 ) nor had significantly high proportions of infertile mites , there is no reason to suspect that they are expressing vsh . instead , the suppression of mite reproductive success in gotland may be due to another mechanism , such as pupal volatile compounds that can inhibit the initiation of egg - laying of mites ( garrido and rosenkranz 2003 ; milani et al . 2004 ) . besides suppressing mite reproduction , both varroa - resistant european honey bee populations in this study also share the fact that they have been unmanaged , enabling natural selection ( as opposed to artificial ) to shape the evolution of their mite resistance . this is an important consideration since it highlights the impact that apicultural practices otherwise have on these host parasite interactions ( fries and camazine 2001 ) , suggesting a human interference in co - evolution between species . this tri - layered complex host parasite system between honey bees ( a multilevel organism with high genetic recombination rates ) , the varroa mite ( with a fast generation time but low genetic variation ) , and the viruses ( vectored by varroa ) that infect both the bee and the mite ( de miranda and genersch 2010 ) , challenges basic coevolutionary theories and has not been fully exploited by evolutionary biologists as a model for host our hope is to stimulate interdisciplinary research between apicultural studies and evolutionary biology to provide new insight into parasitic interactions of this system . a deeper understanding of how honey bee colonies naturally coevolve with parasites , and understanding the mechanisms and traits behind such coevolution , is necessary for establishing new optimal and long - term sustainable honey bee health management strategies in apiculture .

honey bee societies ( apis mellifera ) , the ectoparasitic mite varroa destructor , and honey bee viruses that are vectored by the mite , form a complex system of host parasite interactions . coevolution by natural selection in this system has been hindered for european honey bee hosts since apicultural practices remove the mite and consequently the selective pressures required for such a process . an increasing mite population means increasing transmission opportunities for viruses that can quickly develop into severe infections , killing a bee colony . remarkably , a few subpopulations in europe have survived mite infestation for extended periods of over 10 years without management by beekeepers and offer the possibility to study their natural host parasite coevolution . our study shows that two of these natural honey bee populations , in avignon , france and gotland , sweden , have in fact evolved resistant traits that reduce the fitness of the mite ( measured as the reproductive success ) , thereby reducing the parasitic load within the colony to evade the development of overt viral infections . mite reproductive success was reduced by about 30% in both populations . detailed examinations of mite reproductive parameters suggest these geographically and genetically distinct populations favor different mechanisms of resistance , even though they have experienced similar selection pressures of mite infestation . compared to unrelated control colonies in the same location , mites in the avignon population had high levels of infertility while in gotland there was a higher proportions of mites that delayed initiation of egg - laying . possible explanations for the observed rapid coevolution are discussed .

Introduction Materials and Methods Results Discussion

the research reports , accumulated since the fortieth of the last century , regarding the isotope effects in chemical exchange system proved that there are little differences in the chemical properties of the different isotopes of the same element . recently , researches in the isotopes separation field indicated that the isotopes of a given element may show some quantitative differences in chemical reaction equilibria and/or reaction rates ; the former is the equilibrium isotope effects and the later is the kinetic isotope effects . separation of isotopes by ion exchange chromatography is one of the most effective chemical exchange methods , which is based on the chemical equilibrium between isotopic species distributed between the stationary resin phase and the mobile solution phase . it has been applied successfully to the separation of isotopes of various elements in ligand exchange systems , in particular , those using hydroxycarboxylates as ligands , such as ce , gd , zn , eu , cu and nd [ 911 ] and in electron exchange systems such as eu and u . the first trial to explore the origin of the isotope effects in chemical exchange reactions was carried out by clewett and schaap , who suggested that the isotope effects in a chemical exchange reaction are due to a slight difference in the affinity of the isotopes for a given molecule or complex due to minor variances in the internal energies , mainly vibrational energy , of the molecule . based on the quantum molecular vibration energy , bigeleisen formulated the method to calculate the isotope exchange equilibrium constant from spectroscopic data . this method was used to calculate the equilibrium constant of the isotopic exchange of many elements ranging from hydrogen to uranium . unfortunately , this method could not explain the anomalous isotope effects of the odd isotopes u and u among the other uranium even isotopes . this anomaly was found to be similar to the odd even staggering of the isotope shift in the atomic spectra . according to the new theory derived by bigeleisen later on , similar odd even isotope effects were found in gd , zn [ 3,4,1921 ] , nd [ 911 ] and cd . lanthanides and actinides are known to have deformed nuclei , which cause the charge distribution effects in the isotope shifts of the atomic emission spectral lines . therefore , the field shift is expected to have a great effect on their isotope effects . in case of cd , the contribution of the nuclear field shift effect to the observed isotope enrichment factor was estimated to be 530% . another supporting proof for the importance of the field shift on isotope effects was given by the study of temperature effect on eu isotope effects . it was shown that the separation coefficient of eu isotopes increases with the increase in temperature , which could be explained by the field shift effects . kim et al . studied the isotope effects of uranyl complexes by means of ion exchange chromatography and reported that the malic acid eluent system had the largest separation coefficient among some selected uranyl carboxylate complexes . therefore , the purpose of the work is to study the isotope effects of neodymium in ligand exchange system using glycolic , malic and citric acids as mono , di and tri carboxylic acid to compare the effect of different ligands on the isotope effects of nd in nd - ligand exchange system . it is aimed to find the most suitable ligand that gives the highest separation coefficient and to get more information that may lead to more understanding of the theory of isotope effects . the cation exchange resin used in the ligand exchange system , lxs , was a macroporous strongly acidic cation exchange resin , ( sqs , 100200 mesh size ) obtained as a gift from asahi chemical co. japan , nd2o3 of purity 99.99% was supplied by alfa - aesar , usa , and converted to ndcl3 by dissolving in 2 m hcl solution followed by well gentle evaporation , drying the obtained solid salt , washing several times with distilled water followed by evaporation till neutrality , then used without further purification . neodymium isotope separation experiment based on the ligand complex formation was carried out with a cyclic displacement chromatography system which is composed of three glass columns , 0.8 cm i.d . 100 cm long , with water jacket , connected in series with teflon tubes , 1 mm inner diameter , so that they were repeatedly used in merry - go - round way for the desired migration length . the resin was pretreated with 2 m , mol / dm , hcl solution to remove impurities and to convert the resin into h form . this was followed by passing a solution of 0.1 m cucl2 to convert the resin into cu form . then a 0.05 m ndcl3 solution was fed into the first column at a constant flow rate by a peristaltic pump to form nd adsorption band . when the nd ion adsorption band had grown to an appropriate length the nd and cu adsorption bands were eluted by an eluent solution containing 0.2 m ammonium malate or 0.15 m ammonium citrate or 0.2 m ammonium glycolate + 0.1 m nh4no3 + 0.0002nan2 adjusted to ph 4.6 with nh4oh solution . the adsorption band of nd was visible , pink , in contrast with the preceding green cu band . when the nd adsorption band migration length reached to the desired length , it was eluted out from the last column . the effluent was collected in small fractions that were , thereafter , subjected to the concentration analysis and the isotopic analysis . the temperatures of the columns were kept constant at 25 0.2 c by circulating the thermostated water through the water jackets surrounding the columns . the uv visible spectra of lanthanides were scanned starting from a wavelength of 500 nm by means of uv visible spectrophotometer to check the interference with any possible other rare earth ions . the intense pink color solution of nd is the bases for the determination of nd concentration by photometry after dilution with 0.1 m hcl at wavelength 576 nm . the neodymium isotopic ratios of some selected samples were measured by using a joel high - resolution inductively coupled plasma mass spectrometer ( jms - plasma 2 ) . the samples were first burned completely to remove any residues for the carboxylic acids , then dissolved in nitric acid . the samples in the form of nd(no3)3 were supplied to the inlet system which consists of the peristatic sample inlet section of the icp - ms . the cation exchange resin used in the ligand exchange system , lxs , was a macroporous strongly acidic cation exchange resin , ( sqs , 100200 mesh size ) obtained as a gift from asahi chemical co. japan , nd2o3 of purity 99.99% was supplied by alfa - aesar , usa , and converted to ndcl3 by dissolving in 2 m hcl solution followed by well gentle evaporation , drying the obtained solid salt , washing several times with distilled water followed by evaporation till neutrality , then used without further purification . neodymium isotope separation experiment based on the ligand complex formation was carried out with a cyclic displacement chromatography system which is composed of three glass columns , 0.8 cm i.d . 100 cm long , with water jacket , connected in series with teflon tubes , 1 mm inner diameter , so that they were repeatedly used in merry - go - round way for the desired migration length . the resin was pretreated with 2 m , mol / dm , hcl solution to remove impurities and to convert the resin into h form . this was followed by passing a solution of 0.1 m cucl2 to convert the resin into cu form . then a 0.05 m ndcl3 solution was fed into the first column at a constant flow rate by a peristaltic pump to form nd adsorption band . when the nd ion adsorption band had grown to an appropriate length , the supply of the feed solution was stopped . the nd and cu adsorption bands were eluted by an eluent solution containing 0.2 m ammonium malate or 0.15 m ammonium citrate or 0.2 m ammonium glycolate + 0.1 m nh4no3 + 0.0002nan2 adjusted to ph 4.6 with nh4oh solution . the adsorption band of nd was visible , pink , in contrast with the preceding green cu band . when the nd adsorption band migration length reached to the desired length , it was eluted out from the last column . the effluent was collected in small fractions that were , thereafter , subjected to the concentration analysis and the isotopic analysis . the temperatures of the columns were kept constant at 25 0.2 c by circulating the thermostated water through the water jackets surrounding the columns . the concentration of neodymium was determined in each sample by using uv visible spectrophotometer . the uv visible spectra of lanthanides were scanned starting from a wavelength of 500 nm by means of uv visible spectrophotometer to check the interference with any possible other rare earth ions . the intense pink color solution of nd is the bases for the determination of nd concentration by photometry after dilution with 0.1 m hcl at wavelength 576 nm . the neodymium isotopic ratios of some selected samples were measured by using a joel high - resolution inductively coupled plasma mass spectrometer ( jms - plasma 2 ) . the samples were first burned completely to remove any residues for the carboxylic acids , then dissolved in nitric acid . the samples in the form of nd(no3)3 were supplied to the inlet system which consists of the peristatic sample inlet section of the icp - ms . the isotopes separation of certain element by ion exchange chromatography is best achieved by the band displacement technique . this operation is characterized by sandwiching a band of the ions of the element to be studied , nd , between two other chemical species bands , cu and nh4 + , maintaining self - sharpening band boundaries at both the migration band ends . during this operation , the band of the isotopic chemical species of the element to be separated is eluted through the column by a displacing eluent solution . the velocity of the band displacement is controlled by the eluent type and concentration in the solution phase , equilibrium between the solution phase and the resin phase as well as by the flow rate of the solution . the profiles of nd concentration in the effluent fractions , which correspond to the nd band profile in the column , after 11.58 m migration is shown in fig . 2 for glycolate system . the sharp boundaries of the band shown in this figure indicate that the chromatographic displacement was almost ideal at both boundaries . naturally occurring neodymium 3 shows the isotope distribution ratios for neodymium in nd- glycolate system at constant temperature of 25 c . it can be seen that the heavier isotopes nd , nd , nd , nd , nd and nd are enriched into the front part , or preferentially fractionated in the complex form in the solution phase . the degree of fractionation of neodymium isotopes takes the order ; nd 143nd144nd145nd146nd148nd. this tendency is the same as that observed in the chromatographic isotope separation of ce , gd , zn , cu and eu . since the heavier isotope is enriched in the complex species , the observed isotopic enrichment tendency accords with the theoretically expected direction of the isotopic effects in chemical exchange . the schematic diagram of the expected ion exchange mechanism under the above mentioned conditions , in the simplest form , is represented in fig . 4 . the chemical reactions involved in the present systems first takes place at the interface between nh4 + and nd adsorption bands . when ( nh4 ) n - ligand reached the rear boundary of nd adsorption band , the ligands are transferred to nd because of the large stability constant of the nd - ligand complex compared to that of ammonium ion - ligand complex . during the moving down of the solution phase , which contains nd - ligand complex species through the nd adsorption band in the column , the isotopic exchange reaction takes place between nd ions in the resin phase and nd - ligand complex species in the solution phase . after that the nd - ligand complex reaches the cu ion band , where ligand are transferred to cu ions and nd ions are adsorbed in the resin phase . the related chemical reactions for the three types of carboxylic acids , mono - basic ( glycolate ) , di - basic ( malate ) and tri - basic ( citrate ) ligands can be expressed , in the simplest form , as : for the mono - basic glycolate ligand(1)4nh4-lg+nd3++h+4nh4++nd-(lg)4-h(2)hnd3++lnd-(lg)4-hlnd3++hnd-(lg)4-h(3)nd-(lg)4-h+cu2++h+nd3++cu-(lg)4 - 2h for the mono - basic glycolate ligand for the di - basic malate ligand:(4)2(nh4)2-lm+nd3++h+4nh4++nd-(lm)2-h(5)hnd3++lnd-(lm)2-hlnd3++hnd-(lm)2-h(6)nd-(lm)2-h+cu2++h+nd3++cu-(lm)2 - 2h for the di - basic malate ligand : for the tri - basic citrate system:(7)(nh4)3-lc+nd3++h+3nh4++nd - lc - h(8)hnd3++lnd - lc - hlnd3++hnd - lc - h(9)nd - lc - h+cu2++h+nd3++cu - lc-2hwhere the underlines represent the species in the resin phase , l represents the ligand species ( where lg = glycolate , lm = malate and lc = citrate ) and nd and nd represent the heavy and the light neodymium isotopes , respectively . in fact , the chemistry of the system may be more complicated than that represented by the above equations . the exact complex structure and the different possibilities of nd and/or h2o hydrolysis are out of the scope of the present work . for the tri - basic citrate system : the single stage separation factor , = ( 1 + ) for each nd isotopes is defined here as:(10)=1+=142nd/hnd/142nd / hndwhere the underline represents the species in the resin phase and h can take the values 143 , 144 , 145 , 146 , 148 and 150 . the separation coefficients , s were calculated by using the isotopic enrichment curves of the front and rear boundaries according to the equation developed by spedding et al . and kakihana and kanzaki .(11)=qi|ri - ro|/{qro(1-ro)}where q is the amount of neodymium in the sample fraction , q is the total amount of sorbed neodymium in the column packed resin , ri is the isotopic ratio of nd / nd , and the subscripts i and o denoted the fraction number and the original feed , respectively . in general , the isotope exchange reaction effectively proceeds and reaches the equilibrium between two phases of the solution and the resin at lower flow rate condition . the mathematical averages of the two separation coefficient values obtained from the front and rear boundaries were taken to calculate the process separation coefficient ( ) . the average values of the separation coefficients of each isotope relative to nd for different ligands are given in table 3 with an estimated error factor of 5.0% . from the data shown in table 3 it can be easily noticed that the separation coefficient increases with the increase of the mass number . this trend agrees with the previous findings in case of u , zn [ 1921 ] , gd nd citrate system and nd malate system . the arrangement of the ligands takes the following direction with respect to the increasing capacity of each ligand to increase the separation coefficient of each isotope : malate ligand > citrate ligand > glycolate ligand the values of the separation coefficients were plotted as a function of the mass number at 25 c as shown in fig . a linear relationship was obtained between the mass number and the separation coefficient for the three ligands . the current discussion can not be extended to the odd even or mass anomaly phenomena due to the short migration of the bands that leads to high errors in the isotope ratio measurements carried out by icp mass . the odd even and mass anomaly phenomena were discussed for neodymium malate system elsewhere . 6 shows the structure of the three ligands compared in this study according to wikipedia site . the malate structure has up to 4 possible active sites for complexion with nd ions . this number is reduced to three only in case of citrate , as two sites were not available for complexion due to steric hindering . the number of possible complexion sits of the three ligands takes the order malate > citrate > glycolate , which agree with the order of isotope effects of the three systems as studied by the separation coefficients shown above . the plate height , hetp , is a very important factor in determining the performance of any chromatographic separation system . the smaller the value of hetp , the shorter the migration length needed for a specific separation task i.e. the higher the efficiency of the system . ( 12 ) and ( 13).(12)hetp=(/s)+(1/s2l)where l is the total migration length and s is the slope of the plots of ln ( ri ro ) vs. xi l , where ri is the neodymium isotopic ratio of nd / nd in the fraction , ro is the neodymium isotopic ratio of the feed solution , xi is the hypothetical distance of the sample fraction , calculated from the starting point at the time when the boundary is eluted from the column after migration distance of l. the hypothetical distance is calculated based on the effluent volume being proportional to the migration distance of the absorbed band:(13)xi=(vi / qt)*lwhere vi is the effluent volume of the sample fraction i , qt is the total effluent volume and l is the total migration length . xi l carried out at 25 c for nd at nd - malate system was shown in a previous article . the values of the hetp for each neodymium isotope for different ligands at constant temperature 25 c have been calculated using eq . it can be easily noticed from table 4 that the values of the ( hetp ) are small , which leads to a higher degree of separation and a better separation performance . the hetp values of neodymium isotope separation by ion exchange chromatography in ligand exchange system are of the same magnitude of hetp values of europium isotope separation , while it is 10 times larger than those of copper . this could be due to the larger size of the ions of the f electron element like eu and nd compared to cu ions . the isotopes separation of certain element by ion exchange chromatography is best achieved by the band displacement technique . this operation is characterized by sandwiching a band of the ions of the element to be studied , nd , between two other chemical species bands , cu and nh4 + , maintaining self - sharpening band boundaries at both the migration band ends . during this operation , the band of the isotopic chemical species of the element to be separated is eluted through the column by a displacing eluent solution . the velocity of the band displacement is controlled by the eluent type and concentration in the solution phase , equilibrium between the solution phase and the resin phase as well as by the flow rate of the solution . the profiles of nd concentration in the effluent fractions , which correspond to the nd band profile in the column , after 11.58 m migration is shown in fig . 2 for glycolate system . the sharp boundaries of the band shown in this figure indicate that the chromatographic displacement was almost ideal at both boundaries . naturally occurring neodymium 3 shows the isotope distribution ratios for neodymium in nd- glycolate system at constant temperature of 25 c . it can be seen that the heavier isotopes nd , nd , nd , nd , nd and nd are enriched into the front part , or preferentially fractionated in the complex form in the solution phase . the degree of fractionation of neodymium isotopes takes the order ; nd 143nd144nd145nd146nd148nd. this tendency is the same as that observed in the chromatographic isotope separation of ce , gd , zn , cu and eu . since the heavier isotope is enriched in the complex species , the observed isotopic enrichment tendency accords with the theoretically expected direction of the isotopic effects in chemical exchange . the schematic diagram of the expected ion exchange mechanism under the above mentioned conditions , in the simplest form , is represented in fig . 4 . the chemical reactions involved in the present systems first takes place at the interface between nh4 + and nd adsorption bands . when ( nh4 ) n - ligand reached the rear boundary of nd adsorption band , the ligands are transferred to nd because of the large stability constant of the nd - ligand complex compared to that of ammonium ion - ligand complex . during the moving down of the solution phase , which contains nd - ligand complex species through the nd adsorption band in the column , the isotopic exchange reaction takes place between nd ions in the resin phase and nd - ligand complex species in the solution phase . after that the nd - ligand complex reaches the cu ion band , where ligand are transferred to cu ions and nd ions are adsorbed in the resin phase . the related chemical reactions for the three types of carboxylic acids , mono - basic ( glycolate ) , di - basic ( malate ) and tri - basic ( citrate ) ligands can be expressed , in the simplest form , as : for the mono - basic glycolate ligand(1)4nh4-lg+nd3++h+4nh4++nd-(lg)4-h(2)hnd3++lnd-(lg)4-hlnd3++hnd-(lg)4-h(3)nd-(lg)4-h+cu2++h+nd3++cu-(lg)4 - 2h for the mono - basic glycolate ligand for the di - basic malate ligand:(4)2(nh4)2-lm+nd3++h+4nh4++nd-(lm)2-h(5)hnd3++lnd-(lm)2-hlnd3++hnd-(lm)2-h(6)nd-(lm)2-h+cu2++h+nd3++cu-(lm)2 - 2h for the di - basic malate ligand : for the tri - basic citrate system:(7)(nh4)3-lc+nd3++h+3nh4++nd - lc - h(8)hnd3++lnd - lc - hlnd3++hnd - lc - h(9)nd - lc - h+cu2++h+nd3++cu - lc-2hwhere the underlines represent the species in the resin phase , l represents the ligand species ( where lg = glycolate , lm = malate and lc = citrate ) and nd and nd represent the heavy and the light neodymium isotopes , respectively . in fact , the chemistry of the system may be more complicated than that represented by the above equations . the exact complex structure and the different possibilities of nd and/or h2o hydrolysis are out of the scope of the present work . for the tri - basic citrate system : the single stage separation factor , = ( 1 + ) for each nd isotopes is defined here as:(10)=1+=142nd/hnd/142nd / hndwhere the underline represents the species in the resin phase and h can take the values 143 , 144 , 145 , 146 , 148 and 150 . the separation coefficients , s were calculated by using the isotopic enrichment curves of the front and rear boundaries according to the equation developed by spedding et al . and kakihana and kanzaki .(11)=qi|ri - ro|/{qro(1-ro)}where q is the amount of neodymium in the sample fraction , q is the total amount of sorbed neodymium in the column packed resin , ri is the isotopic ratio of nd / nd , and the subscripts i and o denoted the fraction number and the original feed , respectively . in general , the isotope exchange reaction effectively proceeds and reaches the equilibrium between two phases of the solution and the resin at lower flow rate condition . the mathematical averages of the two separation coefficient values obtained from the front and rear boundaries were taken to calculate the process separation coefficient ( ) . the average values of the separation coefficients of each isotope relative to nd for different ligands are given in table 3 with an estimated error factor of 5.0% . from the data shown in table 3 it can be easily noticed that the separation coefficient increases with the increase of the mass number . this trend agrees with the previous findings in case of u , zn [ 1921 ] , gd nd citrate system and nd malate system . the arrangement of the ligands takes the following direction with respect to the increasing capacity of each ligand to increase the separation coefficient of each isotope : malate ligand > citrate ligand > glycolate ligand the values of the separation coefficients were plotted as a function of the mass number at 25 c as shown in fig . a linear relationship was obtained between the mass number and the separation coefficient for the three ligands . the current discussion can not be extended to the odd even or mass anomaly phenomena due to the short migration of the bands that leads to high errors in the isotope ratio measurements carried out by icp mass . the odd even and mass anomaly phenomena were discussed for neodymium malate system elsewhere . 6 shows the structure of the three ligands compared in this study according to wikipedia site . the malate structure has up to 4 possible active sites for complexion with nd ions . this number is reduced to three only in case of citrate , as two sites were not available for complexion due to steric hindering . the number of possible complexion sits of the three ligands takes the order malate > citrate > glycolate , which agree with the order of isotope effects of the three systems as studied by the separation coefficients shown above . the plate height , hetp , is a very important factor in determining the performance of any chromatographic separation system . the smaller the value of hetp , the shorter the migration length needed for a specific separation task i.e. the higher the efficiency of the system . ( 12 ) and ( 13).(12)hetp=(/s)+(1/s2l)where l is the total migration length and s is the slope of the plots of ln ( ri ro ) vs. xi l , where ri is the neodymium isotopic ratio of nd / nd in the fraction , ro is the neodymium isotopic ratio of the feed solution , xi is the hypothetical distance of the sample fraction , calculated from the starting point at the time when the boundary is eluted from the column after migration distance of l. the hypothetical distance is calculated based on the effluent volume being proportional to the migration distance of the absorbed band:(13)xi=(vi / qt)*lwhere vi is the effluent volume of the sample fraction i , qt is the total effluent volume and l is the total migration length . xi l carried out at 25 c for nd at nd - malate system was shown in a previous article . the values of the hetp for each neodymium isotope for different ligands at constant temperature 25 c have been calculated using eq . it can be easily noticed from table 4 that the values of the ( hetp ) are small , which leads to a higher degree of separation and a better separation performance . the hetp values of neodymium isotope separation by ion exchange chromatography in ligand exchange system are of the same magnitude of hetp values of europium isotope separation , while it is 10 times larger than those of copper . this could be due to the larger size of the ions of the f electron element like eu and nd compared to cu ions . the isotope effects of neodymium in nd - glycolate ligand exchange system were studied by using ion exchange chromatography . the heavier isotopes nd were clearly found to be enriched in the nd - glycolate species in the solution phase . the degree of fractionation takes the order , nd nd nd nd nd nd . the separation coefficients of neodymium isotopes , s , were calculated from the observed isotopic ratios at the front and rear boundaries of the neodymium adsorption band . the separation coefficients of neodymium isotopes , s , for the nd - glycolate ligand exchange system were compared with those of nd - malate and nd - citrate , which indicated that the isotope effects of neodymium as studied by the three ligands takes the following direction malate > citrate > glycolate . this order agrees with the number of available sites for complexation of each ligand . the plate height , hetp , values of nd in nd - ligand exchange systems were calculated and found to be of the same magnitude of eu , while it is 10 times larger than cu .

the isotope effects of neodymium in nd - glycolate ligand exchange system were studied by using ion exchange chromatography . the separation coefficients of neodymium isotopes , s , were calculated from the observed isotopic ratios at the front and rear boundaries of the neodymium adsorption band . the values of separation coefficients of neodymium isotopes , s , for the nd - glycolate ligand exchange system were compared with those of nd - malate and nd - citrate , which indicated that the isotope effects of neodymium as studied by the three ligands takes the following direction malate > citrate > glycolate . this order agrees with the number of available sites for complexation of each ligand . the values of the plate height , hetp of nd in nd - ligand exchange systems were also calculated .

Introduction Experimental Ion exchange resins and reagents Chromatographic system Analysis Results and discussion Chromatographic system Conclusions

, priorities for prevention , treatment , and management can be identified , and strategies and resources allocated appropriately . for many years , diabetes has been a leading cause of vi in many countries , and still takes a major toll on vi . in england and wales , the uk national screening committee for diabetic retinopathy has set 18 service objectives and quality assurance standards for diabetic retinopathy screening services.1,2 the first service objective is to reduce new blindness due to diabetic retinopathy ( dr).2 it stipulates that local services will need to prospectively audit both certifications of visual impairment ( cvi ) and incidence of vi predominantly due to dr in order to establish a baseline . the standard acceptable annual registration rate for severe vi and vi due to dr is 9.5 and 9.3 per million per year for england and wales , respectively . these figures have been derived from national data in 19901991.3 the minimum standard achievable is a 10% reduction in severe vi and vi registration rate within 5 years of the start of the screening program . the desirable standard is 40% reduction . from 2006 and annually thereafter , dr screening programmes in england and wales will be required to submit an annual report to the national screening programme , containing general information about the service offered and information to support an assessment against the service objectives and quality assurance standards for the programme . all programmes in england and wales will be required to use a report template in order to facilitate the collation and comparison of data.4 locally derived data on new vi should be included in the annual report submitted to the national screening programme . prior to 2005 , screening for dr in cambridgeshire was largely hospital - based , with patients being referred by their general practitioners , diabetic physicians , or optometrists directly to ophthalmologists at either addenbrookes or hinchingbrooke hospital . optometrists have recently been trained to perform optometric based screening , and to refer patients in a timely manner with maculopathy ( m1 ) , preproliferative retinopathy ( r2 ) , and proliferative retinopathy ( r3 ) . in november 2003 , these apply to the function of the better eye ; people with good vision in one eye are not eligible for certification . this is the first study to obtain the severe vi and vi registration rates predominantly due to dr in south cambridgeshire , cambridge city , and huntingdonshire . it was performed to establish a reference point of vi registration due to dr at the beginning of the screening program . a retrospective review of all cvi for patients with cambridgeshire post codes over 24 months from january 1 , 2004 to december 31 , 2005 was conducted . the type of vi , cause of vi and patient s age were noted for each form . an attempt was made to validate the certificates of vi with the central list of all new registrations of vi held by cambridgeshire social services . population data was obtained from census 2001 and cambridgeshire primary care trusts to determine the total and diabetic populations of south cambridgeshire , cambridge city and huntingdon . we had to exclude east cambridgeshire and the fenlands as patients from these areas attend other local district general hospitals eg , queen elizabeth hospital king s lynn for vi assessment and registration . the annual registration rates of severe vi and vi due to dr were calculated per million population per year . in addition , the rate per million diabetic patients and prevalence of diabetes were calculated . from january 1 , 2004 to december 31 , 2005 , there were 367 cvi for patients from cambridgeshire , cambridge city , and huntingdonshire . each cause was noted which resulted in the number of causes ( 384 ) exceeding the number of registration forms ( 365 ) . the leading causes of vi registration were age - related macular degeneration in 224 or 61.4% of patients , glaucoma ( 43 or 11.8% ) , and optic neuropathy ( 27 or 7.4% ) , ( table 2 ) . according to census 2001 , the total population of south cambridgeshire the number of registrations predominantly due to dr was 18 ; 13 visually impaired and 5 with severe vi . the rates of severe vi and vi registration predominantly due to dr were 17.1 and 6.5 per million per year , respectively . the diabetic population of south cambridgeshire ( 2729 ) , cambridge city ( 3361 ) and huntingdonshire ( 4752 ) in june 2005 was 10,842 , and the prevalence of diabetes in this population of cambridgeshire is calculated to be 2.74% . the severe vi and vi registration rates in the diabetic population were 230 and 600 per million population with diagnosed diabetes per year , respectively . in our study , dr was the fifth leading cause of registered vi , superseded by age - related macular degeneration , glaucoma , optic neuropathy , and visual cortex disorder in that order . in persons of working age ( 1664 years ) , the leading cause of vi registration was optic neuropathy followed by retinitis pigmentosa ( table 2 ) . the specific causes of optic neuropathy were not stated in most instances on the cvi form . most optic neuropathies were congenital or secondary to demyelination and did not include diabetic or glaucomatous optic neuropathy . further studies are needed to clarify the types of optic neuropathy , by examining the patient records . a comparison of the demographic profile of our study population with that of england and wales reveals a younger age profile ( table 4 ) . there are 0.8% less persons aged 75 years and over , and 0.6% more persons in the 015 year age group of cambridge city , south cambridgeshire , and huntingdonshire . , dr does not appear to be the leading cause of cvi in the working age group in this population . this finding is contrary to that of bunce and colleagues5 who found that dr was the leading cause of vi in the working age group in england and wales in 19992000 . the severe vi registration rate of 6.5 per million per year meets the national standard of 9.5 per million per year . the vi registration rate was 17.1 per million per year , and almost doubles the current national standard of 9.3 per million per year . however , new data on national vi registration has emerged from a study carried out by bunce and colleagues5 in 19992000 . in this study the rate of certification of vi due to dr was 38.4 per million per year , compared to 19.9 per million per year in 19901991.3,6 these rates have doubled over the nine years , partly explained by increased vi registration rates during the time interval 19911999 , an aging population , and increasing prevalence of type 2 and type 1 diabetes.5 given these new figures , we recommend that the national standards of severe vi and vi registration rates be revised . a severe vi registration rate of 12 per million population per year has been reported for fife from 19901999,7 and a severe vi registration rate of 10 per million per year and a vi registration rate of 24 per million per year was reported for leeds for 2002.8 the prevalence of diabetes in south cambridgeshire , cambridge city , and huntingdonshire ( 2.74% ) is less than the national prevalence estimated as 4.26%.9 the prevalence in leeds is 2.9%.8 the region of cambridgeshire studied has about 5% more whites than the ethnic profile of england / wales , ( table 4 ) . likewise , our studied region has 2.8% less asians and 2.3% less blacks than england / wales . this difference might account for the slightly lower prevalence of diabetes than the national prevalence , as there is well documented evidence of an increased prevalence of diabetes in asians and blacks.10,11 the severe vi and vi registration rates per million diabetic patients per year were 230 and 600 respectively . these rates are lower than the corresponding rates in the diabetic population of leeds of 337 and 817 , respectively.8 the rates of registration in our study are also lower than the severe vi registration rate of 640 per million diabetics per year reported for fife between 19901999,7 and similar to the vi registration rate of 530 per million diabetics per year calculated for tayside in 1998.12 this interregional variation may be related to differing population profiles.13,14 addenbrookes hospital is a tertiary referral hospital in cambridge city and hinchingbrooke hospital is a secondary care centre which serves as a district general hospital for huntingdonshire and other surrounding subpopulations of cambridgeshire . we questioned whether our relatively low rates of registration of vi due to diabetes were due to the nature of these hospitals . geographically , addenbrookes hospital is the closest hospital to patients living in cambridge city and south cambridgeshire and being a tertiary referral centre , it would serve all patients in cambridge in addition to receiving referrals from outside cambridge . our results were cross - checked with the relevant primary care trusts and both sets of data correlated very well . the primary care trusts had no record of any patient living in the study population , who was registered visually impaired outside of addenbrookes or hinchingbrooke hospitals or from the private sector in the study period . the possibility of a large number patients being registered visually impaired in the private sector is unlikely . it is well known that there are limitations in using vi registration data to study rates of vi.15,16,17 vi registration data are hospital - based , not population - based.5 the patient must access the hospital eye service in order to be seen by a consultant ophthalmologist . between 43% and 58% of eligible outpatients are said to remain unregistered even after consultation with an ophthalmologist,15,16 and up to 40% of registered patients are inappropriately registered.15 patient attitudes to registration process ( patients are entitled to refuse the offer ) , and medical attitudes to registration ( there is no statutory requirement for it to be offered ) also affect registration rates.5,18 there is often a delay between onset of certifiable visual loss and offer of registration.5 studies have shown that certification of vi is biased towards severe visual loss , permanent , nontreatable causes , and those that affect central rather than peripheral vision.15,17 ethnic minorities are less likely to undergo registration.16,19 a prospective audit of incident vi would be more useful . despite these limitations , data on vi registration rates may be useful as estimates of incidence of vi and to establish a baseline for dr screening programmes . from our study it would appear that registration of severe vi secondary to dr is uncommon and does not appear to be the main cause of vi registration in the working age group in this population of cambridgeshire . these rates form a baseline for the region , to which future rates can be compared . we are unlikely to be able to achieve a lower rate of severe vi registration from dr . improvement in vi due to dr may depend on improving other aspects of diabetic care , such as control of blood glucose and blood pressure , particularly before retinopathy occurs , and timely referral of patients with sight - threatening retinopathy .

background / aims : the uk national screening committee ( nsc ) has set 18 standards for diabetic retinopathy ( dr ) screening services in england and wales , the first of which is to reduce new visual impairment ( vi ) due to dr by 10% within 5 years . this study examined the incidence of vi due to dr in cambridgeshire ( city , south , and huntingdonshire ) in order to establish a baseline rate of vi registration.methods:a retrospective review of all certificates of visual impairment ( cvi ) for 2004 and 2005 was conducted . hospital records of patients registered due to dr were reviewed to ascertain conformity to nsc standards . the incidence of vi registration due to dr was calculated.results:the number of registrations predominantly due to dr was 18 ; 13 visually impaired and 5 with severe vi . the rates of vi and severe vi predominantly due to dr were 17.1 and 6.5 per million per year , respectively . the vi and severe vi registration rates in the diabetic population were 600 and 230 per million per year , respectively.conclusion:the severe vi registration rate due to dr lies within the national standard . the vi registration rate exceeds 19901991 national standards but lies within 19992000 national figures .

Introduction Methods Results Discussion Conclusions

genetic and epigenetic alterations that lead to the functional deregulations of several signaling and metabolic pathways are known to be the major driving forces behind carcinogenesis and cancer progression . those functional deregulations in cancer cells have been exploited for pathway - targeted anticancer therapy . small molecules and antibodies that directly inhibit critical nodes in oncogenic signaling networks , most notably kinases or enzymes , have been used to treat various cancers in humans , resulting in substantial improvement in clinical symptoms and outcomes in a subset of cancer patients . however , many critical nodes in oncogenic signaling networks may not be targeted directly by small molecules or antibodies . for example , functional losses in tumor suppressor genes caused by gene mutations or deletions may not be restored through small molecules . moreover , the functions of some intracellular oncogene products , such as ras and c - myc , have been found to be difficult to modulate directly through small molecules . nevertheless , functional alterations in nondruggable targets may lead to changes in signal transduction and metabolism that render the mutant cells more susceptible to functional changes in other genes or to pharmaceutical interventions aimed at other targets , providing an opportunity to selectively eliminate those mutant cells through synthetic lethality . synthetic lethality ( the creation of a lethal phenotype from the combined effects of mutations in two or more genes ) offers the potential to eliminate malignant cells by indirectly targeting cancer - driving molecules that are difficult to target directly with small molecules or antibodies . the concept of synthetic lethality is illustrated in figure 1a . the two genes a and b are synthetic lethal if the mutations in any one of them will not change the viability of a cell or an organism , but simultaneous mutations in both a and b genes will result in a lethal phenotype . this concept has has been used in genetic studies to determine functional interactions and compensation among genes for decades and has recently been exploited for the development of new genotype - selective anticancer agents , identification of novel therapeutic targets for cancer treatment , and characterization of genes associated with treatment response . for example , if gene a in figure 1b is mutated , small interfering rna ( sirna ) or small molecules targeting the genes x , y , or z would likely induce synthetic lethality in cells with an abberant a but not in the cells with a wild - type a. therefore , using paired isogenic cell lines with and without abberant a , one can screen for sirna or compounds that specifically kill the cells with an abberant a. concept and models of synthetic lethal interactions . ( a ) synthetic lethality between genes a and b. a and b represent wild types , while a and b represent mutants . synthetic lethality refers to a lethal phenotype observed only in the combination group of a and b. ( b ) an essential survival function is regulated by two pathways conducted by a , b , c and x , y , x , respectively . a functional change in either of these pathways is insufficient to induce viability changes . however , the simultaneous presence of mutations or dysfunctions in both pathways , such as a mutation in a and any mutation in x , y , or z , induces lethal phenotype . thus , a is synthetic lethal with x , y , and z , and vice versa . ( c ) an essential survival function is regulated by pathway a alone , in which a2 is a multiprotein complex composed of x , y , and z ; and a3 has homologues of , and . synthetic lethality may exist among x , y , and z and among a3 , , and . several models of interactions among genes and/or proteins have been proposed to account for synthetic lethality , including the components of parallel pathways that together regulate an essential biological function , the presence of homologous genes or protein isomers derived from the same ancestral gene ( paralogs ) , subunits of an essential multiprotein complex , and components of a single linear essential pathway ( figure 1b , c ) . studies in yeast revealed that synthetic lethal interactions occurred significantly more frequently among genes with the same mutant phenotype , among genes encoding proteins with the same subcellular localization , and among genes involved in similar biological processes , such as those in parallel or compensating pathways or bridging bioprocesses . for a particular tumor suppressor gene or oncogene , synthetic lethality can be identified by using isogenic cell lines to screen an sirna library for synthetic lethal genes or a chemical library for synthetic lethal compounds . this review discusses recent advances in the development of synthetic lethality based anticancer therapeutics . in particular , it emphasizes the development of anticancer agents that target dna damage response and oncogene ras pathways through a synthetic lethality approach . the tp53 gene , which encodes tumor suppressor protein p53 , a master transcriptional regulator of cellular response to dna damage , is commonly inactivated in about 50% of human cancers by either gene mutations or degradation through hdm2 . moreover , pathways involved in dna damage response are often constitutively activated in a majority of tumors , even in early stages of tumor development and in tumor specimens from untreated patients , presumably because of oncogene - mediated deregulation of dna replication . different mechanisms are used in cells in response to different types of dna damage . single - strand breaks ( ssbs ) activate poly adp - ribose polymerase ( parp ) and are repaired mainly by parp - mediated base - excision repair , while double - strand breaks ( dsbs ) are repaired by the mechanisms of homologous recombination ( hr ) and nonhomologous end joining ( nhej ) . parp can be activated by binding to ssbs , leading to ssb repair through base excision mechanisms ( figure 2 ) . however , if ssbs are not repaired , they will cause a blockage or collapse of dna replication forks during dna synthesis and the formation of dsbs . dsbs can also be incurred by endogenous and exogenous dna - damaging agents such as ionizing radiation . single - strand break ( ssb ) , double - strand break ( dsb ) , and single strand dna derived from dna damage or stalled replication fork are recognized by various sensor molecules ( marked yellow ) , leading to activation of signal transducers ( marked green ) , which in turn activate different dna repair pathways and checkpoint pathways , thereby preventing transmission of the genetic lesion to the daughter cells . those parallel pathways provide opportunities of eliminating some cancer cells with mutations in those pathways through synthetic lethality . the single - strand dna present at stalled replication forks or generated by processing of dsbs is recognized by replication protein a ( rpa ) . the assembly of those sensor molecules in the damaged dna sites leads to the recruitment and activation of signal transducers , including three phosphatidylinositol 3-kinase related kinases ( pikks ) ( ataxia telangiectasia mutated ( atm ) , atm- and rad3-related ( atr ) , and dna - dependent protein kinase ( dna - pk ) ) that in turn activate downstream effectors , resulting in the activation of checkpoint and dna repair pathways . the phosphorylation of h2ax by atm , atr , or dna - pk at s139 ( known as h2ax ) triggers the recruitment of dna repair proteins and leads to the assembly of dna repair complexes at the damaged dna sites . consequently , the cell cycle progression is arrested to permit the repair of the damaged dna , thereby preventing transmission of the genetic lesion to the daughter cells ( figure 2 ) . both brca1 and brca2 are required for the assembly of protein complexes for hr , including recruitment of recombinase rad51 to the dna dsbs . dsb repair through hr is mostly error free and can occur only in the late s and g2 phases of the cell cycle because it requires an intact sister chromatid as a template for repair . in contrast , nhej involves ku70/80 , dna - pk , xrcc4 , and dna ligase iv , often results in gene deletion or translocation , and can occur in all phases of the cell cycle . most nhej occurs independent of the mre11/rad50/nbs1 complex and atm activation because the ku70/ku80 heterodimer can directly bind to the ends of double - strand dna , recruit dna - pk to the site , and initiate an nhej process . in the absence of ku proteins , an alternative nhej initiates with the involvement of parp1 , xrcc1 , and ligase i / iii ( figure 2 ) . parp is a group of adp - ribose transferase enzymes that catalyze polyadp - ribosylation of proteins by transferring adp - ribose groups from the donor substrate nicotinamide adenine dinucleotide ( nad ) to glutamic acid , aspartic acid , and lysine residues in the acceptor proteins , thereby regulating the functions of those proteins . dna - dependent parp subfamily members parps 13 have been reported to regulate various dna damage response processes . the recognition and binding to damaged dna structures by parp1 and parp2 , either through their own dna binding domain or through interaction with damaged dna - binding protein 2 , lead to the activation of their enzymatic activity and the polymerization of adp - ribose units of a number of proteins , including parp1/2 , histones , topoisomerase , and dna - pk . the polyadp - ribose on those proteins provides a docking site for recruiting cell cycle checkpoint proteins and dna repair proteins ( e.g. , p53 , xrcc1 , dna - pk , ku70 , and atm ) to the sites of dna lesions , thereby regulating various processes of dna repair , including base - excision repair , hr , and nhej . parp1 regulates base - excision repair by interaction with xrcc1 , dna polymerase , and the base - excision repair enzymes apurinic / apyrimidinic endonuclease 1 and alc1 . parp1 also interacts with dna - pk and ku and is required for an alternative and parp - dependent nhej pathway . although parp1 embryonic stem cells and embryonic fibroblasts exhibit normal repair of dna dsbs and rad51 foci formation , parp1 mice have increased deletion mutations and insertions and/or rearrangements in vivo after treatment with the alkylating agent n - nitrosobis(2-hydroxypropyl)amine . interestingly , parp1 mice are viable and fertile and do not develop spontaneous tumors , possibly because of functional compensation from parp2 , as parp1 and parp2 double knockout is embryonically lethal . nevertheless , parp1 mice or cells exhibit defective dna ssb repair and increased hr , sister chromatid exchange , and chromosome instability . parp1 , but not parp2 , is required for the survival of cells with defects in the hr pathway because knockdown of both parp1 and brca2 significantly reduces the survival of human cells , whereas knockdown of both parp2 and brca2 has no effect on cell survival . the mechanisms underlying the synthetic lethality of parp1 and brca genes are still not clear , although evidence suggests that it might be caused by the deregulation of nhej , increased spontaneous dna breaks that need to be repaired by hr , or the suppression of brca and rad51 expression by e2f4/p130-mediated transcriptional repression caused by parp1 inhibition . the synthetic lethality of parp1 and brcr1/2 genes reported in 2005 by farmer et al . and bryant et al . sparked much interest in the concept of using parp inhibitors to selectively eliminate brca1 or brca2 mutant tumor cells . germ line mutations in brca genes predispose carriers to breast , ovarian , and other cancers in an autosomal dominant manner , with 5080% penetrance for breast cancer and 3050% for ovarian cancer . early studies revealed that parp1 activation facilitates dna repair and maintenance of genomic integrity and is required for recovery from dna damage in mice and in cells . however , excessive parp1 activation leads to cell death because of overconsumption and depletion of nad and atp in the cells , whereas genetic disruption or pharmaceutical inhibition of parp protects animals from ischemia - induced brain and heart damage . in addition , parp1 was found to regulate the transcriptional activity of nfb and other inflammation - related transcription factors , promoting the expression of inflammation mediators . thus , parp inhibitors have been investigated for the therapeutic benefits of protecting tissue from ischemia - induced injury , suppressing inflammation , and sensitizing cancer cells to dna damage - based anticancer therapy . briefly , parp inhibitors used in clinical investigation mostly compete with the adp - ribose donor substrate nad and inhibit both parp1 and parp2 . a binding assay with catalytic domains from 13 of the 17 human parp family members revealed that many of the best known parp inhibitors , including those used in clinical studies such as olaparib ( 1 ) , veliparib ( 2 ) , and rucaparib ( 3 ) ( figure 3 ) , bind to several parp family members , suggesting nonspecific activity of those inhibitors . structures of parp inhibitors . parp inhibitors are currently under intensive investigations as therapeutic agents for the treatment of cancers with deficiencies in brca or other dna repair proteins . an initial preclinical study by farmer et al . revealed that the brca1/2-defective cells were 57- to 133-fold more sensitive to parp inhibitors ku0058684 ( 4 ) and ku0058948 ( 5 ) than wild - type cells . at the same time , bryant et al . showed that hr - defective cells with a deficiency in xrcc2 , xrcc3 , or brca2 ( xrcc11 ) were killed by parp inhibitors such as nu1025 ( 6 ) and ag14361 ( 7 ) at concentrations that were nontoxic to normal cells . recent studies revealed that defects in other dna repair proteins , such as atm , mre11 , ercc1 , and p53 or pten , also induce synthetic lethality with the parp inhibitors . a high - throughput rna interference screen for 230 known and putative dna repair proteins revealed additional genes that have synthetic lethality with compound 5 , including atr , pcna , rad51 , and xrcc1 . a similar study with a novel potent parp1/2 inhibitor ( bmn 673 ) ( 8) and an sirna library targeting 960 genes , including kinases and kinase - related genes , tumor suppressors , and dna repair proteins , showed synthetic lethality of 8 with hr and dsb repair genes moreover , parp1 inhibitors induced synthetic lethality in cancer cells with positive e26 transformation - specific gene fusions and with egfr inhibitors . because of the critical roles of parp1 in the dna repair process , parp inhibitors have also been intensively tested for sensitizing radiotherapy and chemotherapy that induces dna damage . compounds 1 and 2 are the most extensively investigated inhibitors in clinical trials for the treatment of brca1/2-mutated cancers . other parp inhibitors under clinical trials are niraparib ( mk-4827 ) ( 9 ) , 3 , and 8 . a phase i study of the combination therapy of rucaparib with temzolomide in patients with advanced solid tumors showed that 3 at a dose of 12 mg / m inhibited 7497% of parp activity in peripheral blood mononuclear cells . a dose of 12 mg / m3 in combination with 200 mg / m temozolomide was tolerated , with a dose - limiting toxicity of myelosuppression . a phase ii study of intravenous administration of 12 mg / m3 with temozolomide in patients with metastatic melanoma showed that 150200 mg m day temozolomide can be safely given in the combination therapy , with a response rate of about 17% and an increase in progression - free survival over historical controls in metastatic melanoma patients . phase i clinical trials with compound 1 in recurrent / advanced cancer patients with or without brca1/2 mutations revealed that the maximum tolerated dose for 1 was 400 mg twice daily , with dose - limiting toxicities of mood alteration , fatigue , and thrombocytopenia . clinical benefit was observed in 3060% of brca1/2 mutant breast or ovarian cancer patients . the pharmacokinetics study revealed a maximum concentration of 2.64.8 g / ml at doses of 400 mg twice daily . the mean maximal parp inhibitions in peripheral blood mononuclear cells and tumor tissues were 50% and 70% , respectively . mean terminal half - life was about 711 h. subsequently , 1 has been evaluated in combination therapy with various conventional anticancer agents , including cisplatin and gemcitabine , topotecan , bevacizumab , dacarbazine , and the vegfr inhibitor cediranib . the overall response rates were variable , from 0% to 44% . a phase ii comparison study of 1 versus liposomal doxorubicin treatment for brca1/2 mutant ovarian cancer patients who had recurrent tumors after platinum therapy revealed overall response rates of 2531% , not significantly different from that of doxorubicin alone ( 18% ) . phase i trials of a combination of 2 ( half - life of about 5 h ) with cyclophosphamide or topotecan in refractory solid tumors and lymphomas showed promising activity in a subset of patients with brca mutations . the maximum tolerated dose was defined as 60 mg of 2 with 50 mg of cyclophosphamide once daily or 0.6 mg m day topotecan administered intravenously on days 15 and 10 mg of 2 twice daily on days 15 in 21-day cycles . parp activity was significantly inhibited in peripheral blood mononuclear cells ( by 50% ) and in tumor biopsies ( by 80% ) . a phase ii trial of the combination compared with single - agent cyclophosphamide is ongoing for cases of brca mutant ovarian cancer , triple - negative breast cancer , and low - grade lymphoma . a phase 1 dose - escalation trial of 9 in brca mutation carriers and patients with sporadic cancer revealed a maximum tolerated dose of 300 mg / day . the mean terminal elimination half - life was 36.4 h. pharmacodynamic analyses confirmed that parp inhibition exceeded 50% at doses greater than 80 mg / day , and antitumor activity was documented at doses beyond 60 mg / day . clinical benefit was observed in 4050% of brca1/2 mutation carriers with ovarian or breast cancer . antitumor activity was also reported in sporadic high - grade serous ovarian cancer , non - small - cell lung cancer , and prostate cancer . a phase i study of 8 in solid tumors showed that recist and/or ca-125 response occurred at doses of > 100 g / day in 11/17 brca carrier ovarian / peritoneal cancer patients . in summary , the results from these clinical studies revealed that myelosuppression is the major dose - limiting toxicity of various parp inhibitors and that clinical benefit is variable in the single - agent and combination therapies , with significant benefit observed in brca mutant cancers , consistent with the findings in the preclinical studies . the atm / checkpoint kinase 2 ( chk2 ) and atr / chk1 signaling pathways regulate many common downstream proteins , including p53 , cdc25 phosphatases , and wee1 kinase , thereby regulating g1 , s , and g2/m checkpoints ( figure 4 ) . because activation of oncogenes can cause replication stress and dna damage , inhibiting checkpoint pathways may trigger synthetic lethality in cancer cells by enhancing the dna damage - induced apoptosis or senescence , which may be modulated by p53 status . phosphorylation of p53 on s15 by atm / atr and/or on s20 by chk1/chk2 stabilizes p53 protein and up - regulates the expression of p21 ( also known as cip1/waf1 ) , an inhibitor of cyclin e / cyclin - dependent kinase 2 ( cdk2 ) that controls g1/s progression . in contrast , phosphorylation of cdc25 phosphatases by chk1/chk2 promotes degradation of cdc25 , which is required for dephosphorylation and activation of cyclin b / cdk1 kinases that control the transition of g2/m phases ( figure 4 ) . evidence has shown that atr / chk1 is critical in regulating the activity of cdc25 and s / g2 checkpoints . although p53 also regulates the g2 checkpoint , g2 arrest is normally induced in p53-deficient cancers , suggesting that some p53-independent mechanisms are sufficient for g2 checkpoint functioning . recent studies showed that p53-deficient cells rely on atm- and atr - mediated checkpoint signaling through the p38 mitogen - activated protein ( map ) kinase / map kinase - activated protein kinase 2 ( mk2 ) pathway for survival after dna damage . evidence has shown that p53-mediated apoptosis or cell cycle arrest is modulated by atm and chk2 activities . in cells and tumors that lacked a functional p53 pathway , inactivation of atm or its downstream molecule chk2 was sufficient to globally sensitize the cells to genotoxic chemotherapy with cisplatin or doxorubicin . in contrast , in p53 wild - type cells , the inhibition of atm or chk2 resulted in a substantial survival benefit , suggesting that a combination of cisplatin and doxorubicin with inhibitors of atm and chk2 could benefit patients with p53 mutant tumors . genome - wide small hairpin rna screening also revealed that inhibiting atm or met induced synthetic lethality with a p53 stabilizing / activating compound nutlin-3 ( 10 ) ( figure 5 ) and converted the cellular response from cell cycle arrest to apoptosis in various cancer cell types without affecting the expression of key p53 target genes . although atm inhibitors such as cp466722 ( 11 ) and ku59403 ( 12 ) do not have single - agent activity in cancer cell lines , they could sensitize cancer cells to ionizing radiation and/or genotoxic chemotherapeutics . dna damage caused by physical , chemical , and biological factors , such as oncogene activation , activates phosphatidylinositol 3-kinase related kinases atm and atr , leading to the activation of chk2 , chk1 , and p38/mk2 , which further regulate activity and stability of cell cycle regulators , including p53 and cdc25 . the loss of p53 function in cancer cells makes the cells addicting to the s and/or g2/m checkpoints for dna repaire and survival . inhibiting s and/or g2/m checkpoint regulators may induce synthetic lethality in p53 mutant cells when dna is damaged . arrow indicates activation , and the line terminating with a black circle indicates suppression . similar results have shown that inhibiting atr and chk1 exacerbates levels of oncogene - induced replicative stress , promoting the cell killing of oncogene - overexpressing cells and sensitizing tumor cells to dna - damaging therapy . inhibiting atr by a dominant negative construct selectively sensitizes g1 checkpoint - deficient cells to dna damage - induced lethal premature chromatin condensation . knockdown of atr expression selectively enhanced cisplatin sensitivity in human colorectal cancer cells with inactivated p53 , whereas the restoration of p53 in atr - deficient cells increased cell survival after cisplatin treatment . reduced atr expression prevented the development of myc - induced lymphomas or pancreatic tumors in mice by enhancing myc - induced replicative stress and apoptosis , which is more pronounced in p53-deficient cells . transgenic mice with diminished atr function in the skin have increased apoptosis after ultraviolet exposure and reduced ultraviolet - induced skin carcinogenesis , suggesting that the inhibition of the replication checkpoint function may have therapeutic and/or preventive benefits . inhibiting atr also induced synthetic lethality in xrcc1-deficient cancer cells and sensitized cancer cells to dna - damaging chemotherapeutic agents . synthetic lethality in xrcc1-deficient cancer cells is also elicited by the atm inhibitor ku55933 ( 13 ) and the dna - pk inhibitor nu7441 ( 14 ) . a cell - based screening of 623 pi3k inhibitors led researchers to identify an mtor- and atr - selective inhibitor , etp-46464 ( 15 ) , that induces replicative stress and synthetic lethality in p53-deficient or cyclin e - overexpressing cells . the ic50 values of 15 for mtor and atr are 0.6 and 14 nm , respectively , but > 36 nm for dnapk , pi3k , and atm . az20 ( 16 ) , an atr inhibitor derived from the mtor inhibitor sulfonylmorpholinopyrimidine , was reported to have single - agent activity when administered orally in mice bearing the xenograft established from colon cancer cell line lovo . through high - throughput screening and compound optimization , charrier et al . developed an atr - selective inhibitor , ve-821 ( 17 ) , with ic50 values for atr , atm , and dnapk of 12 nm , > 8 m , and > 8 m , respectively . in vitro study revealed that treatment with 17 alone induced selective killing of atm- or p53-deficient cancer cells but only reversibly limited cell cycle progression in normal cells . 17 also increased cisplatin potency 10-fold in hct116 cells , suggesting that inhibiting atr could potentiate the efficacies of radiotherapy and genotoxic drugs . ve-822 ( 18 ) , an analogue of 17 , was found to have in vivo activity in blocking atr and sensitizing pancreatic cancer cells to gemcitabine - based chemoradiation therapy . nevertheless , no clinical studies with atm or atr inhibitors have yet been reported . in comparison to the development of atm / atr inhibitors , the development of chk inhibitors , specifically chk1 inhibitors , is more advanced possibly because it is easier to perform enzymatic analysis on chk1/chk2 . chk1 and chk2 have a highly conserved kinase domain but have distinct overall protein structures . however , several small molecular inhibitors inhibit both chk1 and chk2 with a similar potency . in an e-myc - driving lymphoma model , inhibiting chk1 , chk2 , or both with small molecule inhibitors induced cell death , although the e-myc p53 null lymphoma cells were more sensitive to a dual chk1/chk2 inhibitor than to a chk1-specific inhibitor . azd7762 ( 19 ) ( figure 6 ) , a dual chk1/2 inhibitor , also enhances radiosensitivity- and chemotherapy - induced apoptosis in p53 mutant and/or p21-deficient tumor cells to a greater extent than in p53 wild - type tumor cells . the potentiation of dna damaging agent - induced apoptosis by chk inhibitors is possibly caused by abrogation of the g2 checkpoint and/or inhibition of hr dna repair . gene knockout studies revealed that knockout of chk1 or chk2 caused defects in the induction and/or maintenance of irradiation - induced g2 arrest . intriguingly , knockout of atm or chk2 is viable for cells and animals , although phenotypes of ataxia telangiectasia , chromosomal abnormality , and the development of thymic lymphomas are observed in atm knockout , whereas resistance to ionizing radiation - induced apoptosis is observed in chk2 knockout . in contrast , knockout of atr or chk1 is lethal for cells and embryos with defects in the g2/m dna damage checkpoint , indicating that the atr / chk1 pathway is essential for cell survival . therefore , inhibitors of atr and/or chk1 could be more potent and toxic than those of atm and/or chk2 . a synthetic lethality sirna screening of 572 kinases for improving gemcitabine or cisplatin response in pancreatic or ovarian cancer cells revealed the greatest potentiation by sirna targeting of atr and/or chk1 . similar results were obtained by inhibiting chk1 with small molecule inhibitors such as pd407824 ( a dual inhibitor of chk1 and wee1 ) ( 20 ) . a phase i study on 19 single - agent therapy and combination therapy with gemcitabine in patients with advanced solid tumors showed that the dose - limiting toxicities are cardiac and liver function abnormalities and myelosuppression . no objective responses were observed , although disease stabilization was observed in some patients . ucn-01 ( 7-hydroxystaurosporin ) ( 21 ) , a protein kinase c inhibitor that also inhibits many other kinases , including chk1 , and abrogates the g2 checkpoint has been reported to enhance the effectiveness of genotoxic agents in p53-deficient cells . a phase i study of 21 in combination with perifosine or irinotecan showed some partial response in p53-defective triple - negative breast cancer , whereas a phase ii trial in metastatic melanoma showed that 21 as a single agent is not active in refractory melanoma . both 19 and 21 have been found to be not favorable for further development because of pharmacokinetic and toxicity issues . mk-8776 ( sch900776 ) ( 22 ) and ly2603618 ( 23 ) are chk1 selective inhibitors ( 50- to 500-fold more active than on chk2 ) that are being used in clinical trials for the treatment of leukemias and solid tumors . cardiac toxicity and myelosuppression were observed in phase i trials of both 22 and 23 in combination therapy with cytarabine and pemetrexed , respectively.22 was used in combination with cytarabine to treat refractory acute leukemias . complete remissions occurred in 8 ( 33% ) of 24 patients , mostly at a dose of 40 mg / m or higher of 22 . the maximum tolerated dose for 22 was approximately 56 mg / m.23 in combination with pemetrexed ( 500 mg / m ) for the treatment of solid tumors revealed a maximum tolerated dose for 23 of 150 mg / m ; some partial response or disease stabilization was observed . some chk2-selective inhibitors have been identified , including pv1019 ( 24 ) and cct241533 ( 25 ) . both agents were reported to be highly selective against chk1 and have radioprotective effects in mouse thymocytes . as single agents , both 24 and 25 had mild antitumor activity but were found to potentiate the cytotoxicity of genotoxic agents and parp inhibitors , respectively . activating mutations in three oncogenic ras genes ( h- , n- , and k - ras ) is among the first and the most common genetic alterations identified in human cancers , occurring in approximately 30% of human tumors . the kras gene encodes two splicing isoforms , a major kras 4b and a minor kras 4a . therefore , mammals have four small ( 21 kda ) oncogenic ras proteins of about 190 amino acids in size , with the first 165 aa conserved in the n - terminal for all the ras proteins . the kras 4b , hras , and nras isoforms are ubiquitously expressed , whereas kras 4a is expressed mainly in kidney , liver , and gastrointestinal tissues . as a subfamily of small guanine nucleotide - binding proteins , ras proteins cycle between an active guanosine triphosphate ( gtp ) bound form and an inactive guanosine diphosphate ( gdp ) bound form . binding of ras with gtp is facilitated by guanine nucleotide exchange factors through catalyzing the release of gdp and is required for the interaction of ras with target proteins . the intrinsic gtpase activity that is enhanced by gtpase - activating proteins converts gtp to gdp , leading to a gdp - bound , inactive ras . ras mutations that diminish the gtpase activity or decrease the gdp binding capacity render ras in a constitutively active , gtp - bound status . in the absence of a ras mutation , increased ras activity is frequently detected in human cancer because of gene amplification , overexpression , an increase in upstream signals from tyrosine - kinase growth - factor receptors such as her2 and egfr , and altered expression of micro - rna such as let-7 . increased ras activity is associated with resistance to chemotherapy and radiotherapy , leading to a poor prognosis . as a key mediator in the signaling transduction for a variety of growth factors , cytokines , and hormones , ras proteins are transferred to the inner leaflet of the plasma membrane , where they interact with a diversity of membrane receptors and execute signal transduction in a variety of signaling pathways that govern cell growth , proliferation , differentiation , and death . several steps of posttranslational modifications are critical for trafficking ras proteins to the plasma membrane , including farnesylation at the cysteine residue of the carboxy - terminal caax motif and methylation of farnesyl cysteine at the c - terminal . the enzymes involved in these processes , such as farnesyltransferase , geranylgeranyltransferase , and isoprenylcysteine carboxyl methyltransferase , have been intensively investigated in preclinical and clinical trials for anti - ras therapy . small molecules binding irreversibly to the kras ( g12c ) mutant protein or interfering with ras effector protein interaction have recently been reported . targeting the ras downstream pathways , particularly the raf / mek / erk and pi3k / akt / mtor pathways , has also been investigated for inhibiting ras mutant cancer cells . a clinical trial with biomarker - integrated targeted therapy for lung cancer has revealed that sorafenib ( 26 ) , a pan - raf and vegfr inhibitor , has impressive benefits for kras mutant patients . however , selective inhibition of braf with a dominant negative construct in mice or with braf - selective inhibitors such as vemurafenib ( 27 ) in patients promoted the development and/or progression of ras mutant cancers possibly because of the activation of other raf isoforms , such as raf-1 . thus far , effective anti - ras therapeutics is not clinically available . indirect anti - ras therapy with the synthetic lethality - based approach has recently been investigated by several groups . it is noteworthy that expression of oncogenic ras in primary normal human or rodent cells often results in apoptosis or senescence , whereas expression of oncogenic ras in immortal cells or cells with inactivation of p53 , p16 , or the transcriptional activator interferon regulatory factor 1 leads to transformation and tumorigenesis , suggesting that ras transformed cells have additional signaling context for survival , which provides opportunity of synthetic lethality based anti - ras therapy . several studies on sirna library screens with isogenic cell lines harboring mutant and wild - type ras genes have revealed synthetic lethal interactions of oncogenic ras with some key nodes in cancer signaling network , including polo - like kinase 1 ( plk1 ) , a serine / threonine protein kinase that regulates cell mitosis ; the transcription factor wilms tumor 1 ( wt1 ) ; tank - binding kinase 1 ( tbk1 ) , a noncanonical ib kinase that regulates the stability of ib ; spleen tyrosine kinase ( syk ) ; and cdk4 ( figure 7 ) . some small - molecule inhibitors of plk1 , cdk4 , and syk are already being used in clinical trials for anticancer therapy . the synthetic lethality interactions of those targets with oncogenic ras suggest that ras gene mutation might be used as a marker to identify responders . receptor tyrosine kinases ( rtk ) activate ras and pi3k / akt / mtor pathways . ras in turn activates raf / mek / erk , pi3k / akt / mtor , and ralgef / ral pathways and crosstalks with rtk , wnt , c - jun n - terminal kinases ( jnk ) , reactive oxidative species ( ros ) , stat3 , and tumor necrosis factor ( tnf)/nfb pathways . several key nodes in those signaling networks , such as tbk1 , plk1 , cdk4 , syk , and wt1 ( colored tan ) , have been reported to have synthetic lethal interactions with oncogenic ras . arrow indicates activation , and the line terminating with a black circle indicates suppression . several innovative anticancer agents that selectively induce cytotoxic effects in cancer cells with ras mutations have been identified by screening chemical libraries , including triphenyltetrazolium ( 28 ) and a sulfinyl cytidine derivative ( 29 ) ( figure 8) that demonstrated approximately 6-fold selectivity for cell lines containing mutant kras ; erastin ( 30 ) , which exhibited lethal selectivity in human tumor cells harboring mutations in the hras , kras , or braf oncogenes by acting on mitochondrial voltage - dependent anion channels and inducing oxidative cell death ; lanperisone ( 31 ) ; and oncrasin-1 ( 32 ) . interestingly , 30,31 , and analogues of 32(161,162 ) all induced cell - killing effects in ras mutant tumor cells by triggering oxidative stress , although through different underlying mechanisms . while 30 may act on mitochondrial voltage - dependent anion channels and induce oxidative cell death,32 and its analogues act on rna polymerase ii , protein kinase c ( pkc ) , and stat3 . most of the molecules involved in oncrasin - induced antitumor activity are directly involved either in signal transductions in ras , myc , and stat3 pathways or in causing synthetic lethality in cells with elevated activity of ras or myc oncogenes . similar to the agents identified through other approaches , substantial efforts will be required for optimization of compounds identified through synthetic lethality screening . effort has been made in the developmental therapeutics program at the national cancer institute and in our own laboratory for compound optimization of oncrasin 1 . one of the most active analogue compounds , nsc-743380 ( 33 ) , was tested in vitro with the nci-60 cell panel and 50 non - small - cell lung carcinoma cell lines and was highly active ( ic50 between 10 nm and 1 m ) in 30 of 102 cancer cell lines tested . in 50 non - small - cell lung cancer cell lines tested , 16 ( 32% ) were highly responsive to this compound ( ic50 < 0.33 m ) , including many kras mutant cancer cell lines , suggesting that a large subset of cancer patients may potentially benefit from treatment with this agent . in vivo studies performed in our laboratory and by the national cancer institute s developmental therapeutics program have shown that intraperitoneal administration of 33 at doses of 67150 mg / kg caused complete tumor regression or significant growth suppression in some xenograft tumor models , suggesting that this compound has the potential to move to further development . nevertheless , most compounds developed by synthetic lethality screening for oncogenic ras are still at the preclinical evaluation stage . the enthusiasm for developing synthetic lethality based anticancer therapeutics has been increasing recently , with increasing numbers of publications on this topic . most potential therapeutic targets or therapeutic agents developed through the concept of synthetic lethality are identified by cell - based screening with pairs of isogenic cell lines . although this approach may facilitate development of genotype - specific anticancer therapeutics , several studies have demonstrated that synthetic lethality is likely cell context dependent . for example , kras mutant cancer cell lines have been characterized as either kras - dependent or kras - independent , on the basis of cell - killing effects induced by knockdown of the kras gene itself . when 45 genes that have synthetic lethality with egfr inhibitors in the cervical adenocarcinoma cell line a431 were tested for sensitization to erlotinib or cetuximab in seven other cell lines , none of the genes sensitized all tested cell lines , although several of the genes sensitized three to five of the cell lines . similarly , resistance to the synthetic lethality of parp inhibitors in brca1 and brca2 mutant cancers has been observed both in experimental tumor models and in clinical trials . the differences in genetic and/or epigenetic backgrounds in individual cells may explain the cell - context - dependent synthetic lethality observed in various studies . because a tumor may harbor an average of 3070 mutated genes , an individual primary tumor or established cancer cell line may carry multiple concomitantly activated oncogenes or inactivated tumor suppressor genes . the activation in other signaling pathways may provide redundant input that drives and maintains downstream survival signaling , resulting in resistance to therapeutic agents that target a particular genetic lesion either directly or indirectly through synthetic lethality . moreover , even though some passenger mutations in tumor cells may not contribute to tumorigenesis , these mutations may affect drug response because of altered drug metabolism or drug efflux . as a result , querying for the synthetic lethality partners of an oncogenic kras gene can identify different candidate genes or lead compounds in different cell lines . similarly , a synthetic lethality gene agent combination identified in one cell line may not necessarily be applicable to another cell line . mechanistic delineation of molecules or pathways that mediate responses to synthetic lethality anticancer therapeutics and the identification of predictive biomarkers for treatment responses will be critical for the successful development of synthetic lethality anticancer therapeutics . on the other hand , the concept of synthetic lethality has also been explored for characterizing mechanisms of resistance and for combination therapy or multimodality therapy to enhance the efficacy of anticancer drugs . simultaneous targeting the redundant survival pathways is expected to overcome resistance and/or enhance efficacy in anticancer therapy . our own experience in developing synthetic - lethality - based anticancer therapeutics suggests that mechanistic characterization and compound optimization could be challenging and time - consuming . the biological functions of compounds identified through cell - based synthetic lethality screening are largely unknown . technological developments in chemical biology , such as conjugating compounds to biotin or resin beads and performing affinity - based target precipitation and subsequent protein identification by mass spectrometry analysis , may facilitate target and mechanistic characterization . however , conjugating and immobilizing a small compound may change its biological function and protein - binding specificity . alternatively , target proteins may be enriched by protecting the targets from protease - mediated degradation through the binding of unmodified compounds to their targets . robust efforts on in vivo optimization of the lead compound are also essential in drug development , as compounds with similar chemical structures and in vitro activity may have dramatically different in vivo toxicity and efficacy profiles .

the concept of synthetic lethality ( the creation of a lethal phenotype from the combined effects of mutations in two or more genes ) has recently been exploited in various efforts to develop new genotype - selective anticancer therapeutics . these efforts include screening for novel anticancer agents , identifying novel therapeutic targets , characterizing mechanisms of resistance to targeted therapy , and improving efficacies through the rational design of combination therapy . this review discusses recent developments in synthetic lethality anticancer therapeutics , including poly adp - ribose polymerase inhibitors for brca1- and brca2-mutant cancers , checkpoint inhibitors for p53 mutant cancers , and small molecule agents targeting ras gene mutant cancers . because cancers are caused by mutations in multiple genes and abnormalities in multiple signaling pathways , synthetic lethality for a specific tumor suppressor gene or oncogene is likely cell context - dependent . delineation of the mechanisms underlying synthetic lethality and identification of treatment response biomarkers will be critical for the success of synthetic lethality anticancer therapy .

Introduction DNA Damage Response Pathway PARP and PARP Inhibitors Checkpoint Inhibitors Oncogenic RAS and Anti-RAS Therapeutics Future Prospects

local anesthetics like lidocaine and bupivacaine , opioids like morphine , alpha2 adrenoceptor agonists like clonidine , dexmeditomidine , and magnesium sulphate have all been tried intra - articularly either as sole agents or in combination , to provide effective postoperative analgesia . studies have shown that dexamethasone increases the duration of regional blocks , when combined with local anesthetics . therefore , it is expected that such a beneficial effect of dexamethasone can be manifested when it is injected in combination with levobupivacaine to intra - articular spaces . this placebo - controlled , double - blind , prospective study is designed to assess the efficacy of intra - articular dexamethasone administered as adjuvant to local anesthetic levobupivacaine in patients undergoing arthroscopic knee surgery . the study protocol was approved by the institutional ethical committee and informed consent was obtained from every patient . fifty asa i - ii patients of either sex , aged 18 - 65 years , undergoing elective knee arthroscopy were randomly assigned to one of the two groups using computer - generated random numbers comprising of 25 patients each . before performing the study , we hypothesized that the beneficial effect of levobupivacaine alone ( in terms of prolonged analgesia ) will be evident in at least 25% of the patients , after reviewing related articles and our experience . considering an absolute improvement in the primary outcome by 40% ( by the addition of dexamethasone ) in the study group can be considered as clinically relevant and based on a type i error level of 0.05 , type ii error level of 0.2 , and a two - sided test , we needed 21 patients in each treatment groups . therefore , to account for probable drop outs , a number of 25 patients in each group was proposed . surgical procedures mainly consisted of meniscectomy and ligament repair . patients having history of cardiovascular , cerebrovascular , and respiratory diseases , pregnancy , receiving chronic pain treatment , diabetes , and acid peptic disease were excluded from the study . on preoperative rounds , patients were explained regarding the procedure and were also taught to interpret the visual analogue scale ( vas ) ( graded from 0 = no pain to 10 = maximum pain ) . ranitidine was repeated on the day of surgery 2 h before induction with sips of water . on the operation table , routine monitoring ( electrocardiography , pulse oximetry , noninvasive blood pressure ) was started and baseline vital parameters like heart rate ( hr ) , blood pressure ( systolic , diastolic , and mean ) , and arterial oxygen saturation ( spo2 ) were recorded . after preoxygenation for 3 min , induction of anesthesia was done by fentanyl 2 g / kg and propofol 2 mg / kg intravenously ( i.v . ) . trachea was intubated with appropriate size endotracheal tube after muscle relaxation with vecuronium bromide in a dose of 0.08 mg / kg i.v . anesthesia was maintained with 33% oxygen in nitrous oxide and isoflurane was adjusted to maintain a minimum alveolar concentration ( mac ) of 0.7 . hr and mean arterial pressure were maintained within 20% of baseline value by giving additional bolus doss of fentanyl 25 g and propofol 10 mg i.v . patients were randomly allocated using a computer - generated randomization list into two groups ( n = 25 ) . prefilled syringes were prepared with either levobupivacaine and saline or levobupivacaine and dexamethasone and kept in number coded sealed envelopes , made sterile by sterrad sterilization machine . the anesthesiologist and surgeon were unaware of the nature of the drug in each syringe . at the end of the surgical procedure , intraarticular solutions were injected into the knee joint through the cannular sheath after withdrawal of camera by the orthopedic surgeon before the arthroscope was removed . in group l , 18 ml of 0.25% levobupivacaine and 2ml isotonic saline [ total volume 20 ml ] was administered into the knee joint . similarly group d patients received 8 mg dexamethasone ( 2 ml ) added to 18 ml 0.25% levobupivacaine ( again making a volume of 20 ml ) . at the end of the operation , residual neuromuscular paralysis was reversed using intravenous glycopyrrolate and neostigmine and subsequently extubation was done . all patients were observed postoperatively by resident doctors who were unaware of the study group . patients were transferred to postanesthesia care unit and intensity of pain and vital parameters were assessed after 30 min and then an hourly interval for 24 h. diclofenac sodium ( 75 mg ) was administered i.v . as analgesic supplement if the recorded vas pain score was 4 or more and was repeated every 8 h , if required . was used as a rescue analgesic , if the patients continued to have pain after diclofenac administration . the time to the first analgesic requirement and the total diclofenac consumption during first 24 h after operation were also recorded . the primary outcome variable in the study was the duration of analgesia following the surgery and the secondary outcome variables were total diclofenac consumption and the requirement of rescue analgesic between the study groups . student 's t - test was employed to calculate the statistical differences in continuous variables between the groups , categorical variables were compared with chi - square test(or fisher 's exact test ; as applicable ) . a ssps ; version 16.0 ( spss , chicago , il , usa ) was used for analysis . the primary outcome variable in the study was the duration of analgesia following the surgery and the secondary outcome variables were total diclofenac consumption and the requirement of rescue analgesic between the study groups . student 's t - test was employed to calculate the statistical differences in continuous variables between the groups , categorical variables were compared with chi - square test(or fisher 's exact test ; as applicable ) . a ssps ; version 16.0 ( spss , chicago , il , usa ) was used for analysis . the two groups were comparable with regard to age , sex , body weight , and duration of surgery [ table 1 ] . the groups were also comparable regarding fentanyl and propofol consumption during intraoperative period ( p > 0.05 ) [ table 2 ] . intensity of pain was significantly less in group d compared with group l upto 9 h following surgery . however , from 10 h , intensity of pain was comparable in both groups [ table 3 , figure 1 ] . patientscharacteristics ( mean standard deviation ) fentanyl and propofol consumption in the intraoperative period ( mean standard deviation ) intensity of pain ( visual analogue scale ) in postoperative period intensity of pain in terms of visual analogue scale in postoperative period in patients belonging to group l and group d. * indicates p < 0.05 ; * * indicates p < 0.01 the mean duration of analgesia ( delay between the intra - articular injection and the first postoperative analgesic demand ) was longer in group d compared with group l ( 10.24 2.8 h vs. 5.48 1.6 h ; mean sd ; p < 0.01 ) [ table 4 ] . total diclofenac consumption in first 24 h was significantly less in group d compared with group l ( p < 0.01 ) [ table 4 ] . duration of analgesia and diclofenac consumption in the postoperative period ( mean standard deviation ) in an attempt to improve the recovery and early rehabilitation after arthroscopic knee surgery , research has been directed toward developing newer techniques for postoperative analgesia . dexamethasone a 9-derivative synthetic glucocorticoid was selected because of its highly potent anti - inflammatory property with minimal mineralocorticoid activity , thus found to be safer and devoid of potential side effects . local anesthetic agents can provide analgesia for limited period of time when used as single injection . as steroids block the transmission of impulse in nociceptive c fibers , we were interested in determining whether dexamethasone might prolong the duration of analgesia when administered intra - articularly along with local anesthetic agents . few preliminary studies reported that steroids significantly prolong the duration of analgesia in extremity nerve blocks . dexamethasone has been reported to result in significant prolongation of supraclavicular brachial plexus block when added as an adjuvant to local anesthetic bupivacaine . we assumed the similar probable mechanism regarding dexamethasone and levobupivacaine combination as bupivacaine and levobupivacaine were comparable regarding quality and duration of blockade when used in three - in - one blocks in a study by urbanek et al . the dense and prolonged block in the dexamethasone group is due to the synergistic action with local anesthetic levobupivacaine on blockade of nerve fibers . the block prolonging effect of dexamethasone is due to its local action , not a systemic one . it has been found that this effect of steroid is mediated via steroid receptors . when steroids alone were used in regional blocks , the blockade is not produced . steroids might bring about this effect by altering the function of potassium channels in excitable cells . the delay between intr - aarticular injection of levobupivacaine with dexamethasone and supplementary analgesic administration was 10.24 2.8 h in our study . we could not find studies using dexamethasone with levobupivaciaine intraarticularly for prolongation of postoperative analgesia after arthroscopic knee surgery . in a study performed by paul et al . , it was found that time period for first analgesic request for intra - articular bupivacaine and magnesium sulphate combination was 12.32 2.8 h , intra - articular bupivacaine and clonidine was 10.16 2.4 h. in another study by paul et al . , time for first analgesic request for intra - articular dexmedetomidine in combination with ropivacaine was 10.84 2.6 h. it seems that dexamethasone administered as adjuvant to levobupivacaine was able to provide analgesia which was comparable to other intra - articular agents used in previous similar studies . dexamethasone administered intra - articularly as an adjuvant to local anesthetic levobupivacaine improves the quality and duration of postoperative analgesia and reduces the consumption of diclofenac sodium in patients undergoing elective knee arthroscopy .

background and aims : in an attempt to improve the recovery and early rehabilitation after arthroscopic knee surgery , various medications have been administered via intra - articular route to prolong the duration and improve the quality of postoperative analgesia . among the potentially effective substances , steroids like dexamethasone could be of particular interest.materials and methods : fifty patients undergoing elective knee arthroscopy were randomly assigned to one of the following groups containing 25 patients each . group d patients received 8 mg ( 2 ml ) of dexamethasone added to 18 ml of 0.25% levobupivacaine intra - articularly , ( total volume 20 ml ) . group l patients received 18 ml of 0.25% levobupivacaine and 2 ml of isotonic saline ( 20 ml in total ) intra - articularly . analgesic effect was evaluated by measuring pain intensity visual analogue scale score and duration of analgesia.results:a longer delay was observed between intra - articular injection of study medication and first requirement of supplementary analgesic in group d ( 10.24 2.8 hours ) compared with group l ( 5.48 1.6 h ) . total consumption of diclofenac sodium in first 24 h in postoperative period was significantly less in group d. no significant side effects were noted.conclusion:dexamethasone , used as adjunct to levobupivacaine in patients undergoing arthroscopic knee surgery , improves the quality and prolongs the duration of postoperative analgesia .

Introduction Materials and Methods Statistical analysis Results Discussion Conclusions

disruptions in connectivity across distributed neural networks are common features of stress - related neuropsychiatric conditions , and understanding how they arise may yield new insights into mechanisms of resilience and vulnerability . stress has potent effects on apical dendrites and postsynaptic dendritic spines in multiple brain regions . in the hippocampus , which plays an important negative feedback role in hpa axis regulation , chronic stress causes atrophy of apical dendrites in ca1 and ca3 pyramidal cells and a decrease in the density of postsynaptic dendritic spines ( jacobson and sapolsky , 1991 , magarios and mcewen , 1995a , magarios and mcewen , 1995b , magarios et al . , 1996 , , 1997 , sousa et al . , 2000 , vyas et al . , other studies have identified associated behavioral deficits in spatial learning and memory tasks such as the radial arm and y mazes ( luine et al . , 1994 , conrad et al . , 1996 , in contrast , in the amygdala , which up - regulates hpa axis activity , chronic stress causes hypertrophy of dendritic arbors , accompanied by a facilitation of aversive learning and heightened fear and anxiety ( vyas et al . importantly , analogous effects have been observed in parallel rodent and human neuroimaging studies of the prefrontal cortex ( fig . 1 ) . many of these studies have focused on the dorsolateral prefrontal cortex in humans , and the medial prefrontal cortex in rodents , as these regions share important functional and neuroanatomical similarities ( ongur and price , 2000 , dalley et al . , 2004 ) , although it should be noted that rodents do have a dorsal prefrontal cortex , which may contribute to associated cognitive functions ( lai et al . , 2012 ) . in rats , pyramidal cells in layer ii / iii of the medial pfc show a pattern of structural changes similar to what has been observed in the hippocampus : retraction of apical dendritic branches and reduced spine density after repeated stress exposure ( cook and wellman , 2004 , radley et al . these changes were associated with specific deficits in an extradimensional attentional set shifting task that correlated with individual differences in the degree of dendritic atrophy ( liston et al . , 2006 ) . in another study , chronic stress caused deficits in spatial working memory that correlated with spine loss on the apical dendrites of prelimbic pyramidal cells ( hains et al . , 2009 ) . the apical dendrites of layer ii / iii pyramidal cells are important recipients of long - range corticocortical projections , so apical dendritic atrophy would be expected to impair functional connectivity across neuroanatomically distributed brain networks ( dehaene et al . , 1998 ) . this is exactly what was observed in a related functional neuroimaging study ( liston et al . , 2009 ) . here , chronically stressed but otherwise healthy human subjects were tested on an attention shifting task during fmri scanning . they exhibited deficits in fmri measures of functional connectivity between dorsolateral prefrontal cortex and a frontoparietal attention network that were correlated with stress levels and attention shifting impairments . similar effects were also observed in the medial prefrontal cortex in another human neuroimaging study , in which stressful life events were associated with decreased gray matter volume in the medial prefrontal , anterior cingulate , and subgenual cingulate cortex ( ansell et al . , 2012 ) . thus , chronic stress has been linked to deficits in structural and functional connectivity measures and associated attentional impairments in both rodent models and human neuroimaging studies . these studies also indicate that connectivity in cortical networks is highly plastic and is often capable of recovering after a change in stress exposure . in rats , four weeks after cessation of the stressor , spine densities fully recovered to unstressed levels ( radley et al . , 2005 ) . similarly , when the same human subjects were re - scanned after a month of rest and reduced stress , both functional connectivity deficits and attention shifting impairments normalized and were no different from unstressed control subjects ( liston et al . , the reversibility of these stress effects underscores the striking capacity for resilience that is evident in the healthy brain . while the healthy human brain demonstrates a remarkable capacity for adaptation and recovery from stressors in daily life , patients with neuropsychiatric disorders often do not . in a recent clinical neuroimaging study , we found that patients with depression exhibited a similar pattern of functional connectivity deficits between dorsolateral prefrontal cortex and a frontoparietal control network that may contribute to rumination , executive control deficits , and other cognitive symptoms ( liston et al . however , in contrast to the study of chronically stressed but otherwise healthy subjects , when depressed patients were re - scanned after five weeks of antidepressant treatment , frontoparietal connectivity deficits persisted ( liston et al . , these results are consistent with the hypothesis that stress - associated changes in connectivity in large - scale brain networks are an important feature of depression and other stress - related neuropsychiatric disorders , and that resilience and vulnerability may be determined in part by individual differences in the capacity for plasticity within these circuits . understanding the mechanisms by which stress alters connectivity in vulnerable circuits may reveal new avenues for treatment . undoubtedly , many factors are involved , and some of them have been reviewed elsewhere ( de kloet et al . , 2005b , arnsten , 2009 , jols and baram , 2009 , chen et al . , we focus on a factor that has received relatively little attention , namely , endogenous glucocorticoid oscillations and their role in regulating synaptic plasticity . glucocorticoids are hormones that are released from the adrenal gland in response to signals originating in the pituitary and hypothalamus , which receives projections from distinct circuits for detecting physiological and psychosocial stressors ( herman and cullinan , 1997 , ulrich - lai and herman , 2009 ) ( fig . , glucocorticoids serve to mobilize energy resources and facilitate sympathetic nervous system responses to maintain homeostasis and adapt to stress . in the long term , however , prolonged exposure to glucocorticoids in chronic stress states can have maladaptive effects , mediated in part by disruptions in negative feedback mechanisms ( mcewen , 1998 , mcewen , 2003 ) . glucocorticoid activity also oscillates with diurnal activity rhythms , independent of external stressors ( fig . 2b ) : glucocorticoid secretion tends to peak in the early morning in diurnal animals ( early evening in nocturnal animals ) , remains relatively elevated for most of the active period of the animal 's day , and becomes relatively suppressed for most of the night . in addition , recent reports ( stavreva et al . , 2009 , lightman and conway - campbell , 2010 ) have shown that an ultradian oscillation with a period of 12 h is superimposed on this circadian rhythm and has equally important consequences for glucocorticoid signaling ( reviewed below ) . in previous fixed tissue studies , stress and glucocorticoid effects on dendritic 2006 ) , which would imply that glucocorticoid oscillations occurring on a timescale of minutes to hours were unlikely to play a direct role in these changes . however , recent studies indicate that glucocorticoids and related signaling molecules can have much more rapid effects on dendritic spines than were previously suspected . for example , in hippocampal organotypic cultures , corticotropin - releasing hormone ( crh)a peptide hormone neurotransmitter and upstream regulator of glucocorticoid synthesis rapidly increased the retraction and elimination of apical dendritic spines after just 30 min of exposure ( chen et al . , 2008 ) , providing one potential mechanism for stress - induced deficits in memory recall ( chen et al . , 2010 ) . similarly , using transcranial two - photon microscopy to image the dynamic remodeling of postsynaptic dendritic spines in the living , developing cortex ( liston and gan , 2011 ) , we found that glucocorticoids have rapid effects on both spine formation and elimination within hours of exposure . surprisingly , low - dose dexamethasone ( 0.1 mg / kg ) , a synthetic glucocorticoid that inhibits endogenous corticosteroid synthesis without penetrating the blood / brain barrier ( karssen et al . , 2005 ) , effectively prevented developmental spine formation and pruning . it is important to note that studies in neuronal cultures and in the developing cortex are investigating spine remodeling under conditions of heightened plasticity , so additional work will be needed to understand how the results apply to the adult brain . however , these experiments indicate that glucocorticoids play an unexpected , necessary role in facilitating physiological spine maturation in the developing adolescent brain , acting on timescale of minutes to hours to facilitate spine remodeling . these unexpectedly rapid effects also suggest that circadian glucocorticoid oscillations may contribute to synaptic plasticity during learning and development . to test this hypothesis , we conducted a series of two - photon imaging studies in mice before and after training on a rotarod motor skill - learning paradigm , and found that circadian glucocorticoid peaks and troughs play critical , complementary roles in facilitating experience - dependent spine remodeling ( fig . 2c specifically , circadian glucocorticoid peaks enhanced spine formation rapidly in the hours after learning , acting through a glucocorticoid receptor - dependent , non - transcriptional mechanism . in accord with prior reports ( yang et al . , 2009 ) , training increased formation rates but only if it occurred during the circadian peak . in mice that were trained during the circadian trough , spine formation rates were equivalent to those of untrained mice , and memory retention was reduced one week later . furthermore , circadian troughs were necessary for stabilizing a subset of learning - related spines and pruning a corresponding set of pre - existing synapses . memory retention and the long - term survival of learning - related spines required intact circadian troughs in the days after learning , which enhanced learning - related spine pruning through a distinct , mineralocorticoid receptor - dependent , transcriptional mechanism . in this way , circadian glucocorticoid oscillations were critical for maintaining homeostasis in synaptic density , by balancing formation and pruning after learning to maintain relatively stable synaptic densities despite repeated bouts of learning - related remodeling . chronic stress states disrupt this balance . in the same rotarod motor skill - learning study ( liston et al . , 2013 ) , prolonged glucocorticoid exposure an important feature of chronic stress states disrupted circadian troughs , reducing the survival of newly formed spines while simultaneously increasing the elimination of pre - existing synapses . together , these two effects led to widespread spine loss and reduced spine densities , in striking contrast to the tight coupling between formation and pruning rates that was observed across all other experimental conditions in the study . related effects were observed on spine maturation across adolescence ( liston and gan , 2011 ) , and in a mouse model of chronic circadian rhythm disruption ( karatsoreos et al . notably , disrupted oscillations in chronic stress states have complex effects on synaptic remodeling that are modulated by the developmental trajectories of synapse formation ( fig . whereas transient glucocorticoid activity increases the pruning mostly of young , recently formed spines , prolonged glucocorticoid exposure disrupts circadian troughs , eliminating synapses that formed progressively earlier in development ( liston and gan , 2011 , liston et al . , 2013 ) . this finding may inform efforts to understand how stress effects interact with synaptic development across the lifespan of an organism . stress has varying effects on brain function , behavior , and psychiatric risk that depend on when during development the stressor occurs ( lupien et al . , this dependence may relate to the varying trajectories of synaptic development across different brain regions ( lupien et al . , 2009 ) . for example , during infancy and early childhood , the hippocampus is developing rapidly and may be particularly vulnerable to early - life stress , whereas protracted development in the prefrontal cortex during the transition from adolescence to early adulthood may increase its vulnerability during this period ( lupien et al . , 2009 ) . in accord with this hypothesis , a variety of early - life stressors can induce long - lasting changes in hippocampal corticosteroid receptor expression and hpa reactivity , heightened anxiety , and hippocampus - dependent memory deficits that persist into adulthood ( barbazanges et al . , 1996 , valle et al . , 1999 , lemaire et al . , 2000 , tsoory et al . , 2007 , eiland and romeo , 2012 , lui et al . , 2012 , importantly , glucocorticoid activity oscillates not only with the circadian cycle of day and night , but also on a much faster time scale with a period of 12 h ( stavreva et al . , 2009 , lightman and conway - campbell , 2010 ) . these ultradian oscillations , which are superimposed on the slower circadian cycle ( fig . recent studies have shown that ultradian glucocorticoid rhythms generate cycles of gr - mediated gene pulsing , which regulate gene expression on faster timescales than was previously suspected ( stavreva et al . , 2009 ) . facilitated by the rapid , chaperone - mediated recycling of nuclear grs , ultradian gene pulses trigger changes in gr - regulated promoter activity that are tightly coupled to physiological oscillations ( stavreva et al . , 2009 ) . ultradian glucocorticoid oscillations penetrate the blood / brain barrier and are preserved within stress - sensitive brain areas ( droste et al . , 2008 ) , where they probably play an important role in responding to stressors and other environmental stimuli in physiological circumstances . conversely , in chronic stress models , disruptions of the ultradian oscillation alter gene expression responses in these regions and cause correlated changes in locomotor activity and risk assessment behaviors ( sarabdjitsingh et al . , 2010a , sarabdjitsingh et al . , 2010b ) . whether and how these ultradian oscillations affect synaptic remodeling remains unclear , but they are likely to have important effects , acting potentially through both transcriptional and non - transcriptional mechanisms ( mcewen , 1991 , makara and haller , 2001 , lsel and wehling , 2003 , groeneweg et al . , 2011 ) . as mentioned above , glucocorticoids can increase spine formation in cortical pyramidal cells by ten - fold in just 20 min , acting through non - genomic signaling pathways ( liston et al . similarly , glucocorticoids can rapidly enhance the frequency of miniature excitatory postsynaptic potentials , increasing glutamate release probability by activating a non - genomic , mr - dependent signaling pathway ( karst et al . , 2005 ) . similarly rapid effects have been observed in other studies in the prefrontal cortex , hippocampus , amygdala , and hypothalamus ( di et al . , 2003 , , 2011 , popoli et al . , 2011 , tasker and herman , 2011 ) . the studies reviewed above indicate that stress and glucocorticoids have potent but complex effects on synaptic remodeling , and understanding the underlying molecular mechanisms is a rapidly emerging area of active investigation . these studies are challenging due in part to the fact that stress effects on dendritic remodeling , synaptic plasticity , and associated molecular signaling mechanisms vary with the region and developmental age under investigation ( lupien et al . , 2009 ) . however , one theme to emerge from this work is that glucocorticoids may engage distinct intracellular signaling mechanisms , depending on the timing of a stressor and the kinetics of the glucocorticoid response . for example , in response to an acute stressor , glucocorticoids promote memory consolidation and impair working memory ( mcgaugh and roozendaal , 2002 , barsegyan et al . , 2010 ) through a mechanism involving beta adrenergic- and camp - dependent activation of protein kinase a in the amygdala and prefrontal cortex ( roozendaal et al . , 2002 , barsegyan et al . , acutely , glucocorticoids also promote long - term memory retention by enhancing learning - dependent spine formation , acting through a glucocorticoid receptor - dependent non - genomic signaling mechanism that increases lim kinase and cofilin phosphorylation ( liston et al . , 2013 ) , which stabilizes actin polymers and promotes spine growth ( gu et al . , 2010 recent reviews underscore the point that acute glucocorticoid exposure modulates multiple additional molecular processes that are relevant in this context : acutely , glucocorticoids potentiate glutamate transmission by increasing presynaptic glutamate release and enhancing ampa and nmda receptor trafficking to postsynaptic membranes ; they activate mapk and camkii signaling pathways that have been linked to transcription - dependent mechanisms for memory consolidation ; and they enhance endocannabinoid signaling , which in turns modulates the release of glutamate and other neurotransmitters ( arnsten , 2009 , campolongo et al . , 2009 , in contrast , chronic glucocorticoid exposure engages a variety of molecular signaling mechanisms that are distinct from those engaged by an acute stressor . for example , chronic glucocorticoid exposure has effects on glutamate receptor expression that oppose those induced by an acute stressor , reducing the expression of the nmda receptor subunit nr2b and the ampa receptor subunits glur2/3 in the prefrontal cortex ( gourley et al . , 2009 ) . chronic stress effects on dendritic atrophy in the hippocampus and prefrontal cortex have also been linked to excessive protein kinase c signaling ( hains et al . , 2009 ) and reduced expression of neural cell adhesion molecules ( ncam-140 ) ( sandi , 2004 ) . and chronic glucocorticoid exposure suppresses bdnf transcription in the orbitofrontal cortex ( gourley et al . , 2009 ) and reduces trkb and erk1/2 signaling in the hippocampus ( gourley et al . , 2008 ) . although studies indicate that reduced activity - dependent bdnf secretion probably does not by itself cause spine loss or dendritic atrophy ( hill et al . , 2005 , magarinos et al . , 2011 ) , it is likely that altered bdnf signaling plays a role through interactions with other factors . stress especially chronic , uncontrollable stress is an important risk factor for depression , ptsd , and other anxiety disorders , and stress effects on glucocorticoid oscillations may contribute to this effect . stress has varying effects on hpa axis activity and glucocorticoid secretion that depend on the timing and nature of the stressor ; on the individual 's subjective perception of the situation ; and likely also on his genetic predisposition to developing stress - related psychiatric conditions ( miller et al . , 2007 ) . in a recent meta - analysis of 8521 subjects across 107 independent studies , the most consistent findings were that chronic stress increases the total daily output of cortisol ( the principal glucocorticoid in humans ) , flattens the diurnal rhythm , and reduces the amplitude of the circadian peak ( miller et al . , 2007 ) . . the disruption may be particularly significant during the circadian trough , as unopposed mr activity typically occurs only during the trough when glucocorticoid secretion is low ( reul and de kloet , 1985 , de kloet et al . , 1998b ) , and a relatively small increase in trough levels could have pronounced effects on glucocorticoid signaling . in conjunction with the studies cited above , these results suggest that chronic stress may predispose vulnerable individuals to a variety of neuropsychiatric disorders by disrupting the circadian oscillation and especially the circadian trough , reducing the survival of newly formed synapses , and destabilizing synapses formed early in development . converging evidence from both clinical studies and animal models lend support to this hypothesis . disrupted circadian glucocorticoid cycling is a relatively consistent feature in clinical studies of patients with depression or ptsd ( heim et al . , 2000 , holsboer , 2000 , yehuda , 2002 , miller et al . , 2007 ) . blunted circadian cortisol oscillations are a feature common to both ptsd and depression ( yehuda et al . . however , these two disorders appear to involve opposing changes in total cortisol secretion ( decreased in ptsd , variably increased in depression ) : in ptsd , blunted oscillations are driven primarily by reduced circadian peaks ( yehuda et al . , 1996 ) , while in depression , they are driven primarily by elevated cortisol secretion during the circadian trough ( yehuda et al . , 1996 ) , especially in psychotic depression ( sachar et al . , 1973 , keller et al . , 2006 ) . in both disorders , blunted corticol cycling is associated with hippocampal volume loss ( bremner et al . 1996 ) and partially overlapping alterations in functional connectivity ( davidson et al . , 2002 , , 2004 , greicius et al . , 2007 , sheline et al . , 2010 , yin et al . , 2011 , 2014 ) , which is consistent with results in animal models indicating that both peaks and troughs are necessary for balancing synaptic formation and pruning . multiple animal models of depression including chronic unpredictable stress , chronic social defeat stress , and early life stress recapitulate neuroendocrine abnormalities found in patients , including blunted glucocorticoid oscillations , elevated glucocorticoid activity , and disrupted circadian troughs ( willner , 1997 , meaney , 2001 , krishnan et al . , 2007 , nestler and hyman , 2010 ) . in at least one study , blunted circadian cycling was linked specifically to stress susceptibility : circadian rhythm amplitudes were blunted only in mice that exhibited a vulnerable behavioral phenotype in response to chronic social defeat stress , relative to resilient mice that did not develop depression - like symptoms ( krishnan et al . , 2007 ) . in other studies , circadian rhythm disturbances have been causally related to mood symptoms . in a genetic model , mice carrying a mutation in the clock gene showed a loss of circadian rhythms in locomotor activity and a host of mania - like behavioral symptoms ( roybal et al . , 2007 ) . and in an environmentally induced model of circadian rhythm disruption , mice that were housed on a shortened 20-h light dark cycle exhibited learning and structural connectivity deficits comparable to those seen in chronic stress states , including apical dendritic atrophy in mpfc pyramidal cells and pfc - dependent cognitive deficits ( karatsoreos et al . , dark cycle also developed metabolic problems , including obesity , increased leptin levels , and signs of insulin resistance . shift workers and frequent travelers who suffer from chronic jet lag may experience analogous cognitive and metabolic changes ( sack et al . , 2007 , lupien et al . , 2009 , mcewen , 2012 ) , and in susceptible individuals , travel across time zones may even trigger severe mood episodes requiring psychiatric hospitalization ( jauhar and weller , 1982 ) . an increasing awareness of the importance of circadian and ultradian glucocorticoid oscillations in learning - related synaptic remodeling may also have implications for efforts to optimize training regimens for promoting motor skill learning , which is known to vary with the time of day in both adolescents and adults ( atkinson and reilly , 1996 , miller et al . similarly , disruptions in circadian glucocorticoid oscillations may be an important factor to consider in patients undergoing treatment with corticosteroids , which are frequently used in the management of a variety of common autoimmune disorders . cognitive complaints and mood symptoms are extremely common but poorly understood side effects of treatment ( brown and suppes , 1998 , otte et al . , 2007 , cornelisse et al . , 2011 ) , which could potentially be mitigated by designing treatment regimens to preserve naturally occurring oscillations whenever possible . converging evidence from animal models and human neuroimaging studies indicates that stress - associated functional connectivity changes are a common feature of depression , ptsd , and other neuropsychiatric conditions and are associated with correlated structural changes in the prefrontal cortex , hippocampus , and other vulnerable brain regions . these , in turn , may be caused in part by circadian disturbances in glucocorticoid activity . circadian glucocorticoid peaks and troughs are critical for generating and stabilizing new synapses after learning and pruning a corresponding subset of pre - existing synapses . chronic stress disrupts this balance , interfering with glucocorticoid signaling during the circadian trough and leading to widespread synapse loss , dendritic remodeling , and behavioral consequences . these effects interact with synaptic development trajectories that vary across brain regions and may be particularly pronounced during the transition from adolescence to young adulthood , when major neuropsychiatric conditions most commonly emerge . together these findings provide a model for understanding how stress effects on circadian glucocorticoid oscillations may contribute to connectivity changes and ultimately to the pathophysiology of depression , ptsd , and other disorders . still , many questions remain , and we conclude by considering a few of them . perhaps most importantly , many of these links remain purely correlative , and it will be critical to test whether and how changes in synaptic remodeling directly affect the function of cortical microcircuits , the integration of information across neuroanatomically distributed networks , and the emergence of behavioral effects and psychiatric symptoms . to this end , the recent development of optogenetic tools for manipulating activity in specific neural circuits will be critical for establishing causal mechanisms ( yizhar et al . , 2011 , tye and deisseroth , 2012 , berndt et al . , 2014 ) . likewise , recently developed imaging modalities provide a means for testing how structural changes within a given microcircuit affect functional circuit dynamics another critical , unanswered question . these methods use genetically encoded calcium indicators ( tian et al . , 2009 ) to quantify neuronal activity with single - cell precision in the living organism . in combination with implantable optical devices ( flusberg et al . , 2008 , , 2009 , chia and levene , 2009 , andermann et al . , 2013 ) , these tools will extend the reach of conventional two - photon microscopy to enable in vivo imaging in the hippocampus , amygdala , medial prefrontal cortex , and other stress - sensitive limbic circuits , which tend to lie deep below the cortical surface . finally , in vivo imaging tools may also prove useful for investigating the role of ultradian oscillations , which are superimposed on the circadian glucocorticoid rhythm . what is clear is that these oscillations trigger pulses of gene expression every 12 h ( stavreva et al . , 2009 ) , and that glucocorticoids are capable of regulating synapse function and facilitating synapse formation on a comparably rapid timescale ( popoli et al . , 2011 , together , these emerging technologies will enable investigators to ask fundamentally new questions about the links between circadian rhythm disruptions , structural measures of synaptic remodeling , and their functional consequences .

stress especially chronic , uncontrollable stress is an important risk factor for many neuropsychiatric disorders . the underlying mechanisms are complex and multifactorial , but they involve correlated changes in structural and functional measures of neuronal connectivity within cortical microcircuits and across neuroanatomically distributed brain networks . here , we review evidence from animal models and human neuroimaging studies implicating stress - associated changes in functional connectivity in the pathogenesis of ptsd , depression , and other neuropsychiatric conditions . changes in fmri measures of corticocortical connectivity across distributed networks may be caused by specific structural alterations that have been observed in the prefrontal cortex , hippocampus , and other vulnerable brain regions . these effects are mediated in part by glucocorticoids , which are released from the adrenal gland in response to a stressor and also oscillate in synchrony with diurnal rhythms . recent work indicates that circadian glucocorticoid oscillations act to balance synapse formation and pruning after learning and during development , and chronic stress disrupts this balance . we conclude by considering how disrupted glucocorticoid oscillations may contribute to the pathophysiology of depression and ptsd in vulnerable individuals , and how circadian rhythm disturbances may affect non - psychiatric populations , including frequent travelers , shift workers , and patients undergoing treatment for autoimmune disorders .

Stress effects on structural and functional connectivity Neuroendocrine mechanisms: glucocorticoid oscillations regulate synaptic remodeling in cortical circuits Molecular mechanisms of synaptic remodeling by glucocorticoids Translational implications: circadian glucocorticoid oscillations and the pathogenesis of stress-related neuropsychiatric disorders Conclusions and future directions

the epidermal growth factor receptor ( egfr ) is over expressed in various solid malignancies including non small cell lung cancer ( nsclc ) . however , they are associated with a dermatologic side effects , which can occasionally be responsible for discontinuation of the egfr inhibitors . hence , we report a case of metastatic adenocarcinoma of lung who developed skin ulceration with gefitinib and responded to interruption of the drug and early intervention . the present case report is about a 50-year - old female patient who had been diagnosed as having lung adenocarcinoma with multiple bone metastases was initiated on gefitinib therapy at an oral dose of 250 mg / d . after 2 weeks of initiating therapy , the patient presented with ulcer over the palm [ figure 1 ] . the ulcers improved with stopping gefitinib for 2 weeks and also with the addition of topical steroids and antibiotics . non - small - cell lung cancer ( nsclc ) with sensitive mutations of the egfr is highly responsive to gefitinib . gefitinib is a small molecule tyrosine kinase inhibitor ( tki ) of egfr . since 2004 , it was clear that a substantial proportion of nsclc obtaining objective response when treated with gefitinib harboring activating mutations in the egfr gene . the occurrence of skin disorders ( dry skin and acneiform rash ) is explained by the fact that egfr is also expressed in the basal layer of the skin ; inhibition of the receptor will disturb normal biology and result in skin rash . skin rash is notorious as an adverse event of egfr - tki and is noted in up to two - thirds of patients receiving any of these agents although severe in only 5 - 10% who can develop pyogenic granuloma like lesions . very rarely the cutaneous inflammation is so pronounced that skin necrosis with black eschar formation and ulceration is seen . the cutaneous side - effects are treated with topical steroids and antibiotics with interruption of treatment for 2 - 4 weeks as in our case .

we report a case of gefitinib - induced skin ulceration in a 50-year - old female with metastatic adenocarcinoma of lung who developed this adverse effect 2 weeks following initiation of gefitinib at a dose of 250 mg / day . the ulcer improved with stopping gefitinib for 2 weeks and also addition of topical steroids and antibiotics . we are reporting this case to create awareness among treating oncologists of this adverse effect and also prompt interruption of therapy and topical steroids / antibiotics is useful to treat this adverse event .

INTRODUCTION CASE REPORT DISCUSSION

to report a case of acute quinine poisoning , document acute and chronic macular changes with optical coherence tomography imaging and fluorescein angiography ( fa ) , and to review the literature on ocular toxicity of quinine . a 32-year - old white female presented to our emergency department after ingesting over 7.5 g of quinine . she underwent a complete ophthalmologic examination , fluorescein angiography , stratus time - domain optical coherence tomography ( oct ) , and electroretinography at 72 hours and 15 months postingestion . stratus time - domain and cirrus spectral - domain oct , fundus autofluorescence , and fa were obtained at 28 months postingestion . oct showed marked thickening of the inner retina bilaterally . at 15 and 28 months follow - up , fundus photography and fluorescein angiography demonstrated optic nerve pallor , severely attenuated retinal vessels while oct showed inner retinal atrophy . quinine toxicity as seen by oct reveals increased thickness with inner retinal hyperreflectivity acutely with development of significant retinal atrophy in the long - term . these findings suggest that quinine poisoning may produce a direct toxic effect on the inner retina in the acute phase resulting in long - term retinal atrophy . acute quinine poisoning is a devastating ocular event that can result in severe loss of vision.1 quinine is an antimalarial agent that is often used for the treatment of restless legs syndrome . the drug has a narrow therapeutic range and carries the risk of multiple side effects such as cinchonism , hypoglycemia , arrhythmias , hemolysis , gastrointestinal intolerance , fever , and nephritis.2 in early 2007 , the us food and drug administration restricted the use of quinine solely to the treatment of malaria . quinine has long been known to be toxic to the eye even at therapeutic levels , causing symptoms such as loss of vision , reduced color vision , and reduced visual fields.3,4 most visual symptoms occur after a quinine dose greater than 4 g and death can occur with doses exceeding 8 g.5 we describe a patient with profound visual loss after acute quinine poisoning . at 72 hours postingestion , erg , stratus time - domain optical coherence tomography ( oct ) , fundus photography , and fluorescein angiography ( fa ) were performed on the patient . at 15 months postingestion , time - domain oct and fa were again performed on our patient . at the 28 months postingestion visit , cirrus spectral - domain and stratus time - domain oct , fa , and fundus autofluorescence ( faf ) were performed . to the best of our knowledge , this is the first documentation in the literature of the retinal changes in acute quinine toxicity as seen by oct and faf . a 32-year - old white female presented to our emergency department five hours after attempting suicide by quinine overdose . the dose was estimated to be between 7.5 and 10 g. on initial examination the patient was complaining of tinnitus , nausea , vomiting , as well as total loss of vision . serum sodium and potassium were low at 133 meq / l and 3.6 meq / l , respectively , and the patient s ecg showed a prolonged qt interval . the patient was admitted to the medical intensive care unit of the ohio state university medical center for monitoring and support . the first ophthalmologic exam was performed at the bedside 23 hours postingestion and showed that the patient had no light perception in both eyes . fundoscopy revealed optic nerves with normal color and crisp margins , retinal vessels with normal course and caliber , and maculas with diffuse retinal thickening and bilateral cherry - red spots ( crs ) . the patient received hyperbaric oxygen therapy per the recommendation of the medical intensive care unit team . at 48 hours postingestion , examination revealed partial resolution of the crs with persistent retinal thickening . at 72 hours postingestion , fluorescein angiography showed normal filling times and no evidence of leakage or vascular staining ( figure 1c , d ) . stratus time - domain oct revealed inner retinal hyperreflectivity with thickening in both eyes ( figure 2a , b ) . central subfield thicknesses were 292 microns od and 293 os and macular volumes for a 6 mm diagonal were 8.43 mm od and 8.75 mm os . at this visit , bright flash erg yielded reduced a - waves and absent b - waves , consistent with previous reports on the electrophysiologic effects of quinine poisoning.6 the patient was subsequently lost to follow - up for several months , as she was repeatedly hospitalized in psychiatric institutions and underwent drug rehabilitation . her first ophthalmologic follow - up examination was performed 15 months postingestion . at this visit , the patient s uncorrected visual acuity ( va ) was 20/20 ou . although zeiss - humphrey 30 - 2 visual fields demonstrated normal foveal thresholds ou ( 33 db od , 35 db os ) , they were constricted to 15 degrees ou . dilated fundus examination revealed optic nerve pallor ou with retinal atrophy and severely attenuated retinal arterioles and venules ( figure 3a , b ) . however , normal arteriovenous transit times and arteriolar perfusion were demonstrated by fluorescein angiography ( figure 3c , d ) . stratus time - domain oct revealed severe atrophy of the neuroretina in both eyes with central subfield thickness being 199 microns od and 218 microns os . macular volumes for a 6 mm diagonal had decreased to 4.68 mm od and 5.06 mm os ( figure 4a , b ) . the patient was last seen at the ophthalmology clinic at 28 months postingestion . at this time , her uncorrected va was 20/20 od and 20/20 os . farnworth d-15 color vision testing demonstrated mild blue - yellow color deficiencies . there were no changes worth noting between the patient s humphrey visual fields or fa between this visit and her visit at 15 months postingestion . cirrus spectral - domain oct revealed central subfield thicknesses that were 283 microns od and 279 microns os and average retinal thicknesses that were 213 microns od and 211 microns os ( normal average retinal thickness is 264 21.9 microns).7 although the central retinal thicknesses on the cirrus oct were within the normal range , the average macular thicknesses were decreased , a finding consistent with retinal atrophy and to the peripheral constriction seen on the visual fields . faf photography ( trc-50dx ; topcon , oakland , nj ) revealed a generalized hyperfluorescent pattern without evidence of atrophic retinal pigment epithelial changes ( figures 5 , 6 ) . the presentation and ophthalmologic clinical findings of this patient appear typical of quinine - induced ocular damage . previous case reports have demonstrated that patients usually develop loss of vision between 10 and 24 hours after ingestion of toxic levels of quinine . most patients experience a return of central acuity with restricted visual fields over the next several weeks to months . vessel attenuation and disk pallor seen at our patient s 15- and 28-month examinations are consistent with the typical late fundus findings of quinine toxicity.5 despite the compound s well - established ocular toxicity , the mechanism behind the damage it mediates is not entirely known . towards this end , the acute oct and fa findings in our patient were enlightening . at 72 hours postingestion , this finding is consistent with oct performed on the ischemic retina during central retinal artery occlusion ( crao).8 however , in our patient the fa in the acute stage demonstrated no abnormalities in arteriovenous transit and retinal perfusion . cirrus spectral - domain oct demonstrates an intact external limiting membrane as well as inner and outer segment of the photoreceptor layer at 28 months . these findings suggest that quinine poisoning produces damage that is confined to the inner retinal layers . the presence of a crs during the acute phase of quinine poisoning in our patient is consistent with previous reports of quinine overdose . crs formation is seen with ischemia of the ganglion cell layer ( gcl ) in crao and in conditions where storage materials or metabolites accumulate in the gcl of the retina such as congenital gangliosidosis ( tay sachs disease and sandhoff s disease ) , sphingolipidosis ( niemann - pick s disease ) , glucocerebrosidosis ( gaucher s disease ) , and with patients on long - term parenteral nutrition.9,10 in addition to quinine , crs has also been observed with toxic interactions following intravitreal aminoglycoside injection , ingestion of dapsone , and ingestion of methanol.1113 in a histopathologic report on primates , conway et al reported that high doses of intravitreal gentamicin led to retinal toxicity with the formation of a crs . the retinal toxicity was primarily confined to the inner retina with relatively intact photoreceptor and retinal pigment epithelial layers . in the acute phase , there was nerve fiber and ganglion cell swelling with subsequent atrophy of these layers in the chronic phase . they postulated that retinal toxicity was primarily due to a direct neurotoxic effect on the inner retina.14 this mechanism appears to be most consistent with the clinical , oct , and faf findings in our patient . the optic nerves do not appear to be affected in the early stages of toxicity as their appearance was unremarkable and there was no papillary leakage or staining on fa at 72 hours . in the latter stages of follow - up the pattern of visual field loss was one of generalized constriction rather than a cecocentral scotoma , a pattern more consistent with diffuse retinal rather than optic nerve toxicity . quinine is a class ia anti - arrhythmic that blocks sodium and potassium channels in cardiac myocytes , causing a delay in the initiation of action potentials and increasing the action potential duration.15 various studies have shown quinine capable of blocking voltage - gated outward potassium channels , stimulating intracellular inositol-1,4,5-triphosphate production , and activating intracellular pathways via guanine nucleotide binding protein ( g - protein)-coupled receptors.1618 these pharmacologic actions of quinine could be responsible for the clinical observations of rapid onset bilateral vision loss and eventual neuronal damage . prolonged depolarization of the cell membrane can lead to depolarization of the mitochondrial membrane and stimulation of mitochondrial - mediated apoptosis.19,20 several proposed mechanisms of direct quinine - retina interaction exist in the literature . aloisi et al postulated that retina damage is a result of free radicals generated by the photoionization of quinine.21 it has long been suspected that quinine blocks acetylcholine transmission in the retina . recent evidence shows quinine to have an antagonistic effect on 910 nicotinic acetylcholine receptors elsewhere in the body.22 acetylcholine blockade can explain the immediate total blindness observed in quinine overdose , but does not explain how quinine leads to eventual cell death . perhaps the most promising research concerning the mechanism of quinine toxicity involves gap junctions and connexins . gap junctions are formed by structural proteins known as connexins and allow for intracellular electrical communication by linking the cytosol of two consecutive cells and are found in gastrointestinal smooth muscle , cardiac muscle , and retinal cells . studies in transfected mammalian cells have shown that quinine has the ability to act as a reversible , concentration - dependent gap junction channel blocker.23 furthermore , quinine has been shown to block specific connexins , including connexin 36 ( cx36 ) , which has been found in mouse and rat retinas.24,25 cx36 gap junctions are responsible for excitatory and inhibitory interneuron communications between retinal ganglion cells and amacrine cells.26 the interaction of quinine with these junctions may help explain the acute blindness seen in quinine toxicity and may also provide greater understanding of the mechanism of quinine s neurotoxic effect . our clinical experience and recent literature support the theory that quinine is directly neurotoxic to the inner retina . more research is needed to identify the exact mechanism by which quinine mediates direct neuronal cell death . interventions geared towards disrupting quinine s toxic neuronal activity would perhaps be able to prevent the devastating loss of vision associated with this agent .

purposeto report a case of acute quinine poisoning , document acute and chronic macular changes with optical coherence tomography imaging and fluorescein angiography ( fa ) , and to review the literature on ocular toxicity of quinine.methodsa 32-year - old white female presented to our emergency department after ingesting over 7.5 g of quinine . she underwent a complete ophthalmologic examination , fluorescein angiography , stratus time - domain optical coherence tomography ( oct ) , and electroretinography at 72 hours and 15 months postingestion . stratus time - domain and cirrus spectral - domain oct , fundus autofluorescence , and fa were obtained at 28 months postingestion.resultsfluorescein angiography at 72 hours postingestion revealed normal filling times and vasculature . oct showed marked thickening of the inner retina bilaterally . at 15 and 28 months follow - up , fundus photography and fluorescein angiography demonstrated optic nerve pallor , severely attenuated retinal vessels while oct showed inner retinal atrophy . fundus autofluorescence did not reveal any retinal pigmentary abnormalities.conclusionsquinine toxicity as seen by oct reveals increased thickness with inner retinal hyperreflectivity acutely with development of significant retinal atrophy in the long - term . fundus autofluorescence reveals an intact retinal pigment epithelial layer at 28 months . these findings suggest that quinine poisoning may produce a direct toxic effect on the inner retina in the acute phase resulting in long - term retinal atrophy .

Purpose Methods Results Conclusions Introduction Case report Discussion

developmental dyslexia is a neurobiological disorder characterized by a difficulty in reading acquisition despite adequate intelligence , conventional education , and motivation ( apa 1994 ) . the prevailing view supports the hypothesis that dyslexia results from a specific deficit of auditory - phonological perception , representation , and phonological memory ( see vellutino et al . children and adults with dyslexia show , indeed , deficits in the representation and manipulation of phonological information ( e.g. , poor speech - sound awareness , slow lexical retrieval and poor phonological short - term memory ; see ramus 2003 , for a review ) . these deficits could interfere with one of the most critical skills for successful reading acquisition , such as phonological decoding ( share 1995 ; ziegler and goswami 2005 ) . apart from their phonological difficulties , dyslexic subjects often suffer from a variety of subtle sensory and motor deficits . whether these deficits have any causal relation to the reading disorder , or are totally independent , is currently under debate . one hypothesis of a visual cause for dyslexia is that the reading disorder is caused by a deficiency in the magnocellular part ( also referred to as the transient system ) of the visual system ( stein and walsh 1997 ) . this hypothesis might seem controversial , since one would expect the parvo- rather than the magnocellular pathways to be largely involved with fine pattern vision and object discrimination that are essential for reading . however , studies have indicated a function for the magnocellular - dominated dorsal stream in selective attention ( motter 1993 ; vidyasagar 1998).vidyasagar and pammer ( 1999 ) suggested that if the magnocellular system ( m system ) is involved in gating all visual input going through the striate cortex , a deficit in this system would also affect the parvocellular system ( p system ) . this would become manifest in tasks in which there is intense competition for attentional resources and in which the supposed m - mediated attentional spotlight is essential for good performance . stein ( 2003 ) also suggested that a magnocellular deficiency may cause a type of visual attention deficit in dyslexia . this has made it important to assess visual attention in dyslexic readers in more detail . a recent and particularly interesting hypothesis that links the magnocellular deficit with reading problems is that dyslexics may have sluggish attentional shifting ( sas ) ( hari and renvall 2001 ) . the present study was motivated by the idea that sas could indeed provide a coherent framework to understand a variety of sensory problems that dyslexics encounter . the basic notion underlying sas is that sensory input is chunked and that attention of dyslexic subjects , once engaged on a chunk , can not be easily disengaged ( hari and renvall 2001 ) . this causes impairments in the shift or the focusing of attention ( hari and renvall 2001 ) , and it may result in a prolonged attentional dwell time and poor judgments of temporal order ( jskowski and rusiak 2008 ) . sas can affect fluent reading because the sensory input is prolonged , thereby degrading essential cortical representations ( for review , see hari and renvall 2001 ) . ( 2010 ) used an auditory and visual stream segregation task and reported that in order to process two successive stimuli separately , dyslexic participants with phonological impairments required a significantly longer inter - stimulus interval than controls regardless of sensory modality . another important prediction from sas is that dyslexics may profit from a transient sound because of a general alerting effect that improves the disengagement of attention . a number of methods have been used to measure visual attention in dyslexics , but so far , none has used sounds to improve search time . in the standard visual search task , participants search for a prespecified visual target among other distracters . previous reports are rather consistent with a visual attention deficit in dyslexics , reporting slower search times for dyslexic than normal readers ( williams et al . 1987 ; ruddock 1991 ; casco and prunetti 1996 ; vidyasagar and pammer 1999 ; sireteanu et al . pammer and vidyasagar ( 2005 ) and jones et al . ( 2008 ) argued that dyslexics may suffer from an impairment in the serial allocation of attention . according to sas , the slowness of dyslexics can be explained by an impairment in the disengagement of attention from an element in the search set . here we thought to add sounds to the visual search task , using the pip - and - pop these authors designed a visual search task in which a target ( a horizontal or vertical line ) was embedded in a cluttered display of distracters ( oblique lines ) . the targets and distracters changed , on randomly determined times color ( and , important from the perspective of the magnocellular system , also luminance ) from green - to - red or red - to - green . they found that a simple auditory pip could drastically decrease search times if the pip was synchronized with the color / luminance - change of the target : the pip then made the target pop - out . further studies have shown that a sound will only lead to benefits in visual search if the changes in the two signals are both synchronized and transient ( van der burg et al . if this condition is met , then the effect will also resist wide spatial misalignment ( fiebelkorn et al . , we used this paradigm to examine whether a sound would improve the visual search time of dyslexic readers more than it does in normal readers . if , as proposed in sas , dyslexic readers have problems with the disengagement of attention from the current fixation , one expects them in the tone - absent condition ( serial search ) to have longer search times than normal readers , and their slope of the search time per item should be steeper ( see also vidyasagar and pammer 1999 ; sireteanu et al . 2011 ) . in the sound - present condition , though , the pip can make the target pop - out ( parallel search ) , and search time may become independent of the set size of the distracters . this should be particularly helpful for dyslexic readers , as they may have a specific difficulty with serial , but not parallel , search ( sireteanu et al . ultimately , then , a single pip may compensate for the dyslexics visual attention deficit . fifteen young adults with developmental dyslexia ( five men and ten women ) and 15 age - matched controls without reading difficulties ( five men , ten women ) were tested . the dyslexic readers had been diagnosed with developmental dyslexia based on standard exclusion criteria ( apa 1994 ) . they were all formally assessed and diagnosed by clinical and educational psychologists . their reading achievements ( accuracy and/or speed ) were additionally assessed via standardized dutch reading tests for single word and nonword reading ( brus and voeten 1997 ; van den bos et al . dyslexic participants were selected on the basis of ( 1 ) normal or corrected - to - normal vision and hearing ; ( 2 ) absence of neurological and/or psychiatric disorders ; ( 3 ) absence of attention deficit disorder with hyperactivity ( because of the high comorbidity with dyslexia ) ; ( 4 ) absence of color blindness . the two groups were drawn from the same subject pool of university students , but were significantly different for both accuracy and speed of word and nonword reading ( see table 1 for details ) . participants were tested individually , were unaware of the purpose of the experiment , and received course credits or money for their participation . written consent was obtained from all participants according to the declaration of helsinki.table 1mean and standard deviation ( sd ) of age ( in years ) , word and nonword reading scores ( errors and speed in number of correctly read items ) in dyslexics ( n = 15 ) and age - matched normal reading controls ( n = 15)dyslexicscontrolscomparisonmeansdmeansdt(28)page21.52.220.71.71.10.28words reading errors1.31.10.30.63.090.004 speed77.810.393.516.43.160.004nonword reading errors8.93.02.32.96.73<0.001 speed69.916.298.514.05.17<0.001the bold values are with p < 0.05 mean and standard deviation ( sd ) of age ( in years ) , word and nonword reading scores ( errors and speed in number of correctly read items ) in dyslexics ( n = 15 ) and age - matched normal reading controls ( n = 15 ) the bold values are with p < 0.05 the stimuli were made as in van der burg et al . the auditory stimulus was a short white noise click of 68 ms presented at 74 db(a ) through the laptop speakers . the visual stimuli were presented on a 15-inch , 60-hz laptop monitor ( dell latitude e5500 ) , controlled by e - prime 1.2 ( psychology software tools , inc . ; http://www.pstnet.com/eprime ) . the visual search displays consisted of 24 or 48 red ( 20 cd m ) and green ( 11 cd m ) line segments ( length 0.88 visual angle ) against a dark background ( 0.05 cd m ) . the lines were randomly placed in an invisible 10 10 grid ( 10.5 6.5 ) centered on a white central fixation cross , with the constraint that the target was never presented at the four central positions , to avoid immediate detection . the target was a horizontal or vertical line , while for distracters line orientation deviated randomly by plus or minus 26.5 from horizontal or vertical . the distracters changed color ( from red - to - green or vice versa ) every 50 , 100 , or 150 ms . the number of distracters that changed simultaneously during a trial varied for the different set sizes ; in set size 24 , 1 , 2 or 4 distracters changed simultaneously , while in set size 48 , it was 1 , 4 or 7 distracters . the target changed color every 500 or 1,000 ms , and always changed alone . distracters did not change color from 150 ms before the target until 100 ms after the target had changed color . during the first 500 ms of a trial , the target also did not change color . a dynamic example of trials with and without sound can be found at http://www.psy.vu.nl / pippop/. participants were tested in a dimly lit and sound - proof cabin and were seated approximately 65 cm in front of the laptop screen . a white fixation cross was illuminated in the center of the screen at the beginning of each trial . after 150500 ms , the display with target and distracters appeared at the screen . in the sound - present condition , a change in the color of the target was always accompanied by a simultaneously presented sound . participants were instructed to search for the target and to press one of two buttons corresponding with the target orientation - or all participants were explicitly told that sounds , if present , were synced with a color change of the target , and that they thus could benefit from the sound because it signaled that the target had changed color . to encourage that participants reacted as fast and as accurately as possibly throughout the whole experiment , written feedback about accuracy and search time was given after each trial . a practice session preceded the experimental test that stopped until 10 consecutively correct answers were given . there were two within - subject factors : set size ( 24 or 48 ) and sound ( present or absent ) . the whole test consisted of 1 block of 80 experimental trials , in which each of the 4 unique conditions was presented 20 times . fifteen young adults with developmental dyslexia ( five men and ten women ) and 15 age - matched controls without reading difficulties ( five men , ten women ) were tested . the dyslexic readers had been diagnosed with developmental dyslexia based on standard exclusion criteria ( apa 1994 ) . they were all formally assessed and diagnosed by clinical and educational psychologists . their reading achievements ( accuracy and/or speed ) were additionally assessed via standardized dutch reading tests for single word and nonword reading ( brus and voeten 1997 ; van den bos et al . dyslexic participants were selected on the basis of ( 1 ) normal or corrected - to - normal vision and hearing ; ( 2 ) absence of neurological and/or psychiatric disorders ; ( 3 ) absence of attention deficit disorder with hyperactivity ( because of the high comorbidity with dyslexia ) ; ( 4 ) absence of color blindness . the two groups were drawn from the same subject pool of university students , but were significantly different for both accuracy and speed of word and nonword reading ( see table 1 for details ) . participants were tested individually , were unaware of the purpose of the experiment , and received course credits or money for their participation . written consent was obtained from all participants according to the declaration of helsinki.table 1mean and standard deviation ( sd ) of age ( in years ) , word and nonword reading scores ( errors and speed in number of correctly read items ) in dyslexics ( n = 15 ) and age - matched normal reading controls ( n = 15)dyslexicscontrolscomparisonmeansdmeansdt(28)page21.52.220.71.71.10.28words reading errors1.31.10.30.63.090.004 speed77.810.393.516.43.160.004nonword reading errors8.93.02.32.96.73<0.001 speed69.916.298.514.05.17<0.001the bold values are with p < 0.05 mean and standard deviation ( sd ) of age ( in years ) , word and nonword reading scores ( errors and speed in number of correctly read items ) in dyslexics ( n = 15 ) and age - matched normal reading controls ( n = 15 ) the bold values are with p < 0.05 the auditory stimulus was a short white noise click of 68 ms presented at 74 db(a ) through the laptop speakers . the visual stimuli were presented on a 15-inch , 60-hz laptop monitor ( dell latitude e5500 ) , controlled by e - prime 1.2 ( psychology software tools , inc . ; http://www.pstnet.com/eprime ) . the visual search displays consisted of 24 or 48 red ( 20 cd m ) and green ( 11 cd m ) line segments ( length 0.88 visual angle ) against a dark background ( 0.05 cd m ) . the initial color ( red or green ) was randomly determined for each item . the lines were randomly placed in an invisible 10 10 grid ( 10.5 6.5 ) centered on a white central fixation cross , with the constraint that the target was never presented at the four central positions , to avoid immediate detection . the target was a horizontal or vertical line , while for distracters line orientation deviated randomly by plus or minus 26.5 from horizontal or vertical . the distracters changed color ( from red - to - green or vice versa ) every 50 , 100 , or 150 ms . the number of distracters that changed simultaneously during a trial varied for the different set sizes ; in set size 24 , 1 , 2 or 4 distracters changed simultaneously , while in set size 48 , it was 1 , 4 or 7 distracters . the target changed color every 500 or 1,000 ms , and always changed alone . distracters did not change color from 150 ms before the target until 100 ms after the target had changed color . during the first 500 ms of a trial , the target also did not change color . a dynamic example of trials with and without sound can be found at http://www.psy.vu.nl / pippop/. participants were tested in a dimly lit and sound - proof cabin and were seated approximately 65 cm in front of the laptop screen . a white fixation cross was illuminated in the center of the screen at the beginning of each trial . after 150500 ms , the display with target and distracters appeared at the screen . in the sound - present condition , a change in the color of the target was always accompanied by a simultaneously presented sound . participants were instructed to search for the target and to press one of two buttons corresponding with the target orientation - or all participants were explicitly told that sounds , if present , were synced with a color change of the target , and that they thus could benefit from the sound because it signaled that the target had changed color . to encourage that participants reacted as fast and as accurately as possibly throughout the whole experiment , written feedback about accuracy and search time was given after each trial . a practice session preceded the experimental test that stopped until 10 consecutively correct answers were given . there were two within - subject factors : set size ( 24 or 48 ) and sound ( present or absent ) . the whole test consisted of 1 block of 80 experimental trials , in which each of the 4 unique conditions was presented 20 times . the overall mean error rate was low ( 5.8% for the dyslexic group and 4.4% for the control group ) and did not significantly differ between groups , t(28 ) = 1.32 , p > 0.05 . search time was measured from the onset of the search display until the response to the target . an overall repeated - measures anova was conducted with group ( dyslexics versus normal readers ) as between - subject factor , and set size ( 24 or 48 items ) and sound ( sound present or absent ) as within - subject factors . as expected , dyslexics had longer overall search times than normal readers , f(1,28 ) = 5.66 , p < 0.05 , p2 = 0.17 ( mean search time of 8,004 ms for dyslexics and 6,100 ms for normal readers ) . the search time was also faster for the small than large set size , f(1,28 ) = 144.94 , p < 0.001 , p2 = 0.84 ( mean search time of 4,759 ms for set size 24 and 9,351 ms for set size 48 ) , and search time of trials with sound was faster than without sound , f(1,28 ) = 13.58 , p < 0.01 , p2 = 0.17 ( mean search time of 7,929 ms for sound - absent conditions and 6,181 ms for sound - present conditions ) . there was an interaction between set size and group , f(1,28 ) = 7.15 , p < 0.05 , p2 = 0.20 , indicating that dyslexics had slower search times per item than normal readers ( dyslexics : 222 ms / item ; normal readers : 170 ms / item ) . most importantly , there was interaction between group , sound , and set size , f(1,28 ) = 5.275 , p < 0.05 , p2 = 0.16 . as is clearly visible in fig . 1 , and as predicted , both groups benefitted from sound , but the dyslexics profited more from sound than normal readers as their improvement in search times per set size was bigger ( an improvement of 1,000 ms for set size 24 , and 4,735 ms for set size 48 ) than that of the controls ( an improvement of 281 ms for set size 24 , and 976 ms for set size 48).fig . 1mean search time ( in seconds ) as a function of set size and presence of sound for the dyslexic ( left panel ) and normal reading ( right panel ) group . error bars represent 1 standard error of mean mean search time ( in seconds ) as a function of set size and presence of sound for the dyslexic ( left panel ) and normal reading ( right panel ) group . error bars represent 1 standard error of mean separate anovas on the sound - absent and sound - present conditions showed that in the sound - absent conditions , the dyslexics were significantly slower than the normal readers , f(1,28 ) = 9.15 , p < 0.01 , p2 = 0.25 , and this difference was bigger with the large set size ( set size group interaction effect , f = 9.52 , p < 0.01 , p2 = 0.25 ) . in stark contrast , in the sound - present condition , the search time of the dyslexic group was not different from the control group ( main effect of group , f < 1 , set size group , f < 1 ) . here we examined the effect of sound on visual search times of dyslexic versus normal readers , using the pip - and - pop task . our results confirmed , in accordance with predictions from sas , that ( 1 ) in the sound - absent condition , dyslexics search time was much longer than of normal readers , ( 2 ) in the sound - absent condition , dyslexics search time increased more strongly with an increase in set size than of normal readers , and ( 3 ) dyslexics search time improved drastically by the presence of a transient sound ; in fact their search time then became as good as normal readers . the general slowness of the dyslexic group is consistent with previous studies using visual search tasks ( e.g. , vidyasagar and pammer 1999 ; sireteanu et al . account of hari and renvall ( 2001 ) , according to which the dyslexics automatic attention system can not disengage fast enough from one item to move to the next . the improvement in performance by the presence of the sound leads to the question why a transient sound could speed up the orienting of attention of dyslexic readers as much as it does . first of all , it is important to note that the sound used in the experiment did not bias attention toward a specific direction or location . we used a static sound that was centrally presented , so the sound was not informative about the possible location of the target . the gain offered by the sound for dyslexic readers is in line with other findings , demonstrating that dyslexics have specific problems in serial , but not parallel , search . 2008 ) demonstrated that dyslexics , compared to normal readers , have difficulties in serial , but not parallel , search . 1987 ; ruddock 1991 ; casco and prunetti 1996 ; vidyasagar and pammer 1999 ) in that we found that in the sound - absent condition , the search time of dyslexic readers increased more with the number of distracters and was significantly slower than that of the normal readers . in the sound - present condition , it has been argued that the binding of synchronized auditory - visual signals occurs rapidly , automatically , and effortlessly , with the auditory signal attaching to the visual signal relatively early in the perceptual process . through this , a nonspatial auditory event ( pip ) can guide attention toward the location of a synchronized visual event that , without an auditory signal , is difficult ( van der burg et al . the pip then makes the target pop - out , changing a serial search into an automatic , parallel search . this then led to a decrease in dyslexics search times up to the level of normal readers . although it is clear that dyslexics were better in parallel search than serial search , one can still ask whether there were besides sas any other reasons why dyslexics benefited significantly more from sound than the normal readers . one clue for this may come from a visual search study by facoetti et al . these authors found that dyslexic children had a bigger pop - out effect , which is a characteristic of parallel processing . the authors argued that dyslexia is characterized by a difficulty to narrow the attentional focus , and dyslexics therefore tended to adopt a more distributed focus of attention . ( 2008 ) suggested that at least some distributed attention is necessary for observers to notice the synchronized event of the pip and pop . by combining these two notions , it may become understandable why dyslexics , presumably with a more distributed focus of attention , could profit more from sound than normal readers . plausible explanations for the substantial benefit of sound by dyslexics might also be derived from studies that examined the effect of sound on visual attention . robertson et al . ( 1998 ) studied patients with neglect and showed that the phasic alerting by a transient nonspatial sound can overcome their spatial deficits in visual awareness . this finding provides evidence that the phasic alerting alone can directly affect the speed of perceptual processing , rather than merely affecting motor readiness . ( 2008 , 2011 ) , however , found evidence for a very early multisensory interaction that ruled out that the pip - and - pop effect is due to increases of alertness , as the effect follows a time course that is quite different from alerting effects . doyle and snowden ( 2001 ) also examined the effects of simple auditory signals whose onset was synchronized with that of the visual target , but provided no information about the target location . their findings made them speculate that an auditory signal may promote attentional disengagement ( for similar reasoning , see keetels and vroomen ( 2011 ) ) . related to our study , the sound may thus have a facilitatory effect on the disengagement of attention of the dyslexic readers , making them process the visual target ( much ) sooner when accompanied by a sound relative to when visual information is presented alone . a final speculation about the reason for the bigger improvement by sound in the dyslexic group may be related to crossmodal temporal deficits that have been found in dyslexia . ( 2008 ) , in order to be effective , a sound needs to be presented in close temporal proximity to the visual target change . various authors , though , argued that dyslexics exhibit deficits in different sensory systems , which involve alterations in temporal information processing ( e.g. , tallal 1980 ; kinsbourne et al . the authors found support for the idea of altered crossmodal temporal processing in dyslexia , as they reported that dyslexic subjects showed an extended temporal window for binding visual and auditory cues . these findings could be potentially relevant for our results , because an enlarged temporal window may lead to a bigger pip - and - pop effect in the dyslexics , as they may profit over an extended period of time of the sound . it should be noted , though , that an enlarged temporal window of integration may also lead to more spurious binding between the sound and color changes of distracters . an enlarged temporal window would then interfere rather than being of help in visual search time . future studies that vary the soa between sound and target and the soa between sound and distractor change might give more detailed information on this and on the mechanisms of multisensory integration in dyslexic readers . to summarize , our results showed that dyslexic readers have problems with visual serial search . this is evidence for visual attentional abnormalities in dyslexia , more specifically in the disengagement and shifting of attention . it remains for future studies with other clinical populations who are thought to have difficulties with disengaging and shifting attention ( e.g. , high - functioning autistic individuals ) to further explore the effects of sound on visual attention .

we examined whether developmental dyslexic adults suffer from sluggish attentional shifting ( sas ; hari and renvall in trends cogn sci 5:525532 , 2001 ) by measuring their shifting of attention in a visual search task with dynamic cluttered displays ( van der burg et al . in j exp psychol human 34:10531065 , 2008 ) . dyslexics were generally slower than normal readers in searching a horizontal or vertical target among oblique distracters . however , the addition of a click sound presented in synchrony with a color change of the target drastically improved their performance up to the level of the normal readers . these results are in line with the idea that developmental dyslexics have specific problems in disengaging attention from the current fixation , and that the phasic alerting by a sound can compensate for this deficit .

Introduction Method Participants Stimuli Procedure Design Results Discussion

the diagnosed incidence of neuroendocrine tumors ( nets ) in the current decade has risen to 5/100,000 from about 1 to 2 cases per 100,000 , three decades ago . this can be attributed to advanced diagnostic radiological and pathological techniques available in medical science today . multi detector computed tomography ( ct ) techniques with dynamic scanning of the abdomen in the arterial phase to detect hypervascular lesions such as those found in net is routine protocol for patients who have a clinical suspicion of the tumor . similarly , functional imaging such as nuclear positron emission tomography ( pet ) scans with ga - dota - nai - octreotide ( ga - dotanoc ) has further narrowed the possibility of detecting these lesions . we present a perplexing case of a patient who presented with a solitary liver mass , mimicking hepatocellular carcinoma ( hcc ) , on imaging and cytopathology and was subsequently operated for the same . a fluorodeoxyglucose ( fdg ) pet scan done before the surgery did not detect the primary tumor . the patient was diagnosed to have a metastatic secondary in the liver from a primary net , only after histopathology and immunohistochemistry of the explanted liver was performed . further evaluation in the postoperative period with ga - dotanoc pet enabled the localization of the primary tumor in the midgut , which was then re - explored and excised with a follow - up surgery . this case highlights the importance of immunohistochemistry for suspected hypervascular mass lesions in the abdomen . in addition , it emphasizes the relevance of functional imaging with ga - dotanoc pet and pitfalls of fdg pet in the assessment of hypervascular tumors of the abdomen and gastrointestinal tract . the use of ga dotanoc pet in the first stage of evaluation of the liver mass , along with fdg pet could have pointed to the nature of the mass and thus saved the patient morbidity related to two consecutive major laparotomy procedures . on review of the literature , we came across only one case report , which showed a primary hcc metastasis to pancreas resembling a net , however no other such mimic cases have been reported . a 55-year - old male presented to our hospital with continuous vague pain in the upper abdomen for a month . no other positive history of chronic diseases , prodromal symptoms , altered bowel habits , weight loss or gastrointestinal bleed was elicited . ultrasound abdomen , performed at an outside hospital had revealed a space - occupying lesion in the liver for which he underwent a fine - needle aspiration and cytology ( fnac ) . the available report of the above ( done elsewhere ) showed hcc ; however no slides were made available for review . physical examination did not show any positive findings , and the patient underwent a contrast - enhanced computed tomography ( cect ) of the upper abdomen for further evaluation and staging of the mass lesion in the liver . the cect revealed underlying diffuse hepatomegaly with hepatosteatosis . an arterial phase enhancing , well defined lobulated , rounded , hypervascular lesion measuring approximately 10 cm in its largest diameter was present in the right lobe of the liver ( segments viii and v ) [ figure 1a d ] . a 55-year - old gentleman with solitary hypervascular mass in the right lobe of liver on dynamic computed tomography ( ct ) . ( a ) mildly hypodense mass ( * ) in the region of right lobe of liver on noncontrast ct scan . ( b ) the mass ( * ) shows arterial hypervascularity along its periphery ( bold arrow ) . ( c ) the lesion showed contrast washout on the portal venous phase and was seen to encase the anterior division of the right portal vein . ( d ) washout persistent in the equilibrium phase in the mass ( * ) in addition , a contrast - enhanced magnetic resonance imaging ( cemri ) with hepatocyte - specific contrast ( gadolinium bopta , bracco ) was performed for further characterization of the mass and to look for satellite lesions that may have been missed on ct . the cemri showed t1-weighted hypointense , t2-weighted hyperintense and diffusion restriction of the mass . with subsequent washout on portal venous and delayed hepatobiliary phase obtained at 90 min post injection [ figure 2a g ] . it showed hypervascularity of the lesion on arterial phase . a 55-year - old man with hypervascular hepatic neuroendocrine tumor secondary deposit . ( a ) the fat - suppressed t1-weighted fast spin - echo , magnetic resonance imaging ( mri ) image performed after the dynamic computed tomography ( ct ) shows a hypointense mass ( * ) in right lobe ( block arrow ) ( b ) the fat - suppressed t2-weighted fast spin - echo , mri image performed after the dynamic ct shows a hyperintense mass ( * ) in the right lobe of liver ( block arrow ) and in caudate lobe ( open white arrow ) . ( c ) the axial diffusion weighted image of b value 1000 shows restriction of the lesion ( * ) on t2-weighted ( block and open arrows ) . ( d ) the fat - suppressed t1-weighted fast spin - echo , dynamic mri in the arterial phase shows a hypervascular enhancing mass ( * ) in the right lobe of liver ( block arrow ) ( e ) fat - suppressed t1-weighted fast spin - echo , dynamic mri in the portal venous phase shows an encapsulated mass ( * ) with central washout in the right lobe of liver ( block arrow ) . ( f ) the fat - suppressed t1-weighted fast spin - echo , dynamic magnetic resonance imaging mri in the equilibrium phase shows an encapsulated mass ( * ) with better visualized central hypointensity in the right lobe of liver ( block arrow ) . ( g ) the fat - suppressed t1-weighted fast spin - echo , dynamic mri in the hepatocyte specific phase at 90 min shows an encapsulated mass ( * ) with central hypointensity in the right lobe of liver ( block arrow ) this suggested predominance of non hepatocyte cellular contents within the mass . differential diagnosis of primary hepatocellular cancer and solitary hypervascular metastasis from an occult primary was made . in view of the above findings and previously conducted fnac , the diagnosis of hcc was primarily considered , and an fdg pet scan was conducted to rule out occult primary or distant secondaries before subjecting the patient to hepatectomy . no obvious evidence of fdg pet avid lesion or extrahepatic disease was found on the pet scan . with a provisional diagnosis of primary hcc without extrahepatic spread , right hepatectomy specimen was sent for histopathological analysis [ figure 3a and b ] on gross pathology examination ; transection margin was found to be 1 cm away from the tumor mass and was free from the tumor [ figure 3c ] . explanted right hepatectomy specimen with tumor . ( c ) gross pathology specimen with tumor ( * ) the uninvolved liver parenchyma was non cirrhotic . on microscopic examination of the sections from the tumor , lobular architecture comprising of thickened trabeculae nests , insular pattern and acini separated by fine endothelial network with a mild amount of interspersed fibrous stroma was found . on immune histochemical analysis , tumor cells showed strong immunostaining with synaptophysin and chromogranin - a with ki-67 immunolabelling index of < 2% . a diagnosis of metastatic neuroendocrine carcinoma , with small and large vessels invasion , was made . in view of the metastatic neuroendocrine nature of the liver lesion , a dotanoc pet scan was done to look for the primary , as well as any other occult secondary deposits in the abdomen . the scan was suggestive of nodular activity in the distal small bowel mesentery , in the right lower abdomen with an associated reactive focus in the ileum [ figure 4a c ] . ( a ) axial section of dota - nai - octreotide ( dotanoc ) positron emission tomography / computed tomography ( pet / ct ) showing reactive focus in the small bowel mesentery ( * ) . ( b , c ) coronal section of dotanoc pet / ct ( bold arrow ) and isotope scan ( outlined arrow ) showing reactive focus in the small bowel mesentery subsequently the patient was posted for a follow - up surgery at 4 weeks from the previous hepatectomy . the repeat laparotomy revealed a stricture in the long segment of the distal ileum with multiple small nodules and ulceroproliferative lesions in the mucosa for a span of approximately 30 cm . an additional small mass lesion in the terminal ileum with mesenteric invasion and desmoplastic reaction was localized which was subjected to en block resection with end to end anastomosis of the ileum . on immunohistochemistry , the tumor was synaptophysin , chromogranin - a positive with ki-67 index < 2% with the final diagnosis of multicentric neuroendocrine carcinoma ( pathological staging of iv ) . the patient had an uneventful postoperative period and was free at a year 's follow - up . the term neuroendocrine in nets derives from precursor cells of these mass lesions , which are essentially endocrine cells with nerve cell antigens . these cells normally evolve into endocrine glands which are an essential element of the neuroendocrine system and are classically found in the small bowel , where they are involved in gut motility as well as secretion of metabolically active substances such as serotonin , chromogranin , kinins , prostaglandins and various other growth factors . nets are most commonly seen in the midgut ( ileum and jejunum ) , pancreas as well as large bowel . many of these tumors are incidentally detected during the course of investigations or at the time of autopsy . as the name suggests , nets are comprised of endocrine cells that may or may not secrete hormones and hence are classified as functional or nonfunctional tumors . the nonfunctioning nets are usually asymptomatic and difficult to diagnose based on the clinical history . for example , in the case discussed above , the patient did not report any endocrine or hormonal imbalances , hence the primary was not suspected . functional tumors manifest with clinical symptoms pertinent to the hormone secreted by the tumor for example serotonin , insulin , glucagon , etc . , which are likely to cause endocrinological imbalance . the world health organization ( who ) recently introduced a novel classification system for nets on the basis of tumor grading in 2010 . this system utilizes histopathological markers of ki-67 index , mitotic count , and tumor necrosis and is now being used as standard criteria for histopathological diagnosis and staging of these tumors . nets are associated with syndromes like von - hippel - lindau , multiple endocrine neoplasia type 1 and neurofibromatosis - type 1 . midgut nets are second most common malignancy after adenocarcinoma 's in the small bowel and are notorious for being asymptomatic or presenting as nonspecific symptoms . they have a relatively good prognosis and a 5 year survival rate of > 50% even with synchronous metastatic disease . the hepatic involvement by nets is seen as : metastatic spread ( in 2590% ) , mixed hcc / adeno - neuroendocrine carcinoma and the primary net of liver ( < 0.5% of all net 's ) in the same order . there is an increase by 5 times in the detection rate of net 's in the last two decades , partly due to improved radiological techniques . the latest epidemiological survey from a south asian country like japan shows that almost 20% of patients have distant spread of the disease at presentation . carcinoid syndrome which is characterized by flushing , diarrhea , and abdominal pain is observed in approximately 3% of the gut tumors . abdominal ct with contrast is the most readily available and simplest method of the preliminary investigation of suspected midgut net 's or tumors . ct enterography using positive or neutral oral contrast with adequate small bowel distension and multi - planar reformatting post acquisition facilitates viewing of the small bowel loops . the sensitivity of ct and mr enteroclysis to detect small bowel net 's is 85% and 86% respectively and appears limited , however distant spread and extra - tumoral involvement is well - demonstrated by the above . at our center , we use the ct enterography technique where oral neutral contrast along with methylcellulose is given to distend the small bowel without any discomfort of inserting the enteroclysis tube . in cases where the primary site of the tumor is unidentifiable , such as seen in our patient , whole - body scintigraphy using somatostatin receptor scintigraphy ( ssrs ) for pet / ct ( using gallium - labeled somatostatin analogs ) or it has been established that receptor subtypes , sstrs 2 and 5 are useful for diagnostic workup of primary net 's . dotanoc binds to sstr2 , sstr3 , and sstr5 receptors whereas dota octreotide ( dotatoc ) and dota octreotate bind to sstr2 and sstr5 . these analogues accumulate in the tumor nodules within 100120 min and can be rapidly imaged . the demonstration of somatostatin receptor status by in - octreotide or ga - labelled peptide pet / ct imaging not only serves as a diagnostic tool but also helps in predicting the response to somatostatin analogue therapy . ga - dotatoc has higher sensitivity ( 96% ) and specificity ( 92% ) to ct or ssrs for occult primary work up , staging and follow - up of the disease process . dotatoc is superior in diagnosis of systemic and bony spread however has been found inadequate for detection of liver and lung secondaries where ct is recommended . the unavailability of nuclear scanning on a daily widespread basis and its practical cost implications are the major disadvantage of this technique . it also has its limitations in detection of low receptor density and small ( < 1 cm ) lesions . recent advances in use of newer agents like 18f - dopa for pet / ct has shown even higher sensitivity in metastatic nets ( almost 100% ) . premedication with carbidopa for reduction of artifacts due to normal physiological activity in the peripancreatic tissues has been recommended . 18f - fdg pet / ct is mostly useful for diagnosis and staging of poorly differentiated net 's which essentially are who grade 3 and 4 . poorly differentiated midgut lesions with reduced hormone production , and a high cellular proliferative activity have a higher propensity to take up 18f - fdg as do most other this may be the reason that the tumor in distal small bowel ( which was not poorly differentiated ) in the case described above , could not be detected on fdg pet on the initial screening . this fact suggests that all tumors that have not been histologically defined should undergo both fdg and a dotanoc pet so as not to miss occult and well differentiated net 's . also in cases where the clinical suspicion of an net is high and fdg pet is unable to diagnose the primary , dotanoc pet or alternate scintigraphy scans may be considered so as not to miss the primary lesion . other modalities such as meta - iodobenzyl guanidine scans can be used to investigate patients with metastatic disease who may be potential candidates for treatment with radionuclide therapy . debulking of the small bowel primary tumor and subsequent surgical anastomosis is generally recommended in case of midgut net 's because of future beneficial effect in decreasing small bowel and vascular complications . a multivariate analysis of the study population in the united kingdom by niederle mb et al . showed that age at diagnosis , ki-67 level and surgical removal of the primary tumor were standalone predictors of survival in patients with midgut net and associated hepatic secondaries . this is especially true for the nonfunctioning midgut tumors where somoatostatin analogs and systemic chemotherapy has limited or essentially no role to play . the chances of lymph nodal spread of the disease is seen in almost 60% of small bowel primary net 's . associated probability of hepatic secondaries at the time of diagnosis is about 30% . as discussed in the guidelines of management of midgut net 's by cheung et al . resection of the primary tumor and associated mesenteric lymph nodes is mandatory to treat small bowel net 's , irrespective of the presence of hepatic secondaries or not . in addition , this group recommended , that patients who are found to have small bowel nets , after laparotomy and histopathology , such as in our patient 's case , are candidates for further surgery which is beneficial for future prognosis . the modality for follow - up imaging should ideally be the one which was able to detect and diagnose the lesion pretreatment . ssrs imaging should be performed for sstr avid tumors with ct and mri wherever indicated . ct and mri are the only means of follow - up when tumor is sstr negative . frequency of assessment depends on tumor growth rate , and mri may be used to prevent excessive radiation exposure . the term neuroendocrine in nets derives from precursor cells of these mass lesions , which are essentially endocrine cells with nerve cell antigens . these cells normally evolve into endocrine glands which are an essential element of the neuroendocrine system and are classically found in the small bowel , where they are involved in gut motility as well as secretion of metabolically active substances such as serotonin , chromogranin , kinins , prostaglandins and various other growth factors . nets are most commonly seen in the midgut ( ileum and jejunum ) , pancreas as well as large bowel . many of these tumors are incidentally detected during the course of investigations or at the time of autopsy . as the name suggests , nets are comprised of endocrine cells that may or may not secrete hormones and hence are classified as functional or nonfunctional tumors . the nonfunctioning nets are usually asymptomatic and difficult to diagnose based on the clinical history . for example , in the case discussed above , the patient did not report any endocrine or hormonal imbalances , hence the primary was not suspected . functional tumors manifest with clinical symptoms pertinent to the hormone secreted by the tumor for example serotonin , insulin , glucagon , etc . , which are likely to cause endocrinological imbalance . the world health organization ( who ) recently introduced a novel classification system for nets on the basis of tumor grading in 2010 . this system utilizes histopathological markers of ki-67 index , mitotic count , and tumor necrosis and is now being used as standard criteria for histopathological diagnosis and staging of these tumors . nets are associated with syndromes like von - hippel - lindau , multiple endocrine neoplasia type 1 and neurofibromatosis - type 1 . midgut nets are second most common malignancy after adenocarcinoma 's in the small bowel and are notorious for being asymptomatic or presenting as nonspecific symptoms . they have a relatively good prognosis and a 5 year survival rate of > 50% even with synchronous metastatic disease . the hepatic involvement by nets is seen as : metastatic spread ( in 2590% ) , mixed hcc / adeno - neuroendocrine carcinoma and the primary net of liver ( < 0.5% of all net 's ) in the same order . there is an increase by 5 times in the detection rate of net 's in the last two decades , partly due to improved radiological techniques . the latest epidemiological survey from a south asian country like japan shows that almost 20% of patients have distant spread of the disease at presentation . carcinoid syndrome which is characterized by flushing , diarrhea , and abdominal pain is observed in approximately 3% of the gut tumors . abdominal ct with contrast is the most readily available and simplest method of the preliminary investigation of suspected midgut net 's or tumors . ct enterography using positive or neutral oral contrast with adequate small bowel distension and multi - planar reformatting post acquisition facilitates viewing of the small bowel loops . the sensitivity of ct and mr enteroclysis to detect small bowel net 's is 85% and 86% respectively and appears limited , however distant spread and extra - tumoral involvement is well - demonstrated by the above . at our center , we use the ct enterography technique where oral neutral contrast along with methylcellulose is given to distend the small bowel without any discomfort of inserting the enteroclysis tube . in cases where the primary site of the tumor is unidentifiable , such as seen in our patient , whole - body scintigraphy using somatostatin receptor scintigraphy ( ssrs ) for pet / ct ( using gallium - labeled somatostatin analogs ) or it has been established that receptor subtypes , sstrs 2 and 5 are useful for diagnostic workup of primary net 's . dotanoc binds to sstr2 , sstr3 , and sstr5 receptors whereas dota octreotide ( dotatoc ) and dota octreotate bind to sstr2 and sstr5 . these analogues accumulate in the tumor nodules within 100120 min and can be rapidly imaged . the demonstration of somatostatin receptor status by in - octreotide or ga - labelled peptide pet / ct imaging not only serves as a diagnostic tool but also helps in predicting the response to somatostatin analogue therapy . ga - dotatoc has higher sensitivity ( 96% ) and specificity ( 92% ) to ct or ssrs for occult primary work up , staging and follow - up of the disease process . dotatoc is superior in diagnosis of systemic and bony spread however has been found inadequate for detection of liver and lung secondaries where ct is recommended . the unavailability of nuclear scanning on a daily widespread basis and its practical cost implications are the major disadvantage of this technique . it also has its limitations in detection of low receptor density and small ( < 1 cm ) lesions . recent advances in use of newer agents like 18f - dopa for pet / ct has shown even higher sensitivity in metastatic nets ( almost 100% ) . premedication with carbidopa for reduction of artifacts due to normal physiological activity in the peripancreatic tissues has been recommended . 18f - fdg pet / ct is mostly useful for diagnosis and staging of poorly differentiated net 's which essentially are who grade 3 and 4 . poorly differentiated midgut lesions with reduced hormone production , and a high cellular proliferative activity have a higher propensity to take up 18f - fdg as do most other this may be the reason that the tumor in distal small bowel ( which was not poorly differentiated ) in the case described above , could not be detected on fdg pet on the initial screening . this fact suggests that all tumors that have not been histologically defined should undergo both fdg and a dotanoc pet so as not to miss occult and well differentiated net 's . also in cases where the clinical suspicion of an net is high and fdg pet is unable to diagnose the primary , dotanoc pet or alternate scintigraphy scans may be considered so as not to miss the primary lesion . other modalities such as meta - iodobenzyl guanidine scans can be used to investigate patients with metastatic disease who may be potential candidates for treatment with radionuclide therapy . debulking of the small bowel primary tumor and subsequent surgical anastomosis is generally recommended in case of midgut net 's because of future beneficial effect in decreasing small bowel and vascular complications . a multivariate analysis of the study population in the united kingdom by niederle mb et al . showed that age at diagnosis , ki-67 level and surgical removal of the primary tumor were standalone predictors of survival in patients with midgut net and associated hepatic secondaries . this is especially true for the nonfunctioning midgut tumors where somoatostatin analogs and systemic chemotherapy has limited or essentially no role to play . the chances of lymph nodal spread of the disease is seen in almost 60% of small bowel primary net 's . associated probability of hepatic secondaries at the time of diagnosis is about 30% . as discussed in the guidelines of management of midgut net 's by cheung et al . resection of the primary tumor and associated mesenteric lymph nodes is mandatory to treat small bowel net 's , irrespective of the presence of hepatic secondaries or not . in addition , this group recommended , that patients who are found to have small bowel nets , after laparotomy and histopathology , such as in our patient 's case , are candidates for further surgery which is beneficial for future prognosis . the modality for follow - up imaging should ideally be the one which was able to detect and diagnose the lesion pretreatment . ssrs imaging should be performed for sstr avid tumors with ct and mri wherever indicated . ct and mri are the only means of follow - up when tumor is sstr negative . frequency of assessment depends on tumor growth rate , and mri may be used to prevent excessive radiation exposure . neuroendocrine tumors are a unique group of tumors pertaining to their etiology , origin and function . they may or may not be easily detected on routine ct and mri investigations especially if they are nonfunctional . distant spread to the liver may sometimes be the only manifestation of the tumor and despite the frequency of this presentation ; it may be a clinically diagnostic challenge . multidisciplinary approach , in which nuclear medicine techniques play an important role in the detection , staging , follow - up and response of these tumors , is essential . net metastases to the liver can mimic primary hcc on imaging , fnac as well as core biopsy . it is crucial to be aware of this pitfall while evaluating solitary hypervascular liver lesions and to develop a robust strategy with judicious use of ga - dotanoc and 18f - fdg pet / ct to reach the correct diagnosis as well as staging which has a major role in treatment management and patient prognosis .

neuroendocrine tumor metastases to the liver can mimic primary hepatocellular carcinoma ( hcc ) on imaging , cytology , and core biopsy . we present a case study along with the literature review of a patient who presented as a solitary liver mass mimicking hcc and subsequently underwent a partial hepatectomy . the histopathology and immunohistochemisrty of the resected specimen revealed metastatic neuroendocrine carcinoma . positron emission tomography ( pet ) scan with 68ga - dota - nai - octreotide ( 68ga - dotanoc ) localized the primary tumor in the ileum . a curative follow - up surgery for resection of the small bowel containing the primary tumor was carried out . this case illustrates the shortcomings of routine imaging methods , utility of immunocytochemistry and the importance of 68ga - dotanoc pet in determining the metastatic spread as well as the origin of neuroendocrine tumors ( nets ) . this case report attempts to highlight the current imaging paradigms and management strategy of midgut and other net 's at the point of detection , staging and follow - up .

INTRODUCTION CASE REPORT DISCUSSION Pathophysiology and incidence Diagnosis Management Follow-up and tumor response CONCLUSION

exposure to moderate to heavy amounts of alcohol during pregnancy remains a leading preventable cause of intellectual disabilities in north america ( abel and sokol , 1986 ; may and gossage , 2001 ; chudley et al . , 2005 ; may et al . , 2009 ) . children with fetal alcohol spectrum disorder ( fasd ) face a broad spectrum of cognitive and behavioral challenges , including deficits in sensory processing , attention , working memory and executive function ( mattson et al . , 1998 ; , 2010 ; mattson et al . , 2011 ; riley et al . , 2011 ) . although facial dysmorphia is characteristic of fetal alcohol syndrome ( fas ) , the severe end of the fasd spectrum , many children with fasd lack physical abnormalities and hence are often not diagnosed , even though sharing many of the same cognitive and behavioral issues ( mattson et al . , 1998 ; kodituwakku , 2009 ; this latter group of children , labeled as showing alcohol related neurodevelopmental disorder ( arnd ) , is known to display aberrant neural functions and subtle neuroanatomical differences in neuroimaging studies . delayed and/or abnormal brain development may contribute to deficits in cognitive function and increased behavioral issues in adolescents with fasd ( lebel et al . , 2011 ; triet et al . , 2013 ) . brain regions particularly vulnerable to alcohol 's teratogenicity include the frontal and parietal cortex , posterior sensory cortex , caudate , hippocampus , and cerebellum ( for a review , see roussotte et al . , 2010 ) . although reduction in total brain volume is a common feature in fasd ( astley et al . , 2009 ; lebel et al . , 2011 ) , increased local cortical thickness has been reported in the parietal and frontal cortices ( sowell et al . , 2002 ; sowell et al . , 2008 ) and in the inferior frontal , superior temporal , and middle temporal cortex ( yang et al . , 2012 ) . , 2012 found that even children with arnd showed volume reductions in multiple brain regions , including the frontal , parietal , and temporal lobes , although these volume reductions were due to reduced cortical surface area rather than thickness . abnormal and delayed development of white matter tracts have also been seen in fasd in the posterior corpus callosum , anterior posterior fiber bundles , superior longitudinal fasciculus and superior and inferior fronto - occipital fasciculus , and cerebellar peduncles ( cf . 2011 ; triet et al . , 2013 ; green et al . , 2013 ) . functional neuroimaging studies reveal that typically developing adolescents exhibit weaker modulatory control from frontal areas compared to adults ( hwang et al . , 2010 ) . in a recent fmri study of children from 714 years of age , fasd showed reduced activation bilaterally in the frontal , parietal and temporal cortex compared to controls , suggesting an impact of alcohol exposure in utero on maturation ( gautam et al . , 2014 ) . increased frontal and parietal activation has been reported during the performance of spatial working memory task in arnd and go / no - go tasks in fasd ( malisza et al . , 2012 ; norman et al . , 2013 ; although differences observed in microvascular networks in a mouse model of fas / partialfas suggest some caution in the interpretation of these fmri data ( jgou et al . , 2012 ) , electroencephalographic ( eeg ) and magnetoencephalographic ( meg ) studies also support differences in measures of brain function in fasd . deficits in auditory stimulus classification and inhibition have been reported in adolescents with fas / partialfas ( steinmann et al . , 2011 ) . latency and amplitude differences of the p300 auditory event - related potential ( erp ) in an oddball task discriminated between children with down syndrome , fasd , and typically developing controls ( kaneko et al . auditory processing delays have also been observed in a meg study of preschool children with fasd ( stephen et al . , 2012 ) . the present study utilized meg to investigate brain dynamics of adolescents with fasd during the performance of an auditory oddball task . perceptual expectation for a set of repeated ( standard ) tones , detection of target tones that elicit behavioral responses and processing of novel digital sounds in cortico - hippocampal circuits ( halgren et al . , 1998 ) . sex - related differences in brain structure are known to emerge in typically developing adolescents , with increased volume of the amygdala in males and of the hippocampus in females ( for a review , see blakemore , 2012 ) . since prenatal ethanol exposure is known to produce sex - specific deficits in hippocampus in rodent models ( coleman et al . , 2012 ; see also helfer et al . 2014 ) , we hypothesized that meg measures of brain activation in the oddball data may reveal sex - specific differences for adolescents with fasd . consideration of potential sexual dimorphism in neuroimaging and neurophysiological studies in adolescents with fasd is rare ( although see kaneko et al . , 1996a ) . the present effort will contribute novel information on sex - specific effects on brain function and motivate further attention to potential sexual dimorphism in studies of adolescents with fasd . forty eight adolescents and young adults in the age range 1222 years were recruited for this study . for the participants utilized in the meg analysis , twenty two of the participants ( 9 male , age 15.0 yrs , sd = 3.6 yrs ; 13 female , age 15.5 yrs , sd = 2.8 yrs ) were identified as fasd according to the modified institute of medicine criteria ( stratton et al . , , 9 were diagnosed with fas ( 6 male and 3 female ) and 13 with alcohol - related neurodevelopmental disorder ( arnd ) ( 3 male and 10 female ) . twenty - two age- and sex - matched healthy individuals ( hc ; 9 male , m age 13.5 yrs , sd = 4.7 yrs ; 13 female , m age 16.8 yrs , sd = 3.3 yrs ) with no history of prenatal alcohol exposure , developmental delays , significant psychiatric or neurological problems served as controls . all of the participants were right handed ( edinburgh handedness inventory : oldfield , 1971 ) and none of the participants had significant sensory problems ( e.g. poor vision or hearing ) or difficulty understanding the task demands . participants with fasd were recruited at the university of new mexico fetal alcohol diagnostic and evaluation clinic and healthy controls ( hc ) through flyers and word of mouth . this study was approved by the university of new mexico health sciences center institutional review board and was in full compliance with the code of ethics of the world medical association ( declaration of helsinki ) . informed consent was obtained from the parents / legal guardians and/or participants dependent on the age and assent from minors in accord with the institutional review board guideline of the university of new mexico . cognitive assessment was performed at the mind research network in conjunction with the meg / mri scans . two subtests from the wechsler abbreviated scale of intelligence ( wasi , vocabulary and matrix reasoning ) were utilized to compute full scale iq . tone bursts ( 80% ) , 1.5 khz target tone bursts ( 10% ) and novel digital sounds ( 10% ) presented binaurally through plastic tubes placed into the ear canals . the duration of all stimuli was 200 ms with a pseudorandom stimulus onset asynchrony between the stimuli of 13 s ( mean 1.5 s ) and intensity of 85 db . the stimuli were grouped into four equal - duration blocks , with brief rest intervals ( 15 min ) between blocks . the total number of stimuli in all four blocks was 784 ( standard ) , 98 ( target ) and 98 ( novel ) . participants were asked to press a response button with the right index finger upon perception of the 1.5 khz target tones . presentation software ( http://www.neurobs.com ) was used to deliver stimuli and record motor responses to target stimuli . magnetoencephalographic ( meg ) data were acquired at the mind research network ( mrn , albuquerque , nm ) . participants were seated inside a double - layer magnetically shielded room ( vacuumschmelze ) under a 306-channel meg array ( elekta neuromag ) and monitored throughout the scan . prior to the scan , a polhemus 3d position tracker was used to record the location of four head positioning ( hpi ) coils on the left and right mastoid and bilaterally on the forehead and the left and right preauricular and nasion fiducial points . the meg data were sampled at 1200 hz and band - pass filtered online at 0.1330 hz . the location of the participant 's head with respect to the meg array was recorded throughout the scan through activation of the hpi coils . bipolar horizontal and vertical electro - oculograms and a bipolar electrocardiogram were recorded throughout the scan . high - resolution t1-weighted anatomic images were acquired using a 3 t siemens trio tim with a multi - echo magnetization prepared rapid gradient echo ( mprage ) sequence ( echo time [ te ] = 1.64 , 3.5 , 5.36 , 7.22 , and 9.08 ms ; repetition time [ tr ] = 2530 ms ; inversion time [ ti ] = 1200 ms ; flip angle = 7 ; number of excitations = 1 ; slice thickness = 1 mm ; field of view [ fov ] = 256 mm ; resolution = 256 256 mm ) . the scan session lasted approximately 30 min and also included functional mri ( fmri ) and diffusion tensor imaging ( dti ) acquisition , which are not included in this manuscript . the average image ( root - mean - square ) across the five echoes of the mprage was used for co - registration with meg data and for construction of a boundary element model ( bem ) for each participant . elekta neuromag maxfilter software was used to compensate for head movement under the scanner and to remove artifacts originating outside the cranial volume ( taulu and simola , 2006 ) . all data for each subject were co - located to a common subject - specific head position . signal - space projectors were created from these data and used to further suppress blink and cardiac signals on an individual subject basis ( tesche et al . , 1995 ; tesche et al . , the data were down - sampled at 600 hz and averaged time - locked to stimulus presentation for each stimulus type ( standard , target , novel ) for epochs of 500 ms before to 1000 ms after auditory stimulus presentations . the evoked - response averages were baseline corrected from 500 to 0 ms before stimulus presentation . since activity at 1000 ms after stimulation occurred immediately before the earliest possible presentation of a subsequent stimulus ( the minimum isi between all stimuli was 1000 ms ) , the evoked - response waveforms were terminated at 1000 ms to avoid contamination with the processing induced by subsequent stimuli . surface tessellation of the cerebral and of the cerebellar cortex was extracted from each participant 's mr images using brainsuite ( http://brainsuite.org ) . the cerebral and cerebellar cortical tessellations were merged to form a brain - based source space for meg data inversion . a similar cortico - cerebellar tessellation was constructed from mr images for the collin 27 adult brain ( collins , 1998 ) which was used as a common source space for all between - subject analyses . brainstorm ( tadel et al . , 2011 ) was used to compute average sensor waveforms and global field power plots from the meg sensor data and to extract brain - based waveforms for specific brain regions . brainstorm is a documented and freely available package downloaded online under a gnu general public license ( http://neuroimage.usc.edu/brainstorm/ ) . the meg data were co - localized with the structural mri data on an individual participant basis . source - space waveforms were then computed for each participant from all sensor evoked - response data ( utilizing both gradiometer and magnetometer sensor data ) and the individual brain surface tessellation using a weighted minimum norm estimate ( wmne ) . the p50 m and n100 m responses were determined for each participant from their individual meg / mri data . an initial region of interest was selected in and near the posterior ramus of the lateral sulcus . a waveform of activation for this roi was then extracted from the participant 's evoked - response data and the latency of the peak response noted . the initial roi was adjusted on an iterative basis to encompass the region of activation at the peak latency . this procedure was followed for activation between 40 and 70 ms for the p50 m response and independently at 80120 ms for the n100 m response . when these cortical areas corresponding to the p50 m and n100 m responses were projected onto the colin 27 brain , variable blurring and shifting of the rois across participants were observed . more representative individual latency values used in the present study were determined using each participant 's mri before the transformation of the source data into the colin 27 brain . group - averaged brain activation patterns were determined by projection of each participant 's source - space data onto a common surface derived from the collin 27 brain . averages of the absolute value of individual activation patterns within this source space were determined for the standard , target and novel trials separately for male and female fasd and the sex- and age - matched controls . meg data for this subject were projected directly onto the collin 27 brain using a polhemus digitization of the participant 's face and scalp . brain activation patterns were determined for all participants at 100 , 250 and 350 ms after stimulus presentation . waveforms of brain activity were computed within brainstorm from group averages of the absolute value of source activation data . the following regions were selected as salient for stimulus processing and novelty detection : the posterior ramus of the lateral sulcus and the inferior frontal sulcus as described in the destrieux cortical atlas ( destrieux et al . , 2010 ) and the hippocampus as determined from the collin 27 images within brainstorm . comparisons of fasd and hc were calculated for neuropsychological measures , response times to target stimuli and age ( table 1 ) . all statistics were calculated two - tailed and the critical value for rejecting the null hypothesis was p 0.05 . to assess performance on the oddball task , response times ( rts ) and accuracy to the target stimuli the raw scores for the vocabulary and matrix reasoning subtests from the wasi were t scored and used to determine the participant 's iq score . fasd and control group performance on the oddball task , and wasi performance was further explored by comparing sex differences by group and then within group . to test for a difference in age an independent samples t - test was performed . to test for difference in sex , a chi - squared test was performed . independent samples t - tests were performed to evaluate the differences between fasd and hc groups for latency measures of the auditory evoked - response to standard stimuli ( p50 m , n100 m , and n100 m onsets ) ( table 2 ) . differences in latencies were further explored by comparing sex differences by group and then within group . a 2 3 repeated measures anova was performed to compare the left hemisphere p50 m , n100 m , and n100 m latencies by group . a separate 2 3 repeated measures anova was performed to compare the right hemisphere p50 m , n100 m , and n100 m latencies by group . within subject lateralization differences were tested using paired - sample t - tests . pearson 's correlations were executed to examine relationships between the auditory evoked - response latencies and the behavioral , neuropsychological and age data . these relationships were further explored by comparing sex differences both between groups and within group . brainstorm ( tadel et al . , 2011 ) was used to compute brain activation patterns for fasdm , fasdf , hcm and hcf ( figs . the data were averaged for standard , target and novel trials at 0 , 100 , 250 and 350 ms following stimulus presentation . in brainstorm , the visualization parameter amplitude was set to 50% and the minimum size was set to 1 ( all features of every size are displayed ) . comparison of activation plots for fasdm vs. hcm and for fasdf vs. hcf was also computed in brainstorm ( figs . the activation plots for each participant were normalized to baseline values from 500 to 0 ms prior to computation of group - averaged data . the comparisons between groups of evoked - response waveforms were performed using a matched - pair ( sex and age ) t - test on each sampled instant ( figs . 9 , 11 , 13 ) . epochs of significant differences ( p < 0.01 ) were computed from the data and are indicated as black bars on the horizontal axes of the figures . the time frequency plots ( figs . 10 , 12 , 14 ) were computed without normalization or thresholding of the results . a matched - pair ( sex and age ) t - test was used for comparison between groups with p - value threshold of 0.05 . five participants did not complete the cognitive assessment . the remaining 39 participants ( 46.15% male ) were assessed for a relationship between response time to target auditory stimuli and demographic ( age , sex ) and cognitive measures ( iq , wasi vocabulary , wasi matrix reasoning ) . no significant between - group differences were detected for age ( t(44 ) = 0.919 , p = .36 ) or sex ( (1 , n = 39 ) = 0.022 , p = .882 ) . large and significant differences were detected for iq mainly due to a substantial difference in vocabulary ( see table 2 ) . in addition , a significant association was detected between wasi vocabulary and response time ( r = .350 , p = .039 ) . there was no significant effect of sex on response time ( rt ) , the number of false positives , the ratio of incorrect / correct , on rt weighted by hits or on the change of rt or false positives across the 4 blocks . significant differences in iq and vocabulary scores were also observed in male and female group comparisons . in the male comparisons by group , iq scores were significantly different [ t(15 ) = 4.42 , d = 2.28 , p = 0.001 ] , with the control males having higher iq scores . vocabulary scores were also significantly different [ t(15 ) = 5.97 , d = 3.08 , p = 0.00003 ] , with the control males having higher vocabulary scores . the female comparisons followed the same trend with iq scores being significantly different [ t(22 ) = 4.27 , d = 1.82 , p = 0.0003 ] , with the control females having higher iq scores . vocabulary scores were also significantly different [ t(21 ) = 4.53 , d = 1.98 , p = 0.0002 ] , with the control females having higher vocabulary scores . again within group comparisons did not reveal any significant differences between sexes for any of the measures . the p50 m and n100 m peak latencies and the onset of the n100 m for the standard stimuli were determined for each participant from waveforms for activity in primary / secondary auditory cortex ( fig . an independent samples t - test for p50 m and n100 m latencies and for the n100 m onset in the left and in the right hemisphere revealed significant differences between fasd and hc in the left n100 m onset [ t(36 ) = 2.267 , p = 0.029 , d = 0.735 ] and left n100 m latency [ t(39 ) = 2.368 , p = 0.023 , d = 0.739 ] . a repeated measures anova was performed to compare the latencies of the p50 m , n100 m , and n100 m evoked responses in the left and right hemisphere . this yielded a significant difference between hemispheres [ f(1,34 ) = 5.382 , p = 0.026 , partial = 0.195 ] . both fasd and hc showed differences in latency that depended on sex ( fig . an independent samples t - test revealed that in hc , males and females were significantly different for the left hemisphere n100 m onset [ t(17 ) = 4.137 p = 0.001 , d = 1.922 ] , left hemisphere n100 m latency { t(18 ) = 3.536 p = 0.002 , d = 1.613 } , right hemisphere p50 m latency [ t(17 ) = 2.448 , p = 0.026 , d = 1.137 ] , and right hemisphere n100 m latency [ t(19 ) = 2.834 , p = 0.011 , d = 1.273 ] . in fasd , males and females were significantly different for the left hemisphere n100 m onset [ t(17 ) = 2.275 , p = 0.036 , d = 1.082 ] , right hemisphere p50 m latency [ t(16.151 ) = 5.905 , p = 0.000021 , d = 2.743 ] , and right hemisphere n100 m onset [ t(9 ) = 2.790 , p = 0.021 , d = 1.69 ] . however , an independent t - test comparison of female fasd and female hc revealed no significant differences . an independent t - test comparison of male fasd and male hc revealed significant differences in the left hemisphere n100 m onset [ t(13 ) = 2.537 , p = 0.025 , d = 1.313 ] , and left hemisphere n100 m latency [ t(14 ) = 2.229 , p = 0.043 , d = 1.115 ] . lateralization differences were observed in hc and tested using paired - sample t - tests . onset of n100 m in the left hemisphere at 72 ms lagged onset in the right at 66 ms [ t(15 ) = 2.199 , p = 0.044 , d = 0.55 ] . n100 m latency on the left at 100 ms lagged the right at 91 ms [ t(19 ) = 3.158 , p = 0.005 , d = 0.706 ] . the difference between the left p50 m at 52 ms was almost significant compared to the right p50 m at 47 ms [ t(16 ) = 1.95 , p = 0.069 , d = 0.472 ] . in contrast no significant differences were observed between the hemispheres in p50m / n100 m latency and n100 m onset in fasd . correlations between the p50 m , n100 m onset and n100 m component latency and neuropsychological tests ( wasi : iq score , vocabulary , and matrix reasoning ) were also investigated . no significant correlations were found with the control males , fasd males , nor with all male scores grouped together . with all female scores combined , there was a correlation between the left n100 m latency and iq [ r(21 ) = 0.427 , p = 0.042 , r = 0.18 ] and with the left n100 m latency and matrix reasoning [ r(20 ) = 0.459 , p = 0.032 , r = 0.21 ] . there was also a correlation between the right n100 m latency and vocabulary [ r(13 ) = 0.522 , p = 0.046 , r = 0.27 ] , but not with the left n100 m latency . there were also no correlations found in the combined control group . in the fasd group , there were no correlations with the left and right p50 m and n100 m onset . there was a correlation between the right n100 m and vocabulary [ r(14 ) = 0.512 , p = 0.043 , r = 0.26 ] , but not in the left n100 m . 2 shows group - averaged meg sensor waveforms and global field power ( gfp ) for standard , target and novel trials . there are also a series of peaks from 250 to 450 ms for standard , target and novel trials , and also sustained activity to 800 and 1000 ms for target and novel trials , respectively . figs . 35 show group - averaged patterns of brain activation represented on the cortical surface as the absolute value of current flow at 0 , 100 , 250 and 350 ms following presentation of the standard , target and novel stimuli . responses for standard stimuli were strongly right lateralized for both fasdm and hcm but not for fasdf and hcf at 100 , 250 and 350 ms . increased frontal and parietal activation responses following target stimuli showed a similar pattern of strongly right - lateralized activation for fasdm and hcm , but not for fasdf and hcf . increased frontal and parietal activation for fasdm and fasdf responses following novel stimuli showed right - lateralized activation for all groups , with frontal activation at 100 ms and temporal activation at 350 ms for fasdm . 68 show group - averaged patterns of brain activation for fasdm vs. hcm and fasdf vs. hcf at 0 , 100 , 250 and 350 ms following presentation of the standard , target and novel stimuli . the data for each of the participants were normalized to baseline values ( from 500 to 0 ms before stimulus presentation ) prior to computation of the mean activation patterns for each group . 68 reflect both activation at the indicated time epochs and also baseline activation levels . in fig . 6 , the t - test plots at 100 ms reveal scattered regions of significant differences between fasdm and hcm , including increased activation of the right parietal cortex for standard stimuli and of the right cerebellum for target stimuli in fasdm . novel stimuli elicited significant increases in bilateral frontal , parietal and cerebellar cortex for fasdm compared to hcm . there was also increased activation of bilateral frontal cortex in fasdf compared to hcf for all three stimulus types . in fig . 7 the t - test plots at 250 ms reveal significant increases for fasdm in left temporal and left inferior frontal activation and decreases in bilateral medial frontal and right frontal activation compared to hcm for standard stimuli . responses for target stimuli also showed significant increases in left temporal activation and decreases in bilateral medial frontal and right frontal activation . there was also significant increases for fasdf in bilateral frontal activation to standard stimuli , right frontal activation to target stimuli and bilateral activation to novel stimuli compared to hcf . novel stimuli also elicited increases in medial frontal and decreases in parietal activation in fasdf compared to hc . both target and novel stimuli elicited significant increases in the cerebellum for fasdm compared to hcm , but not for fasdf compared to hcf . in fig . 8 the t - test plots at 350 ms for standard stimuli show significant decreases in bilateral frontal and parietal cortex and increases in bilateral temporal cortex for fasdm compared to hcm . target and novel stimuli elicited significant increases in bilateral frontal and temporal cortex for fasdm . there were also significant increases in right frontal activation to standard stimuli and increases in bilateral frontal activation to target and novel stimuli for fasdf compared to hcf . decreased activation of bilateral parietal cortex 914 show group - averaged waveforms and power time frequency ( tf ) plots for current flow within and near the left and right primary auditory cortex ( posterior ramus of the lateral sulcus ) , the inferior frontal sulcus and the hippocampus for the standard , target and novel conditions . although there are intermittent epochs of significant differences between fasd and hc both before and after stimulus presentation , differences in the amplitude of the n100 m response to standard and target stimuli are not significant . interestingly , the evoked - response waveforms following standard and target stimuli reveal sustained activity from 0.5 to 1 s for both fasd and hc . the activity at 1 s occurs just prior to the earliest possible presentation of a subsequent stimulus . in contrast , hcm , hcf and fasdf waveforms for novel trials return to baseline in the left and right hemispheres during the same epoch . only waveforms for fasdm show a tendency for sustained activity in the right hemisphere . 10 for current flow in the auditory cortex reveal stimulus - locked alpha - band ( 813 hz ) activity for both fasd and hc . right - lateralization of responses is seen for hcm for standard stimuli and for fasdm for all stimulus types . right - lateralization of responses for standard stimuli is seen also for hcf , and for target stimuli for fasdf . the t - test plots for the right auditory cortex show significant increases in alpha - band activity for fasdm compared to hcm both prior to and after stimulus presentation for target stimuli . in contrast , the t - test plots for fasdf vs. hcf show significant decreases in alpha - band activity for fasdf both prior to and after stimulus presentation in the left and right auditory cortex for all stimulus types . the t - test plots for standard trials in the left but not the right auditory cortex also show significant increased alpha , beta ( 1335 hz ) and gamma ( 3560 hz ) activities for fasdm compared to fasdf . increased gamma - band activity in the left auditory cortex is not seen in hcm vs. hcf . the t - test plots for the right auditory cortex show significant increased alpha - band activity for fasdf compared to fasdm for target stimuli . fig . in contrast to the waveforms for activity within the left and right auditory cortex , fig . 11 reveals multiple epochs of significant differences between responses for fasd compared to hc , with amplitudes for fasd exceeding that for hc for all stimulus categories , particularly in the right hemisphere . there is also sustained activity from 0.5 to 1 s following standard and target stimuli for fasd and hc , and sustained activity from 0.5 to 1 s in the right inferior frontal sulcus following novel stimuli for fasd . significant differences in baseline activity are also seen in the data for both male and female fasd compared to controls . 12 for current flow in the inferior frontal sulcus are similar to those for the auditory cortex , in that stimulus - locked alpha - band activity is more right - lateralized for both fasd and hc following standard and target stimuli . in contrast to the results for the auditory cortex , alpha - band activity for novel stimuli is more right - lateralized for fasdm and more left lateralized for fasdf . the t - test plots show significantly increased alpha - band activity for fasdm compared to hcm both prior to and after stimulus presentation in the right inferior frontal sulcus for target and novel stimuli . in contrast to the results for the auditory cortex , the t - test plots for fasdf vs. hcf for standard stimuli show significant increases in alpha- , beta- and gamma - band activities for fasdf after stimulus presentation in the left hemisphere and both prior to and after stimulus presentation in the right hemisphere . gamma - band increases for fasdf compared to hcf can also be seen for target and novel trials . the t - test plots for fasdm vs. fasdf for standard and target trials show decreased alpha- , beta- and gamma - band activities in the left hemisphere for male compared to female fasd . the t - test plots for hcm vs. hcf for standard and target trials also show decreased alpha- and beta - band activities in the left hemisphere for males compared to female hc . in contrast to responses in the auditory cortex , there are few significant differences for either fasdm vs. fasdf or for hcm vs. hcf in the right hemisphere for standard and target stimuli , or in either hemisphere for novel stimuli . fig . there are multiple epochs of significant differences between responses for fasd compared to hc , with waveform amplitudes for fasd exceeding that for hc for all stimulus categories in both the left and right hemispheres . fasdm waveforms show a pronounced , bilateral and prolonged p300-type response to novel stimuli with a sustained response to ~800 ms . there are also significant differences between fasd and hc in the sustained activity from 0.5 to 1 s following standard and target stimuli . differences in baseline activity are also seen in the data for all conditions with the exception of the left hemisphere responses in the hippocampus for fasdf compared to hcf . the tf plots in fig . 14 for current flow in and near the hippocampus show increased bilateral alpha - band activity for fasdm compared to hcm following standard and target stimuli , and increased right - hemisphere alpha - band activity following novel stimuli . differences in the tf plots for fasdf and for hcf are less pronounced , although interesting stimulus - locked beta- and gamma - band activities can be seen for both fasdf and hcf . the t - test plots for fasdm vs. hcm for standard and target stimuli reveal significant increases in alpha- , beta- and gamma - band activities for fasdm . alpha - band activity is also significantly increased for fasdf compared to hcf , although the differences are not as pronounced . the t - test plots for standard stimuli also reveal significantly less alpha- , beta- and gamma - band activation for fasdm compared to fasdf in the left and right hippocampus , but only minor differences for hcm compared to hcf . the present study revealed differences in brain activation and dynamics in adolescents with fasd compared to typically - developing controls during the performance of an auditory oddball task . this task probes development of top - down perceptual expectation for repeated ( standard ) tones , detection of target tones that elicit a behavioral response and processing of novel digital sounds in cortico - hippocampal circuits ( halgren et al . , 1998 ) . the main finding was widespread sex - specific differential activation of the frontal and medial temporal cortex in adolescents with fasd compared to typically developing controls . significant differences in evoked - response and time frequency measures of brain dynamics for fasd were observed for all stimulus types in the auditory cortex , inferior frontal sulcus and hippocampus . these results underscore the importance of considering the influence of sex when analyzing neurophysiological data in children with fasd . although fasd responded more slowly to target tones compared to hc in the oddball task , there was no effect of sex on the response times to target stimuli . in contrast , significant differences were observed in the latencies of the auditory n100 m response to standard stimuli between male and female participants with fasd . in a previous meg study of 10 preschool children with fasd and 15 healthy controls , stephen and colleagues ( 2012 ) found significant delays in fasd in the n100 m and n200 m evoked - response peaks following presentation of a train of 1000 hz tone bursts . this interesting study suggested that auditory evoked - response latency differences may evidence alcohol - induced brain damage in this age group . in the present study on 22 adolescents with fasd and 22 typically developing controls , latency differences between participants with fasd and healthy controls were observed in both the p50 m and n100 m auditory evoked responses . in contrast to the stephen study , latencies of the p50 m and n100 m were shorter for adolescent fasd compared to healthy controls . ( 1996a ) reported no significant n100 latency differences for standard stimuli between children from 4 to 15 years with fas and healthy controls . suggested that the discrepancy between their results and that of kaneko et al . may be due in part to maturational differences in auditory processing between younger and older children . maturation of the cortical auditory evoked response in typically developing children is known to shorten the latency of n1 and p2 in eeg scalp recordings ( wunderlich et al . , 2006 ) . in the context of fasd , studies performed in alcohol - exposed rats reveal that abnormalities in auditory brainstem responses observed in the newborn ( church , 1987 ) tend to dissipate in adulthood ( church et al . , 2012 ; leigland et al . , these data suggest that , although neurophysiological measures of auditory processing delays may have potential as markers for compromised brain function in very young children with fasd , these measures may not be useful for older children . another possible contributor to the observed differences between the young children in prior work ( kaneko et al . , 1996a ; stephen et al . , 2012 ) and the present study could be in the nature of the auditory stimuli presented to each group . the young children in the stephen study were passively exposed to trains of 1000 hz tones . children in the kaneko study listened to standard , rare and noise - burst stimuli but did not make a behavioral response , in contrast , adolescents in the present oddball study were requested to make a motor response to the ( rare ) target stimuli . perceptual expectation for the repeated standard tones and processing of novel digital sounds in cortico - hippocampal circuits but also generation of behavioral responses to target tones and inhibition of behavioral responses to both standard and novel stimuli . thus participants needed to attend to all of the oddball stimuli in order to successfully perform the requested motor response . stimulus - driven attention is known to increase the speed of auditory processing ( folyi et al . , 2012 ) . hence the latency differences observed for the standard stimuli between fasd and hc in the present oddball study may reflect not just maturation but also a contribution from differences in top down attentional and inhibitory functions between the two groups . in support of this notion , we observed widespread activation , not only of auditory , but also of frontal cortex as early as 100 ms after stimulus presentation . activation of the frontal cortex continued until immediately prior to presentation of the subsequent stimuli with significant differences in brain activation between male and female fasd and sex - matched hc . the shorter p50 m and n100 m auditory evoked - response latencies in the auditory cortex in fasd did not translate into reduced response times to the target stimuli . this result supports the notion that , although differences in early processing in the auditory cortex may evidence the effects of alcohol exposure in fasd , processing in other cortical and/or subcortical regions must also have been impacted by alcohol exposure . prenatal ethanol exposure is known to affect both the frontal cortex and hippocampus ( for a review , see roussotte et al . , 2010 ) , and also to produce sex - specific deficits in the hippocampus in rodent models ( coleman et al . , 2012 ; sickmann et al . , 2014 ) . our results indicate that the application of high - temporal - resolution neuroimaging techniques such as meg with the potential to characterize brain dynamics in frontal - hippocampal circuitry can play a valuable role in characterizing neurophysiological deficits seen in fasd . in the present study , significant differences were observed between fasd and hc and between males and females in the evoked - response waveforms and in the time frequency ( tf ) plots of stimulus - locked oscillatory activity for regions of interest centered in the primary / secondary auditory cortex , inferior frontal sulcus and hippocampus . although the relationship between evoked - response waveforms , ongoing ( endogenous ) alpha , induced ( stimulus - locked ) alpha and stimulus - evoked alpha in meg data are complex and controversial ( for a review , see mazaheri and jensen , 2010 ) , oscillatory activity is believed to play a critical role in the sculpting and coordination of brain function . alpha - band ( 813 hz ) activity has been implicated in timing and attention ( for a review see klimesch , 2012 ) and in the inhibition of neuronal populations irrelevant to task performance ( jensen and mazaheri , 2010 ) . although alpha oscillations can be found throughout the frontal and posterior cortex , the most prominent alpha - band activity ( eyes - closed alpha ) occurs near the parieto - occipital sulcus in the absence of visual stimuli . reduction of left - hemisphere eyes - closed alpha has been reported in a previous eeg study in fas ( kaneko et al . meg detection of stimulus - induced alpha in the auditory cortex ( tau ) has been reported by several groups ( tiihonen et al . , 1991 ; in the present study , differences between fasd and hc and between males and females were more apparent in the stimulus - locked alpha - band activity than in the evoked - response waveforms . the significant increases in the alpha - band activity seen in the left hemisphere for hcf compared to fasdf , for fasdf compared to fasdm and for hcf compared to hcm suggest that measures of induced alpha may be salient markers for abnormalities in inhibitory processes in the auditory cortex in fasd . the motivation for selecting the inferior frontal sulcus as a region of interest in the present study is the known role of the ventrolateral prefrontal cortex ( vlpfc ) in the processing of acoustic features of complex sounds ( for a review , see plakke and romanski , 2014 ) . auditory association areas , including the auditory belt and superior temporal gyrus project to vlpfc areas 12/47 , 45 , and 12 orbital . a more general role of the right inferior frontal cortex in auditory processing is somewhat more controversial ( cf . swick and chatham , 2014 ; aron et al . , 2014 ) , although recent fmri data suggest that inferior frontal cortical regions participate to spatially distributed networks in the processing of infrequent stimuli ( erika - florence et al . , 2014 ) . in the present study , in contrast to responses seen in the auditory cortex , there was a consistent increase in evoked - response and alpha - band activity in the inferior frontal sulcus for standard and target stimuli in fasd compared to hc . in male fasd , increases were seen primarily in the right hemisphere . in female fasd , increased activity was more bilateral and accompanied by prominent right - hemisphere gamma oscillations . a deficit in inhibitory interneuron development , hypothesized to be a long - term consequence of developmental ethanol exposure ( sadrian et al . , 2013 ) , may contribute to this increased evoked - response , alpha- and gamma - band activities seen in fasd . in pioneering passive oddball eeg study of children with fas , kaneko , riley and collaborators found latencies of the p300 evoked response over the parietal cortex to novel stimuli to be increased in fas compared to controls ( kaneko et al . , 1996a ) . the oddball paradigm in the eeg literature is utilized to characterize attention and novelty detection , with the p3a component of the p300 associated with involuntary orientation of attention to novel stimuli in fronto - hippocampal circuits , and the p3b component associated with voluntary detection of task - salient target stimuli ( for a review see soltani and knight , 2000 ; polich , 2007 ) . in the present meg study , significant differences emerged between fasd and hc in and near the hippocampus . standard , target and novel stimuli all elicited significant increases in evoked - response amplitudes in fasd compared to hc at 300 ms , with sustained activation to 1000 ms for both standard and target , but not novel , stimuli . tf plots revealed increased alpha , beta and gamma - band activities for fasd vs. hc and for fasdm vs. fasdf for standard and target stimuli , and for fasdf vs. hcf for novel stimuli . the elevated activation to all stimulus types was also seen in the right inferior frontal sulcus in fasd . hyperactivity has been reported in olfacto - hippocampal circuits in the alcohol - exposed rodent during both the spontaneous ( resting ) state and in sensory - evoked responses ( wilson et al . , 2011 ) . although a detailed analysis of cortico - hippocampal network dynamics is not reported here , these results suggest a common auditory - evoked and alpha - band hyperactivity in both the inferior frontal sulcus and hippocampus in adolescents with fasd . observation of both evoked - response and alpha - band differences in fasd enlarges the potential set of neurophysiological measures for the impact of alcohol exposure on brain function . the main finding of this meg study was widespread sex - specific differential activation of the auditory , frontal and mesial temporal cortex in adolescents with fasd compared to typically developing controls during the performance of an auditory oddball task . this task probed development of top - down perceptual expectation for repeated ( standard ) tones , detection of ( rare ) target tones that elicit a behavioral response and processing of novel digital sounds in cortico - hippocampal circuits . auditory n100 m evoked - response latencies for fasd compared to healthy controls were opposite to those reported previously for very young children . significant sex - related differences in evoked - response and oscillatory time frequency measures of brain dynamics were observed for all stimulus types . these results underscore the importance of considering the potential effect of sex when analyzing neurophysiological data in adolescents with fasd and expand the potential set of neurophysiological markers for this disorder .

children exposed to substantial amounts of alcohol in utero display a broad range of morphological and behavioral outcomes , which are collectively referred to as fetal alcohol spectrum disorders ( fasds ) . common to all children on the spectrum are cognitive and behavioral problems that reflect central nervous system dysfunction . little is known , however , about the potential effects of variables such as sex on alcohol - induced brain damage . the goal of the current research was to utilize magnetoencephalography ( meg ) to examine the effect of sex on brain dynamics in adolescents and young adults with fasd during the performance of an auditory oddball task . the stimuli were short trains of 1 khz standard tone bursts ( 80% ) randomly interleaved with 1.5 khz target tone bursts ( 10% ) and novel digital sounds ( 10% ) . participants made motor responses to the target tones . results are reported for 44 individuals ( 18 males and 26 females ) ages 12 through 22 years . nine males and 13 females had a diagnosis of fasd and the remainder were typically - developing age- and sex - matched controls . the main finding was widespread sex - specific differential activation of the frontal , medial and temporal cortex in adolescents with fasd compared to typically developing controls . significant differences in evoked - response and time frequency measures of brain dynamics were observed for all stimulus types in the auditory cortex , inferior frontal sulcus and hippocampus . these results underscore the importance of considering the influence of sex when analyzing neurophysiological data in children with fasd .

Introduction Methods Results Discussion Conclusions

it consists of these phases : filling , congestion , rigidity and full erection ( 1 ) . noteworthy to know is that in most of the patients , maximum psv happens in the first 5 minutes ; moreover , in a minority of patients all the process of changes happen in the first 5 minutes ( 5 ) . for better description of these dynamic changes , we got an idea from the study of fitzgerald al . ( 5 ) and tried to designate dynamic patterns for spectral waveform changes of cavernosal arteries in each patient . in this study , we tried to classify our patients based upon their patterns of changes in a dynamic study and to subsequently better describe their underlying problem . this case series study was conducted in hasheminejad urology center , iran university of medical sciences ( iums ) , from april 2011 till april 2012 . we evaluated 59 men who were referred from a urology clinic for post - ici color doppler investigation of suspected ed . the stages of the test and possible role of the study in their therapeutic plan were described comprehensively for each patient and then a written consent was obtained . the demographic data and medical history including duration of ed , history of diabetes , hypertension , cigarette smoking , drug history and previous interventions for vascular diseases were recorded . one of this study investigators ( gharib , mh . ) performed all examinations with a linear ( 5 - 10 mhz ) probe of esaote technos device ( italy , 2002 ) . the probe was placed over the ventral aspect of the penis and scans were performed in longitudinal and transverse planes before injection of the vasoactive agent . we used papaverine hydrochloride because of the availability and acceptable price . for post - ici assessment , first a maximum dose of 40 mg papaverine was injected into the right corpus covernosum , at the junction between the middle and distal third of the penile dorsal aspect . if maximum psv did not reach 30 cm / s in 5 minutes , further injections of 20 mg doses of papaverine were also performed , up to a maximum total dose of 80 mg . scanning started about one minute after the injection and each of the cavernosal arteries was evaluated continuously thereafter until either erection happened or psv started to decline . parameters such as psv , edv , minimum of resistive index ( ri ) and time to reach maximum psv were recorded . if full erection happened , the patient was under observation and if erection persisted for more 3 hours , the patient was sent to the urologic emergency room for appropriate interventions . based on temporal changes in the waveform of cavernosal arteries , new patterns were defined . patients were classified based on previously known etiologic categories ( i.e. arterial insufficiency , venous leak , mixed type , and normal response ) and also categorized into these new patterns . fifty - nine patients with the mean age of 45.6 13.1 ( 24 to 74 ) years were enrolled into this study . twenty - two cases revealed normal response ( non - organic causes as 37.3% ) , 27 were classified as venous leakage , eight with arterial insufficiency and two were considered as mixed type . the mean time to reach maximum psv was 3.4 0.8 minutes ( median 3 , range 2 - 5 minutes ) in 51 patients without arterial insufficiency . we defined 8 patterns for the temporal changes in cavernosal arterial waveform in our patients ( table 1 ) . for classification , we considered four different aspects in our study : sufficiency of cavernosal arteries [ for judgement of this sufficiency , we considered points such as maximum psv during the study ( cut point of 30 cm / s ) , amount of difference of psv between the two sides ( below or above 10 cm / s ) , acceleration time of each waveform ( cut point of 80 ms ) and pattern of blood filling in the arteries ] competent filling of sinusoidal blood pools [ including qualitative assessment of edv ( considered as satisfactory or not ) and duration of edv rise ( at least one minute ) ] veno - occlusive capability of corpus cavernosum [ even though a clinically assessed full erection is the best determinant . in doppler study , long time persistence of vigorous diastolic flow ( edv more than 5 cm / s ) would be the indicator ] . finally , how long did it take the study to be finished ( below or above 5 minutes ) . we defined a psv level more than 40 cm / sec as a requisite to consider the patient as having venous leak with no arterial component based on benson et al . those patients with a psv between 30 and 40 who did not elicit erection were placed in category 2 under the label of mixed type . patterns 3 , 4 and 5 denote to previously known venous leak group and patterns 6 , 7 and 8 are patients with normal response . table 2 shows the patient classification based on various patterns of arterial spectral waveform changes . among all , 8 patients completed all phases of erection in the first 5 minutes ( one with pattern 3 and 7 with pattern 6 ) . pattern 5 was considered as the common pattern of venous leak ; while patterns 3 and 4 were considered as the uncommon group . in our study , six patients demonstrated the uncommon patterns of venous leak ( 22.2% of all patients with venous leak ) . the mean of psv was not different between these two groups ( 57.7 vs. 52.5 cm / s , p = 0.38 ) . mean age and minimum recorded ri were higher in the uncommon group , although they did not show statistical significance ( p = 0.14 and 0.22 , respectively ) . hypertension was more prevalent in the uncommon pattern of venous leak ( p = 0.01 ) . smoking was more prevalent in patients with uncommon patterns ; however , the difference was not statistically significant ( p = 0.29 ) . we detected one patient with micropenis who demonstrated normal pattern of changes in response to papaverine even though with a maximum psv under 30 cm / s . htn , hypertension ; psv , peak systolic velocity ; ri , resistive index . in this study , we investigated continuous assessment of cavernosal arterial waveforms of patients with ed in comparison with its routine doppler evaluation . the conventional method of post ici of papaverine color doppler study includes recording psv and edv values in the cavernosal artery spectral waveform 5 minutes after injection which is repeated every 5 minutes afterward up to 30 minutes ( 1 , 4 ) . we found that in most patients ( 92.2% ) , maximum psv happened before the fifth minute . fitzgerald et al . also showed this finding in a considerable percent of their patients ( 76% ) ( 5 ) . this emphasizes the need for early initial assessment of flow in cavernosal artery after the injection of papaverine . they are filling , tumescence , rigidity and full erection ( 1 , 3 , 4 , 8) . it is obvious that these events will result in a sequence of changes in the waveform of cavernosal artery . a process that can be chased meticulously in a continuous color doppler protocol ( figure 1 ) . conventionally four groups of responses have been defined : arterial insufficiency , venous leak , normal response and a mixed pattern ( 9 ) . for better delineation of dynamic changes during ultrasonography , we got the idea of categorizing waveform pattern changes during continuous assessment from the study conducted by fitzgerald et al . ( 5 ) and defined 8 patterns of changes for arterial spectral waveform . in our classification , we considered subgroups for patients with the uncommon pattern of venous leak and those with normal response based on the response within the first 5 minutes after injection or thereafter ( patterns 3 and 4 ; and patterns 6 and 7 respectively ) . the left column of the image shows tumescent phase in this patient 2 minutes after injection . in the middle column , finally , the right column depicts waveforms in the rigidity phase in the 6th minute . we noticed that all phases of the response to papaverine occurred within the first 5 minutes in 13.8% of our patients ( 1 with pattern 3 and 7 with pattern 6 ) . in conventional practice , for patients with pattern 3 , we might need to repeat the injection or just judge based on the clinical fact that erection has not happened . systolic velocity starts to decline and the arterial system , especially helicine arterioles become progressively less visible ( 4 ) . so here , we were not able to designate a normal response based on the findings of the study and just the occurrence of full erection would be the clue for our normal reports . these findings again clarify the importance of careful observation of changes both continuously and from the early beginning . we used to designate 4 groups to our patients based upon findings in the conventional study . in fact in the conventional study , the sufficiency of the arterial system and veno - occlusive mechanisms of corpus cavernosum are the mainstay of classification ; however , we think that one more aspect should be delicately followed in the process of erection , and that is the appropriate reaction of sinusoidal blood pools in each cc . an important outcome of this dynamic study is distinction between patients formerly designated as having venous leak . normally , a marked increase in psv should result in concomitant significant rise in the diastolic blood flow . we believe that patterns 3 and 4 are related to a more decreased amount of trabecular smooth muscles and/or a change in the fibroelastic composition of cc , what we considered as the competency of filling of sinusoidal blood pools or in other words , effective congestion . consequently , in color doppler study , the diastolic flow will not rise to a favorable amount for an acceptable duration ( figure 2 ) . these patients , although few ( 6 patients in this study ) , seem to have more aggravated problems and would not have a satisfactory response to common medications used for venous leak and should be directed for prosthesis placement . the meanage and the lowest recorded ri are higher in this group of venous leak , which we labeled arbitrarily as the uncommon group , compared to the common group ( 54.5 vs. 46.3 and 77.7 vs. 74.3 , respectively ) . although possibly due to the small number of patients , they did not show statistical significance ( p value 0.14 and 0.22 , respectively ) . the probable extensive changes in tissue texture of patients with uncommon venous leak would result in a lesser degree of diastolic flow compared to the common pattern . as the patient grows older , the ratio of collagen type 3 ( the elastic one ) counts down and collagen type 1 gradually replaces it . moreover , the content of trabecular smooth muscle also decreases up to 35% ( 1 ) . hypertension and smoking have been introduced as other important factors involved in the extent of changes in the tissue texture of cc ( 1 ) . however , in our study the prevalence of smoking was still not statistically significant in the uncommon venous leak group ( p = 0.29 ) . we think that the amount and duration of smoking ( quantified in pack - year ) may alter the pattern of response in patients with venous leak . as the pack - year of smoking inflates , we had one patient that showed erection with psv values below 30 cm / sec . the amount of blood flow directed to cc depends on the volume of recipient sinusoidal blood pools . it is obvious that in a patient with micropenis , a lesser amount of flow is needed to result in erection and the maximum psv ( one important determinant of flow ) would be lower compared to other normal responders with a normal - sized penis , even below the required post injection psv of more than 30 cm / s . while , in a continuous study , we can follow the normal sequence of changes in cc and easily denote that the patient has no vascular problem . in conclusion , we highlight a considerable role of early and continuous evaluation started one minute after ici for better description of underlying pathologies of ed especially in patients with venous leak etiology . this study was just a case series to obtain a general concept about the benefits of a dynamic study . the patterns described here are just those seen in these 59 cases . in further studies with a larger sample size , it may be possible to declare new patterns or more sharply elucidate the characteristics of the aforementioned groups . the two left columns are waveforms of a patient with the common pattern of venous leak ( pattern 5 ) in the 3rd and 8th minutes , respectively . the two right columns are for a patient with an uncommon pattern of venous leak ( pattern 4 ) in approximately similar times . note the prominent diastolic flow ( edv = 19cm / s ) in the left side patient , while the diastolic flow in the right side patient is not as much vigorous ( edv = 8 cm / s ) throughout the dynamic study .

background : erection is a dynamic multi - stage neurovascular phenomenon consisting of 4 phases . conventional protocol of color doppler study can easily overlook these ongoing dynamic events.objectives:here , we tried to designate patterns for these dynamic spectral waveform changes of cavernosal arteries in patients with erectile dysfunction and subsequently better describe the extent of their underlying problem.patients and methods : we evaluated 59 men who were referred for post - intracavernosal injection ( ici ) color doppler investigation of suspected erectile dysfunction ( ed ) . the demographic data and medical history were recorded . afterwards , first scan injection was done . then scanning of cavernosal arteries was started about one minute after the injection and was continued thereafter . for better description of temporal changes in the waveform of cavernosal arteries , new patterns were defined and used . patients were also classified based on previously known etiologic categories ( i.e. arterial insufficiency , venous leak , mixed type , and normal response).results : the mean age was 45.6 13.1 ( 24 to 74 ) years . twenty - two were normal responders [ considered as non - organic causes ( 37.3% of all patients ) ] , 27 were classified as venous leakage , eight had arterial insufficiency and two were mixed type . maximum psv occurred before the fifth minute in 47 patients ( 92.2% ) . eight patients completed all phases of erection in the first 5 minutes . we defined 8 patterns for the temporal changes in cavernosal arterial waveform . pattern 5 was the most common pattern of venous leak ; while , patterns 3 and 4 were considered as the uncommon group . six patients demonstrated the uncommon patterns of venous leak ( 22.2% ) . hypertension was more prevalent in the uncommon pattern of venous leak.conclusions:we highlight the considerable role of continuous evaluation starting one minute after intra cavernosal with ici injection of the vasoactive agent for better description of the underlying pathologies of ed especially in patients with venous leak etiology .

1. Background 2. Objectives 3. Patients and Methods 4. Results 5. Discussion

crohn 's disease ( cd ) is an autoimmune inflammatory disorder that may involve different sites along the gastrointestinal tract . the disease tends to be more severe and widespread in children and young adults [ 1 , 2 ] . during the last 2 decades , the incidence of cd in childhood has considerably increased [ 2 , 3 ] . pulmonary involvement in cd is well described , and though it is rarely reported in pediatric patients , it may be more common than previously reported . pulmonary cd can be latent or symptomatic , with symptoms manifesting before , during or after the diagnosis of cd . down syndrome ( ds ) has been associated with increased frequency of malignancies , autoimmune diseases and infections . it has been hypothesized that this is due to abnormal precocious aging . however , recent evidence suggests that it is more likely that the immune system in ds is deficient from the very beginning , with immune dysregulation causing a tendency towards autoimmune diseases . in addition to other congenital defects , individuals with ds are also more likely to have structural and functional disorders of the gastrointestinal tract . associations between cd and ds have been reported , though very rarely [ 9 , 10 , 11 , 12 , 13 ] . in our search of the literature , we did not find any reported case of ds with pulmonary cd to date . a 5-year - old girl with known ds and a history of chronic intermittent abdominal pain presented to the emergency department with worsening symptoms . her abdominal pain has previously been attributed to underlying chronic constipation and possible irritable bowel syndrome . workup for her abdominal pain included serologic testing for celiac disease , which showed increased anti - gliadin iga and igg but normal tissue transglutaminase iga . on presentation to the emergency department , an abdominal x - ray was done due to suspicion of constipation , and a chest x - ray confirmed left lower lobe pneumonia . she then returned to the hospital due to persistent fevers and abdominal pain and was admitted for 5 days for intravenous antibiotics . on serial chest x - rays during the hospitalization and after discharge , she seemed to have persistent left - sided and perhilar infiltrates that remained essentially unchanged in appearance . a pediatric pulmonologist was consulted , who felt that she had no symptoms suggestive of asthma , aspirated foreign body , cystic fibrosis , primary ciliary dyskinesia or immunodeficiency . a chest computed tomography ( ct ) scan was done that showed multiple noncalcified pulmonary nodules bilaterally , mainly peripheral in location . the largest nodule measured 8.0 mm and was in the posterior medial aspect of the superior segment of the left lower lobe adjacent to the pleura . the second largest was 7.0 mm in the right pulmonary apex , and another 2 nodules measuring 4.0 mm were seen in the right upper lobe ( fig . 1 ) . two additional 4.0-mm nodular densities were seen in the posterior periphery of the superior segment of the left lower lobe just caudal to the dominant lesion . there were localized patchy reticular nodular infiltrates in an extreme superior aspect of the superior segment of the left lower lobe and similar extensive infiltrates extending from the suprahilar region on the right side into the right pulmonary apex . lymphocyte subsets , immunoglobulin levels and vaccine responses to tetanus and pneumococcus were done , as well as a neutrophil oxidative burst assay for chronic granulomatous disease . neutrophil function showed 74% activity at 48 h , which was considered a normal response and not compatible with a diagnosis of chronic granulomatous disease . her immunoglobulin assay showed an igg level of 1,130 mg / dl ( range 2261,870 ) , an iga level of 218 mg / dl ( range 3155 ) and an igm level of 45 mg / dl ( range 12219 ) . her tetanus antibody level was 0.97 iu / ml , which was considered a normal immunization response . results showed a cd19 b - cell count of 127 cells/l , a cd3 t - cell count of 1,033 cells/l , a cd4 cell count of 605 cells/l , a cd8 cell count of 395 cells/l , and a cd56/16 natural killer cell count of 99 cells/l ; the cd4/cd8 ratio was normal at 1.5 . after a relatively extensive infectious workup , she underwent a bronchoscopy and ct - guided needle biopsy of the lung nodules . the branching pattern also was normal ; however , the right upper lobe bronchus gave only 2 branches compared with the usual 3 branches . broncheoalveolar lavage ( bal ) analysis was performed , and specimens were sent for bacterial , fungal and mycobacterial culture analysis as well as for cytology . no acid - fast bacilli were seen on fluorochrome stain , and culture results showed no organisms even after 56 days of incubation . ct - guided core lung biopsies showed extensive necrosis with surrounding palisading histiocytes , fibrosis and chronic inflammation ( fig . 2 ) . acid - fast bacillus and grocott 's methenamine silver stains were negative for any organisms . these findings , along with the history of chronic abdominal pain , raised concern for primary cd with secondary involvement of the lungs . the esophagogastroduodenoscopy showed localized mild mucosal abnormality characterized by congestion , erosion and inflammation in the 3rd part of the duodenum . a benign - appearing diffuse , severe mucosal abnormality characterized by congestion , discoloration , erythema , erosion , friability , granularity , inflammation and nodularity was found in the entire examined stomach . on colonoscopy , patchy , mild inflammation characterized by congestion ( edema ) , erythema and aphthous ulceration was found in the cecum , ascending colon , transverse colon and descending colon . normal mucosa was seen in the rectum . the gastric biopsy exhibited moderate to focally marked expansion of the lamina propria by a mixed leukocytic population . also present were scattered areas of neutrophils , some of which were present in the surface epithelium . a giemsa stain was performed and demonstrated the presence of bacteria ( these bacteria , however , did not have the usual morphological features of helicobacter ) . both the cecum and ascending colon biopsies exhibited cryptitis as well as eosinophilia of the lamina propria . also present were focal aggregates of histiocytes ( although well - formed epithelioid granulomas were not observed ) . in contrast , the transverse colon and descending colon biopsies showed similar cryptitis and eosinophilia and , in addition , there were scattered epithelioid granulomas . acid - fast bacillus and grocott 's methenamine silver stains were performed on these specimens , and no organisms were seen . she was then started on mesalamine and later on infliximab and methotrexate . with the start of therapy , to our knowledge , this is the first reported case of pulmonary cd in a child with ds . the natural history of pulmonary cd in the pediatric population is not very well studied . furthermore , since ds has been well known to be associated with increased frequency of malignancies and autoimmune conditions due to immune dysregulation , it is difficult to predict the severity and possible complications in this patient .

crohn 's disease ( cd ) is an autoimmune inflammatory disorder that primarily affects the gastrointestinal tract . it may have pulmonary involvement , which has been rarely reported in pediatric patients . down syndrome ( ds ) has been associated with increased frequency of autoimmune diseases . however , associations between cd and ds have been rarely reported . we present the case of a 5-year - old girl with known ds and a history of chronic intermittent abdominal pain who presented with persistent pneumonia . her workup included a chest computed tomography ( ct ) scan that showed multiple noncalcified pulmonary nodules . an extensive infectious workup was done that was negative . ct - guided needle biopsy of the lung nodules showed necrotizing granulomas . this raised concern for primary cd with extraintestinal pulmonary manifestation . an esophagogastroduodenoscopy and colonoscopy were performed , and colon biopsies showed scattered epithelioid granulomas . based on this information , there was consensus that her lung nodules were secondary to cd . she was started on standard therapy for cd , and her abdominal and respiratory symptoms gradually improved . however , she continues to have mild residual lung calcification and fibrosis . to our knowledge , this is the first reported case of pulmonary cd in a child with ds . the natural history of pulmonary cd in the pediatric population is not very well studied . furthermore , since ds has been well known to be associated with increased frequency of malignancies and autoimmune conditions due to immune dysregulation , it is difficult to predict the severity and possible complications in this patient .

Introduction Case Report Diagnosis Conclusion Statement of Ethics Disclosure Statement

a 28-year - old man who was known to have fhi in the right eye was referred for secondary iol implantation . six years before referral , his right eye had undergone cataract surgery which was complicated by the capsular rupture and vitreous prolapse , for which the patient received complete anterior vitrectomy with removal of all capsular remnants . the patient was left aphakic and was prescribed with aphakic contact lens ; however , he developed contact lens intolerance over time . on presentation , his uncorrected visual acuity was 20/20 in the left eye and counting finger in the right eye which could be corrected to 20/20 with aphakic correction . slit - lamp examination of the right eye revealed diffuse fine keratic precipitates over the entire corneal endothelium and mild iris stromal atrophy with notable heterochromia . advantages and unknown risks of the surgery were thoroughly explained for the patient and he consented to have secondary iol implantation . under general anesthesia , an iris - claw iol ( artisan , ophtec , groningen , the netherlands ) was implanted in right eye through a limbal incision followed by a superior peripheral iridectomy . enclavation of the iol haptics was easily performed ; no intraoperative complication including hyphema was noted . the latter was prescribed as 0.1% betamethasone every 2 hours while awake for 1 week and then four times a day which was tapered within 6 weeks . postoperative follow - up examinations were performed at 1 , 2 , 3 , 5 , and 7 days , then weekly for 1 month , monthly for 3 months , and every 23 months thereafter until 1 year . postoperative course was uneventful with no significant anterior chamber inflammation ( more than 1 + cellular reaction ) or fibrin formation . on the first postoperative day , the examination showed 1 + cellular reaction and pigments in the anterior chamber which disappeared within 2 weeks . no subsequent exacerbation of the intraocular inflammation was observed during 12 months of postoperative follow - up ; therefore , no additional course of steroid was required . occasional cells in the anterior chamber were seen at some visits which were left untreated . one month after surgery , the patient achieved a best - corrected visual acuity of 20/20 in the right eye which was maintained for 12 months of follow - up . the iol remained stable with no subsequent iris atrophy at the enclavation sites , subluxation , or pupil ovalization . furthermore , the patient did not develop any anterior or posterior segment complication including glaucoma , vitreous inflammation , or clinical cystoid macular edema . secondary implantation of iris - claw artisan intraocular lens ( iol ) in an eye with fuchs heterochromic iridocyclitis . during 12 months of postoperative follow - up , no remarkable anterior chamber inflammation was observed in the right eye ( a ) and there were only few deposits on the iol surface ( b ) . the heterochromia in the involved eye is most obvious compared with the normal left eye ( c ) although secondary iol implantation in the ciliary sulcus has been reported to be safe in fhi , angle- and iris - supported iols have been feared because of the possible risk of postoperative uveitis , glaucoma , and hyphema . to the best of our knowledge , there has been no previous report of implantation of iris - claw artisan iols in eyes with fhi . even though our patient only received topical steroids , he did not show any significant postoperative inflammation or fibrinous reaction neither at the early postoperative period nor during 12 months of follow - up . therefore , it may suggest that in eyes with fhi the uveal irritation by iris - claw artisan iols is less than expected and the iol is more tolerable , even though recurrent or chronic anterior chamber inflammations has previously been reported in some eyes with these iols without preexisting uveitis . however , this lack of exacerbated postoperative inflammation in fhi may not be extrapolated to eyes with other more severe forms of uveitis . on the other hand , although fhi - associated iris atrophy in severe cases may theoretically make enclavation more difficult or compromise the long - term stability of an iris - claw iol , neither did develop in our case . therefore , it seems iris - claw iols , which have been shown to be safe in aphakic eyes without uveitis , may be an option in aphakic patients with fhi who do not have capsular support . however , studies on large number of patients with long - term follow up are required to determine the safety of these iols in eyes with uveitis including fhi .

implantation of iris - claw artisan intraocular lens ( iol ) is a surgical option for correction of aphakia ; however , these iols have not been used in eyes with uveitis including fuchs heterochromic iridocyclitis ( fhi ) due to possible risk of severe postoperative intraocular inflammation . in the case reported here , we secondarily implanted an artisan iol in a 28-year - old man with fhi who had aphakia with no capsular support due to a previous complicated cataract surgery . enclavation was easily performed and no intraoperative complication was noted . postoperative course was uneventful with no significant anterior chamber inflammation during 12 months of follow - up . although there were few deposits on the iol surface , the patient achieved a best - corrected visual acuity of 20/20 without developing glaucoma or other complications . therefore , artisan iol may be considered for correction of aphakia in patients with fhi . however , studies on large number of patients are required to evaluate safety of the procedure .

Case Report Discussion

the world health organization ( who ) , in 2012 , indicated there were an estimated 8.6 million new cases of active tb and 1.3 million tb deaths . the world health organization reported saudi arabia as having a moderate tb incidence rate , with 15 for every 100,000 . tb remains an important public health problem in saudi arabia , affecting all age groups and regions , and is associated with higher mortalities among saudis . since pulmonary tb this has become even more important with the development of drug - resistant tb , making effective treatment even more difficult . tuberculosis was accepted as a diagnosis if the sputum culture was positive for mycobacterium tuberculosis ( mtb ) . the interferon alpha release assay ( qft - g ) is a new diagnostic test for latent tuberculosis infection ( ltbi ) . qft - g is similar to the tuberculin skin test ( tst ) , but can not differentiate between ltbi and active tb . however , despite the limitation of qft - g in the diagnosis of active disease , it has been recommended by some investigators and it has been used in the diagnosis of active tuberculosis in the private sector . , using qft - g , was performed for the diagnosis of active tuberculosis in 13 studies , and there were 13 studies on cases with known active tuberculosis . the overall sensitivity of qft - g in the diagnosis of active tuberculosis was 6983% . another meta - analysis by dai y et al . revealed the overall sensitivity and specificity of qft - g in the diagnosis of active tuberculosis to be 85 and 84% . few other studies recommended the use of qft - g for ruling out active tuberculosis , especially in high - income countries where the prevalence of tuberculosis was low . legesse m et al . documented in their study that the sensitivity and specificity of qft - g , using the manufacturer 's cut - off value , was very low in the diagnosis of active tuberculosis in tuberculosis - endemic regions . the qft - g - tb gold kit ( cellestis limited , melbourne , australia ) was approved in 2009 for use in king abdulaziz medical city - riyadh ( kamc - r ) for the diagnosis of latent tb . local saudi guidelines on the management of latent tuberculosis did not recommend using qft - g for the diagnosis of active tuberculosis . the clinical use of qft - g has expanded dramatically in the diagnosis of tuberculosis disease . this expanded use was not based on local studies , which confirmed or refuted such practice in saudi arabia . it was clear that the use of qft - g in the diagnosis of active tuberculosis should be based on the local prevalence of the disease , local data , and many other logistic and resource considerations . the aim of this study was to assess the sensitivity and specificity of the qft - g test in the diagnosis of tuberculosis in patients admitted with pneumonia , when it was ordered to rule out tuberculosis . a retrospective study was conducted at kamc - r saudi arabia from january 2009 to december 2013 . the study included all patients admitted with a diagnosis of pneumonia , and qft - g was ordered to rule out active tuberculosis . all cases with pneumonia or a final diagnosis of tuberculosis , but with no qft - g results available , only patients aged 18 years or older with available qft - g tests were included in the analysis . the qft - g results were divided into three categories : positive , indeterminate , and negative . the procedures for the qft - g test in our hospitals have been explained in detail in our previous published study . the following data were extracted from the hospital records - demographic and clinical characteristics and qft - g results . descriptive statistics such as means and standard deviation , mean sd , were used to describe the age of the patients . frequencies and percentages n(% ) were used to describe the gender and the qft - g test results . the diagnostic performance of the qft - g test was assessed using sensitivity , specificity , and positive / negative predictive values . we used independent sample t - tests to compare the patients ages across the tuberculosis and pneumonia cases . the chi - square tests were used to assess the associations between the demographic characteristics and groups ( tuberculosis and pneumonia cases ) . the percentage of positive qft - g results in each disease group and gender group was assessed by the chi - square tests . we examined whether the age was significantly different between the positive and negative qft - g results of the two groups . statistical analyses were performed using sas 9.2 ( sas institute , cary , nc , usa ) . over the study period , 6907 patients were admitted with diagnoses of pneumonia , and 639 ( 9% ) of them were diagnosed with tuberculosis . the results of qft - g test were available in 368 patients : 142 ( 38.6% ) patients with active tb and 226 ( 61.4% ) patients with pneumonia . table 1 demonstrates the patients demographic and clinical characteristics in relation to the disease status . out of 368 patients , 188 ( 51.1% ) were female and 180 ( 48.9% ) were male . most of the 368 patients were saudis : 363 ( 98.6% ) . in both groups ( tuberculosis and pneumonia ) , the results of the qft - g tests were observed to be negative in 183 cases ( 49.7% ) , positive in 143 cases ( 38.9% ) , and indeterminate in 42 cases ( 11.4% ) . when the 368 patients were classified by the disease status , the qft - g test appeared to have a higher positivity rate among the tuberculosis cases ( 68.3% ) than the pneumonia cases ( 20.4% ) , p - value = 0.001 . the result of the qft - g test was observed to be negative in 33 cases ( 23.2% ) and indeterminate in 12 cases ( 8.5% ) in the tuberculosis group , whereas , the qft - g test was observed to be negative in 150 cases ( 66.4% ) and indeterminate in 30 cases ( 13.3% ) in the pneumonia group [ table 1 and figure 1 ] . the patients ages were significantly higher among the pneumonia group ( 64.4 17.4 , range 19107 years ) than the tuberculosis group ( 54.9 19.4 , range 1892 ) , p - value = 0.001 . there were no differences between males and females across the two groups ( p - value = 0.755 ) . demographic characteristics and quantiferon results in relation to disease status ( n = 368 ) diagnostic accuracy of the quantiferon test among cases with pneumonia or tuberculosis table 2 shows the patients demographic and disease status in relation to qft - g results , excluding 42 patients with indeterminate results . the 42 patients who had indeterminate results were excluded because no follow - up qft - g test was performed on these patients . the mean age for the negative qft - g ( n = 183 ) results was shown to be 62.50 18.0 years , which was significantly higher than that for the positive qft - g ( n = 143 ) results ( 57.7 19.7 years ) , p - value = 0.021 . there was no significant difference between the positive qft - g results comparing males ( 42.9% ) and females ( 44.7% ) , p - value = 0.749 . the positive results of qft - g were higher in patients with tuberculosis disease than in patients with pneumonia disease ( 74.6 vs. 23.5% , p - value = 0.001 ) . table 3 shows the sensitivity , specificity , and positive / negative predictive values of the qft - g test . the sensitivity of the qft - g test was 74.6% [ 95% ci : 66.09 to 81.65% ] , while its specificity was 76.53% [ 95% ci : 69.85 to 82.15% ] . the positive predictive value of the qft - g test was 67.83% [ 95% ci : 59.43% , 75.25% ] and the negative predictive value was 81.97% [ 95% ci : 75.46% , 87.10% ] . among 130 tuberculosis cases , the false negative rate was 25.4% ( 33/130 tuberculosis cases ) . among 196 pneumonia cases , the false positive of the qft - g test was 23.5% ( 46/196 pneumonia cases ) . furthermore , figure 2 shows how well the qft - g test separates the two groups , tuberculosis and pneumonia , with an area under the curve of 75.60% [ 95% ci : 70.1081.10% ] . demographic characteristics in relation to quantiferon results , excluding 42 patients with indeterminate results ( n = 326 ) diagnostic accuracy of the qft - g test , excluding 42 indeterminate results ( n = 326 ) receiver operating characteristic ( roc ) curve of qft - g test early diagnosis of active tuberculosis is essential to ensure early treatment and prevention of infection . sputum culture with microbiological confirmation remains the gold standard for the clinical diagnosis of active tb , but requires a long follow - up . qft - g held a promise to provide a rapid and reliable test to diagnose active tb . in this study , the sensitivity of qft - g for the diagnosis of tuberculosis was 74.6% and specificity was 76.53% . however , several studies subsequently showed only a modest sensitivity of the qft - g test to detect tb , although it performed better than tuberculin skin test ( tst ) . lai cc et al . reported 66% sensitivity and specificity ( 76% ) , which was comparable to our findings . in their meta - analysis of 26,680 participants , rangaka et al . concluded that qft - g did not have high accuracy for the prediction of active tuberculosis , although the use of qft - g in high - risk populations might reduce the number of people considered for preventive treatment . equally , the qft - g has suboptimal accuracy for confirming or ruling active tuberculosis disease . in a meta - analysis comparing commercial interferon - gamma release assays for detecting active tb , the authors found that commercial qft - gs were superior to tsts for detecting confirmed active tb disease , especially when performed in developed countries . the overall pooled sensitivity and specificity of quantiferon tb gold was 6985% and 5184% , which was similar to our study . a study from china reported a higher overall sensitivity of 81.4% and up to 86.6% in smear - positive cases , while having a specificity of 97% , which was comparable to our findings . another study from indonesia revealed the sensitivity of qft - g to be 88.7% in active tb cases , which was higher than our study . our study had three advantages : first it was from an intermediate tb - prevalent region and included large numbers of culture - positive , confirmed , tb cases , therefore , it was probably a better representation of the region , with an intermediate prevalence of tb compared to other studies . pre - test probability is a very important factor for a better interpretation of a positive qft - g test in cases of active tb suspicion . interferon- release assays can be used more reliably in excluding tb , particularly extrapulmonary , in patients originating from areas of low tuberculosis incidence . other factors influencing discordant results of the qft - g test in patients with active tb include older age , lower lymphocyte count , total protein and albumin levels , and high crp levels . in both groups , the elderly patients were more likely to have negative results of qft - g ( 62.50 18.0 years ) than positive results of qft - g ( 57.7 19.7 years ) . nevertheless , no gender differences between pneumonia and tuberculosis groups were found in our study . there was some evidence that the qft - g response could be diminished in cases with advanced tb . the advantage of our study was having a large number of patients with a confirmed culture positive tuberculosis the major limitations included the fact that it was a retrospective study with known limitations . we did not include tst as an additional test to the qft - g and we did not include pre - test probability of active tuberculosis when ordering the qft - g test . the indeterminate results of the qft - g tests were not common in tuberculosis ( 8.5% ) compared to pneumonia ( 13.2% ) , which was similar to other studies . it is imperative to indicate that there are two commercial qft - g tests ( tb gold and tb spot ) . they differ in their positive and negative predictive values , and the concordance of the two tests is modest in both immunocompetent and immunocompromised patients , for both latent and active tb . although our findings that quantiferon tb gold can be used as an adjunct tool in the diagnosis of active tb , it certainly can not be used solely and indiscriminately , separate from other clinical epidemiological and radiological factors , and the pre - test probability remains very important for the interpretation of these tests .

background : the utility of quantiferon - tb gold in - tube ( qft - g ) test in the diagnosis of tuberculosis disease has been validated in high and low tuberculosis - prevalent ( tb ) countries . aim : the aim of this study is to assess the performance of the qft - g test in the diagnosis of tuberculosis disease among tuberculosis patients in an intermediate prevalent country.setting and design : a retrospective study at the king abdulaziz medical city - riyadh ( kamc - r)materials and methods : we retrospectively reviewed all the patients with a diagnosis of pneumonia , including tuberculosis , admitted to kamc - r between 1 january 2009 and 31 december 2013 . we included only patients with an available result of the qft - g test . a total of 142 tuberculosis cases and 226 pneumonia cases were studied , to assess the utility of the qft - g test in diagnosing tuberculosis cases.results:among the tuberculosis ( n = 142 ) cases , the qft - g tested positive in 68.3% , negative in 23.2% , and indeterminate in 12 cases ( 8.5% ) . of the 226 pneumonia cases , the qft - g tested positive in only 20.4% , while a majority of 66.4% tested negative , with 30 cases ( 13.3% ) being indeterminate . when we excluded 42 patients with indeterminate results , the qft - g test achieved a sensitivity of 74.6% [ 95% ci : 66.09 to 81.65% ] and specificity of 76.53 % [ 95% ci : 69.85 to 82.15% ] in the diagnosis of tuberculosis cases.conclusions:this study concludes that the qft - g test is a useful tool for detecting tuberculosis disease when used as an adjunct tool for the diagnosis of active tb cases . it certainly can not be used solely and indiscriminately , separate from other clinical and radiological information , in the diagnosis of active tuberculosis cases .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION

there is considerable interest in understanding the role of vitamin d in cancer in general and in ovarian cancer in particular . experimental studies have shown that vitamin d administration reduces proliferation and promotes apoptosis in ovarian cancer cell lines and animal models [ 16 ] . ovarian cancer incidence and mortality rates are higher in northern latitudes , where sun exposure , which is required for the initiation of vitamin d synthesis in the skin , is lower [ 710 ] . an inverse association between dietary vitamin d intake and risk of ovarian cancer has been reported in one epidemiologic study , although others have not supported this finding [ 1216 ] . studies of the effect of dietary vitamin d intake are limited because estimation of dietary vitamin d intake does not capture cutaneous production of vitamin d. thus , circulating vitamin d , which reflects both cutaneous production and dietary / supplement intake [ 1720 ] , is considered the best indicator of overall vitamin d status . however , its concentration is about 1000 times lower than that of 25(oh)d in circulation , due to its shorter half - life and local production in target tissues , such as the ovaries [ 21 , 22 ] . thus , 25(oh)d is thought to better reflect overall vitamin d status than 1,25(oh)2 d [ 23 , 24 ] . to date , only one epidemiologic study has examined the relationship between prediagnostic levels of vitamin d and risk of ovarian cancer . did not find an association of ovarian cancer risk with the 25(oh)d or 1,25-dihydroxyvitamin d ( 1,25(oh)2d ) plasma levels . polymorphisms in the vdr gene may influence the ability of 1,25(oh)2d to activate vitamin d target genes , including those involved in growth regulation and apoptosis . in a previous manuscript , we reported an overall null association between four common polymorphisms in the vdr gene ( bsm1 , apa1 , taq1 , and fok1 ) and risk of ovarian cancer , although a retrospective multiethnic study of 313 cases and 574 controls and a large pooled analysis including 1473 cases and 2006 controls from four studies ( one retrospective case - control study and three case - control studies nested in prospective cohorts ) found an association with the fok1 snp among caucasian women . mixed results for this and other vdr snps may be due to chance findings or limited power to detect associations . it is also possible that genetic variants influence ovarian cancer risk differently , depending on an individual 's vitamin d status . the objective of the present study was to examine the relationship between circulating levels of 25(oh)d and risk of invasive epithelial ovarian cancer and to assess the combined effect of circulating 25(oh)d and vdr polymorphisms on ovarian cancer risk . descriptions of the university of ume northern sweden health and disease study ( nshds ) and the new york university women 's health study ( nyuwhs ) have been provided previously [ 2931 ] . briefly , since 1985 the nshds has enrolled approximately 53 756 women aged 3065 through local health promotion intervention programs in northern sweden . the nyuwhs enrolled 14 274 healthy women aged 3465 years at a breast cancer screening center in new york city between 1985 and 1991 . each study cohort collected information about medical history , reproductive history , family history of cancer , medications , smoking history , and diet during enrollment and/or followup . blood collected at enrollment and any subsequent visits was processed according to standardized procedures within each cohort . in the nshds cohort , blood was collected , centrifuged , and plasma aliquots were frozen at 80c and transferred within 1 week to a 80c central storage facility ( the northern sweden medical research biobank ) . in the nyuwhs cohort , blood was drawn , collection tubes were kept covered at room temperature ( 2125c ) for 15 minutes , then at 4c for 60 minutes to allow clot retraction , and then centrifuged for 25 minutes . after centrifugation , serum samples were divided into aliquots and immediately stored at 80c at the local site . participants who reported being pregnant or using exogenous hormones within 6 months of enrollment were not eligible for the nyuwhs cohort or for case - control selection from nshds . in the nshds , cohort linkages to regional and national cancer registries and to all - cause mortality registries were used to capture cases of incident invasive epithelial ovarian cancer . in the nyuwhs cohort , case ascertainment was achieved through self report on followup questionnaires and through linkages with state tumor registries in new york , new jersey , and florida . medical records were obtained to verify reported events . as of november 1 , 2005 , a total of 192 invasive ovarian cancer cases ( 107 from the nshds and 85 from the nyuwhs ) had been identified . twenty - two nonepithelial ovarian cancer cases ( 8 from the nshds and 14 from the nyuwhs ) were excluded from this study because they did not meet the criteria of being invasive epithelial ovarian cancer . for the current study , there were a total of 170 invasive eoc cases ( 71 from nyuwhs and 99 from nshds ) . however , two cases from the nshds cohort had only dna available for analysis , and were only included in the main vdr genotyping analysis . for each case , two controls were randomly selected from cohort members who were alive and free of cancer at the time of diagnosis of the case . controls were also matched to the case on cohort ( nyuwhs or nshds ) , age at entry ( 6 months ) and date of blood donation ( 15 days ) . seventeen cases from the nyuwhs cohort had only one eligible matched control because 10 controls had a complete bilateral oophorectomy before the diagnosis date of the case and seven cases could not be sufficiently closely matched to a second control on date of blood donation ( strict matching is required to control for seasonal effects of vitamin d ) . of the potential 323 eligible controls in total ( 198 from the nshds , 125 from the nyuwhs ) , seven were excluded from the nsdhs because either the control or matching case did not have plasma available . the institutional review boards of new york university school of medicine and the regional ethical committee of the university of ume , sweden , and the swedish data inspection board reviewed and approved this study . serum 25(oh)d was measured at the university of ume using a gamma - b 25-hydroxy vitamin d radioimmunoassay ( immunodiagnostic systems ( ids ) , inc . ) . acetonitrile extraction of 25(oh)d was followed by incubation with radioionidated tracers and sheep antibodies to 25(oh)d . samples from each cohort and case - control set were assayed together in the same laboratory batch . quality controls and study samples were distributed randomly throughout the batches and the laboratory personnel were blinded to the samples ' case - control status . the intra- and interbatch coefficients of variation were 17.7% and 24.6% for nshds , respectively . for nyuwhs , the intra- and interbatch coefficients of variation were 16.6% and 16.2% , respectively . 25(oh)d values were log 2 transformed to reduce departures from the normal distribution ( the log 2 transformation is useful for estimating odds ratios associated with a doubling in vitamin d levels ) . linear regression and anova were used to test whether 25(oh)d levels differed according to baseline characteristics . conditional logistic regression , which allows for the matched design , was used to evaluate the association between serum concentration of 25(oh)d and risk of eoc . because cases were individually matched to controls for laboratory batch and date of sampling ( i.e. , season ) , these variables were controlled for by design when 25(oh)d was modeled as a continuous variable . to create meaningful tertiles of 25(oh)d for categorical analysis , however , the 25(oh)d values needed to be laboratory batch and season , to prevent individuals from being arbitrarily included in a tertile simply on the basis of their season of blood draw or inclusion in a particular batch . the adjustment for laboratory batch was done by first regressing the log - transformed 25(oh)d values on season , age , and bmi ( the three variables that were associated with 25(oh)d ) and computing the residuals within each cohort . we then computed the mean residual for each laboratory batch and subtracted the appropriate batch mean from each individual 's log - transformed vitamin d value to center each batch at the grand mean for each cohort . we then adjusted for seasonal effects by performing a nonparametric local regression ( proc loess , sas ) of 25(oh)d values on day of the year of blood donation and used the residuals to create cohort - specific tertiles . potential confounders , specifically reproductive history ( parity , number of full - term pregnancies , and age at first full - term pregnancy ) , age at menarche , menopausal status at enrollment , history of oral contraceptive use at baseline , body mass index at enrollment , and smoking status at baseline ( never , current , former ) were considered in the logistic regression models . however , the only variables significantly different between cases and controls were parity and oral contraceptive use ( both categorized as ever / never ) . therefore , multivariate models included only these two variables ( age and date of blood donation which were controlled for by the matched design and use of the conditional logistic regression model ) . an indicator variable for sample type ( serum versus plasma ) also was examined as a potential interaction term . we also conducted analyses excluding individuals diagnosed within five years of blood donation , and evaluated the vitamin d - ovarian cancer relationship within histological subtypes , and by stage ( i - ii versus iii - iv ) , grade , bmi ( dichotomous variable < 25 versus 25 ) , oral contraceptive use ( ever versus never ) , and vdr snp genotype ( assuming a codominant model ) . haplotypes were estimated from genotype data using phase version 2.1.1 ( http://www.stat.washington.edu/stephens/phase.html ) and odds ratios for the interaction between having zero , one , or two copies of the haplotype and 25(oh)d levels were determined using conditional logistic regression . we used sas software ( version 9.1 , sas institute , cary , nc ) for all statistical analyses . the characteristics of the study participants from each cohort at baseline have been described previously . the median age at enrollment was 52 and 55 years for nshds and nyuwhs participants , respectively . nshds cases had a median of 4.6 years between blood donation and diagnosis and nyuwhs cases were diagnosed an average of 7.0 years after blood donation . nshds cases were less likely than nshds controls to have ever been pregnant ( 78% versus 89% , p = .01 ) and to have ever taken oral contraceptives ( 33% versus 45% , p = .03 ) . nyuwhs cases and controls were not significantly different with regard to their baseline characteristics . regarding differences between cohorts , nyuwhs controls were more likely than nshds controls to be nulliparous ( 31% versus 11% , p < .0001 ) , more likely to be premenopausal at baseline ( 42% versus 28% , p = .01 ) , less likely to have used oral contraceptives ( 32% versus 45% , p = .03 ) , more likely to have smoked ( 61% versus 43% , p = .01 ) , and had higher 25(oh)d levels ( 45.8 versus 39.4 nmol / l , p = .04 ) . cases and controls did not differ with regard to genotype frequency at any of the four vdr snp sites for either of the cohorts . table 2 shows 25(oh)d by characteristics of controls for the nshds and nyuwhs cohorts . in both cohorts , median 25(oh)d levels were higher in women who were older at enrollment and in women who had lower bmi , and were somewhat higher in women who were ever parous and had used oral contraceptives . however , the two cohorts differed with regard to smoking status : in the nyuwhs , current smokers had higher median 25(oh)d levels ( 50 nmol / l in current versus ~45 nmol / l in former and never smokers ) , while smoking in the nshds showed a somewhat opposite relationship with 25(oh)d ( ~38 nmol / l in current and former versus 40 nmol / l in never smokers ) . 25(oh)d was only modestly related to vdr genotype in the nshds cohort at the bsm1 ( p = .16 ) and taq1 ( p = .19 ) loci ( table 3 ) . in both cohorts , women with two copies of the bat haplotype ( associated with the bsm1 g , apa1 g , and taq1 t allele combination ) had higher levels of circulating 25(oh)d , although the tests for trend were not statistically significant ( table 3 ) . we did not observe an overall association between vitamin d and ovarian cancer when 25(oh)d was modeled on the continuous ( multivariate adjusted or for a doubling in vitamin d levels = 1.1 , 95% ci : 0.71.7 ) or categorical scale ( table 4 ) . there was some evidence of interaction between 25(oh)d and cohort ( p = .07 ) , though cohort - specific odds ratios do not support an association with risk in either cohort ( table 4 ) . the lack of association between vitamin d and ovarian cancer remained after controlling for parity and oral contraceptive use . we did not observe any significant differences in the relationship between 25(oh)d and ovarian cancer by season of blood collection , bmi ( < 25 versus 25 kg / m ) , menopausal status at enrollment , vdr snp genotype or haplotype , tumor stage ( i - ii versus iii - iv ) , grade , or histological subtype ( serous versus mucinous , clear cell , and endometriod ) ( data not shown ) . odds ratios for 25(oh)d and risk of ovarian cancer did not change appreciably in analyses restricted to 74 matched sets in which cases were diagnosed five or more years after blood donation ( or for the highest versus lowest tertile = 0.9 , 95% ci : 0.461.72 ) . in the current study , we did not observe an association between circulating levels of 25(oh)d and risk of epithelial ovarian cancer . the lack of an association remained after controlling for potential confounders , excluding cases diagnosed within 5 years of blood donation , and considering subgroups defined by genetic variation in the vdr , tumor characteristics ( i.e. , stage , grade , and histological subtype ) , menopausal status , and bmi . initial support for a protective role for vitamin d was provided by ecological studies showing an inverse association between uv - b exposure and ovarian cancer incidence or mortality rates [ 710 ] . however , research conducted with this type of study design can not elucidate the temporal association between exposure and disease . case - control and cohort studies of dietary vitamin d intake and risk of ovarian cancer have been inconsistent [ 1116 ] . the results of our study are in agreement with the overall results of tworoger et al . , the only other prospective study of ovarian cancer to report on circulating 25(oh)d to date . our study similarly found that the lack of association between serum 25(oh)d and risk of ovarian cancer did not differ by vdr genotype . however , tworoger et al . found an inverse association for 25(oh)d among women with bmi 25 kg / m , which was not observed in the current study . consistent with previous studies [ 3337 ] , higher bmi was associated with lower circulating 25(oh)d in both cohorts . vitamin d is fat - soluble and studies in obese persons and mice have shown increased storage and decreased bioavailability of vitamin d in fat cells [ 38 , 39 ] . we also observed that parity was associated with higher 25(oh)d ; which is in agreement with a similar observation in the plco cancer screening trial . contrary to some previous reports [ 37 , 40 , 41 ] , we observed a positive relationship between age and 25(oh)d , which showed increased levels of vitamin d in the 5060 year age group as compared with younger women . this may be due to an increased intake of calcium and vitamin d - rich foods and supplements around the time of menopause in an effort to prevent or treat osteoporosis . oral contraceptive use was associated with higher median 25(oh)d levels in our study ; previous studies have found a similar relationship in current oc users [ 17 , 42 , 43 ] . we also found that the bsm1 g , apa1 g , and taq1 t haplotype , in the vdr gene was modestly associated with higher 25(oh)d . publications on the relationship between vdr genotype and levels of 25(oh)d have been fairly inconsistent . in the physicians health study cohort , the bsm1 genotype was not related to total 25(oh)d levels , although the bb genotype was associated with higher index of free 25(oh)d and with higher 1,25(oh)2d levels in older men . the bb genotype was also associated with higher 25(oh)d in a small finnish study ( n = 93 ) that collected all blood samples in the winter when skin synthesis of vitamin d is very low . however , a large study of 2845 women found no association between any vdr snps genotype and 25(oh)d . individuals with two copies of the bat haplotype ( bsm1 g , apa1 t , and taq1 t ) had lower levels of 25(oh)d than individuals with 0 or 1 copy ( p - trend = .09 ) . individuals without any copies of bat ( bsm1 g , apa1 g , and taq1 t ) in the current study ( which would include all individuals with two copies of the bat haplotype ) had lower 25(oh)d levels , thus providing indirect support for the previous finding . this study limitations include the use of only one sample to determine each participant 's 25(oh)d status . however , in a preliminary reproducibility study of 25(oh)d among 16 nyuwhs participants with at least 3 annual visits , the intraclass correlation coefficient was quite high ( 0.71 ) , suggesting stability of this metabolite from visit to visit , which has been observed by others [ 47 , 48 ] . the relatively high coefficient of variation for the 25(oh)d assay adds random error to the measurements and may have attenuated the association . although we had sufficient sample size to detect small differences between cases and controls ( a priori , we had 80% power to detect a mean difference of 6 nmol / l between cases and controls ) , we had limited ability to explore interactions . previous studies have demonstrated that vitamin d deficiency is more common in europe than the united states , and that in the united states , the latitude of residence is inversely associated with vitamin d ( reviewed in ) . we anticipated that the ranges of 25(oh)d values in the new york and northern sweden populations would be lower than those reported from lower latitudes [ 50 , 51 ] . in the highest tertile , nmol / l for nyuwhs and 51.6 nmol / l for nshds ; somewhat lower than the 75 nmol / l , that is , considered to be optimal for multiple health outcomes . nmol / l , thus we can not rule out the possibility that women with very high 25(oh)d levels may have a reduced risk of ovarian cancer . strengths of the study include the use of samples collected before diagnosis , limiting the potential for existing disease to influence vitamin d levels , the use of circulating 25(oh)d as a composite measure of vitamin d overall status , careful consideration of seasonal effects , and the use of a nested case - control design , which helps ensure that the controls are comparable to the cases . in conclusion , our findings do not provide support for the hypothesis that circulating vitamin d levels are associated with risk of invasive epithelial ovarian cancer later in life . larger studies are needed to evaluate gene - environment interactions and potential subgroups which may benefit from vitamin d chemoprevention .

we conducted a nested case - control study within two prospective cohorts , the new york university women 's health study and the northern sweden health and disease study , to examine the association between prediagnostic circulating levels of 25-hydroxy vitamin d ( 25(oh)d ) and the risk of subsequent invasive epithelial ovarian cancer ( eoc ) . the 25(oh)d levels were measured in serum or plasma from 170 incident cases of eoc and 373 matched controls . overall , circulating 25(oh)d levels were not associated with the risk of eoc in combined cohort analysis : adjusted or for the top tertile versus the reference tertile , 1.09 ( 95% ci , 0.592.01 ) . in addition , there was no evidence of an interaction effect between vdr snp genotype or haplotype and circulating 25(oh)d levels in relation to ovarian cancer risk , although more complex gene - environment interactions may exist .

1. Introduction 2. Methods 3. Results 4. Discussion

for a century , the cardinal features of alzheimer 's disease ( ad ) , amyloid plaques and neurofibrillary tangles , were thought to underlie this chronic neurological disorder . however , based on the evidence accumulated over the past ten to fifteen years , the toxicity of these lesions has been questioned . instead , the emerging soluble aggregation - intermediate forms of amyloid - beta ( a ) and tau proteins , which compose plaques and tangles , are now believed to underlie the synaptic and neuronal losses observed in ad . studies focusing on oligomeric a assemblies [ 14 ] have paved the way for other amyloid proteins including tau , alpha - synuclein [ 68 ] , and the prion protein prp in the field of neurodegenerative disorders . this principle simply revolutionized our understanding of ad , parkinson 's disease , frontotemporal dementias , and prion diseases , opening new avenues for therapeutic strategies . in what might seem like an all rosy affair , this paradigm shift also contributed to complicating even more the putative sequence of biological events responsible for these diseases . in ad , the classical view of the amyloid hypothesis postulated that amyloid plaques are altering the physiological function of neurons , which in turn disrupts tau biology leading to the demise of the cell . the modern view of the amyloid hypothesis suggests the involvement of a multitude of endogenous bioactive a molecules that include a dimers , trimers , a*56 , annular protofibrils , and amyloid plaques , as opposed to a single culprit ( i.e. , plaques ) . this notion appears to be consistent with the myriad cell surface receptors and signaling pathways that have been described as specifically activated by putative endogenous soluble a oligomers . if this scenario was not entangled enough , numerous studies aiming at elucidating the function of oligomeric a ( oa ) use oligomeric preparations of synthetic a peptides whose folding conformation and posttranslational modifications might not accurately reflect to these found in biologically relevant systems ( i.e. , brain , cerebrospinal fluid , blood , and primary neurons ) . in the end , this increased complexity of the problem coupled with a lack of adequate experimental descriptions of the oa used and specific detection tools ( e.g. , antibodies specific to a single a assembly ) renders interpretation and comparison of the observed phenomena between different research groups arduous and impedes on our progress to better understand the role of a oligomers in ad . a clear example of this issue plaguing our field is illustrated by the controversial debate surrounding the role of the cellular form of the prion protein ( prp ) in mediating the deleterious effects of oligomeric a. in 2009 , lauren and colleagues reported that prp was acting as a receptor for synthetic a oligomers also called a-derived diffusible ligands ( addls ) [ 13 , 14 ] . addls have been characterized by denaturing electrophoresis ( sds - page ) , transmission electron microscopy ( tem ) and size - exclusion chromatography ( sec ) coupled with static light scattering ( sls ) , but each technique generated inconsistent and contradicting results . first , addls ran as an undefined smear ranging from ~25 to 200 kda using sds - page followed by western blotting with the sole 6e10 antibody detecting a116 . additional bands were detected as putative monomers , trimmers , and tetramers in the addl preparation but since these same immunoreactive bands were also detected in freshly resuspended synthetic a peptides , they are likely a result of the presence of sds in the experimental conditions . tem revealed that addls contained spheroidal structures of various sizes ; the most abundant form appeared to correspond to 5 - 6 nm spheroids . it is important to note that short filamentous structures were also clearly visible possibly corresponding to protofibrils . finally , liquid phase chromatography coupled with sls revealed the presence of only two elution peaks under nondenaturing conditions , a broad trailing peak detected shortly after the void volume containing a molecules of ~500 kda mass and a well - defined sharp peak corresponding to monomeric a peptides . the authors concluded that the preparation of addls used was approximately made of an assembly composed of 50 to 100 a monomers . based on the aforementioned data , it seems reasonable to conclude that these addls are not stable under denaturing conditions as previously reported and that the exact composition of the synthetic a oligomers used remains inconclusive . despite the apparent inconsistency of the observations characterizing the oa used in this study , prp appeared to be necessary to mediate the inhibition of long - term potentiation ( ltp ) induced by oa . as expected , this study stimulated several independent groups to reproduce these findings using various sources and preparations of a [ 1720 ] . a team led by gianluigi forloni first reported that prp was not required to mediate the cognitive impairments induced by synthetic a oligomers . synthetic a peptides were prepared to generate addls following the same groundwork established by william klein and his colleagues at northwestern university [ 13 , 21 ] . analyses using atomic force microscopy ( afm ) and sec defined the addls and obtained and confirmed the presence of mixed structural species ( i.e. , spherical assemblies and protofibrils ) by afm and the presence of two elution peaks following sec ( a sharp peak close to or within the void volume and a smaller peak containing putative a monomers ) . while these elements could suggest at first glance that the addls generated at yale and at the mario negri institute are similar , it bears to mention here that the columns used in both studies greatly differed ( a sequential connection of superdex 200 , superdex 75 , and superdex peptide , 10/30 , hr sec columns for the yale group and a single superdex 75 column for the italian group ) raising the possibility that in fact both addl preparations were different . to further demonstrate the involvement of prp in a-induced deficits , the role of prp was examined in middle - aged appps1e9 transgenic mice used to model alzheimer 's disease expressing or deficient for the prnp gene . gene deletion of prnp had no apparent effect on soluble and insoluble monomeric a levels as measured by western blot analyses using 6e10 despite a ~20% reduction in amyloid burden , indicating potential discrepancies in a measurements and quantification . behaviorally , ablation of prnp resulted in rescuing synaptic loss , app - induced premature mortality , and spatial learning and memory compared to appps1 mice . puzzlingly , ca1 ltp was not altered in appps1e9 hippocampal slices , possibly suggesting that the endogenous a species responsible for ltp inhibition are not present or that these mice might develop homeostatic compensations in response to synaptic injury induced by a. in addition to the apparent inconsistency in the a levels , the nature and characterization of the a molecules in 12-month - old appps1 and appps1xprnp were not mentioned , begging the question as to whether the same a species initially found to interact with prp are the same as the hypothesized a oligomers present in vivo . a few months later , two independent studies published at the same time challenged the conclusions that prp is a mediator of a toxicity [ 18 , 19 ] . prp was not found to be required for a-induced synaptic deficits in hippocampal slices transfected with a carboxyl terminal domain of the amyloid precursor protein appct100 and for addl - induced ltp inhibition . in the former paradigm , it is unknown whether oligomeric a species are present in appct100-expressing slices [ 19 , 24 ] , and if they were , the information pertaining to their characterization was not discussed . in the second experimental condition although the method used to generate addls was identical to the one used by lauren and coworkers , gene deletion of the prnp gene failed to rescue the ltp inhibition induced by addls . it is important to note that the characterization of the a oligomers formed only included one western blot analysis with an unspecified antibody following sds - page and revealed the presence of a poorly resolved smear ranging from ~35 to ~180 kda and monomers . in addition , the concentration at which the mixtures were used ( 1 m ) was greater than those used by the original study ( 20200 nm ) , possibly adding an additional confounding factor when comparing the experimental designs . due to the absence of data describing the aggregation state of the a used in these paradigms , it is difficult to conclude that the results presented invalidate the findings of the initial study by laurn et al . . the role of prp in mediating a-induced ltp deficits was investigated in hippocampal slices of 2 to 4-month - old appps1l166p mice that were genetically manipulated to express 2 , 1 , or 0 copies of the prnp gene . contrary to earlier findings , ltp was impaired in an age - dependent fashion in appps1l166p slices , but prnp copy numbers did not influence the observed ltp deficits . neither full - length app and carboxyl - terminal fragments of app ctf and ctf nor soluble a42 levels were altered by prnp genotypic differences indicating that prp does not alter app / a metabolism in this mouse model . despite these rigorous analyses of app derivatives , the exact nature and relative abundance of soluble a assemblies present in 4-month - old appps1l166p mice were not addressed . in light of these disparate observations , nature neuroscience published an editorial in april 2011 entitled state of aggregation which reiterated the critical need to clearly describe the initial state of the protein , its source , and its stoichiometry in order to maximize the success of independent groups that want to reproduce observed phenomena . shortly thereafter , freir and colleagues confirmed that prp is required for ltp inhibition induced by addls and by protein lysates of ad brain tissue containing a . a major reason as to why this study stood out relies on the fact that synthetic oa preparations were carefully characterized by sec , analytical ultracentrifugation , electron microscopy , and by sds - page and that all techniques produced results that were intrinsically consistent . sec and auc analyses of addls and biotinylated addls ( baddls ) confirmed the presence of 2 peaks reminiscent of these described by laurn et al . however , leading and trailing shoulders in the sec elution peaks were observed suggesting the presence of species ranging from 90 to 400 kda in the mixture , which was confirmed by auc . astutely , the authors also noticed that the addition of a biotin residue to a artificially enriched the abundance of high - molecular weight species compared to unbiotinylated addls . using em , both spherical and short filamentous structures were observed consistent with the profile obtained in the original study . finally , sds - page followed by 6e10 immunoblotting analyses confirmed that addls are not sds resistant and predominantly migrate as experimental artifacts as a monomers , dimers , trimers , and tetramers following denaturation . when this mixture was applied to hippocampal slices , altogether , based on these biophysical observations , prp appears to be mediating the inhibition of ltp induced by one or several unidentified synthetic a oligomers . more importantly , a similar rescue of ltp inhibition was observed in prnp slices when tris - buffered saline ( tbs ) soluble protein extracts from an ad brain were applied . biochemical analysis of tbs fractions from ad and control brains by immunoprecipitation / western blotting revealed the presence of putative sds - stable a dimers ( ~7 kda ) and monomeric a in ad tbs extracts , while no a species were detected in control tbs lysates . it is difficult to determine whether other a assemblies were present as there was substantive nonspecific background in the no protein condition ranging from 18 to 80 kda and because only one antibody was used to detect a ( presumably 6e10 ) . integrating the observations from the studies mentioned above , it seemed reasonable at the time to conclude that prp is required for the inhibition of ltp induced by a mixture of soluble brain - derived a species . after two years of intense investigation , we still did not know the answers to the most crucial questions related to oa if one aims to use this knowledge to develop diagnostic and therapeutic tools : ( 1 ) which endogenous a assembly is binding to prp ? ( 2 ) where is this interaction occurring ? ( 3 ) when do endogenous oa engage prp ? ( 4 ) how does prp mediate the deleterious effect(s ) of oa ? we sought to answer these questions combining in vivo experiments using human , transgenic mouse brain tissues and in vitro paradigms using primary neurons derived from various mouse lines . to ascertain the relevance of the study , all soluble a species were purified from human ad brain tissue or conditioned media of transgenic cortical neurons in liquid phase experiments ( i.e. , immunoaffinity capture in suspension followed by sec ) and characterized by immunoprecipitation / western blot using a panel of 4 antibodies detecting the n - terminal region ( 6e10 ) , the central domain ( 4g8 ) , or the c - termini of a ( 40- and 42-end specific antibodies mab2.1.3 and mab13.1.1 , kind gifts from pritam das , mayo jacksonville ) . in a reproducible fashion , we isolated endogenous a monomers , dimers , trimers , a*56 , and protofibrillar species migrating at ~175180 kda in absence of any additional detectable a species using our panel of a antibodies . of note , we also used the oligomer - specific antibody a11 to further confirm the nature of human a*56 ( data not shown ) . moreover , none of the purified soluble a species displayed aberrant migration profiles induced by sds - page analysis ( i.e. , apparent monomers , dimers , trimers , and tetramers comigrating in the same lane ) , and all soluble a captured were eluted at the predicted molecular weight during sec , arguing against the possibility that the assemblies detected are gel artifacts . finally , putative a dimers and trimers could be found in the conditioned medium of primary mouse cortical neurons expressing the swedish mutant form of human app disproving that these apparent a oligomers are induced by lysis or the presence of detergents . because we thoroughly characterized and documented the initial or current state of the endogenous oa present in our biological specimens , we believed we could address the who / where / when / how . briefly , we identified that prp formed a complex with fyn / caveolin-1 in ad brain tissues and that a dimers were the only low - molecular oligomer that coimmunoprecipitated with this complex . using 84 human brain specimens from the religious orders study ( ros ) , we also demonstrated that both prp and active fyn ( phosphorylated at y416 , pfyn ) proteins were abnormally elevated in ad compared to age - matched controls and that fyn activation was correlated to prp expression levels . we next applied a mixture of oa purified from ad brain tissue containing a monomers , dimers , trimers , a*56 , and protofibrils onto protein extracts enriched in membrane proteins derived from control subjects with no detectable a species . upon prp pulldown , only a dimers were visibly captured further validating the coimmunoprecipitation findings previously obtained using ad brain . to determine where oa could interact with prp , we performed triple - labeling immunofluorescence colocalization experiments using sections from ad and control brain and confocal imaging and image reconstruction . soluble a was identified as punctae along the neuronal processes , colocalized with prp at dendritic spines in ad but not control brain tissue , which accounted for ~22% of oa present at dendritic spines labeled with fyn . although the data were slightly higher ( ~36% ) , analyses performed on tg2576 primary cortical neurons expressing a monomers , dimers , and trimers generated similar results . importantly , pfyn was also observed to colocalize with a and prp most notably at synaptic varicosities traditionally considered to reflect alterations in microtubule organization . since tau is a microtubule - associated protein and believed to mediate a-induced deficits , we analyzed tau phosphorylation status and cellular localization when prp / fyn / oa were engaged into forming an active complex . consistent with the synaptic varicosities , tau was hyperphosphorylated at y18 , a well - known target phosphorylation site for fyn , and abnormally accumulated at postsynaptic sites reminiscent of phenomena associated with synaptic dysfunction [ 30 , 31 ] . it then appeared that a dimers could bind to prp engaging the activation of fyn at dendritic spines , but knowing when this pathological event took place remained unknown . to address this question , we examined the role of aging on oa in appps1l166p mice . in 2-month - old appps1l166p , in contrast , very abundant a monomers and putative a dimers and trimers were observed at 14 months of age . these results were consistent with earlier reports considering that a dimers are associated with plaques [ 4 , 32 ] and that amyloid deposition occupies ~10% of the neocortical areas at 8 months in appps1l166p mice . further supporting the hypothesis that a dimers activate the prp / fyn complex , fyn activation was remarkably elevated in aged appps1l166p mice while undetectable in young animals . in addition , the electrophoretic migration pattern for oa did not appear to differ substantially between appps1l166p mice expressing prp and appps1l166p mice deficient for prnp ( appps1l166pxprnp ) . as predicted by our hypothesis , fyn phosphorylation was reduced by ~50% at 14 months of age in appps1l166pxprnp mice suggesting that oa , and presumably a dimers induced the activation or prp / fyn in aged appps1l166p mice when amyloid burden is well established . finally , we sought to establish how prp mediated the effects of oa. to this end , we applied isolated a monomers , dimers , trimers , a*56 , and protofibrils at equimolar concentrations ( 5 nm ) onto primary cortical neurons . since a trimers did not appear to interact with prp based on our coimmunoprecipitations , our results pointed to a dimers as the major soluble endogenous a ligand for prp in vitro . these findings were also in agreement with our in vivo data showing that prnp gene deletion partly abolished fyn activation in aged appps1l166p mice . tau , known to mediate a-induced deficits , was hyperphosphorylated at y18 in neurons treated with a dimers and trimers . in aged appps1l166p mice , removing both copies of prnp diminished tau hyperphosphorylation by ~40% and missorting by ~65% compared to appps1l166pxprnp mice . in contrast , overexpressing prp in appps1l166p mice ( appps1l166pxtga20 ) led to an ~60% increase in tau phosphorylation at y18 and 80% in tau missorting to the postsynaptic density . accompanying this apparent potentiation of the prp / fyn pathway activation in old appps1l166pxtga20 mice , the expression of postsynaptic but not presynaptic proteins including the postsynaptic scaffold protein pds-95 was reduced by ~35% adding weight to the suggestion that increasing prp expression was potentiating a dimer - induced toxicity in vivo . the publication of our study was preceded by a few months by a study from the strittmatter group whom reported that oa binds to postsynaptic prp to activate fyn and impair neuronal function . here , synthetic oa were used as previously described as well as tbs - soluble extracts from individuals diagnosed with ad . despite using 4 antibodies to identify prp - oa complexes ( namely , 2454 , 82e1 , nu-4 , and ab5306 ) on immobilized prp molecules , the characterization of the species detected with these antibodies in both preparations was not documented thereby hampering our ability to put clothes on the emperor to borrow the expression employed by benilova et al . . instead , i am convinced that we , as a field , need to dedicate more efforts into better defining what oligomeric amyloid species are employed if we want to leapfrog towards a more comprehensive knowledge of the disease . i think we can do better than describing a subset of peptide with deleterious actions on neurons and synapses . a recent study from the ashe and lesn groups provides support to the need of distinguishing oligomeric forms of a from each other as opposed to considering them as a pool of molecules triggering the same biological effect . if correct , the findings suggest that the mixture of soluble a species present in the continuum of aging ad is evolving contrasting with the determined mixture of synthetic oa preparations . specifically , a*56 was most prominent in preclinical phases of ad , a trimers were elevated in early symptomatic phases ( i.e. , mild - cognitive impairment ) , and a dimers dominated in late symptomatic phases of ad . if longitudinal studies can confirm these changes , knowing the pathophysiological function of each a oligomer in the brain could be crucial in designing therapeutic interventions . such vision could be envisioned particularly at a time when personal medicine is emerging and when our population is aging very quickly . in addition , another important advance in our knowledge of ad will be to decipher where each oligomeric a assembly is coming from , that is , intracellularly or extracellularly . for these reasons , i believe we should encourage better characterization of the soluble forms of a we use experimentally and pursue initiatives to develop new reagents specific to each oligomeric a assembly ( which might also allow us to identify the formation and location of a oligomers in situ ) in the hope that together we can soon break the code of the a oligomer enigma .

departing from the original postulates that defined various neurodegenerative disorders , accumulating evidence supports a major role for soluble forms of amyloid proteins as initiator toxins in alzheimer 's disease , parkinson 's disease , frontotemporal dementias , and prion diseases . soluble multimeric assemblies of amyloid- , tau , -synuclein , and the prion protein are generally englobed under the term oligomers . due to their biophysical properties , soluble amyloid oligomers can adopt multiple conformations and sizes that potentially confer differential biological activities . therein lies the problem : with sporadic knowledge and limited tools to identify , characterize , and study amyloid oligomers , how can we solve the enigma of their respective role(s ) in the pathogenesis of neurodegenerative disorders ? to further our understanding of these devastating diseases , the code of the amyloid oligomers must be broken .

1. Commentary

physicians have long recognized that certain patients develop postoperative cognitive dysfunction ( pocd ) , especially after cardiac surgery . recently , as investigators have begun to examine the incidence of pocd after major non - cardiac , non - carotid , non - neurosurgical procedures , certain risk factors have been identified . monk and colleagues studied 1064 patients aged 18 years and older before and after non - cardiac surgery and found that pocd was present at hospital discharge in 117 ( 36.6% ) young ( 18 to 39 years ) , 112 ( 30.4% ) middle - aged ( 40 to 59 years ) , and 138 ( 41.4% ) elderly ( 60 years and older ) patients . the difference in incidence was significant between the age groups themselves and between each age group and 210 age - matched ( but not disease - matched ) controls . at 3 months after surgery , the presence of pocd , while similar between young and middle - aged patients and age - matched controls , was significantly higher in older patients as compared with older controls ( p 0.001 ) . the independent risk factors for pocd at 3 months identified by monk and colleagues included older age ( perhaps owing to a diminution in cognitive reserve ) , lower level of education , history of previous cerebrovascular accident without residual impairment , and presence of pocd at hospital discharge . postoperative delirium and increased use of opioid analgesics correlated with pocd at hospital discharge but not at 3 months . patients who had pocd were also at increased risk of death in the first year after surgery . other risk factors for the development of pocd include major but not minor surgery , a history of alcohol abuse in older patients , and postoperative changes in thyroid hormones as demonstrated by the occurrence of the euthyroid sick syndrome - reduced serum t3 and t4 concentrations without an increase in thyroid - stimulating hormone secretion - within hours after major surgery . modifications in thyroid hormone functioning may take place as a result of the psychophysical stress caused by surgery and the reduced conversion of t4 into t3 by a liver engaged in the metabolism of anesthetic drugs . as there is a possible association between thyroid abnormalities and alzheimer disease because of the interrelationship between thyroid hormones and the cholinergic system , which is selectively affected in alzheimer disease , postoperative changes in thyroid hormones may play a role in the pathogenesis of pocd . bickel and colleagues , in their study of 200 patients , 60 years and older , undergoing hip surgery , reported that postoperative delirium was a strong independent predictor of the development of subsequent cognitive impairment , subjective memory decline , and the need for long - term care . a similar correlation was noted by rudolph and colleagues between delirium and early ( 7 days ) but not late ( 3 months ) pocd in 1,218 patients , 60 years and older , undergoing elective non - cardiac surgery . kat and colleagues also reported that the risk of dementia or mild cognitive impairment in 112 hip surgery patients , 70 years and older , at 30 months after discharge was almost doubled in patients who had postoperative delirium ( 77.8% ) as compared with at - risk patients who had not developed delirium ( 40.9% ) . cerebral trauma ( even in the absence of symptoms ) and preoperative cognitive decline have also been reported to be risk factors for the development of postoperative delirium and pocd in the elderly . tan and colleagues investigated 103 patients who had pocd and 103 cognitively normal controls and reported that pocd was induced by the use of patient self - controlled intravenous analgesia ( pcia ) . a history of cerebral trauma was an independent risk factor for pocd induced by the use of pcia , but a high education level seemed to be protective . ggenur and colleagues , in their study of the cognitive function in 36 patients before and 4 days after major abdominal surgery , reported that pocd was associated with inferior sleep quality and more awakenings , but not with postoperative disturbances in circadian rhythm . interestingly , what has not been shown to correlate with the development of pocd is whether the patient had regional or general anesthesia [ 17 - 19 ] . deeper levels of general anesthesia , as assessed by the use of the bispectral index ( median of 50.7 versus 38.9 ) , however , were associated with better cognitive function , especially the ability to process information , 4 to 6 weeks after surgery . most of the studies of pocd , however , have methodological difficulties , as pointed out by newman and colleagues in their review of more than 40 studies . the definition used to classify individuals as having pocd was not standardized among investigators , nor was there uniformity in the number , range , and diversity of neuropsychological tests , their sensitivity to change and learning , and the intervals between testing . there was also no standardization in experimental design with variations in the type of surgery and anesthesia , presence or absence of controls , type of controls , and statistical methods used to analyze the data , all of which make comparisons among studies very difficult . a significant limitation of the studies of pocd is that they do not include a standardized preoperative neurological examination in addition to the neuropsychological testing . this makes it almost impossible to separate out the relationship between surgery and anesthesia and subsequent cognitive decline and death from the cognitive decline and death that occur among older adults without surgery . the relationship between aging and cognitive decline and mortality rate in the absence of surgery was demonstrated almost a decade ago . more recently , inzitari and colleagues developed a 15-minute neurological examination to elicit subtle but clinically detectable neurological abnormalities ( snas ) , defined as abnormalities demonstrated in the absence of patient complaints and not associated with any neurological disease . follow - up examination at 4 and 8 years revealed that patients who had three or more snas at initial evaluation had an increased risk of cognitive decline , cerebrovascular events , and death , possibly because the snas signaled a concomitant decline in cognitive reserve . the authors did not track which patients had surgery and anesthesia during the follow - up period . in light of the demonstration by inzitari and colleagues of the progression of neurological deterioration , it is essential that future studies of pocd include a uniform neurological examination of all patients and control subjects . the neurological examination must have good inter - rater agreement and reproducibility . without prior knowledge of snas , it is impossible to assign causation to the cognitive dysfunction that may occur after surgery and anesthesia . is it the normal progression of a condition , however subtle , that is present preoperatively ; is it the effect of surgery and anesthesia alone ; or have surgery and anesthesia worked in some way to hasten the progression of the preoperatively present condition ? clearly , whatever else the experimental protocols include to achieve uniformity and facilitate interstudy comparison ( age- and disease - matched controls in every study and uniformity of operation , anesthesia , neuropsychological tests , testing intervals , statistical analysis , and control subjects ) , neurological examination for both gross and subtle neurological abnormalities must be included too . even in the absence of pocd study protocols , preoperative information about snas would facilitate the discussion of informed consent when older adults are contemplating surgical procedures as neurological abnormalities , even in the absence of overt symptoms , have been correlated with pocd . thus it may be advisable for an sna score as developed by inzitari and colleagues with their brief neurological examination , to be included with the other vital signs measured in older adults before surgery . it is important to note that the studies of pocd are , as yet , in their infancy . until research protocols achieve sufficient power and uniformity , it will be difficult to draw conclusions applicable to patient care . as suggested by newman and colleagues , the very term pocd as a binary definition of what may be , in reality , a continuous process may require modification to reflect the necessity of examining cognitive change as a continuum that marches through discrete events such as surgery and anesthesia . this will necessarily influence the methodology by which changes in test performance are analyzed . while central nervous system dysfunction after surgery and anesthesia has been demonstrated to occur , especially in older adults , it is important to bear in mind that , as silverstein and colleagues point out , any illness requiring hospitalization may be associated with cognitive decline . this introduces the possibility that cognitive decline occurs as a concomitant of generalized illness rather than being causally related to surgery and anesthesia and speaks to the need for not only age - matched controls but also disease - matched and hospitalization - matched clinical cohorts as well . in addition , the observation made by a number of investigators that cognitive decline itself increases the risk of mortality in older adults further confounds interpretation of the correlation between pocd and mortality reported by monk and colleagues . newman and colleagues also direct our attention to the problem inherent in conducting adequately - powered studies in this era of scarce health care resources . they suggest that investigators develop a consensus regarding the experimental protocols to enable them to pool data across studies to achieve power in secondary analyses . even in the absence of uniform , adequately - powered studies of pocd for example , postoperative delirium , a correlate of pocd , is associated with increased intraoperative blood loss and postoperative transfusions , a postoperative hematocrit of less than 30% , and severe postoperative pain . the hospital elder life program has developed interventions to decrease the incidence and severity of delirium . these include the frequent presentation of orienting information , physical activity , cognitive stimulation activities , use of visual aids and auditory amplifying devices , sleep inducement through nonpharmacological methods , assistance with alimentation , geriatric - psychiatric consultations , and patient and family education .

postoperative cognitive dysfunction ( pocd ) refers to a deterioration in cognition noted to occur after surgery and anesthesia . recent studies have demonstrated a number of correlates and risk factors for this condition , although much remains to be elucidated in terms of the true incidence , etiology , prevention , and treatment .

Introduction and context Recent advances Implications for clinical practice Competing interests

although perioperative mortality from tonsillectomy and submucosal uvulopalatopharyngoplasty ( smuppp ) with tonsillectomy has decreased significantly , postoperative bleeding is still an important complication . the incidence of bleeding after tonsillectomy is approximately 0.5%-10% , with death occurring in 1 in 20,000 patients . primary bleeding refers to that occurring within the first 24 h postoperatively , and bleeding occurring 5 - 10 days after surgery has been classified as secondary or delayed bleeding . factors such as age , gender , and surgical technique have been evaluated as risk factors for posttonsillectomy bleeding . to date , no study has specifically compared the rate of bleeding after tonsillectomy and smuppp . we reviewed the medical records of all patients at our institution who underwent unipolar cautery tonsillectomy alone or in conjunction with smuppp during the last 10 years to compare the incidence of secondary , delayed postoperative hemorrhage between the two procedures . in this retrospective study , following approval from the institutional review board , we reviewed the medical records of 404 patients who underwent tonsillectomy and smuppp procedures at our institution between january 2001 and december 2010 . the patients were divided into two groups according to the surgical intervention they had gone through . group 1 , who underwent tonsillectomy , consisted of 198 patients ; group 2 , who underwent smuppp , consisted of 206 patients . patients younger than 18 years of age or those who underwent a tonsillectomy as part of the treatment of carcinoma of the head or neck were excluded from the study . all postoperative secondary , delayed ( 5 - 10 days after surgery ) hemorrhage which required intervention , such as electrocautery under local anesthesia or a second surgery under general anesthesia for both groups was recorded . it is based on standard surgical principles of epithelial preservation and tension - free closure of the epithelium . most of the mucosa of the soft palate and the anterior and posterior pillars are preserved . elimination of redundant palatal and pharyngeal tissue is accomplished by subepithelial and muscular stretching and closure . the smuppp technique comprises two steps : step 1 , tonsillectomy and excision of the soft palate and redundant tissue ; and step 2 , reconstruction . a detailed description of the technique is as follows . the patient is orally intubated , and the head is hyperextended with a crowe - davis tonsillectomy mouth gag in place . this helps to assess the lateral extent of the tonsil and the proper plane of dissection . the needle tip is then used in 35 w cutting mode to expose the tonsil capsule via a curvilinear incision . to further identify the capsule , yankauer suction the dissection proceeds using a bovie in 35 w coagulation mode to separate the tonsil capsule from the superior constrictor muscle and to cauterize the blood vessels entering the tonsil . constant traction of the tonsil is maintained , allowing the tissue to be separated as it is cauterized by the bovie . the removal of the tonsil proceeds within its anatomical boundaries , with the musculature of the tonsil fossa left intact . dissection proceeds inferiorly toward the base of the tongue until the tonsil is free of all attachments . at the end of the tonsillectomy , after the removal of both tonsils , the palate is addressed . the uvula is grasped with allis forceps and retracted anteriorly for an optimal approach to the posterior surface of the soft palate . a curvilinear horizontal incision is made on the mucosa at the base of the uvula posteriorly , preserving almost the entire posterior soft palate mucosa . using the needle tip in cautery coagulation mode , the mucosa is separated from the muscle , releasing the posterior soft palate mucosa . using the needle tip in cutting mode , a trapezoid incision is outlined at the anterior mucosa of the soft palate at a level previously identified below the dimpled area , as visualized preoperatively on the awake patient . the incision is extended bilaterally and horizontally across the soft palate to the downward slope of the anterior pillar . the uvula and the submucosal tissue of the lower edge of the soft palate are excised . the redundant pharyngeal folds are eliminated by approximation of the muscular tissue of the tonsillar fossa and the soft palate using interrupted 3 - 0 vicryl sutures through these muscles . the mucosal flap edges are loosely approximated , without undermining , using 3 - 0 vicryl sutures . particular attention is paid to the inferior parts of the tonsillar fossa , where the majority of secondary bleeding occurs . bipolar cautery is used to cauterize these parts , after which the inferior parts of the tonsillar fossas are sutured using inferolateral pharyngoplasty . inferolateral pharyngoplasty involves at least four interrupted sutures with 3 - 0 vicryl to tack the inferior pharyngeal redundancy laterally . this is accomplished by suturing the muscle layer of the inferior tonsillar fossa laterally to the base of the tongue as the first layer . the second layer of mucosal epithelial interrupted sutures then overlies this layer . during soft palate excision , particular attention is paid to the base of the uvula on both sides where the uvular artery enters the soft palate . bipolar cauterization followed by tacking with 3 - 0 vicryl sutures may have decreased the incidence of postoperative bleeding compared wth routine tonsillectomy . the tonsillectomy technique used in group 1 patients is also the same electrocautery technique and instrumentation described by drezner , and the tonsillar fossae are left intact for secondary healing [ videos 1 - 2 ] . the test was used for statistical analysis . except in cases with expected sample sizes of fewer than five , postoperative secondary bleeding from the tonsillectomy regions were recorded and compared . bleeding from the palate was excluded . the smuppp technique used in this study it is based on standard surgical principles of epithelial preservation and tension - free closure of the epithelium . most of the mucosa of the soft palate and the anterior and posterior pillars are preserved . elimination of redundant palatal and pharyngeal tissue is accomplished by subepithelial and muscular stretching and closure . the smuppp technique comprises two steps : step 1 , tonsillectomy and excision of the soft palate and redundant tissue ; and step 2 , reconstruction . a detailed description of the technique is as follows . the patient is orally intubated , and the head is hyperextended with a crowe - davis tonsillectomy mouth gag in place . this helps to assess the lateral extent of the tonsil and the proper plane of dissection . the needle tip is then used in 35 w cutting mode to expose the tonsil capsule via a curvilinear incision . to further identify the capsule , yankauer suction the dissection proceeds using a bovie in 35 w coagulation mode to separate the tonsil capsule from the superior constrictor muscle and to cauterize the blood vessels entering the tonsil . constant traction of the tonsil is maintained , allowing the tissue to be separated as it is cauterized by the bovie . the removal of the tonsil proceeds within its anatomical boundaries , with the musculature of the tonsil fossa left intact . dissection proceeds inferiorly toward the base of the tongue until the tonsil is free of all attachments . at the end of the tonsillectomy , and the muscle fibers are still covered by fascia . after the removal of both tonsils , the uvula is grasped with allis forceps and retracted anteriorly for an optimal approach to the posterior surface of the soft palate . a curvilinear horizontal incision is made on the mucosa at the base of the uvula posteriorly , preserving almost the entire posterior soft palate mucosa . using the needle tip in cautery coagulation mode , the mucosa is separated from the muscle , releasing the posterior soft palate mucosa . using the needle tip in cutting mode , a trapezoid incision is outlined at the anterior mucosa of the soft palate at a level previously identified below the dimpled area , as visualized preoperatively on the awake patient . the incision is extended bilaterally and horizontally across the soft palate to the downward slope of the anterior pillar . the uvula and the submucosal tissue of the lower edge of the soft palate are excised . the redundant pharyngeal folds are eliminated by approximation of the muscular tissue of the tonsillar fossa and the soft palate using interrupted 3 - 0 vicryl sutures through these muscles . the mucosal flap edges are loosely approximated , without undermining , using 3 - 0 vicryl sutures . particular attention is paid to the inferior parts of the tonsillar fossa , where the majority of secondary bleeding occurs . bipolar cautery is used to cauterize these parts , after which the inferior parts of the tonsillar fossas are sutured using inferolateral pharyngoplasty . inferolateral pharyngoplasty involves at least four interrupted sutures with 3 - 0 vicryl to tack the inferior pharyngeal redundancy laterally . this is accomplished by suturing the muscle layer of the inferior tonsillar fossa laterally to the base of the tongue as the first layer . the second layer of mucosal epithelial interrupted sutures then overlies this layer . during soft palate excision , particular attention is paid to the base of the uvula on both sides where the uvular artery enters the soft palate . bipolar cauterization followed by tacking with 3 - 0 vicryl sutures may have decreased the incidence of postoperative bleeding compared wth routine tonsillectomy . the tonsillectomy technique used in group 1 patients is also the same electrocautery technique and instrumentation described by drezner , and the tonsillar fossae are left intact for secondary healing [ videos 1 - 2 ] . the test was used for statistical analysis . except in cases with expected sample sizes of fewer than five , the mean age of group 1 patients was 38.1 ( 2.58 ) years , and that of group 2 was 37.7 ( 2.2 ) years . no statistically significant difference in age or gender distribution was found between groups 1 and 2 ( p > 0.05 ) . there were 198 patients in the tonsillectomy with unipolar electrocautery group ( group 1 ) and 206 in the smuppp group ( group 2 ) . the incidence of secondary , delayed hemorrhage was 5.05% ( 10 patients ) in group 1 and 1.45% ( 3 patients ) in group 2 ( p = 0.05 ) showing statistically significant difference . the incidence of delayed hemorrhage requiring surgical treatment was 4.54% ( nine patients ) in group 1 and 0.97% ( two patients ) in group 2 [ graph 1 ] . the rate of post - tonsillectomy hemorrhage reported in the literature is variable due to the lack of consensus on what is considered significant postoperative hemorrhage . in many studies , only if surgical intervention under general anesthesia is required to control the bleeding will a case be considered as having significant hemorrhage , and the studies that take this view find lower hemorrhage rates . but in our study , all patients who required medical attention for control of bleeding were considered as having postoperative hemorrhage , regardless of whether they required hemorrhage control under local anesthesia or full surgery under general anesthesia . posttonsillectomy hemorrhage incidence in adults is reported in the literature to be 1.5%-18.0% , but the more commonly given range is between 3.0% and 5.0% . in our study , the postoperative bleeding rate of the tonsillectomy group was similar to the rates mentioned in the literature . rates of hemorrhage after smuppp have not been studied as extensively as those after tonsillectomy . the range encountered in the literature varies from 0.6% to 14.0% , and in our study , the bleeding rate after smuppp was 1.45% which falls within that range . in the present study , when electrocautery tonsillectomy and smuppp groups were compared , a significant difference in the rate of hemorrhage was apparent . although the tonsillectomy portion of the procedures was performed in an identical manner for both of our study groups , the postoperative bleeding rates differed . some studies have found an increased rate of posttonsillectomy hemorrhage in males compared with females , but the gender distribution did not differ between study groups , which agrees with several other studies . the increased rate of hemorrhage in the tonsillectomy group could not be attributed to any factor other than the operative techniques used . however , the bleeding rates for tonsillectomy and smuppp patients remained significantly higher among tonsillectomy patients whose muscular tissue of the tonsillar fossa was not approximated using interrupted 3 - 0 vicryl sutures through the tissue . suturing both the muscular and mucosal layers of the tonsillar fossa in smuppp seemed to decrease the incidence of postoperative bleeding . furthermore , bipolar cauterization followed by tacking with 3 - 0 vicryl sutures may have . decreased the incidence of postoperative bleeding . suturing of the tonsillar pillars is the only influencing factor detected that may have lowered the bleeding incidence . double - layer closure and approximating muscular and mucosal layers after tonsillectomy might help postoperative oropharyngeal healing , resulting in decreased bleeding incidence . medical attention for control of bleeding were considered as having postoperative hemorrhage , regardless of whether they required hemorrhage control under local anesthesia or full surgery under general anesthesia . posttonsillectomy hemorrhage incidence in adults is reported in the literature to be 1.5%-18.0% , but the more commonly given range is between 3.0% and 5.0% . in our study , the postoperative bleeding rate of the tonsillectomy group was similar to the rates mentioned in the literature . rates of hemorrhage after smuppp have not been studied as extensively as those after tonsillectomy . the range encountered in the literature varies from 0.6% to 14.0% , and in our study , the bleeding rate after smuppp was 1.45% which falls within that range . in the present study , when electrocautery tonsillectomy and smuppp groups were compared , a significant difference in the rate of hemorrhage was apparent . although the tonsillectomy portion of the procedures was performed in an identical manner for both of our study groups , the postoperative bleeding rates differed . some studies have found an increased rate of posttonsillectomy hemorrhage in males compared with females , but the gender distribution did not differ between study groups , which agrees with several other studies . the increased rate of hemorrhage in the tonsillectomy group could not be attributed to any factor other than the operative techniques used . however , the bleeding rates for tonsillectomy and smuppp patients remained significantly higher among tonsillectomy patients whose muscular tissue of the tonsillar fossa was not approximated using interrupted 3 - 0 vicryl sutures through the tissue . suturing both the muscular and mucosal layers of the tonsillar fossa in smuppp seemed to decrease the incidence of postoperative bleeding . furthermore , bipolar cauterization followed by tacking with 3 - 0 vicryl sutures may have . suturing of the tonsillar pillars is the only influencing factor detected that may have lowered the bleeding incidence . double - layer closure and approximating muscular and mucosal layers after tonsillectomy might help postoperative oropharyngeal healing , resulting in decreased bleeding incidence . submucosal tonsillectomy , which is a part of smuppp , has a lower incidence of postoperative delayed hemorrhage compared with tonsillectomy using unipolar cautery in adult patients . we suggest routine use of the suturing technique for smuppp in all tonsillectomy patients to reduce the rate of postoperative hemorrhage .

background : the aim of this study was to compare the incidence of postoperative secondary hemorrhage for tonsillectomy and submucosal uvulopalatopharyngoplasty ( smuppp).materials and methods : in this retrospective case series , the medical records of 404 patients who underwent tonsillectomy with unipolar electrocautery and smuppp at our institution between january 2001 and december 2010 were reviewed . the patients were divided into two groups : group 1 ( 198 patients ) underwent tonsillectomy ; group 2 ( 206 patients ) underwent smuppp . main outcome measures were incidence of bleeding or complications after tonsillectomy and smuppp and the need for revision surgery.results:the mean age of group 1 patients was 38.1 ( 2.58 ) years and that of group 2 was 37.7 ( 2.25 ) years . males were 51.3% of group 1 and 46.7% of group 2 . no statistically significant difference in age or gender distribution was found between groups 1 and 2 . the incidence of secondary , delayed hemorrhage was 5.05% ( 10 patients ) in group 1 and 1.45% ( three patients ) in group 2 ( p = 0.05 ) . the incidence of delayed hemorrhage requiring surgical treatment was 4.54% ( nine patients ) in group 1 and 0.97% ( two patients ) in group 2.conclusion:in adults , smuppp , which includes tonsillectomy , has a lower incidence of postoperative delayed hemorrhage than does tonsillectomy with unipolar cautery .

INTRODUCTION PATIENTS AND METHODS smUPPP and tonsillectomy smUPPP and tonsillectomy smUPPP and Tonsillectomy RESULTS DISCUSSION smUPPP and tonsillectomy smUPPP and tonsillectomy CONCLUSION

acute pancreatitis ( ap ) is an acute inflammatory process of the pancreas with variable severity . it can be severe and associated with systemic or local complications , especially those with infected pancreatic or peripancreatic necrosis ( ipn ) . gastrointestinal ( gi ) fistula is one of the well - recognized complications secondary to severe ap . depending on the sites of fistula , it may involve the stomach , duodenum , jejunum , ileum , and colon , either in combination or separately . it may result from direct erosion from digestive enzymes released by the inflamed pancreas on adjacent gi tract , or it could occur as a consequence of the intestinal necrosis due to vascular thrombosis in an area of inflammation and infection . although previous studies suggest the fistula of gi tract occurs infrequently in ap patients , ipn and the operative managements for ipn would increase the frequency . it has been reported gi fistulas may cause serious clinical consequences such as hemorrhage and exacerbation of infection with fatal outcome . in this retrospective study we aimed to evaluate the incidence and clinical outcome of gi fistulas in the setting of ap with ipn clinical data from patients with gi fistula secondary to ap between january 1 , 2010 and december 31 , 2013 in our center were retrospectively reviewed . ap was diagnosed according to clinical presentation ( typically abdominal pain ) , laboratory parameters ( serum amylase or lipase levels exceeding 3 times the upper limit of normal ) and abdominal imaging by contrast - enhanced computed tomography ( ct ) . contrast - enhanced ct was performed for all patients within 72 hours since admission . ipn was diagnosed according to the positive gram stain and culture results of pancreatic or peripancreatitic necrotic tissue obtained by means of ct guided fine needle aspiration , or from the first percutaneous drainage or operation . the severity was defined according to the determinant - based classification of acute pancreatitis severity . fistula was defined as pathological communications that connect any portion of gi tract with the necrotic cavity , the peritoneal space , the retroperitoneal areas , or another internal organ . diagnosis of gi fistula was based on fistulography , digestive endoscopy , or operative findings . data pertaining to the severity of ap , the severity score , ct severity score , interval between onset of ap and admission to our center , interval between onset of ap and detection of gi fistula , location of gi fistula , intervention for gi fistula and ipn , and outcomes were recorded . continuous data were compared using a student t test , and categorical data were analyzed using a chi - square test . a p - value of < 0.05 was regarded as statistically significant . the data analyses were performed using spss 20.0 ( ibm spss statistics ; ibm corporation ; armonk , ny ) . a total of 928 patients with ap admitted between january 1 , 2010 and december 31 , 2013 were screened for potential inclusion and 311 of them developed ipn in the disease course . of the 311 patients , 209 ( 67.2% ) had been diagnosed with ipn before admission , of which 87 ( 28.0% ) patients had percutaneous drainage , 39 ( 12.5% ) patients had open necrosectomy . only 83 ( 8.9% ) of all ap patients were admitted in our center within 24 hours since onset of symptoms , and 7 of these 83 patients developed ipn . one hundred nineteen of all ap patients were diagnosed with gi fistula and all of them were ipn patients . all these patients were classified as critical or severe ap and most of them developed a critical course ( 98 , 82.4% ) . their mean ( sd ) age was 45.1 ( 13.7 ) , and 79 ( 66.4% ) of them were male . the median interval between onset of ap and admission to our center was 38 days . table 1 shows the comparison of baseline characteristics between the patients with gi fistula and those without gi fistula . moreover , they likely had higher ct severity score with a certain trend toward significance ( p = 0.08 ) . comparison of baseline characteristics of ap patients with ipn in total , 119 patients developed 160 gi fistulas . sixty - one ( 45.9% ) patients of 133 ipn patients who had drainage and operative before admission in our center were found with fistulas . of the other 178 patients who did not have drainage and operative in other centers , 58 ( 15.7% ) patients developed gi fistulas . the colonic fistula was the most common form which was found in 72 patients , followed by duodenal fistula which could be seen in 53 patients . fistula occurred in duodenum in isolation in 28 patients and in colon alone in 42 patients . isolated gastric and jejunal fistula were observed in only 8 and 5 patients , respectively . the remaining patients demonstrated a combination of fistulas and duodenal combined with colonic fistula was the dominant form unsurprisingly ( table 2 ) . the median ( quartile ) interval between onset of ap and detection of gi fistula was 54 ( 3778 ) days . one hundred one ( 84.9% ) patients were detected with gi fistula beyond 1 month . fifty - four ( 45.4% ) patients were detected with gi fistula after performing first open necrosectomy . distribution of gastrointestinal fistulas fistulas were managed by a similar step - up approach which included percutaneous drainage , cnpi , and open necrosectomy . all fistulas of upper digestive tract , jejunum , and ileum were managed by nonsurgical procedure . seventy - four ( 84.1% ) of these 88 fistulas closed spontaneously over time after the source of infection was controlled . twenty - one of the other 25 colonic fistulas managed by nonsurgical procedure closed spontaneously . parenteral nutrition was used for a transition period and after the sinus tract 's formation enteral nutrition was performed continuously ( table 3 ) . nineteen of these died of multiorgan failure , and the other 15 of septic shock . table 4 shows the comparison of outcomes between the ipn patients with and without gi fistula . although patients with gi fistula stayed longer in intensive care unit ( icu ) and hospital , the mortality between the 2 groups did not differ significantly however , the death rate in patients with colonic fistula was 25 ( 34.7% ) out of 72 , which was significantly higher than that in patients without gi fistula ( p = 0.039 ) . treatment and outcomes of gastrointestinal fistulas in acute pancreatitis comparison of outcomes of ap patients with ipn sixty - one ( 45.9% ) patients of 133 ipn patients who had drainage and operative before admission in our center were found with fistulas . of the other 178 patients who did not have drainage and operative in other centers , 58 ( 15.7% ) patients developed gi fistulas . the colonic fistula was the most common form which was found in 72 patients , followed by duodenal fistula which could be seen in 53 patients . fistula occurred in duodenum in isolation in 28 patients and in colon alone in 42 patients . isolated gastric and jejunal fistula were observed in only 8 and 5 patients , respectively . the remaining patients demonstrated a combination of fistulas and duodenal combined with colonic fistula was the dominant form unsurprisingly ( table 2 ) . the median ( quartile ) interval between onset of ap and detection of gi fistula was 54 ( 3778 ) days . one hundred one ( 84.9% ) patients were detected with gi fistula beyond 1 month . fifty - four ( 45.4% ) patients were detected with gi fistula after performing first open necrosectomy . fistulas were managed by a similar step - up approach which included percutaneous drainage , cnpi , and open necrosectomy . all fistulas of upper digestive tract , jejunum , and ileum were managed by nonsurgical procedure . seventy - four ( 84.1% ) of these 88 fistulas closed spontaneously over time after the source of infection was controlled . twenty - one of the other 25 colonic fistulas managed by nonsurgical procedure closed spontaneously . parenteral nutrition was used for a transition period and after the sinus tract 's formation enteral nutrition was performed continuously ( table 3 ) . nineteen of these died of multiorgan failure , and the other 15 of septic shock . table 4 shows the comparison of outcomes between the ipn patients with and without gi fistula . although patients with gi fistula stayed longer in intensive care unit ( icu ) and hospital , the mortality between the 2 groups did not differ significantly . however , the death rate in patients with colonic fistula was 25 ( 34.7% ) out of 72 , which was significantly higher than that in patients without gi fistula ( p = 0.039 ) . treatment and outcomes of gastrointestinal fistulas in acute pancreatitis comparison of outcomes of ap patients with ipn although gi fistula is a well - recognized complication of ap , it has been reported in limited literature recently . in this study , we reported our experience with gi fistula in ap with ipn in our center . the incidence of gi fistula varied from 3% to 47% in different studies depending on different study population , but all these studies included small number of cases . in the present retrospective study , we found 119 ( 38.3% ) patients with gi fistula among 311 ap patients with ipn , and the overall incidence in all ap patients in our center was 12.8% . furthermore , enzyme - rich fluid and necrosis can lead to vascular thrombosis , which compromise the blood supply of the segmental gi tract , leading to bowel necrosis eventually . in our study , all the patients with gi fistula had necrotizing pancreatitis with ipn . with regard to the time of occurrence of gi fistula during the course of ap , 84.9% patients had gi fistula beyond 1 month , which suggests that development of gi fistulas is associated with the long - term effects of the pancreatic or peripancreatic inflammation and infection . it was reported that frequent debridement and controlled open drainage may increase the incidence of intestinal fistulas in 1989 . and a study published in 1995 from mayo clinic showed that 19 out of 61 ( 31.2% ) patients developed gi fistulas after surgical management while only 4 ( 6.6% ) were found at the time of initial operation . during recent years , the mainstream management of ap with ipn has changed from open necrosectomy to minimally invasive techniques based step - up approach . our patients were treated by step - up approach but with a similar incidence of gi fistula and 54.6% patients were detected with gi fistula before performing first open necrosectomy . it was also observed previously that the approach for ipn management did not affect incidence of gi fistula . it suggests that at present time step - up approach might not reduce the risk of iatrogenic gi injury . in addition , it had been recommended that severe ap should be treated in multidisciplinary specialist units , which included icu specialists , interventional endoscopists , diagnostic and interventional radiologists , and surgeons . our results showed that 133 of ipn patients had operative procedures before transfer and 45.9% developed fistula as opposed to 15.7% of those transferred in who did not have operation . gi fistula could involve the stomach , duodenum , jejunum , ileum , and colon , either in combination or separately . same to other studies , colonic fistula was the commonest form of gi fistulas in our study , which was found in 72 patients and duodenal fistula the second ( 53 patients ) . the underlying mechanisms of this phenomenon may include : first , the anatomy characteristics of peritoneal reflection results in colon and duodenal more frequently affected directly . second , gut ischemia , as a result of low - flow state or hemodynamic response to sepsis , may be more commonly associated with colon . furthermore , the stomach and small intestine have a much better blood supply , which could provide a protective mechanism for preventing the formation of fistula . it has been reported that most upper - gut fistulas could close with time and colonic fistulas may require active intervention . in our center , fistulas of upper gi tract , jejunum , and ileum usually closed spontaneously with time if infected source could be well controlled while approximately 7 out of 10 colonic fistulas needed to be managed by enterostomy . however , a study which reviewed 43 reports suggested that colonic fistulas which became apparent after percutaneous pancreatic drainage might close spontaneously . moreover , several reports showed colonic fistula could close with the aid of nonsurgical techniques such as percutaneous drainage and endoscopic therapy . in our study , 21 colonic fistula closed spontaneously with conservative management . our experience is that those excrement can be completely drained by nonsurgical techniques would close spontaneously . gi fistula may cause clinical consequences such as gi hemorrhage and sepsis which might lead to death eventually . in our study , patients with gi fistula were associated with more severe disease course and suffered more organs failure . on the other hand , gi fistula could potentially benefit the patient by draining ipn into gi tract . in persistence to previous studies that suggested gi fistula did not increase mortality , the death rate of patients with gi fistula in our study did not differ significantly from those without gi fistula . however , subgroup analyses showed mortality of patients with colonic fistula was significantly higher than that in patients without gi fistula , namely , colonic fistula was related with higher mortality . the actual incidence of gi fistula could be lower than ours because the patients admitted to our center were so complicated that most of them had been treated in other facilities for a long time , even with percutaneous drainage or open necrosectomy , and some patients had been diagnosed with gi fistula before transferred . the heterogeneity of our patients and variable lengths of time to referral to our center would impact the reliability of conclusions regarding identification of factors associated with fistula formation and predictors of death . and some data in previous facilities were incomplete . additionally , it was a single - center retrospective study . in conclusion , colonic and duodenal fistulas are the two commonest forms of gi fistula in ipn patients , and most of them could close spontaneously with proper nonsurgical management except approximately 70% of colonic fistulas needing surgical intervention . for the clinical outcome , the occurrence of colonic fistula is associated with worse outcome .

abstractgastrointestinal ( gi ) fistula is a well - recognized complication of acute pancreatitis ( ap ) . however , it has been reported in limited literature . this study aimed to evaluate the incidence and outcome of gi fistulas in ap patients complicated with infected pancreatic or peripancreatic necrosis ( ipn).between 2010 and 2013 ap patients with ipn who diagnosed with gi fistula in our center were analyzed in this retrospective study . and we also conducted a comparison between patients with and without gi fistula regarding the baseline characteristics and outcomes.over 4 years , a total of 928 ap patients were admitted into our center , of whom 119 patients with ipn were diagnosed with gi fistula and they developed 160 gi fistulas in total . colonic fistula found in 72 patients was the most common form of gi fistula followed with duodenal fistula . all duodenal fistulas were managed by nonsurgical management . ileostomy or colostomy was performed for 44 ( 61.1% ) of 72 colonic fistulas . twenty - one ( 29.2% ) colonic fistulas were successfully treated by percutaneous drainage or continuous negative pressure irrigation . mortality of patients with gi fistula did not differ significantly from those without gi fistula ( 28.6% vs 21.9% , p = 0.22 ) . however , a significantly higher mortality ( 34.7% ) was observed in those with colonic fistula.gi fistula is a common finding in patients of ap with ipn . most of these fistulas can be successfully managed with different procedures depending on their sites of origin . colonic fistula is related with higher mortality than those without gi fistula .

INTRODUCTION MATERIALS AND METHODS RESULTS Pattern of GI Fistulas Treatment and Outcome DISCUSSION

all forms of mercury viz . , organic , elemental , and mercury salts are toxic and manifestations depend on nature , intensity and the chemical form of mercury . most human exposure results from fish consumption ( organic mercury ) or dental amalgam ( metallic mercury ) . kidneys are the prime target of mercury toxicity as it is primarily excreted through them . here , we describe a patient who consumed mercuric chloride with suicidal intent , and presented with typical manifestation such as acute kidney injury ( aki ) and gastrointestinal erosion . in addition , he had disseminated intravascular coagulation ( dic ) , a rare complication of mercury poisoning . a 36-year - old male was admitted with 2 days history of oliguria progressing to anuria , facial puffiness , edema legs , bleeding gums , hematochezia , and fever . he gave a history of consumption of unknown substance ( around 500 mg ) a week back used for folk remedies and rituals . his heart rate was 92/min , respiratory rate was 15/min , and blood pressure was 130/90 mm of hg . laboratory investigations showed hemoglobin 11.2 g / dl ; total count 6000/mm ; platelet count 100,000/mm ; blood urea 124 mg / dl ; serum creatinine 6.7 mg / dl ; sodium 135 meq / l ; and potassium 6.1 meq / l ; arterial blood gas analysis showed high anion gap metabolic acidosis . his coagulation profile showed prothrombin time 18 s , inr 1.6 ; activated partial thromboplastin time 60 s ; fibrin degradation products 10 mg / ml ; d - dimer levels 1 mg / ml ; and serum fibrinogen 250 mg / dl . diagnosis of overt dic was made as per criteria proposed by the international society of thrombosis and hemostasis with total score of five at admission . he received eight sessions of hemodialysis over 2 weeks after which his urine output started improving . renal biopsy done 2 weeks after admission showed markedly dilated tubules with sloughed off epithelium and cell debris within lumen [ figure 1 ] , interstitial edema , and mild inflammatory infiltrate in the interstitium consistent with acute tubular necrosis . consumed substance brought by the patient 3 weeks later was white colored powder , called . toxicological analysis of the compound revealed it to be mercuric chloride . at the end of 2 months , there are three classes of mercury : metallic elemental mercury , inorganic mercurial salts ( mercurous and mercuric salts ) , and organic mercurials . acute poisoning of this leads to corrosive bronchitis , pulmonary edema / fibrosis , diarrhea , renal dysfunction , visual and neuropsychiatric disturbances , and in severe cases , death due to respiratory failure . organic mercury compounds are absorbed completely from the intestine , converted to inorganic forms , and possess similar toxic properties . mercuric chloride is still used as wood preservative , photographic intensifier , disinfectants and also in indigenous drug formulation , and folk remedies in asian countries . once ingested , mechanism of mercury toxicity include ( a ) mercuric ions precipitate proteins that cause direct necrosis of tissues . about 8590% of mercury in the body accumulate in the kidneys causing acute renal failure due to necrosis of the proximal tubular epithelium . ( b ) inorganic mercury complexes sulfhydryl groups and causes metabolic acidosis , vasodilatation , and shock . though acute tubular necrosis is the most common lesion , tubulointerstitial nephritis and immune - mediated glomerular damage can also occur . rarely , it can present as hypertensive encephalopathy especially in children , nephrotic syndrome , chronic tubulointerstitial nephritis , or with isolated tubular dysfunction . our patient consumed mercuric chloride with suicidal intention and developed gastrointestinal erosion , anuric renal failure , and dic . franco et al . reported one patient with mercuric chloride poisoning who developed two consecutive episodes of acute renal failure by two different mechanisms , one toxic and the other immunological . renal biopsy done in that patient , showed acute tubular necrosis initially and granulomatous interstitial nephritis in the second biopsy . the international society of thrombosis and hemostasis criteria , which has 91% sensitivity and 97% specificity , was used for the diagnosis of overt dic . a score of five or higher is compatible with dic while a score below five is suggestive of dic . the possible explanation for dic was the lowered fibrinolytic activity due to inhibition of plasma plasminogen activator or the inhibition of plasminogen activation reaction catalyzed by this enzyme as demonstrated in experimental rat models . measurement of mercury levels in blood ( > 3.6 mg / dl ) and urine ( > 15 mg / dl ) may be helpful in diagnosis . chelation therapy should be considered for any symptomatic patient with a history of acute elemental mercury exposure . chelating agents include dimercaprol ( bal ) , 2,3-dimercaptopropane-1-sulfonate ( dmps ) , dimercaptosuccinic acid , and penicillamine . hemodialysis is not effective in removing mercury , but can enhance the removal of the dimercaprol - mercury complexes . the outcome depends on the form of the mercury compound and severity of the exposure . we did not do urine mercury levels , and the patient had not received any chelating agents as toxicological analysis was done much later . we conclude that mercury poisoning should be considered in case of aki and dic though it is a rare complication . prompt treatment with chelating agents guided by measurement of mercury levels will have an impact on the favorable clinical outcome .

mercury is a toxic heavy metal and occurs in organic and inorganic forms . inorganic mercury includes elemental mercury and mercury salts . mercury salts are usually white powder or crystals , and widely used in indigenous medicines and folk remedies in asia . inorganic mercury poisoning causes acute kidney injury ( aki ) and gastrointestinal manifestations and can be life - threatening . we describe a case with unknown substance poisoning who developed aki and disseminated intravascular coagulation ( dic ) . renal biopsy showed acute tubular necrosis . later , the consumed substance was proven to be mercuric chloride . his renal failure improved over time , and his creatinine normalized after 2 months .

Introduction Case Report Discussion Financial support and sponsorship Conflicts of interest

hair dyes are perhaps among the most commonly used cosmetics by elderly and the young alike - for concealing gray hair by the former or just for a fashion statement by the latter . the popularity of hair colouring can be gauged from the fact that the median age for debut was 16 years and nearly 75% of women and 18% of men had dyed their hair at some point in their lives according to a danish population - based study . this rising trend of hair colouring has resulted in an increased prevalence of hair dye - associated adverse effects accounting for 5.3% of danish persons who dyed their hair . similarly , 42% of the respondents reported adverse reactions from use of hair dyes and the mean age of hair dye debut was 27 years in an indian study . hair dyes include a variety of coloring agents such as 2,7-naphthalenediol , 2-aminomethyl - p - aminophenol hydrochloride , 2-chloro - p - phenylenediamine , n - phenyl - p - phenylenediamine , and o - aminophenol , p - aminophenol . although all these agents can cause allergic contact reactions , p - phenylenediamine ( ppd ) remains the most commonly implicated agent for the contact sensitivity . it is an effective compound for hair dyes due to its low molecular weight , high protein- binding capacity , and ability to penetrate the hair shaft . apart from being a common constituent in varying concentrations of nearly 70% of the hair colorants available worldwide , it is also present in dyes for henna tattoos , textiles , leather and fur , and black rubbers . being a member of 1,4-substituted benzenes , it cross - reacts with para - amino benzoic acid ( paba ) , sulphonamides , para - amino salicylic acid , ester anesthetics , thiazides , sesquiterpene - lactone mix , and azo dyes . it is a potent contact sensitizer even in low concentration and considered a best indicator and useful patch test screening allergen for hair dye dermatitis . the reported prevalence of positive patch test reactions to ppd among dermatitis patients is 4.4% in asia , 4.1% in europe , 6.0% in north america , and 11.5% in india . the clinical features of hair dye dermatitis vary from mild contact dermatitis localized to one body site ( hand dermatitis ) or disseminated generalized dermatitis to severe life - threatening complications such as contact urticaria / angioedema , rhinitis / bronchospasm / asthma , and renal toxicity . the most common clinical presentations include contact dermatitis localized to sites of contact or photoexposed skin , periorbital dermatitis , airborne contact dermatitis , hand dermatitis , and rarely erythema multiforme - like lesions . in this pilot study , we present our clinico - epidemiological observations and patch test results of ppd contact sensitivity in patients suspected to have hair dye dermatitis . eighty ( m : f 47:33 ) consecutive patients suspected to have hair dye allergy were enrolled for the study after obtaining informed consent . patients having acute dermatitis were patch tested after control of their dermatitis , when they were off systemic corticosteroids or the dose of prednisolone was < 20 mg / day . details about age , gender , occupation , personal or family history of atopy ( nasobronchial allergy , asthma , childhood eczema ) , use of hair dye and its duration , onset , duration , and distribution of dermatitis were noted . the enrolled patients were patch tested by finn chambers method with indian standard patch test series including ppd ( 1.0% pet ) recommended by contact dermatitis and occupational dermatoses forum of india . patches were applied on the upper back and the patients were asked to return for results after 48 hrs ( d2 ) and 72 hrs ( d3 ) . the results were graded according to the international contact dermatitis research group criteria . only reactions persisting on d3 were considered positive for final analysis . side effects such as adhesive tape reaction , discomfort and itching , flare of dermatitis , angry back phenomenon , active sensitization , and pigment alteration at test site , when they occurred , were recorded . the study included 47 ( 58.8% ) males aged between 19 and 74 years and 33 ( 41.2% ) females aged between 18 to 74 years . the majority , that is , 57 ( 71% ) patients were older than 40 years , while whereas 23 ( 29% ) were younger than 40 years , the youngest being a 19-year - old male . forty six ( 57.5% ) patients were from an urban background and 34 ( 42.5% ) patients belonged to a rural background . among the males , 21 ( 44.7% ) were office goers , 9 ( 19.1% ) shopkeepers , and 6 ( 12.7% ) defence personnel . among females 30 ( 90.9% ) were housewives and 3 ( 9.09% ) were students . the duration of hair dye usage varied from less than one month in 11 ( 13.8% ) to more than three years in 17 ( 21.2% ) patients . other 52 ( 65% ) patients were using hair dyes for variable period of 1 month to 3 years . the duration of dermatitis varied from < 1 month in 11 ( 13.8% ) patients and > 1 year in 27 ( 33.7% ) patients ; forty - two ( 52.5% ) patients had dermatitis between one month and one year . clinically , characteristic acute ( erythematous , edematous , oozy , crusted eczematous plaques ) , subacute and chronic dermatitis ( hyperpigmented , lichenified eczematous lesions ) involving multiple sites such as scalp , scalp margins , forehead , eyelids , beard , neck , upper back , and/or hands was observed in all cases . additionally , the most common patterns of hair dye dermatitis observed were contact dermatitis localized to scalp and/or scalp margins in 49 , followed by dermatitis of face ( including beard and periorbital skin ) and neck in 23 and hands and/or feet in 12 patients , respectively . other patterns observed were airborne contact dermatitis in 9 , hand dermatitis in 5 , eyelid dermatitis in 4 , and discoid dermatitis and disseminated dermatitis in 1 ( 1.85% ) patient each . one patient had generalized diffuse dermatitis and another patient showed erythema multiforme - like lesions . none of the patients had followed the manufacturer 's instructions to perform sensitivity testing prior to applying the hair dye . baseline characteristics of the patients studied only 54 ( 67.5% ) patients comprising 33 ( 61% ) males and 21 ( 39% ) females aged between of 19 and 74 years showed positive results to patch testing with ppd . eight of these patients also showed positive patch test reaction to other allergens ; fragrance mix in 5 , thiuram mix in 3 , and paraben mix and colophony in 1 patient each . thirty ( 55.5% ) patients belonged to urban populations and 24 ( 44.5% ) patients were from rural background . the common clinical patterns noted were : ( a ) dermatitis localized to the scalp , face , neck or hands , ( b ) airborne dermatitis , ( c ) chronic actinic dermatitis ( actinic reticuloid ) , ( d ) generalized diffuse dermatitis , and ( e ) erythema multiforme - like dermatitis [ figures 1 to 5 ] . ppd contact dermatitis localized to face , cheeks , nose , neck , and dorsal hands in photodistributed pattern ppd contact dermatitis localized to eyelids and periorbital skin ppd contact dermatitis localized over neck . she also had dermatitis involving the scalp skin ( a ) chronic actinic dermatitis ( actinic reticuloid ) due to ppd . ( b ) patch test shows 3 + reaction to ppd ppd induced erythema multiforme - like lesions over ( a ) upper back and ( b ) palms . the use of hair colorants has increased exponentially over the last few decades due to increased societal pressure and changing fashion trends . over the years , the colouring agents have diversified in nature with the arrival of oxidative hair dyes that include many synthetic and natural agents . the more commonly used hair dye agents include resorcinol , henna , hydroquinone , lead acetate , m - aminophenol , n - phenyl - p - phenylenediamine , o - aminophenol , p - aminophenol , and ppd or related para - amino compounds such as toluene-2,5-diamine sulfate . nearly 5% of 21,515 individuals were allergic to ppd in a multicentric european study . similarly , ppd was the commonest sensitizer among cosmetics in two separate indian studies . hairdressers and textile dye workers are particularly at risk and have high prevalence of ppd contact dermatitis varying between of 15% and 45% or as high as 58% because of high occupational exposure . apart from hair colorants , sensitization may also occur from ppd in textile or fur dyes , black rubber , temporary tattoos , and photocopying and printing inks . similarly , hair dye dermatitis is observed among urban dwellers more often than in their rural counterparts ; a prevalence of 84% versus 16% among urban versus rural population has been observed in a previous study . this trend may be because of easy availability of hair dyes , increased awareness , and peer pressure to look younger among the urban population . sensitization from ppd can occur at any age including among children as it depends mainly upon exposure to the allergen . the weighted average of ppd sensitization in the general population is estimated to be 1.0% . however , the prevalence of ppd sensitivity varies according to cultural and occupational practices and a higher prevalence is seen in asia ( 2%12% ) , particularly among asian males . most cases occur in middle - aged individuals between 30 and 50 years of age and males are affected two times more than the females . this increased prevalence in middle - aged people has been attributed to the frequent use of hair dye in order to camouflage their greying hair . higher sensitization to hair dye among males is probably due to the more frequent applications that are required for facial ( beard ) hair as compared to scalp hair . clinically , hair dye dermatitis can present as both irritant dermatitis and allergic contact dermatitis . it may also cause severe clinical contact reactions ranging from anaphylaxis to oedema of the scalp , face , and eyelids . scalp and scalp margins , and beard skin are the reported sites that are commonly affected due to hair dye usage , while hands and other body sites may be affected among persons not using gloves while dying hair . mild to moderate contact reactions such as erythema , oozing , and ulceration typically at the scalp margin , and on the ears and neck are common as a result of direct contact . ho et al . observed that hair dye dermatitis primarily involved the face and neck ( 28% ) , and hands ( 25% ) , whereas widespread dermatitis occurred in 17% of patients . airborne contact dermatitis , irritant contact dermatitis , photocontact dermatitis , periorbital eczema , hand eczema , lichenoid lesions , and lichen planus pigmentosus - like pigmentary changes were the commonly observed clinical patterns of hair dye dermatitis , whereas contact leukcoderma , contact urticaria , lymphomatoid papulosis , erythema multiforme - like or prurigo nodularis - like lesions , and anaphylaxis have occurred atypically with ppd . localized contact dermatitis was observed in nearly all our patients , particularly involving the scalp and/or scalp margin in 49 patients , face , beard , and periorbital skin in 23 , and hands and feet in 12 patients . uncommon patterns such as airborne contact dermatitis ( 9 patients ) , hand dermatitis ( 5 patients ) , eyelid dermatitis ( 4 patients ) , disseminated dermatitis and erythema multiforme - like lesions ( 1 patient each ) were also observed in this series . although ppd is not considered photosensitizing , dermatitis localized to photoexposed skin and chronic actinic dermatitis ( actinic reticuloid ) in a few patients suggests its possible photosensitizing potential . it is also possible that persistence of allergen and photoaggravation of dermatitis is responsible for photolocalization of ppd induced dermatitis in some individuals . contact sensitivity to fragrance mix , colophony , paraben mix , and thiuram mix , observed in eight patients was perhaps due to prior sensitisation as they are present in most topical medications , cosmetics , perfumes , and pharmaceuticals . prohaptens and their metabolites in the skin , particularly the p - benzoquinone , are considered responsible for its allergenicity and cross - reactivity . another postulation is that bandrowski 's base , a trimer of ppd formed on exposure , is perhaps responsible for its allergenicity . however , patch testing with these agents individually is negative in a sizeable population of patients who had tested positive to for ppd . a genetic polymorphism in the cutaneous metabolism of ppd too has been suggested to explain why only a few persons using hair dyes develop contact sensitivity or variable allergic responses from to it . reported a personal history of atopy in 24% of their patients with cosmetic contact sensitivity . atopic individuals are perhaps at an enhanced risk of for cosmetic contact sensitivity because of increased allergen penetration through impaired skin barrier . a personal history of atopy was observed in 18 ( 33% ) patients in our study . the european union cosmetic directive allows a maximum concentration of 6% ppd in hair dyes , while the bureau of indian standards has set a maximum permissible limit of 30% and not less than 3% ppd after dilution of the powder form and a maximum of 4% and not less than 1.2% after dilution of the oxidation liquid type . however , many manufacturers fail to comply with these standards , and a strict legislation is perhaps needed for adherence to safe limits of ppd in hair dyes . it is also desirable that manufacturers print directions in bold text over the product package regarding safe use of the hair dye . there is also an urgent need to increase awareness among consumers regarding the adverse effects of hair dyes , the available safer alternatives , and the significance of performing sensitivity testing prior to actual use , in adherence of usage instructions . the hair dyes usually have two separate components , the colorant and the developer that are mixed before application . we did not patch test these agents in our study and that might have been responsible for negative patch test results in 26 of our patients . unavailability of hair dye allergens other than ppd , the small number of patients , and not testing with patient 's own hair colorant or other cosmetics may have resulted in our missing some cases of compound allergy . the hair dyes usually have two separate components , the colorant and the developer that are mixed before application . we did not patch test these agents in our study and that might have been responsible for negative patch test results in 26 of our patients . unavailability of hair dye allergens other than ppd , the small number of patients , and not testing with patient 's own hair colorant or other cosmetics may have resulted in our missing some cases of compound allergy .

background : the contact allergic reactions from p - phenylenediamine ( ppd ) in hair dyes vary from mild contact dermatitis to severe life- threatening events ( angioedema , bronchospasm , asthma , renal impairment).objectives : to study the clinical patterns and ppd contact sensitivity in patients with hair - dye dermatitis.materials and methods : eighty ( m : f 47:33 ) consecutive patients aged between 18 and 74 years suspected to have contact allergy from hair dye were studied by patch testing with indian standard series including p - phenylenediamine ( ppd , 1.0% pet).results:54 fifty - four ( m : f 21:33 ) patients showed positive patch tests from ppd . eight of these patients also showed positive patch test reaction from fragrance mix , thiuram mix , paraben mix , or colophony . fifty - seven ( 71% ) patients affected were aged older than 40 years . the duration of dermatitis varied from < 1 month to > 1 year with exacerbation following hair coloring . forty - nine patients had dermatitis of scalp and/or scalp margins and 23 patients had face and neck dermatitis . periorbital dermatitis , chronic actinic dermatitis , and erythema multiforme - like lesions were seen in 4 , 2 , and 1 patients , respectively.conclusions:hair dyes and ppd constitute a significant cause of contact dermatitis . there is an urgent need for creating consumer awareness regarding hair - dyes contact sensitivity and the significance of performing sensitivity testing prior to actual use .

INTRODUCTION MATERIALS AND METHODS RESULTS AND OBSERVATIONS DISCUSSION Limitations

eosinophilic granuloma ( eg ) , a benign local bone disease , is classified as the mildest form of langerhans ' cell histiocytosis ( lch ) . eg predominantly affects children , adolescents , and young adults , and the skull is the most common site of involvement.5 ) the pathologic diagnosis of eg can be confirmed by positive stains of cd1a antigen and protein s-100 or when intracytoplasmic organelles ( birbeck granules ) are detected using electron microscopy.11 ) the most common symptom of eg is a tender , growing scalp mass , but it can be asymptomatic and incidentally found on skull x - rays . the clinical course is benign with a tendency to spontaneous regress ; however , eg may also recur . it is common to prove the antecedent of a mild head trauma preceding clinical symptoms . a-6-year - old boy was referred to our hospital with a soft mass on the midline of his forehead . he had undergone surgery for eg in the vertex 19 months ago ( figure 1 ) . one month prior to minor head trauma , a follow - up computed tomography ( ct ) ( figure 2 ) was performed to check for recurrence , and none was found . one week before his arrival at the hospital , he had hit his head , and the resulting mass grew rapidly after the trauma . the findings of the neurological examination were unremarkable , except for a non - tender , soft , and immobile mass . the three - dimensional ( 3d ) ct showed a lytic bony defect on the frontal bone without hemorrhage ( figure 3a and b ) and the enhanced magnetic resonance imaging ( mri ) revealed a 1.4 cm - sized growing mass on the midline of the forehead ( figure 3c and d ) . the level of erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) was within normal limits . the protruding mass extended from the scalp through the defect in the frontal bone , and was visualized when the scalp flap was reflected ( figure 4a ) . after removal of the bone flap and tumor , it was noted that there was no hematoma and the dura mater was intact without invasion ( figure 4b ) . the tumor was removed completely and the bony defect was replaced with bone cement ( figure 4c ) . the histopathological examination revealed numerous oval langerhans ' cells and eosinophils ( figure 5a and b ) . the langerhans ' cells were stained for cd1a and s-100 ( figure 5c and d ) . the patient was followed - up six months after the operation and had a normal neurologic examination at that point . lch is a unifocal or multifocal disorder of the bone or soft tissue , most often appearing as a lytic lesion of the skull . eg is the mildest form of lch.5 ) the exact incidence of eg is not well known but vandenberg and coley12 ) found that it accounted for only 2.4% of benign skull tumors . in the series of cases studied by jelsma and ross,4 ) the most common symptom of eg is a tender , enlarged scalp mass on the parietal and frontal bones . eg may be asymptomatic and only discovered on a skull x - ray by chance . the x - ray radiologic findings consist of a punched - out , skull lesion with sharply defined margins . as the clinical and radiologic findings are not specific enough to determine the diagnosis , cytology is very helpful in diagnosing eg . the key feature is the identification of characteristic langerhans cells in a background of eosinophils and red blood cells.5 ) there is no definite disease etiology for eg . however , autoimmune diseases , inflammatory processes , and uncontrolled langerhans cell replication can be considered to be etiological factors.3 ) also , minor trauma is considered an etiologic factors . there have been six reported cases of eg associated with epidural hematoma ( table 1).1678910 ) the possible mechanisms of epidural hematomas in the six cases consisted of a rupture of the tumor cyst , communicating with the epidural vein and the sinus pericranii , or a head trauma - related intratumoral hemorrhage , which subsequently penetrated into the epidural space . all six cases were associated with epidural hemorrhages , while our case was not . in our case , no hematoma or hemorrhage was found in the ct / mri image , or in intraoperative and pathologic findings . the patient in our case regularly visited the clinic for follow - up appointments due to his history of eg . the ct scan taken one month prior to the trauma showed no definite recurrence ; however , a newly developed eg lesion was found one week after the trauma . this indicates that the development of eg may be associated with trauma . in this case , it is thought that eg developed through a local inflammatory response due to a minor trauma . trauma may be a trigger factor of the inflammatory response instead of the etiology of the disease . the elevated levels of esr and crp are found in some , but not all , cases of eg . this is because eg lesions are limited to local level and the time between diagnosis and trauma varies . in the present case , the author finds the period between the trauma and diagnosis to be relatively long . factors related to hematoma formation may include the trauma 's intensity and the time interval after the trauma . for example , in one case , a patient with an epidural hematoma had a two - week time interval , with a fluid level confirmed four weeks later . in the management of solitary eg , surgical excision is recommended and radiotherapy can be considered as an adjuvant therapy if necessary . some authors advocate surgical excision followed by postoperative treatment that includes low - dose radiotherapy , intralesional application of corticosteroids , or a combination of chemotherapy and radiotherapy.11 ) other studies found that solitary calvarial eg in skeletally immature patients 14 years of age or younger resolved fully without any recurrence.2 ) eg is responsive to steroid treatment and this indicates that the etiology of eg is associated with local inflammatory processes . to avoid surgical procedures , the prognosis depends on the age of the patient at the time of diagnosis and the number of lesions . the local recurrence rate is 6% , and new lesions appear in about 22% of patients , therefore , long - term follow - up is recommended.311 ) our case suggests that minor trauma may be an aggravating factor for the progression of eg , based on the radiological findings before and after the trauma . thus , careful observation with regular follow - up is needed for patients with eg after trauma .

the authors present a case of rapidly progressing eosinophilic granuloma ( eg ) of the skull without hemorrhage after minor trauma . a 6-year - old boy presented with a soft mass on the midline of his forehead . he had a surgery for eg 19 months ago . one month earlier , computed tomography ( ct ) and bone scans were performed to evaluate the possible recurrence of eg , and there was no evidence of recurrence in ct . however , a slightly increased uptake in the bone scan was noted on the midline of the forehead . a rapid growing mass developed in a new spot after a minor trauma 7 days before the patient arrived at the clinic . his physical examination was unremarkable , except for a non - tender , soft , and immobile mass . a plain skull x - ray and ct showed a lytic bony defect on the midline of the frontal bone . magnetic resonance imaging showed a 1.4 cm sized enhancing mass . surgical resection and cranioplasty were done . the role of trauma in the development of eg is unclear . however , our case suggests that minor trauma is an aggravating factor for eg formation . careful observation with regular follow - up is necessary in patients with eg after minor trauma .

Introduction Case Report Discussion Conclusion

situs inversus totalis , a congenital anomaly present in approximately 0.01% of the population , results in complete mirror - image reversal of all the thoracic and abdominal organs . the laparoscopic literature has several reports of successful bariatric procedures in patients with situs inversus despite the extremely low prevalence of this condition.[13 ] while several equivalent alternatives are available in the bariatric algorithm , more recently the laparoscopic sleeve gastrectomy ( sg ) has been gaining traction as an effective means of weight loss in patients with morbid obesity.[47 ] a 39-year - old woman who had previously undergone an open gastric banding procedure 20 months earlier for morbid obesity presented with increased weight gain . her weight at presentation was 106 kg ( body mass index 42 kg / m ) , a percentage excess weight loss ( ewl ) of only 1.9% . her medical history was significant for hypertension , noninsulin - dependent diabetes mellitus , hypothyroidism , obstructive sleep apnea , and situs inversus totalis . the presence of situs inversus was initially discovered during her first weight loss operation and confirmed by computed tomography of the abdomen [ figure 1 ] . the operating surgeon began the case laparoscopically , but upon recognizing the altered anatomy made the decision to convert to an open gastric band placement . given the failure of this first procedure to produce meaningful weight loss , the patient was scheduled for laparoscopic removal of the gastric band with concurrent sg . coronal computed tomographic scan of the abdomen and pelvis with oral and intravenous contrast demonstrating the mirror - image anatomy . panel a displays a cross - section of the band in its position on the right side of the abdomen . panel b further demonstrates the altered anatomy with left - sided liver and right - sided stomach the patient was positioned supine on the operating room table . secondary to the presence of situs inversus , the veress needle was placed in the right upper quadrant to avoid the liver . a 12-mm trocar was placed five fingerbreadths above the umbilicus , just to the right of midline . next , a 5-mm trocar was placed in the left lower quadrant approximately two fingerbreadths below the umbilicus in the midclavicular line . a 12-mm port was then placed under direct vision in the left midclavicular line approximately five fingerbreadths above the umbilicus . a 12-mm port was placed in the right upper quadrant in the midclavicular line , and a 5-mm port was placed in the right upper quadrant one fingerbreadth below the costal margin in the midaxillary line [ figure 2 ] . exploration revealed extensive adhesions as a result of her previous open procedures . at this point , the stomach was identified and noted to be severely adhered to the liver , which was , in turn , adherent to the abdominal wall . the stomach was mobilized , the band was identified , and the band buckle was cut and removed . the previous fundoplication was taken down using a 3.5-mm depth 45-mm length stapler , and the greater curvature and short gastric vessels were divided using a harmonic scalpel . after performing the dissection all the way to the angle of his and exposing the left crux of the diaphragm , a 34-french bougie was placed into the stomach with the tip of the bougie sitting in the proximal duodenum . the formation of the gastric sleeve with a 4.8-mm depth 45-mm length stapler was started from a point 5 cm proximal to the pylorus muscle and directed toward the angle of his [ figure 3 ] . eight total firings were used , thus dividing the stomach completely and forming a gastric tube over the 34-french bougie . at the most proximal aspect of the stomach , several dense adhesions to the diaphragm were encountered and eventually taken down . following the formation of the gastric tube , the staple line was oversewn with 2 - 0 absorbable suture using an endo stitch ( covidien inc . , after submerging the gastric tube underwater , air was pumped into the scope , and subsequently no leak was appreciated . before removal of the last trocar , the detached stomach was placed into a specimen retrieval bag and removed from the peritoneal cavity via the 12-mm port in the right upper quadrant . the same trocar site was slightly extended to allow for removal of the port and band . finally , a jackson pratt drain was placed by the sleeve for surveillance purposes . novel port placement ( copyright sages 2010 , soper nj , swanstrom ll , eubanks ws , eds . mastery of endoscopic and laparoscopic surgery ) intraoperative image ( white arrow indicates the angle of his ; blue arrows indicate several gastrohepatic adhesions , and black arrows indicate the greater curvature of the stomach ) the postoperative course was complicated by a leak resulting in a 3.9 2.8 cm collection in the gastrosplenic ligament adjacent to the surgical suture line [ figure 4 ] . a jackson pratt drain was left alongside the sg at the time of surgery as this is the surgeons protocol for revisional surgery . the patient underwent an upper endoscopy and placement of a 12-cm removable polyflex stent ( boston scientific inc . , natick , ma ) for management of the leak [ figure 5 ] . over the next few weeks further imaging demonstrated interval migration of the stent into the stomach with no change in the size or location of the perigastric collection [ figure 6 ] . the patient was managed conservatively despite the stent movement and had eventual resolution of her symptoms . the stent was subsequently removed without any complications . currently , the patient is 2 years out from the laparoscopic sg . postoperative upper gi series demonstrating extravasation of contrast at the most proximal aspect of the staple line completion radiograph following endoscopic placement of a removable stent across the anastamotic leak site coronal computed tomographic scan of the abdomen and pelvis with oral and intravenous contrast demonstrating complete migration of the stent into the body of the stomach secondary to the presence of situs inversus , the veress needle was placed in the right upper quadrant to avoid the liver . a 12-mm trocar was placed five fingerbreadths above the umbilicus , just to the right of midline . next , a 5-mm trocar was placed in the left lower quadrant approximately two fingerbreadths below the umbilicus in the midclavicular line . a 12-mm port was then placed under direct vision in the left midclavicular line approximately five fingerbreadths above the umbilicus . a 12-mm port was placed in the right upper quadrant in the midclavicular line , and a 5-mm port was placed in the right upper quadrant one fingerbreadth below the costal margin in the midaxillary line [ figure 2 ] . exploration revealed extensive adhesions as a result of her previous open procedures . at this point , the stomach was identified and noted to be severely adhered to the liver , which was , in turn , adherent to the abdominal wall . the stomach was mobilized , the band was identified , and the band buckle was cut and removed . the previous fundoplication was taken down using a 3.5-mm depth 45-mm length stapler , and the greater curvature and short gastric vessels were divided using a harmonic scalpel . after performing the dissection all the way to the angle of his and exposing the left crux of the diaphragm , a 34-french bougie was placed into the stomach with the tip of the bougie sitting in the proximal duodenum . the formation of the gastric sleeve with a 4.8-mm depth 45-mm length stapler was started from a point 5 cm proximal to the pylorus muscle and directed toward the angle of his [ figure 3 ] . eight total firings were used , thus dividing the stomach completely and forming a gastric tube over the 34-french bougie . at the most proximal aspect of the stomach , several dense adhesions to the diaphragm were encountered and eventually taken down . following the formation of the gastric tube , the staple line was oversewn with 2 - 0 absorbable suture using an endo stitch ( covidien inc . , after submerging the gastric tube underwater , air was pumped into the scope , and subsequently no leak was appreciated . before removal of the last trocar , the detached stomach was placed into a specimen retrieval bag and removed from the peritoneal cavity via the 12-mm port in the right upper quadrant . the same trocar site was slightly extended to allow for removal of the port and band . finally , a jackson pratt drain was placed by the sleeve for surveillance purposes . novel port placement ( copyright sages 2010 , soper nj , swanstrom ll , eubanks ws , eds . mastery of endoscopic and laparoscopic surgery ) intraoperative image ( white arrow indicates the angle of his ; blue arrows indicate several gastrohepatic adhesions , and black arrows indicate the greater curvature of the stomach ) the postoperative course was complicated by a leak resulting in a 3.9 2.8 cm collection in the gastrosplenic ligament adjacent to the surgical suture line [ figure 4 ] . a jackson pratt drain was left alongside the sg at the time of surgery as this is the surgeons protocol for revisional surgery . the patient underwent an upper endoscopy and placement of a 12-cm removable polyflex stent ( boston scientific inc . , natick , ma ) for management of the leak [ figure 5 ] . over the next few weeks further imaging demonstrated interval migration of the stent into the stomach with no change in the size or location of the perigastric collection [ figure 6 ] . the patient was managed conservatively despite the stent movement and had eventual resolution of her symptoms . postoperative upper gi series demonstrating extravasation of contrast at the most proximal aspect of the staple line completion radiograph following endoscopic placement of a removable stent across the anastamotic leak site coronal computed tomographic scan of the abdomen and pelvis with oral and intravenous contrast demonstrating complete migration of the stent into the body of the stomach to our knowledge , this is the first published report of a laparoscopic sg after open gastric banding in a patient with situs inversus totalis . however , modifications in the standard trocar placement can help make the procedure more technically feasible . awareness of the inherited condition before undertaking the operation allows for advanced planning and preparation . in this case , the history of prior open gastric banding made the operation especially tricky , primarily due to the numerous adhesions encountered . revisional surgery is always difficult , but when performed in a patient with situs inversus may be even more challenging . after encountering the initial disorientation , experienced we believe the postoperative leak occurred secondary to the difficult dissection around the gastric fundus , independent of the altered anatomy . these anastamotic leaks can be classified as early or late , depending on how soon postoperatively they occur . in the early period ( <3 days ) , many advocate primary repair . washout and drainage is also an excellent alternative in patients with severe inflammation , signs of sepsis , or hemodynamic instability . the endoscopic placement of polyester or nitinol covered stents is a fairly recent innovation , allowing patients to be maintained on oral enteral nutrition . there have been several reports in the literature supporting their use in both early and late leaks.[911 ] the accepted leak rate for sg is 1.6% at the esophagogastric junction and 0.8% at lower points along the staple line . laparoscopic vertical sg after open gastric banding in a patient with situs inversus can be performed safely by experienced laparoscopic surgeons . while our case yielded a good result , other similar cases are needed to establish the reproducibility and long - term efficacy of the procedure .

while several equivalent alternatives are available in the bariatric algorithm , more recently the laparoscopic sleeve gastrectomy ( sg ) has been gaining traction as an effective means of weight loss in patients with morbid obesity . we present the case of a 39-year - old woman with situs inversus totalis , who was taken to the operating room for laparoscopic sg . the patient had previously undergone a failed open gastric banding procedure 20 months earlier . awareness of the inherited condition before performing the operation allows for advanced planning and preparation . subsequent modifications to the standard trocar placement help make the procedure more technically feasible . to our knowledge , this is the first published report of a laparoscopic sg after open gastric banding in a patient with situs inversus totalis . after encountering the initial disorientation , we believe experienced laparoscopic surgeons can perform this procedure successfully and safely .

INTRODUCTION CASE REPORT Operation Postoperative DISCUSSION CONCLUSION

all 53 scz families were recruited from the afrikaner population in south africa and heritage was established by surname and by having 4 afrikaans - speaking grandparents . family history was obtained from the proband , each participating parent , and additional relatives as needed , by two independent raters , a nursing sister , who recorded pedigree information , and by the clinical interviewer , who inquired in detail about family history during the clinical interview . for additional cohort characteristics , the control cohort consisted of 22 families ( triads ) with established afrikaner heritage recruited from the afrikaner community . paternity and maternity were confirmed prior to sequencing for all case and control families via the affymetrix genome - wide human snp array 5.0 as well as via a panel of microsatellite markers . exome enrichment was conducted using the sureselect human all exon target enrichment system ( agilent technologies ) based on the methodology described in . briefly , 3 ug of genomic dna was fragmented by sonication using the covaris s2 to achieve a uniform distribution of fragments with a mean size of 300 bp . the sonicated dna was purified using agencourt s ampure xp solid phase reversible immobilization paramagnetic bead ( spri ) followed by polishing of the dna ends by removing the 3 overhangs and filling in the 5 overhangs resulting from sonication using t4 dna polymerase and klenow fragment ( new england biolabs ) . a-base was added to the 3 end of the dna fragments using klenow fragment ( 3 to 5 exo minus ) . this prepares the dna fragments for ligation to specialized adaptors that have a t-base overhang at their 3ends . the end - repaired dna with a single a-base overhang is ligated to the illumina paired - end adaptors in a standard ligation reaction using t4 dna ligase and 2 um 4 um final adaptor concentration , depending on the dna yield following purification after the addition of the a-base . following ligation , the samples were purified using spri beads , quality controlled by assessment on the agilent bioanalyzer and then amplified by 6 cycles of pcr to maintain complexity and avoid bias due to amplification . 500 ng of amplified , purified dna ( dna library ) was prepared for hybridization by adding the dna library to agilent blocking reagents , denaturing at 95 c and incubating at 65 c . hybridization buffer was added to the prepared library and the entire mix was then added to an aliquot of the agilent sureselect capture library and mixed . the dna library and biotin - labeled capture library were hybridized by incubation at 65 c for 24 hours . following hybridization , streptavidin coated magnetic beads were used to purify the rna : dna hybrids formed during hybridization . the rna capture material was digested via acid hydrolysis following elution from the purification beads . the neutralized captured dna was purified , desalted and amplified by 12 cycles of pcr using herculase ii fusion dna polymerase . the libraries were purified following amplification and the library was assessed using the agilent bioanalyzer . a single peak between 300 400 bp indicates a properly constructed and amplified library ready for sequencing . final quantitation of the library was performed using the kapa biosciences real - time pcr assay and appropriate amounts of the library were loaded onto the illumina flowcell for sequencing by paired - end 50 nt sequencing on the illumina hiseq2000 instrument . following dilution to 10 nm final concentration based on the real - time pcr and bioanalyzer results , the final library stock was then used in paired - end cluster generation at a final concentration of 6 8 pm to achieve a cluster density of 600,000/mm ( on the illumina hiseq2000 instrument ) . following cluster generation , raw sequencing data for each individual were mapped to the human reference genome ( build hg19 ) using the burrows - wheeler aligner ( bwa v0.5.81536 ) . the bwa aligned sequencing reads were processed by picard ( http://picard.sourceforge.net/ ) to label the pcr duplicates . the genome analysis toolkit ( gatk , version 5091 ) was then used to remove duplicates , perform local realignment and map quality score recalibration to produce a cleaned bam file for each individual . snp calls were made by the unified genotyper module in gatk using the cleaned bam files in batch fashion ( 90 samples per batch ) . the resulting variant call format ( vcf , version 4.0 ) files were annotated using the genomicannotator module in gatk to identify and label the called variants that are within the targeted coding regions and overlap with known and likely benign snps reported in dbsnp v132 ( ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/vcf/v4.0/00-all.vcf.gz ) . the annotated vcf files were then filtered using the gatk variant filter module with a hard filter setting and a custom script for initial filtering . variant calls that failed to pass the following filters were eliminated from the call set : i ) mq0 > = 4 & & ( ( mq0/(1.0 * dp ) ) > 0.1 ) ; ii ) qual < 30.0 || qd < 5.0 || hrun > 5 || sb > 0.00 ; iii ) cluster size 10 ; iv ) contain dbsnp i d ; v ) outside the targeted regions . combined vcf files were then split into individual files and variants in each offspring were compared to variants present in parents using a custom script pipeline in order to determine the inheritance pattern and annotate de novo mutations . because the gatk unified genotyper is set to maximize the sensitivity of variant calls , it allows for a significant portion of false positives among candidate variants even following the initial filtering process . to address this issue and eliminate potential false positive calls in the offspring and false negative calls in the parents , we took advantage of the inheritance information provided by our family design and revalidated all variants identified using the mpileup module in the sam tools ( http://samtools.sourceforge.net/ ) according to the following rules : i ) the forward reference ( fr ) count ( i.e. the number of forward reads that match the reference base at this locus ) , the reverse reference ( rr ) count ( i.e. the number of reverse reads that match the reference base at this locus ) , the forward non reference ( fnr ) count ( i.e. the number of forward reads that do not match the reference base at this locus ) and the reverse non reference ( rnf ) count ( i.e the number of reverse reads that do not match the reference base at this locus ) in the offspring must be 2 or greater ; ii ) total read depth in both parents must be 10 or greater ; iii ) both fr and rr count in both parents must be 2 or greater ; iv ) either fnr or rnr count in both parents must be 0 ; v ) the fnr and rnr count to total count ratio in the parental population ( defined as all 150 parental samples sequenced ) must be less than 1/2n , where n is the population size ; vi ) if any of rules 15 was violated , the sequence information was considered insufficient to make a de novo call at this locus . in / del calls were made by the dindel software using one cleaned bam file per run . the resulting vcf files were used to determine inheritance patterns using the same procedure described above for point mutations . to determine potential mutations at splice - donor or acceptor sites , gatk variant calls were made in a batch fashion ( with 90 samples per batch ) that covered each target coding region and 50 bp flanking segments in each direction . the polyphen-2 ( http://genetics.bwh.harvard.edu/pph2/ ) online server was used to determine the non - synonymous and synonymous nature of the mutations and predict their functional impact by further classifying them as non - tolerated ( damaging ) or benign at a given site . the grantham score for each coding variant the phylop score for each coding variant was extracted from the phylop46wayall table in the ucsc table browser ( http://genome.ucsc.edu/cgi-bin/hgtables ) . the human splicing finder ( hsf , version 2.4.1 ) software ( http://www.umd.be/hsf/ ) was used to predict potential functional impact of the mutations at splice sites . the kolmogorov - smirnov test ( ks - test ) was used to compare the distribution of phylop and grantham scores among de novo or private inherited mutations in cases . fisher s exact test or chi - square test with yates correction was used for the analysis of contingency tables depending on the sample sizes . candidate de novo variants were tested using standard sanger sequencing on an abi 3730xl dna analyzer to validate presence of each mutation in the subjects and absence in the parental genomes , by designing custom primers ( sigma ) based on ~500 bp of genomic sequence flanking each variant . de novo occurrence of mutations was not confirmed in 6 out of 46 and 2 out of 9 candidate alterations in cases and controls , respectively . all 53 scz families were recruited from the afrikaner population in south africa and heritage was established by surname and by having 4 afrikaans - speaking grandparents . family history was obtained from the proband , each participating parent , and additional relatives as needed , by two independent raters , a nursing sister , who recorded pedigree information , and by the clinical interviewer , who inquired in detail about family history during the clinical interview . for additional cohort characteristics , the control cohort consisted of 22 families ( triads ) with established afrikaner heritage recruited from the afrikaner community . paternity and maternity were confirmed prior to sequencing for all case and control families via the affymetrix genome - wide human snp array 5.0 as well as via a panel of microsatellite markers . exome enrichment was conducted using the sureselect human all exon target enrichment system ( agilent technologies ) based on the methodology described in . briefly , 3 ug of genomic dna was fragmented by sonication using the covaris s2 to achieve a uniform distribution of fragments with a mean size of 300 bp . the sonicated dna was purified using agencourt s ampure xp solid phase reversible immobilization paramagnetic bead ( spri ) followed by polishing of the dna ends by removing the 3 overhangs and filling in the 5 overhangs resulting from sonication using t4 dna polymerase and klenow fragment ( new england biolabs ) . a-base was added to the 3 end of the dna fragments using klenow fragment ( 3 to 5 exo minus ) . the end - repaired dna with a single a-base overhang is ligated to the illumina paired - end adaptors in a standard ligation reaction using t4 dna ligase and 2 um 4 um final adaptor concentration , depending on the dna yield following purification after the addition of the a-base . following ligation , the samples were purified using spri beads , quality controlled by assessment on the agilent bioanalyzer and then amplified by 6 cycles of pcr to maintain complexity and avoid bias due to amplification . 500 ng of amplified , purified dna ( dna library ) was prepared for hybridization by adding the dna library to agilent blocking reagents , denaturing at 95 c and incubating at 65 c . hybridization buffer was added to the prepared library and the entire mix was then added to an aliquot of the agilent sureselect capture library and mixed . the dna library and biotin - labeled capture library were hybridized by incubation at 65 c for 24 hours . following hybridization , streptavidin coated magnetic beads were used to purify the rna : dna hybrids formed during hybridization . the rna capture material was digested via acid hydrolysis following elution from the purification beads . the neutralized captured dna was purified , desalted and amplified by 12 cycles of pcr using herculase ii fusion dna polymerase . the libraries were purified following amplification and the library was assessed using the agilent bioanalyzer . a single peak between 300 400 bp indicates a properly constructed and amplified library ready for sequencing . final quantitation of the library was performed using the kapa biosciences real - time pcr assay and appropriate amounts of the library were loaded onto the illumina flowcell for sequencing by paired - end 50 nt sequencing on the illumina hiseq2000 instrument . following dilution to 10 nm final concentration based on the real - time pcr and bioanalyzer results , the final library stock was then used in paired - end cluster generation at a final concentration of 6 8 pm to achieve a cluster density of 600,000/mm ( on the illumina hiseq2000 instrument ) . following cluster generation , raw sequencing data for each individual were mapped to the human reference genome ( build hg19 ) using the burrows - wheeler aligner ( bwa v0.5.81536 ) . the bwa aligned sequencing reads were processed by picard ( http://picard.sourceforge.net/ ) to label the pcr duplicates . the genome analysis toolkit ( gatk , version 5091 ) was then used to remove duplicates , perform local realignment and map quality score recalibration to produce a cleaned bam file for each individual . snp calls were made by the unified genotyper module in gatk using the cleaned bam files in batch fashion ( 90 samples per batch ) . the resulting variant call format ( vcf , version 4.0 ) files were annotated using the genomicannotator module in gatk to identify and label the called variants that are within the targeted coding regions and overlap with known and likely benign snps reported in dbsnp v132 ( ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/vcf/v4.0/00-all.vcf.gz ) . the annotated vcf files were then filtered using the gatk variant filter module with a hard filter setting and a custom script for initial filtering . variant calls that failed to pass the following filters were eliminated from the call set : i ) mq0 > = 4 & & ( ( mq0/(1.0 * dp ) ) > 0.1 ) ; ii ) qual < 30.0 || qd < 5.0 || hrun > 5 || sb > 0.00 ; iii ) cluster size 10 ; iv ) contain dbsnp i d ; v ) outside the targeted regions . combined vcf files were then split into individual files and variants in each offspring were compared to variants present in parents using a custom script pipeline in order to determine the inheritance pattern and annotate de novo mutations . because the gatk unified genotyper is set to maximize the sensitivity of variant calls , it allows for a significant portion of false positives among candidate variants even following the initial filtering process . to address this issue and eliminate potential false positive calls in the offspring and false negative calls in the parents , we took advantage of the inheritance information provided by our family design and revalidated all variants identified using the mpileup module in the sam tools ( http://samtools.sourceforge.net/ ) according to the following rules : i ) the forward reference ( fr ) count ( i.e. the number of forward reads that match the reference base at this locus ) , the reverse reference ( rr ) count ( i.e. the number of reverse reads that match the reference base at this locus ) , the forward non reference ( fnr ) count ( i.e. the number of forward reads that do not match the reference base at this locus ) and the reverse non reference ( rnf ) count ( i.e the number of reverse reads that do not match the reference base at this locus ) in the offspring must be 2 or greater ; ii ) total read depth in both parents must be 10 or greater ; iii ) both fr and rr count in both parents must be 2 or greater ; iv ) either fnr or rnr count in both parents must be 0 ; v ) the fnr and rnr count to total count ratio in the parental population ( defined as all 150 parental samples sequenced ) must be less than 1/2n , where n is the population size ; vi ) if any of rules 15 was violated , the sequence information was considered insufficient to make a de novo call at this locus . in / del calls were made by the dindel software using one cleaned bam file per run . the resulting vcf files were used to determine inheritance patterns using the same procedure described above for point mutations . to determine potential mutations at splice - donor or acceptor sites , gatk variant calls were made in a batch fashion ( with 90 samples per batch ) that covered each target coding region and 50 bp flanking segments in each direction . the polyphen-2 ( http://genetics.bwh.harvard.edu/pph2/ ) online server was used to determine the non - synonymous and synonymous nature of the mutations and predict their functional impact by further classifying them as non - tolerated ( damaging ) or benign at a given site . the grantham score for each coding variant the phylop score for each coding variant was extracted from the phylop46wayall table in the ucsc table browser ( http://genome.ucsc.edu/cgi-bin/hgtables ) . the human splicing finder ( hsf , version 2.4.1 ) software ( http://www.umd.be/hsf/ ) was used to predict potential functional impact of the mutations at splice sites . the kolmogorov - smirnov test ( ks - test ) was used to compare the distribution of phylop and grantham scores among de novo or private inherited mutations in cases . fisher s exact test or chi - square test with yates correction was used for the analysis of contingency tables depending on the sample sizes . candidate de novo variants were tested using standard sanger sequencing on an abi 3730xl dna analyzer to validate presence of each mutation in the subjects and absence in the parental genomes , by designing custom primers ( sigma ) based on ~500 bp of genomic sequence flanking each variant . de novo occurrence of mutations was not confirmed in 6 out of 46 and 2 out of 9 candidate alterations in cases and controls , respectively .

despite high heritability , a large fraction of cases with schizophrenia do not have a family history of the disease ( sporadic cases ) . here , we examine the possibility that rare de novo protein - altering mutations contribute to the genetic component of schizophrenia by sequencing the exome of 53 sporadic cases , 22 unaffected controls and their parents . we identified 40 de novo mutations in 27 patients affecting 40 genes including a potentially disruptive mutation in dgcr2 , a gene removed by the recurrent schizophrenia - predisposing 22q11.2 microdeletion . comparison to rare inherited variants revealed that the identified de novo mutations show a large excess of nonsynonymous changes in cases , as well as a greater potential to affect protein structure and function . our analysis reveals a major role of de novo mutations in schizophrenia and also a large mutational target , which together provide a plausible explanation for the high global incidence and persistence of the disease .

METHODS Cohorts Exome library construction Library capture and sequencing Exome data analysis for Statistics None Supplementary Material

animal models with a human hematopoietic and immune system are now important tools for studying the human immune system as well as human - specific infections , such as hiv-1 [ 1 , 2 ] . recent approaches have involved the use of genetically immunodeficient mice that have been reconstituted using human - derived hematopoietic stem cells ( hscs ) ( known as humanized mice ) . several immunodeficient mice have been developed and nod / scid mice with nk defective genetically modified mice are mainly used for this approach [ 35 ] , because they exhibit deficiencies in macrophage and dendritic cell function , and complement as well as t and b lymphocyte deficiencies . rag-2c mice are also commonly used for establishing humanized mice [ 7 , 8 ] , and it is known that the genetic background of rag-2c mice is influenced by the efficiency of human cell engraftment . jak3 is a non - receptor - type tyrosine kinase crucial for mediating signaling from the common -chain of cytokine receptors , and jak3-deficient mice and common -chain - deficient mice show the same phenotype . based on these findings , we generated rag-2jak3 mice with c57/bl6 and balb / c genetic backgrounds . balb / c rag-2jak3 mice showed high efficiency of both human cd34 hematopoietic stem cell ( hsc ) and peripheral blood mononuclear cell ( pbmc ) transplantation compared with c57/bl6 rag-2jak3 mice . our data show that the genetic background of the mice influences human cell engraftment and balb / c rag-2jak3 mice are becoming an alternative source of humanized mice . c57/bl6 rag-2/jak3 double - deficient mice were established by crossing rag-2-deficient mice ( obtained from the center for animal resources and development , kumamoto university , japan ) and jak3-deficient mice ( kindly provided by dr . balb / c rag-2-deficient ( rag-2 ) mice and balb / c jak3-deficient ( jak3 ) mice were established by crossing rag-2 mice or jak3 mice with the balb / c strain for 10 generations , respectively . balb / c rag-2/jak3 double - deficient ( rag-2jak3 ) mice were established by crossing balb / c rag-2 mice and balb / c jak3 mice , and were housed and monitored in our animal research facility according to institutional guidelines . all experimental procedures and protocols were approved by the institutional animal care and use committee at kumamoto university . peripheral blood and umbilical cord blood samples were collected after obtaining written informed consent and approval from the ethics committee of kumamoto university faculty of medical and pharmaceutical sciences . cd34 cells were isolated using the cd34 progenitor cell isolation kit ( miltenyi biotec , sunnyvale , ca ) and transplanted into the liver of irradiated ( 4.0 gy ) newborn mice . at 12 weeks after transplantation , peripheral blood was obtained and analyzed by flow cytometry . peripheral blood mononuclear cells ( 2 10 cells ) were transplanted into 5.0 gy irradiated adult mice ( 810 weeks old ) as described . at 2 weeks after transplantation , mouse spleen cells were stained with dx5-fitc ( pan nk marker ) , mcd122 ( il-2r)-pe , mcd19-apc , and mcd3-pe / cy7 ( ebiosciences , san diego , ca ) to detect murine lymphocytes . peripheral blood samples were obtained from the retro - orbital sinus of transplanted mice , and red blood cells were lysed with an ammonium chloride - potassium buffer and stained with antimouse cd45-apc / cy7 and antihuman cd45-pb ( biolegends , san diego , ca ) . cells were washed and resuspended in pbs supplemented with 3% fcs , 0.02% nan3 , and 1 g / ml propidium iodide and were analyzed using lsr ii ( bd biosciences , san jose , ca ) . k562 cells ( obtained from riken cell bank , tsukuba , japan ) were cultured in rpmi1640 medium ( sigma ) supplemented with 10% fbs , and were transplanted subcutaneously into the right flank of c57/bl6 rag-2jak3 mice and balb / c rag-2jak3 mice . the generated c57/bl6 rag-2jak3 mice and balb / c rag-2jak3 mice survived and bred well under the specific pathogen - free conditions . to confirm the predicted immunophenotype of c57/bl6 rag-2jak3 mice and balb / c rag-2jak3 mice , single - cell suspensions from spleen cells were labeled with fluorescent antibodies against mouse dx-5 ( pan nk marker ) , cd122 ( il-2r ) , cd3 ( t - cell marker ) , and cd19 ( b - cell marker ) . in contrast to wild - type mice , no b ( cd20 positive ) and t ( cd3 positive ) lymphocytes or nk cells ( dx-5 and cd122 double - positive cells ) were detected in either c57/bl6 or balb / c rag-2jak3 mice ( figure 1 ) . to determine the engraftment efficiency of human hematopoietic stem cells , 2 10 cord blood - derived cd34 cells from normal volunteers were injected intrahepatically into c57/bl6 rag-2jak3 mice and balb / c rag-2jak3 mice as described [ 5 , 7 ] . levels of human cell engraftment were determined 12 weeks later ( figure 2(a ) ) . of the engrafted c57/bl6 rag-2jak3 mice , 18 of 28 mice had less than 0.1% of human cd45 cells , and only 2 had > 10% human cd45 cells in the peripheral blood ( 1.7 4.5% , n = 28 ) . in contrast , balb / c rag-2jak3 mice were highly engrafted and reconstituted with human cells ( 37.8 21.5% , n = 24 ) ( figure 2(b ) ) . to determine the engraftment efficiency of human primary lymphocyte populations , 2 10 pbmcs from normal volunteers were injected intraperitoneally into c57/bl6 rag-2jak3 mice and balb / c rag-2jak3 mice . although human cells ( human cd45 cells ) were detected in c57/bl6 rag-2jak3 mice , the degree of engraftment was very low ( 1.7 4.5% , n = 13 ) . in contrast , balb / c rag-2jak3 mice were highly engrafted with human cells ( 37.8 21.5% , n = 12 ) ( figure 3 ) . subcutaneous administration of k562 cells resulted in solid tumor formation in both strains of rag-2jak3 mice . the weight of tumors in both strains showed no significant difference ( c57/bl6 : 0.59 0.26 g , n = 7 , balb / c 0.63 0.33 g , n = 7 , p > in this study , we established c57/bl6 and balb / c strains of rag-2jak3 mice , and showed that balb / c rag-2jak3 mice supported a high level of human lymphohematopoietic cell engraftment , whereas c57/bl6 rag-2jak3 mice achieved little engraftment . interestingly , both strains supported the engraftment of human hematopoietic malignancy . humanized mice with reconstituted human hematopoietic and immune cells are becoming a powerful tool for the investigation of human biological systems and for translational research . nod / scid mice have been used for these purposes ; however , human hematopoietic stem cell engraftment is not sufficient and functionally mature lymphocytes are not developed in these mice , mostly due to residual nk activity in this mouse . to overcome these limitations , nod / scid mice were intercrossed with nk defective genetically modified mice , and several strains of mice suitable for humanized mice were established [ 35 ] . among them , nod / scid/c ( nog and nsg ) mice are becoming the gold standard for generating humanized mice . recently , spira gene polymorphism has been identified as a determinant influencing the efficacy of human hematopoietic stem cell engraftment into the nod / scid strain . meanwhile , stroma cells of the balb / c strain have been shown to support human hematopoiesis to a lesser extent but not other strains ( c57/bl6 , c3h , icr ) , indicating that other mechanisms support human cell engraftment in immunodeficient mice than spira gene polymorphism . in fact , manz and colleagues described the reconstitution of human acquired and innate immunity in balb / c rag-2c mice . although no study has compared reconstitution efficiency directly between nod / scid/c mice and balb / c rag-2c mice , the efficiency of human hematopoietic stem cell engraftment seems to be higher in nod background from the previous studies [ 1 , 2 ] . however , the efficiency of reconstitution in balb / c rag-2c mice is high enough for human immune and hematopoietic cell research ( figures 2 and 3 ) and balb / c background has several advantages compared with nod / scid background . mice with the scid mutation lack functional t and b lymphocytes resulting from the absence of gene recombination events in t - cell receptors ( tcrs ) and immunoglobulins ; however , they are known to show a leaky phenomenon in which functional t and b lymphocytes are produced with aging or ionized irradiation [ 13 , 14 ] . in addition , the prkdc gene disrupted by the scid mutation is expressed broadly and is involved in dna repair , while expressions of rag-1 and rag-2 are limited to hematopoietic cells and are involved only in dna recombination of t- and b - cell receptor genes , indicating that scid mice are more sensitive to radiation - induced dna damage than their rag-1 or rag-2 counterparts . established radioresistant nod rag-1c mice and showed that they support a similar level of human lymphohematopoietic cell engraftment , which could overcome the disadvantages of the scid mutation . the nod / scid strain has a predisposition to thymic lymphoma due to an endogenous ectopic provirus ( emv-30 ) . nod / scid and nod / scid/2 m mice have a short mean life span for this reason [ 6 , 17 ] , while nod / scid/c ( nog and nsg ) mice do not develop thymic lymphoma for an unknown reason . balb / c strain could overcome these disadvantages of nod / scid strain , although efficiency of human hematopoietic stem cell engraftment is not better than nod / scid strain . as the strain background is known to affect human - cell engraftment and to function markedly in scid mice [ 1 , 2 , 18 ] , we established and directly compared c57/bl6 and balb / c strains of rag-2jak3 mice . rag-2jak3 mice showed the same phenotype as rag-2c mice lacking t , b , and nk cells ( figure 1 ) . the efficiency of human hematopoietic stem cell and pbmc engraftment in c57/bl6 rag-2jak3 mice was extremely poor , although balb / c mice and rag-2jak3 mice appeared to have similar levels as balb / c rag-2c mice ( figures 2 and 3 ) . the breeding performance of balb / c rag-2c mice was the same as balb / c mice in our study . in addition , balb / c rag-2c mice were relatively radioresistant compared with nod / scid strains . thus , balb / c rag-2jak3 mice are a very useful strain of immunodeficient mice derived from animals with defined molecular lesions and have distinct advantages over nod / scid - based immunodeficient mice . in conclusion , we established c57/bl6 and balb / c strains of rag-2jak3 mice and showed that balb / c rag-2jak3 mice enabled high human hematopoietic cell engraftment .

immunodeficient mice are becoming invaluable tools in human stem cell and tumor research . in this study , we generated rag-2/jak3 double - deficient ( rag-2/jak3/ ) mice with a c57/bl6 and balb / c genetic background and compared the human lymphohematopoietic cell engraftment rate . human cord blood - derived cd34 + hematopoietic stem cells were successfully engrafted into balb / c rag-2/jak3/ mice ; however , the engraftment rate was far lower in c57/bl6 rag-2/jak3/ mice . transplantation of human peripheral blood mononuclear cells resulted in the same tendency . thus , a balb / c background offers superior engraftment capacity than a c57/bl6 background and provides an attractive model for human hematopoietic cell engraftment .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

cardioembolic stroke ( ces ) , which causes 20% of all ischemic strokes each year , leads to severe neurological deficits . ces is associated with high mortality and is a common cause of its atrial fibrillation ( af ) , which has an increasing incidence with age [ 35 ] . proposed that af is an important and treatable cause of recurrent stroke and needs to be ruled - out by thorough evaluation before the diagnosis of cryptogenic stroke is assigned . ces is largely preventable through control of major primary cardioembolic risk factors , such as hyperlipidemia and high blood pressure . giralt et al . offered evidence of significant genetic involvement in ischemic stroke . in recent years , gene expression profiling of human disease tissues has provided insights into molecular mechanisms and eventually led to the identification of novel therapeutic targets . currently available high - throughput microarray experiments were developed to analyze genetic expression patterns with differentially expressed genes ( deg ) and dysregulated pathways . canonical reports claimed that gene expression patterns can identify biomarkers of ischemic stroke , which highlighted the relevance of the innate immune system through deg and signaling pathways [ 1113 ] . however , most methods did not consider regulatory cross - talk among pathways , and treated pathways as independent mechanisms . although it is intuitive that interacting pathways could influence each other , the presence of this frame and available technique have not been completely studied yet . antonio et al . developed an integrated approach to identify functional mirnas regulating pathway cross - talk in breast cancer with pairs of pathways . differential protein - protein interaction networks were constructed in ces with akaike information criterion ( aic ) method . to the best of our knowledge , there are few studies that constructed pathway networks correctly to discriminate controls versus ces . in this work we develop an integrated approach that is able to construct individual networks comprising pathways cross - talk to quantify differences between ces and controls . we used the individualized pathway aberrance score ( ipas ) to assess pathway statistics of every ingenuity pathways analysis ( ipa ) pathway . random forest ( rf ) classification was implemented to calculate the auc of every network . these procedures were tested by monte carlo cross - validation ( mccv ) for 50 bootstraps . . the novel approach may be the basis of individual medical treatment in ces , serving as therapy targeting markers . one biological dataset , e - geod-58294 , was derived from the gene expression omnibus ( geo ) database ( http://www.ncbi.nlm.nih.gov/geo/ ) . the platform was a - affy-44 affymetrix genechip human genome u133 plus 2.0 , which was used to read the gene chip % h0 . the linear models for microarray data ( limma ) was then used to preprocess data . after quantile data normalization performed by robust multi - array average ( rma ) , 20 544 genes were obtained . in order to identify a group of pathways significantly enriched in ces with respect to controls , we collected 589 biological pathways including 5169 genes from the ipa tool ( http://www.ingenuity.com/ ) . after genes of expression profile were enriched in ipa pathways , we focused on 4929 genes . raw p - values were adjusted by false - discovery rate ( fdr ) procedure for multiple testing corrections . a total of 23 accumulated normal samples ( ans ) were used to identify ipa pathways as reference . individual normal sample gene expression was standardized with the mean and standard deviation ( sd ) . for genes of every ces sample , as quantile normalization was performed . average z equation was recently proved to be a biologically valid modification of pathway analysis methods for ipas . z=(z1 , z2 , , zn ) represents the expression state of a pathway where zi denotes the standardized expression value of i - th gene and the number of genes existing in the pathway is n. gene statistics of each gene from every ces sample : each ipa pathway statistics : zi represents the standardized gene level statistics of 1-i gene and the number of genes existing in the pathway is n. z values of every pathway in ces samples were gathered after significance testing . differentially expressed pathways were selected with z<0.05 . the discriminating score ( ds ) was computed to quantify pathway cross - talk in each sample for the pair of pathways x and y. ds was defined as where mx and sx represent mean and standard deviation of expression levels of genes in a pathway x and my and sy in a pathway y . ds score indicates the relationships between pairs of pathway , with a larger value indicating relatively higher difference of activity between pathways . ds of normal samples was standardized using the mean and sd as reference . z values of every pathway pair in ces samples z values of differentially expressed pathways and pathway pairs were used to construct individual networks with cytoscape version 3.2.0 . it randomly selected expression data in proportion 6:4 to form the training and testing set . then the process was repeated in 50 bootstraps , randomly generating new training and test partitions each time . the number of main networks appearing in the 50 bootstraps was counted by ranking all networks with their auc values . one biological dataset , e - geod-58294 , was derived from the gene expression omnibus ( geo ) database ( http://www.ncbi.nlm.nih.gov/geo/ ) . the platform was a - affy-44 affymetrix genechip human genome u133 plus 2.0 , which was used to read the gene chip % h0 . the linear models for microarray data ( limma ) was then used to preprocess data . after quantile data normalization performed by robust multi - array average ( rma ) , 20 544 genes were obtained . in order to identify a group of pathways significantly enriched in ces with respect to controls , we collected 589 biological pathways including 5169 genes from the ipa tool ( http://www.ingenuity.com/ ) . after genes of expression profile were enriched in ipa pathways , we focused on 4929 genes . raw p - values were adjusted by false - discovery rate ( fdr ) procedure for multiple testing corrections . a total of 23 accumulated normal samples ( ans ) were used to identify ipa pathways as reference . individual normal sample gene expression was standardized with the mean and standard deviation ( sd ) . for genes of every ces sample , as quantile normalization was performed . average z equation was recently proved to be a biologically valid modification of pathway analysis methods for ipas . z=(z1 , z2 , , zn ) represents the expression state of a pathway where zi denotes the standardized expression value of i - th gene and the number of genes existing in the pathway is n. gene statistics of each gene from every ces sample : each ipa pathway statistics : zi represents the standardized gene level statistics of 1-i gene and the number of genes existing in the pathway is n. z values of every pathway in ces samples were gathered after significance testing . the discriminating score ( ds ) was computed to quantify pathway cross - talk in each sample for the pair of pathways x and y. ds was defined as where mx and sx represent mean and standard deviation of expression levels of genes in a pathway x and my and sy in a pathway y . ds score indicates the relationships between pairs of pathway , with a larger value indicating relatively higher difference of activity between pathways . ds of normal samples was standardized using the mean and sd as reference . z values of every pathway pair in ces samples z values of differentially expressed pathways and pathway pairs were used to construct individual networks with cytoscape version 3.2.0 . it randomly selected expression data in proportion 6:4 to form the training and testing set . then the process was repeated in 50 bootstraps , randomly generating new training and test partitions each time . the number of main networks appearing in the 50 bootstraps was counted by ranking all networks with their auc values . in the present study we developed an integrated approach that was sufficient to construct individual networks comprising pathways cross - talk to quantify differences between ces and controls . rf classification was implemented to calculate auc of every network , which was tested by mccv for 50 bootstraps . we obtained a heatmap in which pink squares indicate pathway pairs for classification in the training dataset for that bootstrap ( the frequency > 6 ) . there were 4 pairs of pathways in 46 bootstraps : cholesterol biosynthesis i and cholesterol biosynthesis ii , cholesterol biosynthesis i and cholesterol biosynthesis iii , cholesterol biosynthesis ii and cholesterol biosynthesis iii , uracil degradation ii and thymine degradation . individual networks were ordered with respect to their auc and 28 networks with auc > 0.9 were found between ces and controls . among them , 3 networks with auc=1.0 had the best performance for classification of ces and normal samples for all 50 bootstraps . as shown in figure 2 , the best individual networks were in 4 , 10 , and 23 bootstraps . therefore , the 3 pathway networks were able to significantly identify ces versus controls , which showed as biomarkers in the regulation and development of ces . then we found there were 22 pairs of pathways that commonly appeared in 3 networks ( table 1 ) , which revealed that the pathway pairs were important in regulating ces . given the substantial difference in the activities of main networks between ces and controls , we examined its effectiveness in classifying ces and normal samples based on their profiles . in the best 3 networks , we focused on pathways that had multi - cross - talk with others . the msp - ron signaling pathway had the most cross - talk , which played an important interaction role in the best networks . a previous study has reported that msp - ron signaling is important for the invasive growth of many types of cancers and appeared to have potential as a therapeutic target . pathway analysis has become the first choice for extracting and explaining the underlying pathology for high - throughput molecular measurements . personalized identification of altered pathway pairs is important for understanding disease mechanisms and for the future application of custom therapeutic decisions . existing pathway analysis methods are not suitable for identifying the pathway aberrance that may occur in an individual sample . therefore , we employed the ipas to analyze the personalized identification of networks , taking advantage of a vast number of normal samples . a key innovation of the method is ipas using ans in ces . proved that the average z equation can efficiently reveal noticeable aberrance in expression profiles and clinical significance , which sufficed to confirm the best averaged validation rate and distinguish a known survival - relevant pathway statistically . furthermore , ans data is expected to be available in more fields of medicine along with rapid advances in high - throughput databases . ds obtained lightly more improvement than the euclidean distance as a metric to quantify pathway cross - talk . in recent years , different validation technologies have been generally used to evaluate performance of pathways and networks in medical regression analysis . the mccv pays attention to a notable part of the sample at a time during network building and validation with multi - repeats . compared with conventional validation tests for capturing the best predictor variables , mccv showed superior performance , resulting from a form of cross - validation based on vast combinations of data sets . interestingly , mccv has not been utilized in individual networks comprising pathways cross - talk in ces patients . in this study we developed an integrated approach to quantify differences between ces and controls with the mccv test , which suggests that mccv worked better , based on strong predictive ability . screened networks were efficient in distinguishing differences among individual ces samples , and can provide broader carcinogenic insight in personalized medicine . the final purpose of our approach was to detect the best network able to discriminate ces versus controls . we found that the 3 best networks were similar and had 22 common pairs of pathways . we tended to select network 10 to differentiate ces disease from normal samples , with the fewest pairs of pathways ( figure 2b ) . our novel approach identified 3 networks able to accurately classify ces and normal samples in individuals .

backgroundcardioembolic stroke ( ces ) , which causes 20% cause of all ischemic strokes , is associated with high mortality . previous studies suggest that pathways play a critical role in the identification and pathogenesis of diseases . we aimed to develop an integrated approach that is able to construct individual networks of pathway cross - talk to quantify differences between patients with ces and controls.material/methodsone biological data set e - geod-58294 was used , including 23 normal controls and 59 ces samples . we used individualized pathway aberrance score ( ipas ) to assess pathway statistics of 589 ingenuity pathways analysis ( ipa ) pathways . random forest ( rf ) classification was implemented to calculate the auc of every network . these procedures were tested by monte carlo cross - validation for 50 bootstraps.resultsa total of 28 networks with auc > 0.9 were found between ces and controls . among them , 3 networks with auc=1.0 had the best performance for classification in 50 bootstraps . the 3 pathway networks were able to significantly identify ces versus controls , which showed as biomarkers in the regulation and development of ces.conclusionsthis novel approach could identify 3 networks able to accurately classify ces and normal samples in individuals . this integrated application needs to be validated in other diseases .

Background Material and Methods Step 1: Datasets Step 2: Pathway enrichment analysis Step 3: Pathway-level statistics Step 4: Pathway pairs Step 5: Construction of network Step 6: Random Forest (RF) classification Step 7: Selection of the best network Results Discussions Conclusions

study participants were members of the cardiovascular health study ( chs ) , a prospective cohort consisting of 5,888 men and women aged 65 years who were randomly selected from medicare - eligibility lists in four u.s . communities ( forsyth county , nc ; washington county , md ; sacramento county , ca ; and pittsburgh , pa ) . a detailed description of methods and procedures in the chs has previously been published ( 26 ) . briefly , persons eligible to participate were not institutionalized or wheelchair dependent , did not require a proxy for consent , were not receiving treatment for cancer , and were expected to remain in their respective regions for 3 years . from 1989 to 1990 , 5,201 participants were recruited in the original cohort . between 1992 and 1993 , 687 subjects ( predominantly african american ) were also recruited . baseline evaluation of study participants included standardized questionnaires , physical examination , anthropometric measurements , resting electrocardiography , and laboratory examinations . from 1989 through 1999 , participants were followed up every 6 months , alternating between telephone calls and clinic visits ; biennial telephone calls have continued since then . the institutional review board at each center approved the study , and each participant gave informed consent . for this analysis , the 19921993 clinic visit was used as baseline . of the 5,553 participants alive at the 19921993 clinic visit , we excluded 773 people with prevalent diabetes , 780 people with missing data on fabp4 and nefa , 205 people with missing data on prevalent or incident type 2 diabetes , and 55 individuals with missing covariate information . plasma samples collected at the 19921993 examination were stored at 70c until analyzed at the central laboratory at the university of vermont . the interassay coefficient of variation ( cv ) was 2.615.32% ( detectable range 5250 ng / ml ) . this technique relies on the acylation of coa by the fatty acids in the presence of added acyl - coa synthetase . acyl - coa produced is oxidized by added acyl - coa oxidase with generation of hydrogen peroxide and in the presence of peroxidase permits the oxidative condensation of 3-methy - n - ethyl - n(-hydroxyethyl)-aniline with 4-aminoantipyrine to form a purple - colored adduct . we assessed medication use at baseline and annually by a validated medication inventory ( 27 ) through 2007 . in addition , fasting glucose was measured on blood specimens from the examinations in years 19921993 , 19961997 , 19981999 , and 20052006 ; nonfasting glucose was measured on blood specimens from 1994 to 1995 . a participant was classified as having type 2 diabetes if any of the following conditions were met : 1 ) use of insulin or oral hypoglycemic agents , 2 ) fasting glucose level of 7 mmol / l ( 126 mg / dl ) , or 3 ) a nonfasting glucose level of 11.1 mmol / l ( 200 mg / dl ) . age , sex , race , years of education , smoking status , and alcohol consumption were based on self - report . leisure - time activity ( kilocalories per week ) was assessed using a modified minnesota leisure - time activities questionnaire ( 28 ) . bmi was calculated as weight in kilograms divided by the square of height in meters . missing values for smoking and height to calculate bmi were carried forward from previous years if available . serum albumin was assessed using the kodak ektachem 700 analyzer ( eastman kodak , rochester , ny ) . plasma triglyceride was measured by enzymatic methods on an olympus demand system ( olympus , lake success , ny ) . hdl was measured by an enzymatic method after precipitation of apolipoprotein b containing lipoproteins with dextran sulfate / magnesium sulfate . interassay cvs using reference standards for triglycerides and hdl were 1.78 and 2.15% , respectively . cystatin c was measured by nephelometer using a particle - enhanced immunonephelometric assay ( n latex cystatin c ; dade behring , newark , de ) ( 30 ) with a interassay cv of 2.93.3% . baseline characteristics of study participants were summarized according to categories of fabp4 and nefa ; continuous variables were presented as means sd and categorical variables as percentages . cox proportional hazards regression was used to estimate the association of fabp4 and nefa with incident type 2 diabetes to allow adjustment for covariates . because the distribution of fabp4 differed appreciably between men and women , fabp4 was modeled as sex - specific tertiles with the lowest tertile as the referent category . nefa was similarly modeled as tertiles based on the overall distribution and also continuously per sd . individuals were censored for death , loss to follow - up , or end of diabetes ascertainment ( 20062007 ) . potential confounders included in adjusted models were age , race , and sex ( where appropriate ) ( model 1 ) with the addition of bmi ( included in nefa model only ) , education ( less than high school versus high school or more ) , cystatin c ( log transformed and included in fabp4 model only ) , serum albumin ( included in nefa model only ) , kilocalories of physical activity ( log transformed ) , alcohol intake ( none and < 0.5 , 0.51 , and > 1 drinks / day for women ; none and < 1 , 12 , and > 2 drinks / day for men ) , smoking status ( never , former , and current ) , self - reported health status ( fair / poor versus better ) , and estrogen use for women ( model 2 ) . given the production of fabp4 in adipocytes , we examined interaction between bmi and fabp4 . to evaluate intermediate pathways by which fabp4 might lead to type 2 diabetes , we adjusted for c - reactive protein ( log transformed ) , homa - ir , triglycerides ( log transformed ) , hdl , and ldl . to evaluate the joint impact of fabp4 and nefa on diabetes risk we also tested for an interaction between fabp4 and nefa on the risk of incident type 2 diabetes . in secondary analyses , we evaluated whether there were statistically significant interactions between log fabp4 and age or waist circumference or between nefa and sex or bmi . because measured weight may not always reflect adiposity in older adults , we excluded participants with unintentional weight loss ( defined as self - reported loss of 10 pounds not due to diet or exercise during the past 12 months ) , prevalent cardiovascular disease ( coronary heart disease or stroke ) , or cancer in a sensitivity analysis . since plasma nefa varies with dietary intake ( 31 ) and lipid metabolism and a single measure may not be a good estimate of average concentrations over the long term , we repeated the analysis while restricting follow - up to the first 5 years . schoenfeld residuals and plots of the residuals over time were used to evaluate proportional hazards assumptions ; there were no meaningful violations . stata , version 11.1 ( statacorp , college station , texas ) , was used for all analyses , and p values < 0.05 were considered statistically significant . plasma samples collected at the 19921993 examination were stored at 70c until analyzed at the central laboratory at the university of vermont . the interassay coefficient of variation ( cv ) was 2.615.32% ( detectable range 5250 ng / ml ) . this technique relies on the acylation of coa by the fatty acids in the presence of added acyl - coa synthetase . acyl - coa produced is oxidized by added acyl - coa oxidase with generation of hydrogen peroxide and in the presence of peroxidase permits the oxidative condensation of 3-methy - n - ethyl - n(-hydroxyethyl)-aniline with 4-aminoantipyrine to form a purple - colored adduct . we assessed medication use at baseline and annually by a validated medication inventory ( 27 ) through 2007 . in addition , fasting glucose was measured on blood specimens from the examinations in years 19921993 , 19961997 , 19981999 , and 20052006 ; nonfasting glucose was measured on blood specimens from 1994 to 1995 . a participant was classified as having type 2 diabetes if any of the following conditions were met : 1 ) use of insulin or oral hypoglycemic agents , 2 ) fasting glucose level of 7 mmol / l ( 126 mg / dl ) , or 3 ) a nonfasting glucose level of 11.1 mmol / l ( 200 mg / dl ) . age , sex , race , years of education , smoking status , and alcohol consumption were based on self - report . leisure - time activity ( kilocalories per week ) was assessed using a modified minnesota leisure - time activities questionnaire ( 28 ) . bmi was calculated as weight in kilograms divided by the square of height in meters . missing values for smoking and height to calculate bmi were carried forward from previous years if available . serum albumin was assessed using the kodak ektachem 700 analyzer ( eastman kodak , rochester , ny ) . plasma triglyceride was measured by enzymatic methods on an olympus demand system ( olympus , lake success , ny ) . hdl was measured by an enzymatic method after precipitation of apolipoprotein b containing lipoproteins with dextran sulfate / magnesium sulfate . interassay cvs using reference standards for triglycerides and hdl were 1.78 and 2.15% , respectively . cystatin c was measured by nephelometer using a particle - enhanced immunonephelometric assay ( n latex cystatin c ; dade behring , newark , de ) ( 30 ) with a interassay cv of 2.93.3% . baseline characteristics of study participants were summarized according to categories of fabp4 and nefa ; continuous variables were presented as means sd and categorical variables as percentages . cox proportional hazards regression was used to estimate the association of fabp4 and nefa with incident type 2 diabetes to allow adjustment for covariates . because the distribution of fabp4 differed appreciably between men and women , fabp4 was modeled as sex - specific tertiles with the lowest tertile as the referent category . nefa was similarly modeled as tertiles based on the overall distribution and also continuously per sd . individuals were censored for death , loss to follow - up , or end of diabetes ascertainment ( 20062007 ) . potential confounders included in adjusted models were age , race , and sex ( where appropriate ) ( model 1 ) with the addition of bmi ( included in nefa model only ) , education ( less than high school versus high school or more ) , cystatin c ( log transformed and included in fabp4 model only ) , serum albumin ( included in nefa model only ) , kilocalories of physical activity ( log transformed ) , alcohol intake ( none and < 0.5 , 0.51 , and > 1 drinks / day for women ; none and < 1 , 12 , and > 2 drinks / day for men ) , smoking status ( never , former , and current ) , self - reported health status ( fair / poor versus better ) , and estrogen use for women ( model 2 ) . given the production of fabp4 in adipocytes , we examined interaction between bmi and fabp4 . to evaluate intermediate pathways by which fabp4 might lead to type 2 diabetes , we adjusted for c - reactive protein ( log transformed ) , homa - ir , triglycerides ( log transformed ) , hdl , and ldl . to evaluate the joint impact of fabp4 and nefa on diabetes risk we also tested for an interaction between fabp4 and nefa on the risk of incident type 2 diabetes . in secondary analyses , we evaluated whether there were statistically significant interactions between log fabp4 and age or waist circumference or between nefa and sex or bmi . because measured weight may not always reflect adiposity in older adults , we excluded participants with unintentional weight loss ( defined as self - reported loss of 10 pounds not due to diet or exercise during the past 12 months ) , prevalent cardiovascular disease ( coronary heart disease or stroke ) , or cancer in a sensitivity analysis . since plasma nefa varies with dietary intake ( 31 ) and lipid metabolism and a single measure may not be a good estimate of average concentrations over the long term , we repeated the analysis while restricting follow - up to the first 5 years . schoenfeld residuals and plots of the residuals over time were used to evaluate proportional hazards assumptions ; there were no meaningful violations . stata , version 11.1 ( statacorp , college station , texas ) , was used for all analyses , and p values < 0.05 were considered statistically significant . among 3,740 participants , 2,259 were women ( 60% ) and the mean age at baseline was 74.8 years ( range 6598 ) . median plasma fabp4 was 29.5 ng / ml ( interquartile range 22.039.3 ) , and women had substantially higher concentrations of fabp4 ( median 34.4 ng / ml ) than men ( median 22.8 ng / ml ) . compared with the lowest tertile of fabp4 , those in the highest tertile had higher measures of adiposity and were more likely to have insulin resistance , higher prevalence of dyslipidemia , poorer health , higher levels of cystatin c , and lower physical activity . details on correlation coefficients between fabp4 and risk factors for type 2 diabetes are presented in supplementary table 1 . characteristics of 3,740 participants by sex - specific tertiles of fabp4 in the chs during a mean follow - up of 9.5 years , 305 cases of incident diabetes occurred . hazard ratios ( hrs ) associated with each sd increase in log fabp4 were 1.39 ( 95% ci 1.191.62 ) overall , 1.35 ( 1.101.65 ) for women , and 1.45 ( 1.131.85 ) for men after adjustment for age , race , sex , education , physical activity , cystatin c , alcohol intake , smoking , self - reported health status , and estrogen use for women ( table 2 ) , p for sex - by - fabp4 interaction 0.10 ) . there was evidence for an interaction between bmi and fabp4 on the risk of diabetes ( p value for interaction between continuous bmi and log fabp4 : p = 0.009 overall , 0.02 for women , and 0.135 for men ) ( table 3 ) . fabp4 was associated with diabetes in people with lower bmi in both sexes , but the only significantly elevated risk was among lean men ( table 3 ) . incidence rate and hrs of type 2 diabetes according to fabp4 tertiles or sd of log fabp4 ( 0.46 ) in the chs hr of diabetes per sd increase in log fabp4 stratified by bmi in the chs * as expected , additional adjustment for potential mediating factors ( c - reactive protein , homa - ir , ldl and hdl cholesterol , and triglycerides ) attenuated the observed association further ( relative risk [ rr ] per sd increase of log fabp4 of 1.25 [ 95% ci 1.011.55 ] ) for women and 1.17 [ 0.901.53 ] for men ) . relations between each potential mediator and type 2 diabetes when added individually to the full model are shown in supplementary table 2 . there was no statistically significant interaction between fabp4 and nefa ( p = 0.16 ) , and results were similar with the addition of nefa to these models ( data not shown ) . in a sensitivity analysis , exclusion of individuals with reported unintentional weight loss , prevalent cardiovascular disease , and cancer tended to strengthen the association ( hr per sd increase in log fabp4 from 1.39 [ 95% ci 1.191.62 ] before exclusion to 2.42 [ 1.563.73 ] after exclusion for men and women combined ) . participants with higher concentrations of nefa were older , were more likely to be female , had higher measures of adiposity , and had higher levels of total cholesterol , triglycerides , hdl , and c - reactive protein levels ( supplementary table 3 ) . in a multivariable model adjusted for age , sex , ethnicity , education , bmi , leisure - time physical activity ( kilocalories ) , smoking , alcohol use , health status , estrogen use ( in women ) , and serum albumin , the hr associated with each sd of nefa ( 0.20 meq / l ) was 1.08 ( 95% ci 0.961.23 ) ( table 4 ) . results were similar with the addition of fabp4 to these models ( data not shown ) . when stratified by bmi ( < 25 , 2529.9 , and 30 kg / m ) , the results did not change materially and the p value for bmi - by - nefa interaction was 0.13 . in a secondary analysis restricted to the first 5 years of follow up , each sd of higher nefa was associated with an hr of 1.15 ( 0.971.36 ) in a fully adjusted model , and there was evidence for increased risk of diabetes at higher levels of nefa when analyzed by tertiles of nefa ( 1.0 [ ref . ] , 1.68 [ 95% ci 1.122.53 ] , and 1.63 [ 1.072.50 ] ) ( table 4 ) . there was no evidence for sex - by - nefa interaction ( p = 0.97 ) . hr ( 95% ci ) of diabetes by category of and per sd ( 0.20 meq / l ) increase in nefas in the chs table 1 presents baseline characteristics of subjects according to tertiles of fabp4 by sex . compared with the lowest tertile of fabp4 , those in the highest tertile had higher measures of adiposity and were more likely to have insulin resistance , higher prevalence of dyslipidemia , poorer health , higher levels of cystatin c , and lower physical activity . details on correlation coefficients between fabp4 and risk factors for type 2 diabetes are presented in supplementary table 1 . characteristics of 3,740 participants by sex - specific tertiles of fabp4 in the chs during a mean follow - up of 9.5 years , 305 cases of incident diabetes occurred . hazard ratios ( hrs ) associated with each sd increase in log fabp4 were 1.39 ( 95% ci 1.191.62 ) overall , 1.35 ( 1.101.65 ) for women , and 1.45 ( 1.131.85 ) for men after adjustment for age , race , sex , education , physical activity , cystatin c , alcohol intake , smoking , self - reported health status , and estrogen use for women ( table 2 ) , p for sex - by - fabp4 interaction 0.10 ) . there was evidence for an interaction between bmi and fabp4 on the risk of diabetes ( p value for interaction between continuous bmi and log fabp4 : p = 0.009 overall , 0.02 for women , and 0.135 for men ) ( table 3 ) . fabp4 was associated with diabetes in people with lower bmi in both sexes , but the only significantly elevated risk was among lean men ( table 3 ) . incidence rate and hrs of type 2 diabetes according to fabp4 tertiles or sd of log fabp4 ( 0.46 ) in the chs hr of diabetes per sd increase in log fabp4 stratified by bmi in the chs * as expected , additional adjustment for potential mediating factors ( c - reactive protein , homa - ir , ldl and hdl cholesterol , and triglycerides ) attenuated the observed association further ( relative risk [ rr ] per sd increase of log fabp4 of 1.25 [ 95% ci 1.011.55 ] ) for women and 1.17 [ 0.901.53 ] for men ) . relations between each potential mediator and type 2 diabetes when added individually to the full model are shown in supplementary table 2 . there was no statistically significant interaction between fabp4 and nefa ( p = 0.16 ) , and results were similar with the addition of nefa to these models ( data not shown ) . in a sensitivity analysis , exclusion of individuals with reported unintentional weight loss , prevalent cardiovascular disease , and cancer tended to strengthen the association ( hr per sd increase in log fabp4 from 1.39 [ 95% ci 1.191.62 ] before exclusion to 2.42 [ 1.563.73 ] after exclusion for men and women combined ) . participants with higher concentrations of nefa were older , were more likely to be female , had higher measures of adiposity , and had higher levels of total cholesterol , triglycerides , hdl , and c - reactive protein levels ( supplementary table 3 ) . in a multivariable model adjusted for age , sex , ethnicity , education , bmi , leisure - time physical activity ( kilocalories ) , smoking , alcohol use , health status , estrogen use ( in women ) , and serum albumin , the hr associated with each sd of nefa ( 0.20 meq / l ) was 1.08 ( 95% ci 0.961.23 ) ( table 4 ) . results were similar with the addition of fabp4 to these models ( data not shown ) . when stratified by bmi ( < 25 , 2529.9 , and 30 kg / m ) , the results did not change materially and the p value for bmi - by - nefa interaction was 0.13 . in a secondary analysis restricted to the first 5 years of follow up , each sd of higher nefa was associated with an hr of 1.15 ( 0.971.36 ) in a fully adjusted model , and there was evidence for increased risk of diabetes at higher levels of nefa when analyzed by tertiles of nefa ( 1.0 [ ref . ] , 1.68 [ 95% ci 1.122.53 ] , and 1.63 [ 1.072.50 ] ) ( table 4 ) . there was no evidence for sex - by - nefa interaction ( p = 0.97 ) . hr ( 95% ci ) of diabetes by category of and per sd ( 0.20 meq / l ) increase in nefas in the chs in this prospective study of 3,740 people , we demonstrate a positive association between plasma fabp4 and incident type 2 diabetes in older adults and such association was modified by bmi in a way that a statistically significant higher risk of diabetes with fabp4 was observed in lean men only . we also observed a significant positive association between plasma nefa and incident type 2 diabetes during the first 5 years that was attenuated and not statistically significant when the total follow - up period was considered . this association was not materially altered with adjustments for fabp4 , and there was no interaction between fabp4 and nefa with incident type 2 diabetes . to the best of our knowledge , this is the first large prospective study to evaluate associations between plasma fabp4 and incident type 2 diabetes among older men and women in a community setting . while several animal studies have examined the effects of fabp4 expression on adiposity , insulin resistance , and type 2 diabetes risk ( 7,10,11,32 ) , there are only limited data available in humans . in a cross - sectional study of 98 patients with coronary artery disease , serum levels of fabp4 were positively correlated with the prevalence of metabolic syndrome ( mets ) ( p = 0.037 ) and the number of mets components ( p = 0.035 ) ( 33 ) . in another cross - sectional study of 806 middle - aged men and women , each sd of higher log fabp4 was associated with a 1.85-fold increased odds of mets ( 95% ci 1.532.23 ) controlling for age , sex , and race ( 5 ) . ( 8) ( n = 229 ) and stejskal and karpisek ( 6 ) ( n = 138 ) have reported positive associations between serum concentrations of fabp4 and mets . baseline fabp4 was also shown to be associated with incident mets after 5 years of follow - up in 356 chinese individuals ( 9 ) . only one study has evaluated the association of fabp4 levels with incident type 2 diabetes . in a 10-year prospective study of 544 chinese participants with a mean age of 50 years , fabp4 levels above the population median ( 15.3 ng / ml for men and 20.4 ng / ml for women ) were associated with a twofold increased risk of type 2 diabetes after controlling for bmi and other confounding factors ( rr 2.25 [ 95% ci 1.403.65 ] ) ( 16 ) . we found that the association of fabp4 with type 2 diabetes risk was most pronounced in persons with bmi < 25 kg / m . in light of this finding , it is notable that the above chinese study has a lower bmi ( mean sd 24.3 3.7 kg / m ) than the chs study ( 26.4 4.6 kg / m ) ( 16 ) . the interaction between bmi and fabp4 is consistent with the positive association seen in the leaner chinese cohort . our working hypothesis is that expression of fabp4 may be directly associated with the size of adipocytes ; furthermore , we are hypothesizing that overweight / obese subjects have larger adipocyte size than lean people . our findings of no overall significant association between nefa and type 2 diabetes in older adults are contrary to other reports . ( 19 ) reported a 63% higher risk of type 2 diabetes in the fourth relative to the first quartile of nefa ( rr 1.63 [ 1.04 2.57 ] ) in middle - aged adults . similar results were noted in the pima study ( 18 ) with a 2.3-fold greater risk of type 2 diabetes comparing the highest with the lowest decile of plasma nefa . the mean duration of follow - up in our study ( 9.5 years ) was at least twice as long as that reported in the pima study ( 18 ) and nearly five times longer than the 2 years reported in the paris prospective study ( 34 ) . furthermore , subjects in our study were much older ( mean age 74.8 years ) compared with a mean age of 26 years in the pima study ( 18 ) , 48.9 years for the paris study ( 34 ) , and 52.8 years for atherosclerosis risk in communities ( aric ) study ( 19 ) . the longer follow - up duration and older age of participants in our cohort might explain the lack of an association in our data . in particular , it is possible that a single nefa concentration may be less strongly associated with type 2 diabetes risk over long - term follow - up compared with in the short term . nefa may better predict diabetes risk within a shorter period of follow - up as observed in the paris and pima studies ( 18,34 ) . this hypothesis is consistent with the larger effect size ( hr 1.63 [ 95% ci 1.072.50 ] comparing the 3rd to the 1st tertile of nefa ) observed in our analysis when follow - up time was restricted to the first 5 years of follow - up . if this hypothesis is correct , it suggests that it might be necessary to update nefa measurements over time to fully characterize nefa exposure . nonetheless , our findings also differ from the 53% lower risk of type 2 diabetes ( 95% ci 1973 ) per unit of log nefa observed in the insulin resistance atherosclerosis study ( iras ) ( 20 ) . iras showed that 2-h glucose was a major confounder ; unfortunately , we did not conduct an oral glucose tolerance test in our cohort at the time of fabp4 and nefa measurement ( 20 ) . further , iras was multiethnic with younger average age ( 55 vs. 75 years in the chs ) . what potential biologic mechanisms could causally relate fabp4 and nefa to type 2 diabetes ? as a lipid chaperone , fabp4 is expressed in adipocytes and macrophages and plays an important role in lipid metabolism and perhaps glucose utilization ( 35 ) . as such , it is possible that fabp4 is a mediator of the obesity type 2 diabetes association . such a hypothesis would be consistent with the fact that compared with wild - type mice , fabp4 knockout mice do not develop insulin resistance despite extreme adiposity when fed a high - fat diet ( 10 ) . on the other hand , fabp4 might influence the size of fat cells through de novo lipogenesis and lead to obesity . at this point fabp4 also inhibits stearoyl - coa desaturase-1 , an enzyme that plays a key role in de novo lipogenesis ( 36 ) and could influence plasma nefa . during de novo lipogenesis , plasma glucose is metabolized to saturated fatty acids ( myristic acid [ c14 ] and palmitic acid [ c16 ] ) ( 37 ) . stearoyl - coa desaturase-1 catalyzes the conversion of palmitic to palmitoleic acid and stearic ( c18 ) to oleic acid ( c18 ) , a glucose - requiring process ( 36 ) . in fabp4-deficient mice , there is an increased ratio of short - chain fatty acids ( c14 ) to longer chain ( c18 ) in muscle and adipose tissues ; a more favorable ratio leads to enhanced insulin receptor signaling , amp - activated kinase activity , and insulin - stimulated glucose uptake ( 38 ) . in addition , fabp4 attenuates the inhibition of hepatic sensitive lipase through its binding of fatty acids ( 17 ) . hepatic sensitive lipase activity can lead to lipolysis with elevated triglycerides and release of free fatty acids , thus leading to insulin resistance . higher nefa concentrations can increase insulin resistance ( 21,22 ) , exert toxic effects on pancreatic -cells ( 23,24 ) , and increase glucose production ( 25 ) . in addition , treatment with pioglitazone ( which reduces insulin resistance ) has been associated with reduced nefa and lipotoxicity ( 39 ) . additional adjustment for fabp4 did not alter the point estimate for nefa in this study , suggesting that the contribution of fabp4 to nefa concentration may be negligible . hence , we were unable to account for change in these biomarkers resulting from change in weight or other factors over time . weight loss is associated with a reduction in serum fabp4 in humans ( 40 ) , and in our study , subjects in the highest tertile of fabp4 were more likely to report unintentional weight loss . the fact that we observed a stronger association between fabp4 and diabetes risk after exclusion of subjects who reported unintentional weight loss , cancer , or cvd suggests that repeated measures of fabp4 might lead to even stronger relationships . as an observational study , we can not exclude residual or unmeasured confounding as an alternative explanation of observed associations . our sample consisted of caucasian and , to a lesser degree , african american adults , all of whom were aged 65 years ; results may not generalize to younger individuals or other race / ethnicities . we did not have measures of fasting glucose in all years , and , hence , we likely missed type 2 diabetes cases in intervening years . we did not have 2-h glucose at the time of fabp4 and nefa measurement for further adjustment . we can not exclude the possibility that obese people were less likely to attend clinic and have their blood glucose measured ; missing data on glucose that was differential based on obesity may have led to an underestimate of type 2 diabetes events . however , the fact that a similar proportion of obese subjects attended the baseline ( 17.6% ) and 19961997 ( 18.1% ) examination is reassuring . despite these limitations , our study has numerous strengths including a large sample size , a representative sample of older adults , inclusion of both men and women , the use of a valid and reproducible method to assess fabp4 and nefa , availability of data on numerous potential confounders , and long - term and nearly complete follow - up . in summary , we observed a positive association between plasma fabp4 and incident type 2 diabetes that was statistically significant only among lean men . lastly , our data support a statistically significant association between a single measure of nefa and incident type 2 diabetes in older adults during a shorter but not a longer follow - up period .

objectiveto examine the relation of fatty acid binding protein ( fabp)4 and nonesterified fatty acids ( nefas ) to diabetes in older adults.research design and methodswe ascertained incident diabetes among 3,740 cardiovascular health study participants ( 19922007 ) based on the use of hypoglycemic medications , fasting glucose 126 mg / dl , or nonfasting glucose 200 mg / dl . fabp4 and nefa were measured on specimens collected between 1992 and 1993.resultsmean age of the 3,740 subjects studied was 74.8 years . for each sd increase in log fabp4 , hazard ratios ( hrs ) for diabetes were 1.35 ( 95% ci 1.101.65 ) for women and 1.45 ( 1.131.85 ) for men controlling for age , race , education , physical activity , cystatin c , alcohol intake , smoking , self - reported health status , and estrogen use for women ( p for sex - fabp4 interaction 0.10 ) . bmi modified the fabp4-diabetes relation ( p = 0.009 overall ; 0.02 for women and 0.135 for men ) , in that statistically significant higher risk of diabetes was mainly seen in men with bmi < 25 kg / m2 ( hr per sd : 1.78 [ 95% ci 1.132.81 ] ) . there was a modest and nonsignificant association of nefa with diabetes ( ptrend = 0.21 ) . however , when restricted to the first 5 years of follow - up , multivariable - adjusted hrs for diabetes were 1.0 ( ref . ) , 1.68 ( 95% ci 1.122.53 ) , and 1.63 ( 1.072.50 ) across consecutive tertiles of nefa ( ptrend = 0.03).conclusionsplasma fabp4 was positively associated with incident diabetes in older adults , and such association was statistically significant in lean men only . a significant positive association between plasma nefa and incident diabetes was observed during the first 5 years of follow - up .

RESEARCH DESIGN AND METHODS Measurement of plasma FABP4 and NEFA Assessment of incident type 2 diabetes Other covariates Statistical analyses RESULTS FABP4 and type 2 diabetes risk NEFA and type 2 diabetes risk CONCLUSIONS Supplementary Material

diabetic retinopathy ( dr ) is a leading cause of blindness among working group in developed countries . it is estimated that the number of diabetes patients will achieve 366 million by 2030 , the majority of which will be type 2 diabetes mellitus ( t2 dm ) . after initial diagnosis , over 80% of t2 dm patients dr is a prototypical microvascular disorder characterized by microaneurysms , capillary nonperfusion , intraretinal hemorrhages , intraretinal microvascular abnormalities , and neovascularization [ 46 ] . however , recent studies have identified neuroretinal abnormalities in diabetics , even before the evidence of visible microvascular changes [ 710 ] . dr patients usually exhibit reduced responses in full - field and multifocal electroretinography , decreased blue - yellow color sensitivity , and contrast sensitivity before the microvascular lesions occurrence . large amount of neuronal cells is detected to be damaged in the very early stage of the disease , while microvascular lesions are usually difficult to be identified by fundus photography or ffa , which would cause easily clinical missed diagnosis followed by worsen progression . retinal neurodegeneration has also been identified in diabetic rodent models , which reproduces most aspects of the early stages of dr . lewis rats with streptozotocin - induced type 1 diabetes have shown the most accelerated loss of retinal ganglion cells ( rgcs ) at 8 months after the onset of diabetes . the spontaneous development of diabetes in ins2akita mice for 5 - 6 months also reveals the changes in neurosensory retina , including rgcs apoptosis as well as marked alterations to the morphology of surviving cells , reduction of cholinergic and dopaminergic amacrine cells , and a distinct thinning of the inner plexiform layer and the inner nuclear layer [ 1416 ] . furthermore , morphologic alterations of astrocytes and microglial cells in the inner retina and impaired glutamate metabolism by mller cells are found in other rodents [ 1719 ] . type 1 diabetic animal models were used in the majority of these researches , and to date retinal neural structural and functional studies of type 2 diabetic animal model are scarce . the db / db mouse ( bks / db/ ) is a typical model of type 2 diabetes that exhibits hyperglycemia associated with obesity a few 48 weeks after birth . physiological studies have revealed early inner retinal neuronal dysfunction including prolonged latencies of the oscillatory potentials and impaired b - wave at 24 weeks of age . an increased apoptosis of rgcs and other retinal neurons was observed in 60 weeks old db / db mice . however , the structural and functional features of inner retina on db / db mice during the early stage of diabetes remain unclear . this study was designed to follow the development of neurosensory retina damage from both structural and functional aspects in the early stages of diabetes in db / db mice . thirty - seven 8-week - old male db / db mice ( bks / db/ ) and 37 age - matched nondiabetic littermates ( bks / db+/+ ) were provided by the animal laboratory center of nanjing university and were kept in our spf - certified vivarium and exposed to a 12-hour light - dark cycle . all experiments conformed to standard environmental conditions ( at room temperature of 23c and humidity of 60% ) . to assess the chronological sequence of the retinal abnormalities associated with diabetes , 6 diabetes db / db mice were compared with 6 age - matched nondiabetic mice at difference ages ( 12 , 16 , 20 , 24 , and 28 weeks , resp . ) . visual functions were measured using pattern electroretinography ( perg ; roland consult , germany ) and in vivo retinal structures were visualized with spectral domain oct ( cirrus hd - oct , zeiss meditec , germany ) . at last , mice were anesthetized with intraperitoneal injection of a mixture containing 5% urethane and 10% chloralic hydras ( 1 : 1 ) ( 1020 mg kg body weight ) . all animal procedures were performed according to guide for the care and use of laboratory animals published by the institute for laboratory animal research . , mice ensured to natural light - adapted state were weighted and anesthetized as above mentioned . self - modified electrodes were made of acupuncture needles , welded to the signal - recorded wire . a recording electrode ( 0.25 mm diameter silver wire configured to a semicircular loop of 2 mm radius ) reference and ground electrodes were inserted under the skin of ipsilateral pars buccalis and tail , respectively . the pupils were not dilated , and eyes were not refracted for the viewing distance since the mouse eye has a large depth of focus . visual stimuli consisted of horizontal bars with a contrast of 99% at 0.05 cycles / degree spatial frequency , 1 hz temporal frequency . perg waveforms consisted of two main waves : a positive wave with a peak latency of 90 to 100 ms ( p1 ) followed by a broad negative with peak latency in the range of 200 to 300 ms ( n1 ) . after anesthetizing , mice were dilated with tropicamide 1% and underwent spectral domain oct ( cirrus hd - oct , zeiss meditec , germany ) as reported elsewhere [ 26 , 27 ] . in brief , mice were placed on the three - dimensional table . the mouse eyeball was coated with viscoelastic material and covered with a coverslip to form a plano - concave lens . then the 90 dpt noncontact slit lamp lens ( volk , superfield nc , volk optical inc . , macular cube scanning in the cirrus hd - oct was performed with the 512 128 scan pattern where a 6 6 mm area on the retina is scanned with 128 horizontal lines , each consisting of 512 a - scans per line with the scanning speed of 27000 a - scans per second . during the analysis procedure then retinal thicknesses are averaged in nine retinal subfields which are an area of a 6 mm diameter circle centered on the mouse optic disk . the eyes were dipped in ffa ( mixture of 95% ethyl alcohol , 10% neutral formalin , and glacial acetic acid , 17 : 2 : 1 ) for 1 min and fixed in 0.1 m buffer phosphate ( ph 7.4 ) containing 4% paraformaldehyde for 2 hours at 4c . then , the anterior segment of the eye was dissected away , the vitreous cleared , and the eyecup was left for further fixation overnight . serial sections 7 m thick were prepared for the assessment of retinal morphology , immunofluorescence staining , and tunel immunoreactivity . after deparaffinization and rehydration , the sections were stained with hematoxylin and eosin ( h&e ) . the measurements were taken at the regions of the retina ( at 480 m form ora serrata ) and were examined to ensure similar locations of measurements for all eyes . image analyses of ten sections of each eye were used to quantify total retinal thickness , the thickness of the inner nuclear layer ( inl ) and outer nuclear layer ( onl ) . images of h&e sections were captured with a microscope ( olympus ) using the program image j for quantification . the terminal deoxynucleotidyl transferase - mediated biotinylated utp nick - end labeling ( tunel ) assay was performed with dapi ( 4,6-diamidino-2-phenylindole ) staining . the prepared tissue sections were deparaffinized in xylene for 10 min and hydrated through a graded ethanol series . the tunel assay was then carried out following the protocol described by the manufacturers ( in situ cell death detection ; roche molecular biochemicals ) . after staining retinal sections were mounted with fluorescence mounting medium and images quantitative observations of retinal cells count from semithin section were defined as five hp fields ( 40 10 ) since 200 um up from the optic papilla . after deparaffinization and rehydration , the sections were incubated with ionized calcium binding adaptor molecule 1 ( iba-1 ; dilution 1 : 150 , wako , neuss , germany ) and f4/80 ( m-300 ; dilution 1 : 200 , santa cruz ) at 48c for 2 days and then rinsed in pbs ( 3 1 hr ) . then , the retina was incubated at 48c in sheep anti - mouse and anti - rabbit antibodies conjugated to fluorescein - isothiocyanate ( fitc ) ( boehringer mannheim gmbh , germany ) dilution 1 : 30 in 0.1% triton x-100 in 0.01 m pbs at ph 7.4 , for 3 days , and rinsed again . the retina was mounted on a slide in glycerol diluted with pbs at a ratio of 1 : 9 . whole retina thicknesses obtained from all oct devices were compared one to each other using unpaired student 's t - test . measurements of blood glucose ( vein blood of tail using contour ts ) and body weight were conducted in diabetic and nondiabetic mice before visual function testing or they were killed for other experiments at each time point . when the result of blood glucose value was beyond the upper limit of detection ( 33.3 mmol / l ) , we set 33.3 mmol / l as the statistical default . there were significant statistic differences of body weight and blood glucose level between the two groups , and hyperglycemia in diabetic mice runs in parallel with a significant increase of weight . p1 amplitudes , measured from the peak of the p1 wave to the trough of the n1 wave , were slightly reduced in diabetes mice at the age of 12 and 16 weeks , but they were significantly reduced in diabetes mice when compared with controls at the age of 20 , 24 , and 28 weeks ( figure 2(a ) ) . besides , a significant delay of p1 latency recorded in the diabetic mice at the ages of 24 and 28 weeks was observed when compared with the age - matched control mice ( figure 2(b ) ) . these data showed abnormal perg responses in diabetic db / db mice for 20 weeks , which also suggested that rgcs dysfunction might have occurred in early period of db / db mice . measurements of retinal thickness in diabetic and in nondiabetic mice at 20 , 24 , and 28 weeks are shown in figure 3 . total retinal thickness ( measured from inner limiting membrane to bruch 's membrane ) was significantly decreased in diabetic mice in comparison with nondiabetic mice at 28 weeks . furthermore , a reduction in onl was observed in diabetic mice in comparison with nondiabetic mice at 28 weeks . the retinal thickness was measured by oct noninvasively in 7 diabetic db / db mice and 7 nondiabetic mice at 28 weeks . one eye was selected at random in each mouse and only that eye was included in the analysis . as shown in table 1 , oct revealed a significant thinner in total retinal thickness of db / db mice than the control mice ( p < 0.01 ) . specifically , the differences were significant also for all quadrants . moreover , both the inner and outer sectors thicknesses of superior as well as nasal quadrants in db / db mice were significantly thinner than nondiabetic mice . additionally , significant thinning occurred in inner sector of the temporal quadrant in diabetic mice compared with control mice , despite the fact that no significant difference was detected in the temporal quadrant between the two groups . after examinations of perg , ffa were conducted which monitor the flow of a fluorescent dye through the retinal vasculature . all db / db as well as control mice did not show any alternations corresponding to relevant vascular abnormalities at each endpoint . figure 4 shows the images of ffa from db / db and db/+ mice at 28 weeks and there was no visible neovascularization and cellular capillaries in the retina . retinal sections were stained for dying photoreceptors by tunel staining to further determine the histological retina changes . a significant increase in tunel - positive immunofluorescence was observed in diabetic mice in comparison with retinas from nondiabetic mice at 20 , 24 , and 28 weeks ( figure 5 ) . tunel - positive cells were mainly localized in the rgcs layer , as well as the inl , implying the rgcs apoptosis which was also suggested by preg results . in addition , the number of apoptosis cells was increased from 1 - 2/hp at 20 weeks to 8 - 9/hp at 28 weeks ( figure 5 ) . to confirm the possible neuroinflammation in retinal neurodegeneration , iba-1-labeled microglia / macrophages and f4/80-labeled mature macrophages staining were performed . as shown in figure 6 , no positive expression of the two markers was observed in either 20-week - old diabetics or nondiabetics mice . however , db / db mice at 24 and 28 weeks showed obvious fluorescence of positive iba-1 and f4/80 expression in rgcs layer and inl , while no specific immunofluorescence exhibited in the retina of control mice ( figure 6(a ) ) . moreover , positive f4/80 was also expressed in the onl of db / db mice ( figure 6(b ) ) . these results confirmed the presence of iba-1 and f4/80 positive cells in rgcs layer and inl by the time of 24 weeks . when compared with normal heterozygous littermates , the db / db ( lepr ) mice can be affected with hyperglycemia , hyperlipidemia , and accelerated degeneration of the retinal capillaries and pericytes . it has been reported that 26-week - old db / db mice showed early features of dr , manifesting pericyte and endothelial cell loss , bruch 's membrane thickening , and increased blood flow in the retina [ 2931 ] . however , rodent models can reproduce most aspects of the early stages of dr but fail to develop retinal neovascularization or other advanced lesions ( retinal hemorrhages and microaneurysms ) of retinopathy . although cheung et al . had reported that 15-month - old db / db mice showed increased density of retinal capillaries in the inner nuclear layer , in current study , we did not found any obvious microvascular changes using ffa in db / db mice alive for 28 weeks . moreover , the reduction of retinal thickness in the db / db mice by using oct also supports that there was no retinal edema and/or retinal blood barrier damage . the relatively short lifespan of the mice and thus shorter duration of diabetes ( most studies are < 1 year ) were probable reason for failing to observe neovascularization in these models . therefore , the results of our study were supporting previous researches which implied that db / db mice developed capillary changes under microscope even in the early period of life span , but the lesion was not severe enough to cause the breakdown of retinal blood barrier . the results of perg presented in our study indicated that diabetic condition acts to be injurious events that lead to exacerbation of rgcs death . perg signal depends on the structural and functional integrity of rgcs and will greatly reduce when rgcs were selectively degenerated after optic nerve lesion . perg , therefore , is extensively used to probe rgc function in clinical and experimental models of diabetes and optic neuropathies [ 3436 ] and may be more sensitive to assess early damage of dr . previous studies showed that perg impairment could be detected in diabetic patients without or with minimal signs of retinopathy . this suggests that retina functional loss may occur in the early stage of this disease . therefore , we used perg to evaluate the changes in rgcs function and we found that the p1 amplitudes significantly reduced at the follow - up examinations for 20 weeks in db / db mice ; then a significantly increased latency was found later . all these results indicated that the deficit function of rgcs in db / db mice had certainly occurred . it was reported that rgcs die in a compartmentalized manner such that the mechanisms responsible for death of the rgcs body and dendrites may be different from those responsible for axonal injury ; both of them compromised the rgcs dysfunction . oct was performed as an indicator of progressive neural retinal pathology in animal models of retinal degeneration [ 38 , 39 ] . in the present study , we found a significant reduction in overall retinal thickness as well as all four quadrants , depending on the oct scanning , in db / db mice when compared with control mice at the age of 28 weeks . moreover , the results of h&e showed that total retinal thickness as well as onl ( at 480 m form ora serrata ) was significantly decreased in diabetic mice in comparison with nondiabetic mice at only 28 weeks , but there was no difference between the 2 groups at 20 and 24 weeks . these results are mainly due to the apoptosis of the ganglion cell layer and photoreceptors . in a recent study , bogdanov et al . reported that total retinal thickness in both central and peripheral retina was significantly decreased in db / db diabetic mice at 16 and 24 weeks , and a thinning in both onl and inl as well as a reduction in the number of cells in the gcl unfortunately , in our study only the db / db mice at 28 weeks were measured by oct , with the original intention to validate the reduced perg response . whether there existed oct alternations before 28 weeks so further studies are needed to determine the early changes of oct in db / db mice and evaluate the correlation between oct measured and histologically measured changes in retinal thickness following the life periods . recent studies have approached a common view that cell apoptosis is the base of diabetic neurodegeneration in cytopathogenesis . reportedly , various retinal neurocytes in early dr have been in apoptosis state , in particular the rgcs [ 4244 ] . accompanying cell apoptosis , inflammation has been considered to be an important pathogenesis in early stages of experimental dr , which has shown both of microglial and macrophages reaction represented during the alternations of functional and structural in retina [ 4547 ] . here , to further confirm the rgcs dysfunction determined by perg previous study reported that 15-month - old db / db mice had increased apoptosis of rgcs and other cells in the neural retina . in our study , apoptotic rgcs were observed in 20-week - old db / db mice , consistent with the reduced perg amplitudes . moreover , the number of apoptotic cells was increasing with age , accompanied with evident induction of iba-1 and f4/80 expression , both of which were considered as established marker for microglia / macrophages in the retina . additionally , iba-1 and f4/80 positive cells as well as apoptosis cells were also found in the inl , which was implied to be affected by db / db mice . all these findings indicated that db / db mice undergoing diabetes in 20 weeks or longer had developed neurodegeneration and neuroinflammation . in conclusion , we demonstrated that functional and structural retinal neurodegeneration exactly occurred in db / db mice with type 2 diabetes mellitus as early as 20 weeks , preceding any detectable alternations of blood vessel visibly . the retina lesions that develop in type 2 diabetes are similar to those that develop in type 1 diabetes , although the severity and/or incidence may be different . thus , it is prominently important to trace the degenerated phases and change rule of diabetic nerve cells in the early stage of dr and timely block and reverse these cells ' degeneration . these actions would play a significant role in prevention of early diabetic retinal neuropathy and nerve protection treatment , which are promising to be a potently effective target for the early intervention of diabetic retinopathy in future .

purpose . to describe both the functional and pathological alternations in neurosensory retina in a murine model of spontaneous type 2 diabetes ( db / db mouse ) . methods . db / db ( bks / db/ ) mice and heterozygous littermates ( as control group ) at various ages ( 12 , 16 , 20 , 24 , and 28 weeks ) were inspected with pattern electroretinogram ( perg ) , fundus fluorescein angiography ( ffa ) , and optical coherence tomography ( oct ) . histological markers of neuroinflammation ( iba-1 and f4/80 ) were evaluated by immunohistochemistry . in addition , levels of retinal ganglion cell death were measured by terminal dutp nick - end labeling ( tunel ) . results . significant alternations of perg responses and increased retinal ganglion cells ( rgcs ) apoptosis were observed in diabetic db / db mice for 20-week period when compared with control group . iba-1 and f4/80 expression in microglia / macrophages became evidently for 24-week period , thus supporting the perg findings . furthermore , obvious thinning of nasal and dorsal retina in 28-week - old db / db mice was also revealed by oct . no visible retinal microvascular changes were detected by ffa throughout the experiments on db / db mice . conclusions . diabetic retina underwent neurodegenerative changes in db / db mice , which happened at retinal ganglion cell layer and inner nuclear layer . but there was no obvious abnormality in retinal vasculature on db / db mice .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

infected dental plaque biofilm and the impaired host response remain the main causes of a wide range of gingival diseases . the ability of the patient to adhere to a proper oral care plan is also a critical factor that controls the tissue reaction and disease progression . the clinical manifestations of gingival inflammation differ according to the severity , distribution , and the response to treatment ranging between being localized and highly responsive to treatment to long standing lesions with persistent redness and massive bleeding on probing with variable degrees of swelling . the efficacy of treatment and the subsequent tissue response vary according to the etiology and idiopathic , local , or systemic cause . under healthy conditions , the neutrophils pass from the gingival connective tissue through the junctional epithelium into the gingival sulcus , providing a dynamic balance between continuously invading microorganisms and the immune response . the antioxidants , either enzymatic or nonenzymatic , play a crucial role in the tissue equilibrium via neutralizing such harmful agents ( ros ) [ 5 , 6 ] . under certain inflammatory conditions , the total amount of antioxidants decreases to its lowest levels , which necessities their supplementation by external source [ 7 , 8 ] . one of the most important antioxidant agents is vitamin c ( vit - c ) which has an important role in different body functions [ 7 , 8 ] . despite its mild acidity ( ph 4.2 ) , it requires an alkaline medium to perform its function as a reducing agent . to be activated , many changes in its structure occur in three successive cycles of oxidation ( figure 1 ) . vitamin c , being a strong reducing agent , can regulate the resolution of the inflammatory process and stimulate the tissue repair . it modulates the release of catabolic inflammatory cytokines [ 1012 ] , chemotaxis of the immune cells , and activation of the phagocytosis . the neutrophils and lymphocytes containing vitamin c show lower apoptotic potentiality and higher proliferation rate . furthermore , it enhances the synthesis of collagen type i , reduced by inflammatory process , keeps the balance between collagen i and collagen iii , and modifies the rate of fibroblast proliferation . it also reduces the potentiality of scaring via inhibiting cross - linking of collagen fibers and fibrosis . it acts as a cofactor in hydroxyproline synthesis to produce collagen type iv and improves endothelial cell vitality and function [ 1013 ] . the aim of the present study is to investigate the exact role and efficiency of the locally injected vitamin c in the treatment of persistent gingival inflammation after single or multiple dosing based on clinical and histopathological examination . each patient signed an informed detailed consent form before participation , explaining the benefits , steps , and side effects of the treatment protocol . the study was designed as a single arm , unblinded , and unrandomized trial as the trial did not depend on patient selection but it was rather based on an detection of a chronic persistent phenomenon . only patients with persistent inflammation patients were recruited among those diagnosed with plaque induced gingivitis in the postgraduate periodontology clinic at cairo university between the years 2013 and 2016 . an initial evaluation , including medical and dental history , clinical examination , and radiographic examination , was conducted by nmy and ara to determine patient eligibility for the study . fifty patients who met the following inclusion criteria were examined : ( 1 ) aged between 20 and 50 y , ( 2 ) medically free , and ( 3 ) generalized plaque induced gingivitis . all the reasons that could provoke an inflammatory reaction were excluded : ( 1 ) systemic diseases , ( 2 ) pregnant and lactating mothers , ( 3 ) treatment with antibiotic medication within 1 month before the trial , and ( 4 ) local causes ( smoking , mouth breathing , local trauma , and periodontitis ) ( figure 2 ) . each patient underwent full - mouth sessions of supragingival debridement using ultrasonic and hand instrumentation and received personalized oral hygiene instructions . about twenty patients achieved a minimal residual inflammation ( > 15% of plaque and bleeding scores according to o'leary 's scoring system ) and optimal soft tissue conditions during two weeks . combination antibiotic therapy ( amoxicillin 500 mg and metronidazole 500 mg/3 times per day for 7 days ) was administrated in order to control the amount of the condition . after 7 days of the complexion of the antibiotic course , reevaluation of the remaining 30 patients was undergone . at the end of the maintenance period ( 4 weeks ) , the included patients were 20 who suffered from persistent gingival inflammation in the esthetic anterior region ( figure 2 ) . the site of interest was anesthetized using lidocaine - epinephrine 1 : 100,000 . intraepidermal injection ( mesotherapy approach ) of 11.5 ml ( 200300 mg concentration ) of l - ascorbic acid was locally introduced in relation to the keratinized gingival tissues with prevalent extension to the whole target region , respectively , using insulin syringes . the current dose is equivalent to the treated region ( distance extends between six maxillary anteriors ) . during the first injection visit the same dose was repeated once per week until inflammation subsided . at the end of each session , patients were prescribed a rescue analgesic ( ibuprofen 200 mg ) to be used as needed . the patients were asked to abstain from mechanical oral hygiene procedures in relation to the target region for the day of procedure only . immediately before injection procedure , the following clinical measurements were performed by the same examiners ( nmy and ara ) : plaque and bleeding score using o'leary 's scoring system and local bleeding score using sulcus bleeding index ( sbi ) as a more specific index : score 0 : healthy looking and no bleeding on probingscore 1 : healthy looking and bleeding on probingscore 2 : bleeding on probing , change in color , and no edemascore 3 : bleeding on probing , change in color , and slight edemascore 4 : bleeding on probing , change in color , and obvious edemascore 5 : spontaneous bleeding , change in color , and marked edemathe latter index examined color , swelling , and bleeding tendency . at the completion of the injection visits , patient satisfaction was performed by using a 5- graded self - assessment analysis : excellent ( 4 ) , improved over 75% ; good ( 3 ) , improved 5075% ; moderate ( 2 ) , improved 2550% ; fair ( 1 ) , improved less than 25% ; no change or worse ( 0 ) , not improved or darkened . score 0 : healthy looking and no bleeding on probing score 1 : healthy looking and bleeding on probing score 2 : bleeding on probing , change in color , and no edema score 3 : bleeding on probing , change in color , and slight edema score 4 : bleeding on probing , change in color , and obvious edema score 5 : spontaneous bleeding , change in color , and marked edema preoperative and postoperative ( after 1 week of last injection ) gingival biopsies were excised , immediately fixed in 10% neutral buffered formalin , and then processed in the routine way for preparing a paraffin block . tissue sections were cut and stained with hematoxylin & eosin ( h&e ) for histopathological examination . finally , epidermal and dermal changes before and after ascorbic acid application were assessed using computer image analyzer software leica qwin 515 system ( england ) . the experimental period was between september 2013 and april 2016 ( last follow - up visit ) . twenty sites of localized chronic gingival inflammation were included with no definite cause ranging between marginal gingivitis and diffuse gingivitis . improvement was reported in all cases after maximum 2 injections except 2 cases that needed one more injection . measurement of the sbi was done following phase i therapy and after the completion of the treatment . preoperatively , it was noted that 12 ( 60% ) out of 20 patients scored 3 and 8 patients ( 40% ) scored 4 on sbi index . postoperatively , the range changed into 20 patients ( 100% ) scoring zero with variable degree of response to the applied treatment . seven patients ( 35% ) out of twenty treated patients were totally free of inflammation with zero sbi score after 1 injection visit . eleven ( 55% ) patients showed the same results after 2 injection visits . only 2 patients ( 10% ) out of twenty needed further injection to reach the zero score . all the enrolled patients showed great satisfaction about the treatment results , even the patients who were not fully treated . all patients ( 100% ) showed great satisfaction with the results ( score 4 ) ( figures 3 and 4 ) . the surface epithelium of parakeratinized stratified squamous type was hyperplastic with broad and elongated rete pegs , forming numerous epithelial arcades . obvious intracellular edema and extracellular edema of epithelial cells disturbing the intercellular desmosomal junctions were seen . an intense acute and chronic inflammatory cells infiltrate was observed dispersed in the whole thickness of connective tissue along with coarse blood capillaries ( table 1 ) . basement membrane was masked in some area by inflammatory cells ( figure 5 ) . microscopic examination revealed lower grade of inflammation . on the contrary to the preoperative sections , the connective tissue was formed of proliferating fibroblasts , collagen fiber formation , and few aggregates of chronic inflammatory cells . the characteristic phenomena were the presence of vacuolated epithelial cells especially in basal cell layer ( at the site of injection ) and the appearance of minute capillaries in subepithelial ct areas ( figure 5 ) . obvious reduction in the epithelial thickness was detected with minimal epithelial rete pegs and epithelial arcades . well - formed collagen fiber bundles with numerous and widely distributed blood vessels were detected in the connective tissue . fewer chronic inflammatory cells were detected but restricted to the deep connective tissue ( figure 5 ) . due to diversity of the gingival diseases , treatment plan should be variably designated based on the associated causative factors . however , one of the embarrassing problems is the presence of chronic or resistant inflammatory conditions with no definite aetiopathogenesis . they are usually characterized by persistent redness and bleeding on probing with different degrees of tissue edema which may be localized or diffused . in these cases , massive antibiotic course or corticosteroids regimens followed by surgical intervention if needed were the conventionally and commonly used protocols . despite the incredible results accompanying corticosteroids , they are usually avoided due to their adverse effects . therefore , there is a need for other safe nonsurgical therapeutic agents in order to control such conditions or , at least , improve the tissue healing and reduce inflammatory manifestations prior to the surgical removal of remaining pseudopocketing . dermal mesotherapeutic techniques using antioxidants such as vit - c showed promising results in the treatment of similar localized inflammatory conditions . the aim of the current study is the regulation of the overresponse of the inflammatory process , promoting healing , increasing the collagen content of the affected tissues , and improving the gingival circulation . in the current study , twenty patients were enrolled and evaluated at the baseline ( after 4 weeks following phase i therapy ) and postoperatively in the recall visit ( after 1 week after the last intraepidermal vitamin c injection ) . the long follow - up period preceding the therapy was essential in order to ensure that gingival inflammation is resistant to the conventional therapy . during inflammation , it was found that the tissue antioxidant level ( vit - c , vit - e , etc . ) decreases rapidly , indicating the need of its supplementation . on the other hand , the free radicals production increases at the site of inflammation [ 19 , 20 ] . extra doses of antioxidants , especially vitamin c , are essential . in localized inflammatory conditions , the administration of the needed higher doses ( higher than 500 mg ) can not be absorbed by the gastrointestinal tract which easily excreted through urine . moreover , in order to reach this dose at the site of inflammation , administration of very high systemic doses is needed , which could be harmful to the patient . , the incidence of vitamin c deficiency is nearly neglected due to its availability in a wide range of fruits and vegetables . due to the impaired financial status of our patients and the absence of the deficiency conditions , the used technique is much cheaper than providing a long term special food protocol or oral supplementations in order to improve their health status . the local injection of vit - c was preferred rather than the usage of topical vitamin c gel or dentifrice that was previously used by daniels and jefferies and shimabukuro et al . . many studies used different forms of lipid soluble topical vitamin c in order to overcome its limited absorption . these studies met several limitations such as very long term improvement time ( 12 weeks ) , easily dislodged from the oral tissues , limited absorption , instability when exposed to solutions , air , heat , or light , and localized enamel erosions [ 9 , 24 , 25 ] . total numerical evaluation of the gingival inflammation ( using sbi ) was determined , resulting in an average value per each patient . this analysis indicates 100% reduction in gingival inflammation from the average baseline value over the 721 days . intraepidermal vitamin c injection could be either single or double or triple with one week apart according to the severity of the condition . more cautious handling of the inflamed tissues during the first visit is quite important in order to avoid tearing or necrosis , especially in thin biotype tissues . improvement of the tissue color and form was clearly observed in the recall visits after 2 months . once inflammation subsided , representative tissue biopsies have been obtained 7 days following the last injection from the patients indicated for gingivoplasty or gingivectomy . clinically significant reduction of the pseudogingival enlargement was associated with return of the basal keratinocytes to their normal proliferative pattern which is the main role of vitamin c [ 26 , 27 ] . the anti - inflammatory action of vit - c was also evident and was detected in our specimens as a reduced intraepithelial edema and inflammatory cells . other characteristic changes which occurred after vit - c administration were in accordance with nusgens et al . . an increased number of fibroblasts were clearly detected forming more collagen fibers that showed more maturation and bundles formation following second injection . these features are consistent with its known essential role in the formation of new connective tissue in a healing wound . this is because it acts as a cofactor for enzymes critical in collagen formation , the main component of the connective tissue that forms the framework around which the new tissue is rebuilt . this is why , despite the increase in number of blood vessels , redness and bleeding tendency markedly decreased clinically . these vessels provide more nutritional and oxygen support to chronically irritated and continuously damaged mucosal areas , improving their healing . they detected that vitamin c promotes the development of an organization of the basement membrane and also restores the epidermal barrier within 2 - 3 weeks . furthermore , it promotes the wound closure and reduces its contraction which limits the incidence of scare formation . histologically , a characteristic cellular vacuolization was observed in all groups . in the preoperative specimens , vacuolated cells appeared as clear cells with small pyknotic dark nucleus representing signs of degeneration . in contrast , vit - c associated vacuolated cells were individually distributed along the epithelial layers with greatest aggregations in basal cells . a similar vacuolization was found in immediate and 15-minute biopsies excised after intradermal injection of local anesthesia described by kimura et al . . they attributed this phenomenon to the injection procedure itself rather than the used solution spatially with the presence of vacuolization in biopsies . however , the presence of these cells in after - week biopsies may be due to the ability of vitamin c to increase the cell resistance to death . furthermore , the basal localization of vacuolated cells , adjacent to injection , may indicate proper infusibility of vit - c . all these positive clinical changes were met by further patients ' cooperation and resulted in their end - treatment satisfaction . these data suggest a significant enhancement of the gingival health by the usage of the antioxidant approach . finally , we recommend the usage of the intraepidermal vitamin c injection as an adjunctive approach for the conventional nonsurgical treatment modality .

objective . the purpose of this study is to investigate the role and efficiency of the locally injected vitamin c in the treatment of persistent gingival inflammation . design . twenty adult patients with persistent chronic gingival inflammation were included in this study . the same dose of sterile vitamin c was injected in gingival tissues after the completion of phase i therapy . gingival biopsies were taken after total resolution of inflammation . the specimens were examined histologically , using h&e stain . results . clinical evaluation revealed great improvement of the injected sites with recall visits . histopathological results revealed marked decrease in inflammatory cells and epithelial thickness and a higher number of newly formed subbasal capillaries . conclusions . vitamin c is an effective adjunctive treatment in reducing various degrees of chronic gingival inflammation .

1. Introduction 2. Methodology 3. Results 4. Discussion

the endoplasmic reticulum ( er ) fulfills multiple cellular functions . once er functions are perturbed by various pathological conditions , unfolded or misfolded proteins accumulate in the er lumen , resulting in er stress characterized by increasing er molecular chaperones and diminishing global protein synthesis . activation of the signaling network in response to er stress is known as unfolded protein response ( upr ) . there are three distinct upr signaling pathways triggered in response to er stress , which are mediated by ( 1 ) rna - dependent protein kinase - like endoplasmic reticulum kinase ( perk ) , ( 2 ) activating transcription factor 6 ( atf6 ) , and ( 3 ) inositol - requiring enzyme 1 ( ire1 ) , respectively , [ 2 , 3 ] . under physiological conditions , perk , atf6 , and ire1 are associated with the abundant luminal chaperone bip ( also known as glucose - regulated protein 78 , grp78 ) . when the er is overloaded with newly synthesized proteins or is stimulated by agents that cause unfolded proteins to accumulate , grp78/bip preferentially associates with the unfolded proteins , releasing perk , atf6 , and ire1 to activate downstream signaling molecules . in the perk - mediated pathway , activated perk phosphorylates eif-2. the phosphorylated eif-2 subsequently inhibits global protein synthesis , preventing further influx of nascent proteins into an already saturated er lumen . paradoxically , eif-2 phosphorylation enhances the translation of activating transcription factor-4 ( atf4 ) and subsequently upregulates the expression of atf4-target genes , including several protein chaperones . recent studies also demonstrated that eif-2 phosphorylation upregulates atf6 expression and enhances atf6 activity and therefore increases the expression of its target genes . although upr signaling pathways are activated classically by unfolded er proteins , increasing evidence demonstrates that lipids / lipoproteins can also trigger upr . for instance , a prior study reported that accumulation of free cholesterol in the er was able to activate upr signaling pathways in mouse peritoneal macrophages . also , studies from our laboratory demonstrated that treatment of mouse macrophages with lipoproteins carrying apolipoprotein ( apo ) b48 but lacking apoe ( e / b48 ) induced foam cell formation , and enhanced phosphorylation of perk and eif-2 , increased expression of atf4 and several molecular chaperons and reduced global protein synthesis [ 7 , 8 ] . furthermore , we observed that overexpression of dominant - negative mutants of perk or eif-2 , or treatment with the eif-2 inhibitor , 2-aminopurine ( 2-ap ) , suppressed foam cell formation induced by e / b48 lipoproteins [ 7 , 8 ] . these findings suggest that activation of the perk - eif2 signaling pathway is an underlying mechanism by which e / b48 lipoproteins induce foam cell formation . such a transformation of macrophages into a foam cells is an early step of atherogenesis . individuals with defective isoforms of apoe , such as apoe4 , develop postprandial hypercholesterolemia and atherosclerosis . similarly , apoe knockout ( apoe ) mice manifest an elevated plasma cholesterol and develop atherosclerosis in a manner that resembles the human disease [ 10 , 11 ] . the hypercholesterolemia in apoe mice results mainly from the increased levels of e / b48 lipoproteins . it is interesting to note that atherosclerotic lesions in the aorta sinus of apoe mice show upr , as reflected by increased perk phosphorylation in the lesions [ 12 , 13 ] . data from the present report demonstrated that treatment of apoe mice with the eif-2 inhibitor 2-ap reduced atherosclerotic lesions in their aortas compared to lesions observed in control mice . taken together , these findings suggest that activation of eif-2 signaling pathway is an underlying mechanism for the development of atherosclerosis in apoe mice and that inhibition of this upr pathway might provide a therapy strategy for treatment of atherosclerosis . male apoe mice were obtained from jackson laboratory ( bar harbor , me ) . these mice were generated using embryonic stem cells from the 129 strain of mice and were crossbred to c57bl/6 for over 10 generations . they were maintained under barrier conditions in a temperature - controlled environment and fed with a mouse chow containing approximately 5% fat and 19% protein by weight ( harlan teklad , madison , wi ) . at 6 weeks of age one group of the mice was gavage - fed 2-ap at a dose of 200 mg / kg body weight ( bw ) in 200 l water once every other day , and another group of mice was fed with same volume of water as a control . after 24 weeks of treatment , mice were fasted overnight and anesthetized with ketamine hydrochloride ( 80 mg / kg bw ) and xylazine hydrochloride ( 16 mg / kg bw ) . approximately 0.5 ml of blood was collected from the posterior vena cava of each mouse . thereafter , a 23-gauge needle was inserted into the left ventricle and 4% paraformaldehyde was delivered into the animal at pressure of 80 mm hg . a small incision was made into the liver to allow efflux of blood and fixative . after fixation , the heart and the proximal aorta were removed from the body and stored in 4% paraformaldehyde at 4c before sectioning . the distal aorta ( 2 mm from the heart to the iliac bifurcation ) was opened longitudinally using microscissors and pinned flat on a black wax surface in a dissecting pan under a dissecting microscope ( smz1000 , nikon instruments inc . , this en face preparation was fixed overnight and stained with oil - red - o . the photo - image of the aorta was captured with a coolsnap digital camera ( nikon instruments ) mounted on the smz1000 dissecting microscope . the atherosclerotic lesion area and the total aortic area were measured using a metamorph imaging system ( nikon instruments ) . the proximal aorta attached to the heart was used to prepare cross - sections , as described previously . briefly , the heart was sectioned transversely immediately below and parallel to a plane formed by the line between atrial leaflets . the portion of the heart with the attached aorta was embedded either in oct or in paraffin , and sectioned from the attached aorta towards the root of the aorta where the aorta valves were attached . sections ( 58 m ) were cut from the site where the aorta valve cups appear at the aorta root . melville , ny ) equipped with a cool snaps color digital camera and a metamorph computer image acquisition system . the average area ( m ) and morphological features ( foam cell deposits , cholesterol clefts , lipid cores and fibrous - caps ) of the lesions in 16 sections were determined for each mouse . immunostaining was performed with the use of the vectastain abc system ( vector laboratories , inc . , the endogenous peroxidase activity was blocked with 5% hydrogen peroxide for 10 min . after blocking with 5% normal goat or rabbit serum , the sections were incubated with primary antibodies against grp78 or phosphorylated eif-2 ( abcam inc . , cambridge , ma ) . after treatment with a secondary antibody produced from goats or rabbits , sections were stained with diaminobenzidine or nova red substrates and counterstained with hematoxylin . the immunostaining of the aortic sections were viewed using a microscope equipped with an hq2 coolsnap high - resolution camera ( nikon ) and the megamorth computer image acquisition system . the levels of plasma cholesterol and triglycerides were measured by spectrophotometric quantification using reagents obtained from sigma chemical co. ( st . cholesterol - reaction reagent was incubated at 37c for 30 min , and the absorbance was read at 530 nm with a dynex microplate reader ( thermo labsystems , franklin , ma ) . for measuring triglycerides , the mixture of plasma and triglyceride - reaction reagent was incubated at 37c for 10 min , and the absorbance was read at 530 nm . plasma concentrations of cholesterol and triglycerides were determined based on the absorbance obtained by incubation of the cholesterol and triglyceride standards provided by sigma . for determination of the cholesterol level in various lipoproteins , a 100 l plasma sample obtained from individual mice was fractionated using a fast performance liquid chromatography ( fplc ) ( kta fplc 900 , amersham biosciences , piscataway , nj ) in a buffer containing 0.15 m nacl , 0.01 m na2hpo4 , 0.1 mm edta , ph 7.5 , at a flow rate of 0.5 ml / min . it had already been established that fractions 1417 contain very low - density lipoprotein ( vldl ) and chylomicrons , fractions 1825 contain ldl , and fractions 2640 contain high - density lipoprotein ( hdl ) [ 14 , 15 ] . the cholesterol content in various lipoproteins was calculated from the concentration in the fplc fractions [ 14 , 15 ] . the antibodies against phosphorylated eif-2 , grp78 and lysosomal acid lipase ( lal ) were obtained from abcam inc . ( cambridge , ma ) , while the antibodies against eif-2 and -actin were obtained from santa cruz biotechnology inc . aortas from two mice were pooled , homogenized in 20 mm tris - cl and centrifuged at 14,000 rpm for 10 min at 4c . supernatants containing 15 g protein were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis on 10% gels and transferred to polyvinylidene difluoride membranes . membranes were blocked with 5% fat - free milk in tbs - t ( 2.5 mm tris , 15 mm nacl , 0.01% tween 20 ; ph 7.6 ) and then consequently incubated with primary antibodies against indicated proteins and horseradish peroxidase - conjugated secondary antibodies , as previously described . immunoreactive bands were visualized using ecl - plus chemiluminescence reagent ( ge healthcare healthcare - amersham ) and analyzed with a gs-700 imaging densitometer ( bio - rad , hercules , ca ) . the differences between 2-ap treatment and control groups were analyzed by student 's t - test . the pharmacological properties of 2-ap , such as effective dose 50 ( ed50 ) and effective half - life ( t1/2 ) , have not been tested in vivo . the material safety data sheet produced by invivogen ( san diego , ca ) indicates that the lethal dose 50 ( ld50 ) of 2-ap via oral administration and intraperitoneal injection of rats is 723 and 270 mg / kg body weight ( bw ) , respectively . a preliminary study in our laboratory demonstrated that gavage feeding of 2-ap to apoe mice at doses greater than 400 mg / kg bw once every other day reduced food intake and resulted in death ( data not show ) . in the present study , we observed that feeding 2-ap at a dose of 200 mg / kg bw once every other day did not reduce food intake and body weight , and did not increase mortality within 24 weeks as compared to untreated control apoe mice ( table 1 ) . specifically , the average of food intake of apoe mice at 2430 weeks of age with or without 2-ap treatment was 0.24 0.03 and 0.25 0.07 g chow / g bw / day , respectively . the body weight of these mice at 30 weeks of age was about 27 g. no significant difference was observed between the 2-ap treated and the untreated control mice . we previously reported that 2-ap inhibited e / b48 lipoprotein - induced transformation of macrophages into foam cells . figures 1(a ) and 1(b ) show examples of cross - sections and en face preparations of aortas obtained from apoe mice treated with or without 2-ap . data in figures 1(c ) and 1(d ) show that the mean size of atherosclerotic lesions in the aorta sinus and the surface area of the entire aorta of 2-ap - treated apoe mice were reduced by about 55% and 39% , respectively , compared to those in the untreated control apoe mice . consistent with the smaller lesion size , the advanced lesions were reduced markedly in 2-ap - treated mice . for instance , the number of lipid cores ( acellular areas ) in the aortic sinus in the 2-ap - treated and untreated control apoe mice were 1.2 0.6 and 0.4 0.1/section ( p < 0.05 ) , respectively . these results , together with our previous findings that 2-ap inhibits e / b48 lipoprotein - induced foam cell formation , suggest that 2-ap is able to inhibit atherogenesis in vitro and in vivo . an increase in plasma cholesterol and triglycerides has been suggested to be a risk factor for atherosclerosis . to determine whether the reduction in atherosclerotic lesions induced by 2-ap treatment was due to a change in plasma cholesterol and triglycerides , we measured the levels of plasma cholesterol and triglycerides in apoe mice with or without 2-ap treatment . as the data in table 1 show that the average plasma concentrations of total cholesterol and triglycerides were 513 and 146 , respectively , in apoe mice without 2-ap treatment and that 2-ap treatment did not significantly alter these plasma lipid levels . to investigate whether 2-ap feeding affected the distribution of cholesterol among the lipoproteins , we fractionated mouse plasma with an fplc system ( figure 2(a ) ) . as the data in figure 2(b ) show , the plasma cholesterol levels in vldl , ldl , and hdl fractions were comparable in 2-ap - treated and untreated control mice . these results suggest that the reduced atherosclerotic lesions in 2-ap treated mice were not due to altered levels of plasma lipids . we previously reported that transformation of macrophages into foam cells by e / b48 lipoproteins was associated with er stress , as reflected by increased phosphorylation of perk and eif-2. further that 2-ap inhibited e / b48 the present report studied the effect of 2-ap on the expression level of total and phosphorylated eif-2 in the aorta of apoe mice . data in figure 3(a ) show that the level of total eif-2 was comparable in aortas obtained from apoe mice treated with or without 2-ap treatment . in contrast , the level of phosphorylated eif-2 in the aorta was about 64% lower in 2-ap - treated apoe mice than in untreated control mice ( figure 3(b ) ) . the data in figure 3(c ) demonstrate that the protein level of chaperon grp78 was reduced by ~53% in 2-ap - treated apoe mice as compared to the untreated control littermates . we previously reported that intralysosomal accumulation of lipids / lipoproteins induced by e / b48 lipoproteins was associated with decreased lysosomal hydrolase lal , and that 2-ap treatment restored e / b48 lipoprotein - reduced expression of lal . therefore , the present report compared the protein levels of lal in the aorta of apoe mice with or without 2-ap treatment . data in figures 3(a ) and 3(c ) show that the protein level of aortic lal was ~2.6 fold higher in 2-ap - treated apoe mice than in their untreated littermates . having demonstrated the inhibitory activity of 2-ap on er stress in the aorta , we then compared the expression of grp78 and phosphorylated eif-2 in the lesional area in the aorta sinus . as the representative immunostaining sections in figure 4 show , the atherosclerotic lesions , especially the areas close to the plaque surface , accumulated cells positively stained by antibodies against grp78 or phosphorylated eif-2. the number of positively stained cells in 2-ap - treated apoe mice was much less than those in untreated control mice . these results are consistent with the western blot data shown in figure 3(a ) . these findings provide evidence that 2-ap inhibits er stress in the aorta of apoe mice . the most important finding of this report is that oral feeding of the eif-2 phosphorylation inhibitor 2-ap reduced atherosclerotic lesions in apoe mice . this finding suggests that induction of eif-2 phosphorylation is a causal mechanism for the development of atherosclerosis in apoe mice . four eif-2 kinases have been identified in mammalian cells , which each catalyze eif-2 phosphorylation in response to various stressful cellular events [ 18 , 19 ] . specifically , er stress activates perk , heme deprivation activates heme - regulated inhibitor ( hri ) , virus infection activates double - stranded rna - activated protein kinase ( pkr ) and amino acid deprivation activates general control nonderepressible-2 ( gcn2 ) . previous studies from our laboratory demonstrated that treatment of mouse macrophages with e / b48 lipoproteins induced phosphorylation of perk but no other eif-2 kinases and that overexpression of a nonphosphorylatable perk mutant attenuated e / b48 lipoprotein - induced eif-2 phosphorylation and foam cell formation [ 7 , 8 ] . these findings suggest that perk is responsible for the increased eif-2 phosphorylation observed in e / b48 lipoprotein - treated macrophages . a high plasma level of e / b48 lipoproteins is a hallmark feature of apoe mice [ 10 , 20 ] . data from the present report demonstrated that 2-ap treatment reduced eif-2 phosphorylation in the aorta apoe mice . it is highly likely that plasma e / b48 lipoproteins infiltrate into the arterial walls of apoe mice , where they activate perk and sequentially increase eif-2 phosphorylation in vascular cells , including resident macrophages . indeed , phosphorylation of eif-2 induced by e / b48 lipoproteins has been associated with increased expression of calreticulin and grp 78 . inhibition of eif-2 by a nonphosphorylatable eif-2 mutant or an 2-ap attenuated e / b48 lipoprotein - induced expression of these protein chaperons . data from the present report showed that 2-ap treatment reduced the expression of grp78 . reduction in global protein synthesis is another hallmark consequence of eif-2 phosphorylation . under physiological conditions , inhibition of global protein synthesis and upregulation of protein chaperones reduces the accumulation of newly synthesized proteins in the er , thereby relieving er stress [ 21 , 22 ] . however , constant phosphorylation of eif-2 and inhibition of global protein synthesis might overpower normal cellular functions , causing pathological conditions [ 21 , 22 ] . for example , we previously observed that e / b48 lipoprotein - induced eif-2 phosphorylation was associated with reduced global protein synthesis and reduced expression of lysosomal hydrolases , such as lysosomal acid lipase ( lal ) . in addition , we previously observed that inhibition of eif-2 phosphorylation by 2-ap , or a nonphosphorylatable eif-2 mutant , attenuated the reduced expression of lal and inhibited foam cell formation induced by e / b48 lipoproteins [ 7 , 8 ] . lal is the sole hydrolase responsible for cleavage of cholesteryl esters delivered to lysosomes [ 24 , 25 ] . taken together , our previous studies suggest that reduction in lysosomal hydrolases could be a fundamental mechanism by which e / b48 lipoproteins trigger intracellular lipid / lipoprotein accumulation and transform macrophages into foam cells . correspondingly , the present report demonstrated that treatment of apoe mice with 2-ap significantly elevated the protein level of lal in the apoe mouse aorta . it is possible that the e / b48 lipoproteins deposited in the arterial wall induce eif-2 phosphorylation , which downregulates lysosomal hydrolases , such as lal , in the resident macrophages , and therefore reduces the degradation of e / b48 lipoproteins leading to intralysosomal e / b48 lipoprotein accumulation and resulting in foam cell formation and atherosclerosis development . this postulation is supported by the evidence showing that patients with a deficiency of lal manifest both an accumulation of lipids in cells and develop premature atherosclerosis . further more , overexpression of lal reduces atherosclerotic lesions in mice deficient in low - density lipoprotein receptor . this report demonstrated that er stress occurred in the aorta of apoe mice , as reflected by increased phosphorylation of perk and eif-2 and by increased expression of chaperon grp78 . we also observed that inhibition of eif-2 phosphorylation by 2-ap reduced atherosclerotic lesions in the aorta of apoe mice . these observations suggest that induction of er stress , that is , activation of the perk - eif2 signaling cascade , is a causal mechanism for development of atherosclerosis in apoe mice . such insights will inform novel strategies for using er stress inhibitors such as 2-ap to prevent or treat atherosclerosis .

we previously reported that the apolipoprotein ( apo ) b48-carrying lipoproteins obtained from apoe knockout ( apoe/ ) mice , so called e/b48 lipoproteins , transformed mouse macrophages into foam cells and enhanced the phosphorylation of eukaryotic translation initiation factor 2 ( eif-2 ) . furthermore , the eif-2 phosphorylation inhibitor , 2-aminopurine ( 2-ap ) , attenuated e/b48 lipoprotein - induced foam cell formation . the present report studied the effect of 2-ap on atherosclerosis in apoe/ mice . our results showed that the level of food intake , bodyweight , plasma cholesterol , and triglycerides was comparable in apoe/ mice treated with or without 2-ap . however , the mean size of atherosclerotic lesions in the aorta sinus as well as the surface area of the entire aorta of 2-ap - treated apoe/ mice were reduced by about 55% and 39% , respectively , compared to samples from untreated control apoe/ mice . in addition , the 2-ap - treated apoe/ mice showed a significant decrease in glucose - regulated protein 78 ( grp78 ) and phosphorylated eif-2 in their aortic samples as compared to levels in untreated control apoe/ mice . these observations suggest that endoplasmic reticulum stress is a causal mechanism for the development of atherosclerosis in apoe/ mice and that therapeutic strategies can be developed for using eif-2 phosphorylation inhibitors , such as 2-ap , to prevent or treat atherosclerosis .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

the tsc lines used in this study were b6ts4 and egfp - ts3.5 , which were derived from a blastocyst of the c57bl/6 and icr mouse strain , respectively . tscs were cultured as described previously . in brief , cells were cultured on mitomycin - c ( sigma - aldrich , st . louis , mo , usa)-treated primary mouse embryonic fibroblasts in rpmi1640 medium ( thermo fisher scientific , san jose , ca , usa ) with 20% fetal bovine serum ( thermo fisher scientific ) , 25 ng / ml human recombinant fgf4 ( wako pure chemicals , osaka , japan ) , 1 g / ml heparin ( sigma - aldrich ) , 100 m 2-mercaptoethanol ( sigma - aldrich ) , 1% glutamax ( thermo fisher scientific ) , and 1 mm sodium pyruvate ( thermo fisher scientific ) . representative colony morphologies are shown in fig . 1 , together with descriptions of their morphological characters . there was an additional type ( type 5 ) , but this was not analyzed here because it rarely emerged under normal tsc culture conditions . at 96 h after passaging , colonies were picked up using a glass capillary pipette under a dissecting microscope and used for rt - qpcr analysis . total rna for rt - qpcr was extracted with rneasy micro kits ( qiagen , venlo , netherlands ) from tsc colonies . following extraction , the first strand cdna was synthesized with a superscript iii reverse transcriptase reagent set ( thermo fisher scientific ) . gene expression was assessed by qpcr on a steponeplus instrument ( thermo fisher scientific ) using quantitect sybr green pcr kits ( qiagen ) according to the manufacturer s instructions . samples were denatured at 95c for 10 min , followed by 40 amplification cycles consisting of denaturation at 95c for 15 sec , and an annealing and extension step at 60c for 1 min . raw cq ( ct ) values ( pcr cycles at which the fluorescence signal crosses threshold ) were calculated using stepone software ( v. 2.1 ; thermo fisher scientific ) setting baseline and appropriate threshold values . all runs were performed in triplicate and an identical sample was used in each different runs as an inter - run calibration sample to correct for the technical variance between the runs and thus compare results from different plates [ 4 , 6 ] . the primer sets used for tsc marker genes were the following : cdx2 , 5gcagtccctaggaagccaag3 and 5gcagccagctcacttttcct3 ; elf5 , 5gtggcatcctggaatgggaa3 and 5cactaacctccggtcaaccc3. for quantification of reference genes ( atp5b , canx , cyc1 , gapdh , ubc , rn18s ) , the primer sets from the mouse genorm kit ( primerdesign ltd . , southampton , uk ) were used . actb was analyzed as an additional reference gene using the primer set 5ctgtcgagtcgcgtcca3 and 5acccattcccaccatcacac3. the baseline cycles and cycle thresholds were established manually for each gene . to assess the stability of the reference genes , the raw cq values of each reference gene were analyzed with the genorm algorithmic tool using qbase software ( biogazelle ) . these values were converted into normalized relative quantities ( nrqs ) with multiple reference genes based on the modified classic --ct method or a single reference gene . nrqs were scaled in relation to the mean across all samples for each target or to reference genes . we ranked the stability of the reference genes based on the mean expression stability ( genorm m value ) provided by the genorm program . to determine the optimal number of reference genes across different colony types , qbase was also used to calculate pairwise variation ( v value ) . normalization of the expression levels of tsc marker genes ( cdx2 and elf5 ) was performed by qbase software using reference gene(s ) ranked as described above . to compare the gene expression levels between colony types within the tsc lines , normalized relative mrna levels were analyzed with kruskal - wallis tests followed by dunnett s multiple comparison tests ; p < 0.05 was considered statistically significant . the tsc lines used in this study were b6ts4 and egfp - ts3.5 , which were derived from a blastocyst of the c57bl/6 and icr mouse strain , respectively . tscs were cultured as described previously . in brief , cells were cultured on mitomycin - c ( sigma - aldrich , st . louis , mo , usa)-treated primary mouse embryonic fibroblasts in rpmi1640 medium ( thermo fisher scientific , san jose , ca , usa ) with 20% fetal bovine serum ( thermo fisher scientific ) , 25 ng / ml human recombinant fgf4 ( wako pure chemicals , osaka , japan ) , 1 g / ml heparin ( sigma - aldrich ) , 100 m 2-mercaptoethanol ( sigma - aldrich ) , 1% glutamax ( thermo fisher scientific ) , and 1 mm sodium pyruvate ( thermo fisher scientific ) . representative colony morphologies are shown in fig . 1 , together with descriptions of their morphological characters . there was an additional type ( type 5 ) , but this was not analyzed here because it rarely emerged under normal tsc culture conditions . at 96 h after passaging , colonies were picked up using a glass capillary pipette under a dissecting microscope and used for rt - qpcr analysis . total rna for rt - qpcr was extracted with rneasy micro kits ( qiagen , venlo , netherlands ) from tsc colonies . following extraction , the first strand cdna was synthesized with a superscript iii reverse transcriptase reagent set ( thermo fisher scientific ) . gene expression was assessed by qpcr on a steponeplus instrument ( thermo fisher scientific ) using quantitect sybr green pcr kits ( qiagen ) according to the manufacturer s instructions . samples were denatured at 95c for 10 min , followed by 40 amplification cycles consisting of denaturation at 95c for 15 sec , and an annealing and extension step at 60c for 1 min . raw cq ( ct ) values ( pcr cycles at which the fluorescence signal crosses threshold ) were calculated using stepone software ( v. 2.1 ; thermo fisher scientific ) setting baseline and appropriate threshold values . all runs were performed in triplicate and an identical sample was used in each different runs as an inter - run calibration sample to correct for the technical variance between the runs and thus compare results from different plates [ 4 , 6 ] . the primer sets used for tsc marker genes were the following : cdx2 , 5gcagtccctaggaagccaag3 and 5gcagccagctcacttttcct3 ; elf5 , 5gtggcatcctggaatgggaa3 and 5cactaacctccggtcaaccc3. for quantification of reference genes ( atp5b , canx , cyc1 , gapdh , ubc , rn18s ) , the primer sets from the mouse genorm kit ( primerdesign ltd . , southampton , uk ) were used . actb was analyzed as an additional reference gene using the primer set 5ctgtcgagtcgcgtcca3 and 5acccattcccaccatcacac3. the baseline cycles and cycle thresholds were established manually for each gene . to assess the stability of the reference genes , the raw cq values of each reference gene were analyzed with the genorm algorithmic tool using qbase software ( biogazelle ) . these values were converted into normalized relative quantities ( nrqs ) with multiple reference genes based on the modified classic --ct method or a single reference gene . nrqs were scaled in relation to the mean across all samples for each target or to reference genes . we ranked the stability of the reference genes based on the mean expression stability ( genorm m value ) provided by the genorm program . to determine the optimal number of reference genes across different colony types , qbase was also used to calculate pairwise variation ( v value ) . normalization of the expression levels of tsc marker genes ( cdx2 and elf5 ) was performed by qbase software using reference gene(s ) ranked as described above . to compare the gene expression levels between colony types within the tsc lines , normalized relative mrna levels were analyzed with kruskal - wallis tests followed by dunnett s multiple comparison tests ; p < 0.05 was considered statistically significant .

mouse trophoblast stem cells ( tscs ) form colonies of different sizes and morphologies , which might reflect their degrees of differentiation . therefore , each colony type can have a characteristic gene expression profile ; however , the expression levels of internal reference genes may also change , causing fluctuations in their estimated gene expression levels . in this study , we validated seven housekeeping genes by using a geometric averaging method and identified gapdh as the most stable gene across different colony types . indeed , when gapdh was used as the reference , expression levels of elf5 , a tsc marker gene , stringently classified tsc colonies into two groups : a high expression groups consisting of type 1 and 2 colonies , and a lower expression group consisting of type 3 and 4 colonies . this clustering was consistent with our putative classification of undifferentiated / differentiated colonies based on their time - dependent colony transitions . by contrast , use of an unstable reference gene ( rn18s ) allowed no such clear classification . cdx2 , another tsc marker , did not show any significant colony type - specific expression pattern irrespective of the reference gene . selection of stable reference genes for quantitative gene expression analysis might be critical , especially when cell lines consisting of heterogeneous cell populations are used .

Materials and Methods Cell lines Colony classification and sample collection RT-qPCR Data analysis Statistical Analysis

epilepsy surgery is an established treatment in selected patients with drug - resistant epilepsy resulting in seizure freedom or a significant reduction of seizure frequency in the majority of operated patients.13 a detailed clinical assessment is critical before a decision about surgery can be made in order to localise the seizure onset zone . for many patients , however , especially in mri - negative patients , invasive seizure monitoring is required for localising the seizure onset zone and also for delineating the area of planned resection against eloquent cortex.4 despite the potential benefits of the invasive workup , they have to outweigh the risks related to the neurosurgical procedure . the rates of reported complications related to invasive monitoring differ widely between studies , from no complications at all5 up to 26.3%.6 the reasons for these varying proportions may be related to the definitions of complications and to study methodology ( eg , if data are obtained retrospectively or prospectively ) . many reports use the terms transient and permanent , surgical and neurological complications.7 8 additionally , severity scales from 1 to 4,9 or from 1 to 5 have been used.4 in the swedish national epilepsy surgery register all complications related to diagnostic or therapeutic epilepsy surgery procedures are reported and are graded as major or minor.10 a few studies have evaluated the usefulness and safety versus the risks associated with implantation of intracranial electrodes , and the benefits of invasive workup for epilepsy surgery in general seem to outweigh the risks.11 12 increased number of electrodes and longer duration of monitoring has been shown to be associated with increased frequency of adverse events.13 other aspects not explored include age and medication . higher age was shown to be associated with an increased risk for complications at epilepsy surgery in an earlier swedish national study10 and , therefore , it would be of interest to investigate whether the risk of complications related to invasive monitoring is also age related . valproate treatment may induce thrombocytopenia which seems to be dose dependent with a negative correlation between valproate trough levels and platelet counts.14 although several studies have found no indication that patients on valproate treatment are at an increased risk of surgical bleeding complications,15 16 there is a worry about the possible risk , and some epilepsy surgeons do not operate patients who are on valproate treatment . the aim of the current study was to analyse data from the prospective population - based swedish national epilepsy surgery register 19962010 , in order to describe the complications related to preoperative invasive investigations with intracranial electrodes . secondary aims were to explore if the risk of complications is age related , if there was a higher risk of haemorrhagic complications in patients who were treated with valproate , and whether complications occurring during invasive monitoring is a risk factor for complications at therapeutic surgery . every epilepsy surgery procedure in sweden is reported to the swedish national epilepsy surgery register . the register includes data on all patients who have been operated in sweden since 1990 . it was initiated by the swedish board of health and welfare as a quality control register , and is controlled by the swedish data inspection board . the validity of the data collected from the centres is regularly checked by intrinsic checkpoints within the database and by external revision . two epilepsy nurses visit the six centres regularly and compare the data entered into the central database with the original data from the patient files for a random yearly sample of around 25% of the patients operated at each centre . the items controlled in this external revision include side and site of operation , complications , main histopathological findings and seizure outcome at the two - year follow - up . so far , there have been no mismatches in the reporting on any of these central items . the regional board of medical ethics at the university of gothenburg considered this study a quality control study not necessitating informed consent for research . in this study , we have analysed complications after invasive eeg monitoring in all patients who , prior to surgery , underwent investigations with subdural strips or grids , intracerebral depth electrodes , foramen ovale electrodes or epidural electrodes from january 1996 to december 2010 . ( during this time period , stereo - eeg ( seeg ) was not performed in sweden , the depth electrodes used were freely placed most often in conjunction with grid electrodes ) . two or more electrode types were often combined , and when reporting complications in relation to electrode type the most complication - prone electrode type has been accounted for . the register does , however , not provide information on the number of electrodes and the duration of monitoring . complications are reported as major or minor to the register , and the type of complication is commented upon . minor complications are defined as those that resolve within 3 months , while major complications affect activities of daily living and last longer than 3 months . major complications also include any significant neurological deficits , even if they do not affect activities of daily living.10 the antiepileptic drug treatment at the presurgical investigation is reported , but not the dosage . the swedish national epilepsy surgery register does not contain information on laboratory variables , such as trough levels of antiepileptic drugs or platelet counts . between 1 january 1996 and 31 december 2010 , 865 patients underwent therapeutic surgical procedures . seven hundred and ninety - eight of the operations were resections : 523 were temporal lobe resections ( tlr ) and 142 were frontal lobe resections ( flr ) . there were 44 parietal lobe resections ( plr ) , 27 occipital lobe resections ( olr ) , 19 multilobar resections ( mlr ) and 43 hemispherectomies . two hundred and seventy - six of the 865 patients ( 32% ) underwent diagnostic intracranial monitoring with invasive electrodes prior to the therapeutic surgical procedure . two hundred and sixty - four of them had a resective procedure later , and there were eight multiple subpial trans - sections , three callosotomies and one exploration . forty three per cent ( n=61 ) of the patients who eventually had an flr were invasively monitored , versus 30% ( n=156 ) of the patients who had a tlr , 57% of the patients who had a plr , 30% of the patients who had an olr , 63% of the patients who had an mlr and 5% of the patients who had a hemispherectomy . patient age at surgery ranged from two years to 58 years ( median 26 years ) , 134 ( 48.6% ) were female and 142 ( 51.4% ) were male . for five patients , data on complications to the invasive investigation were missing , which is why complication data are reported for 271 patients . for another five patients , data on electrode type was missing , hence , the analysis of electrode type related to surgical complications is limited to 271 patients . minor complications occurred in 13 of 271 cases ( 4.8% ) ( table 1 ) . complications related to intracranial monitoring haematomas were most common , associated with a 3.7% risk ( n=10 ) . of these , seven ( 2.6% ) were subdural haematomas and three were epidural haematomas ( 1.1% ) . two patients suffered from wound infections and one from electrode dislocation , representing a complication rate of 0.7 and 0.4% . individual patient data for all complications occurring during intracranial monitoring are given in table 2 . individual complications occurring during intracranial monitoring lflr , left frontal lobe resection ; ltlr , left temporal lobe resection mst , multiple subpial trans - section ; rflr , right frontal lobe resection rtlr , right temporal lobe resection . ten per cent ( n=6 ) of the 61 patients who were investigated for an flr and 4% ( n=6 ) of the 156 patients investigated for a tlr suffered from complications from the invasive electrode monitoring . in the group of patients who had complications , five out of the six who had frontally located electrodes had a subdural haematoma . among the patients with complications from temporally located electrodes , there was a slight , non - significant difference in complication rate between female ( 3.9% , n=5 ) and male patients ( 5.7% , n=8 ) . among the 108 patients who were monitored with subdural grids , eight ( 7.4% ) suffered from complications , mostly haematomas . as shown in table 3 , grids had the highest complication rate , followed by intracerebral depth electrodes . two patients in the study had epidural electrodes , and one of them got a subdural haematoma . electrode types and complications electrode type alone or in combination , most complication prone first . d , electrode dislocation ; eh , epidural haematoma ; i , infection ; sh , subdural haematoma . when patients were divided into age categories ( table 4 ) there was a difference between the age groups . children ( age 518 years ) and young adults ( age 1835 years ) had complications in 3.2 and 3.6% , respectively , while 8.3% of adults 35 years old had complications . age and complications sixty of the 271 patients ( 22% ) in who reports on complications or not had been registered were treated with valproate at the time of presurgical investigations , alone or in combination with other antiepileptic drugs . three of the 60 patients on valproate had a bleeding during invasive monitoring ( 5% ) compared with seven of the 211 patients who were not treated with valproate ( 3.3% ) . treatment with valproate and having a bleeding was associated with an or of 1.53 ( 95% ci 0.38 to 6.12 ) compared to having a bleeding and not being treated with valproate . this association was , however , not significant as shown by the wide ci including 1 . in the whole swedish series of 865 therapeutic surgeries 19962010 , there were 26 major complications ( 3%).17 a post hoc analysis of a possible relationship between having a complication during invasive monitoring and at surgery was performed . two of 13 patients ( 15% ) who had a complication at the invasive monitoring in addition also suffered a major complication related to the therapeutic procedure , compared to 24/852 ( 3% ) patients who had a complication only at therapeutic surgery . having a complication during invasive monitoring was associated with a significant or of 6.27 ( ci 1.32 to 29.9 ) of also having a complication at therapeutic surgery compared to the risk of having a complication only at surgery . there was no relationship between the kind of complication ( bleeding or other ) at the one or the other procedure . in this series , the rate of haemorrhagic complications ( 3.6% of the patients ) was comparable with that reported in a recent systematic review concerning adverse events related to invasive eeg monitoring with subdural grid electrodes which identified 21 studies including 2542 patients.13 in this review , the mean pooled prevalence of haematomas was 4% . the development of subdural haematoma was the most common type of complication ( 2.6% ) in our series , more than half the complications were in this category ( n=7 ) . the prevalence of subdural haematomas varies widely in the literature and is reported to be common in some studies , whereas , other groups report no subdural haematomas at all in their series . in the abovementioned review , subdural haematomas were documented in 41 of 2356 patients ( pooled prevalence 1.7%).13 three ( 1.1% ) of our patients developed epidural haematomas during the invasive eeg monitoring . this is slightly higher than the 0.6% reported by arya et al.13 even higher rates have been reported by hamer et al ( 2.5%),6 while several studies report no epidural haematomas at all.1820 two ( 0.7% ) of the patients in our study had wound infections , whereas , there were no intracranial infections . this is a low number compared to other studies . in the review by arya et al , infections emerged as the most common type of complication with a pooled prevalence of 5.3% ( 2.3% neurologic infections and 3.0% superficial infections).13 some series also have significantly higher infection rates.9 21 in one prospective study , the infection rate was shown to increase if more than 100 electrode contacts were used , if more than ten electrode cables were present , or if electrodes remained implanted for more than 14 days.22 since the swedish national epilepsy surgery register does not contain data on number of electrode contacts or days , we were not able to analyse the impact of these factors in our series . we hypothesise that one reason we do not have any bone flap or deep infections may be attributed to short surgical time23 since we , in general , use fewer grids than reported from many centres in complication series . in our series , grid electrodes caused more complications than other types of electrodes , as eight of 13 affected patients had grid electrodes alone or in combination with other electrode types . this correlation between subdural grids and complications has also been shown by other groups.4 24 the reasons for this increased risk are unclear but could be mechanical or haemodynamic ( the grid disturbing the csf circulation ) . whether the addition of strips to a subdural grid recording increases the risk of complications can not be excluded , although strips per se have a low complication rate . patients who are investigated for frontal lobe seizure onset tend to have more grid electrodes than other patients . this group of patients also suffered from complications more often than other groups in our series , nearly 10% ( 6 out of 61 ) , and all were haematomas . next in line were the patients investigated for temporal lobe epilepsy , almost 4% ( 6 out of 156 ) had complications . we assume that the high rate of haemorrhagic complication in patients with frontal lobe seizures was related to the more common use of grids . there was a ( non - significant ) trend towards higher risk for complications in patients who were 35 years or more in our series . the association between complications and age has previously been documented in relation to invasive monitoring , resective epilepsy surgery procedures and other neurosurgical procedures , and has been discussed in terms of increasing tissue fragility and affection of the cerebrovascular system with increasing age.6 10 25 on the other hand , blauwblomme et al studied adverse events related to invasive eeg monitoring in children and found a very high complication rate , almost half the patients suffered from some kind of complication . this can partly be explained by the fact that in this series a wide range of adverse events was considered as complications , for example , cerebrospinal leakage.9 minor adverse events such as headache , nausea , light fever and tiredness during the first postoperative days can be associated with the implantation of subdural electrodes , but most surgeons consider them as expected effects of the implantation and they are rarely documented . in the post hoc exploration of a possible relationship between complications during invasive monitoring and at surgery it was notable that two of the 13 patients with complications in our study also suffered from major complications after the therapeutic resection.17 since this association was not explained by bleedings , some other vulnerability may be at play , for which we presently have no explanation . in order to verify and elucidate this finding , prospective multicentre studies of complications during invasive monitoring and in relation to resective surgery , collecting more detailed patient data is needed . there was no significant association between valproate treatment and bleeding complications during invasive monitoring and , therefore , there is no support for the notion that valproate treatment is an important risk factor for bleedings . however , the or of 1.53 implies that there is a small increase in risk and it would be valuable if this could be further studied in larger samples preferably with data on valproate dosage , trough levels and platelet counts . in one large single centre study , the risk of bleedings requiring acute decompression was shown not to be related to the surgical learning curve , and so , not to diminish over time.4 the importance of minimising such potentially life - threatening complications during presurgical investigations can not be overstated . five deaths directly related to subdural grid implantation were documented in the systematic review.13 this does not , however , cover complications related to depth electrodes . in general , complications have been reported to be less common with depth electrodes than with subdural grids,4 5 7 2629 but at least two fatalities have been reported with seeg recordings.30 31 also , engel et al early on reported two deaths from intracerebral haemorrhage caused by depth electrodes.32 an important issue when striving to lower the risk of serious complications related to invasive monitoring is surveillance . it is clear from the literature that some reported deaths have been related to lack of 24 h professional surveillance.33 while serious complications can not totally be avoided , their effects may be minimised with rapid intervention such as acute decompression . in our series , the four swedish centres in which subdural grids are used all have personalised 24 h surveillance of those patients and have , therefore , managed to act rapidly in case of complications . the spectrum of definitions and scales makes it difficult to compare studies and , therefore , reporting only percentages is not very meaningful . the main issues are study methodology on the one hand , and the definitions of complications on the other . most studies are single - centre retrospective studies , while a few studies analyse prospectively recorded data.9 22 24 it would be valuable if an agreement could be reached on how to report complications associated with invasive eeg monitoring , and agree about what is to be considered a complication and what could rather be described as a more or less expected adverse event . in the present study , we have not considered transient csf leakage , fever and headache as complications , as all these commonly occur after implantation of intracranial electrodes . neither have we had as a routine to report small asymptomatic subdural haematomas . we acknowledge that this is a limitation of the study , and are aware that it leads more to a top of the iceberg reporting , but we capture symptomatic complications and especially all those necessitating interventions . another limitation of the study is that the register does not contain information on the number of electrodes and duration of invasive monitoring , and these variables could , therefore , not be related to the risk of complications . the main strength of the study is the prospective collection of population - based data in a large national series . also , our external quality control ensures that the data has been correctly entered from the patient files into the register . in this prospective population - based epilepsy surgery series , the most common complications were haematomas , and subdural grids carried the highest risk of complications . close supervision and rapid interventions led to avoidance of permanent morbidity . whether the slightly increased risk of haematomas with valproate treatment is clinically relevant needs further investigation , as does the finding of an increased risk for complications at epilepsy surgery for patients who had a complication during invasive monitoring . there is a need for consensus on how to report complications related to invasive monitoring in order to provide patients with adequate information on risks .

objectivein some patients who undergo presurgical workup for drug - resistant epilepsy invasive seizure monitoring is needed to define the seizure onset zone and delineate eloquent cortex . such procedures carry risks for complications causing permanent morbidity and even mortality . in this study , prospective data on complications in a national population - based sample were analysed.designcomplication data from the prospective swedish national epilepsy surgery register were analysed for 271 patients in whom therapeutic surgery was preceded by invasive monitoring 19962010.resultscomplications occurred in 13/271 patients ( 4.8% ) . subdural grids carried the highest risk of complications ( 7.4% ) . there was no surgical mortality or permanent morbidity . subdural haematomas were most common ( n=7 ) followed by epidural haematomas ( n=3 ) . valproate treatment and having a haematoma was associated with an or of 1.53 ( ci 0.38 to 6.12 ) compared to having a haematoma without valproate treatment . having a complication during invasive monitoring was associated with a significant or of 6.27 ( ci 1.32 to 29.9 ) of also having a complication at therapeutic surgery compared to the risk of having a complication only at surgery.conclusionsin this prospective population - based epilepsy surgery series , the most common complications were haematomas , and subdural grids carried the highest risk . close supervision and rapid interventions led to avoidance of permanent morbidity . the clinical implications of the slightly increased risk of haematomas with valproate treatment needs further investigation as does the finding of an increased risk for complications at epilepsy surgery for patients who had a complication during invasive monitoring .

Introduction Patients and methods Results Discussion Conclusion

scoliosis , newly developed in a skeletally mature patient , is termed degenerative scoliosis or de novo scoliosis . prevalence and incidence of degenerative scoliosis increase with age . an overall increase is seen due to the demographic shift towards an aging society [ 17 , 33 , 39 ] . generally it is assumed that degenerative scoliosis is caused by asymmetric disc degeneration and facet joint degeneration [ 1 , 3 , 4 , 7 , 27 , 30 , 36 ] and that the onset is marked by disc degeneration [ 17 , 25 ] . this etiology sets degenerative scoliosis apart from other types of scoliosis , such as adolescent idiopathic scoliosis and scoliosis secondary to neuromuscular disease . in addition , degenerative scoliosis develops most frequently in the lumbar spine , where degenerative changes are most prevalent , whereas in neuromuscular and idiopathic scoliosis the major curve is usually in the thoracic or thoracolumbar spine . . showed that the normal spine has a specific pattern of vertebral rotation , with a predominant rotation to the right at the mid - thoracic level . most prevalent curve types of adolescent idiopathic scoliosis were found to demonstrate comparable patterns [ 8 , 11 , 12 , 14 , 21 , 23 , 32 , 35 , 40 ] , which correspond to the predominant rotational pattern in the normal spine . this implies that once the spine starts to decompensate , due to a still unknown cause , it follows this already built - in rotational tendency . in degenerative scoliosis factors causing asymmetrical degeneration and the eventual disruption of the spinal equilibrium whether a pre - existing rotational pattern also plays a role in degenerative scoliosis is unknown . an argument against this is that the normal lumbar spine does not show an obvious rotation deviating from the midline . we hypothesize that spinal decompensation based on degenerative changes is purely coincidental and that left and right curves in lumbar degenerative scoliosis are equally distributed . however , if the distribution of curve direction is unequal , this may point to a pre - existing rotational tendency that has so far not been demonstrated . symptoms of degenerative scoliosis are most frequently progressive back pain , radiculopathy and neurogenic claudication [ 1 , 3 , 7 , 9 , 13 , 15 ] . aging progressively affects all structures of the spinal units , eventually leading to degenerative instabilities such as spondylolisthesis , spinal stenosis and scoliosis . relationships between scoliotic pattern and patient symptoms are unclear , although speculations on such relationships are frequently made [ 1 , 3 , 7 , 30 , 42 ] . some authors suggest that pain at the convexity is caused by muscle fatigue of the paraspinal muscles [ 3 , 30 , 42 ] . other authors claim that pain at the convexity can also be caused by facet joints . pain at the concavity of the scoliotic curve is thought to be caused by destruction of facet joints and degenerative changes in disc spaces . radicular pain at the concavity can arise from narrowed foramen [ 1 , 3 , 42 ] or ruptured discs causing radiculopathy [ 1 , 3 ] . dynamic overstretch of a nerve root could also cause radicular pain at the convex side of the scoliosis . the first objective of this study is to assess whether a dominant direction of compensation exists in degenerative scoliosis . our second objective is to investigate whether asymmetric symptoms are related to the curve direction , i.e. whether pain and radicular symptoms in degenerative lumbar scoliosis are predominantly present at one side relative to the curve direction . in this retrospective study we filtered the outpatient records of our institution for patients who presented between 1996 and 2007 and were diagnosed with degenerative scoliosis . patients aged 50 and over at the initial presentation of degenerative scoliosis and had a scoliosis of at least 10 in the coronal plain were included . patients were excluded if they had a previous history of idiopathic scoliosis , neuromuscular scoliosis , or scoliosis secondary to an underlying pathology . the patient records were reviewed in order to obtain patient data about age , gender , length , height , weight , symptoms , physical examination and history . for each patient , curve direction , apical level , apical vertebra , cobb angle in the coronal plane , and length of the curve were determined . the apex of the curve was determined in the coronal plane and the apical level was determined . the apical vertebra was defined according to the scoliosis research society ( srs ) as the vertebra with the greatest distance from the midline with the most rotation . according to the srs classification curves with an apex at the 12th thoracic vertebral body or the first lumbar vertebral body are thoracolumbar curves . curves with an apex between the first lumbar disc and the fourth lumbar vertebral body are lumbar curves . the cobb angle is the angle between the two most tilted vertebrae within a scoliotic curve . the length of the curves was taken as the number of vertebrae between these two most tilted vertebrae . patient symptoms recorded were low back pain , pain in the buttocks , leg pain , hypo- or hyperesthesia and weakness affecting the legs . all statistical analyses were performed with spss 15.0 for windows ( spss , inc , chicago , il ) . the binominal test was used to compare the observed frequencies of right and left curves to an equal distribution . in addition , it was tested whether curve direction depended on apex level using the chi - square test . whether the observed frequencies of ipsilateral and contralateral pain and/or radicular symptoms relative to the scoliotic curve direction differs from an equal distribution was tested using a binominal test . all statistical analyses were performed with spss 15.0 for windows ( spss , inc , chicago , il ) . the binominal test was used to compare the observed frequencies of right and left curves to an equal distribution . the tests were performed for all curves combined and also separately per apical level . in addition , it was tested whether curve direction depended on apex level using the chi - square test . whether the observed frequencies of ipsilateral and contralateral pain and/or radicular symptoms relative to the scoliotic curve direction differs from an equal distribution the group consisted of 71 women and 17 men with a mean age of 70 ( 70.1 10.3 ; range 5093 ) . of these patients 50 all patients had a single curve in the thoracolumbar range , except one patient who had a double curve . for this double curve , the curve with the largest cobb angle was considered in the analyses . of the total group , 39 curves ( 44% ) were to the right and 49 ( 56% ) were to the left ( p = 0.337 ) . apical levels ranged from the 12th thoracic disc to the 4th lumbar vertebra ( median apex , 2nd lumbar disc ) . the mean cobb angle was 25 ( 25.4 13.0 ; range 1083 ) . eighty - three patients had lumbar curves and five patients had thoracolumbar curves according to the srs classification . fifty - eight percent ( 49 ) of the lumbar curves were convex to the left ( p = 0.156 ) . eighty - three percent ( 5 ) of the thoracolumbar curves were convex to the right ( p = 0.375 ) . the apical vertebrae of the curves varied from l1 to l4 ( table 1 ) , with l3 the median apical vertebra.table 1the distribution of curve direction for each apical vertebraapical vertebra of curvennumber of curves convex to the rightnumber of curves convex to the leftp ( binominal test)l165 ( 83%)1 ( 17%)0.219l23520 ( 57%)15 ( 43%)0.500l33912 ( 31%)27 ( 69%)0.024*l482 ( 25%)6 ( 75%)0.289the p level indicates whether the distribution deviates significantly from an equal left right distribution*statistically significant ( p < 0.05 ) the distribution of curve direction for each apical vertebra the p level indicates whether the distribution deviates significantly from an equal left right distribution * statistically significant ( p < 0.05 ) left and right distributions were also tested per apical vertebra ( table 1 ) . for apical level l1 an inclination for convexity to the right eighty percent ( 4 ) of patients with the apex of the curve at l1 had a convexity to the right ( p = 0.219 ) . in 35 a small majority , 57% ( 20 ) of curves were convex to the right ( p = 0.500 ) . curves with an apex at l3 ( n = 39 ) , however , showed a significant inclination to the left . in this group 69% ( 27 ) had a curve convexity to the left ( p = 0.024 ) . also most ( 75% , n = 6 ) of the curves with the apex at l4 were convex to the left ( p = 0.289 ) . the curve direction depended significantly on the apical level ( p = 0.011 ) and on the level of the apical vertebra ( p = 0.017 ) ( fig . 1 ) . the direction of the curve depends significantly on the apical vertebra ( chi - square , p = 0.017 ) . when tested separately per level , the left right distribution for curves with an apex at l3 differed significantly from a random distribution ( binominal , p = 0.024 ) distribution of left and right convex curves per apical vertebra . the direction of the curve depends significantly on the apical vertebra ( chi - square , p = 0.017 ) . when tested separately per level , the left right distribution for curves with an apex at l3 differed significantly from a random distribution ( binominal , p = 0.024 ) all patients had low back pain . only four patients ( 5% ) had unilateral back pain . this was not related to the curve direction , since two patients had pain at the same , and two at the contralateral side of curve convexity . of these patients 57% ( 41 ) had unilateral leg pain , the others had pain in both legs . the side at which unilateral radicular leg pain occurred was unrelated to the curve direction ; 21 patients ( 51% ) had symptoms ipsilateral to the curve convexity and 20 ( 49% ) patients contralateral to the scoliotic curve ( p = 1.000 ) . seventy - two patients had symptoms of the lower extremities of which 22 had weakness , 1 hyperesthesia , 6 hypoesthesia and 11 showed neurological symptoms during physical examination . the group consisted of 71 women and 17 men with a mean age of 70 ( 70.1 10.3 ; range 5093 ) . of these patients 50 all patients had a single curve in the thoracolumbar range , except one patient who had a double curve . for this double curve , the curve with the largest cobb angle was considered in the analyses . of the total group , 39 curves ( 44% ) were to the right and 49 ( 56% ) were to the left ( p = 0.337 ) . apical levels ranged from the 12th thoracic disc to the 4th lumbar vertebra ( median apex , 2nd lumbar disc ) . the mean cobb angle was 25 ( 25.4 13.0 ; range 1083 ) . eighty - three patients had lumbar curves and five patients had thoracolumbar curves according to the srs classification . fifty - eight percent ( 49 ) of the lumbar curves were convex to the left ( p = 0.156 ) . eighty - three percent ( 5 ) of the thoracolumbar curves were convex to the right ( p = 0.375 ) . the apical vertebrae of the curves varied from l1 to l4 ( table 1 ) , with l3 the median apical vertebra.table 1the distribution of curve direction for each apical vertebraapical vertebra of curvennumber of curves convex to the rightnumber of curves convex to the leftp ( binominal test)l165 ( 83%)1 ( 17%)0.219l23520 ( 57%)15 ( 43%)0.500l33912 ( 31%)27 ( 69%)0.024*l482 ( 25%)6 ( 75%)0.289the p level indicates whether the distribution deviates significantly from an equal left right distribution*statistically significant ( p < 0.05 ) the distribution of curve direction for each apical vertebra the p level indicates whether the distribution deviates significantly from an equal left right distribution * statistically significant ( p < 0.05 ) left and right distributions were also tested per apical vertebra ( table 1 ) . for apical level l1 an inclination for convexity to the right eighty percent ( 4 ) of patients with the apex of the curve at l1 had a convexity to the right ( p = 0.219 ) . in 35 a small majority , 57% ( 20 ) of curves were convex to the right ( p = 0.500 ) . curves with an apex at l3 ( n = 39 ) , however , showed a significant inclination to the left . in this group 69% ( 27 ) had a curve convexity to the left ( p = 0.024 ) . also most ( 75% , n = 6 ) of the curves with the apex at l4 were convex to the left ( p = 0.289 ) . the curve direction depended significantly on the apical level ( p = 0.011 ) and on the level of the apical vertebra ( p = 0.017 ) ( fig . 1 ) . the direction of the curve depends significantly on the apical vertebra ( chi - square , p = 0.017 ) . when tested separately per level , the left right distribution for curves with an apex at l3 differed significantly from a random distribution ( binominal , p = 0.024 ) distribution of left and right convex curves per apical vertebra . the direction of the curve depends significantly on the apical vertebra ( chi - square , p = 0.017 ) . when tested separately per level , the left right distribution for curves with an apex at l3 differed significantly from a random distribution ( binominal , p = 0.024 ) all patients had low back pain . only four patients ( 5% ) had unilateral back pain . this was not related to the curve direction , since two patients had pain at the same , and two at the contralateral side of curve convexity . of these patients 57% ( 41 ) had unilateral leg pain , the others had pain in both legs . the side at which unilateral radicular leg pain occurred was unrelated to the curve direction ; 21 patients ( 51% ) had symptoms ipsilateral to the curve convexity and 20 ( 49% ) patients contralateral to the scoliotic curve ( p = 1.000 ) . seventy - two patients had symptoms of the lower extremities of which 22 had weakness , 1 hyperesthesia , 6 hypoesthesia and 11 showed neurological symptoms during physical examination . in this retrospective radiographic study we have assessed the direction of curve decompensation in a group of 88 patients with degenerative lumbar scoliosis . it was found that curve direction depended significantly on the apical level of the curve . interestingly , the majority of curves with an apex above l2 were convex to the right , whereas curves with an apex below l2 were more frequently convex to the left . the srs classification does not differentiate in this respect , since the transition from left to right - sided curves falls within the class of lumbar curves . hence , when looking at all lumbar curves combined , no predominant curve direction is found . vertebral rotation and lateral deviation of the spine are coupled phenomena , with the rotation of vertebral bodies directed into the convexity of the curve . it was previously demonstrated that in the normal non - scoliotic spine a predominant left - sided rotation exists in the high thoracic vertebrae , whereas the mid- and lower thoracic vertebrae are predominantly rotated to the right . this prevalent rotational pattern in the normal spine corresponds with the predominance of right - sided thoracic and thoracolumbar curves in idiopathic and neuromuscular scoliosis [ 19 , 38 ] . however , in idiopathic and neuromuscular scoliosis often a left - sided compensatory curve is seen at the lumbar level [ 19 , 38 ] . although in lumbar degenerative scoliosis , the scoliotic curve is essentially at the lumbar level , it apparently does show the same predominant direction as the compensatory lumbar curve in idiopathic or neuromuscular scoliosis . the strong relationship between apical level and curve direction does indicate that also in degenerative scoliosis the innate curvature of the spine plays a role in the direction of the curve . in this study we have analyzed curve directions in the coronal plane , although scoliosis is essentially a complex 3d deformation . nevertheless , a good impression can be obtained from 2d images because lateral deviation is coupled to rotational deviation [ 20 , 38 ] . in idiopathic scoliosis , it is assumed that biomechanical factors play a role in the development and progression of the curvature . it is thought that a spine with scoliosis experiences greater loading on the concave side and that this asymmetrical loading causes asymmetrical growth and progression of deformity . similar processes may play a role in degenerative scoliosis , only in this case , the greater loads at the concave side may induce degenerative changes which could result in a further progression of the scoliosis . these degenerative changes , however , can be diverse , ranging from degenerative changes in the intervertebral discs to spondylolysis or spondylolisthesis , rotatory dislocations and destruction of facet joints , depending on the weakest link . it is known that disc degeneration temporarily induces segmental instability [ 16 , 24 ] , making the spinal construct more vulnerable to forces that can increase a slight pre - existing rotatory pattern , such as dorsally directed shear loads ( ddsl s ) [ 5 , 18 ] . the fact that degenerative scoliosis occurs most often in the lumbar spine , where most vertebrae are subject to these ddsl s supports this assumption . in our patient population , we found that all patients presented with back pain and most patients experienced radicular leg pain . several possible mechanisms have been put forward to explain the causes of radicular pain in degenerative scoliosis . radicular pain may result from impingement of the nerve root due to decreased foraminal width or overstretching of the neural elements . it decreases during extension , ipsilateral lateral side bending , and ipsilateral axial rotation and increases during flexion , contralateral lateral side bending and contralateral axial rotation . based on this , in scoliosis a decreased foraminal width can be expected at the concavity of the curve . although this was corroborated in an mri study of ploumis et al . , they found that the foraminal width at the concave side was still within the normal range . they concluded that ligamentum flavum hypertrophy , posterior disc bulging , and bony overgrowth are more likely to contribute to stenosis irrespective of scoliosis . this would also explain why in our study radicular leg pain is not related to the direction of the curve . hence , for a better understanding of the symptoms related to degenerative scoliosis the underlying local deformations should be studied in more detail . one of the potential effects of severe degeneration is scoliosis . in 88 patients with degenerative lumbar scoliosis we found a significant relationship between curve direction and the apex of the curve . curves with an apex above l2 were mostly convex to the right , whereas curves with an apex below l2 were more frequently convex to the left . this indicates that in degenerative scoliosis the innate curvature or rotatory pattern of the spine is an important factor for the direction of spinal decompensation . although the normal spine does not show a pre - existing rotation at the lumbar level , the asymmetry of the whole spine is presumably directive for the decompensatory changes . this supports the concept that symptoms are the result of specific degenerative changes irrespective of the scoliotic curve .

due to the aging population , degenerative scoliosis is a growing clinical problem . it is associated with back pain and radicular symptoms . the pathogenesis of degenerative scoliosis lies in degenerative changes of the spinal structures , such as the intervertebral disc , the facet joints and the vertebrae itself . possibly muscle weakness also plays a role . however , it is not clear what exactly causes the decompensation to occur and what determines the direction of the curve . it is known that in the normal spine a pre - existing rotation exists at the thoracic level , but not at the lumbar level . in this retrospective study we have investigated if a predominant curve pattern can be found in degenerative scoliosis and whether symptoms are predominantly present at one side relative to the curve direction . the lumbar curves of 88 patients with degenerative scoliosis were analyzed and symptoms were recorded . it was found that curve direction depended significantly on the apical level of the curve . the majority of curves with an apex above l2 were convex to the right , whereas curves with an apex below l2 were more frequently convex to the left . this would indicate that also in degenerative scoliosis the innate curvature and rotational pattern of the spine plays a role in the direction of the curve . unilateral symptoms were not coupled to the curve direction . it is believed that the symptoms are related to local and more specific degenerative changes besides the scoliotic curve itself .

Introduction Materials and methods Statistical analysis Results Curve patterns Symptoms Discussion Conclusion

teneligliptin is a novel dipeptidyl peptidase4 ( dpp4 ) inhibitor belonging to the relatively novel pharmacological class of antihyperglycaemic agents that are now recommended as second or firstline agents in specific situations 1 , 2 , 3 . in a phase ii clinical trial , a 4week course of teneligliptin ( 20 mg ) monotherapy produced significant least squares ( ls ) mean reductions of 2.78 0.43 , 1.93 0.51 , and 2.08 0.42 mmol / l in 2h postprandial glucose level after breakfast , lunch and dinner , respectively , in japanese patients with type 2 diabetes ( t2 dm ) 4 . we therefore conducted the present phase iii , randomized , doubleblind , placebocontrolled study to assess the clinical efficacy and safety of teneligliptin in korean patients with t2 dm that was inadequately controlled with diet and exercise . the present study was designed to confirm the efficacy and safety of teneligliptin compared with placebo . the study was conducted in accordance with the principles of good clinical practice and was approved by the appropriate institutional review boards and regulatory agencies . participants considered eligible for the study were patients aged 18 years with t2 dm inadequately controlled [ glycated haemoglobin ( hba1c ) 7.0% and < 10.0% ] through diet and exercise for 8 weeks , who had not taken an oral antihyperglycemic agent ( oha ) for 8 weeks . exclusion criteria included current or history of significant comorbidities such as cardiovascular , hepatic or renal disease . patients with adequate compliance ( 80% ) after a 2week singleblind placebo runin period underwent baseline evaluation and were randomized according to hba1c ( using an 8.0% threshold ) into two parallel groups ( teneligliptin and placebo ; 2 : 1 matching ) for 24 weeks . ( hba1c < 7 and < 6.5% ) , changes in fasting plasma glucose ( fpg ) , and homeostatic model assessment of insulin resistance ( homair ) and cell function ( homa ) at week 24 . subjects who did not meet progressively stricter glycaemic goals immediately stopped the study without rescue therapy and underwent the evaluation planned for the final visit . these subjects were included in our analysis . threeway analysis of variance ( anova ) was used to compare the primary endpoint between the treatment groups with baseline hba1c and previous antihyperglycaemic agents as fixed effects . for other endpoints ( fpg , homa and homair ) , analysis of covariance was used with previous antihyperglycaemic agents as fixed effects and baseline hba1c as a covariate . the differences between the parallel groups were calculated as ls means standard error ( s.e . ) . responder rate ( hba1c < 6.5% , hba1c < 7.0% ) was analysed using multiple logistic regression analysis with the same factors as used in the threeway anova . of the 222 subjects screened , 142 eligible subjects were randomized to treatment as follows : 99 received teneligliptin and 43 received placebo . in total , our analysis set consisted of 141 subjects for whom baseline and postbaseline values of the primary efficacy endpoint were available ( figure s1 , file s1 ) . the treatment groups were not significantly different with respect to demographic or clinical characteristics ( table s1 , file s1 ) . the mean baseline hba1c value was 7.63% in the teneligliptin group and 7.77% in the placebo group . the changes in hba1c from baseline to week 24 in the teneligliptin and placebo groups were ls mean s.e . 0.09% and 0.03 0.12% , respectively ( p < 0.001 ; table 1 ) . a greater decrease in hba1c was observed with teneligliptin compared with placebo at week 8 , which was sustained throughout the randomized treatment period ( figure 1 ) . significantly more subjects in the teneligliptin group achieved an hba1c level of < 7% at week 24 than in the placebo group ( 69.39% in the teneligliptin group vs 20.93% in the placebo group ; p < 0.001 ; figure s2 , file s1 ) . approximately 34.69% of all subjects in the teneligliptin group achieved an hba1c level < 6.5% at week 24 , whereas only 4.65% achieved this level in the placebo group ( p = 0.0016 ; figure s2 , file s1 ) . in subgroup analysis of subjects with high or low hba1c level ( 8.0 or < 8.0% ) at baseline , the effect of teneligliptin was greater in the hba1c 8.0% group ( 1.15 0.99% , n = 25 ) than in the hba1c < 8.0% group ( 0.69 0.70% , n = 73 ; p = 0.0019 ) . effects of teneligliptin and placebo on glucose metabolism between baseline and week 24 . ci , confidence interval ; fpg , fasting plasma glucose ; hba1c , glycated haemoglobin ; homa , homeostatic model assessment of cell function ; homair , homeostatic model assessment of insulin resistance ; s.d . , standard deviation ; s.e . , * according to threeway analysis of variance ( anova ) . * * p < 0.0001 versus placebo according to threeway anova . teneligliptin decreased the fpg level from baseline to week 24 , while the fpg level did not change in the placebo group . at week 24 , the difference in change in fpg between the two groups was 1.21 mmol / l [ 95% confidence interval ( ci ) 1.72 , 0.70 ; p < 0.0001 ( table 1 ) ] . cell function , as assessed by homa , was improved in the teneligliptin group at week 24 but not in the placebo group . at week 24 , the difference in homa change between the groups was 12.23% [ 95% ci 5.78 , 18.67 ; p = 0.0003 ( table 1 ) ] . the teneligliptin group exhibited an improved homa score compared with the placebo group at week 8 and throughout the randomized treatment period ( figure s3 , file s1 ) . no significant difference in homair was observed between the two treatment groups . during this study , 81 adverse events ( aes ) occurred in 49 ( 34.5% ) of the 142 randomized subjects . among the 81 aes , 43 occurred in 29 ( 29.59% ) teneligliptintreated subjects , and 38 occurred in 20 ( 45.5% ) placebotreated subjects . the incidences of aes were not significantly different between the two groups at week 24 ( p = 0.0660 ) . hypoglycaemia occurred in one case in the placebo group but in no cases in the teneligliptin group . the results of the present study showed that 24 weeks of teneligliptin as a monotherapy was well tolerated and significantly decreased the hba1c level in korean patients with t2 dm . this is the first 24week , phase iii , doubleblind , randomized , placebocontrolled study on the efficacy and safety of teneligliptin . at present , more than five competitive reversible inhibitors are currently on the market , and each has different characteristics . a cochrane review that included 11 trials with sitagliptin and 14 trials with vildagliptin reported reductions in hba1c level of 0.7% and 0.6% , respectively , compared with placebo 5 . another dpp4 inhibitor , saxagliptin , was also shown to reduce hba1c by 0.450.63% compared with the placebo group 6 . in a recent phase ii study with 12 weeks of teneligliptin treatment ( n = 324 ) , significant ls mean reductions in hba1c for 10 , 20 and 40mg groups vs a placebo group were 0.9% ( 95% ci 1.0 , 0.7 ) , 0.9% ( 95% ci 1.1 , 0.7 ) , and 1.0% ( 95% ci 1.2 , 0.9 ) , respectively ( all p < 0.001 ) 7 . another recent study assessed the efficacy of teneligliptin when added to an ongoing metformin treatment at week 16 , and the mean reductions in hba1c and fasting plasma glucose level compared with placebo were 0.78% and 1.24 mmol / l , respectively 8 . the results of the present study in week 8 are consistent with these previous reports . specifically , the differences in changes ( baseline to week 8) in hba1c and fpg between the teneligliptin 20mg group and the placebo group were 0.80% ( 95% ci 1.02 , 0.59 ) and 0.95 mmol / l ( 95% ci 1.37 , 0.53 ) , respectively ( all p < 0.001 ) . moreover , the differences in hba1c and fpg changes between the teneligliptin 20mg group and the placebo group were maintained until week 24 [ 0.94% ( 95% ci 1.22 , 0.65 ) and 1.21 mmol / l ( 95% ci 1.72 , 0.70 ) , respectively ( all p < 0.001 ) ] , and a large proportion ( 69.39% ) of patients achieved an hba1c level < 7% compared with those using other dpp4 inhibitors ( 40% ) 9 , 10 , 11 . according to our results , teneligliptin has similar efficacy in the treatment of diabetes to other orally administered dpp4 inhibitors . cell destruction is key to the pathophysiology of t2 dm , and cell conservation delays disease progression 12 . improvements in cell function have been observed in clinical trials with the dpp4 inhibitors sitagliptin , saxagliptin , vildagliptin , alogliptin and linagliptin 13 , 14 , 15 , 16 , 17 . teneligliptin also resulted in increased homa index relative to placebo in the present study , suggesting that , like other dpp4 inhibitors , teneligliptin modestly improves pancreatic function . in the present study , the incidences of aes and adverse drug reactions were not significantly different between the teneligliptin and placebo groups at week 24 . together , these results indicate that teneligliptin is well tolerated and safe in korean patients with diabetes . in conclusion , this study showed that 20 mg of teneligliptin exhibits efficacy and safety after 24 weeks when administered once daily as a monotherapy to korean patients with t2 dm who are adhering to a diet and exercise control programme . k. a. , c. h. , b. j. , h. c. , c. w. , m.k . baseline characteristics . table s2 effects of teneligliptin and placebo on weight , and lipid profiles between baseline and week 24 . percentage of responders with hba1c < 7.0 or < 6.5% from baseline to week 24 . * p < 0.0001 vs. placebo by multiple logistic regression analysis with adjustment for hba1c ( < 8.0 or 8.0 ) and for antidiabetic medication ( prior to the study ) . * * p < 0.05 vs. placebo by multiple logistic regression analysis with adjustment for hba1c ( < 8.0 or 8.0 ) and for antidiabetic medication ( prior to the study ) . * * * p < 0.005 vs. placebo by multiple logistic regression analysis with adjustment for hba1c ( < 8.0 or 8.0 ) and for antidiabetic medication ( prior to the study ) . changes in mean homa score throughout the randomized treatment period . * by ancova . *

we assessed the 24week efficacy and safety of teneligliptin , a novel dipeptidyl peptidase4 inhibitor , in korean patients with type 2 diabetes mellitus ( t2 dm ) that was inadequately controlled with diet and exercise . the present study was designed as a multicentre , randomized , doubleblind , placebocontrolled , parallelgroup , phase iii study . patients ( n = 142 ) were randomized 2 : 1 into two different treatment groups as follows : 99 received teneligliptin ( 20 mg ) and 43 received placebo . the primary endpoint was change in glycated haemoglobin ( hba1c ) level from baseline to week 24 . teneligliptin significantly reduced the hba1c level from baseline compared with placebo after 24 weeks . at week 24 , the differences between changes in hba1c and fasting plasma glucose ( fbg ) in the teneligliptin and placebo groups were 0.94% [ leastsquares ( ls ) mean 1.22 , 0.65 ] and 1.21 mmol / l ( 1.72 , 0.70 ) , respectively ( all p < 0.001 ) . the incidence of hypoglycaemia and adverse events were not significantly different between the two groups . this phase iii , randomized , placebocontrolled study provides evidence of the safety and efficacy of 24 weeks of treatment with teneligliptin as a monotherapy in korean patients with t2 dm .

Introduction Methods Results Discussion Conflict of Interest Supporting information

the binding of a drug - like molecule to a protein leads to displacement of water molecules from the protein s binding pocket , and the thermodynamics of this displacement process is thought to contribute significantly to the overall thermodynamics of protein protein hydrogen bonds may incur a large energetic penalty , whereas displacement of water from hydrophobic parts of the binding pocket may help drive ligand - binding . intuitively , one may view different parts of the protein s surface as imposing different surface energies on the nearby water , with correspondingly different thermodynamic consequences for water displacement by various ligands . the use of molecular distribution functions to analyze molecular dynamics ( md ) simulations has led to important advances in the study of binding site water and its role in molecular recognition ; parallel progress with the 3d rism approach also deserves mention but is not considered here . key early contributions include development of watermap ( schrdinger llc ) , stow , and other approaches , which have provided new insight and shown promise as tools to help discover small molecules that will bind a targeted binding pocket . such methods frequently define spherical sites , where water is present at high density , to represent the distribution of water in the binding site . this hydration site approach ( hsa ) is motivated in part by the practical consideration that , in regions where water is present at lower density , it becomes more difficult to obtain converged values of the local orientational entropy of water . this is a simple consequence of the lower number of water samples available from the simulation in such low - density locations . the hsa strategy of limiting attention to hydration sites where water is present at high density maximizes the chances for good numerical convergence of the orientational entropy . however , as previously discussed , the regions in a binding site where water is present at high density can have a complex shape , which is not easily represented by a collection of spheres . this limitation has been addressed in a grid - based implementation of inhomogeneous solvation theory ( ist ) , termed gist . instead of constructing hydration sites , gist discretizes the smooth distributions of water density and other properties onto a fine , three - dimensional grid . the problem of converging the local orientational entropy of water is overcome through the use of a highly efficient nearest - neighbor ( nn ) method , as opposed to histogram methods , which require more sampling to reach adequate convergence . gist can also take advantage of the fact that regions of lower density contribute proportionately less than regions of higher density regions to the overall orientational entropy of the displaced water . this density - weighting means that , if one is interested in the integral of the orientational entropy over a volume containing both high and low density regions , one can converge the overall integral to an acceptable tolerance , so long as the high - density regions are well converged . alternatively , the grid approach makes it straightforward to focus on regions where water is present at high density , as done in hsa , without simplifying their shapes . here protein system . in order to establish a clear basis for comparing methods , we study coagulation factor xa ( fxa ) with a set of small molecule inhibitors used in early studies of the watermap method , and we derive scoring functions based on both gist and hsa methods . for this initial test of gist s applicability to protein ligand modeling , we do not seek to establish a full - fledged protein ligand scoring function , suitable for virtual screening or lead optimization . instead , as previously done , we ask how well the gist treatment of hydration can capture affinity differences between closely related congeneric pairs of ligands , where differences in binding affinity that result from contributions other than solvation such as configurational entropy and protein our results support the applicability of gist and , in addition , provide an unexpected outcome regarding the role of energetically versus entropically unfavorable water . we ran explicit - water md simulations of fxa and used both gist and our local hsa implementation to extract information about the structure and thermodynamics of the water in the binding site . we then considered the displacement of this binding site water by various fxa inhibitors , whose binding site poses are known or could be inferred from the known poses of very similar compounds . candidate scoring functions , based on the computed properties of the water displaced by each ligand , were trained on subsets of the experimental affinity data and then tested on separate sets , in order to assess the utility of the hydration data to resolve the relative binding affinities of pairs of congeneric ligands . details of the computational methods are presented in the following subsections . as previously detailed , gist uses a three - dimensional rectangular grid of cubic voxels in the region of interest and processes the snapshots of an md trajectory to compute the following thermodynamic quantities for each voxel , k , centered at location rk : ek , swnorm , the mean solute water interaction energy of a water molecule in voxel k. ek , wwnorm , one - half the mean interaction energy of the water in voxel k with all other waters . the factor of 1/2 , which was not included in the definition of the corresponding water water interaction energy in our initial presentation of gist , is customary in liquid - state theory ; it allows the total energy of neat water to be written as the sum of the individual water energies . tsk , swtrans , norm , the single - body ( one - water ) translational entropy of water in voxel k , relative to bulk , normalized to the mean number of waters in the voxel . tsk , sworient , norm , the single - body ( one - water ) orientational entropy of water in voxel k , relative to bulk , normalized to the mean number of waters in the voxel . note that we previously used a somewhat different notation for these quantities ; for example , ek , swnorm was eswnorm(rk ) . here , a 20.5 20.5 22.5 grid was centered on the active site of fxa . the grid spacing of 0.5 provides voxels large enough to give statistically meaningful data but small enough to still give a high resolution description of the density distribution functions . it is worth noting that the volume of each voxel is 33.5 times less than that of a hydration site ( see below ) , as the latter represents a sphere of radius 1 . the gist lennard - jones and electrostatic energies were computed from stored md frames , using the minimum image convention and no cutoff , and the reference value of the bulk water the main gist calculations presented here used 100 000 frames saved at 1 ps intervals during a 100 ns production md run , but shorter durations were also examined , to study convergence , as detailed below . when a ligand binds a protein , it displaces water from the protein s binding site . if the displaced water was unfavorable relative to bulk , then water displacement should make a favorable contribution to the ligand s binding affinity . with this in mind , we initially looked for a correlation between measured ligand binding affinities and regional hydration free energies ( eq 25 of ref ( 28 ) ) , where the region was defined as those voxels covered by each ligand in a bound pose . however , finding little correlation ( data not shown ) , we conjectured that any underlying correlation had been obscured by noise , due to sharp variations in the hydration energies with even small changes in ligand position . this sharpness traces , at least in part , to our use of a single pose for each ligand , and a restrained protein structure in the water simulations . we addressed this issue by constructing scoring functions which are based on the gist data but are less sensitive to the details of local water properties , due to the use of cutoffs in local water density , energy , and entropy . the use of cutoffs to construct a well - behaved scoring function from local hydration data was first introduced in the context of a hydration site model . we tested three such scoring functions based on the gist hydration data available from the grid described above . in all three cases , voxel k can contribute to a ligand s score only if the voxel s center , rk , lies within the van der waals radius of any atom of the ligand . for a given ligand , then , each voxel is assigned a binary displacement indicator , dk , which equals 1 if the center of the voxel lies within the van der waals radius of any ligand atom and 0 if it does not . the van der waals radii are drawn from the software package crystal maker ( crystalmaker software ltd . ) , which in turn relies on bondi . we also allowed the scoring function to focus on voxels where water is present at high density by setting up an additional binary indicator , gk , which is set to 1 if the water density in voxel k exceeds a cutoff gco , and 0 if it does not . this cutoff is one of the trained parameters , so it will be greater than zero only if imposing a density cutoff actually improves the accuracy of the scoring function . finally , we set up similar cutoffs for the total energy and entropy , eknorm and tsk , swnorm , associated with each voxel k , and used these to define additional binary masks based on energy and entropy thresholds . thus , the binary mask , ek , equals 1 if eknorm exceeds the cutoff , eco , and 0 otherwise ; and the binary mask , sk , equals 1 if tsk , swnorm exceeds the cutoff , sco , and 0 otherwise . like the density cutoff , gco , the values of eco and sco are fitted parameters and hence are free to go to zero if imposing these cutoffs does not improve the accuracy of the scoring function . the total energy and entropy were computed as eknorm ek , swnorm + 2ek , wwnorm 2eww , the quantity eknorm is the mean interaction energy of the water in voxel k with the protein and all other waters , relative to what its interactions would be in bulk , 2eww , bulknorm , computed in the same convention as the other gist quantities . with the voxels binary masks in place for density , energy , and entropy , we now define the three candidate scoring functions , one using both the energy and entropy data from gist , the second using only the energy data , and the third using only the entropy data:1 here , eaff and saff are additional fitted parameters , which specify the affinity increments provided by voxels surpassing the energy and entropy cutoffs , respectively , and also meeting the criteria dk = gk = 1 . note that in this study , each of these scoring functions was trained separately and has its own fitted values of gco and c , as well as eco and eaff and/or sco and saff . we adjusted the scoring functions described above to fit the measured relative binding free energies , gexpt , of 28 different congeneric pairs of fxa inhibitors ( see below ) . separate training and test sets were used , in order to avoid overfitting of the parameters . thus , we used a random number generator to split the 28 pairs into two arbitrarily selected sets of 14 apiece . ten such random splits were carried out , creating 10 distinct training and test sets . parameters were optimized for each training set and then tested on the corresponding test set . we report means and standard deviations over these 10 splits for the resulting fitted parameters and accuracy metrics . we further assess the significance of these results by comparing them with results obtained after a shuffling operation , which used the gsl_permutation function in the gnu scientific library , to randomly exchange the entropy and enthalpy values among pairs of voxels . for each training set , the parameters were adjusted as follows , using ges as an example . we scanned values of eco and sco from 0 to 4 kcal / mol and values of gco from 0 to 4 ( in units of neat water density ) , each in increments of 0.1 . this scan yields 41 41 41 = 68 921 combinations of the three cutoff values . for each combination , linear regression was then used to obtain values of eaff and saff that provide the highest correlation coefficient ( r ) of the relative scores for the congeneric pairs , ges , to the corresponding experimental values , gexpt , for the training set . the optimized values of the five fitted parameters were then used to compute ges for the congeneric pairs in the training set , and the reliability of the scoring function was evaluated based on the resulting value of r for the test set . analogous procedures were used for the other two scoring functions , ge and gs . these require scanning only 41 41 = 1681 cutoff combinations and yield only one of the two affinity parameters , eaff or saff , rather than both as for ges . hydration sites in the fxa binding site were defined and analyzed thermodynamically based on the same md simulation used for the gist calculations , using the first 10 ns ( 10 000 frames ) , in accord with the common practice of using approximately 210 ns simulations for hsa calculations . we first collected all instances , in these 1000 frames , of water molecules within 5 of any heavy atom of any bound ligand ( see below ) . for each water molecule in this set , we counted the number of neighboring waters from the same set , using the criterion of an oxygen , a water molecule can count as its own neighbor , if two instances of it in different frames meet the distance criterion . the location of the first hydration site was then set to the coordinates of the water oxygen with the most neighbors . this water molecule and all of its neighbors were then removed from consideration as potential hydration sites , and the location of the next hydration site was set to the coordinates of the remaining water oxygen with the most neighbors , based on the initial counts . this removal process was iterated until the number of neighbors of all remaining waters was less than twice that expected for a 1000 frame simulation of bulk water ( i.e. , < 280 from 1000 frames ) . each hydration site then was associated with all water instances , from the full 10 000 md frames ( above ) , whose oxygens lay within 1 of the site . each hydration site i was associated with a mean energy ei and a one - body entropy si . the energy of a water molecule in a given hydration site was calculated as half the difference between the total energy of the water a script invoking the program amber , with settings matched to those of the md simulation , was used to compute these energies . the mean energy of the hydration site then is the average of these energies for all water molecules that populate the site , minus the average energy of a water molecule in neat water from matched calculations . the water entropy si associated with hydration site i is the sum of its one - body translational and orientational entropies , si , swtrans k g(r ) ln g(r ) dr and si , sworient ( ( kni)/ ) g( ) ln g( ) d , where r is position in the protein frame of reference , k is boltzmann s constant , is bulk water density , g(r ) is the local water density referenced to bulk , ni is the number of water molecules associated with hydration site i , 8 , vhs indicates an integral restricted to the spherical hydration site , and defines orientational coordinates in the protein frame of reference . the translational entropy was computed by the histogram method , where spherical coordinates r , , centered on the hydration site were divided into uniformly spaced bins in r , cos , to generate 512 three - dimensional bins of equal volume , with r [ 0 , 1 ] , [ 0 , ] , and [ 0 , 2 ] . the orientational entropy associated with a hydration site was computed via the same nearest neighbor method used by gist for individual voxels . we used the hydration sites described above as the basis for three cutoff - based scoring functions , whose functional forms build on prior work . like the three gist scoring functions ( above ) , the free hsa - based scoring functions are based on , respectively , both energy and entropy , energy alone , and entropy alone:2 here , the sums range over hydration sites i ; ei and si equal 1 if ei and tsi are greater than cutoff values eco and sco , respectively , and 0 otherwise ; di is a displacement function , defined below , which accounts for the overlap of the ligand , in a given pose , with hydration site i ; eaff and saff are fitted constants ; and c is a constant offset . note that the hsa scoring parameters in eq 2 are set independently of the gist scoring parameters in eq 1 , despite the use of some equivalent symbols . one is identical to that used in the previous paper , while the second , as discussed below , applies a physically motivated cap to this quantity:3 here , (x ) , the heaviside step function , equals 0 if x 0 and 1 otherwise ; rco is a distance cutoff ; rij is the distance between hydration site i and atom j of the ligand being scored ; and the sum runs over all atoms belonging to the ligand being scored , i. for dinocap , which is modeled on the prior hydration site scoring function , each ligand atom within rco of the hydration site makes a contribution that scales between 0 and 1 as it approaches the center of the site , so the displacement function accounts for the degree to which a ligand displaces the water in the site . however , this approach is nonphysical in the sense that , if rij < rco for multiple ligand atoms j and a single site i , then the displacement of solvent from the site may be multiply counted . that is , for the energy / entropy scoring function , a site might contribute more than eaff + saff ; for the energy - only scoring function , it might contribute more than eaff ; and for the entropy - only scoring function , it might contribute more than saff . indeed , in the present study , we found values of dinocap up to 3.2 , implying that a single site might contribute over three times . we therefore also considered the alternative displacement function , dicap , which is capped at a value of 1 , so that no hydration site may contribute more than one - fold to a ligand s score , in accordance with the fact that the site can not be displaced more than once . the parameters of the hsa - based scoring functions were adjusted in the same manner as those of the gist - based scoring functions , except that rco took the place of gco . thus , values of rco were scanned from 2 to 3 , in steps of 0.1 and , as for gist , values of eco and sco were scanned from 0 to 4 kcal / mol in increments of 0.1 kcal / mol . ( note that no hydration sites had energies greater than 3.7 kcal / mol . ) the sums in eq 2 were evaluated for each ligand and with each combination of rco , eco , and sco . for each set of cutoffs scanned , values of eaff and saff were obtained by linear regression against the differences in measured binding free energies for a training set of congeneric ligand pairs , for each scoring function in eq 2 . the parameters that yielded the highest correlation coefficients were chosen and were tested for their ability to reproduce the difference in binding affinities for the congeneric pairs in the test set . this procedure was applied to the same 10 training and test sets used for the gist scoring function . as done for gist , we assessed the significance of the hsa results by comparing them with results obtained after a shuffling operation , which randomly exchanges the entropy and enthalpy values across pairs of hydration sites . both gist and the hsa methods take as input a boltzmann sample of water configurations for a given configuration of the protein . here , we used molecular dynamics ( md ) simulations to generate this sample from the canonical ensemble ( nvt ) , as follows . we used the structure of fxa from protein data bank entry 1fjs , as previously done , and our assignment of protonation states was also consistent with this prior study . we removed the ligand from the binding site and used tleap and other amber tools to assign protein parameters from the amber99sb force field and solvate the protein with 8557 tip3p water molecules . the simulations used a periodic box with dimensions 66.5 72.2 60.9 , which afforded at least 10 between any protein atom and the edge of the periodic box . four disulfide bonds were set up to join cysteine pairs 7/12 , 27/43 , 156/170 , and 181/209 , and two ions observed in the crystal structure ( ca and cl ) were restrained to their original positions . the resulting simulation system had 29 338 atoms , comprising the protein , the two ions , and the water molecules . energy minimization , followed by md simulation , was carried out with the amber 12 software using pmemd.cuda on a single gpu . first , the energy of the system was minimized in two rounds ; both used 1500 steps of the steepest descents algorithm followed by the conjugate gradient method for a maximum of 2000 steps . in the first round , all protein atoms were harmonically restrained to their initial positions with a force constant of 100 kcal / mol / . in the second round , the system was further relaxed keeping only non - hydrogen protein atoms restrained , with the same force constant . the energy minimized system was then heated with a series of 20 ps constant - volume and -temperature md simulations with the first simulation at 50 k and the temperature incremented by 50 k every 20 ps until 300 k was reached . the system was then equilibrated for 10 ns at 300 k at a constant pressure of 1 atm . at the final volume , the system was then equilibrated for an additional 5 ns at constant volume . the final md production run of 100 ns was at constant number of particles , volume , and temperature ( nvt ) , and system configurations were stored every 1 ps , for a total of 100 000 stored configurations . during all md simulations , all protein atoms were harmonically restrained to their positions following the energy minimization step , with a force constant of 100 kcal / mol / . the shake algorithm was used to constrain the lengths of all bonds involving hydrogen atoms . particle mesh ewald was implemented to account for long - range electrostatic interactions , and the leapfrog algorithm was used to propagate the trajectory . for the constant pressure simulations , isotropic position scaling was implemented with a pressure relaxation time of 0.5 ps . the main gist and hsa solvation maps however , in order to study the convergence properties of gist , we performed two additional 20 ns nvt production runs storing configurations every 0.05 ps ; one was begun identically with the 100 ns run , and the other was begun with the last md configuration of the 100 ns run . we trained and tested the scoring functions with a set of 28 congeneric ligand pairs ( see supporting information ) , where the members of each pair differ only by small , localized chemical changes in rigid moieties , leading to differential displacement of solvent . as previously discussed , this approach minimizes the contributions of free energy terms other than hydration and thus allows a focus on the quantity of central interest in this study . the 28 pairs used here are a subset of 31 drawn from several experimental series for use in a previous computational study : we eliminated three pairs ( matter:25/matter:28 ; matter:28/2bmg : i1h ; mueller:3/mueller:2 ) , because we were not confident of the conformation of at least one member of the pair , and hence of the location of the displaced solvent . in particular , mueller:3 differs from mueller:2 by a phenyl group whose orientation is not clear , because it is attached by a rotatable bond ; and for the other two pairs , an aromatic ring changes to a nonaromatic ring , whose conformation is uncertain . it is worth noting that , for this set of ligands , there is essentially no correlation between binding free energy and molecular weight ( r = 0.12 ) . ligand poses were drawn from available cocrystal structures or generated from a cocrystal structure of a closely related ligand by a small chemical adjustment . in all cases , the cocrystal structure was aligned with the simulated protein ( above ) to generate an initial pose in the binding site for which the hydration structure was computed . final poses for modeling solvent displacement were generated by protonating the ligands , then minimizing the initial poses in the simulated protein structure while allowing the ligand and protein hydrogen atoms to relax . the atomic partial charges for each ligand were obtained from the restrained electrostatic potential ( resp ) method , using quantum - mechanically derived electrostatic potentials with the 6 - 31 g * basis set . note that these parameters were used only to generate the ligand poses studied with the gist and hsa scoring functions . the hsa hydration sites are informative about water density but do not capture the level of detail available from gist s grid - based method . the two approaches are compared in figure 1 , which displays the hsa sites ( blue spheres ) computed for the binding pocket of factor xa , along with gist s gridded representation of water density , contoured at three different levels . contours of water density at 6 times that of bulk ( g = 6 ) appear as discrete , mostly convex droplets ( yellow contours , left panel ) , although a few of these high - density regions are elongated , rather than round . every high - density droplet is matched by a spherical hsa site , but there are many hsa sites in the binding pocket that do not enclose one of these high - density droplets . contours at 4 times bulk density ( g = 4 ) appear as more and larger droplets and match the hsa sites rather well ( gold contours , middle panel ) . contours at twice bulk density ( g = 2 ) form long , curved strands , which follow the contours of the protein surface ( orange contours , right panel ) , and are not well represented by the hsa sites . these begin to delineate the first hydration shell of the protein . finally , contours at still lower density ( e.g. , g = 1.5 ) include parts of the second hydration shell ( not shown ) . overall , the hsa representation captures the droplet - like distribution of the highest water densities but does not distinguish between high and medium density regions and does not capture the complex distributions of water density that become apparent at densities roughly twice that of bulk . this observation has practical relevance , because the scoring functions developed here include regions where water density is of this order , as detailed in the next subsection . comparison of the gist and hsa representations of water density in the factor xa binding pocket . hsa sites ( blue spheres ) are the same in all three panels . from left to right , the gist contour levels are at g = 6 , 4 , and 2 . the gist water densities are based on the occupancy of grid voxels by water oxygens , and the boundaries of the grid box may be discerned in the right - hand panel . it is also worth remarking that a hydration site should not be directly equated with a single bound water , as the sites occupancies are typically well below one . thus , for the hsa sites within 5 of the bound ligands , we find a mean occupancy of 0.58 waters molecules , with a standard deviation of 0.22 . these values are similar to those reported previously for factor xa in an early implementation of watermap : the occupancies reported in table 1 of the prior report correspond to a mean of 0.51 water molecules per hydration site , with a standard deviation of 0.22 . a gist - based scoring function based on both the local energy and one - body entropy of displaced water yields good correlations with the measured binding affinity differences for the 28 congeneric ligand pairs ( table 1 , top row ) . the mean r value is 0.94 across 10 training sets drawn at random from the full set of 28 pairs , and a high correlation ( r = 0.84 ) is preserved when the optimized parameters are applied to the respective test sets . the best results are obtained when voxels are excluded if their water density is less than about twice the bulk density ( gco = 1.9 ) . each voxel which furthermore meets the energy cutoff ( about 0.6 kcal / mol / water above bulk ) contributes about 0.2 kcal / mol of affinity . the entropy terms are somewhat puzzling : the entropy cutoff of 3.3 kcal / mol / water is much higher than the energy cutoff of 0.6 kcal / mol / water , and the positive value of saff seemingly indicates that displacing low entropy water disfavors binding , rather than favoring it , as might be anticipated . these results suggest that the energy term may be more meaningful ; this topic is further discussed below . the quality of each scoring function is reported in terms of coefficients of determination ( r ) . the test - set results ( test r ) are the most meaningful ; the training - set results ( train r ) are included for completeness . all quantities are averages across the 10 splits , with associated standard deviations . results are presented for the actual hydration data and for hydration data shuffled among voxels ( gist ) or hydration sites ( hsa ) , and hsa results are presented for capped and uncapped displacement functions ( see methods ) . scoring functions were constructed based on both energy and entropy data ( e / s ) , energy data only ( e ) , and entropy data only ( s ) ; the parameters are defined in the methods section . it is of interest to visualize the energy and entropy scoring regions ; i.e. , those voxels which meet either both the density and energy cutoffs or both the density and entropy cutoffs , respectively . as shown in figure 2 ( left ) , the energy scoring region tends to localize at extended regions of the nonpolar surface . these are places where water molecules lose more energy due to desolvation by the protein than they gain by making new interactions with the protein . ( the projection from three to two dimensions makes some scoring regions appear deceptively close to polar protein atoms . ) the analogous visualization for the energy - only scoring function , which is discussed below , is very similar ( data not shown ) . the locations of the entropy scoring regions ( figure 2 , middle ) are more complicated . some ( white arrows ) lie at the surface of polar atoms ; others ( pink arrows ) lie at hydrophobic locations . the frequent localization of entropy scoring regions at polar surfaces , and the unexpectedly positive value of saff , likely reflects the fact that polar surfaces can tightly bind waters , leading to unfavorable entropies but favorable energies ( figure 2 , right ) typical of traditional entropy enthalpy compensation . displacement of water from such regions may be net unfavorable , and this might help account for the positive value of saff . on the other hand , the displacement of entropically disfavored water from subregions where energy is not particularly favorable should favor ligand binding . thus , the energetically mixed nature of the entropic scoring regions further suggests that it may not give a clear signal in the overall scoring function . gist contours in binding site of fxa , in molecular surface representation . left : energy scoring region , which meets both density and energy cutoff criteria for the combined energy middle : entropy scoring region , which meets both density and entropy cutoff criteria for the combined energy entropy scoring function . right : normalized total water energy , contoured at 2.6 kcal / mol / water . graphic generated with vmd . in order to study the significance of the energy and entropy terms in more detail , we also considered a scoring function based only on density and energy , and another based only on density and entropy . as shown in table 1 ( second and third rows ) , the energy - only scoring function performs just as well ( r = 0.85 for the test sets ) as the original one based on both energy and entropy . in addition , the fitted parameters are similar in magnitude and sign to those of the original energy term . in contrast , the entropy - only scoring function yielded a poor correlation with experimental data ( r = 0.35 for the test sets ) , and the sign of saff is reversed relative to that in the original scoring function . thus , the hydration energy alone carries all of the predictive power of the gist - based scoring function , at least for fxa with this ansatz . this result is consistent with the analysis of the combined energy / entropy scoring function , above . as a further check of the statistical significance of the present results , we shuffled the gist data among voxels and then refitted all three gist - based scoring functions using the shuffled data . although correlations as high as r = 0.82 are obtained for the training sets , the test - set results are all poor ( r 0.4 0.2 ) . this result supports the significance of the high correlations obtained with the true ( unshuffled ) data and indicates that the low correlations observed for the entropy - only scoring function should be viewed as statistically insignificant . finally , we examined the amount of md simulation data required to generate the high correlations observed above . first , we reanalyzed the original set of md frames , which had been saved at 1 ps intervals . for increasing numbers of frames from this set , we reran the 10 training and test calculations and computed the mean and standard deviation of the resulting 10 values of r. as shown in figure 3 ( left ) , the value of r and its standard deviation ( error bars ) appear to plateau at about 60 ns for the combined energy entropy scoring function ( top left ) . interestingly , the plateau starts much earlier , at about 30 ns , for the energy - alone scoring function ( lower left ) . it appears that the more slowly convergent entropy term delays convergence of the energy entropy scoring function , so that leaving out the entropy term in the energy - only scoring function speeds convergence . this result is , again , consistent with the irrelevance of the entropy term in the gist scoring functions . we then asked whether shorter md simulations might give better convergence if frames were saved at shorter time intervals . first , we reprocessed the first 20 ns of the same simulation , now processing frames saved at 0.05 ps . as shown in figure 3 ( top middle ) , the combined energy / entropy scoring function now converges somewhat more quickly , especially as measured by the reduction in the standard deviation of r across the 10 train / test calculations . the improvement is more marked for the energy - only scoring function , as well - converged results are now available after only 10 ns of simulation time , although the standard deviation of r remains slightly higher than that from the 100 ns simulation . we then extended the 100 ns simulation by 20 ns , saving frames at 0.05 ps intervals , and examined convergence over this short simulation . the results are further improved , with good convergence and tight error bars achieved within about 5 ns for the energy - only scoring function , and 10 ns for the combined energy / entropy one . the improvement in these results , relative to those from the early 20 ns segment , suggests that the water structure continued to equilibrate somewhat during the 100 ns run , so it would have been appropriate to use a somewhat longer equilibration period in the md protocol . in summary , at least for fxa , a simulation of 10 ns or less suffices to gain all the benefit of these gist scoring functions . convergence of r values for gist scoring functions , as a function of simulation duration . bottom row : energy - only scoring function . left : 100 ns simulation , frames saved at 1 ps intervals . middle : the first 20 ns of the same 100 ns simulation , frames saved every 0.05 ps . right : 20 ns simulation initiated from the last frame of the 100 ns simulation , frames saved every 0.05 ps . as discussed in the methods section , a prior hsa scoring function was constructed in such a way that the thermodynamic contribution of each hydration could be counted multiple times , if more than one ligand atom lay within a cutoff distance . this function gave good results but is arguably nonphysical , because once the water in a hydration site has been displaced , it can not be displaced again . here , we present results for a set of similarly constructed hsa - based scoring functions in which , as before , a hydration site can be counted multiple times ; as well as a second set , in which the contribution of each hydration site is capped , so that it can only contribute once . for both the uncapped and capped models , we examine scoring functions based on energy and entropy , energy only , and entropy only , as also done for gist . with the original uncapped approach , where a hydration site can contribute multiple times , the combined energy / entropy scoring function provides high correlation coefficients for both the training ( r = 0.88 ) and test ( r = 0.80 ) sets ( table 1 , fourth row , marked e / s ) . these values of r are slightly lower than those for gist , but the difference is not statistically significant . interestingly , the fitted value of eaff ( 1.70 kcal / mol ) is much greater than that of saff , which in fact is assigned a positive sign ( 0.09 kcal / mol ) . in addition , the training procedure puts much sharper constraints on the energy terms than the entropy terms , as indicated by the fact that the standard deviations of eo and eaff ( 0.08 and 0.31 kcal / mol , respectively ) are lower than those for so and saff ( 0.50 and 0.60 kcal / mol ) . thus , the training results suggest that the entropy term is of lower importance than the energy term , much as observed in the case of gist . accordingly , a scoring function based entirely on energy ( table 1 , row 5 , marked e ) performs as well as the one with both energy and entropy , and furthermore yields values of rco , eco , and eaff very similar to those of the combined energy entropy scoring function . on the other hand , an entropy - only scoring function ( table 1 , row 6 , marked s ) also performs fairly well , with a value of r = 0.66 for the test sets , and the fitted value of saff , 1.52 kcal / mol , is essentially the same as the fitted value of eaff for the energy - only scoring function , 1.50 kcal / mol . thus , the entropy - only scoring function appears to largely replicate the energy - only scoring function , with some drop in the correlation with experimental data . these results are similar to those for gist , as in both cases , the energy - only scoring function performed as well as the energy / entropy one , while the entropy - only one is worse . however , the decline in performance on going to entropy - only is much greater for gist than for hsa . in the second variant of the hsa - based scoring functions , no hydration site can contribute more than one - fold to the difference between two ligands affinities . imposing this physically reasonable cap on the contribution of each site reduced the experimental correlation of the scoring function with experimental data to 0.66 for the test sets with the combined energy entropy scoring function but had essentially no effect on the correlations for the energy - only and entropy - only test - set results . thus , the results remain consistent with a conclusion that the energy term alone is enough to gain all the benefit of the scoring functions . the only other major change , relative to the uncapped version of the scoring function , is that the fitted values of eaff and saff changed from about 1.5 kcal / mol to about 2.3 kcal / mol , except that saff for the combined energy / entropy scoring function remained small . these increases presumably have the effect of compensating for the reduced values of the displacement function , i.e. , for the fact that dicap dinocap in eqs 2 and 3 . in order to further test the statistical significance of the hsa scoring results , we shuffled the energies and entropies among hydration sites and then refitted all six hsa - based scoring functions with the shuffled data . as summarized in the last six rows of table 1 , the uncapped scoring functions now yield poor correlations with experimental data ( r 0.4 ) , just as observed for gist , and the correlations for the capped scoring functions fall even lower . these results support the significance of the correlations obtained with the actual ( unshuffled ) data . the fact that the shuffled results are worse for the capped hsa scoring functions suggests , but does not prove , that applying the physically reasonable cap might reduce spurious correlations . it is of interest to examine the locations of hsa scoring sites relative to the gist scoring regions . we focus here on the energy - only scoring functions , since it is not clear that including entropy adds useful information , at least for fxa within the present functional form . as shown in figure 4 ( left ) , the hsa sites do not capture the complex shapes of the gist scoring regions , and substantial parts of the gist scoring region are entirely missed by the hsa scoring sites . these regions the spatial relationship of the scoring sites to the ligands studied here may be appreciated from figure 4 ( right ) , which shows the van der waals surface of a representative ligand . comparison of gist and hsa scoring locations , in the context of the fxa binding site ( gray ) . left : scoring sites from the capped hsa energy - only scoring function ( blue spheres ) and energy scoring regions from the gist energy - only scoring function ( orange contours ) . gist results are present only within the limits of the gist grid ( orange lines ) . right : a representative ligand , pdb het i d 4qc , in van der waals representation ( pink ) . ligand modeling is that the detailed representation of water structure and thermodynamics it affords works at least as well in a simple scoring function as the prior and present site - based hsa implementations . in addition , the gist results converge well within 510 ns of md simulation time , depending upon whether one uses the energy - only model or the energy / entropy model . these simulation times are commensurate with those normally used for the hsa approach ; see the methods . additional considerations include the fact that site - based approaches may require less data storage and that they paint a simple picture of water structure in a protein binding site . on the other hand , the gist grid files produced are still small ( < 1 mb ) , and we anticipate that the more detailed rendering of hydration structure and thermodynamics afforded by the grid approach will be useful for insight and prediction . note , in particular , that there are hsa sites which are only partly occupied by the more refined gist scoring regions , as well as gist scoring regions that are not identified by the hsa model , as evident from figure 4 . more generally , the fact that gist is a more direct representation of the common underlying inhomogeneous solvation theory facilitates the interpretation of its results and provides clear pathways to future enhancements , such as the incorporation of higher - order correlations , as touched on below . a fast implementation of gist , based upon focused grand canonical monte carlo sampling , may be of particular interest in the near term for high - throughput applications . another novel and striking result of the present study is that both the gist and hsa models provide clear signals that ligands can gain affinity by displacing energetically unfavorable binding site water , whereas the displacement of entropically unfavorable water seems to play a negligible role . the energetically unfavorable water highlighted by this study localizes at hydrophobic patches of the protein surface , perhaps especially in concave regions where water molecules are expected to lose hydrogen bonds . the concept that energy may outweigh entropy in cases of strong hydrophobic binding has been raised before , in both experimental and computational contexts . nonetheless , water entropy is typically thought to play a central role in hydrophobic binding . here , interestingly , neither the gist or hsa models made a compelling case that the displacement of entropically unfavorable water consistently enhances affinity . we conjecture that the lack of a clear correlation of water entropy with affinity may reflect the fact that low water entropy often results from energetically favorable water protein interactions , so that water may actually be quite stable in many locations where its entropy is low . this view is consistent with the experimental observation that the entropy of hydration of small ions is strongly negative , although the free energy is also strongly negative . it may be possible in the future to devise a more sophisticated scoring function that would account for the enthalpy entropy compensation between stabilizing energy and destabilizing entropy and focus on regions where this compensation breaks down , such as in the binding cavity of the synthetic host molecule cucurbituril . it is also worth mentioning that different protein binding sites affect water differently , so a different result might be obtained for a different protein . finally , it may be that capturing the entropic aspect of the hydrophobic effect requires accounting for water water correlations , which are absent from the one - body entropy considered here . if so , the entropy term may become more important once pairwise correlations have been incorporated into gist s entropy calculations . our observation that the displacement of high energy water plays a greater role in ligand scoring than displacement of low entropy water appears to contrast with a prior hsa - based study of the same system , where the fitted scoring function placed approximately equal weight on water energy and entropy . however , the range of fitted values for saff in our hsa models nearly spans the value of 0.66 kcal / mol for the corresponding parameter in the prior study , srwd . in addition , the prior study did not examine the uncertainty in its fitted energy and entropy parameters or evaluate a scoring function based purely on water energy . therefore , the results of these two studies should not be regarded as inconsistent . in summary , the grid - based gist method of extracting information about hydration thermodynamics from md simulations with explicit water has provided encouraging results in its first application to protein ligand binding . it thus appears to hold significant promise as a broadly applicable method of understanding the role of binding site water in protein ligand binding , and as a tool to improve the accuracy of methods for discovering high affinity targeted ligands . it is anticipated that the detailed representation of water distributions and thermodynamics which gist affords will make it particularly informative . we are currently working to develop such applications and to release an open - source implementation of gist within the ambertools software package for others to study and use .

water molecules in the active site of an enzyme occupy a complex , heterogeneous environment , and the thermodynamic properties of active - site water are functions of position . as a consequence , it is thought that an enzyme inhibitor can gain affinity by extending into a region occupied by unfavorable water or lose affinity by displacing water from a region where it was relatively stable . recent advances in the characterization of binding - site water , based on the analysis of molecular simulations with explicit water molecules , have focused largely on simplified representations of water as occupying well - defined hydration sites . our grid - based treatment of hydration , gist , offers a more complete picture of the complex distributions of water properties , but it has not yet been applied to proteins . this first application of gist to protein ligand modeling , for the case of coagulation factor xa , shows that ligand scoring functions based on gist perform at least as well as scoring functions based on a hydration - site approach ( hsa ) , when applied to exactly the same simulation data . interestingly , the displacement of energetically unfavorable water emerges as the dominant factor in the fitted scoring functions , for both gist and hsa methods , while water entropy plays a secondary role , at least in the present context .

Introduction Methods Results Discussion

yeast cultures were grown in nutrient - rich ypd media ( 1% yeast extract , 2% peptone , and 2% dextrose ) at 30 on a rotary shaker unless otherwise noted . for induction of autophagy , cells were grown to mid - log phase ( a600 = 0.7 ) in ypd , collected by centrifugation ( 3000 rpm 5 min ) , washed with water , then resuspended in nitrogen starvation media ( 1.7 g / liter yeast nitrogen base without amino acids and without ammonium sulfate , plus 2% dextrose ) . for northern blot analysis of temperature - sensitive mutants , cultures were grown at 30 to an od600 of 0.7 and then incubated at 37 for 1 hr before rna extraction . spei cut atg31ses1 intergenic fragment ( pcr amplified with oligos ddo1281/-1282 , which added an artificial xhoi site ) into bluescript sk+ ( all oligos used are listed in supporting information , table s2 ) . two - step pcr mutagenesis was performed using pdd1232 as template and t7 and t3 primers with mutagenic primers ( ddo184/-1284 ; ddo183/-1285 , respectively ) to amplify the fragment containing the tdna deletion ; this fragment was then cloned into bluescript sk+ as above to create pdd1233 . direct - site - directed mutagenesis was performed on pdd1232 to create pdd1248 ( tdna b - box ) , pdd1249 ( tdna b - box mutant ) , pdd1261 ( tdna a - box mutant ) , and pdd1260 ( tdna::ecori bamhi linker ) , using ddo1391/-1392 , ddo1393/-1394 , ddo1474/-1475 , and ddo1466/-1467 primer sets , respectively . the b - box mutant had the invariant cytosine and following guanine bases changed to gc , and the a - box mutant scrambled the entire consensus . plasmids pdd1262 ( flipped orientation of the tdna ) and pdd1272 ( tdna::etc9 ) were created by cloning ecori bamhi - digested pcr - amplified fragments using ddo1468/-1469 ( flip ) , or ddo1534/-1535 ( etc9 ) , respectively , into ecori yeast genomic dna was used as pcr template . plasmid pdd1263 ( tdna::etc4 ) was constructed by directly ligating complementary oligonucleotides ( ddo1489/-1490 ) containing ecori yeast strains were generated from wild - type s. cerevisiae w303 - 1a ; genotypes of all strains used and generated in this study are given in table 1 . parent tdna::ura3 ( ddy46054607 ) strains were created by amplifying ura3 with primers ddo1279/-1280 containing homology to the flanking region of tv(uac)d , and then this dna was transformed into wild - type ddy3 followed by selection of ura+ colonies and pcr identification of homologous recombinants . linearized tdna mutant plasmids were digested with xhoi and spei , individually transformed into a tdna::ura3 strain , and 5- fluoroorotic acid ( 5-foa ) resistant colonies were isolated . yeast strains for chromatin immunoprecipitation ( chip ) were created by crossing existing brf13x - flag ( ddy1495 ) and tfc13x - flag ( ddy3860 ) strains to ddy4607 , and then flag - tagged ura+ progeny were backcrossed to each tdna mutant . all strains are isogenic to s. cerevisiae w303 - 1a except ddy5010 , which is s288c . the 9x - myc epitope tag was amplified from a trp1 marked cassette ( knop et al . atg319x - myc trp+ homologous recombinants were identified by pcr ( ddo1419/-1464 ) and confirmed by western blotting . atg31 and atg8 knockout strains were constructed by standard yeast homologous recombination . for autophagy induction alkaline phosphatase assays , pho13 pho860 strains were created by crossing a pho13::ura3pho860::his3 strain ( kindly provided by daniel klionsky ) to wild - type and tdna mutants . most northern results were verified with three ( but at least two ) independently isolated mutant strains ; table 1 lists only the specific strains shown in the figures . 5-race analysis was performed on rna isolated from the ddy420 brf1 ii.6 mutant using the first choice rlm - race kit ( ambion / life technologies , am1700 ) . individual clones were sequenced by standard sanger sequencing and mapped to the s. cerevisiae genome on the saccharomyces genome database at http://www.yeastgenome.org ( cherry et al . 2012 ) . quantitative rt pcr was performed as follows : first - strand cdna was synthesized from 0.5 g of total rna after dnase treatment ( rq1 dnase , promega m6101 ) . synthesis was extended from long transcript specific primer ddo1284 using protoscript m - mulv first - strand cdna synthesis kit ( neb e6300s ) . quantitative reverse transcription pcr ( qrt pcr ) was performed on 1:4 diluted cdna using primers ddo1606/-1555 and sybr green super mix ( bio - rad 170 - 8882 ) with 60 annealing temperature . reactions were run and analyzed using a bio - rad myiq as described ( kim et al . 2011 ) and examined by agarose gel electrophoresis to verify that only the predicted pcr products were amplified . the primers were designed to specifically amplify readthrough transcripts ; the strategy is described and illustrated in figure s2 . primers ddo1527/-1555 or ddo1576/-1577 were used to amplify desired regions surrounding tv(uac)d . for western analysis , yeast minilysates were prepared by glass bead lysis of log - phase cultures directly in lysis buffer ( 50 mm tris ph 7.5 , 1% sds , 5 mm edta , 14.3 mm -mercaptoethanol , 1 mm pmsf , 2 g / ml leupeptin and pepstatin ) . pellets from 5 ml ypd culture at a600 1.0 were resuspended in 200 l lysis buffer and then vortexed with glass beads at 4 for 10 min . lysis buffer , 100 l , was added , and the mixture was boiled for 3 min , cooled on ice , and centrifuged at 4 to remove cell debris . to 100 l of clarified minilysate , an equal amount of 2 sds page loading buffer was added , and after boiling , 15 l was loaded on 12% acrylamide protein gel . proteins were transferred to millipore immobilon membrane by semidry transfer and incubated in blotto ( 10 tbs/10% sds/5% dry milk ) for 1 hr . primary myc antibody ( c - myc 9e10 , santa cruz biotechnology ) , anti - mouse ig - horseradish peroxidase secondary antibody ( ge healthcare ) were used for western analysis . immuno - star western chemiluminescent kit ( bio - rad ) yeast strains were grown in ypd rich media to a600 = 1.0 ( 10 cells / ml ) . cells were harvested by centrifugation , washed once with distilled water , and resuspended at 10 cells / ml in media lacking nitrogen . cells were incubated for 6 days at 30 on rotatory shaker , and every other day 200 l of culture dilutions was plated on ypd plates in triplicate . plates were incubated at 30 for 48 hr and survival rate was obtained by counting resulting colonies . figure 1a depicts the atg31ses1 locus , showing the location of the tv(uac)d tdna , and the extent of transcripts normally produced from the region . to test the initial hypothesis that tv(uac)d might act as an insulator by preventing promiscuous activation of atg31 by regulatory elements associated with the strong promoter of the neighboring divergent ses1 gene , we created tv(uac)d deleted ( tdna ) mutant strains . mutation of the tv(uac)d trna gene upstream of atg31 results in readthrough of the intergenic sut467 transcript . ( b ) northern blot analysis of atg31 expression in wild - type and tdna strains reveals the extended transcript . the atg31 coding sequence probe hybridized to rna of 800 bp in wild - type strains ( black arrow ) and to rna of 1200 bp after tdna deletion ( red arrow ) . the sut467 probe hybridized to the predicted 300-bp transcript in wild - type cells ( blue arrow ) and to the same 1200-bp extended transcript in tdna strains . each pair of lanes contained total rna from independent wild - type and mutant strains . ( c ) b - box deletion ( b - box ) or mutation of the invariant cytosine in the b - box ( b - box mut ) also resulted in extended readthrough transcription . strains used were : ( b ) ddy4625 and ddy3 ( wild - type ) ; ddy4653 and 4624 ( tdna ) ; ( c ) ddy3 ( wt ) ; ddy4652 ( tdna ) ; ddy4769 ( b - box ) ; and ddy4925 ( b - box mut ) . northern blot analysis using a probe homologous to the atg31 coding sequence ( figure 1b , left ) showed not only an apparent slight increase in the level of atg31 mrna in the tdna strains ( compared to act1 controls ) , but also an increase in the length of the transcript by 400 nucleotides ( shifting from 800 bases in wild - type strains to 1200 bases ) , with apparent absence of the normal length mrna . recent tiling array and rna - seq studies have identified widespread pervasive and intergenic transcription in eukaryotic cells , and in yeast this often appears to occur as bidirectional transcription from strong promoters ( neil et al . inspection of data from these studies indicated that the sut467 intergenic transcript initiates upstream of the ses1 promoter and terminates near the tdna ( figure 1a ) ; therefore , we hypothesized that the extended atg31 transcript in the tdna strain was a readthrough sut467 transcript that interferes with the production of the normal atg31 transcript . to confirm that the extended transcript in tdna strains was due to readthrough of sut467 and not a 3 extension , we repeated the northern analysis using a probe specific for the transcribed sut467 rna sequence ( figure 1b , right ) . the results showed that this probe hybridized to rna of 300 bases in wild - type strains , consistent with previous annotations of sut467 . the tdna strains showed a longer 1200-base transcript , the same length as when using the atg31 coding - sequence probe . we concluded that in the absence of the tdna at this region , sut467 readthrough occurs and interferes with normal atg31 transcription initiation , producing only the observed extended rna . since our gross deletion of the tdna sequence removed 90 bp of chromosome iv , we confirmed this readthrough effect by creating strains that either had only the b - box sequence of the tdna deleted or contained a mutation in the invariant cytosine residue in the b - box . both of these mutations of the tdna were expected to result in loss of tfiiic binding and inhibition of pol iii complex assembly . northern blot analysis with either probe shown in figure 1c confirmed that in each of these mutant backgrounds , complete readthrough of sut467 occurred as in the tdna strains . the slightly shorter transcript observed in the tdna strain compared to the b - box and point mutant strains is also consistent with the long transcript being a readthrough from upstream of the tdna , as this reflects the 90-bp deletion . also observed were shorter rnas hybridizing to only the sut467 probe , which appear to terminate between the tdna and atg31 . our previous studies of heterochromatin barrier and insulator function of tdnas have shown that assembled tfiiic alone can block the spread of silencing from the hmr locus and can insulate a uas from a promoter ( simms et al . 2008 ) . to determine which components of the pol iii complex are required to block sut467 progression , we analyzed atg31 transcripts in various temperature - sensitive strains compromised for pol iii complex function and formation when pulsed at the nonpermissive temperature before rna extraction . temperature - sensitive mutations in rna polymerase iii subunit genes rpc31 and rpc160 affect transcription initiation and elongation , respectively ( dieci et al . 1995 ; thuillier et al . 1995 ) . these mutants had relatively little effect on the ability of the tdna to block progression of sut467 ( lanes 2 and 3 compared to wild type in lane 1 ) as evidenced by a minimal alteration of the ratio of normal to extended transcripts . in contrast , mutations in the tfiiib subunit encoding brf1 gene ( brf1-ii.6 and -ii.9 ) that impair interactions of brf1p with tbp ( andrau et al . 1999 ) showed a major shift to the longer extended transcript ( lanes 4 and 5 ) , with relatively little normal length rna . interestingly , this mutant also showed an intermediate length atg31 transcript that initiates just upstream of the tdna coding sequence ( see 5-race analysis below ) . ( a ) northern analysis of temperature - sensitive mutants of the pol iii complex was performed as in figure 1 , except that each culture was shifted from 30 to 37 for 1 hr prior to rna extraction . extended atg31 transcripts are most prominent in tfiiib and tfiiic subunit mutants , which also express an intermediate length atg31 transcript . strains used in lanes 18 were ddy3 ( wt ) ; ddy232 ( rpc31 - 236 ) ; ddy246 ( rpc162112 ) ; ddy416 ( brf1 ii.9 ) ; ddy420 ( brf1 ii.6 ) ; ddy261 ( tfc3 g349e ) ; ddy3 ( wt ) ; and ddy4300 ( tfc6 promoter mutant ) . 5-race was performed to map transcriptional start sites ( tss ) for the various transcripts observed in the northern blot analysis of the brf1 ii.6 mutant . colored solid boxes represent the range of alternative tss , which were observed in three distinct clusters . the exact saccharomyces genome database coordinates of all mapped tss are given in figure s1 . rna isolated from the temperature - sensitive , dna - binding defective tfc3 g349e mutant strain ( lefebvre et al . 1994 ) showed apparent equal amounts of both normal and long atg31 transcripts , with a small relative amount of the intermediate transcript ( figure 2a , lane 6 ) . a strain harboring a mutation in the tfc6 promoter that results in reduced expression of tfc6p and slow growth ( kleinschmidt et al . 2011 ) showed a similar pattern ( lane 8) , shifted a bit more to the long and intermediate transcripts . these results demonstrate that loss of tfiiic function also results in readthrough sut467 transcription , but this could be due to loss of tfiiib assembly in the absence of full tfiiic activity . to verify that the transcription start site of our readthrough transcript initiates in the region of the annotated sut467 transcriptional start site ( tss ) and to map the tss of the observed intermediate transcript , we performed 5-race analysis on rna isolated from the brf1-ii.6 mutant , because it contains all three transcripts as detected by northern blotting . as shown schematically in figure 2b , 5-race ends that correspond to the annotated atg31 mrna , and within a 94-nucleotide range that overlaps the annotated sut467 tss , were mapped . the intermediate transcript was found to begin very close to the beginning of the trna coding sequence . the exact saccharomyces genome database chromosome iv coordinates corresponding to each individually mapped 5-race end are listed in figure s1 . to further assess the mechanistic requirements of each pol iii transcription factor in preventing pol ii readthrough transcription , we constructed yeast strains specifically modified at the atg31 upstream tdna locus and analyzed the long vs. short rna phenotypes . inverting the orientation of the tdna had no effect , as no extended atg31 mrna was detected ( figure 3a , lane 1 ) . mutation of the a - box within the tdna or replacement of the tdna with the etc4 site resulted in only the extended transcript being produced ( figure 3a , lanes 2 and 3 ) . each of these replacements was expected to bind tfiiic , but not be able to efficiently recruit tfiiib or pol iii . interestingly , replacing the tdna with the tdna remnant upstream of the tim21 gene , recently referred to as etc9 ( nagarajavel et al . 2013 ) , was sufficient to block readthrough transcription ( figure 3a , lane 4 ) . this tdna remnant has previously been shown to bind both tfiiic and tfiiib , but not the pol iii enzymatic complex ( guffanti et al . strains were constructed to recruit the entire pol iii complex , tfiiib and tfiiic , or tfiiic alone to the atg31ses1 intergenic region . each construct was tested for the ability to block readthrough and for binding of pol iii transcription factor complexes to the ectopic locations . ( a ) schematic of the modified atg31 loci and northern blot of each strain using the atg31 probe . lane 1 , ddy4816 ( tdna flip ) ; lane 2 , ddy4817 ( a - box mut ) ; lane 3 , ddy4819 ( etc4 replacement ) ; lane 4 , ddy4970 ( etc9 replacement ) ; and lane 5 , ddy4925 ( b - box mut ) . replacement of the tdna by etc4 , or mutating the a - box or b - box , resulted in the presence of the extended transcript ( red labels ) . however , inversion of the tdna sequence or replacement with the etc9 sequence still blocked readthrough ( black labels ) . ( b and c ) confirmation of expected pol iii transcription factor binding in the above mutants by chromatin immunoprecipitation . each tdna mutant strain was crossed to strains containing either brf13x - flag or tfc13x - flag alleles , and then subjected to chip analysis using anti - flag antibody . ( b ) the absence of tfiiib upstream of atg31 in the a - box mutant , etc4 replacement , and b - box mutant correlates with the presence of the extended transcript , suggesting that tfiiib binding is required to block readthrough . strains used ( left to right ) were ddy4935 , -4943 , -4949 , -5003 , and -4946 . ( c ) chip analysis of brf13xflag and tfc13xflag strains demonstrates that tfiiic but not tfiiib is bound in etc4 replacement strains , indicating that tfiiic binding alone can not block readthrough transcription . strains used ( left to right ) were ddy4938 , -5003 , -4949 , -3860 , -5006 , and -4917 . these results suggest that recruitment of tfiiib is the critical step that prevents readthrough transcription of sut467 , as binding of tfiiic alone at the etc4 site is not sufficient to block pol ii progression . mutation of the a - box has been demonstrated to impair tfiiib assembly ( huibregtse and engelke 1989 ) , and these interpretations assume that each of these sequences used to replace the tdna have the same in vivo binding characteristics at the atg31 locus as they do in their native chromosomal locations . to confirm such assumptions regarding the presence or absence of each transcription factor complex at these sequences when moved to the atg31 locus , we crossed a 3x - flag - epitope - tagged brf1 allele into each of these mutants . chip results using anti - flag antibody shown in figure 3b demonstrate that the tdna flip and etc9 alleles are strongly enriched for tfiiib at levels comparable to wild - type tdnas , while insertions unable to block readthrough transcription ( a - box mut , etc4 , and b - box mut ) had significantly reduced tfiiib chip signals , comparable to background signals observed in the no antibody control panels . primers amplifying a separate control tdna on chromosome iii showed similar enrichment in each of the samples , indicating that equivalent amounts of chip dna were added to each pcr reaction . we also created strains containing a 3x - flag - epitope - tagged tfc1 allele to assess the binding of tfiiic at modified atg31 loci . the results in figure 3c show that tfiiic but not tfiiib is associated with the etc4 insertion , and both tfiiic and tfiiib are bound at the etc9 insertion and at the wild - type tdna locus . importantly , and contrary to results seen in our earlier tdna heterochromatin blocking studies ( simms et al . 2008 ) , tfiiic binding alone to etc4 is not sufficient to block cryptic transcript readthrough . previous studies on the heterochromatin barrier activity of tdnas revealed the involvement of other chromatin - associated proteins in this extratranscriptional function ( donze et al . 2007 ) . to assess the potential role of these tdna associated proteins in blocking readthrough transcription , we performed northern blot analysis ( using the atg31 coding sequence probe ) on rna isolated from a number of these mutants . the results in figure 4a showed that each of these mutants contain mostly normal - length atg31 transcripts ; however , low levels of readthrough are apparent in some strains , most obvious in nhp6 ( lane 3 ) and smc3 ( lane 12 ) mutants in the particular blot shown . however , the intensity of these signals was relatively weak and was often difficult to consistently distinguish from background in different blots . genetic factors involved in tdna chromatin boundary function have minimal effects on blocking of pol ii progression through tv(uac)d . ( a ) rna from strains containing mutations that weaken tdna boundary function were analyzed by northern blotting using the atg31 probe . strains in lanes 19 were ddy3 , -947 , -1376 , -2236 , -2058 , -2509 , -1631 , -1676 , and -5010 ; lane 10 , sg154.2 ; lanes 1113 , roy1032 , -1060 , and -1063 ; lane 14 , ddy4925 . ( b ) rt pcr analysis of readthrough transcription also shows only minimal effects . to confirm these apparent low levels of readthrough , we used readthrough transcript - specific primers to develop an rt pcr assay to measure differences in the relative levels of the long transcript compared to a wild - type strain . the inset in figure 4b shows an inverted ethidium - stained gel image that verifies that the primers specifically amplified the readthrough cdna , as the b - box mutant strain showed significantly higher levels of rt pcr product than the wild - type strain . there also appears to be a low level of readthrough in the wild - type strain , which is consistent with a genome - wide transcriptome analysis that identified a single readthrough clone overlapping this locus ( miura et al . quantitative rt pcr was performed on the same rna samples shown in the northern blot in figure 4a , and those that showed a significant increase in the long atg31 transcript relative to the wild - type parent are shown in figure 4b . the b - box mutant strain measured 80-fold more readthrough transcript than wild type in this assay , while other mutants were confirmed to have modest ( ranging from 2- to 15-fold ) yet detectable increased levels of the long transcript as suggested by the northern analysis . given the extended 5-utr present on the long atg31 transcript , we next asked to what extent translation of the atg31 protein was affected by readthrough sut467 transcription . we created atg319x - myc epitope - tagged strains in wild - type and tdna mutant backgrounds and then analyzed atg31 protein expression by western blotting . in each strain producing the long transcript , we observed a drastic reduction in atg31p levels ( figure 5a ) . autophagy is a conserved cellular response that recycles cellular components upon nutrient limitation and during normal regulated molecular turnover and involves the formation of autophagosome vesicles that capture and degrade macromolecules after fusion with other membrane bound vesicles ( reggiori and klionsky 2013 ; stanley et al . ( a ) western blot analysis was performed on wild - type and tdna mutants containing an atg319x - myc tag allele to determine whether the extended transcript affects translation of atg31p . no other bands were observed on the western blot , demonstrating that the extended transcript does not lead to production of an extended polypeptide . strains used were ddy5012 ( wt ) , ddy5014 ( tdna ) , ddy5018 ( b - box ) , and ddy5020 ( b - box mut ) . ( b ) inhibition of autophagy induction in yeast expressing the extended transcript as measured by the pho860 alkaline phosphatase assay . strains used were : ddy5051 ( wt control ) , ddy5072 ( tdna ) , ddy5078 ( b - box ) , ddy5081 ( b - box mut ) , ddy5044 ( atg8 ) , and ddy5046 ( atg31 ) . ( c ) production of the extended transcript is associated with reduced survival under nitrogen starvation conditions . strains used were : ddy5012 ( wt ) , ddy5081 ( b - box mut ) , and ddy4764 ( atg31 ) . since atg31p is required for the formation of autophagosomes upon nitrogen starvation ( kabeya et al . 2007 ) , we tested the efficiency of this response using two well - characterized assays to measure autophagy induction . we first created a series of strains that produce the readthrough transcript and contain the pho860 and pho13 alleles . these mutations reduce background alkaline phosphatase levels , and the phosphatase activity of the precursor pho860 protein can be activated only if it is proteolytically processed during autophagy ( klionsky 2007 ) . since atg31 is required for these events , we reasoned that the reduction in atg31p levels due to the extended 5-utr would result in reduced processing of pho860p upon induction of autophagy and therefore reduced levels of alkaline phosphatase activity upon shifting cells to nitrogen starvation conditions . figure 5b shows this to be the case , as strains producing the readthrough transcript showed significantly reduced induction of phosphatase activity compared to a pho13 pho860 strain producing only normal atg31 mrna ( wt in figure 5b ) . complete deletion of atg31 or atg8 in control strains severely reduced starvation - induced phosphatase activity as expected . these results confirm that induction of autophagy is compromised in strains that predominately produce the long atg31 transcript . as a second assay for the efficiency of autophagy induction , we tested the viability of yeast cells producing the long transcript when placed under autophagy - inducing conditions . previous studies have shown that complete deletion of atg31 results in reduced survival of cells undergoing nitrogen starvation due to inhibition of autophagy ( kabeya et al . when we tested a strain containing the b - box mutation in the tdna ( producing the long transcript ) , we found an intermediate level of survival compared with wild - type and atg31 strains ( figure 5c ) . this loss of survival is not due to effects on the neighboring ses1 gene , as wild - type and tdna mutant strains show equivalent expression levels of ses1 when analyzed by northern blotting ( figure s3 ) . this result suggests that readthrough of the cryptic transcript reduces atg31p translation to a level that compromises fitness of the cells during nitrogen starvation . figure 1a depicts the atg31ses1 locus , showing the location of the tv(uac)d tdna , and the extent of transcripts normally produced from the region . to test the initial hypothesis that tv(uac)d might act as an insulator by preventing promiscuous activation of atg31 by regulatory elements associated with the strong promoter of the neighboring divergent ses1 gene , we created tv(uac)d deleted ( tdna ) mutant strains . mutation of the tv(uac)d trna gene upstream of atg31 results in readthrough of the intergenic sut467 transcript . ( b ) northern blot analysis of atg31 expression in wild - type and tdna strains reveals the extended transcript . the atg31 coding sequence probe hybridized to rna of 800 bp in wild - type strains ( black arrow ) and to rna of 1200 bp after tdna deletion ( red arrow ) . the sut467 probe hybridized to the predicted 300-bp transcript in wild - type cells ( blue arrow ) and to the same 1200-bp extended transcript in tdna strains . each pair of lanes contained total rna from independent wild - type and mutant strains . ( c ) b - box deletion ( b - box ) or mutation of the invariant cytosine in the b - box ( b - box mut ) also resulted in extended readthrough transcription . strains used were : ( b ) ddy4625 and ddy3 ( wild - type ) ; ddy4653 and 4624 ( tdna ) ; ( c ) ddy3 ( wt ) ; ddy4652 ( tdna ) ; ddy4769 ( b - box ) ; and ddy4925 ( b - box mut ) . northern blot analysis using a probe homologous to the atg31 coding sequence ( figure 1b , left ) showed not only an apparent slight increase in the level of atg31 mrna in the tdna strains ( compared to act1 controls ) , but also an increase in the length of the transcript by 400 nucleotides ( shifting from 800 bases in wild - type strains to 1200 bases ) , with apparent absence of the normal length mrna . recent tiling array and rna - seq studies have identified widespread pervasive and intergenic transcription in eukaryotic cells , and in yeast this often appears to occur as bidirectional transcription from strong promoters ( neil et al . inspection of data from these studies indicated that the sut467 intergenic transcript initiates upstream of the ses1 promoter and terminates near the tdna ( figure 1a ) ; therefore , we hypothesized that the extended atg31 transcript in the tdna strain was a readthrough sut467 transcript that interferes with the production of the normal atg31 transcript . to confirm that the extended transcript in tdna strains was due to readthrough of sut467 and not a 3 extension , we repeated the northern analysis using a probe specific for the transcribed sut467 rna sequence ( figure 1b , right ) . the results showed that this probe hybridized to rna of 300 bases in wild - type strains , consistent with previous annotations of sut467 . the tdna strains showed a longer 1200-base transcript , the same length as when using the atg31 coding - sequence probe . we concluded that in the absence of the tdna at this region , sut467 readthrough occurs and interferes with normal atg31 transcription initiation , producing only the observed extended rna . since our gross deletion of the tdna sequence removed 90 bp of chromosome iv , we confirmed this readthrough effect by creating strains that either had only the b - box sequence of the tdna deleted or contained a mutation in the invariant cytosine residue in the b - box . both of these mutations of the tdna were expected to result in loss of tfiiic binding and inhibition of pol iii complex assembly . northern blot analysis with either probe shown in figure 1c confirmed that in each of these mutant backgrounds , complete readthrough of sut467 occurred as in the tdna strains . the slightly shorter transcript observed in the tdna strain compared to the b - box and point mutant strains is also consistent with the long transcript being a readthrough from upstream of the tdna , as this reflects the 90-bp deletion . also observed were shorter rnas hybridizing to only the sut467 probe , which appear to terminate between the tdna and atg31 . our previous studies of heterochromatin barrier and insulator function of tdnas have shown that assembled tfiiic alone can block the spread of silencing from the hmr locus and can insulate a uas from a promoter ( simms et al . 2008 ) . to determine which components of the pol iii complex are required to block sut467 progression , we analyzed atg31 transcripts in various temperature - sensitive strains compromised for pol iii complex function and formation when pulsed at the nonpermissive temperature before rna extraction temperature - sensitive mutations in rna polymerase iii subunit genes rpc31 and rpc160 affect transcription initiation and elongation , respectively ( dieci et al . 1995 ; thuillier et al . 1995 ) . these mutants had relatively little effect on the ability of the tdna to block progression of sut467 ( lanes 2 and 3 compared to wild type in lane 1 ) as evidenced by a minimal alteration of the ratio of normal to extended transcripts . in contrast , mutations in the tfiiib subunit encoding brf1 gene ( brf1-ii.6 and -ii.9 ) that impair interactions of brf1p with tbp ( andrau et al . 1999 ) showed a major shift to the longer extended transcript ( lanes 4 and 5 ) , with relatively little normal length rna . interestingly , this mutant also showed an intermediate length atg31 transcript that initiates just upstream of the tdna coding sequence ( see 5-race analysis below ) . ( a ) northern analysis of temperature - sensitive mutants of the pol iii complex was performed as in figure 1 , except that each culture was shifted from 30 to 37 for 1 hr prior to rna extraction . extended atg31 transcripts are most prominent in tfiiib and tfiiic subunit mutants , which also express an intermediate length atg31 transcript . strains used in lanes 18 were ddy3 ( wt ) ; ddy232 ( rpc31 - 236 ) ; ddy246 ( rpc162112 ) ; ddy416 ( brf1 ii.9 ) ; ddy420 ( brf1 ii.6 ) ; ddy261 ( tfc3 g349e ) ; ddy3 ( wt ) ; and ddy4300 ( tfc6 promoter mutant ) . 5-race was performed to map transcriptional start sites ( tss ) for the various transcripts observed in the northern blot analysis of the brf1 ii.6 mutant . colored solid boxes represent the range of alternative tss , which were observed in three distinct clusters . the exact saccharomyces genome database coordinates of all mapped tss are given in figure s1 . rna isolated from the temperature - sensitive , dna - binding defective tfc3 g349e mutant strain ( lefebvre et al . 1994 ) showed apparent equal amounts of both normal and long atg31 transcripts , with a small relative amount of the intermediate transcript ( figure 2a , lane 6 ) . a strain harboring a mutation in the tfc6 promoter that results in reduced expression of tfc6p and slow growth ( kleinschmidt et al . 2011 ) showed a similar pattern ( lane 8) , shifted a bit more to the long and intermediate transcripts . these results demonstrate that loss of tfiiic function also results in readthrough sut467 transcription , but this could be due to loss of tfiiib assembly in the absence of full tfiiic activity . to verify that the transcription start site of our readthrough transcript initiates in the region of the annotated sut467 transcriptional start site ( tss ) and to map the tss of the observed intermediate transcript , we performed 5-race analysis on rna isolated from the brf1-ii.6 mutant , because it contains all three transcripts as detected by northern blotting . as shown schematically in figure 2b , 5-race ends that correspond to the annotated atg31 mrna , and within a 94-nucleotide range that overlaps the annotated sut467 tss , were mapped . the intermediate transcript was found to begin very close to the beginning of the trna coding sequence . the exact saccharomyces genome database chromosome iv coordinates corresponding to each individually mapped 5-race end are listed in figure s1 . to further assess the mechanistic requirements of each pol iii transcription factor in preventing pol ii readthrough transcription , we constructed yeast strains specifically modified at the atg31 upstream tdna locus and analyzed the long vs. short rna phenotypes . inverting the orientation of the tdna had no effect , as no extended atg31 mrna was detected ( figure 3a , lane 1 ) . mutation of the a - box within the tdna or replacement of the tdna with the etc4 site resulted in only the extended transcript being produced ( figure 3a , lanes 2 and 3 ) . each of these replacements was expected to bind tfiiic , but not be able to efficiently recruit tfiiib or pol iii . interestingly , replacing the tdna with the tdna remnant upstream of the tim21 gene , recently referred to as etc9 ( nagarajavel et al . 2013 ) , was sufficient to block readthrough transcription ( figure 3a , lane 4 ) . this tdna remnant has previously been shown to bind both tfiiic and tfiiib , but not the pol iii enzymatic complex ( guffanti et al . 2006 ) . strains were constructed to recruit the entire pol iii complex , tfiiib and tfiiic , or tfiiic alone to the atg31ses1 intergenic region . each construct was tested for the ability to block readthrough and for binding of pol iii transcription factor complexes to the ectopic locations . ( a ) schematic of the modified atg31 loci and northern blot of each strain using the atg31 probe . lane 1 , ddy4816 ( tdna flip ) ; lane 2 , ddy4817 ( a - box mut ) ; lane 3 , ddy4819 ( etc4 replacement ) ; lane 4 , ddy4970 ( etc9 replacement ) ; and lane 5 , ddy4925 ( b - box mut ) . replacement of the tdna by etc4 , or mutating the a - box or b - box , resulted in the presence of the extended transcript ( red labels ) . however , inversion of the tdna sequence or replacement with the etc9 sequence still blocked readthrough ( black labels ) . ( b and c ) confirmation of expected pol iii transcription factor binding in the above mutants by chromatin immunoprecipitation . each tdna mutant strain was crossed to strains containing either brf13x - flag or tfc13x - flag alleles , and then subjected to chip analysis using anti - flag antibody . ( b ) the absence of tfiiib upstream of atg31 in the a - box mutant , etc4 replacement , and b - box mutant correlates with the presence of the extended transcript , suggesting that tfiiib binding is required to block readthrough . strains used ( left to right ) were ddy4935 , -4943 , -4949 , -5003 , and -4946 . ( c ) chip analysis of brf13xflag and tfc13xflag strains demonstrates that tfiiic but not tfiiib is bound in etc4 replacement strains , indicating that tfiiic binding alone can not block readthrough transcription . strains used ( left to right ) were ddy4938 , -5003 , -4949 , -3860 , -5006 , and -4917 . these results suggest that recruitment of tfiiib is the critical step that prevents readthrough transcription of sut467 , as binding of tfiiic alone at the etc4 site is not sufficient to block pol ii progression . mutation of the a - box has been demonstrated to impair tfiiib assembly ( huibregtse and engelke 1989 ) , and this mutation also allows readthrough . these interpretations assume that each of these sequences used to replace the tdna have the same in vivo binding characteristics at the atg31 locus as they do in their native chromosomal locations . to confirm such assumptions regarding the presence or absence of each transcription factor complex at these sequences when moved to the atg31 locus , we crossed a 3x - flag - epitope - tagged brf1 allele into each of these mutants . chip results using anti - flag antibody shown in figure 3b demonstrate that the tdna flip and etc9 alleles are strongly enriched for tfiiib at levels comparable to wild - type tdnas , while insertions unable to block readthrough transcription ( a - box mut , etc4 , and b - box mut ) had significantly reduced tfiiib chip signals , comparable to background signals observed in the no antibody control panels . primers amplifying a separate control tdna on chromosome iii showed similar enrichment in each of the samples , indicating that equivalent amounts of chip dna were added to each pcr reaction . we also created strains containing a 3x - flag - epitope - tagged tfc1 allele to assess the binding of tfiiic at modified atg31 loci . the results in figure 3c show that tfiiic but not tfiiib is associated with the etc4 insertion , and both tfiiic and tfiiib are bound at the etc9 insertion and at the wild - type tdna locus . importantly , and contrary to results seen in our earlier tdna heterochromatin blocking studies ( simms et al . 2008 ) , tfiiic binding alone to etc4 is not sufficient to block cryptic transcript readthrough . previous studies on the heterochromatin barrier activity of tdnas revealed the involvement of other chromatin - associated proteins in this extratranscriptional function ( donze et al . 2007 ) . to assess the potential role of these tdna associated proteins in blocking readthrough transcription , we performed northern blot analysis ( using the atg31 coding sequence probe ) on rna isolated from a number of these mutants . the results in figure 4a showed that each of these mutants contain mostly normal - length atg31 transcripts ; however , low levels of readthrough are apparent in some strains , most obvious in nhp6 ( lane 3 ) and smc3 ( lane 12 ) mutants in the particular blot shown . however , the intensity of these signals was relatively weak and was often difficult to consistently distinguish from background in different blots . genetic factors involved in tdna chromatin boundary function have minimal effects on blocking of pol ii progression through tv(uac)d . ( a ) rna from strains containing mutations that weaken tdna boundary function were analyzed by northern blotting using the atg31 probe . strains in lanes 19 were ddy3 , -947 , -1376 , -2236 , -2058 , -2509 , -1631 , -1676 , and -5010 ; lane 10 , sg154.2 ; lanes 1113 , roy1032 , -1060 , and -1063 ; lane 14 , ddy4925 . ( b ) rt pcr analysis of readthrough transcription also shows only minimal effects . to confirm these apparent low levels of readthrough , we used readthrough transcript - specific primers to develop an rt pcr assay to measure differences in the relative levels of the long transcript compared to a wild - type strain . the inset in figure 4b shows an inverted ethidium - stained gel image that verifies that the primers specifically amplified the readthrough cdna , as the b - box mutant strain showed significantly higher levels of rt pcr product than the wild - type strain . there also appears to be a low level of readthrough in the wild - type strain , which is consistent with a genome - wide transcriptome analysis that identified a single readthrough clone overlapping this locus ( miura et al . quantitative rt pcr was performed on the same rna samples shown in the northern blot in figure 4a , and those that showed a significant increase in the long atg31 transcript relative to the wild - type parent are shown in figure 4b . the b - box mutant strain measured 80-fold more readthrough transcript than wild type in this assay , while other mutants were confirmed to have modest ( ranging from 2- to 15-fold ) yet detectable increased levels of the long transcript as suggested by the northern analysis . given the extended 5-utr present on the long atg31 transcript , we next asked to what extent translation of the atg31 protein was affected by readthrough sut467 transcription . we created atg319x - myc epitope - tagged strains in wild - type and tdna mutant backgrounds and then analyzed atg31 protein expression by western blotting . in each strain producing the long transcript , we observed a drastic reduction in atg31p levels ( figure 5a ) . autophagy is a conserved cellular response that recycles cellular components upon nutrient limitation and during normal regulated molecular turnover and involves the formation of autophagosome vesicles that capture and degrade macromolecules after fusion with other membrane bound vesicles ( reggiori and klionsky 2013 ; stanley et al . ( a ) western blot analysis was performed on wild - type and tdna mutants containing an atg319x - myc tag allele to determine whether the extended transcript affects translation of atg31p . no other bands were observed on the western blot , demonstrating that the extended transcript does not lead to production of an extended polypeptide . strains used were ddy5012 ( wt ) , ddy5014 ( tdna ) , ddy5018 ( b - box ) , and ddy5020 ( b - box mut ) . ( b ) inhibition of autophagy induction in yeast expressing the extended transcript as measured by the pho860 alkaline phosphatase assay . strains used were : ddy5051 ( wt control ) , ddy5072 ( tdna ) , ddy5078 ( b - box ) , ddy5081 ( b - box mut ) , ddy5044 ( atg8 ) , and ddy5046 ( atg31 ) . ( c ) production of the extended transcript is associated with reduced survival under nitrogen starvation conditions . strains used were : ddy5012 ( wt ) , ddy5081 ( b - box mut ) , and ddy4764 ( atg31 ) . since atg31p is required for the formation of autophagosomes upon nitrogen starvation ( kabeya et al . 2007 ) , we tested the efficiency of this response using two well - characterized assays to measure autophagy induction . we first created a series of strains that produce the readthrough transcript and contain the pho860 and pho13 alleles . these mutations reduce background alkaline phosphatase levels , and the phosphatase activity of the precursor pho860 protein can be activated only if it is proteolytically processed during autophagy ( klionsky 2007 ) . since atg31 is required for these events , we reasoned that the reduction in atg31p levels due to the extended 5-utr would result in reduced processing of pho860p upon induction of autophagy and therefore reduced levels of alkaline phosphatase activity upon shifting cells to nitrogen starvation conditions . figure 5b shows this to be the case , as strains producing the readthrough transcript showed significantly reduced induction of phosphatase activity compared to a pho13 pho860 strain producing only normal atg31 mrna ( wt in figure 5b ) . complete deletion of atg31 or atg8 in control strains severely reduced starvation - induced phosphatase activity as expected . these results confirm that induction of autophagy is compromised in strains that predominately produce the long atg31 transcript . as a second assay for the efficiency of autophagy induction , we tested the viability of yeast cells producing the long transcript when placed under autophagy - inducing conditions . previous studies have shown that complete deletion of atg31 results in reduced survival of cells undergoing nitrogen starvation due to inhibition of autophagy ( kabeya et al . when we tested a strain containing the b - box mutation in the tdna ( producing the long transcript ) , we found an intermediate level of survival compared with wild - type and atg31 strains ( figure 5c ) . this loss of survival is not due to effects on the neighboring ses1 gene , as wild - type and tdna mutant strains show equivalent expression levels of ses1 when analyzed by northern blotting ( figure s3 ) . this result suggests that readthrough of the cryptic transcript reduces atg31p translation to a level that compromises fitness of the cells during nitrogen starvation . the results described in this study demonstrate that stable rna polymerase iii transcription factor complexes containing tfiiib assembled at tdnas have the capacity to block the progression of intergenic transcription by rna polymerase ii . high - throughput microarray and sequencing technologies have led to the identification of much more diversity in transcriptomes , from prokaryotes to humans , than was previously appreciated ( core et al . such pervasive transcripts include the cryptic unstable transcripts ( cuts ) , stable unannotated transcripts ( suts ) , xrn1-sensitive unstable transcripts ( xuts ) , and meiotic unannotated transcripts ( muts ) ( wyers et al . additionally , alterations in the prevalence of intergenic transcripts and transcript start and end sites have been observed under different growth and stress conditions ( xu et al . since the vast majority of these cryptic transcripts and transcript isoforms have unknown functions , it has been speculated that they may represent inherent sloppiness of the transcriptional process , referred to as transcriptional noise ( struhl 2007 ) . where functions of such pervasive transcription have been identified in s. cerevisiae , it appears that it is not necessarily the rna produced but the act of transcription itself that leads to the observed function . the short noncoding srg1 transcript inhibits ser3 expression by transcriptional interference and promoter occlusion mechanisms , as the path of the srg1 transcript overlaps transcription factor binding sites within the ser3 promoter ( martens et al . , the srg1 transcript terminates near the beginning of ser3 , while mutation of the tdna at sut467 results in uncontrolled readthrough all the way to the end of atg31 . similar cis - linked mechanisms may be at work at other yeast loci where noncoding transcription appears to block initiation or elongation of adh1 ( bird et al . 2006 ) , imd2 ( kuehner and brow 2008 ) , ura2 ( thiebaut et al . 2008 ) , flo11 ( bumgarner et al . 2009 ) , pho84 ( camblong et al . 2007 ) , and ime4 ( hongay et al . 2006 ; gelfand et al . there is evidence that there are also trans - effects of the noncoding rna product regulating the pho84 locus ( camblong et al . additionally , full repression of yeast gal genes ( houseley et al . 2008 ) , ime1 ( van werven et al . 2012 ) , and again pho84 ( camblong et al . 2007 ) requires chromatin modifications associated with ongoing noncoding transcription . while more instances are likely yet to be identified , this handful of yeast genes has incorporated intergenic transcription into their regulatory programs and generally appears to use it as a means of repression . however , we show in this study that if left unchecked , progression of noncoding transcription can have negative consequences on neighboring gene expression , resulting in reduced fitness of cells . this result demonstrating a cryptic transcript - blocking activity of bound pol iii complexes can be added to the list of extratranscriptional effects of the rna polymerase iii system . our results presented here demonstrate that the tdna upstream of atg31 protects against such repressive transcriptional interference effects . our data are consistent with a model in which tfiiib , as part of the pol iii complex associated with the tv(uac)d tdna , serves as a physical impediment to elongating rna pol ii initiating at the sut467 transcriptional start site . in the absence of tfiiib , nearly complete readthrough by pol ii occurs to produce an extended sut467atg31 rna transcript . this transcript is not efficiently , if at all , translated into atg31 protein , as scanning ribosomes ( kozak 2005 ) attaching at the 5 end of the extended transcript would encounter start and stop codons before reaching the atg31 start codon . this readthrough transcript appears to be both capped and polyadenylated , as the 5-race protocol includes a phosphatase treatment before decapping and adaptor ligation , ensuring that only capped 5 ends are mapped , and the long transcript is enriched in northern analysis of poly(a)-purified rna ( a. korde , unpublished data ) . the small amount of atg31p we detect in our western blots likely results from low levels of normal atg31 transcripts that are undetectable in northern blots from cells grown in rich media . extracts from nitrogen - starved tdna mutants show a slight increase in protein levels , along with detectable normal atg31 transcripts in northern blots of rna isolated from the same cultures ( a. korde , unpublished data ) . this suggests that under conditions that induce atg31 , limited normal initiation is slightly enhanced , but protein levels are still lower than in wild - type cells . previous work from our lab and others has shown that certain extratranscriptional effects associated with tdnas can be mediated by binding of the tfiiic complex alone . propagation of silencing at the hmr mating locus can be blocked by replacing the tdna downstream of the hmr - i silencer with an etc site , and insertion of an etc site between uasg and gal10 insulates the promoter from gal4p activation ( simms et al . heterochromatin boundary activity of tfiiic - only containing complexes is also observed in schizosaccharomyces pombe ( noma et al . additionally , the etc6 site within the tfc6 promoter may modulate transcription by an insulator - like mechanism ( kleinschmidt et al . in this case of preventing readthrough of intergenic transcription , the binding of tfiiic alone is clearly not sufficient . while tfiiic binds to b - box sequences in vitro with extremely high affinity ( lefebvre et al . 2003 ) , this binding is somehow tempered by passage of the pol iii enzymatic complex during transcription of the internal control element regions . on the other hand , after recruitment of tfiiib by tfiiic , the tightly bound tfiiib complex appears to be fixed , as in vitro experiments have shown that tfiiib dna complexes are resistant to high salt and heparin treatments ( kassavetis et al . 1990 ; kassavetis et al . 1995 ) . the fully assembled tfiiib complex also is thought to be kinetically trapped ( cloutier et al . 2001 ) , with a half - life on the order of a full yeast cell cycle , and fully assembled tfiiib likely persists at tdnas until regulated release during mitosis or stationary phase ( fairley et al . 2003 ; roberts et al . such characteristics of tfiiib are consistent with our results that suggest that formation of this complex is the major impediment to cryptic transcript readthrough by sut467 . these results are also compatible with earlier in vitro studies that demonstrated the ability of pol iii to transcribe through assembled tfiiic but not assembled tfiiib ( bardeleben et al . our results suggest that tfiiic yields to pol ii in a similar manner as it does to pol iii , since replacing the tdna with etc4 allowed readthrough of pol ii even though chromatin immunoprecipitation analysis revealed that tfiiic was bound to the ectopic etc4 site ( figure 3c ) . while we have not mapped the exact 3 end of the sut467 transcript , the annotated end mapped by tiling array analysis ( xu et al . 2009 ) places it within 20 bp of the 5 extent of the expected tfiiib footprint at this tdna ( schematically depicted in figure s1 ) . estimation of this 5 end of the tfiiib footprint is based on earlier in vitro footprinting studies ( kassavetis et al . 1989 ) and a recent global bootprinting analysis of in vivo bound pol iii transcription factors ( nagarajavel et al . the location of the 3 end of sut467 is consistent with tfiiib being a transcriptional roadblock that is resistant to displacement by transcribing pol ii . a curious sidelight to this study is the appearance of the intermediate length transcript in tfiiib and tfiiic mutants , but not in tdna mutants . this is most likely initiated by pol ii , as in brf1 , tfc3 , and tfc6 mutants , the tdna terminator sequence is still present , so it is unlikely that this is a pol iii transcript . we speculate that in these mutants , tfiiib binding still occurs , but is unstable , and perhaps dissociation of the brf1p and bdp1p subunits occurs before loss of tbp at the site . such a lingering tbp might then recruit factors necessary to then subsequently recruit pol ii immediately upstream of the tdna . alternatively , the pol iii complex may mask a cryptic pol ii promoter , which is revealed in a subset of cells containing mutations in the pol iii transcription factors . there is mounting evidence that a much larger fraction of genomes is transcribed than was previously appreciated . while rna degradation pathways generally keep most of these transcripts at low levels ( wolin et al . 2012 ) , it has become clear that the act of intergenic transcription can have significant effects on neighboring genes . due to such observations , one must consider how mutation of a specific genomic locus may affect expression of nearby genes in addition to the targeted gene when assigning the actual cause of observed phenotypes ( wei et al . iii extratranscriptional effects , we are conducting rna - seq analysis of wild - type vs. tfc6p underexpressing mutant strains . previous studies have been conducted to determine the global effects of pol iii deficiencies ( conesa et al . 2005 ) , but the rna was analyzed by coding sequence microarray , which could not detect effects involving intergenic transcription . inspection of preliminary rna - seq results suggests that when the pol iii complex is globally compromised , several tdna proximal genes may be affected as described here , and in other possibly unique ways ( q. wang , a. korde , and c. nowak , unpublished results ) . this type of result also raises the question of how to interpret phenotypes due to mutations that may globally affect intergenic transcription ( which may be relevant in mutants of other dna and chromatin binding proteins ) , or as shown here for mutation at a specific locus , as unchecked cryptic transcription can lead to unexpected and even detrimental misexpression of downstream genes . while a subset of pervasive transcription products themselves may be noise

the major function of eukaryotic rna polymerase iii is to transcribe transfer rna , 5s ribosomal rna , and other small non - protein - coding rna molecules . assembly of the rna polymerase iii complex on chromosomal dna requires the sequential binding of transcription factor complexes tfiiic and tfiiib . recent evidence has suggested that in addition to producing rna transcripts , chromatin - assembled rna polymerase iii complexes may mediate additional nuclear functions that include chromatin boundary , nucleosome phasing , and general genome organization activities . this study provides evidence of another such extratranscriptional activity of assembled rna polymerase iii complexes , which is the ability to block progression of intergenic rna polymerase ii transcription . we demonstrate that the rna polymerase iii complex bound to the trna gene upstream of the saccharomyces cerevisiae atg31 gene protects the atg31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic sut467 transcription unit . this protection is predominately mediated by binding of the tfiiib complex . when tfiiib binding to this trna gene is weakened , an extended sut467atg31 readthrough transcript is produced , resulting in compromised atg31 translation . since the atg31 gene product is required for autophagy , strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy - inducing nitrogen starvation conditions . given the recent discovery of widespread pervasive transcription in all forms of life , protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled rna polymerase iii complexes and possibly other dna binding proteins .

Materials and Methods Results Mutation of the tDNA upstream of TFIIIB binding is correlated with blocking of Mutations in genes affecting tDNA heterochromatin barrier function have minimal impact on transcript blocking The extended Discussion Supplementary Material

neglected bilateral anterior shoulder dislocation is a very rare condition , often related to seizures or major trauma . open reduction is recommended whenever hill - sachs lesion is > 25% of the joint and the dislocation is elder than 3 weeks . we describe a case report of a 28-year - old man left handed jehovah s witness laborer assessed 12 weeks after bilateral anterior shoulder dislocation . the patient was evaluated with clinical examination , and it was observed an asymptomatic intrarotation of both shoulders with a mild left circumflex nerve deficit . he was able to perform flexion and abduction of both arms up to 60 and 10 of extrarotation . pre - operative constant scores were 49 in left and 55 in right shoulder , pre - operative disabilities of the arm , shoulder , and hand ( dash ) scores were 57 in left and 53 in right shoulder , and visual analogue scales ( vas ) was 2 . the surgeon treated both shoulder ( not simultaneously ) by open reduction and bristow - latarjet coracoids transfer procedure . a 1 year after operations , left flexion was 180 while right was 160 , bilateral abduction was 180 . he was able to return to his pre - injury activities , the constant score was 89 left and 83 right , dash score was 17 left and 13 right and vas was 0 . atraumatic bilateral neglected anterior shoulder dislocation can be treated with open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient and permit a return to the pre - injury activities , to create a greater extension of the glenoid arc and to avoid future dislocation . bilateral anterior shoulder dislocation is rare , because almost always one extremity takes the brunt of the impact during trauma incidence . usually happen almost always secondary to major trauma ( 50% ) , affect mainly young men ( 70% ) and it is associated with other injuries ( greater tuberosity fractures in 15% , rotator cuff tears , neurological associated lesions ) . muscle contractions due to neurological or psychiatric spasm or electrocution were identified like alternative cause . neglected bilateral anterior shoulder dislocation is very rare condition , often related to seizures or major trauma . for anterior dislocation , open reconstructive options include infraspinatus tendon transfer , disimpaction grafting or allograft repair , bankart repair and shoulder replacement . the goal of surgical treatment is repair of articular defects and maintenance of shoulder stability to allow an early rehabilitation . a 28-year - old male jehovah s witness laborer , affected by iron - deficiency anemia , was evaluated in orthopedic office for restricted mobility and pain ( during daily activities ) in both shoulders from about 12 weeks . he reported that previously these inabilities were interpreted as paraspinal cervical muscle contracture and treated only with muscle relaxant drugs . at the time of evaluation , patient showed mild pain and inabilities in shoulders external rotation and abduction . physical examination revealed : bilateral normal internal rotation ; bilateral 10 external rotation , abduction and flexion about 60 and axillary nerve numbness . anteriorposterior x - ray images evidenced bilateral anterior shoulder dislocation and computer tomography - scan showed bilateral hill - sachs lesion ( < 25% ) ( fig . 1 ) . the surgeon suggested a step - by - step surgical treatment conscious about patient s medical history and refusal of whatever blood transfusion for religious reasons . the first step was surgical treatment of dominant limb and then right side after 1 month . surgical procedures were both performed under general anesthesia , beach chair position and fluoroscan aid . the deltopectoral approach was used and for both cases were evidenced a glenoid fossa deficiency with hypoplasia of scapular neck and glenoid . bleeding was controlled and intraoperative blood salvage was used to accommodate wishes of the patient to refuse homologous and autologous transfusions , as required his confession of faith . through post - operatively management , shoulders were supported by a sling with 15 of abduction and maintained for 3 weeks . a 4 weeks later , clinical and radiographic evaluation were performed , and the patient was introduced to passive shoulder motion , while 2 weeks later he started an active controlled shoulder motion . he was followed for next 6 months by upper extremities therapist team . the 1 year after last operations , the patient was clinical and radiographical evaluated and he was able to perform left flexion up to 180 and 160 in right , bilateral abduction was 180 ( fig . the constant score was 89 left and 83 right , disabilities of the arm , shoulder and hand ( dash ) score was 17 left and 13 right and visual analogue scales were 0 . anterioposterior and axillary x - ray images evidenced bilateral anterior shoulder dislocation and computer tomography - scan showed bilateral hill - sachs lesion . clinical evaluation and x - ray images 1-year as expressed by other authors , this type of lesion can be present in 4% of all shoulder dislocation , even if the most of cases were related to medical conditions including myasthenia gravis , cerebral palsy and scapular myopathy . neglected anterior shoulder dislocation is an exceptional condition whose treatment has not guidelines mutually agreed . in our opinion , treatment of this type of lesion depends on many factors : time of dislocation , age of patient , functional limitation , success of reduction , presence and amount of the hill - sachs lesion and glenoid fossa defect and surgeon s experience . conservative treatment should be considered in patient without shoulder pain or low functional demands and in case of surgical or anesthesiological contraindications . however , in young , active , high demands patients , conservative choice without stabilization should be not the proper procedure due to possible concurrent hill - sachs lesion , to possible concurrent glenoid defect and resulting high risk of instability . solomon et al . suggested closed reduction only up to 6 weeks post - injury due to high risk of iatrogenic fracture or neurovascular damage . open reduction is the recommended procedure with hill - sachs lesion more than 25% of articular surface and after 3 weeks . for anterior dislocation , open reconstructive options include infraspinatus tendon transfer , disimpaction grafting or allograft repair , bankart repair and shoulder replacement . the goal of surgical treatment is repair of articular defects and maintenance of shoulder stability to allow an early rehabilitation . many surgical solutions were proposed like eden - hybinette , arthroscopical bristow - latarjet procedure but recently , longo et al . showed how eden - hybinette procedure has clinical outcomes very similar to the bristow - latarjet with a higher rate of post - operative osteoarthritis and recurrence . authors treated the young patient with an open bristow - latarjet procedure primarily to repair the old dislocation and remedy the glenoid fossa defect . hill - sachs lesions were not treated during surgery because involved < 25% and intraoperatively glenohumeral joint was stable after reduction . author s opinion is to refer surgical treatment of hill - sachs lesion in case of lesion involving over 25% of articular surface to maintain glenohumeral stability by open remplissage with the infraspinatus tendon ( in this technique the head defect was filled with the infraspinatus tendon , by tying the sutures from the anchor , so bringing the tendon down to the defect ) or shoulder arthroplasty if the lesion is over 50% of humeral head . currently , however , literature reports only few studies about results of operative treatment of chronic anterior shoulder dislocation with arthroplasty and this type of surgery should be considered in selected cases : elderly patients ; intraoperatively instability due to severe humeral head cortical depression and/or glenoid defect and degenerative arthropathy . gavriilidis recommended this surgical procedure with large head defects and experienced good mid - term results with benefits for a range of motion , pain and patient satisfaction . this case report showed that anterior shoulder dislocation could also occur without a trauma mechanism due to glenoid fossa dysplasia . despite ethical and religious positions of patient about blood transfusions , open bristow - latarjet procedure may be performed with recovery of good upper extremity function ( constant score and dash score ) , low of recurrence and good clinical outcomes . atraumatic bilateral neglected anterior shoulder dislocation can be treated with an open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient . this open surgical procedure is reliable , secure and burdened with fewer complications over time , especially even in special cases ( jehovah s witness ) to create a greater extension of the glenoid arc and to avoid future dislocation . though very rare , atraumatic bilateral neglected anterior shoulder dislocation does occur and may present to orthopedic evaluation .

introduction : neglected bilateral anterior shoulder dislocation is a very rare condition , often related to seizures or major trauma . open reduction is recommended whenever hill - sachs lesion is > 25% of the joint and the dislocation is elder than 3 weeks.case report : we describe a case report of a 28-year - old man left handed jehovah s witness laborer assessed 12 weeks after bilateral anterior shoulder dislocation . the patient was evaluated with clinical examination , and it was observed an asymptomatic intrarotation of both shoulders with a mild left circumflex nerve deficit . he was able to perform flexion and abduction of both arms up to 60 and 10 of extrarotation . pre - operative constant scores were 49 in left and 55 in right shoulder , pre - operative disabilities of the arm , shoulder , and hand ( dash ) scores were 57 in left and 53 in right shoulder , and visual analogue scales ( vas ) was 2 . radiological examination were bilateral anteroposterior shoulder x - rays and computer tomography scan . the surgeon treated both shoulder ( not simultaneously ) by open reduction and bristow - latarjet coracoids transfer procedure . a 1 year after operations , left flexion was 180 while right was 160 , bilateral abduction was 180 . he was able to return to his pre - injury activities , the constant score was 89 left and 83 right , dash score was 17 left and 13 right and vas was 0.conclusion:atraumatic bilateral neglected anterior shoulder dislocation can be treated with open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient and permit a return to the pre - injury activities , to create a greater extension of the glenoid arc and to avoid future dislocation .

Introduction: Case Report: Conclusion: Introduction Case report Discussion Conclusion

atrophic gastritis ( ag ) is a histopathologic entity characterized by chronic inflammation of the gastric mucosa with loss of gastric glandular cells and replacement by intestinal - type epithelium , pyloric - type glands , and fibrous tissue . atrophy of the gastric mucosa is the endpoint of chronic processes , such as chronic gastritis associated with helicobacter pylori ( h. pylori ) infection , other unidentified environmental factors , and autoimmunity directed against gastric glandular cells . pepsinogen ( pg ) is precursors of pepsin , and consists of two biochemically and immunologically distinct types , namely , pg i and pg ii . serum pg levels are related to gastritis , gastric mucosal lesion , with a particular relationship to ag . decreased serum pg i levels and the pg i / ii ratio can be used to assess gastric atrophy . miki et al . reported that the pg i / ii ratio of more than 3 has a sensitivity of 93.3% and specificity of 87.7% for the diagnosis of normal fundic gland mucosa . h. pylori infection is the most common cause of ag , and at least 50% of the world s population is infected with h. pylori . h. pylori infection can lead to variety of upper gastrointestinal disorders , including peptic ulcer disease , gastric mucosa - associated lymphoid tissue lymphoma , and gastric cancer . in addition , h. pylori infection has been linked to several extra - gastric disorders , such as atherosclerosis and coronary artery disease ( cad ) . some studies have shown a positive association between h. pylori infection and cad , while others have shown no significant association . recently , two studies have suggested that ag irrespective of h. pylori status was associated with atherosclerosis in general population . to the best of our knowledge , however , no previous reports have investigated the effects of ag on the prevalence of cad in general population . therefore , we investigated the relationship between ag , which is diagnosed based on serum pg levels , and cad in general japanese individuals . the human dry dock , is one of the most popular medical services in japan , for the purpose of the medical health checkup promoting public health through early detection of chronic diseases and their risk factors . a standard human dry dock features anamnesis and a survey of lifestyle , a physical examination , serum and urine examination , a chest x - ray , abdominal ultrasonography , and other tests . the fee is paid by participants or supported ( fully or partially ) by their employers or medical insurers . this study was designed to cross - sectionally evaluate the relationship between ag and cad in japanese population . the study included 1,758 male and 875 female subjects , aged 2190 years , who attended the human dry dock of oike clinic in kyoto , japan in 2009 . medical history and lifestyle factors were obtained from a self - administered questionnaire completed by all the subjects , which included medication use , family history of diseases , and habits of smoking and drinking . in addition , all participants underwent physical examinations , routine biochemical screening tests obtained by venipuncture after an overnight fast . all participants gave their informed consent , and the study was approved by the ethics committee of oike clinic . body mass index ( bmi ) was calculated as body weight in kilogram divided by the square of the participant s height in meters . systolic blood pressure and diastolic blood pressure were measured in the right upper arm of participants in a sedentary position using an automatic oscillometric blood pressure recorder . hypertension was defined as systolic blood pressure / diastolic blood pressure 140/90 mmhg or pharmacological treatment for hypertension . dyslipidemia was defined as total cholesterol 5.7 mmol / l , triglyceride 1.7 mmol / l , or pharmacological treatment for hyperlipidemia . hyperuricemia was defined as serum uric acid 416.3 mol / l , or pharmacological treatment for hyperuricemia . atrophic gastritis was defined as pg i 70 ng / ml and pg i / ii ratio 3.0 . coronary artery disease was defined as a previous myocardial infarction based on the clinical history or electrocardiogram . triglyceride value was presented as median ( interquartile range ) due to skewed distribution , and other continuous variables were presented as mean standard deviation ( sd ) . unpaired student s t tests , mann - whitney s u test , or test were conducted as appropriate to assess statistical significance of differences between groups , using stat view software ( ver . 5.0 ; sas institute , cary , nc ) . multiple logistic regression analysis was performed to assess the combined influence of variables on the prevalence of cad . to examine the effects of various factors on the prevalence of cad , the following factors were considered as independent variables : ag , age , sex , obesity , hypertension , diabetes mellitus , hyperlipidemia , hyperuricemia , and habits of smoking and drinking . the human dry dock , is one of the most popular medical services in japan , for the purpose of the medical health checkup promoting public health through early detection of chronic diseases and their risk factors . a standard human dry dock features anamnesis and a survey of lifestyle , a physical examination , serum and urine examination , a chest x - ray , abdominal ultrasonography , and other tests . the fee is paid by participants or supported ( fully or partially ) by their employers or medical insurers . this study was designed to cross - sectionally evaluate the relationship between ag and cad in japanese population . the study included 1,758 male and 875 female subjects , aged 2190 years , who attended the human dry dock of oike clinic in kyoto , japan in 2009 . medical history and lifestyle factors were obtained from a self - administered questionnaire completed by all the subjects , which included medication use , family history of diseases , and habits of smoking and drinking . in addition , all participants underwent physical examinations , routine biochemical screening tests obtained by venipuncture after an overnight fast . all participants gave their informed consent , and the study was approved by the ethics committee of oike clinic . body mass index ( bmi ) was calculated as body weight in kilogram divided by the square of the participant s height in meters . systolic blood pressure and diastolic blood pressure were measured in the right upper arm of participants in a sedentary position using an automatic oscillometric blood pressure recorder . hypertension was defined as systolic blood pressure / diastolic blood pressure 140/90 mmhg or pharmacological treatment for hypertension . diabetes mellitus was defined as fasting blood glucose 7.0 mmol / l or pharmacological treatment for diabetes mellitus . dyslipidemia was defined as total cholesterol 5.7 mmol / l , triglyceride 1.7 mmol / l , or pharmacological treatment for hyperlipidemia . hyperuricemia was defined as serum uric acid 416.3 mol / l , or pharmacological treatment for hyperuricemia . atrophic gastritis was defined as pg i 70 ng / ml and pg i / ii ratio 3.0 . coronary artery disease was defined as a previous myocardial infarction based on the clinical history or electrocardiogram . triglyceride value was presented as median ( interquartile range ) due to skewed distribution , and other continuous variables were presented as mean standard deviation ( sd ) . unpaired student s t tests , mann - whitney s u test , or test were conducted as appropriate to assess statistical significance of differences between groups , using stat view software ( ver . multiple logistic regression analysis was performed to assess the combined influence of variables on the prevalence of cad . to examine the effects of various factors on the prevalence of cad , the following factors were considered as independent variables : ag , age , sex , obesity , hypertension , diabetes mellitus , hyperlipidemia , hyperuricemia , and habits of smoking and drinking . characteristics of the 2,633 subjects enrolled in this study are shown in table 1 . among 2,633 study subjects , 531 subjects ( 20.2% ) mean age was significantly higher in the ag - positive group than that in the ag - negative group ( 64.5 9.4 vs 56.2 11.6 years , p<0.0001 ) . serum uric acid concentration was lower in ag - positive group than that in ag - negative group ( 327.1 83.3 vs 345.0 83.3 mol / l , p<0.0001 ) . proportions of drinker were significantly fewer in the ag - positive group than those in the ag - negative group ( 36.0% vs 40.9% , p<0.0001 ) . the prevalence of hyperuricemia was significantly lower in the ag - positive group than that in the ag - negative group ( 19.2% vs 25.0% , p = 0.0051 ) . the prevalence of cad was significantly higher in the ag - positive group than that in the ag - negative group ( 5.8% vs 2.8% , p = 0.0005 ) ( table 2 ) . multiple logistic regression analysis demonstrated that age ( odds ratio [ or ] , 1.07 ; 95% confidence interval [ ci ] , 1.041.09 ) , hypertension ( or , 2.75 ; 95% ci , 1.674.53 ) , habits of smoking ( or , 2.53 ; 95% ci , 1.544.15 ) , and ag ( or , 1.67 ; 95% ci , 1.032.72 ) were significantly associated with cad ( table 3 ) . we have shown that ag determined by serum pg levels is significantly associated with cad . this significant association remained unchanged even after adjustment for age , sex , obesity , hypertension , diabetes mellitus , dyslipidemia , hyperuricemis , and habits of smoking and drinking . atrophic gastritis represents the end stage of chronic inflammation of gastric mucosa , and h. pylori infection of the stomach is by far the most common cause of ag . h. pylori infection can eventually lead to loss of the normal gastric mucosal architecture , with destruction of gastric glands and replacement by fibrosis and intestinal - type epithelium . this process of ag and intestinal metaplasia are involved in the induction of an inflammatory response characterized by an influx of neutrophils , mononuclear cells , and t - helper 1 cells , typically aimed at clearing intracellular infections . however , h. pylori is not an intracellular pathogen , and thus the t - helper 1 response results in epithelial cell damage rather than in the removal of h. pylori . the ongoing infection with h. pylori thus causes a lifelong proinflammatory response coupled to cellular damage and initiates the cancer cascade . the underlying hypothetical mechanisms include chronic low - grade activation of the coagulation cascade and accelerating atherosclerosis due to the vascular endothelial damage resembling the gastric epithelial damage through the induction of inflammatory response . on the other hand , several studies demonstrated that h. pylori infection was associated with atherogenic lipid profiles including increased serum triglyceride and total cholesterol concentrations , and decreased hdl cholesterol concentrations . however , some studies have shown no significant association between h. pylori infection and cad . this issue is still controversial , thus further studies are needed to confirm the relationship between h. pylori infection and cad . torisu et al . reported that pulse wave velocity , which is an early preclinical marker of atherosclerosis , was significantly higher in healthy subjects with ag diagnosed by serum pg test method than in those without ag . they reported that serum ghrelin levels which might be protective against atherosclerosis , were significantly lower in ag - positive subjects than in ag - negative subjects . reported that ag diagnosed by histologic method might cause hyperhomocysteinemia , which is an independent risk factor for atherosclerosis , in general population . in their report , carotid intima - media thickness in subjects with ag was found to be thicker than that in controls , although it did not reach statistically significant levels . those two reports have suggested that ag irrespective of h. pylori status was associated with atherosclerosis . our study based on a large number of subjects suggested that ag was an independent risk factor for cad . taken together these findings , it seems plausible that ag influences the development of atherosclerotic changes in coronary arteries . second , it was not clear which extent of ag was related to h. pylori infection , because the serum immunoglobulin g antibody to h. pylori was not measured . subjects with autoimmune gastritis and h. pylori - induced gastritis were included in ag - positive group . however , the prevalence of autoimmune gastritis is low in japan , therefore the relationship between ag and cad could be regarded as the relationship between h. pylori - induced ag and cad . third , we did not measure proinflammatory cytokines such as c - reactive protein , tumor necrosis factor - alpha , and interleukin-6 , although they might not be markedly increased in the end stage of chronic inflammation . finally , we did not measure homocysteine , ghrelin , and others , each of which has been reported to be related to atherosclerosis . in conclusion

atrophic gastritis is characterized by chronic inflammation of gastric mucosa by helicobacter pylori infection and other factors . helicobacter pylori infection has been linked to coronary artery disease . to our knowledge , however , no reports are available on the relationship between atrophic gastritis and coronary artery disease . in this study , we investigated the relationship between atrophic gastritis , which is diagnosed based on serum pepsinogen levels ( pepsinogen i 70 ng / ml and pepsinogen i / ii ratio 3.0 ) , and the prevalence of coronary artery disease in general japanese population . among 2,633 study subjects , 531 subjects ( 20.2% ) were diagnosed as atrophic gastritis . the prevalence of coronary artery disease was higher in the atrophic gastritis - positive group than that in the atrophic gastritis - negative group ( 5.8% vs 2.8% , p = 0.0005 ) . multiple logistic regression analysis demonstrated that atrophic gastritis was independently associated with coronary artery disease ( odds ratio , 1.67 ; 95% confidence interval , 1.032.72 ) , after adjustment for age , sex , obesity , hypertension , diabetes mellitus , dyslipidemia , hyperuricemia , and habits of smoking and drinking . these results suggest that atrophic gastritis is an independent risk factor for coronary artery disease . chronic inflammation of gastric mucosa may be associated with the prevalence of coronary artery disease .

Introduction Materials and Methods Study subjects Study measurements Statistical analysis Results Discussion

reduction of health inequalities , including those between social groups and geographical areas , has been a major health policy goal in the united states ( us ) for the past 4 decades.[1 - 5 ] cardiovascular diseases ( cvd ) , including heart disease and stroke , have been the number one cause of death in the united states for the past eight decades , and contribute greatly to overall health inequalities for the nation . while cvd mortality rates are widely reported by age , sex , and race / ethnicity , geographical disparities in cvd mortality are mostly limited to reporting differences by rural - urban or state of residence.[7 - 9 ] analyses of geographical disparities in cvd mortality over time , especially by region or county of residence , and their socioeconomic and behavioral determinants are less common , although a few recent us studies have examined county - level variations in cvd mortality as a function of area - based deprivation or socioeconomic characteristics.[5,10 - 14 ] although us data have identified higher rates of cvd morbidity and mortality in several southern states and the southeastern region , research on whether the magnitude and patterns of geographical disparities in cvd mortality rates at various levels of geography ( such as region , state , and county ) have changed over time is either limited or lacking.[5,12 - 15 ] while national - level analyses are important in understanding overall social - group disparities in cvd , it is crucial to know from a policy standpoint as to how specific regions , states , or geographical areas are performing in reducing their cvd mortality rates and associated risk factors relative to each other or nation as a whole . in the us , states and local communities such as counties are generally responsible for development and implementation of public policies to tackle public health problems , for collecting social , environmental , and health data , and for providing a broad range of social and health services to their residents . documenting disparities between geographical areas with the lowest and highest cvd rates moreover , a spatial - temporal analysis should help identify geographical areas or regions which not only have high rates of cvd mortality but have also experienced slower mortality reductions , indicating the need for urgent action for cvd prevention and control . the aim of our study is to examine changes in the extent of geographical disparities in cvd mortality among 9 census regions , 50 states and the district of columbia , and 3,141 counties of the united states between 1969 and 2011 . using small - area national vital statistics mortality and census data , we model variations in county - level cvd mortality rates as a function of area deprivation , urbanization , racial / ethnic composition , smoking , obesity , physical inactivity , diabetes , and health care access . additionally , we use the national longitudinal mortality study ( nlms ) to model regional and state - level disparities in cvd mortality risks after adjusting for individual - level socioeconomic and demographic characteristics . to analyze geographical disparities in cvd mortality over time , we used the national vital statistics mortality database , which has been the cornerstone of health and disease monitoring among sociodemograhic groups and geographical areas in the us for over a century.[3 - 9,17 ] the national mortality database is based on information from death certificates of every death occurring in the united states each year . while the national mortality database provides the number of deaths ( numerator data ) by year , age , sex , race , geographic area , and cause of death , the corresponding population statistics developed by the us census bureau serve as the denominator for computing mortality rates.[6 - 9,17,18 ] the mainland united states consists of 50 states and the district of columbia , which are grouped into 9 census regions as shown in figure 1 . states are divided into counties , and the number of counties varies by state . in all , there are 3,143 counties in the united states . in our study , cvd mortality rates were computed annually for all 9 regions between 1969 and 2011 . for smaller geographical areas such as states and counties , mortality trends are presented for three time periods due to data availability and space constraints . state - specific cvd mortality rates were computed for 1969 , 1990 , and 2011 . cvd mortality rates were computed for 3,141 counties for the time periods : 1969 - 1974 , 1990 - 1999 , and 2003 - 2007 . mortality rates for all geographic areas were age - adjusted by the direct method using the age - composition of the 2000 us population as the standard.[4 - 9 ] trends in cardiovascular disease ( cvd ) mortality by geographic region , united states , 1969 - 2011 new england = maine + new hampshire + vermont + massachusetts + rhode island + connecticut middle atlantic = new york + new jersey + pennsylvania east north central = ohio + indiana + illinois + michigan + wisconsin west north central = minnesota + iowa + missouri + north dakota + south dakota + nebraska + kansas south atlantic = delaware + maryland + district of columbia + virginia + west virginia + north carolina + south carolina + georgia + florida east south central = kentucky + tennessee + alabama + mississippi west south central = arkansas + louisiana + oklahoma + texas mountain = montana + idaho + wyoming + colorado + new mexico + arizona + utah + nevada pacific = washington + oregon + california + alaska + hawaii log - linear regression models were used to estimate annual rates of decrease in cvd mortality for each census region . specifically , the logarithm of region - specific mortality rates were modeled as a linear function of time ( calendar year ) , which yielded annual exponential rates of change in mortality rates . in order to summarize state- and county - level disparities in mortality , we used various disparity measures such as the coefficient of variation ( cv ) , interquartile range , quintile and percentile ratios , and absolute and relative mean deviation indices . moreover , disparities in mortality were described by rate ratios ( relative risks ) and rate differences ( absolute inequalities ) , which were tested for statistical significance at the 0.05 level . we used weighted least squares regression to model county - level variations in age - adjusted cvd mortality rates as a function of area deprivation , urbanization , racial / ethnic composition , smoking , obesity , physical inactivity , diabetes , and health uninsurance rates , and availability of primary care physicians . the data on county - level covariates were obtained from several sources such as the census , behavioral risk factor surveillance system , and area resource file.[19 - 22 ] for area deprivation , we used a factor - based deprivation index from the 2000 decennial us census . the deprivation index consisted of 22 socioeconomic indicators , which are viewed as broadly representing educational opportunities , labor force skills , economic , and housing conditions in a given county . selected indicators of education , occupation , wealth , income distribution , unemployment rate , poverty rate , and housing quality were used to construct the 2000 index . effects of both continuous and categorical measures of the deprivation index and smoking , obesity , and diabetes prevalence rates were estimated in the regression models . cardiovascular deaths in each county were used as weights in the weighted regression models because the number of deaths is proportional to the inverse of the variance of mortality rates . to examine regional and state - level variations in cvd mortality , we also used the 1979 - 2002 nlms , that allowed us to examine geographical differences in mortality after adjusting for individual - level socioeconomic and demographic characteristics . the nlms is a longitudinal dataset for examining socioeconomic , occupational , and demographic factors associated with all - cause and cause - specific mortality in the united states.[25 - 28 ] the nlms is conducted by the national heart , lung , and blood institute ( national institutes of health [ nih ] ) in collaboration with the us census bureau , the national cancer institute ( nih ) , the national institute on aging ( nih ) , and the national center for health statistics ( centers for disease control and prevention).[25 - 28 ] the nlms consists of 30 current population survey ( cps ) and census cohorts between 1973 and 2002 whose survival ( mortality ) experiences were studied between 1979 and 2002 . the cps is a sample household and telephone interview survey of the civilian non - institutionalized population in the united states and is conducted by the us census bureau to produce monthly national statistics on unemployment and the labor force . data from death certificates on the fact of death and the cause of death are combined with the socioeconomic and demographic characteristics of the nlms cohorts by means of the national death index.[25 - 28 ] detailed descriptions of the nlms have been provided elsewhere.[25 - 27 ] the full nlms consists of approximately 3 million individuals drawn from 30 cps and census cohorts whose mortality experience has been followed from 1979 through 2002 , with the total number of deaths during the 23-year follow - up being 341,343 . however , our study uses the public - use micro - data sample that contains only selected population cohorts between 1979 and 1991 , with a maximum mortality follow - up of 11 years . state- and region - level differentials in mortality risks were adjusted by multivariate cox proportional hazards regression for age and for additional covariates such as sex , race / ethnicity , marital status , metropolitan / non - metropolitan residence , education , income / poverty level , and occupation . the public - use nlms sample for 1979 - 2002 included 780,461 individuals aged 25 at the baseline and 50,430 cvd deaths during the 11-year mortality follow - up . in estimating the mortality risk , all those surviving beyond the 11-year follow - up ( i.e. , 4,018 days of follow - up ) and those dying from causes other than cvd during the follow - up period were treated as right - censored observations . to analyze geographical disparities in cvd mortality over time , we used the national vital statistics mortality database , which has been the cornerstone of health and disease monitoring among sociodemograhic groups and geographical areas in the us for over a century.[3 - 9,17 ] the national mortality database is based on information from death certificates of every death occurring in the united states each year . while the national mortality database provides the number of deaths ( numerator data ) by year , age , sex , race , geographic area , and cause of death , the corresponding population statistics developed by the us census bureau serve as the denominator for computing mortality rates.[6 - 9,17,18 ] the mainland united states consists of 50 states and the district of columbia , which are grouped into 9 census regions as shown in figure 1 . states are divided into counties , and the number of counties varies by state . in all , there are 3,143 counties in the united states . in our study , cvd mortality rates were computed annually for all 9 regions between 1969 and 2011 . for smaller geographical areas such as states and counties , mortality trends are presented for three time periods due to data availability and space constraints . state - specific cvd mortality rates were computed for 1969 , 1990 , and 2011 . cvd mortality rates were computed for 3,141 counties for the time periods : 1969 - 1974 , 1990 - 1999 , and 2003 - 2007 . mortality rates for all geographic areas were age - adjusted by the direct method using the age - composition of the 2000 us population as the standard.[4 - 9 ] trends in cardiovascular disease ( cvd ) mortality by geographic region , united states , 1969 - 2011 new england = maine + new hampshire + vermont + massachusetts + rhode island + connecticut middle atlantic = new york + new jersey + pennsylvania east north central = ohio + indiana + illinois + michigan + wisconsin west north central = minnesota + iowa + missouri + north dakota + south dakota + nebraska + kansas south atlantic = delaware + maryland + district of columbia + virginia + west virginia + north carolina + south carolina + georgia + florida east south central = kentucky + tennessee + alabama + mississippi west south central = arkansas + louisiana + oklahoma + texas mountain = montana + idaho + wyoming + colorado + new mexico + arizona + utah + nevada pacific = washington + oregon + california + alaska + hawaii log - linear regression models were used to estimate annual rates of decrease in cvd mortality for each census region . specifically , the logarithm of region - specific mortality rates were modeled as a linear function of time ( calendar year ) , which yielded annual exponential rates of change in mortality rates . in order to summarize state- and county - level disparities in mortality , we used various disparity measures such as the coefficient of variation ( cv ) , interquartile range , quintile and percentile ratios , and absolute and relative mean deviation indices . moreover , disparities in mortality were described by rate ratios ( relative risks ) and rate differences ( absolute inequalities ) , which were tested for statistical significance at the 0.05 level . we used weighted least squares regression to model county - level variations in age - adjusted cvd mortality rates as a function of area deprivation , urbanization , racial / ethnic composition , smoking , obesity , physical inactivity , diabetes , and health uninsurance rates , and availability of primary care physicians . the data on county - level covariates were obtained from several sources such as the census , behavioral risk factor surveillance system , and area resource file.[19 - 22 ] for area deprivation , we used a factor - based deprivation index from the 2000 decennial us census . the deprivation index consisted of 22 socioeconomic indicators , which are viewed as broadly representing educational opportunities , labor force skills , economic , and housing conditions in a given county . selected indicators of education , occupation , wealth , income distribution , unemployment rate , poverty rate , and housing quality were used to construct the 2000 index . effects of both continuous and categorical measures of the deprivation index and smoking , obesity , and diabetes prevalence rates were estimated in the regression models . cardiovascular deaths in each county were used as weights in the weighted regression models because the number of deaths is proportional to the inverse of the variance of mortality rates . to examine regional and state - level variations in cvd mortality , we also used the 1979 - 2002 nlms , that allowed us to examine geographical differences in mortality after adjusting for individual - level socioeconomic and demographic characteristics . the nlms is a longitudinal dataset for examining socioeconomic , occupational , and demographic factors associated with all - cause and cause - specific mortality in the united states.[25 - 28 ] the nlms is conducted by the national heart , lung , and blood institute ( national institutes of health [ nih ] ) in collaboration with the us census bureau , the national cancer institute ( nih ) , the national institute on aging ( nih ) , and the national center for health statistics ( centers for disease control and prevention).[25 - 28 ] the nlms consists of 30 current population survey ( cps ) and census cohorts between 1973 and 2002 whose survival ( mortality ) experiences were studied between 1979 and 2002 . the cps is a sample household and telephone interview survey of the civilian non - institutionalized population in the united states and is conducted by the us census bureau to produce monthly national statistics on unemployment and the labor force . data from death certificates on the fact of death and the cause of death are combined with the socioeconomic and demographic characteristics of the nlms cohorts by means of the national death index.[25 - 28 ] detailed descriptions of the nlms have been provided elsewhere.[25 - 27 ] the full nlms consists of approximately 3 million individuals drawn from 30 cps and census cohorts whose mortality experience has been followed from 1979 through 2002 , with the total number of deaths during the 23-year follow - up being 341,343 . however , our study uses the public - use micro - data sample that contains only selected population cohorts between 1979 and 1991 , with a maximum mortality follow - up of 11 years . state- and region - level differentials in mortality risks were adjusted by multivariate cox proportional hazards regression for age and for additional covariates such as sex , race / ethnicity , marital status , metropolitan / non - metropolitan residence , education , income / poverty level , and occupation . the public - use nlms sample for 1979 - 2002 included 780,461 individuals aged 25 at the baseline and 50,430 cvd deaths during the 11-year mortality follow - up . in estimating the mortality risk , all those surviving beyond the 11-year follow - up ( i.e. , 4,018 days of follow - up ) and those dying from causes other than cvd during the follow - up period were treated as right - censored observations . figure 1 shows annual trends in cvd mortality among 9 census regions . during 1969 - 2011 , cvd mortality rates declined at the fastest pace in new england and mid - atlantic regions and at the slowest rate in the southeast and southwestern regions of the united states . the average annual rates of decline in mortality during 1969 - 2011 were 2.94% for new england , 2.7% for mid - atlantic , 2.23% for southwest , and 2.12% for southeast . in 1969 , the mortality rate was 9% higher in the southeast than in new england , but this differential increased to 22% in 1990 and 48% in 2011 . a similar increase in relative risk of cvd mortality was seen over time for the southeast and southwest regions when compared to new england and mountain regions ( figure 1 ) . even after adjusting for individual - level socioeconomic and demographic characteristics in the nlms , those in the southeast and east northcentral regions maintained 18 - 19% higher cvd mortality risks than their counterparts in the mountain region ( table 1 ) . the adjusted effects of other individual - level covariates on cvd mortality risks in the nlms are worth noting ( table 1 ) . individuals with low education and incomes had 32 - 40% higher cvd mortality risks than their counterparts with high education and income levels . service workers and manual laborers had 17 - 19% higher cvd mortality risks than those employed in professional and managerial occupations . divorced / separated and never married individuals had 29 - 32% higher cvd mortality risks than married individuals . hispanics and asian / pacific islanders had 35 - 41% lower cvd mortality risks than their non - hispanic counterparts of equivalent socioeconomic backgrounds . age- and covariate - adjusted relative risks of cardiovascular disease ( cvd ) mortality among us adults aged 25+years according to baseline socioedemographic characteristics and region of residence : the us national longitudinal mortaliy study , 19792002 ( n=780,461 ) notes : relative risks ( hazard ratios ) were derived from multivariate cox proportional hazards regression models . adjusted for age , sex , race / ethnicity , marital status , metropolitan / nonmetropolitan residence , educational attainment , occupation , income / poverty level , and geographic region in 2011 , southeastern states such as mississippi and alabama had the highest cvd mortality rates , nearly two times higher than the rates for minnesota and hawaii ( table 2 ) . state patterns were similar in 1969 and 1990 , with substantially increased risks of cvd mortality for most southern states . in 1990 , mississippi and louisiana had the highest mortality rates , 51% , and 42% higher than the rate for hawaii . in 1969 , south carolina had the highest mortality rate , 52% higher than the rate for alaska ( table 2 ) . controlling for individual - level sociodemographic characteristics in the nlms reduced state differentials ; however , individuals in indiana , michigan , louisiana , and kentucky maintained 30 - 35% higher cvd mortality risks than their counterparts in new mexico ( table 3 ) . age - adjusted cardiovascular disease mortality rates by state : united states , 1969 , 1990 , and 2011 notes : rates are per 100,000 population and are directly age - adjusted to the 2000 us standard population . relative risks of cardiovascular disease ( cvd ) mortality among us adults aged 25 years , according to state of residence : the us national longitudinal mortaliy study , 1979 - 2002 ( n=780,461 ) notes : estimated relative risks ( hazard ratios ) were derived from multivariate cox proportional hazards regression models . adjusted for age only . adjusted for age , sex , race / ethnicity , marital status , metro / non - metro residence , educational attainment , occupation , and income / poverty level absolute disparities in state - level cvd mortality , as measured by interquartile range and absolute mean deviation , however , relative disparities in state - level cvd mortality rates , as measured by cv , relative mean deviation index , and quintile and percentile ratios , widened over time . the coefficient of variation in state - level cvd mortality increased by 48% from 10.0 in 1969 to 14.8 in 2011 . the relative mean deviation index indicated a 43% increase in state - level disparity in cvd mortality between 1969 and 2011 ( table 4 ) . summary measures of geographical disparities in cardiovascular disease ( cvd ) mortality , united states , 1969 - 2011 ( 50 states and district of columbia ; 3,141 counties ) interquartile range=3 quartile - 1 quartile ; q1=first quintile ; q4=fourth quintile . p10=10 percentile ; p90=90 percentile county - level variations in area deprivation and cvd mortality rates were closely related , with the weighted correlation being -0.53 ( figure 2 and table 5 ) . consistent with high deprivation levels in the southeast , individuals in this region had the highest cvd mortality rates ( figure 2 ) . area deprivation , smoking , obesity , physical inactivity , diabetes prevalence , urbanization , racial / ethnic composition , lack of health insurance , and lower access to primary medical care were all significant predictors of county - level cvd mortality rates ( table 5 ) . in the multivariate models , these covariates ( excluding health insurance and physician availability because of multicollinearity ) accounted for 52.7% of the county variance . a 10-percentage - point increase in obesity prevalence similarly , a 10-percentage - point increase in diabetes prevalence was associated with a 57.7-point increase in the cvd mortality rate . in multivariate categorical models , consistent gradients in cvd mortality were found by area deprivation and smoking , obesity and diabetes prevalence . even after adjusting for behavioral risk factors , those in the most deprived counties had 15% higher cvd mortality than those in the most affluent counties . cvd mortality rates were 18% higher in areas with smoking rates 36% , compared with areas with smoking rates < 12% . counties with obesity rates 40% had 54% higher cvd mortality than counties with an obesity rate < 15% . counties with a diabetes prevalence 14% had 19% higher cvd mortality than counties with a diabetes prevalence < 6% ( table 5 ) . area ( county ) socioeconomic deprivation index and age - adjusted cardiovascular disease ( cvd ) mortality rates per 100,000 population for the united states ( 2000 us population used as standard ; 3,141 counties ) weighted least squares regression models showing the impacts of the continuous and categorical socioeconomic deprivation index , smoking , obesity , physical activity , diabetes prevalence , ruralurban continuum , and racial / ethnic composition on countylevel ageadjusted cardiovascular disease ( cvd ) mortality rates : united states , 20032007 ( n=3,141 ) notes : b = unstandardized regression coefficient ; =standardized regression coefficient ; r = percentage variance explained . health uninsurance and primary care physician availability rates were not used as covariates in the multivariate model because of estimation problems due to multicollinearity . the 2000 census socioeconomic deprivation index is a continuous variable with a mean of 100 and a standard deviation of 20 . current smoking prevalence among adults aged 18+in 2000 - 2003 . obesity or diabetes prevalence among adults aged 18+in 2006 - 2008 . percentage of physically active adults aged 18+in 2007 , where phyically active = at least 150 minutes of moderate physical activity per week , or 75 minutes of vigorous activity per week , or an equivalent comination of moderate and vigorous physical activity . the 2003 rural - urban continuum is used a continuous variable , with code 1 being the most urbanized county and code 9 being the most rural county . percentage of black , american indian / alaska native , asian / pacific islander , and hispanic populations in 2000 . number of primary care doctors per 100,000 population in 2005 . adjusted for socioeconomic deprivation , smoking , obesity , and pa prevalence , rural - urban continuum , and minority concentration . source : based on the us national vital statistcs system , behavioral risk factor surveillance system , us census , and area resource file county - level differentials in cvd mortality rates , as measured by relative disparity indices , widened over time ; the relative mean deviation index and coefficient of variation indicated , respectively , a 52% and 61% increase in county - level disparity in cvd mortality rates between 1969 and 2007 . absolute county - level disparities in cvd mortality , however , declined over time ( table 4 ) . figure 1 shows annual trends in cvd mortality among 9 census regions . during 1969 - 2011 , cvd mortality rates declined at the fastest pace in new england and mid - atlantic regions and at the slowest rate in the southeast and southwestern regions of the united states . the average annual rates of decline in mortality during 1969 - 2011 were 2.94% for new england , 2.7% for mid - atlantic , 2.23% for southwest , and 2.12% for southeast . in 1969 , the mortality rate was 9% higher in the southeast than in new england , but this differential increased to 22% in 1990 and 48% in 2011 . a similar increase in relative risk of cvd mortality was seen over time for the southeast and southwest regions when compared to new england and mountain regions ( figure 1 ) . even after adjusting for individual - level socioeconomic and demographic characteristics in the nlms , those in the southeast and east northcentral regions maintained 18 - 19% higher cvd mortality risks than their counterparts in the mountain region ( table 1 ) . the adjusted effects of other individual - level covariates on cvd mortality risks in the nlms are worth noting ( table 1 ) . individuals with low education and incomes had 32 - 40% higher cvd mortality risks than their counterparts with high education and income levels . service workers and manual laborers had 17 - 19% higher cvd mortality risks than those employed in professional and managerial occupations . divorced / separated and never married individuals had 29 - 32% higher cvd mortality risks than married individuals . hispanics and asian / pacific islanders had 35 - 41% lower cvd mortality risks than their non - hispanic counterparts of equivalent socioeconomic backgrounds . age- and covariate - adjusted relative risks of cardiovascular disease ( cvd ) mortality among us adults aged 25+years according to baseline socioedemographic characteristics and region of residence : the us national longitudinal mortaliy study , 19792002 ( n=780,461 ) notes : relative risks ( hazard ratios ) were derived from multivariate cox proportional hazards regression models . adjusted for age , sex , race / ethnicity , marital status , metropolitan / nonmetropolitan residence , educational attainment , occupation , income / poverty level , and geographic region in 2011 , southeastern states such as mississippi and alabama had the highest cvd mortality rates , nearly two times higher than the rates for minnesota and hawaii ( table 2 ) . state patterns were similar in 1969 and 1990 , with substantially increased risks of cvd mortality for most southern states . in 1990 , mississippi and louisiana had the highest mortality rates , 51% , and 42% higher than the rate for hawaii . in 1969 , south carolina had the highest mortality rate , 52% higher than the rate for alaska ( table 2 ) . controlling for individual - level sociodemographic characteristics in the nlms reduced state differentials ; however , individuals in indiana , michigan , louisiana , and kentucky maintained 30 - 35% higher cvd mortality risks than their counterparts in new mexico ( table 3 ) . age - adjusted cardiovascular disease mortality rates by state : united states , 1969 , 1990 , and 2011 notes : rates are per 100,000 population and are directly age - adjusted to the 2000 us standard population . relative risks of cardiovascular disease ( cvd ) mortality among us adults aged 25 years , according to state of residence : the us national longitudinal mortaliy study , 1979 - 2002 ( n=780,461 ) notes : estimated relative risks ( hazard ratios ) were derived from multivariate cox proportional hazards regression models . adjusted for age only . adjusted for age , sex , race / ethnicity , marital status , metro / non - metro residence , educational attainment , occupation , and income / poverty level absolute disparities in state - level cvd mortality , as measured by interquartile range and absolute mean deviation , decreased over time . however , relative disparities in state - level cvd mortality rates , as measured by cv , relative mean deviation index , and quintile and percentile ratios , widened over time . the coefficient of variation in state - level cvd mortality increased by 48% from 10.0 in 1969 to 14.8 in 2011 . the relative mean deviation index indicated a 43% increase in state - level disparity in cvd mortality between 1969 and 2011 ( table 4 ) . summary measures of geographical disparities in cardiovascular disease ( cvd ) mortality , united states , 1969 - 2011 ( 50 states and district of columbia ; 3,141 counties ) interquartile range=3 quartile - 1 quartile ; q1=first quintile ; q4=fourth quintile . county - level variations in area deprivation and cvd mortality rates were closely related , with the weighted correlation being -0.53 ( figure 2 and table 5 ) . consistent with high deprivation levels in the southeast , individuals in this region had the highest cvd mortality rates ( figure 2 ) . area deprivation , smoking , obesity , physical inactivity , diabetes prevalence , urbanization , racial / ethnic composition , lack of health insurance , and lower access to primary medical care were all significant predictors of county - level cvd mortality rates ( table 5 ) . in the multivariate models , these covariates ( excluding health insurance and physician availability because of multicollinearity ) accounted for 52.7% of the county variance . a 10-percentage - point increase in obesity prevalence similarly , a 10-percentage - point increase in diabetes prevalence was associated with a 57.7-point increase in the cvd mortality rate . in multivariate categorical models , consistent gradients in cvd mortality were found by area deprivation and smoking , obesity and diabetes prevalence . even after adjusting for behavioral risk factors , those in the most deprived counties had 15% higher cvd mortality than those in the most affluent counties . cvd mortality rates were 18% higher in areas with smoking rates 36% , compared with areas with smoking rates < 12% . counties with obesity rates 40% had 54% higher cvd mortality than counties with an obesity rate < 15% . counties with a diabetes prevalence 14% had 19% higher cvd mortality than counties with a diabetes prevalence < 6% ( table 5 ) . area ( county ) socioeconomic deprivation index and age - adjusted cardiovascular disease ( cvd ) mortality rates per 100,000 population for the united states ( 2000 us population used as standard ; 3,141 counties ) weighted least squares regression models showing the impacts of the continuous and categorical socioeconomic deprivation index , smoking , obesity , physical activity , diabetes prevalence , ruralurban continuum , and racial / ethnic composition on countylevel ageadjusted cardiovascular disease ( cvd ) mortality rates : united states , 20032007 ( n=3,141 ) notes : b = unstandardized regression coefficient ; =standardized regression coefficient ; r = percentage variance explained . health uninsurance and primary care physician availability rates were not used as covariates in the multivariate model because of estimation problems due to multicollinearity . the 2000 census socioeconomic deprivation index is a continuous variable with a mean of 100 and a standard deviation of 20 . percentage of physically active adults aged 18+in 2007 , where phyically active = at least 150 minutes of moderate physical activity per week , or 75 minutes of vigorous activity per week , or an equivalent comination of moderate and vigorous physical activity . the 2003 rural - urban continuum is used a continuous variable , with code 1 being the most urbanized county and code 9 being the most rural county . percentage of black , american indian / alaska native , asian / pacific islander , and hispanic populations in 2000 . number of primary care doctors per 100,000 population in 2005 . adjusted for socioeconomic deprivation , smoking , obesity , and pa prevalence , rural - urban continuum , and minority concentration . source : based on the us national vital statistcs system , behavioral risk factor surveillance system , us census , and area resource file county - level differentials in cvd mortality rates , as measured by relative disparity indices , widened over time ; the relative mean deviation index and coefficient of variation indicated , respectively , a 52% and 61% increase in county - level disparity in cvd mortality rates between 1969 and 2007 . absolute county - level disparities in cvd mortality , however , declined over time ( table 4 ) . cardiovascular disease mortality rates have decreased for all regions and states in the united states . yet , geographical disparities in mortality , in relative terms , have widened over time as several areas in the south experienced slower mortality declines than those in the northeast and western regions of the country . geographical disparities are very marked , with several southern states having nearly twice the risk of cvd mortality than states in the northeastern and western united states . existence of such marked and growing geographical disparities in cvd mortality appears contrary to the goals of the national health initiative that calls for further reductions in cardiovascular disease inequalities in the united states by 2020 . our results are consistent with the previous studies that have shown historically higher rates of cvd mortality in the southern region of the united states.[7,12 - 15 ] because of the persistence of this geographical pattern , the south is often referred to as the stroke or heart disease belt of the united states . since behavioral risk factors such as smoking , unhealthy diet , physical inactivity , and obesity are known to account for about 80% of cvd deaths , geographical disparities in cvd mortality may be understood in terms of geographical distribution of these risk factors . our analysis confirms the significance of geographical distribution of smoking , obesity , physical inactivity , and diabetes prevalence in explaining county - level disparities in cvd mortality rates . nearly 40% of the variance in cvd mortality , and geographical differences in smoking explain about 28% of the variance . smoking , obesity , and physical inactivity rates are highest in the south , and increases in obesity rates have been more marked in the southern states . moreover , smoking rates have declined more slowly in the south than elsewhere in the united states . patterns and increasing geographical disparities in cvd mortality shown here are consistent with those observed previously for the united states and europe.[5,13,33 - 35 ] a recent study showed widening rural - urban disparities in cvd mortality rates in the united states , with those in rural areas experiencing 16% and 26% higher mortality in 1990 and 2009 respectively than their urban counterparts . disparities in cvd mortality between most deprived non - metropolitan areas and most affluent metropolitan areas of the united states also increased markedly between 1990 and 2009 in both absolute and relative terms . coronary heart disease mortality rates have been found to be higher in inner - city areas and in local authority areas in the north of england than those in the south . another study showed a substantial , widening gap in coronary heart disease mortality between the worst health and best health areas of britain over a 10-year period . with the prevalence of many chronic disease risk factors rising in the developing world due to urbanization , development , and globalization , the global burden of cardiovascular diseases is expected to increase further , especially in low- and middle - income countries which account for more than 80% of cvd deaths globally . [ 30,36 - 38 ] cardiovascular disease is the leading cause of death not only in the industrialized world , but also in low- and middle - income countries.[30,36 - 38 ] globally , a major shift has been occurring in the distribution of disease burden as a number of low- and middle - income countries are experiencing an increasing proportion of deaths and years of life lost due to non - communicable diseases such as heart disease , stroke , and copd.[30,36 - 38 ] most of the cvd deaths are preventable through policy measures that are aimed at reducing behavioral risk factors such as smoking , physical inactivity , unhealthy diet , and heavy drinking that account for about 80% of cardiovascular diseases globally . cardiovascular disease burden varies greatly across the world regions , with india and china accounting for > 30% of all global cvd deaths.[30,36 - 38 ] similar analyses of geographical disparities in cardiovascular disease prevalence and mortality rates in developing countries can highlight rural - urban , province- , or district - level disparities , thus indicating the need for targeted action and population - wide interventions to reduce cardiovascular disease incidence and associated behavioral risks . the following countries have the highest disease burden ( in terms of number of heart disease deaths ) : us and germany among high - income countries ; china and indonesia in the east asia and pacific region ; russia and ukraine in europe and central asia ; brazil and mexico in latin america and the caribbean ; india and pakistan in south asia ; and nigeria and ethiopia in sub - saharan africa.[30,36 - 38 ] because of macro - societal forces , such as globalization and urbanization , people in developing countries are increasingly being exposed to such cvd risk factors as smoking , drinking , physical inactivity , and unhealthy diet . at the same time , they do not have similar access to public health education and prevention programs and access to primary care as their counterparts in the industrialized world . geographical inequalities in the united states remain quite marked despite the impressive overall decline in cvd mortality over the past several decades . the growing geographical disparities in cvd mortality are a major public health concern . because cardiovascular diseases are the leading cause of death and account for nearly one - third of all us deaths , the widening inequalities in cvd mortality contribute greatly to overall health and mortality inequalities in the united states . these disparities in mortality may indicate significant geographical inequities in cvd prevention and control efforts . population - wide interventions such as comprehensive tobacco control policies , smoking cessation programs , increased access to primary medical care , physical activity campaigns , and anti - obesity programs can be implemented to reduce cvd risks in the entire population while targeting those in the more disadvantaged areas of the country such as the south . a broad course of policy action related to the wider social determinants can be a particularly effective strategy in reducing cvd inequalities . health and social policy interventions such as improved access to health services , and reductions in inequalities in education , poverty , unemployment , occupation , housing , and access to health - promoting physical or built environments are essential for tackling long - term inequalities in cvd mortality between geographical areas in the united states . previous research has identified higher risks of cvd mortality in the southern region of the united states . our study shows that , despite the substantial decline in overall mortality , regions , states , and counties in the southeastern united states continue to show substantially increased risks of cvd mortality.county- and state - level inequalities in cardiovascular - disease mortality increased consistently between 1969 and 2011 as geographical areas in new england and mid - atlantic regions of the us experienced faster mortality declines than those in the south.both area- and individual - level socioeconomic characteristics influence geographical disparities in cvd mortality in the united states . additionally , preventable or modifiable risk factors such as smoking , obesity , physical inactivity , diabetes , and healthcare access account for much of the geographical inequality in cvd mortality.widening geographical in us cardiovascular - disease mortality may be related to increasing temporal differences in material living conditions and health - risk behaviors such as smoking , obesity , physical inactivity , and unhealthy diet between geographical areas.from a policy standpoint , narrowing the socioeconomic gap and inequalities in smoking , obesity , and physical inactivity between affluent and disadvantaged areas has the greatest potential to reduce cvd and overall mortality rates in the united states.with the prevalence of many chronic disease risk factors rising in the developing world due to globalization and development , the global burden of cardiovascular diseases will likely increase further , especially in low- and middle - income countries , which account for more than 80% of cvd deaths globally . previous research has identified higher risks of cvd mortality in the southern region of the united states . our study shows that , despite the substantial decline in overall mortality , regions , states , and counties in the southeastern united states continue to show substantially increased risks of cvd mortality . county- and state - level inequalities in cardiovascular - disease mortality increased consistently between 1969 and 2011 as geographical areas in new england and mid - atlantic regions of the us experienced faster mortality declines than those in the south . both area- and individual - level socioeconomic characteristics influence geographical disparities in cvd mortality in the united states . additionally , preventable or modifiable risk factors such as smoking , obesity , physical inactivity , diabetes , and healthcare access account for much of the geographical inequality in cvd mortality . widening geographical in us cardiovascular - disease mortality may be related to increasing temporal differences in material living conditions and health - risk behaviors such as smoking , obesity , physical inactivity , and unhealthy diet between geographical areas . from a policy standpoint , narrowing the socioeconomic gap and inequalities in smoking , obesity , and physical inactivity between affluent and disadvantaged areas has the greatest potential to reduce cvd and overall mortality rates in the united states . with the prevalence of many chronic disease risk factors rising in the developing world due to globalization and development , the global burden of cardiovascular diseases will likely increase further , especially in low- and middle - income countries , which account for more than 80% of cvd deaths globally .

objectives : this study examined trends in geographical disparities in cardiovascular - disease ( cvd ) mortality in the united states between 1969 and 2011.methods:national vital statistics data and the national longitudinal mortality study were used to estimate regional , state , and county - level disparities in cvd mortality over time . log - linear , weighted least squares , and cox regression were used to analyze mortality trends and differentials.results:during 1969 - 2011 , cvd mortality rates declined fastest in new england and mid - atlantic regions and slowest in the southeast and southwestern regions . in 1969 , the mortality rate was 9% higher in the southeast than in new england , but the differential increased to 48% in 2011 . in 2011 , southeastern states , mississippi and alabama , had the highest cvd mortality rates , nearly twice the rates for minnesota and hawaii . controlling for individual - level covariates reduced state differentials . state- and county - level differentials in cvd mortality rates widened over time as geographical disparity in cvd mortality increased by 50% between 1969 and 2011 . area deprivation , smoking , obesity , physical inactivity , diabetes prevalence , urbanization , lack of health insurance , and lower access to primary medical care were all significant predictors of county - level cvd mortality rates and accounted for 52.7% of the county variance.conclusions and global health implications : although cvd mortality has declined for all geographical areas in the united states , geographical disparity has widened over time as certain regions and states , particularly those in the south , have lagged behind in mortality reduction . geographical disparities in cvd mortality reflect inequalities in socioeconomic conditions and behavioral risk factors . with the global cvd burden on the rise , monitoring geographical disparities , particularly in low- and middle - income countries , could indicate the extent to which reductions in cvd mortality are achievable and may help identify effective policy strategies for cvd prevention and control .

Introduction Methods Use of National Vital Statistics and Census Databases to Analyze Trends in Regional, State and County-level Disparities National Longitudinal Mortality Study (NLMS) Results Regional Trends and Differentials in CVD Mortality Trends and Differentials in State-Level Disparities in CVD Mortality Trends and Differentials in County-Level Disparities in CVD Mortality Discussion Conclusions and Global Health Implications

type 1 and type 2 diabetes account for more than 95% of all diabetes cases worldwide . although clinical characteristics show clear differences between type 1 and type 2 diabetes , recent developments indicate that the pathogenesis of the two forms of the disease share a number of fundamental features . comparative analyses particularly revealed chronic , low - grade inflammatory processes such as systemically elevated levels of proinflammatory immune mediators in both types of diabetes [ 3 , 4 ] . in type 1 diabetes , systemically increased concentrations of inflammatory mediators may promote immune - mediated destruction of autologous pancreatic beta cells [ 57 ] , whereas in type 2 diabetes , increased systemic levels of inflammatory mediators are supposed to contribute to insulin resistance , a major pathogenetic feature of the disease [ 811 ] . previous studies identified the adipose tissue as a prominent source of proinflammatory cytokines and chemokines [ 12 , 13 ] . this finding gains special importance in view of the observations that an increased adipose tissue mass is associated with an elevated risk for type 2 diabetes [ 14 , 15 ] and an accelerated progression of type 1 diabetes [ 16 , 17 ] . further analyses identified the adipocyte population as an important cellular source of proinflammatory mediators within the adipose tissue and implicate that adipocyte - derived mediators promote local inflammatory processes as well as systemic low - grade inflammation [ 1820 ] . recently , we demonstrated that the ( pro-)inflammatory activity of adipocytes is under control of heat shock protein ( hsp ) 60 [ 2123 ] , a prominent member of the hsp family . the capacity to specifically bind to adipocytes and to induce the release of proinflammatory cytokines and chemokines qualifies hsp60 as a candidate for the induction and progression of inflammatory processes associated with the development of diabetes . initial evidence for a role of hsp60 in the progression of insulin - deficient / type 1 diabetes came from observations in the nonobese diabetic ( nod ) mouse , an animal model of type 1 diabetes which shows aberrant hsp60 expression in pancreatic beta cells already in the prediabetic phase . in this model , moreover , patients with type 1 diabetes have increased hsp60 levels and show delayed disease progression after treatment with the hsp60-derived peptide p277 [ 28 , 29 ] . in obese individuals , hsp60 plasma concentrations were increased and positively correlated with body mass index and insulin resistance . these observations indicate that hsp60 stimulates the proinflammatory activity of adipocytes which then might contribute to the ( pro-)inflammatory processes associated with diabetes . however , the increased proinflammatory activity observed in ( pre-)diabetic individuals may not only be determined by their elevated hsp60 levels but also by an increased responsiveness of their adipocyte population to the stress protein . currently , it is not known whether adipocytes from diabetes - prone individuals exhibit an altered hsp60 responsiveness . we therefore hypothesized that adipocytes of diabetes - predisposed individuals exhibit an increased responsiveness to the ( pro-)inflammatory effects of the stress protein hsp60 . to test the hypothesis , we compared the hsp60 responsiveness of adipocytes from the nod mouse , as preferred animal model of type 1 diabetes [ 32 , 33 ] , and from the new zealand obese ( nzo ) mouse , a model of obesity and the metabolic syndrome . using adipocytes from c57bl/6j mice as reference mouse strain without diabetes risk , we investigated the decisive events assumed to be involved in hsp60-mediated adipocyte activation : ( 1 ) the binding of hsp60 , ( 2 ) the activation of signalling pathways , and ( 3 ) the release of inflammatory mediators . normoglycemic mice ( blood glucose concentration < 10 mmol / l ) of the strains c57bl/6j ( female ) , nod ( female ) , and nzo ( male ) at an age of 70 days were obtained from the breeding colonies at the german diabetes center . animal experimentation was performed in accordance with the principles of laboratory animal care and was approved by the local state animal welfare committee . preadipocytes were isolated from the visceral adipose tissue depot of the various mouse strains , cultivated , and differentiated to mature adipocytes as previously described . the purity of the cell populations and their differentiation state were confirmed by lipid - specific oil red o staining and facs analyses as described . antibodies directed against -actin and signalling proteins ( phospho - erk1/2 mapk thr202/tyr204 , phospho - p38 mapk , phospho - sapk / jnk thr183/tyr185 , phospho - nfb p65 ser536 ) were purchased from cell signalling ( danvers , ma , usa ) . murine anti - human hsp60 abs were from santa cruz ( heidelberg , germany ; clones h-1 , h-300 , k-19 , lk1 ) , bd biosciences ( san diego , ca , usa ; clone 24/hsp60 ) , novus ( littleton , co , usa ; clone mab11 - 13 ) , lifespan ( seattle , wa , usa ; clone hspd1 ) , and thermo scientific ( rockford , il , usa ; clone 4b9/89 ) . isotype controls were from cell signalling , recombinant human hsp60 from loke aps diagnostics ( risskov , denmark ) , recombinant mouse and rat hsp60 from stressgen biotechnologies ( victoria , bc , canada ) , and recombinant hamster hsp60 from immpact biotechnologies gmbh ( hamburg , germany ) . for inhibition studies , the specific erk1/2 inhibitor ( pd98059 ) and the nfb inhibitor sn50 ( calbiochem , darmstadt , germany ) were used . for hsp60 binding studies , 0.5 10 c57bl/6j , nod , or nzo mouse - derived ( pre-)adipocytes were either directly incubated with fluorescent - labelled hsp60 ( 100 nm , hsp60 * ) ( 45 min , 4c ) or preincubated with a tenfold molar excess of unlabelled hsp60 from different species or ovalbumin ( ova , sigma - aldrich , steinheim , germany ) as described . for identification of hsp60 binding epitopes , hsp60 * ( 100 nm ) was preincubated with 025 g / ml of anti - hsp60 antibodies ( 45 min , 4c ) before application to ( pre-)adipocytes . after washing and fixation of the cells in 2% paraformaldehyde , hsp60 * binding was calculated from the geometric mean fluorescence after subtracting the autofluorescence as determined by analyses in a facs calibur flow cytometer ( bd biosciences ) . c57bl/6j , nod , and nzo mouse - derived ( pre-)adipocytes were exposed to medium or 120 g / ml recombinant human hsp60 ( enzo life sciences , lrrach , germany ) . after 24 h , the concentrations of the inflammatory mediators interleukin-6 ( il-6 ) , mouse chemokine cxcl-1 ( kc ) , and monocyte chemoattractant protein-1 ( mcp-1 ) were determined in the culture supernatants by multiplex - beads - systems ( luminex corp . , austin , tx , usa ) . to identify hsp60-activated signaling pathways , c57bl/6j , nod , and nzo mouse - derived ( pre-)adipocytes were seeded in 6 cm petri dishes ( 2 10 cells/5 ml medium ) . cells were treated with medium or hsp60 ( 10 g / ml ) ( 15 min , 37c ) and subsequently washed and treated with lysis - buffer ( 50 mm tris - hcl , 150 mm nacl , 1% np-40 , 0.25% na - desoxycholat ) including protease and phosphatase inhibitors ( roche , mannheim , germany ) ( 20 min , 4c ) . after centrifugation ( 15 min , 10,000 g , 4c ) cell lysates were subjected to sds - page ( 10% ) and appropriate antibodies for detection of activated signal proteins were applied for immunoblot analysis . signals were visualized by the lumi - imager system ( roche applied science , mannheim , germany ) . to analyse the effect of specific signal protein inhibitors on the hsp60-mediated secretion of inflammatory mediators , 1 10 c57bl/6j , nod , and nzo mouse - derived ( pre-)adipocytes were seeded in 1 ml per well of a 48 well plate and incubated ( 1 h , 37c ) either with medium ( control ) , erk1/2 inhibitor pd98059 ( 100 g / ml ) , or nfb inhibitor sn50 ( 50 g / ml ) . afterwards , cells remained unstimulated ( medium ) or were stimulated with hsp60 ( 10 g / ml ) for 24 h. supernatants were collected to determine the concentrations of il-6 , kc , and mcp-1 by multiplex - beads - assays . to characterize the interaction between hsp60 and primary ( pre-)adipocytes from c57bl/6j , nod , and nzo mice , we investigated the binding of fluorescent - labeled hsp60 ( hsp60 * , 100 nm ) to preadipocytes and in vitro differentiated , mature adipocytes of the three mouse strains . facs analyses demonstrated substantial binding of hsp60 to adipocyte populations of all mouse strains ( figures 1(a)1(f ) ) . comparison of the mean fluorescence signals revealed hsp60 binding intensities of preadipocytes from c57bl/6j , nod , and nzo mice within a range of geo means from 19 to 30 ( figure 1(g ) ) . among the adipocyte populations , nzo mouse - derived adipocytes revealed maximum hsp60 binding ( geo mean 38.0 10.7 ) . the specificity of hsp60-(pre-)adipocyte interaction was proven by inhibition of hsp60 * binding to cells preincubated with excess unlabelled hsp60 ( 1000 nm ) to 23.1 2.7% ( c57bl/6j ) , 20.4 1.9% ( nod ) , and 28.7 2.5% ( nzo ) ( p < 0.05 ) ( figure 1(h ) ) . the extent of inhibition of hsp60 binding to mature adipocytes was only marginally lower than that observed for preadipocytes . based on our previous observation that different eukaryotic hsp60 species recognize the same receptor structure(s ) on cells of the murine adipocyte line 3t3-l1 , we investigated the effect of eukaryotic ( human , mouse , rat , and hamster ) and prokaryotic hsp60 species ( e. coli , m. bovis ) on the binding of human hsp60 to primary c57bl/6j , nod , and nzo mouse - derived ( pre-)adipocytes . strong inhibition of hsp60 * binding to preadipocytes was observed after preincubation of hsp60 * with the mammalian hsp60 species ( figure 2 ) . preincubation with human hsp60 induced maximum inhibitory effects by reducing hsp60 * binding to preadipocytes from the three mouse strains to 28.9 14.5% ( c57bl/6j ) , 33.9 18.4% ( nod ) , and 34.1 17.4% ( nzo ) . except for groel - mediated inhibition of hsp60 * binding to c57bl/6j mouse - derived preadipocytes , preincubation with prokaryotic hsp60 species did not significantly affect hsp60 * binding to preadipocyte populations ( figure 2 ) . for primary , in vitro differentiated adipocytes comparable results were obtained ( data not shown ) . our further experiments focused on the identification of the hsp60 epitope(s ) potentially involved in the interaction of the stress protein with ( pre-)adipocytes . in an initial approach , we investigated the effect of antibodies against distinct regions of the hsp60 molecule , on the binding of hsp60 to c57bl/6j , and nod mouse - derived preadipocytes . facs analyses revealed largely comparable patterns of antibody - mediated inhibition of hsp60 binding to preadipocyte populations of both mouse strains ( table 1 ) . preincubation of the cells with antibodies against the n - terminal ( aa1 - 50 ( clone h1 ) , aa1 - 200 ( clone 24/hsp60 ) ) , and c - terminal ( aa523 - 573 ( clone k19 ) ) regions of the hsp60 molecule resulted in strongest reduction of hsp60 binding to 25.5 0.6% . subsequently , we preincubated fluorescent - labeled hsp60 with increasing concentrations ( 025 g / ml ) of the antibodies initially found to inhibit hsp60 binding ( clones h1 , 24/hsp60 , k-19 ( table 1 ) ) prior addition to ( pre-)adipocytes from c57bl/6j , nod , or nzo mice ( figure 3 ) . in c57bl/6j mouse - derived preadipocytes , hsp60 binding was reduced dose - dependently to 51.2 9.1% by the application of the antibody clone h-1 ( aa1 - 50 , 25 g / ml ) and to 28.0 2.6% by applying antibody clone 24/hsp60 ( aa1 - 200 , 25 g / ml ) . in contrast , clone k-19 ( aa523 - 573 ) did not induce clear dose - dependent inhibition of hsp60 binding . comparable inhibitory effects were obtained for preadipocytes from nod and nzo mice . clone h-1 ( aa1 - 50 ) reduced hsp60 binding to 38.2 12.5% ( nod ) and to 47.0 2.9% ( nzo ) ; clone 24/hsp60 ( aa1 - 200 ) reduced hsp60 binding to 23.3 4.9% and to 18.6 3.5% in nod and nzo mouse - derived cells , respectively . as in c57bl/6j preadipocytes , no clear dose - dependent effects were observed for nod and nzo mouse - derived preadipocytes preincubated with the antibody against the c - terminal region of hsp60 ( clone k-19 , aa523 - 573 ) . in binding studies with mature adipocytes , to compare adipocyte populations from different mouse models of diabetes for their ability to release inflammatory mediators , we investigated the accumulation of kc , il-6 , and mcp-1 in cultures of ( pre-)adipocytes derived from c57bl/6j , nod , and nzo mice ( figure 4 ) . unstimulated cells of the three mouse strains spontaneously accumulated substantial amounts of most of the mediators in their supernatants ( figures 4(a ) and 4(b ) ) . independent of the mouse strain , preadipocyte and adipocyte populations released kc in a concentration range of 4.312.9 ng / ml and mcp-1 in a range of 13.327.1 ng / ml . the amounts of il-6 released from c57bl/6j and nod mouse - derived ( pre-)adipocytes were in a range of 0.79.8 ng / ml , whereas ( pre-)adipocytes from nzo mice released exceptionally low levels of the cytokine ( 0.7 0.3 ng / ml and 0.9 0.3 ng / ml il-6 , resp . ) exposure of the ( pre-)adipocyte populations to rising hsp60 concentrations ( 120 g / ml ) for 24 h caused a dose - dependent increase of the secretion of kc , il-6 , and mcp-1 in a cell type- and mouse strain - specific manner ( figures 4(c)4(h ) ) . however , whereas the cytokine release from nod mouse - derived cell populations largely resembled the pattern of c57bl/6j mouse - derived cells , adipocyte populations from nzo mice showed an enhanced release of kc and il-6 . in particular , a strong , 3.9 0.2-fold increase of kc release from nzo mouse - derived adipocytes was observed when compared to adipocytes from c57bl/6j ( 1.7 0.2-fold increase , p < 0.05 ) ) and from nod mice ( 2.4 0.7-fold increase ) ( figure 4(d ) ) . moreover , the release of il-6 induced by hsp60 ( 20 g / ml ) was strikingly increased from nzo mouse - derived preadipocytes ( 7.7 1.0-fold ) and adipocytes ( 19.1 4.0-fold ) when compared to the corresponding cell populations of c57bl/6j and nod mice ( p < 0.05 ) ( figures 4(e ) and 4(f ) ) . we further investigated the effect of hsp60 on the stimulation of proinflammatory signaling pathways by analyzing the activation ( phosphorylation ) of members of the map kinase family ( erk1/2 , jnk(p46 ) , p38 ) and of the transcription factor nfb in ( pre-)adipocytes of c57bl/6j , nod , and nzo mice ( figure 5 ) . hsp60 treatment did not activate erk1/2 , jnk(p46 ) , and p38 in preadipocytes of the three mouse strains ( figure 5(a ) ) . on the other hand , nfb activation was increased to a similar degree in nod and nzo mouse - derived preadipocytes ( 2.6 0.2-fold and 2.6 0.5-fold , resp . ) ( p < 0.05 ) but not in c57bl/6j mouse - derived cells . in contrast to the hsp60 effects observed in preadipocytes , hsp60 exposure of mature adipocytes increased the activation of erk1/2 ( 2.1 0.2-fold , p < 0.01 ) and nfb ( 3.5 0.2-fold , p < 0.01 ) in c57bl/6j mouse - derived cells , whereas in cells from the diabetes predisposed mouse strains , hsp60-induced activation of the investigated pathways was only moderate or low ( < 2-fold ) ( figure 5(b ) ) . these results show that hsp60 preferentially controls erk1/2- and nfb - dependent pathways in a differential manner depending on the maturation state of the adipocytes and on the donor mouse strain . we therefore focused our further analyses on the involvement of erk1/2 and nfb in hsp60-induced cytokine release by the use of specific inhibitors of the signaling molecules . exposure of adipocytes of c57bl/6j and nod mice to the erk1/2-inhibitor pd98059 reduced the hsp60-induced release of il-6 , kc , and mcp-1 to 16 to 67% ( p < 0.05 ) of the levels detectable in cultures treated with hsp60 alone ( figures 6(a ) , 6(c ) , and 6(e ) ) . however , in nzo mouse - derived adipocytes , the hsp60-induced cytokine pattern showed a differential response to erk1/2 inhibition , whereas in the presence of pd98059 , the formation of il-6 remained largely unaffected ( relative il-6 secretion 89.7 10.9% ) ( figure 6(a ) ) , the residual kc formation was in the range of the levels detected in c57bl/6j and nod mouse derived cells ( 48.7 3.8% , p < 0.001 ) ( figure 6(c ) ) and the release of mcp-1 was strongly reduced to 28.7 9.1% ( p < 0.001 ) ( figure 6(e ) ) . inhibition of nfb by sn50 resulted in the reduction of cytokine release in a similar range in cultures of ( pre-)adipocytes from c57bl/6j and nod mice ( 2970% ) ( p < 0.01 ) ( figures 6(b ) , 6(d ) , and 6(f ) ) . the strongest inhibition of hsp60-induced il-6 , kc , and mcp-1 release was found in sn50-exposed ( pre-)adipocytes from nzo mice . in nzo mouse - derived preadipocytes , the nfb inhibitor significantly reduced il-6 release to 3.0 2.1% , kc release to 15.0 4.7% , and mcp-1 release to 5.1 3.6% ( p < 0.001 ) of the cytokine levels measured in the absence of the inhibitor . in adipocytes , nfb inhibition reduced il-6 release to less than 0.1% , kc release to 19.7 9.8% , and mcp-1 release to 26.3 9.1% ( p < 0.001 ) . previous observations suggest an essential contribution of obesity - associated inflammatory processes to the development of type 2 diabetes [ 10 , 11 ] as well as type 1 diabetes . further studies , based on the finding of the strong immunomodulatory capacity of adipocytes , identified the stress protein hsp60 as a potent inductor of proinflammatory mediators from murine and human adipocytes [ 21 , 31 ] . these findings implicate that hsp60-induced adipocyte mediators promote the development of obesity- and diabetes - associated inflammatory processes and further raise the question whether adipocytes from diabetes - prone subjects exhibit an aberrant reactivity to the stress protein . to address this issue , we examined the effect of hsp60 on adipocyte populations derived from the currently best characterized animal models of the two prevailing forms of human diabetes . diabetes observed in the nod mouse reflects major features of human type 1 diabetes [ 32 , 33 ] , whereas the metabolic abnormalities developing in the nzo mouse largely resemble the dysregulations of energy metabolism and glucose homeostasis associated with human type 2 diabetes . as reference , adipocytes from the metabolically healthy mouse strain c57bl/6j were used . for our studies , we selected adipocyte populations isolated from the visceral fat depot as adipose tissue from this anatomical location had been identified as a major source of mediators responsible for diabetes - associated metabolic and immunologic disorders [ 36 , 37 ] . as previous reports indicate that the functional properties of adipocytes depend on their maturation state [ 38 , 39 ] , we investigated hsp60 effects on preadipocytes as well as terminally differentiated adipocytes . our approach focused on the decisive steps assumed to be involved in hsp60-mediated inflammatory adipocyte activation : ( 1 ) the binding of hsp60 to adipocytes regarded as the primary event in hsp60-adipocyte interaction , ( 2 ) the activation of intracellular signaling pathways , and ( 3 ) the resulting release of inflammatory mediators which may act as signaling molecules in an autocrine manner and/or in the attraction and stimulation of immune cells . initial comparative facs studies with fluorescent - labeled hsp60 revealed that preadipocytes and mature adipocytes of all investigated mouse strains are able to bind hsp60 . binding of the stress protein was highly specific as demonstrated by efficient inhibition after preincubation of the cells with unlabelled hsp60 . interestingly , the observed characteristics of hsp60-(pre-)adipocyte interaction showed striking similarities with hsp60 binding by macrophages which was investigated in more detail in previous studies [ 40 , 41 ] . further studies revealed that the receptor structure for hsp60 acts in a stereospecific manner , includes at least two functionally different components engaged in binding and signal transduction , differs from receptors for other heat shock proteins , and triggers endocytosis of its bound ligand . considering the observed similarities in hsp60 binding to ( pre-)adipocytes and macrophages and in view of the close relationship between cells of the adipocyte and macrophage lineages , it may be concluded that hsp60 binding to adipocytes is mediated by similar receptor - mediated mechanisms as the above mentioned mechanisms described for macrophages . interestingly , although efficient hsp60 binding to adipocytes of all three mouse strains was observed , we found strongly enhanced binding of the stress protein to mature nzo mouse - derived adipocytes when compared to cells from c57bl/6j ( and nod ) mice of the same maturation state . this finding may be of special importance in view of the fact that nzo mice are characterized by an increased body fat mass which most likely includes a large proportion of terminally differentiated adipocytes . in more detailed studies , we attempted to identify hsp60 epitopes involved in the interaction of the stress protein with ( pre-)adipocytes . competition experiments with various hsp60 species and with inhibitory antibodies directed against defined hsp60 epitopes revealed that eukaryotic hsp60 molecules bind to ( pre-)adipocytes via highly conserved aminoacid sequences within the n - terminal region . collectively , our studies on hsp60-(pre-)adipocyte interaction demonstrate efficient hsp60-binding to primary nod mouse - derived adipocytes , thereby extending our previous observations of specific hsp60 interaction with adipocytes from nzo mice and with cells of the murine adipocyte line 3t3-l1 . hence , our findings provide further evidence for the assumption that the ability to bind hsp60 represents a general property of murine adipocytes irrespective of their origin and differentiation state . nevertheless , further extensive biochemical studies will be necessary to gain further insight into the structural and functional properties of the hsp60 receptor structure on ( pre-)adipocytes . previous studies identified stress proteins as potent inducers of intracellular signaling pathways . we therefore investigated the effects of hsp60 on the activation of the map kinases erk1/2 , jnk , and p38 and of the transcription factor nfb which are preferentially activated by stress signals but are also essential for the coordination of adipocyte differentiation [ 4446 ] . due to the marked interdependence of signaling and differentiation pathways , we hypothesized that the response of the adipocyte populations depends on the maturation state of the cells . in fact , hsp60 exposure induced increased erk1/2 activation in ( mature ) adipocytes from normal control c57bl/6j mice and enhanced activation of erk1/2 and p38 in adipocytes from nod mice . with regard to nfb , we found an elevated activation of the transcription factor in preadipocytes from diabetes - prone nod and nzo mice but reduced activation in mature adipocytes of the two mouse strains , when compared to the reactivity of cell populations from normal control c57bl/6j mice . as nfb represents an important transcriptional regulator of inflammatory mediators , our findings implicate that preadipocytes of nod and nzo mice exhibit an increased hsp60 responsiveness that might contribute to diabetes - promoting proinflammatory processes in these animals which are genetically predisposed to develop diabetes . collectively , our findings implicate that the hsp60-induced activation of intracellular signaling pathways in adipocytes not only depends on the differentiation state of the cells but also on the donor mouse strain . our observations particularly suggest that aberrant intracellular signaling and disturbed transcriptional regulation in adipocytes enhance diabetes - promoting inflammatory reactivity in animals with a genetic predisposition to develop diabetes . in fact , previous studies demonstrated aberrant activation of map kinases , including p38 , [ 48 , 49 ] and a dysregulation of transcription factors , including nfb [ 5052 ] in diabetes - prone mouse strains . although these findings are mainly derived from macrophages , they obviously reflect intrinsic disturbances of signaling and transcriptional processes in diabetes prone nod and nzo mice that may contribute to the aberrant activation of map kinases and nfb observed in hsp60-exposed ( pre-)adipocytes of these animals . further studies on the elucidation of the intracellular signaling cascade triggered by stress signals ( will ) have to consider the complex situation that most components of the stress response pathways are also critical for the control of adipocyte differentiation [ 45 , 5052 ] . the release of proinflammatory adipocyte mediators induced by hsp60 and the intracellular signaling pathways engaged in this process were further analyzed by focusing on the formation of kc , il-6 , and mcp-1 which had been identified as prominent factors released by adipocytes and are supposed to contribute to obesity - associated inflammatory processes [ 5355 ] . unstimulated preadipocytes and adipocytes of c57bl/6j , nod , and nzo mice released substantial amounts of these mediators , with the exception of nzo mouse - derived adipocyte populations which released markedly low amounts of il-6 . hsp60 , applied at concentrations that largely correspond to the levels found in individuals suffering from cardiovascular and arthritic disorders [ 56 , 57 ] , dose - dependently increased the release of kc , il-6 , and mcp-1 by preadipocytes and adipocytes from the three mouse strains . these results extend our initial observations on the pronounced hsp60 responsiveness of adipocytes of a murine cell line and of nzo mice [ 21 , 22 ] and further support the view that the capacity to release proinflammatory mediators in response to hsp60 reflects a common feature of adipocytes . however , with regard to the release of il-6 , inducibility by hsp60 was strikingly higher in nzo mouse - derived adipocyte populations than in cells from c57bl/6j and nod mice . the potential impact of the donor mouse strain on map kinase - dependent signaling and transcriptional regulation in the hsp60-induced formation of inflammatory adipocyte mediators was further elucidated by selective inhibition of the signaling molecules . blocking of signaling pathways by specific inhibitors [ 58 , 59 ] confirmed the involvement of erk1/2 and nfb in the hsp60-induced release of adipocyte mediators . unexpectedly , the experiments revealed strong differences between the reactivities of adipocyte populations from the two diabetes - predisposed mouse strains . after erk1/2 or nfb inhibition , the reactivity pattern of nod mouse - derived cells largely resembled the pattern of cells from normal control c57bl/6j mice . however , in adipocyte populations of nzo mice , erk1/2 dependency was low for il-6 production , intermediate for kc production , and high for mcp-1 production when compared to c57bl/6j and nod mouse - derived cells . moreover , nfb suppression caused strongest inhibition of 7598% in cultures of nzo mouse - derived cells pointing to a dominant role of nfb in the formation of proinflammatory mediators from hsp60-exposed adipocytes in this mouse strain . this finding appears to be in discrepancy with our above - mentioned results demonstrating that nod and nzo mouse - derived adipocytes show largely comparable activation levels of map kinases and nfb after hsp60 exposure . these contrasting observations obviously reflect strain - specific differences in the preferential usage of intracellular pathways of signaling and transcriptional regulation ( other than nfb - dependent ) to induce the formation of inflammatory mediators in response to hsp60 . this assumption is supported by the finding of aberrant activation of intracellular signaling pathways in diabetes - prone mouse strains [ 49 , 51 , 52 ] . furthermore , the promoter regions of many genes encoding inflammatory mediators ( e.g , il-6 , mcp-1 ) also have binding sites for other transcription factors including activator protein 1 and members of the ccaat - enhancer binding protein family [ 6062 ] . it might be speculated that these factors could be used alternatively to nfb in the induction of proinflammatory adipocyte mediators in different mouse strains , depending , for example , on their genetic predisposition to develop a specific form of diabetes . taken together , our observations in c57bl/6j , nod , and nzo mouse - derived adipocyte populations indicate that the basic structural requirements , such as receptor structure(s ) and hsp60 binding epitopes , involved in the initial recognition of the stress protein , share a high degree of similarity , and irrespective of the donor and of the differentiation state of the cells . however , clear differences between the mouse strains were found regarding the efficiency of hsp60 binding , the patterns of intracellular signaling pathways activated by hsp60 , and the resulting release of inflammatory mediators . these findings warrant further extensive studies for the detailed elucidation of mouse strain dependency and the roles of intracellular signaling pathways in hsp60-induced adipocyte stimulation . nod mice typically exhibit a lean constitution and , accordingly , a low number of ( mature ) adipocytes . moreover , the hsp60 responsiveness of nod mouse - derived adipocytes largely corresponds to the reactivity of adipocytes of normal healthy c57bl/6j mice . based on these considerations , it may be concluded that in nod mice , hsp60-induced proinflammatory adipocyte activities do not play a decisive role in the progression of ( insulin deficient ) diabetes . in nzo mice , however , improved hsp60 binding and dysregulation of il-6 formation reflect an increased proinflammatory reactivity , preferably of mature adipocytes . in addition , the pathological increase of the adipose tissue mass by adipocyte - hyperplasia and proliferation inevitably leads to an elevated number of ( mature ) adipocytes in these mice . as a result , the enhanced release of chemotactic and stimulatory adipocyte mediators may contribute not only to the acceleration of immune cell infiltration into the adipose tissue but also to an elevation of systemic inflammatory mediators which may aggravate peripheral insulin resistance , thereby promoting the progression of metabolic dysregulation and diabetes . moreover , during the development of obesity , the expanding adipose tissue itself may create an increasingly stressful environment in which infiltrating immune cells ( e.g , macrophages ) and adipocytes themselves may become relevant sources of hsp60 and other stress signals .

adipocytes release immune mediators that contribute to diabetes - associated inflammatory processes . as the stress protein heat shock protein 60 ( hsp60 ) induces proinflammatory adipocyte activities , we hypothesized that adipocytes of diabetes - predisposed mice exhibit an increased proinflammatory reactivity to hsp60 . preadipocytes and mature adipocytes from nonobese diabetic ( nod ) , new zealand obese ( nzo ) , and c57bl/6j mice were analyzed for hsp60 binding , hsp60-activated signaling pathways , and hsp60-induced release of the chemokine cxcl-1 ( kc ) , interleukin 6 ( il-6 ) , and macrophage chemoattractant protein-1 ( mcp-1 ) . hsp60 showed specific binding to ( pre-)adipocytes of nod , nzo , and c57bl/6j mice . hsp60 binding involved conserved binding structure(s ) and hsp60 epitopes and was strongest to nzo mouse - derived mature adipocytes . hsp60 exposure induced kc , il-6 , and mcp-1 release from ( pre-)adipocytes of all mouse strains with a pronounced increase of il-6 release from nzo mouse - derived adipocytes . compared to nod and c57bl/6j mouse derived cells , hsp60-induced formation of il-6 , kc , and mcp-1 from nzo mouse - derived ( pre-)adipocytes strongly depended on nfb - activation . increased hsp60 binding and hsp60-induced il-6 release by mature adipocytes of nzo mice suggest that enhanced adipocyte reactivity to the stress signal hsp60 contributes to inflammatory processes underlying diabetes associated with obesity and insulin resistance .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the human cornea is the main refractive surface focusing light into the eye , so its transparency is critical for vision . globally , approximately 4.9 million individuals have bilateral cornea blindness , while 23 million are unilaterally cornea blind.1 donor tissue transplantation is the only widely accepted treatment but the need for donor corneas exceeds the supply and the gap only increases as the population ages . recent advances in corneal transplantation techniques with a shift from penetrating to safer lamellar procedures and wide application of limbal epithelial stem cell transplantation , have resulted in improved outcomes , and have expanded the number of cases of corneal blindness that can now be treated successfully.2 however , patients with severe pathologies ( e.g. , chemical burns , previously rejected grafts , autoimmune disease , and infections ) still have a high risk of rejection and failure , often needing multiple surgeries.38 corneal prostheses are available , but they remain mainly for end - stage disease and even if implanted as primary procedure they often are accompanied by vision - threatening complications,1,9 leaving an unmet need for a de novo solution for high - risk patients . in ukraine , as in many countries , there is a severe shortage of donor corneas . the annual need in 2010 was 4000 grafts , but only 511 corneal transplantations were performed due to the lack of donated tissues . fifty - four percent of these transplantations were performed for tectonic purposes due to the increasing number of infections and injuries.10 to solve the problems of lack of donor tissues as well as the high risk of rejection of allografted corneas , we had developed corneal implants made from interpenetrating networks of cross - linked recombinant human collagen type iii ( rhciii ) and 2-methacryloyloxyethyl phosphorylcholine ( mpc ) , a synthetic phospholipid11 ( figure 1 ) . mpc - polymer has antifouling properties and has been fda approved as a polymer coating in vascular stents.12 here , it was incorporated into rhciii to prevent neovascularization . schematic diagram showing the combination of recombinant human collagen type iii ( rhciii ) and 2-methacryloyloxyethyl phosphorylcholine ( mpc ) to form interpenetrating networks of rhciii - mpc . the rhciii and mpc were mixed together in a syringe , while the final hydrogel was molded into an implant . an image of vladimir filatov , pioneer of human donor cornea grafting , can be seen through the transparent implant . we previously tested implants comprising rhciii alone as substitutes for donor corneas in a phase 1 clinical study , where they promoted good tissue integration with stable regeneration of corneal epithelium , stroma and nerves , restoration of corneal reflex better than allograft ( p = 0.04 ) , maintenance of transparency in cornea and no tissue rejection reported on 4-year follow - up , in the absence of long - term steroid immunosuppression beyond week 7 postimplantation , in patients with keratoconus or central scarring , i.e. , low - risk patients,13 like donor corneas , however , rhciii only implants became neovascularized when grafted into a model of severe pathology , the alkali - burned rabbit cornea.14 incorporation of mpc into rhciii , on the other hand , yielded implants that repelled blood vessels14 while allowing regeneration.15,16 here , we report our initial experience with rhciii - mpc implants into three patients for whom donor cornea grafting carried a high risk of rejection . the primary aim of this early investigation was to assess the safety of such an approach . the secondary aim was to test the feasibility of restoring the integrity of the cornea . this study was performed in accordance to the declaration of helsinki convention of the council of europe on human rights and biomedicine , relevant laws of ukraine , and after approval by the bioethics commission of the filatov institute of eye diseases and tissue therapy of the national academy of medical sciences of ukraine and trial registration ( registered eudract no . 2013 - 002442 - 37 ) . after providing written informed consent , each patient was grafted with a rhciii - mpc implant consisting of rhciii ( 8% wt / vol ; from fibrogen , inc , san francisco , usa),17 mpc ( 4% wt / vol ) and poly(ethylene glycol ) diacrylate ( 1.37% wt / vol)11 by anterior lamellar corneal transplantation . patient 1 , an 80-year - old male , suffered an alkali burn to his right eye resulting in a persistent corneal ulcer resistant to conventional medical treatment and bandage contact lens wear . he suffered from pain , tearing , and photophobia due to the inability of the corneal epithelium to stably adhere to the underlying damaged and vascularized stroma . patient 1 s best corrected visual acuity ( bcva ) was 6/600 , i.e. , near blindness . patient 2 was a 72-year - old female with a previously rejected penetrating human cornea graft in her left eye , which was combined with cataract extraction and intraocular lens ( iol ) implantation . she suffered from corneal ulceration , which was unresponsive to medical treatment and bandage contact lens wear , and had the same symptoms as patient 1 , with only light perception , i.e. , effectively blind . patient 3 was a 52-year - old male who suffered from recurrent corneal erosions following an acid burn . his symptoms were similar to those of the other two patients . during the chronic stage of the burn , he received excimer laser phototherapeutic keratectomy and a human amniotic membrane ( ham ) graft for ocular surface healing . he has also had a cataract phacoemulsification and was implanted with an iol one year after the injury . all three patients needed surgery to treat the ulceration , restore corneal integrity , alleviate the associated pain and discomfort , and to improve vision . based on literature review all were considered high - risk patients for limbal epithelial graft rejection as well as penetrating or lamellar cornea graft rejection and failure . each patient s pathologic cornea was initially cut with a 45-mm - diameter trephine ( depending on lesion diameter ) to remove the lesioned area with a small epithelialized margin around it . the incision was then deepened with a diamond knife set to a depth of 250 or 350 m ( depending on lesion depth ) . a trephine of the same diameter was used to cut the biosynthetic implant of corresponding thickness . once in place , the implant was anchored with three to four overlying 100 nylon mattress sutures to avoid puncturing the implant material . alcon - couvreur n.v . , puurs , belgium ) , a short - term mydriatic ( cyclopentolate 1% , sentiss pharma pvt . ltd . , gurgaon , india ) and a nonsteroidal anti - inflammatory drug ( indomethacin 0.1% , bausch + lomb gmbh , dr . this was followed by a topical antiseptic ( chlorhexidine bigluconate 0.02% , farmacia , lugansk , ukraine ) and a steroid ( dexamethasone 0.1% , s.a . the patients wore 14-mm bandage contact lenses containing 36% water ( bausch & lomb purevision ) until epithelial regeneration was complete . patients were assessed at 1 , 3 , 6 , 9 , and 12 months postoperatively or as determined required by the physician . clinical assessment performed included slit - lamp biomicroscopy to check for signs of inflammation or infection , a fluorescein staining test to confirm epithelial integrity , corneal surface sensitivity assessment ( cochet bonnet esthesiometer , luneau ophthalmologie , france ) , best corrected visual acuity measurement , transpalpebral tonometry to measure intraocular pressure without damaging the epithelium ( diaton , ryazan state instrument - making enterprise , russia ) , ultrasound pachymetry ( sp-100 , tomey , japan ) and in vivo confocal microscopy ( confoscan4 , nidek , japan ) . all implants had similar optical properties to healthy human corneas . while they were mechanically weaker than human donor corneas , they were nevertheless robust enough to withstand the handling and grafting procedure . properties of rhciii - mpc hydrogels used as corneal implants doutch j , quantock aj , smith va , meek km . light transmission in the human cornea as a function of position across the ocular surface : theoretical and experimental aspects . zeng y , yang j , huang k , lee z , lee x. a comparison of biomechanical properties between human and porcine cornea . j biomech . crabb ra , chau ep , evans mc , barocas vh , hubel a. biomechanical and microstructural characteristics of a collagen film - based corneal stroma equivalent . merrett k , fagerholm p , mclaughlin cr , dravida s , lagali n , shinozaki n , watsky ma , munger r , kato y , li f , marmo cj , griffith m. tissue - engineered recombinant human collagen - based corneal substitutes for implantation : performance of type i versus type iii collagen . invest ophthalmol vis sci . 2008 ; 49 : 38873894 . epithelial coverage of the initially cell - free implants took on average 6 weeks ( table2 , figure 2 ) . all three implants remained free of neovascularization or epithelial erosions over the 912 months postoperation follow - up period . however , conjunctival epithelium invaded the implant surface in patient 3 , due to limbal stem cell deficiency ( figure 2 ) . there was no stromal edema , no prolonged inflammation nor any infection in any patient . touch sensitivity increased after surgery in all patients although not to the level of normal human corneas ( figure 3 ) . after the mild deturgescence of the edema that always accompanies corneal ulceration , the corneal thickness remained stable throughout the follow - ups . signs of punctate precipitate and haze appeared at the posterior surface of the implant during the third postoperative week in all cases , but resolved after two weeks of treatment with topical steroids . visual acuity improved in patients 1 and 2 from near blindness ( 6/600 and lp ) to moderate ( 6/38 ) and severe ( 6/75 ) vision loss , respectively , allowing for restricted function with enhancing aids . patient 3 , who had conjunctivalization of corneal surface , showed no change in vision but no longer had recurrent painful erosions seen preoperatively , suggesting that rhciii - mpc implants could stabilize the corneal surface pending further treatment , e.g. , limbal stem cell grafting to improve vision . implants remained stably incorporated without immunosuppression beyond the 6-week course of prophylactic anti - inflammatory medication . details of implanted patients showing their biometrics , diagnosis , treatment , and results cu = corneal ulcer ; rce = recurrent corneal erosion ; acb = acid burn ; alkb = alkali burn ; ptk = phototherapeutic keratectomy ; ce = cataract extraction ; iol = intraocular lens implantation ; phaco = cataract phacoemulsification ; ham = human amniotic membrane transplantation ; pk = penetrating keratoplasty ; lp = light perception . bcva = best corrected visual acuity ( lp , 6/6006/375 : near blindness ; 6/3006/150 : profound vision loss ; 6/1206/60 : severe vision loss : 6/486/24 : moderate vision loss ; 6/196/9.5 : mild vision loss ; 6/7.56/3.8 : normal range of vision ) . corneas of all three patients before and after implantation with tectonic grafts of rhciii - mpc . the green fluorescein staining delineates the large area of eroded epithelium . at 12 months postoperation , patient 2 had a failed 8.5-mm - diameter graft with a persistent ulcer and dense stromal opacification in the visual zone prior to surgery . a small 4-mm implant was grafted into the ulcerated area of the failed graft ( arrowhead ) and has remained relatively clear after 12 months . patient 3 had an opacity with an unstable epithelial surface and vascularized stroma prior to surgery . at 9 months postoperation , while the implant remained clear , the ingrowing conjunctiva has left the surface hazy . restoration of touch sensitivity after grafting with rhciii - mpc implants as an indication of nerve function restoration . central corneal touch sensitivity was assessed by contact esthesiometry in the patients corneas before and after implantation , with the nonoperated , contralateral eyes serving as controls . measurements were obtained using a cochet bonnet esthesiometer with a monofilament , where an increase in filament length ( mm ) corresponds to an increase in touch sensitivity ( n = 3 patients ) . in vivo confocal microscopy of the regenerated neo - cornea of patient 1 showed a regenerated epithelium ( figure 4a ) , which resembled that of a healthy cornea ( figure 4b ) . stromal cells were not clearly seen due to corneal haze , but they appear to have started populating the initially cell - free implant ( figure 4c ) but have not reached the steady state seen in a healthy cornea ( figure 4d ) . confocal microscopy through an implanted cornea at 12 months postoperation showing regenerated patient epithelium ( a ) that resembles that of a healthy cornea ( b ) . stromal cells have grown into the initially cell - free graft , although partially obscured by haze ( c ) , unlike the healthy cornea where the cells are clearly visible ( d ) . the preserved patient endothelium ( e ) has a number of larger sized cells but also endothelial cells that resemble those of a healthy cornea ( f ) . in many countries , such as ukraine , china , south east asia , and india , corneal blindness is a huge problem . in addition to the severe shortage in donated corneas,10 many patients suffer from severe pathologies that have a high risk of graft rejection or failure . poor outcomes of corneal transplantation are likely due to graft rejection and stem cell deficiency . graft rejection is directed at allogenic cells from donor human corneas.18 this is circumvented by cell - free rhciii - based corneal implants . the rhciii replaces the largely collagenous stroma of the native cornea allowing for repopulation by endogenous host corneal cells , as we had previously reported in low - risk patients.13 we have previously shown that the rhciii - mpc implants are composed of lamellae - like layers that are interconnected with fiber - like structures that crudely mimics the structure of the human cornea.11 furthermore , the coefficients of glucose and albumin diffusion through these hydrogels were comparable to that of the human cornea.15 additionally , mpc polymer has reported anti - inflammatory properties,19,20 possibly accounting for the capacity of rhciii - mpc implants to quiesce the immunopathologic corneas , allowing stable restoration of the ocular surface . corneal epithelial limbal stem cell transplantation , which is available in large urban centers in the developed world , is too cost prohibitive for the healthcare systems in many countries such as ukraine , as it requires specialized , certified clean rooms and staffing to expand the cultures , plus time for harvesting through cultivation of cells . in addition , where the damage to the cornea extends below the epithelium , the patients require a subsequent donor graft . in this case , a grafted rhciii - mpc implant can allow for healing of the epithelium and stroma , providing relief from pain and discomfort for patients and allowing for a future limbal epithelial graft as the second step in the treatment . in this initial observational study , small grafts of 45 mm were used to replace the lesioned area with a minimal margin of healthy tissue . the rationale for this was patient safety , i.e. , in case of a serious adverse device effect , the implant can be removed and replaced with a larger human donor cornea graft by deep lamellar keratoplasty , the current conventional treatment . following corneal wounding , overexpression of unaligned , mainly type iii collagen occurs to form a scar.21 bridging the wound gap with rhciii - mpc implants that have a regular lamellar structure,11 however , appears to provide a template for more controlled in - growth of stromal cells that in turn provides for an optically clear regenerated cornea . nonetheless , in patients with limbal epithelial stem cell deficiency , transplantation with corneal epithelial stem cells in conjunction with an implant will be needed to prevent conjunctival in - growth that decreases optical clarity . we have shown that under conditions that render standard of care suboptimal , e.g. , ukraine due to its on - going crisis , making the situation approach that in much of the developing world,22 rhciii implants have the potential to overcome the cornea supply shortage in various regions in the world , and avoid social and religious stigma some may have with allograft corneas . furthermore , rhciii - mpc implants may be an alternative to donor corneas and possibly a superior substitute in high - risk cases for restoring corneal integrity . despite of the limitations of this preliminary case study such as the very small sample population and relatively short followup of 912 months , our initial results nevertheless suggest that bioengineered rhciii - mpc implants may potentially be more efficacious alternatives to donor tissues in repairing corneas with severe pathologies . therefore , further clinical evaluation in form of a clinical study with high - risk patients is merited to determine their safety and full potential as alternatives to donor human cornea transplantation .

corneas with severe pathologies have a high risk of rejection when conventionally grafted with human donor tissues . in this early observational study , we grafted bioengineered corneal implants made from recombinant human collagen and synthetic phosphorylcholine polymer into three patients for whom donor cornea transplantation carried a high risk of transplant failure . these patients suffered from corneal ulcers and recurrent erosions preoperatively . the implants provided relief from pain and discomfort , restored corneal integrity by promoting endogenous regeneration of corneal tissues , and improved vision in two of three patients . such implants could in the future be alternatives to donor corneas for high - risk patients , and therefore , merits further testing in a clinical trial .

Introduction Methods Results Discussion Conclusion

transthyretin familial amyloid polyneuropathy ( ttrfap ) is an autosomaldominant , adultonset disorder associated with over 100 different mutations in the transthyretin ( ttr ) gene that cause transthyretin protein to deposit as amyloid in peripheral and autonomic nerves , heart , gastrointestinal ( gi ) tract , kidneys , eyes , and connective tissue of the transversal carpal ligament ( ando et al . , 2013 ; rowczenio et al . , 2014 ; sekijima , 2015 ) . this results in progressive organ dysfunction and death within an average of 10 years ( ando et al . , 2013 ) . ttrfap is a highly heterogeneous disease associated with a wide range of clinical manifestations that may present in varying degrees and combinations ( ando et al . , 2013 ; sekijima , 2015 ) . the disease can be difficult to recognize due to its variable clinical presentation and nonspecific symptoms . the age of onset ranges from the second to ninth decade of life ( ando et al . , 2013 ) , and incomplete penetrance of clinical disease can lead to sporadic cases without known affected relatives . accurate diagnosis of ttrfap is often delayed for years ( plantbordeneuve et al . , 2007 ; koike et al . , 2011 ; an accurate diagnosis is important to permit effective disease management , as tissue damage is largely irreversible , and available treatment options are most beneficial in early disease stages ( coelho et al . , 2013 ; plantbordeneuve , 2014 ; ericzon et al . , 2015 a particular challenge in making a diagnosis is that clinical manifestations are not necessarily uniform among carriers of the same ttr mutation and can vary even within the same family ( ando et al . , 2013 ) . the clinical phenotype is also influenced by genetic , epigenetic , or environmental factors other than the ttr mutation ( see table 1 ) . gi , gastrointestinal ; ttrfap , transthyretin familial amyloid polyneuropathy ; sd , standard deviation . urinary retention might be underdiagnosed as patients are usually not aware or cognisant of symptoms . lengthdependent peripheral sensorymotor neuropathy is a hallmark feature of ttrfap . in classical earlyonset ( < 50 years of age ) val30met ttrfap ( andrade , 1952 ) , distal small myelinated and unmyelinated nerve fibers associated with pain and temperature sensation become damaged first , which may manifest as paresthesia , dysesthesia , allodynia , hyperalgesia , or spontaneous pain in the feet . axonal degeneration then progresses relentlessly in a distal to proximal pattern reaching upper limbs usually 4 to 5 years after first symptoms . within a few years , larger myelinated sensory and motor nerve fibers become affected and impairment of light touch , vibration , and position sensation , and motor deficit appear in the distal lower limbs . lateonset cases are characterized by relative preservation of unmyelinated nerve fibers and conspicuous presence of axonal sprouting ( koike et al . , 2004 ) . these characteristics are responsible for impaired superficial and deep sensation , severe neuropathic pain , early distal motor involvement , and relatively mild autonomic symptoms ( conceio and de carvalho , 2007 ; koike et al . , the lengthdependent pattern of symmetric sensorymotor and autonomic polyneuropathy in ttrfap is not unique , and similar neurologic impairments can be observed in many conditions , all of which can mislead clinical diagnosis . the most common neuropathic misdiagnosis for sporadic ttrfap is chronic inflammatory demyelinating polyneuropathy ( cidp ) ( plantbordeneuve , 2014 ) . for instance , 20% of 90 french patients without a family history of ttrfap ( plantbordeneuve et al . , 2007 ) and 53% of 15 japanese patients with sporadic v30 m ttrfap ( koike et al . , 2011 ) although cidp is generally characterized by a demyelinating sensorymotor neuropathy , once extensive axonal lengthdependent damage is present , electrophysiological characteristics of ttrfap can resemble those of cidp due to secondary demyelination . furthermore , protein levels in cerebrospinal fluid can be elevated in patients with ttrfap , albeit less markedly than in cidp . in some cases , given the frequent misdiagnosis , there should be a high suspicion index for ttrfap in patients diagnosed with cidp that do not respond to immunomodulatory treatment . there have been numerous cases where ttrrelated amyloidosis was initially misdiagnosed as amyloid lightchain ( al ) amyloidosis ( cowan et al . , 2011 ; briani et al . , misdiagnosis can be due to occurrence of monoclonal gammopathy in elderly patients or false immunolabeling of amyloid deposits , leading to inappropriate , potentially harmful chemotherapeutic treatment . ttrfap is unlikely to be mistaken for other forms of hereditary amyloid neuropathy caused by mutation of the apolipoprotein ai , gelsolin , or 2microglobulin genes . however , although very rare and less rapidly progressive , hereditary neuropathy due to truncation mutations of the prion protein can closely mimic ttrfap ( mead and reilly , 2015 ) and should be considered in the differential diagnosis . consequently , it is important to obtain a complete clinical history with details of symptoms of systemic disease and a complete and detailed family history ( ando et al . , 2013 ; plantbordeneuve , 2014 ) . the occurrence of progressive peripheral sensorymotor polyneuropathy and at least one of the following is suggestive of ttrfap : family history of neuropathy , early autonomic dysfunction , cardiac involvement , diarrhea , constipation , alternating episodes of constipation and diarrhea , inexplicable weight loss , carpal tunnel syndrome , renal impairment , or vitreous opacity ( fig . symptom clusters that may warn of a diagnosis of transthyretin familial amyloid polyneuropathy ( ttrfap ) . of these combinations , peripheral neuropathy with early autonomic signs , such as erectile dysfunction or gi symptoms , and peripheral neuropathy with cardiac manifestations are the most common and important combinations in sporadic patients . rapid disease progression ( dohrn et al . , 2013 ) and failure to respond to immunomodulatory treatment are additional signs . the clusters of clinical symptoms mentioned above should raise suspicion of ttrfap , particularly if there is a positive family history . in patients with suspected ttrfap , the entire coding region of the ttr gene , that is all four exons , should be sequenced . tissue biopsy analysis and neurologic , cardiac , autonomic , and ophthalmologic evaluation can lend further credence to the correct diagnosis .

abstracttransthyretin familial amyloid polyneuropathy ( ttrfap ) is a rare , progressive , lifethreatening , hereditary disorder caused by mutations in the transthyretin gene and characterized by extracellular deposition of transthyretinderived amyloid fibrils in peripheral and autonomic nerves , heart , and other organs . ttrfap is frequently diagnosed late because the disease is difficult to recognize due to phenotypic heterogeneity . based on published literature and expert opinion , symptom clusters suggesting ttrfap are reviewed , and practical guidance to facilitate earlier diagnosis is provided . ttrfap should be suspected if progressive peripheral sensorymotor neuropathy is observed in combination with one or more of the following : family history of a neuropathy , autonomic dysfunction , cardiac hypertrophy , gastrointestinal problems , inexplicable weight loss , carpal tunnel syndrome , renal impairment , or ocular involvement . if ttrfap is suspected , transthyretin genotyping , confirmation of amyloid in tissue biopsy , large and smallfiber assessment by nerve conduction studies and autonomic system evaluations , and cardiac testing should be performed .

Introduction Clinical Features of TTRFAP Common Diagnostic Pitfalls Redflag Symptom Combinations That May Warn of a Diagnosis of TTRFAP Core Diagnostic Tests to Identify TTRFAP

once a single word is presented , its orthographically similar words are also partially activated . coltheart first introduced the concept of orthographic neighborhood of a target word , defined as all words of the same length that can be generated by changing just one letter while preserving letter positions . for example , cheap , chest , cleat , and wheat are all neighbors of cheat . grainger and his colleagues pointed out that the printed frequency of a word 's orthographic neighbors played an important role in identification process of this target word , which is termed as neighborhood frequency effect . the authors indicated that if the frequency of a target word was not the highest among its neighbors , those higher - frequency neighbors ( hfns ) would compete with the target word and , consequently , slow down its processing . this inhibition was reported in several studies of lexical decision [ 28 ] . in naming tasks , no effect or a facilitatory trend of neighborhood frequency grainger gave an explanation to the absence of neighborhood interference based on the analogy theory of word naming [ 10 , 11 ] . the pronunciations in alphabetic orthographic neighborhoods were of high consistency , a word usually sounded similar with its orthographic neighbors , and then the neighbors with higher frequency would provide support for the component phonology of the target word . however , there is a close relationship between visual forms and pronunciations in alphabetic words , thus it is still needed to determine whether the hfns affect the target naming during phonological processing or visual / orthographic analysis . as opposed to alphabetic languages , chinese with a logographic writing system lacks the grapheme - to - phoneme correspondence ( gpc ) rules , in which visual words map onto speech sounds through an addressed way [ 12 , 13 ] . considering different language characteristics , the definition of orthographic neighbors for alphabetic words is inapplicable for chinese characters . however , about 85% of chinese characters are semantic - phonetic compounds [ 14 , 15 ] with the phonetic and semantic radicals informing to some extent about the character 's pronunciation and meaning , respectively . by the medium of phonetic or semantic radicals , orthographic neighborhood of chinese characters can be formed . for instance , characters ( pronounced / ji1/ , meaning garbage ; the number here refers to chinese tone ; the same below ) , ( /ji2/ , draw ) , ( /ji2/ , unmitigated ) , ( /ji2/ , book ) , ( /ji2/ , danger ) , ( /ji2/ , class ) , ( /xi1/ , absorb ) , and ( /sa3/ , shoes ) have the same phonetic radical ( ji2 , and ) and are considered as a phonetic - radical orthographic neighborhood . moreover , because phonological consistency is much lower in chinese orthographic neighborhoods [ 16 , 17 ] , the higher - frequency neighbors were expected to inhibit the target naming according to analogy theory of word naming , and this has been proved . li et al . examined the neighborhood frequency effect in chinese character naming , in which neighbors with the highest frequency sounded differently from target characters in the with - hfn condition . results showed a significantly interference effect of neighborhood frequency , and participants spent longer time and made more errors in with - hfn condition than in without - hfn condition . and their follow - up fmri study found that naming with - hfn characters induced greater activations than naming without - hfn characters in bilateral inferior frontal gyrus ( bi - ifg ) which was related with the phonological competition and inhibition of extraneous phonological activation . the above findings revealed that higher - frequency neighbors exerted an inhibitory influence on chinese - character naming , and this inhibition might be linked to the phonological processing . but whether the hfn effect was special to the phonological level was still unclear because of the low temporal resolution of brain imaging , and the event - related potential ( erp ) technique is undoubtedly a valuable way to dissociate the phonological processing from other stages ( e.g. , visual stage ) . the bilaterally posterior n1 is usually considered as a visual - orthographic component , with amplitude peak at around 130 ms to 170 ms [ 2026 ] . the p2 component occurs around 200 ms after stimulus at centrofrontal sites and indexes lexical phonology in chinese reading [ 2729 ] . a previous study of neighborhood frequency effect using lexical decision found that english words with hfns reliably induced larger amplitude than that without hfns in the 180240 ms time window , while there was no difference between the two conditions at earlier stages , revealing the possible phonological influence of hfns . however , to our knowledge , there were no erp researches on neighborhood frequency effect in naming tasks . so , the present study intended to use erps to examine the mechanism of neighborhood frequency effect in chinese - character naming . according to the analogy theory of word naming , it could be expected that the higher - frequency neighbors would only affect the target processing at phonological stage , exhibiting an effect in p2 component but not n1 component . all the participants were right - handed native mandarin speakers with normal or corrected - to - normal vision . there were 48 characters as targets , 24 for with - hfn and without - hfn conditions , respectively ( see table 1 ) . for the without - hfn characters , a target character had the highest frequency within its neighborhood . for the with - hfn characters , at least one of its neighbors was of 3 per million higher frequency referred to as a previous study ; meanwhile , the target and its neighbor(s ) with the highest frequency sounded differently from each other . for example , ( pronounced /dan4/ , meaning birth , character frequency being 7.09 occurrences per million ; the same below ) , ( /xian2/ , saliva , 0.74 ) , ( /yan2/ , wriggly , 0.85 ) , and ( /yan2/ , feast , 0.65 ) form an orthographic neighborhood . the target character is , and its orthographic neighbors all have much lower character frequency , so this target is considered as a without - hfn character . ( /di2/ , barbarians , 5.41 ) , ( /qiu1/ , autumn , 24.03 ) , ( /huo3/ , partner , 28.72 ) , and ( /huo3/ , holmium , 0.02 ) form another neighborhood , and the target character is . the neighbor has the highest frequency in this neighborhood , and the difference in frequency between ( 5.41 ) and ( 24.03 ) is greater than 3 per million ; meanwhile the two characters sound different from each other , and thus the target is regarded as a with - hfn character . the mean number of hfns in one neighborhood was 2 ( range , 1 to 6 ; standard deviation = 1.47 ) . the irregular character indicates the character whose pronunciation is different from that of its phonetic radical ; for example , ( sa3 , shoes ) is an irregular character , because of its phonetic radical ( ji2 , and ) with a different pronunciation . the consistency value ( c ) can be calculated from the relative ratio of the number of orthographic neighbors with the same pronunciation ( n ) to the whole neighborhood size ( n ) , c = n / n . for example in the phonetic - radical neighborhood of ( ji2 , and ) , its neighborhood size is eight , and there are six neighbors with the same pronunciation / ji/ , ( /ji1/ , garbage ) , ( /ji2/ , draw ) , ( /ji2/ , unmitigated ) , ( /ji2/ , book ) , ( /ji2/ , danger ) , and ( /ji2/ , class ) , producing a consistency level of /ji / of 0.75 ( c = 6/8 ) . in the present study , the consistency of each target character was below 0.4 . the target characters were all left - right structure with the phonetic radical on the right side . moreover , the number of neighbors , character frequency , stroke , and consistency were balanced between conditions ( table 2 ) . character frequency information was collected from the chinese text computing database ( http://lingua.mtsu.edu/chinese-computing/ ) , and the neighborhood was defined on the basis of li and kang 's statistics . participants sat in a sound - attenuated room , at a viewing distance of 50 cm from the screen , with a visual angle of 5.7 5.7. they were instructed to sit comfortably and concentrate on the stimulus avoiding head movements or any other unnecessary movements . figure 1 displays the presentation format within each trial . a trial consisted of a 500 ms cross - fixation , a 500 ms blank screen , and a 500 ms target character . the participants were asked to silently name the target . to ensure that the phonology of the target character was accessed , the covert naming was followed with a homophonic decision , in which participants should make a decision on whether the target and the following probe were homophonic and click mouse buttons with their thumbs , with the left button for different pronunciation and the right button for homophony . for the compound - character probe , its phonetic radical was always different from that of the paired target . half of the probes sounded the same with the targets , and the other half sounded different . the list of the target characters was presented twice so that the number of trials in each condition rose to 48 . one target was paired up with different probes between the two presentations to reduce practice effects . the stimuli were programmed with the stim software and randomly shown on a lenovo monitor . electroencephalographic ( eeg ) activity was recorded from a 64-channel neuroscan version 4.3 system with a common vertex reference and rereferenced to the average of the left and right mastoids in the offline analysis . vertical eye movements ( veog ) were recorded by a pair of electrodes placed on the supraorbit and infraorbit of the left eye , and horizontal eye movements ( heog ) were recorded by a pair of electrodes placed beside the outer canthus of both eyes . eeg signals were recorded and digitized at a bandpass filter of 0.05100 hz , with amplifying at a sample rate of 500 hz . resistances across all the electrodes were kept below 5 k. the acquired data were corrected for eye movements and blinks and segmented to epochs of 800 ms posttarget interval and 100 ms pretarget baseline . epochs containing incorrect behavioral responses or with peak - to - peak differences larger than 100 v were rejected , and this led to a rejection rate of 8% over all trials , without statistical difference in the number of rejections between conditions ( p > 0.1 ) . the remaining epochs were filtered with a low - pass filter of 30 hz ( zero - phase shift mode , 12 db ) and averaged for each condition and participant . figure 2 displays the erp grand averages time locked to the onset of target characters for neighborhood frequency comparison . as can be seen from the figure , the erps show a negative polarity peaked at around 150 ms over posterior regions and a positive polarity peaked at about 170 ms over frontocentral regions . the 40 ms time windows were selected centering the n1 and p2 peaks ( n1 : 130170 ms ; p2 : 150190 ms ) . according to topographic mapping in figure 2 , the n1 amplitude was output at channels of po5-po6 , po7-po8 , o1-o2 , and the p2 amplitude was recorded at channels of frontal ( f1-f2 , f3-f4 ) , frontocentral ( fc1-fc2 , fc3-fc4 ) , central ( c1-c2 , c3-c4 ) , and centroparietal ( cp1-cp2 , cp3-cp4 ) lobes . mean erp amplitudes from corresponding time windows were computed for each participant in both conditions . the n1 amplitude was submitted to a repeated - measure anova with neighborhood frequency ( nf , with / without hfns ) and laterality ( left / right hemisphere ) . the p2 amplitude was submitted to a repeated - measure anova , with three within - subject variables : neighborhood frequency ( with-/without hfns ) , laterality ( left / right hemispheres ) , and lobe ( frontal / frontocentral / central / centroparietal lobes ) . the anova on n1 amplitude showed no significant main effect or interaction ( all ps > 0.1 ) . the anova on p2 amplitude showed a significant main effect of neighborhood frequency ( f(1 , 12 ) = 12.88 , p < 0.01 ) , and erp response to target characters was larger in without - hfn condition than in with - hfn condition ; a significant main effect was also observed for lobe ( f(1 , 12 ) = 8.73 , p < 0.01 ) , and post hoc analysis showed the smallest amplitude in the centroparietal lobe but no differences across other three lobes ; no significant effect was found for laterality ( f(1 , 12 ) < 1 , p = 0.68 ) or any interactions ( all ps > 0.1 ) . in the present study , there was no effect of neighborhood frequency on bilateral posterior n1 amplitude ; as to the p2 amplitude , naming chinese characters without hfns induced more positive erps than that with hfns . the current results uncovered the time course of early influence of orthographic neighbors with higher frequency in chinese - character naming . the absence of neighborhood frequency effect in n1 amplitude revealed that higher - frequency neighbors did not affect visual / orthographic analysis of the target characters , since n1 is usually associated with the visual form processing of written words / characters [ 22 , 26 ] . the finding was consistent with a previous study using english words , in which there was not hfn effect in the early time window before 180 ms . moreover , it was reported that the n1 originates predominately from the occipitotemporal regions ; thus the present result was identical with the nonsignificant hfn effect in the occipital areas reported by li et al . . the current amplitude difference between with- and without - hfn conditions in the p2 time - window indicated that higher - frequency neighbors exerted an influence on phonological processing of chinese characters . debruille also reported an hfn effect in english words with the erps response in the posttarget interval ranging from 180 ms to 240 ms . these findings suggested the universal role of hfns in phonological retrieval of target words / characters across language systems . however , the current hfn effect was greater p2 amplitude in without - hfn condition than that in with - hfn condition , while the neighborhood frequency effect in debruille was opposite . the difference might be ascribed to the language characteristics in phonological consistency . considering the high phonological consistency in alphabetic writing systems , higher - frequency neighbors would provide support for the target phonology , which might correspond with increased brain activity of larger erp amplitude . whereas the phonological consistency was low in chinese orthographic neighborhoods , different pronunciations of the hfns would be more easily activated because of the lower threshold of activation for these neighbors and compete with the phonological activation of the target characters , resulting in the interference on phonological processing of chinese characters , which may inhibit the relevant brain activity of p2 component . additionally , the distribution of p2 effect was mainly located in the frontal and centroparietal areas . neuroimaging studies reported that the left middle frontal gyrus was responsible for the addressed phonology , and the dorsal aspect of the left inferior parietal lobule was thought to be the region specific for phonological storage in chinese ; meanwhile , the right frontal regions were linked to phonological competition and inhibition [ 12 , 19 , 35 , 36 ] . these results indicated that the higher - frequency neighbors might exhibit a disruptive effect in the lexical route of chinese phonological access . the present results were consistent with our prediction based on the analogy theory of word naming , revealing that orthographic neighbors with higher frequency might impact on target naming at the phonological level . proposed that the orthographic neighborhood effect in chinese - character naming may be generated in two phases : orthographic facilitation from visually similar neighbors and phonological inhibition of higher - frequency neighbors . the current findings provided evidence for the phonological inhibition , suggesting negative influence of higher - frequency neighbors at the phonological retrieval in chinese - character naming . the present study used erps to separately examine the effect of higher - frequency neighbors at the early orthographic and phonological stages . results showed amplitude difference between with- and without - hfn conditions in p2 component but not in n1 component , suggesting a special role for the hfns in addressed phonology of chinese characters . the reduced amplitude of p2 for with - hfn characters might reveal the phonological inhibition from the higher - frequency neighbors due to their different phonological representations from the target characters .

the present study explored the time course of neighborhood frequency effect at the early processing stages , examining whether orthographic neighbors with higher frequency exerted an influence on target processing especially at the phonological stage by using the event - related potential ( erp ) . thirteen undergraduate students were recruited in this study , and they were required to covertly name chinese characters with or without higher - frequency neighbors ( hfns ) ; meanwhile , their brain activity was recorded . results showed that the effect of neighborhood frequency was significant in frontocentral p2 amplitude , with a reduction for naming characters with hfns compared to those without hfns ; while there was no effect in posterior n1 amplitude . the only neighborhood frequency effect in p2 component suggested a special role for the hfns in phonological access of chinese characters . the decrease in amplitude for naming with - hfn characters might be associated with the phonological interference of higher - frequency neighbors due to their different pronunciations from the target characters .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

a cataract increases lens opacity and reduces visual acuity ( va ) , thus impairing the patient 's quality of life . various techniques for cataract surgery have been developed since h. ridley introduced intraocular lenses ( iols ) composed of polymethylmethacrylate in 1949 . the stability of iols allows cataract surgery to be commonly performed worldwide , and technological advancements such as multifocal and toric iols have increased the procedure 's popularity [ 6 , 7 ] . to improve quality of life , cataract surgery postoperative va , contrast sensitivity , and optical aberrations were measured as objective indices of surgical success [ 1116 ] . after cataract surgery , improvement in va is typically tested with a high - contrast ( 100% ) chart under photopic and mesopic conditions . for example , visual inspection of human faces of the utmost importance in daily life involves a target of large size and low contrast . the change in va after cataract surgery has not been studied under various levels of contrast . the aim of this study was to assess the visual performance of pseudophakic eyes after cataract surgery at different contrast levels by using the oqas ( optical quality analysis system , visiometrics , terrassa , spain ) . this research was approved by the institutional review board of the catholic medical center at the catholic university of korea and conducted in accordance with ethical research guidelines . the present study adhered to the declaration of helsinki and was approved by the institutional review board of the catholic medical center at the catholic university of korea ( approval number : kc12risi0023 ) . patients completed an informed consent form approved by the institutional review board after the purpose of the study was explained to them . no patients had a history of ocular surgery , ocular disease , or general disorders affecting vision ( e.g. , diabetic retinopathy ) . vision of patients greater than 0.1 logmar was measured using the snellen test and classified as age - matched ( 50s , 60s , and 70s ) between normal and pseudophakic eyes . the patients with pseudophakic eyes had undergone phacoemulsification and received one of five iol types in the posterior chamber 26 months before the study . patients were stratified into the following age groups : 5059 years , 6069 years , and 7079 years . patients with failed iol implantation into the lens capsule , severe posterior lens capsule opacification or history of laser capsulotomy due to opacification , or any other eye complication were excluded . those with poor cooperation were also excluded . to prevent uncorrected refractive error from limiting contrast sensitivity or va [ 20 , 21 ] , va was measured using a snellen chart at 6 m. altered contrast sensitivity was simulated with the oqas by using the double - pass technique . with this approach , the retinal image , degree of haze inside the eye , and condition of visual function are analyzed in terms of objective scattering index ( osi ) , modulation transfer function ( mtf ) cut - off value , and strehl ratio , respectively [ 2225 ] . simulated va by oqas was evaluated at contrast of 100% , 20% , and 9% . testing at each contrast level was performed for all five types of iols : hoya pc-60ad ( hoya , corp , tokyo , japan ) , ec-1pal ( aaren scientific , ontario , canada ) , akreos mi-60 ( bausch & lomb , rochester , ny , usa ) , ny-60 ( hoya , corp , tokyo , japan ) , and xl stabi zo ( carl zeiss meditec , jena , germany ) . analysis of variance ( anova ) and independent - sample t - tests were performed using spss version 18.0 software ( ibm corporation , armonk , ny ) . the subjects ' characteristics are shown in table 1 . mean visual acuities for the normal eyes were 0.16 0.18 logmar , 0.30 0.18 logmar , and 0.52 0.17 logmar at 100% , 20% , and 9% contrast , respectively ( table 2 ) . in normal eyes from all age groups , simulated va decreased significantly when contrast was reduced ( 5059 , p = 0.000 ; 6069 , p = 0.000 ; 7079 , p = 0.020 ) . however , simulated va was highest among those aged 5059 and lowest among those aged 7079 . simulated va at 100% and 9% contrast decreased with increasing age ( 100% , p = 0.045 ; 9% , p = 0.010 ) . no significant differences were noted among the age groups at 20% contrast ( p = 0.070 ) . for pseudophakic eyes , mean visual acuities were 0.16 0.12 logmar , 0.33 0.20 logmar , and 0.56 0.21 logmar at 100% , 20% , and 9% contrast , respectively ( table 3 ) . as in the normal eyes , va decreased significantly when contrast was reduced ( p = 0.000 ) . however , nova was similar in all age groups ( p > 0.05 ) . figure 1 shows simulated va for the normal and pseudophakic eyes in each age group at all contrast levels . however , among those aged 7079 , the pseudophakic eyes exhibited significantly higher va ( p = 0.000 ) . table 4 shows the simulated mean visual acuities of the pseudophakic eyes according to iol type . subjects implanted with ec-1pal and ny-60 iols showed the lowest and the highest va , respectively , although no significant differences were noted among iols at any contrast level . regardless of iol type , va decreased significantly when contrast was reduced ( p = 0.000 ) . osi value , mtf cut - off value , and strehl ratio values are presented in table 5 . the mean values were 2.21 1.38 , 23.29 10.72 , and 0.18 0.47 , respectively , in the pseudophakic group and 1.99 1.41 , 23.41 9.72 , and 0.13 0.07 , respectively , in the normal group . the only significant finding was elevated osi values in normal eyes from the 7079 age group ( p = 0.008 ) . figure 2 shows representative oqas results obtained from a 69-year - old patient with normal eyes and a 72-year - old patient with pseudophakic eyes . in addition to questionnaires , va and contrast sensitivity assessments are used to evaluate ocular health after cataract surgery . recent technological advancements have allowed for the measurement of higher - order aberrations including spherical aberration and coma aberration as well as the optical analysis of light spread within the eye ( point spread function ) [ 2729 ] . however , such tests are useful only in characterizing symptoms . . used the oqas to measure the osi , mtf cut - off value , and strehl ratio after cataract and refractive surgeries and to assess visual function objectively . , we investigated vision at three contrast levels simulated using the oqas and stratified subjects with normal and pseudophakic eyes by age . among patients in their 50s and 60s , normal eyes exhibited sim va superior or similar to that of pseudophakic eyes however , among those in their 70s , pseudophakic eyes had significantly superior va ( p = 0.000 ) . alternatively , the normal eyes in this age group may have been free of any lens opacity that could be detected by slit - lamp examination but may have had fine opacities in the lens and/or vitreous chamber that scattered light , thereby reducing va . another significant finding was the lower osi value of the pseudophakic eyes in this group ( p = 0.008 ) , which is in line with the report by saad et al . that osi values increase with age in normal eyes . in both the normal and pseudophakic groups , va was directly related to contrast level regardless of age . furthermore , va decreased as age increased ; as reported by mathai et al . sim va was similar in normal and pseudophakic eyes of subjects aged 5069 but superior in the pseudophakic eyes of subjects aged 7079 years . therefore , visual function must have returned to normal levels in all patients with iols at 26 months after cataract surgery . the ny-60 and ec-1pal iols were associated with the highest and lowest visual acuities , respectively , regardless of contrast level . interestingly , use of the ny-60 iol is reportedly associated with fewer capsular folds than use of a three - piece iol . ny-60 iol users also report the absence of entoptic phenomena 1 year after surgery . in an eye with an iol , the presence of entoptic phenomena correlates directly with the osi value . this relationship may explain the superior va of the ny-60 group , although this improvement in va was associated with use of the acrysof sn60wf and tecnis zcb00 iols in previous reports . in this study , reduced contrast was associated with decreased acuity across groups , but no significant difference in simulated va among iol types was noted at any contrast level ( p = 0.413 ) . a possible limitation of our study is that the oqas 's he - ne diode laser may have introduced error to the osi readings , for example , in patients with dry eye symptoms or cloudy vitreous , which scatters light . in summary , va at 26 months after cataract surgery in pseudophakic eyes is similar to that of normal eyes and older patients with pseudophakic eyes have superior simulated va to age - matched controls , contrary to previous reports that the level of contrast and age affect visual function . these findings suggest that iols ensure simulated va similar to that of the normal eye even in very low - contrast conditions , as encountered when driving at night . therefore , iol implantation should have a beneficial impact on the patient 's quality of life . the oqas seems to be a useful instrument for the objective evaluation of visual quality under contrast after various surgeries such as cataract surgery , laser - assisted in situ keratomileusis ( lasik ) , laser - assisted subepithelial keratectomy ( lasek ) , and keratoconus surgery .

purpose . to assess visual function using optical quality analysis system ( oqas ) at varying levels of contrast in pseudophakic eyes . methods . the study included patients admitted to seoul st . mary 's hospital between january and february 2012 : 143 pseudophakic eyes with one of five intraocular lens types , examined 26 months after cataract surgery , and 93 normal eyes ( enhanced visual acuity ( va ) < 0.1 logmar ) in age - matched controls . subjects were examined at three contrast levels using the oqas . results . at 100% , 20% , and 9% contrast , simulated mean va was 0.16 0.18 logmar , 0.30 0.18 logmar , and 0.52 0.17 logmar , in normal eyes , and 0.16 0.12 logmar , 0.33 0.20 logmar , and 0.56 0.21 logmar , respectively , in pseudophakic eyes . simulated va decreased significantly when contrast was reduced , regardless of ocular status , age group , and lens type ( p < 0.05 ) . there were no significant differences between normal and pseudophakic eyes among subjects aged 5069 ( p > 0.05 ) . among subjects aged 7079 , pseudophakic eyes showed improved simulated va ( p = 0.000 ) and objective scattering index values ( p = 0.008 ) . conclusions . patients with intraocular lenses have similar or superior visual function when compared to those with normal eyes at 26 months after cataract surgery , even under low - contrast conditions .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

the cavity is enlarged and smoothened to fittingly receive the filling . as tooth and canal anatomies are equally important during canal preparation , the appropriate use of the endodontic instruments and the close contact with canal walls for pulp extirpation and cleaning purposes is likewise crucial to the treatment . several techniques and instruments have been suggested to achieve the desired efficiency in root canal preparation2,6,11,15,19,23 . the concomitant use of chemicals that promote the removal of microorganisms is widely accepted . as regards the cleaning and disinfection of root canals , current literature sets forward conflicting results for manual , mechanical and ultrasonic instrumentation techniques1,3,810,12,13,16,23 . therefore , considering that in the treatment of non - vital teeth with chronic periapical reaction the presence of bacteria inside the root canal system accounts for the development and persistence of periapical lesions , this study was designed to investigate quantitatively the in vitro ability to remove dye adhered to proximally flattened root canals . three techniques were investigated : crown - down technique with rotary instrumentation using nickel - titanium files ( k3 and protaper systems ) ; ultrasonic crown - down technique ; and progressive manual technique without apical pressure - modified oregon technique . a set of 40 permanent human teeth freshly extracted from patients at the university of marlia for periodontal or prosthetic purposes and stored in 0.01% thymol solution was used in this study . teeth were mandibular left and right central incisors and lateral incisors , and mandibular right and left premolars , evenly distributed the groups . all teeth presented proximally flattened root canals . , so paulo , sp , brazil ) using an insulin syringe ( becton dickinson , curitiba , pr , brazil ) , upon the foramen . a fine kerr file was then repetitively pumped in the canal to prevent the formation of bubbles , whereupon teeth were left to rest at room temperature for 48 h to ensure complete curing of red dye . group i was treated with the crown - down technique using the k3 system ( kerr , sybron endo , california , usa ) ( table 1 ) and group ii with the crown - down technique using the protaper system ( dentsply maillefer , ballaigues , switzerland ) ( table 2 ) ; group iii was treated with the progressive manual technique without apical pressure ( modified oregon technique ) ; and group iv was treated with the ultrasonic crown - down technique . the root canal walls of groups i and ii were instrumented using an electric endodontic engine ( endo plus k ; vk driller equipamentos eltricos , so paulo , sp , brazil ) . the device was adjusted to a constant clockwise 250-rpm speed and to a # 3 torque . group iii was instrumented using the modified oregon technique as defined by berbert , et al.2 ( 1996 ) . the process started using a manual size 40 k - file adapted to a ultrasound device ( enac ; osada electric co , japan ) , energized for 1 min . from this point on , smaller files were progressively used to ensure that the desired canal working length was reached . for all groups , canals were flushed with 1.8 ml 2.5% sodium hypochlorite ( chemical institute of marilia , unimar , marilia , sp , brazil ) at each change of file . the canals were then dried using paper points ( tanari industrial ltda , manaus , am , brazil ) and the teeth were decoronated length - wise in a buccolingual direction using a diamond disk . the efficiency of each instrumentation technique under study was measured by assessing quantitatively the amount of dye that remained on the root canal walls . halves containing the root canal dentin walls were digitally captured using a desk scanner ( genius colorpage - vivid pro ii ) coupled to a pentium iv computer equipped with the mgi photosuit software . once resolution , brightness and contrast features were standardized , images were accessed using the sigma scan software ( jandel scientific corporation , san rafael , ca ) . total canal area was obtained ( mm ) and the uninstrumented canal areas that remained stained with the dye were determined . data were entered into a windows excell 2000 spreadsheet , affording the quantification of dye that remained after instrumentation by the percentile difference between total root canal area and the dye - stained uninstrumented canal area . as data met the requirements of normal distribution and variance homogeneity , one - way anova was used to compare statistically the four experimental groups at 5% significance level . the quantitative analysis of the data obtained for the total root canal area and the dye - stained uninstrumented canal areas , as well as the percentile difference between them are shown on figure 1 . table 3 shows the results of the f distribution for the percentile difference between the total root canal area and the dye - stained uninstrumented canal area . no statistically significant difference were found between the groups ( p = 0.101 and f = 2.23 ) . root canal instrumentation is not a simple procedure and demands manual skills as well as deep knowledge of the internal root canal system . the preparation of curved root canals and root canals with isthmuses is more complex because the instrument suffers the tensions and deformations imposed by the procedure , which can ultimately influence the outcomes of the root canal treatment . the experimental model adopted in the present study , using natural human teeth , was chosen because their root canal anatomy is remarkably flattened and irregular . this aspect of human root canals may pose additional difficulties to instrumentation and challenge the treatment outcomes because complete removal of remaining tissues from isthmus areas is sometimes hard to achieve9,13,23 . different methods to evaluate instrumentation techniques and their results have been reviewed in the literature . among the methodologies adopted to investigate root canal preparation methods are scanning electronic microscopy3,8,10,23 , simulated polyester resin root canals22 , computer software5 and clearing17 . gonalves jr9 ( 2003 ) and silva , et al.19 ( 2004 ) used root canal dye techniques to compare instrumentation protocols with respect to efficiency and instrumented area . in the present study it is important to mention that the dye used was proved to be insoluble in water , which makes each instrumentation technique the sole dye removal agent in the study . image digitization of the halves and dye - stained areas on the root canal walls allowed the in - depth analysis of experimental results . although these are twodimensional images , the fact that the specimens present well - defined mesiodistal flattened root canals , with minimal depth9 validates the use of the two - dimensional image approach . table 3 and figure 1 show how the extension of the dye - stained root canal area increases from group iv ( ultrasonic ) to group ii ( protaper ) , iii ( oregon ) and i ( k3 ) , in this sequence . these results allowed observing that none of the adopted techniques was efficient enough to completely remove the dye adhered to the canal walls . similar results have been reported by barbizam , et al.1 ( 2002 ) and zmener , et al.23 ( 2005 ) . table 3 shows that , although no statistically significant difference was observed between the groups , the instruments that reached the root canal walls and isthmuses more effectively produced better results in canal preparation . nevertheless , given that rotary instrumentation systems tend to operate more centrally inside the root canal7,9 and considering that the root canals prepared in the present study were flattened , the performance of the protaper system ( group ii , table 3 ) is worth mentioning . the protaper system produced significantly better instrumentation than the k3 system ( group i , table 3 ) . this is contrary to what is ordinarily expected of oregon and ultrasonic techniques . k3 and protaper techniques have differently tapered rotary instruments to operate on the cervical third and produced considerably different results in the present study . while the k3 system exhibited the worst result among the four groups ( mean= 39.76 ) , the protaper system produced a good instrumentation ( mean = 23.31 ) ( table 3 ) . this is probably due to the gradually tapered instrument design of protaper files , as tapering ranges from 0.02 to 0.12 mm from its end d1 to base d2 . , the active instruments ( protaper ) appeared to remove the smear layer more effectively than instruments with radial lands ( k3 ) . the use of the ultrasonic technique ( group iv , table 3 ) produced a satisfactory result for removal of the dye - stained dentin . this is due to the adoption of the crown - down instrumentation , which started with greater file sizes . it is worth mentioning that thicker instruments tend to be more efficient , removing larger amounts of dentin within shorter times . these findings agree with those of esberard , et al.6 ( 1987 ) , who suggested the need for a closer contact between the instrument and canal walls for optimal dentin removal . in the present study , this procedure was adopted to allow a better comparison between techniques , as these techniques do not intrinsically use irrigation . the results also showed that the ultrasonic technique without constant irrigation proved to be the most efficient technique . the enlargement of the cervical third before instrumentation of the apical region had a positive effect on the performance of the techniques because the influence of dentin thickness is lessened , thus favoring the full - length direct action of instruments along the canal walls . furthermore , shovelton18 ( 1964 ) demonstrated that in addition to dentin contamination , large bacterial counts are found along this portion of the canal . in the present study , the cervical region of all teeth was prepared , by either rotary instruments with accentuate taper or gates - glidden drills ( for the modified oregon technique ) , or even files with larger sizes , as those used for the ultrasonic technique . the use of gates - glidden drills has a beneficial effect on root canal preparation and plays an important role in the cleaning of the cervical third of the canal . the results of the present contradict those of previous investigations in which the modified oregon technique ( group iii ) was shown to produce better results than ultrasonic , canal finder and profile rotary techniques9,16 , when the canal were preflared with gates - glidden drills . in the present study , the progression of instrumentation without apical pressure had little contribution on the cleaning of polar and isthmus zones . progressive instrumentation works smoothly and harmoniously for the benefit of root canal preparation as a whole . root canal enlargement allows introducing the files further into the canal , in contact with the dentin walls . yet , it is not possible to direct the action of the instruments , differently from what is observed for the filing movement . based on the number of remaining dye - stained areas on the canal walls , the outcomes of this study demonstrated that none of the techniques produced an appropriate canal preparation . portions of the canal walls that were untouched by the instruments , such as isthmuses , were often found in all groups . this is imputable to both the inefficiency of the technique and the anatomic abnormalities , even in a technologic scenario that affords a variety of rotary instruments of diverse characteristics10 . in a comparative investigation that assessed manual instrumentation , sonic and ultrasonic techniques , langeland , et al.12 ( 1985 ) affirmed that canal anatomy plays a more important role in endodontic treatment than any instrumentation technique . the authors reported that although the techniques cleaned straight , tubular canals , they failed to reach the same efficiency for curved , irregular canals . therefore , it is important to take into account that all instrumentation techniques demand more attention in the treatment of teeth with pulp necrosis and periapical lesion , in which contamination is wide - ranging and intense , with consequent demand for intracanal dressings and sealing . in the light of the results obtained in the present study , it was observed that : ( i ) no instrumentation technique fully removed all dye - stained areas from the canal walls ; ( ii ) the quantitative assessment of dye removal from the canal walls did not show statistically significant difference between the studied groups ( p<0.05 ) ; ( ii ) the ideal instrumentation technique for curved and irregular root canals has not yet been made available .

objective : the efficiency of rotary , manual and ultrasonic root canal instrumentation techniques was investigated in proximally flattened root canals.material and methods : forty human mandibular left and right central incisors , lateral incisors and premolars were used . the pulp tissue was removed and the root canals were filled with red die . teeth were instrumented using three techniques : ( i ) k3 and protaper rotary systems ; ( ii ) ultrasonic crown - down technique ; and ( iii ) progressive manual technique . roots were bisected longitudinally in a buccolingual direction . the instrumented canal walls were digitally captured and the images obtained were analyzed using the sigma scan software . canal walls were evaluated for total canal wall area versus noninstrumented area on which dye remained.results:no statistically significant difference was found between the instrumentation techniques studied ( p<0.05).conclusion : the findings of this study showed that no instrumentation technique was 100% efficient to remove the dye .

INTRODUCTION MATERIAL AND METHODS RESULTS DISCUSSION CONCLUSIONS