Datasets:

pouya-haghi
/

pile-1k

Dataset card Viewer Files Files and versions Community

Split (1)

train · 1k rows

text stringlengths 18 152k	meta dict
Please find attached the EGM Management Summary and Hot List as of 11/16. Please contact me if you have any questions/comments. Thanks, Jeff ---------------------- Forwarded by Jeff Smith/HOU/ECT on 11/17/2000 04:37 PM --------------------------- From: Patricia Anderson 11/17/2000 11:00 AM To: Jeff Smith/HOU/ECT@ECT cc: Subject: 11/16 Mgmt Summary & Hot List REVISED For distribution Patricia	{ "pile_set_name": "Enron Emails" }
From dissipative dynamics to studies of heat transfer at the nanoscale: analysis of the spin-boson model. We study in a unified manner the dissipative dynamics and the transfer of heat in the two-bath spin-boson model. We use the Bloch-Redfield (BR) formalism, valid in the very weak system-bath coupling limit, the noninteracting-blip approximation (NIBA), applicable in the nonadiabatic limit, and iterative, numerically exact path integral tools. These methodologies were originally developed for the description of the dissipative dynamics of a quantum system, and here they are applied to explore the problem of quantum energy transport in a nonequilibrium setting. Specifically, we study the weak-to-intermediate system-bath coupling regime at high temperatures kBT/ħ > ε, with ε as the characteristic frequency of the two-state system. The BR formalism and NIBA can lead to close results for the dynamics of the reduced density matrix (RDM) in a certain range of parameters. However, relatively small deviations in the RDM dynamics propagate into significant qualitative discrepancies in the transport behavior. Similarly, beyond the strict nonadiabatic limit NIBA's prediction for the heat current is qualitatively incorrect: It fails to capture the turnover behavior of the current with tunneling energy and temperature. Thus, techniques that proved meaningful for describing the RDM dynamics, to some extent even beyond their rigorous range of validity, should be used with great caution in heat transfer calculations, because qualitative-serious failures develop once parameters are mildly stretched beyond the techniques' working assumptions.	{ "pile_set_name": "PubMed Abstracts" }
The Best Books - All The Best Books You Need Stay with Me: A novel Yejide and Akin have been married since they met and fell in love at university. Though many expected Akin to take several wives, he and Yejide have always agreed: polygamy is not for them. But four years into their marriage–after consulting fertility doctors and healers, trying strange teas and unlikely cures–Yejide is still not pregnant. She assumes she still has time–until her family arrives on her doorstep with a young woman they introduce as Akin’s second wife. Furious, shocked, and livid with jealousy, Yejide knows the only way to save her marriage is to get pregnant. Which, finally, she does–but at a cost far greater than she could have dared to imagine. An electrifying novel of enormous emotional power, Stay With Me asks how much we can sacrifice for the sake of family.	{ "pile_set_name": "Pile-CC" }
The conventional method for attaching hardware, such as support brackets and rings for alternate path shunt tubes and bladed centralizers, to oilfield sand screen tubulars and other downhole equipment involves welding such components directly to the production tubular. Welding creates residual stresses in the tubular that can eventually lead to stress or corrosion cracking, surface cracks, and other defects that can ultimately result in the failure of the tubular. However, most welding procedures generally include a post-weld heat treatment designed to minimize the residual stresses and increase the strength of the tubular near the weld joint by re-homogenizing the crystalline structure of the tubular material. However, with increasingly sophisticated metallurgy, such as 25CR-125ksi material commonly used in downhole applications, regaining vital strength properties of the tubular is simply not possible through post-weld heat treatments. Consequently, in applications using modem metallurgy, welding directly to the production tubular will ultimately result in the tubular having reduced strength characteristics as a result of the residual stresses on the tubular. Moreover, in order to comply with downhole drilling regulations, the tubular weld must also be thoroughly inspected in an effort to identify any weld defects that could eventually propagate into cracks and lead to tubular failure. This inspection is commonly undertaken via non-destructive weld examination methods, such as liquid penetrant inspection. Like many other non-destructive weld inspection methods, liquid penetrant inspection requires an in-depth system of quality control documents, traceability, and personnel training which are inherently time consuming and cost prohibitive for many applications. There is a need, therefore, for a system and method of attaching downhole equipment hardware to production tubulars without welding such equipment thereto and thereby compromising the structural integrity of the tubular and requiring costly post-weld treatments or inspections.	{ "pile_set_name": "USPTO Backgrounds" }
Introduction ============ Diabetes mellitus is a common endocrine metabolic disease estimated to affect 629 million individuals in 2045 according to the International Diabetes Federation. T2DM is the extremely prevalent form of diabetes that accounts for 90% of diagnosed cases and is associated with insulin resistance and chronic hyperglycemia ([@B13]). Many clinical studies reported a broad spectrum of lower urinary tract symptoms in diabetic patients ([@B16]), accounting for 90--95% of all diabetes cases ([@B17]). DBD is a major lower urinary tract complication of diabetes and was first described by [@B26]. Such complication is traditionally described as a triad of increased capacity, decreased sensation, and poor emptying ([@B11]) and has affected over 50% of diabetic patients ([@B12]; [@B28]). DBD development is divided into two phases: the compensated phase, which occurs in the early phase and is characterized by an OAB; and the decompensated phase, which occurs in the late phase and is characterized by an atonic bladder ([@B36]; [@B24]). The pathogenesis of DBD is multifactorial and accompanied by the structural and functional impairments of the bladder ([@B37]). The bladder structural remodeling of DBD, such as the increase in bladder capacity, total BWT, and smooth muscle content, was observed in STZ-induced diabetic mice. Such remodeling may be a physical alteration to increase the urine volume ([@B22]). The two major functions of bladder are urine storage and urine disposal, and the uncoordinated contraction in the OAB of a diabetic greatly affects the urine storage ability of this organ ([@B10]). Bladder contraction is mainly mediated by purinergic and cholinergic pathways ([@B23]). In particular, ATP is the purinergic messenger released from varicosities or bulbous nerve endings of neurons, and the contractile responses mediated by ATP play a key role in DBD ([@B44]). Solute carrier family 17 member 9 (SLC17A9) is a member of the solute-carrier protein family that plays an indispensable role in the vesicular storage of ATP ([@B31]; [@B20]). The translocation of neurotransmitter-filled vesicles to the varicose terminal is the first step in the release of vesicular neurotransmitters, followed by the merger of vesicles with the membrane of the varicose terminal and the precise and rapid release of their contents into the synaptic cleft ([@B33]). In addition, the motor of vesicles for transportation to the varicose membrane in the cells is mainly provided by myosin motors, particularly myosin Va ([@B2]). Several studies found that the purinergic inhibitory neurotransmission was impaired in myosin Va-deficient mice ([@B6]). Such finding suggested that myosin Va played an important role in purinergic neurotransmission ([@B3]). Diabetic bladder dysfunction, particularly OAB, is not life threatening to humans. However, this dysfunction seriously affects the quality of the life of patients ([@B24]). The treatment methods for DBD changed when the phase progresses. Anticholinergic drugs, such as tolterodine and solifenacin, are the main treatment options for DBD patients with OAB. However, many side effects, including dry mouth, dry eyes, and memory loss, occurs after the treatment with anticholinergic drugs, thus rendering poor life quality for the patients. In the late phase, surgical intervention was the only therapeutic method for patients who did not benefit from pharmacological and behavioral treatments ([@B45]). However, pharmacological and surgical interventions were largely ineffective in clinics ([@B12]; [@B40]). Therefore, new effective treatments for DBD are urgently needed. In the treatment of diabetic OAB, traditional Chinese medicine and natural plant components have recently attracted increasing attention due to their safeness, few side effects, and excellent activity ([@B41]). SQW is a traditional Chinese herbal formula that was first recorded on Fu Ren Liang Fang in the Southern Song Dynasty (between 1127 and 1279 CE). This medicine is a mixture of three Chinese medicines: roots of Lindera aggregata (Sims) Kosterm. (Lauraceae), roots of Alpinia oxyphylla Miq., (Zingiberaceae), and rhizomes of Dioscorea oppositifolia L. (Dioscoreaceae) at a 1:1:1 ratio ([@B14]). SQW has been used to treat lower urinary tract symptoms, such as nocturia, urgency, and child bedwetting for hundreds of years ([@B4]). We have recently reported that SQW had therapeutic effects on the OAB of bladder outlet obstruction rat models by modulating the TRPV1 expression ([@B18]). In China, SQW is often used in the clinical treatment of diabetic OAB. However, its mechanism remains unclear, and its therapeutic effect has not been investigated in animal studies. Therefore, we designed experiments to explore the effects and therapeutic mechanisms of SQW in diabetic OAB mouse model. Materials and Methods {#s1} ===================== Reagents and Materials ---------------------- Suo Quan Wan was purchased from Hunan Hansen Pharmaceutical Co., Ltd. (China), and the quality control was provided by the company based on Chinese Pharmacopeia employing by high performance liquid chromatography (HPLC) technology from SQW samples ([@B9]). Three Chinese herbals were ground and mixed evenly at a 1:1:1 ratio and appropriate volumes of distilled water were used to make these powders to SQW compound. The doses were adopted according to the Experimental Methodology of Pharmacology, based on clinical usage, the Bios method ([@B39]). SQW H was 2.208 g/kg, SQW M was 1.104 g/kg, and SQW L was 0.552 g/kg. The tolterodine dose for the positive group was 0.82 mg/kg. Streptozotocin was purchased from TOKU-E Co., Ltd. (Japan). HFD (45% fat) and control diet were purchased from Guangdong Medical Laboratory Animal Center (China). Tolterodine was purchased from Chengdu Dikang Pharmaceutical Co., Ltd. (China). Roche dynamic Bg meter was purchased from Hoffmann-La Roche Inc. (Switzerland), and carbachol was obtained from Shandong Bausch & Lomb Freda Pharmaceutical Co., Ltd. (China). α,β-methylene ATP was purchased from Tocris Bio-Techne Ltd. (United Kingdom). FastQuant RT Kit (with gDNAse) and Talent qPCR PreMix (SYBR Green) were purchased from TIANGEN Biotech (Beijing) Co., Ltd. (China). TRIzol reagent was purchased from Thermo Fisher Scientific (United States). RIPA lysis buffer and protease inhibitor cocktail (100×) were obtained from CoWin Biosciences (China). All other reagents used were of analytical grade. Preparation and HPLC Conditions of SQW -------------------------------------- Suo Quan Wan samples were weighted 0.3 g and extracted with 25 mL of methanol-hydrochloric acid solution using heating reflux method and then cool the solution. Finally, the solution was filtered through 0.45 μm nylon membranes before injection. According to the Chinese pharmacopoeia 2015, the content of norisoboldine should be more than 0.4 mg/0.3 g, and the content of allantoin is more than 0.48 mg/0.3 g. The HPLC conditions and gradient elution were shown as [Tables 1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}. ###### Chromatographic condition for norisoboldine. Column C18 (25°C) ------------ ----------------------------------------- ------- Solvent A Acetonitrile Solvent B 0.5% formic acid and 0.1% triethylamine Flow rate 1.0 mL/min Wavelength 280 nm Time (min) A (%) B (%) 0 10 90 13 22 78 30 22 78 ###### Chromatographic condition for allantoin. Column C18 (25°C) ------------ ------------ ------- Solvent A Methanol Solvent B H~2~O Flow rate 1.0 mL/min Wavelength 191 nm Time (min) A (%) B (%) 0 8 92 10 10 90 20 10 90 Animal Model and Treatment -------------------------- All experimental protocols and animal procedures complied with the ethical principle guidelines of the National Research Council. A total of 100 male C57BL/6J mice (18--22 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed in the Experimental Animal Center of Guangzhou University of Chinese Medicine (No. S2017051, Guangzhou, China) under room temperature and exposed to a 12 h/12 h light--dark cycle, with free access to food and water. The animals were fed with normal diet for 3 days and then divided into two groups, namely, diabetic (n = 85) and control (n = 15) groups. The mice in the diabetic group were fed with HFD, whereas those in the control group received normal diet. After 4-week feeding, the mice in the diabetic group were injected with STZ at 100 mg/kg dissolved in citrate buffer for four times (0.05 M, pH 4.3--4.5). The mice in the control group were treated with an equal volume of vehicle (0.05 M citric acid, pH 4.3--4.5). Fasting Bg (FBG) was measured using an ACCU-CHEK advantage Bg monitoring system (Roche, Indianapolis, IN, United States) through the tail vein 72 h after the last injection. The mice with FBG levels above 11.1 mmol/L were considered diabetic and selected for subsequent experiments. The mice in the diabetic group were divided into five groups: model (n = 13), positive (tolterodine, 0.82 mg/kg, n = 13), high-dose (SQW H, 2.208 g/kg, n = 13), medium-dose (SQW M, 1.104 g/kg, n = 13), and low-dose (SQW L, 0.552 g/kg, n = 13) groups. After 3-week feeding, the six mouse groups individually received oral gavage of distilled water (control and model group mice), tolterodine, SQW H, SQW M, and SQW L for 3 weeks. During the experiment, the mice in the control group were given normal diet, whereas those in the other groups were continually fed with HFD. FBG Test and Oral Glucose Tolerance Test (OGTT) ----------------------------------------------- Fasting blood glucose test and OGTT were conducted after the 3-week SQW treatment. All animals were fasted overnight, and the Bg concentration was measured using a glucometer (ACCU-CHEK active) through a drop of tail blood. All the mice were then given with glucose (2 mg/g body weight) by gavage, and tail blood samples were obtained at 0, 15, 30, 60, 90, and 120 min to measure the Bg concentration. The area under the curve of the Bg time course from 0 to 120 min (AUC~0-2~ ~h~) was calculated according to the following formula: AUC 0 − 2 h = \[ ( Bg 0 \+ Bg 15 ) \] × 0.5 \] ÷ 4 \+ \[ ( Bg 15 \+ Bg 30 ) × 0.5 \] ÷ 4 \+ \[ ( Bg 30 \+ Bg 60 ) × 0.5 \] ÷ 2 \+ \[ ( Bg 60 \+ Bg 120 ) × 0.5 \] Measurement of Water Intake, Urine Output, and Frequency -------------------------------------------------------- The mice were placed individually in metabolic cages for 24 h with food and water ad libitum. Water intake was measured based on the water consumption for 24 h. Urine output and micturition frequency were analyzed through the VSOP test. Urine output was measured by evaluating the volume of urine in the collector after the mice were placed in the cages for 5 h. Micturition frequency was measured by visualizing and analyzing the collected papers, which were placed under the metabolic cage for 5 h under ultraviolet light to identify the area of urine spots ([@B38]). The sizes of the urine spots were divided into two levels, namely, bigger volume (\>50 μL) and smaller volume (\<50 μL) voids, to measure the micturition frequency. Urodynamic Test --------------- The urodynamic test was performed using a micro-injection pump and urodynamic measuring device (Laborite Delphis 94-R01-BT, Canada). All mice were anesthetized by the intraperitoneal injection of 25% urethane (2.0 mg/kg). A ventral midline incision was made to expose the bladder, and a 25-gauge needle was inserted into the bladder dome and fixed with silk suture. The needle was connected through a three-way adapter, which was connected with urodynamics at one end and a micro-injection pump at the other. After the bladder was emptied, 0.9% saline solution was injected into the bladder through the micro-injection pump at a rate of 3 mL/h. Pumping was stopped immediately when urine was observed at the external urethra. The bladder pressure line was automatically recorded with a computer. Urodynamic test parameters included the frequency of NVC (higher than 4 cm H~2~O spontaneous bladder contraction that did not result in urination before first urination) frequency, MBC (the volume of saline pumped before first urination), maximum voiding pressure (MP, the maximum peak pressure reached during micturition), RV (manually drained and measured with 1 mL syringe), MV (calculated as MBC - RV), VE (calculated as \[(MBC - RV)/MBC\] × 100%), and BC \[calculated as (MBC/MP) × 100%\]. The mice were euthanized at the end of the experiment through cervical dislocation ([@B19]). Histological Test ----------------- After the mice were euthanized, the bladders were excised and fixed using 4% paraformaldehyde solution for approximately 24 h at room temperature. After fixation, the bladders were conventionally dehydrated and embedded in paraffin. The tissues were cut into 6 μm thickness and stained with hematoxylin and eosin (HE) and Masson's trichrome. The color segmentation of Masson's trichrome was used to identify the whole cross-sectional area and the tissue areas that were stained "pink" (urothelium), "blue" (collagen), and "red" (smooth muscle). The HE images (100×) were used to determine the BWT, whereas the Masson's trichrome stained images (100×) to measure the smooth-muscle-to-collagen ratio. The stained bladder sections were examined under a light microscope, and representative images were photographed with a digital camera mounted on the microscope. All the images were analyzed using image analysis software (Image Pro 6.0). Assessment of Detrusor Smooth Muscle Contractility Study in vitro ------------------------------------------------------------------- The mice were executed, and the bladders were excised at the bladder neck. Full-thickness longitudinal DSM strips (0.7--1 mm × 5 mm) were obtained and mounted in a 5 mL organ bath filled with Krebs-Henseleit solution (NaCl, 118 mM; KCl, 4.75 mM; MgSO~4~, 1.18 mM; NaHCO~3~, 24.8 mM; KH~2~PO~3~, 1.18 mM; CaCl~2~ 2.5 mM; and C~6~H~12~O~6~⋅H~2~O, 10 mM; pH = 7.4) bubbled with a mixture of 5% carbon dioxide and 95% oxygen at 37°C. One side of the strip was attached to the hook with silk suture, and the other side was connected to the force signal transducer ([@B38]). The passive tension was loaded at 0.5 g, and the tissues were equilibrated for 60 min before the experiments. The forced change signals of the DSM strips were recorded with a PowerLab recorder. Purinergic agonist, α,β-methylene ATP (100 μM) was added to the organ bath twice (30 min between each assay) to measure the difference in the contractile responses. The contraction of bladder tissue to electrical field stimulation (EFS, 1, 2, 4, 8, 16, 32, and 64 Hz; 40 V; and 0.5 ms pulse duration for 10 s) was also measured. Furthermore, tests for dose--response curve to carbachol (10^-8^--10^-5^ M) and the contractile response to KCl (120 mM) were performed in the DMS strips. At the end of the experiments, the weight and length of each detrusor strip were recorded. Real-Time RT-PCR ---------------- The total RNA from the whole bladder samples were extracted using TRIzol Reagent (Invitrogen, United States). The absorption of the samples at 260 and 280 nm was used to estimate the RNA quality. A260/A280 was used to check the purity, and A260 values confirmed the concentration of RNA (Shimadzu BioSpec-nano, Japan). The total RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit with gDNA eraser (TIANGEN, China). Real-time PCR analysis was performed using SYBR Green (TIANGEN, China) according to the manufacturer's instructions. Synthetic oligonucleotide primers were designed to amplify the cDNA for the genes encoding the myosin Va, SLC17A9, and β-actin. [Table 3](#T3){ref-type="table"} shows the primer pairs. The reaction program was presented as follows: 95°C for 3 min, followed by 39 cycles at 95°C for 5 s and 55°C for 10 s. Results were recorded and analyzed using complementary software, and the gene expression levels were calculated by 2^-ΔΔCt^ method. The target gene expression levels were individually normalized according to the β-actin expression. ###### Primer sequences of myosin Va, SLC17A9, and β-actin. Gene Primers (5′--3′) ----------------- ------------------------ myosin Va - F AGCTCAACTCCTTCCACTC myosin Va - R ACACACCCCTTTATCCTTCC SLC17A9 - F GCTTCCTCAAGGCTATGATCTT SLC17A9 - R AGGTCCTGAATGTTGACTGAAA β-actin - F CTACCTCATGAAGATCCTGACC β-actin - R CACAGCTTCTCTTTGATGTCAC Western Blot Analysis --------------------- The bladder tissues were homogenized using tissue grinders (Shanghai Jingxin, Shanghai, China) at 65 Hz for 2 min to extract the total protein. BCA protein assay Kit (Beyotime Biotechnology, China) was used to measure the protein concentration. Equivalent proteins (20 μg) were subjected to 10% or 8% SDS-PAGE at 80 V for 30 min or 120 V for 60 min, respectively, to separate the proteins of different molecular weights and transfer to the PVDF membranes using the transblotting apparatus (Bio-Rad Laboratories, Hercules, CA, United States) for 55 or 110 min, respectively, at 300 mA. The PVDF membranes were blocked with 5% (w/v) non-fat milk buffer at room temperature for 2 h and incubated with a primary antibody in TBST \[Myosin Va (1:1000, Santa Cruz), SLC17A9 (1:1000, MBL), or β-actin (1:1000, 4A Biotech)\] overnight at 4°C. The immune-labeled membranes were washed three times with TBST for 15 min each time, and then conjugated with a secondary antibody (1:5000, 4A Biotech) at room temperature for 2 h. After the non-binding secondary antibodies were washed away, the target protein bands were visualized using a chemiluminescent reagent (Millipore, United States). Data were processed using ImageJ, and the immunoblot protein expression levels of myosin Va and SLC17A9 were normalized using β-actin. The antibodies used in the present study are listed in [Supplementary Table 1](#SM1){ref-type="supplementary-material"}. Statistical Analysis -------------------- All data were expressed as mean ± SD. Statistical analyses were performed using SPSS 19.0 (SPSS, United States). The amplitude of contractile responses to stimulus was recorded in tension (Newton) and normalized by the weight (g) of the detrusor strips ([@B5]). Western blot analysis data were processed using ImageJ. Histological test images were analyzed using Image-Pro Plus 6.0, and one-way ANOVA was used for data analysis. P \< 0.05 was considered statistically significant. Results ======= HPLC Analysis of SQW -------------------- For quality assessment of SQW, HPLC analysis was conducted. The detection wavelength of norisoboldine was set at 280 nm and the allantoin was set at 191 nm. The retention times of norisoboldine and allantoin were detected at approximately 17.960 and 11.632 min, respectively ([Figure 1A](#F1){ref-type="fig"}--[D](#F1){ref-type="fig"}). According to the chromatograms results, the contents of norisoboldine and allantoin in SQW sample were 0.72 mg/0.3 g and 0.73 mg/0.3 g, respectively, indicating that the SQW samples meet the requirement. ![HPLC chromatogram of standards and samples; (A) norisoboldine standard; (B) norisoboldine sample; (C) allantoin standard; (D) allantoin sample.](fphar-10-00552-g001){#F1} General Characteristics of the Diabetic Model --------------------------------------------- Compared with the mice in the control group, the T2DM mice exhibited diabetes characteristics, including significantly reduced weight (P \< 0.01) and increased water intake (P \< 0.01), urine volume (P \< 0.01), Bg levels \[high FBG (P \< 0.01), OGTT (P \< 0.01), and AUC~0-2h~ (P \< 0.01)\]. No considerable differences in these parameters were observed among the mice in SQW and model groups ([Figure 2A](#F2){ref-type="fig"}--[F](#F2){ref-type="fig"}). ![Effects of SQW on the general characteristics of diabetic model after the 3-week treatment (n = 8). (A) Weight, (B) water intake, (C) 5 h urine volume, (D) FBG, (E) OGTT, and (F) area under the curve of AUC~0-2~ ~h~ (calculated according to the following formula: AUC~0-2h~ = \[(Bg0 + Bg15) × 0.5\] ÷ 4+ \[(Bg15 + Bg30) × 0.5\] ÷ 4+\[(Bg30 + Bg60) × 0.5\] ÷ 2+\[(Bg60 + Bg120) × 0.5\]). Data represent the means ± SD (model vs. control group, ^∗∗^P \< 0.01 or ^∗^P \< 0.05).](fphar-10-00552-g002){#F2} VSOP and Urodynamic Tests ------------------------- The representative urodynamic response curves of each group are presented in [Figure 3](#F3){ref-type="fig"}. The urinary voiding patterns showed that the frequencies of bigger volume voids (\>50 μL) and smaller volume voids (\<50 μL) were higher in diabetic mice than in the controls [Figure 4A](#F4){ref-type="fig"}. Treatment with SQW M markedly decreased both frequencies (P \< 0.05), whereas treatments with SQW H and SQW L reduced the frequencies of smaller volume and bigger volume voids, respectively. In addition, urodynamic test revealed that compared with the controls, the diabetic mice had significantly increased NVC, MBC, RV, and BC (P \< 0.01) but markedly decreased VE (P \< 0.01), thereby showing typical DBD in the early compensated phase ([Figure 4B](#F4){ref-type="fig"}--[F](#F4){ref-type="fig"}). SQW M treatment remarkably decreased the NVC, MBC, RV, and BC (P \< 0.01 or P \< 0.05) but significantly increased the VE of the mice (P \< 0.01). Furthermore, treatments with SQW H and SQW L remarkably decreased the NVC of the mice (P \< 0.05). No significant differences in MP were found among the control, SQW-treated, and model mice ([Figure 4G](#F4){ref-type="fig"}). ![Representative urodynamic test recording from the six groups of mice. Red arrows indicate the micturition peaks, and black arrows represent the NVC frequency.](fphar-10-00552-g003){#F3} ![VSOP and urodynamic test results in all groups (n = 8). (A) Frequencies of bigger volume (\>50 μL) and smaller volume voids (\<50 μL); (B) Frequency of NVC before the first micturition; (C) MBC; (D) RV; (E) VE; (F) BC; and (G) MP. Data represent the means ± SD (model vs. control group, ^∗∗^P \< 0.01; treatment vs. model group ^\#^P \< 0.05 or ^\#\#^P \< 0.01).](fphar-10-00552-g004){#F4} Morphometric Analysis --------------------- The bladder weight (absolute and relative to body weight) was increased in the diabetic mice (P \< 0.01) but decreased in the SQW M- and SQW L-treated mice (P \< 0.05) compared with that in the controls ([Figure 5A,B](#F5){ref-type="fig"}). The results of the morphometric analysis were consistent with the bladder weight. The BWT was significantly increased in diabetic mice (P \< 0.01), but SQW treatment effectively inhibited this alteration ([Figure 5C](#F5){ref-type="fig"}). No substantial differences in the smooth-muscle-to-collagen ratio were observed among the control, SQW-treated, and model mice ([Figure 5D](#F5){ref-type="fig"}). ![Bladder weight and digital images (100×) of HE and Masson's trichrome staining from the six groups of mice (n = 8). (A) Bladder weight; (B) bladder-weight-to-body-weight ratio; (C) BWT measured from HE images; (D) smooth-muscle-to-collagen ratio determined by the Masson's trichrome images. Data represent the means ± SD (model vs. control group, ^∗∗^P \< 0.01; treatment vs. model group ^\#^P \< 0.05 and ^\#\#^P \< 0.01).](fphar-10-00552-g005){#F5} Contractility Studies in vitro -------------------------------- We found that the DMS strips of diabetic mice exhibited significantly higher amplitudes of spontaneous activity that those of the controls (P \< 0.01). SQW H and SQW M treatments markedly decreased this alteration (P \< 0.01) ([Figure 6A](#F6){ref-type="fig"}--[C](#F6){ref-type="fig"}). α,β-methylene ATP (100 μM), which is the P2X receptor agonist, caused higher contractions in the DMS strips of diabetic mice compared with those of the controls (P \< 0.01). α,β-methylene ATP (100 μM) was added twice to activate the bladder strip. The responses evidently increased in the first reaction but markedly decreased in the second response in the diabetic mice compared with those in the controls (P \< 0.05). SQW H treatment markedly reverted all these alterations (P \< 0.01 or P \< 0.05), and SQW M treatment decreased the ATP-induced contractions ([Figure 6D,E](#F6){ref-type="fig"}). In addition, the contractions caused by KCl (120 mM), EFS (1--64 Hz) were higher in the diabetic mice than in the controls (P \< 0.01 or P \< 0.05). The cumulative concentration -response curve of carbachol (10^-8^--10^-5^ M) was also higher in the diabetic mice than in the controls (P \< 0.01 or P \< 0.05). The contractions of the DSM strips were markedly decreased due to the treatment with SQW (P \< 0.01 or P \< 0.05) ([Figure 6F](#F6){ref-type="fig"}--[I](#F6){ref-type="fig"}). No significant differences in pEC50 were found among the control, SQW-treated, and model mice. The Emax of diabetic mice exhibited significantly higher than the controls (P \< 0.01). Positive and SQW-M treatments markedly decreased (P \< 0.01) ([Table 4](#T4){ref-type="table"}). ![DSM strips of diabetic mice exhibited high amplitudes of spontaneous activity and increased bladder contractions to stimuli, and SQW treatment inhibited the changes (n = 5). (A) Representative spontaneous contractions of the bladder detrusor strips from the mice in the six groups. Quantification of the (B) amplitude and (C) frequency of spontaneous contraction; (D) DSM strip contractions induced by α,β-methylene ATP (100 μM). (E) ATP ratio (calculated as \[before-cons -- after-cons\]/pro-cons), α,β-methylene ATP (100 μM)-induced contractions (two times added α,β-methylene ATP); (F) DSM strip contractions induced by KCl (120 mmol/L); and (G) DSM strip contractions induced by EFS (1--64 Hz); and (H) carbachol (10^-8^--10^-5^ M); (I) The cumulative concentration--response curves of carbachol. Data represent the means ± SD (model vs. control group, ^∗^P \< 0.05 or ^∗∗^P \< 0.01; treatment vs. model group, ^\#^P \< 0.05 or ^\#\#^P \< 0.01).](fphar-10-00552-g006){#F6} ###### The pEC50 and Emax of carbachol (means ± SD, n = 5). Group Dose pEC50 Emax ---------- ------------ ------------- -------------------- Control -- 5.68 ± 0.38 15.07 ± 4.51 Model -- 5.93 ± 0.20 27.58 ± 7.76^∗∗^ Positive 0.82 mg/kg 6.23 ± 0.21 18.14 ± 8.11^\#\#^ SQW-H 2.208 g/kg 5.97 ± 0.65 22.95 ± 7.78 SQW-M 1.104 g/kg 5.94 ± 0.32 16.86 ± 4.68^\#\#^ SQW-L 0.552 g/kg 6.15 ± 0.24 24.59 ± 6.60 Model vs. control group, ∗∗ P \< 0.01; treatment vs. model group \#\# P \< 0.01. Real-Time RT-PCR Analysis ------------------------- According to the results of RT-PCR analysis, the mRNA expression levels of myosin Va and SLC17A9 were significantly increased in the diabetic mice compared with those in the control mice (P \< 0.01 or P \< 0.05). The 3-week SQW M treatment, markedly decreased the mRNA expression levels of myosin Va and SLC17A9 (P \< 0.01 or P \< 0.05), whereas the SQW H and SQW L treatments reduced the myosin Va mRNA expression level only (P \< 0.01 or P \< 0.05) ([Figure 7A,B](#F7){ref-type="fig"}). ![Effects of SQW treatment on the mRNA expression levels of myosin Va and SLC17A9 in the bladder tissues (n = 8). Quantification of mRNA expression levels of (A) myosin Va and (B) SLC17A9 normalized with β-actin by 2^-ΔΔCt^ method. Data represent the means ± SD (model vs. control group ^∗^P \< 0.05 or ^∗∗^P \< 0.01; treatment vs. model group ^\#^P \< 0.05 and ^\#\#^P \< 0.01).](fphar-10-00552-g007){#F7} Western Blot Analysis --------------------- The protein expression levels of myosin Va, SLC17A9, and β-actin were evaluated through Western blotting. The results showed that the protein expression levels of myosin Va and SLC17A9 were significantly increased in the bladder tissues of diabetic mice compared with those in the controls (P \< 0.01). After the 3-week SQW treatment, SQW M treatment markedly decreased the protein expression levels of myosin Va and SLC17A9, whereas SQW H and SQW L treatments significantly reduced the protein expression of myosin Va only (P \< 0.01) ([Figure 8A,B](#F8){ref-type="fig"}). ![Representative immunoblots of the protein expression levels of myosin Va, SLC17A9; and β-actin and effects of SQW treatment on these expression levels in the bladder tissues (n = 8). Quantification of protein expression of (A) myosin Va and (B) SLC17A9 by normalizing with β-actin. Data represent the means ± SD (model vs. control group, ^∗∗^P \< 0.01; treatment vs. model group, ^\#\#^P \< 0.01).](fphar-10-00552-g008){#F8} Discussion ========== Diabetic bladder dysfunction is a major lower urinary tract complication of diabetes, but its molecular mechanism remains unknown. Several studies reported that rat models with STZ-induced T2DM usually exhibited major clinical urodynamic alterations ([@B11]; [@B22]; [@B38]). We have previously reported that TCM, namely SQW, had therapeutic effects on many lower urinary tract diseases, including operation-induced OAB and outlet obstruction ([@B18]). Two components (norisoboldine and allantoin) were detected as quality standards in SQW, and the results of HPLC showed that the active ingredient content met the standard. SQW is an oral traditional Chinese formula for the treatment of lower urinary tract diseases, and the oral dose is 5.4 g/day. The high dose in our study was double the clinical dose, and the middle dose was equation, while the low dose was half. Also, we calculated the equivalent doses of mice administration according to the equation ([@B39]). In the present study, we explored the effects and potential mechanism of SQW on diabetic OAB by using STZ-induced T2DM mouse model. The results of our research showed that the model mice were characterized by a range of T2DM symptoms, including abnormal fat, carbohydrate metabolism, and high Bg levels, thereby indicating the successful establishment of the T2DM model. Our VSOP and urodynamic tests showed significant alternations in the micturition of diabetic mice as characterized by increased frequency of voids (smaller micturition was apparent), NVCs, MBC, BC, and RV and markedly reduced VE after 6 weeks of hyperglycemia status. These results indicated that the diabetic mice entered the stage of OAB, which is consistent with those of previous studies ([@B22]; [@B38]). SQW treatment effectively improved the bladder function of the T2DM mice but did not change the high Bg status. In healthy bladders, the contractions caused by ATP were limited ([@B22]). However, in the early phase of DBD, the purinergic-induced contractions account for up to 150% compared with those in healthy individuals ([@B1]). The transfer of ATP-filled vesicles to the varicose membranes and the effects of DBD on the transfer mechanism were poorly explored. Recent studies have provided key information about the contributions of SLC17A9 and myosin Va in the storage and exocytosis of ATP in secretory vesicles ([@B31]; [@B6]). SLC17A9 is a vesicular nucleotide transporter that plays an essential role in the specific transport of ATP inside purinergic vesicles ([@B30]). This transporter was discovered in various invertebrates and vertebrates, indicating that the molecular mechanisms of purinergic transmission are common in animals ([@B31]). Accurate localization of the neurotransmitter-filled vesicles in varicose membranes is indispensable for exocytosis ([@B29]). The local transport of organelles, including purinergic vesicles, requires energy that is provided by molecular motors, such as myosin Va. Myosin Va is a subtype of the unconventional myosin V and is primarily expressed in the central and peripheral nervous systems and melanocytes ([@B35]). The structure of myosin Va is provided for the continuous forward transport of intracellular cargoes ([@B32]), and its movement changes with cargo binding ([@B15]). Recent studies reported that myosin Va played a key role in purinergic vesicular transport and was closely associated with ATP-containing vesicles by binding directly to SLC17A9 ([@B6]). These findings provided us the research direction to explore the effects of SQW and the alterations in purinergic vesicular transport in DBD mice. The results in vitro contractility study on the bladder were in accordance with the "temporal theory" of DBD. In the early phase, the DSM of diabetic mice exhibited markedly high amplitudes of spontaneous activity and increased responsiveness to stimuli, such as α,β-methylene ATP, KCL, EFS, and carbachol ([@B11]). In vitro studies the results showed that the DMS of diabetic mice exhibited markedly high amplitudes of spontaneous activity compared with those of the controls, and the waves were disordered. The frequency of spontaneous activity remained stable, which was consistent with a previous report ([@B38]). Compared with those of the controls, the contractile responses of the DSM strips of diabetic mice to α,β-methylene ATP were substantially increased during the first response but markedly decreased during the second time. These results suggested that the DSM strips of diabetics exhibited increased responsiveness to exogenous purinergic agonists, and the bladder remained high responsiveness after the first stimulate in diabetic mice. In agreement with the above findings, the contractions of DSM strips to KCL, EFS, and carbachol were high in the diabetic mice. After the 3-week SQW treatment, the mice in the SQW treatment groups displayed varying degrees of reduction for their contractile responses to all stimulus, especially to α,β-methylene ATP, as compared with the models. This result was consistent with those of VSOP and urodynamic test, thus further confirming the therapeutic effects of SQW in the OAB of diabetic mice. The hyper-responsiveness of diabetic DSM to α,β-methylene ATP, KCL, EFS, and carbachol reflects the changes at the neurotransmitter level and/or beyond the neurotransmitters related to the alterations in the upstream vesicular nucleotide transporters. Therefore, we evaluated the expression levels of protein and mRNA for myosin Va and SLC17A9. In the bladders of the models, we found high expression levels of protein and mRNA for myosin Va and SLC17A9, indicating that the increased expression of these genes is the potential pathogenic mechanism of diabetic OAB. Moreover, we found that the expression of levels of proteins and mRNA of myosin Va and SLC17A9 were significantly decreased after SQW treatment, suggesting that the downregulation of expression levels of myosin Va and SLC17A9 contributes to the therapeutic effect of SQW in DBD. In this study, SQW was demonstrated to have effective treatment on DBD, and the possible mechanisms were also explored. However, the active ingredients of SQW are unclear, since the complexity of its component. To further explore the major effective ingredient in SQW is our goal in the future. We want to explore weather a single herbal has effects in DBD. In the present study, we explored the effects and potential mechanism of SQW on diabetic OAB by using STZ-induced T2DM mouse model. SQW is one of the most commonly traditional Chinese formula to treat various urinary system diseases in China for thousands of years ([@B18]), such as urinary incontinence, nocturnal enuresis and OAB symptom syndrome ([@B19]; [@B21]). And diabetic OAB has the same symptom like nocturia and urgency, SQW also was used to treat DBD or combined with other drugs in clinical ([@B25]; [@B8]). Studies has already found some mechanisms, such as β receptor, P2X, TRPV1 ([@B19]; [@B42]), but its complicated. We intend to conduct further research, learn its potential herbal components. Study found that radix linderae extracts have effects on OAB and diabetic bladder ([@B34]; [@B43]). The main components in radix linderae is norisoboldine and ursolide ([@B7]; [@B27]). We intend to conduct further research on efficacy and mechanism using the component in radix linderae. Conclusion ========== In summary, our study revealed that HFD with STZ-induced T2DM model mice showed OAB symptoms after 6 weeks of hyperglycemia status. In addition, the traditional Chinese formula, SQW, exhibited therapeutic effects on the OAB of model mice. SQW directly targeted the bladder, rather than improving the Bg levels. The mechanism was related to the inhibition of the transmission of purinergic neurotransmitters in the bladder of diabetic mice by downregulating the expression levels of myosin Va and SLC17A9. Ethics Statement ================ This study was carried out in accordance with the ethical principle guidelines of the National Research Council. The experimental protocol was approved by the Committee on Ethics of Guangzhou University of Chinese Medicine. Author Contributions ==================== H-yC conceived and designed the study. PH directed the experiments. JW, X-fY, W-jL, RW, L-yT, W-kR, L-jF, F-jC, and D-wL constructed the animal model. JW, X-fY, and Y-fX analyzed the data and drafted the manuscript. D-wL made a great contribution in the revision of the later articles. All authors read and approved the final manuscript. Conflict of Interest Statement ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding. This study was supported by the National Natural Science Foundation of China (Grant No. 81673676) entitled "Effect and Mechanism of SQW on Neurotransmission Abnormality in the Treatment Recovery of Diabetic Cystopathy" and the Science and Technology Bureau (Grant No. 2019622101002). The authors thank the School of Fundamental Medical Science, Guangzhou University of Chinese Medicine for technical support and the Hunan Hansen Pharmaceutical Co., Ltd. for providing quality control materials. Supplementary Material ====================== The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fphar.2019.00552/full#supplementary-material> ###### Click here for additional data file. ANOVA : analysis of variance BC : bladder compliance Bg : blood glucose BWT : bladder wall thickness DBD : diabetic bladder dysfunction DSM : detrusor smooth muscle EFS : electrical-field stimulation FBG : fasting blood glucose HFD : high-fat diet MBC : maximum bladder capacity MV : micturition volume NVC : non-voiding contraction OAB : overactive bladder OGTT : oral glucose tolerance test RV : residual volume SD : standard deviation SQW : Suo Quan Wan SQW H : high-dose SQW SQW L : low-dose SQW SQW M : medium-dose SQW STZ : streptozotocin T2DM : type 2 diabetes mellitus VSOP : voided stain on paper VE : voided efficiency [^1]: Edited by: Adolfo Andrade-Cetto, National Autonomous University of Mexico, Mexico [^2]: Reviewed by: Geng Wenye, Fudan University, China; Fabiola Zakia Mónica, Campinas State University, Brazil [^3]: ^†^These authors have contributed equally to this work [^4]: This article was submitted to Ethnopharmacology, a section of the journal Frontiers in Pharmacology	{ "pile_set_name": "PubMed Central" }
Elena Cuza Elena Cuza (17 June 1825 – 2 April 1909), also known under her semi-official title Elena Doamna, was a Moldavian, later Romanian noblewoman and philanthropist. She was princess consort of the United Principalities and the wife of Alexander John Cuza. Biography The daughter of postelnic Iordache Rosetti, a high-ranking boyar of the Rosetti family, she was also closely related to the Sturdzas and other families of boyars. Born in Iaşi, she married Cuza in 1844 — their relationship soured soon after, as Elena was not able to bear a child. However, she later raised as her own children his two sons by his mistress, Elena Maria Catargiu-Obrenović. She remained, however, very devoted to her husband in their public life, and was responsible for securing his flight from the country in 1848, after Prince Mihail Sturdza began arresting participants in the Moldavian revolutionary movement. They returned after the start of Grigore Alexandru Ghica's rule, but Elena suffered from depression after Cuza began engaging in adulterous affairs and left for Paris, France until 1853. After her return, she became almost completely estranged from her husband, who kept as his mistress Elena Maria Catargiu-Obrenović, the mother of Milan Obrenović (future Prince of Serbia). Elena left for Paris and remained there until 1862, long after the ad hoc Divan had elected Cuza ruler; she had been persuaded to do so by the writer and political figure Vasile Alecsandri, who tried to extinguish the scandal provoked by Cuza's marital neglect. As wife of the head of state, she became noted for her charity work (the building of the Elena Doamna Asylum in Cotroceni, Bucharest) and adopted orphans, including the illegitimate children of her husband — Alexandru Al. Ioan Cuza and Dimitrie Cuza; Elena Cuza took over, furnished, and maintained the private residence in Ruginoasa, Iaşi County, and was responsible for the Neo-gothic style of its decorations. During the coup d'état against her husband (22 February 1866), she was isolated in her apartments by the conspirators, who burst in on Cuza as he was spending the night with Maria Catargi-Obrenović. Both she and Maria joined Cuza in his European exile. After her husband's death in 1873, she took care of their children, and lived to see the death of her two adoptive sons (Alexandru, was the husband of Maria Moruzi - she was later married, for just one day, with the National Liberal leader Ion I. C. Brătianu, and gave birth to the historian and politician Gheorghe I. Brătianu). References Radu R. Florescu, "Elena Cuza - dincolo de legendă", in Magazin Istoric, January 1998 Petre Otu,"«Adevărul rămâne oricare ar fi soarta celor care l-au servit». Gh.I.Brătianu — un istoric printre politicieni", in Dosarele Istoriei, 1/VI, 2001 External links Category:1825 births Category:1909 deaths Category:People from Iași Elena Category:Members of the Romanian Orthodox Church Category:Romanian philanthropists Category:Romanian royalty Category:Spouses of national leaders Category:Royal consorts of Wallachia Category:Royal consorts of Moldavia Category:19th-century philanthropists	{ "pile_set_name": "Wikipedia (en)" }
1844 United States presidential election in North Carolina The 1844 United States presidential election in North Carolina took place between November 1 and December 4, 1844, as part of the 1844 United States presidential election. Voters chose 11 representatives, or electors to the Electoral College, who voted for President and Vice President. North Carolina voted for the Whig candidate, Henry Clay, over Democratic candidate James K. Polk. Clay won North Carolina by a margin of 4.63%. With 52.39% of the popular vote, North Carolina would be Henry Clay's fourth strongest state after Rhode Island, Vermont and Kentucky. This was also the last presidential election until 1992 when a Democrat would win without carrying the state of North Carolina. Results References North Carolina 1844 Category:1844 North Carolina elections	{ "pile_set_name": "Wikipedia (en)" }
Introduction {#Sec1} ============ Coronary heart disease is one of the leading causes of mortality in the world today (MacKay & Mensah, [@CR27]; Murray & Lopez, [@CR31]), and although new cardiac treatments have helped fight coronary heart disease in recent years, an estimated 1/3 of coronary heart disease risk factors remain elusive (Gudnason, [@CR22]). The addition of psychological factors to standard biomedical risk factors may enhance the prediction of patients at risk. Initial research on the Type A behavior pattern suggested that psychological factors were related to increased risk of heart attacks, but further investigations on Type A behavior were inconclusive (Rozanski et al., [@CR44]). Subsequently, researchers turned their focus towards isolated factors such as hostility, depression, anxiety, social isolation, and chronic stress (Matthews, [@CR29]; Rozanski et al., [@CR44], [@CR43]; Strike & Steptoe, [@CR51]) to document a relationship between psychological factors and poor cardiac prognosis (Rozanski et al., [@CR43]). Clustering of psychological factors within individuals enhances the risk of adverse health outcomes (Rozanski et al., [@CR43]; Strike & Steptoe, [@CR51]), and this clustering may partly be attributed to a specific vulnerability in the realm of personality (Dimsdale, [@CR16]). The distressed (Type D) personality construct was originally developed to identify cardiac patients who are vulnerable to emotional and interpersonal difficulties (Denollet, [@CR6]; Denollet et al., [@CR15]). Type D individuals tend to experience negative emotions (elevated score on negative affectivity) while not discussing them with others due to fear of rejection (elevated score on social inhibition) (Denollet et al., [@CR15]). Type D personality has been associated with poor quality of life and increased morbidity and mortality in cardiac patients (Denollet et al., 1996, [@CR11]; Kupper & Denollet, [@CR26]; Pedersen & Denollet, [@CR34]). The prevalence of Type D ranges from 28 to 32% across different cardiovascular conditions, including ischemic heart disease, chronic heart failure, and peripheral artery disease. The mortality risk incurred by Type D is 3-fold, with this risk being independent of disease severity, such as left ventricular dysfunction, and mood states such as anxiety and depression, and despite appropriate medical treatment (Pedersen & Denollet, [@CR34]). The mechanisms relating Type D personality with adverse prognosis in cardiac patients are generally not thought to derive from worse disease severity (de Jonge et al., [@CR5]; Nicholson et al., [@CR32]). Rather, negative health-related behaviors, such as smoking and poor treatment adherence (Kirkcaldy et al., [@CR25]; Pedersen et al., [@CR35]; Schiffer et al., [@CR47]), and dynamic physiological processes such as elevated cortisol levels (Molloy et al., [@CR30]; Whitehead et al., [@CR54]) and pro-inflammatory cytokines (Denollet et al., [@CR12]) have been suggested as possible contributing factors. Importantly, recent findings have casted doubt on the utility of using extent of coronary atherosclerosis as a surrogate means for inferring associations between psychological risk factors and adverse cardiovascular outcomes in cross-sectional data (Rozanski et al., [@CR45]). In the present study, we included assessment of extent of coronary artery disease to rule out the possibility of reverse causation, whereby disease severity can contribute to greater psychological distress and, in turn, may confound the assessment of Type D personality traits. In clinical and epidemiological research, Type D can be assessed with the standardized 14-item Type D Scale (DS14) that measures negative affectivity and social inhibition (7 items for each domain) (Denollet, [@CR7]). The DS14 scale has been validated in Belgian (Denollet, [@CR7]), Chinese (Yu et al., [@CR57]), Danish (Pedersen & Denollet, [@CR33]; Spindler et al., [@CR50]), Dutch (Denollet, [@CR7]), German (Grande et al., [@CR20]), Italian (Gremigni & Sommaruga, [@CR21]) and Ukrainian (Pedersen et al., [@CR37]) cardiac patients and healthy controls. However, only a few studies have examined how the Type D construct fits within the five-factor model of personality, and no study to date has tested how the social inhibition factor relates to emotional control. Hence, the objectives of the current study were (a) to evaluate the psychometric properties of the DS14 in Icelandic cardiac patients with a specific focus on the construct validity of Type D, (b) to examine whether assessment of Type D personality is confounded by worse disease severity in these patients and (c) to explore the association between Type D and health-related risk markers. Method {#Sec2} ====== Participants {#Sec3} ------------ This study included two cardiac patient samples. The first sample (cardiac sample I) consisted of 1,291 patients hospitalized for coronary angiography and/or percutaneous coronary intervention at Landspitali-university hospital in Reykjavik (May 2007--June 2008), the only hospital in Iceland where such operations are performed. These patients were approached when hospitalized to the coronary care unit, upon arrival to the emergency ward or by mail if they were on the waiting list for a coronary catheterization. Patients were eligible for participation only if they (a) underwent a coronary angiography or percutaneous coronary intervention during their current hospitalization; and (b) spoke and read Icelandic fluently. Forty-four patients were excluded because they either did not complete the DS14 (n = 34) or did not undergo coronary angiography (n = 10). The remaining 1,247 patients (875 men and 372 women) had a mean age of 64.8 years (SD 10.8), with women being significantly older than men (M = 63.3 (SD 11.0) vs. M = 68.2 (SD 9.5), t~(1,245)~ = 7.57, P \< 0.001). This patient sample was included in the study to (a) estimate the factor structure of the DS14 scale, and (b) examine whether the assessment of Type D personality is confounded by the severity of underlying coronary artery disease. The second sample (cardiac sample II) consisted of 161 patients from the coronary care unit, and from the heart failure clinic of the Landspitali-university hospital (February--March 2006 and November 2006--April 2007). This sample was included in the study to examine more extensively the validity of the Type D personality construct in Iceland, and how it is related to health-related risk markers. To this end, these patients completed additional measurements that were not administered in the larger cardiac sample I. Four patients were excluded from analysis due to incomplete questionnaire data. The final sample included 157 participants (118 males and 39 females) with an average age of 61.7 years (SD 11.3), and again women tended to be older than men (M = 60.2 (SD 11.1) vs. M = 66.4 (SD 11.0), t~(150)~ = 3.03, P \< 0.01). Baseline characteristics for the two participant samples are presented in Table [1](#Tab1){ref-type="table"}. Patients in cardiac sample I were older on average compared to patients in cardiac sample II (t~(1,397)~ = 3.24; P ≤ 0.001), but gender distribution was similar in the two samples ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \chi_{(1,n\,=\,1,404)}^{2} $$\end{document}$ = 1.68, P = 0.20). The majority of patients in cardiac sample I had coronary artery disease (55%) or had experienced one or more heart attacks (23%), while patients with a history of one or more heart attacks (41%) and heart failure (24%) were more prominent in cardiac sample II.Table 1Baseline characteristicsCardiac sample I (n = 1,247)Cardiac sample II (n = 157)Age (years)Mean (SD)64.8 (10.8)61.7 (11.3)GenderMales70% (875)75% (118)Heart diseaseHeart failure2% (22)24% (38)Pacemaker and cardiac arrhythmia7% (89)11% (17)≥1 heart attacks23% (290)41% (64)Coronary artery disease55% (678)10% (16)Hypertension7% (92)11% (17)No disease6% (73)0 (0%)Unknown0.2% (3)3% (5)Data are presented as percentages (n) unless otherwise specified The study protocol was approved by the medical ethics committee of the National Bioethics Committee in Iceland. The study was conducted to conform to the ethical tenets developed by the World Medical Association, as espoused in the Declaration of Helsinki. All patients provided written informed consent. The DS14 scale {#Sec4} -------------- The DS14 is a 14-item questionnaire comprised of two seven-item subscales (Denollet, [@CR7]), measuring the tendency to (a) experience negative emotions (negative affectivity) and (b) inhibit self-expression in social interactions (social inhibition). The answering format is on a five-point Likert scale, ranging from 0 (false) to 4 (true), with total scores ranging from 0 to 28 for each subscale. Items include "I am often irritated" (negative affectivity) and "I am a closed kind of person" (social inhibition). The original Dutch DS14 was translated into Icelandic by four researchers. They received aid from two fluent Dutch speakers who independently translated the DS14 items from Dutch to Icelandic; a translation group examined the two independent translations, and one final version was constructed. Subsequently, the final Icelandic version was back-translated and compared to the original Dutch version to ensure accuracy. Participants were defined as having a Type D personality if they scored ≥10 on both negative affectivity and social inhibition. This cut-off value has been used in previous research (Denollet, [@CR7]; Emons et al., [@CR17]), and is derived from the median split on negative affectivity and social inhibition scores of participants in those studies. A recent study using item-response theory has shown the cut-off ≥10 on both subscales to be the best to distinguish between Type D and non-Type D individuals, as all items had the highest measurement accuracy around that cut-off (Emons et al., [@CR17]). Construct validity {#Sec5} ------------------ To evaluate the construct validity of the Icelandic DS14 scale, the NEO-five-factor inventory (NEO-FFI) (Costa & McCrae, [@CR3]), emotional control questionnaire (ECQ) (Roger & Najarian, [@CR41]; Roger & Nesshoever, [@CR42]), hospital anxiety depression scale (HADS) (Zigmond & Snaith, [@CR58]) and perceived stress scale (PSS) (Cohen et al., [@CR1]) were administered in Cardiac sample II. The NEO-FFI is a 60-item self-report scale which assesses five broad personality traits from the five-factor model of personality, that is neuroticism (e.g. anxiety, impulsiveness, vulnerability), extraversion (e.g. sociability, activity, positive emotions), openness (e.g. fantasy, feelings, artistic), agreeableness (e.g. trust, straightforwardness, altruism) and conscientiousness (e.g. achievement striving, dutifulness, self-discipline) (Costa & McCrae, [@CR3]). The scale contains 12 statements for each trait, and respondents answer on a five-point Likert scale (ranging from strongly disagree (0) to strongly agree (4)) how each statement refers to them. The psychometric properties of the Icelandic version of the NEO-FFI are acceptable and the test--retest reliability and internal consistency deemed sufficient (Jónsson, [@CR24]), with Cronbach's alpha ranging from 0.71 to 0.88 for the five traits (Svansdóttir, [@CR53]). The emotional control questionnaire or ECQ measures how easily people express and control their emotions (Roger & Najarian, [@CR41]; Roger & Nesshoever, [@CR42]). The scale includes 56 items which are divided into four factors (emotional inhibition, aggression control, benign control and rehearsal), but in this study a shorter 20-item version measuring rehearsal and emotional inhibition only was used (Roger et al., [@CR40]). Rehearsal refers to the tendency of individuals to ruminate over emotionally distressing events while emotional inhibition assesses to what extent people express their emotions. The response format for each item ranges from strongly disagree (1) to strongly agree (4). The Icelandic version of this scale has adequate psychometric properties with Cronbach's alpha reliability coefficients of α = 0.83 for rehearsal and α = 0.74 for emotional inhibition (Ingibergsdóttir, [@CR23]). The HADS is a 14-item questionnaire that measures symptoms of depression and anxiety in physically ill people (Zigmond & Snaith, [@CR58]). The questionnaire contains seven statements for each mood status. Participants rate on a four-point scale (0--3) how well each statement refers to them. Total scores range from 0 to 21 for each domain. The Icelandic version of the HADS identifies symptoms of depression and anxiety sufficiently well (Schaaber et al., [@CR46]), with reliability estimates ranging from α = 0.78--0.86 for anxiety and α = 0.65--0.85 for depression (Smari et al., [@CR49]). The PSS or perceived stress scale is a 14-item measure of self-appraised stress (Cohen et al., [@CR1]). Items include for instance "In the last month, how often have you felt that you were unable to control the important things in your life?" The response format is on a five-point Likert scale ranging from never (0) to very often (4), and total scores range from 0 to 56. The scale has good psychometric properties (Cohen et al., [@CR1]; Cohen & Williamson, [@CR2]) and correlates with social anxiety and depression symptoms (Cohen et al., [@CR1]). The Icelandic version of PSS has comparable psychometric properties to the original language version (Davíðsdóttir & Bachman, [@CR4]) with Cronbach's alpha = 0.89 in a university student sample (Svansdóttir, [@CR53]). Disease severity {#Sec6} ---------------- Disease severity, defined by how many coronary arteries were affected by coronary artery disease (i.e. normal arteries, 1, 2, or 3 arteries affected, and main stem narrowing) was derived from results of the coronary angiography in cardiac sample I. Angiography results were inconclusive for one person, which was excluded from this analysis. Information on disease classification, categorized as hypertension, coronary artery disease, previous heart attacks, pacemaker/arrhythmias and heart failure, was obtained from medical staff and/or retrieved from medical records. Information concerning disease classification was missing for three patients in cardiac sample I (0.2%) and five patients in cardiac sample II (3.2%). Health-related risk markers {#Sec7} --------------------------- Participants in cardiac sample II provided information by self-report regarding certain health-related risk markers. These included (a) smoking status (never, ex-smoker, current smoker); (b) amount of smoking per day (0--10 cigarettes, 10--20 cigarettes, 20--30 cigarettes, and \>30 cigarettes a day); (c) duration of smoking (0--5 years, 5--10 years, 10--20 years, \>20 years); (d) previous mental problems, i.e. "Have you experienced any significant mental problems in the past?" (yes, no); and (e) psychopharmacological medication use, i.e. "Have you used one or more of the following medications for more than two weeks in the past 12 months: sleeping pills, anxiety-reducing medications, antidepressants and sedatives?" (no, sleeping pills, anxiety-reducing medication, antidepressants, sedatives). Of note, due to a low incidence rate for each medication category, answers were recoded post-hoc to a binary variable containing the following distinction: no, I have not used any of these medications; yes, I have used one or more of these medications. Statistical analysis {#Sec8} -------------------- Principal axis factor analysis with direct oblimin rotation (delta = 0) was used to explore the factor structure of the DS14, using the scree plot and criterion of eigenvalues \> 1 to determine the number of factors to extract. A confirmatory factor analysis of the scale was performed to confirm the two-factor structure of the scale, using structural equation modeling (SEM) and the maximum likelihood method in AMOS 17 (Analysis of Moment Structures, Chicago, IL, USA). In the construction of the model, the theoretical foundation of the scale was taken into account. As the negative affectivity and social inhibition subscales each cover three different facets of negative affectivity and social inhibition, respectively, error covariance was added to items representing each facet, i.e. for items measuring the negative affectivity facets dysphoria (items 4, 7 and 13), worry (items 2 and 12) and irritability (items 5 and 9), and for items measuring the social inhibition facets discomfort in social interactions (6, 8 and 14), reticence (10 and 11) and social poise (items 1 and 3). Goodness of fit indexes used in the analysis included the Chi-square, the Comparative fit index (CIF) and the Root mean square error of approximation (RMSEA). For Chi-square, a value ≥ 0.05 indicates good fit (agreement with the null hypotheses that residuals are minimal and the data fit the model well). The Chi-square is influenced by sample size, which can lead to inflated Chi-square values and thus statistical significance, indicating bad fit (Schumacker & Lomax, [@CR48]). For the CFI, values close to 1 indicate a very good fit and values above 0.90 or close to 0.95 good fit. The RMSEA index should be ≤0.05 to indicate good fit, but levels ≤0.08 are considered to indicate adequate fit. Internal consistency of the scale was assessed with Mean inter-item correlation and Cronbach's alpha. Validity of the DS14 was estimated by exploring the Pearson's correlation between the negative affectivity and social inhibition subscales and similar constructs, i.e. neuroticism and extraversion, emotional inhibition and rehearsal, anxiety and depression and perceived stress. A factor analysis of scale scores on the DS14 scale, NEO-FFI, ECQ, HADS and PSS was executed to verify that (a) negative affectivity, neuroticism and rehearsal, and (b) social inhibition, introversion and emotional inhibition measure related constructs, and to test how anxiety, depression and stress would relate to the negative affectivity and social inhibition factors. Differences in disease classification by Type D personality were assessed with Kendall's Tau-c calculations, but patients with arrhythmias and pacemakers were excluded from the analysis due to the different nature of their disease. The Kendall's Tau-c was also employed to estimate differences in disease severity by Type D personality in cardiac sample I, in both the entire sample and among patients who had established coronary artery disease. Finally, Type D and non-Type D patients in cardiac sample II were compared on smoking behavior, prevalence of previous mental problems, and medication use with Chi-square tests for nominal variables and Tau-c for ordinal variables. Association strength was estimated with Cohen's D calculations for quantitative variables and odds ratios for categorical variables. The SPSS 17 statistical software for Windows was used for all main analysis (Statistical Package for Social Sciences, Chicago, IL, USA). Results {#Sec9} ======= Factor structure of the DS14 {#Sec10} ---------------------------- A principal axis factor analysis (direct oblimin rotation, delta = 0) in a combined sample of cardiac patients (n = 1,404) indicated a two-factor solution, which explained 46% of variance in the patient sample. These two factors clearly reflected the negative affectivity and social inhibition subscales, with satisfactory factor loadings (ranging from 0.47 to 0.75) and good internal consistency (negative affectivity: Cronbach's alpha = 0.85 and Mean inter-item correlation = 0.45; social inhibition: Cronbach's alpha = 0.84, Mean inter-item correlation = 0.43) (Table [2](#Tab2){ref-type="table"}).Table 2Factor analysis and reliability of the DS14 scale in a combined cardiac sample (n = 1,404)FactorsIIINegative affectivity items2. I often make a fuss about unimportant things0.610.104. I often feel unhappy0.740.075. I am often irritated0.730.047. I take a gloomy view of things0.63−0.149. I am often in a bad mood0.58−0.1312. I often worry about something0.600.0213. I am often down in the dumps0.73−0.12Cronbach's alpha0.85Mean inter-item correlation0.45Social inhibition items1. I make contact easily when I meet people0.140.723. I often talk to strangers0.160.616. I often feel inhibited in social interactions0.29−0.508. I find it hard to start a conversation0.10−0.7510. I am a closed kind of person0.12−0.6611. I would rather keep other people at a distance0.16−0.4714. When socializing I don't find the right things to talk about0.15−0.69Cronbach's alpha0.84Mean inter-item correlation0.43The highest loadings on the corresponding factor, Cronbach's alpha and mean inter-item correlations are presented in bold A confirmatory factor analysis of the two-factor structure of the Icelandic DS14 in the same sample indicated a good to adequate model fit for the unconstrained model (χ^2^ = 435.63, P ≤ 0.001; CFI = 0.953 and RMSEA = 0.063, 90% CI 0.058--0.069). Standardized regressional weights of items to factor ranged from 0.52 to 0.79 for negative affectivity and 0.44--0.80 for social inhibition (Fig. [1](#Fig1){ref-type="fig"}).Fig. 1Standardized regression weights for the 2-factor model of the DS14, representing negative affectivity (NA) and social inhibition (SI) Construct validity {#Sec11} ------------------ The convergent and construct validity of the Icelandic DS14 scale was evaluated by examining correlations of negative affectivity and social inhibition with similar construct measurements in cardiac sample II. The negative affectivity subscale had a high positive correlation with neuroticism (r = 0.80) and rehearsal (r = 0.58), while social inhibition was negatively correlated with extraversion (r = −0.65) and positively with emotional inhibition (r = 0.50), which further supports the divergent validity of the Type D factors and their individual attributes. Negative affectivity had a high correlation with anxiety, depression and stress scores, indicating that it clearly measures increased negative affect. An axis factor analysis (direct oblimin rotation, delta = 0) of scale scores confirmed that the negative affectivity and social inhibition subscales were differentially related to the five-factor model of personality; negative affectivity (loading = 0.79), neuroticism (0.78) and rehearsal (0.64) loaded on a single negative affectivity/neuroticism factor. Social inhibition (−0.95), extraversion (0.57) and emotional inhibition (−0.44) loaded together on a separate inhibition factor. Neither DS14 subscale was related to agreeableness, conscientiousness or openness of the five-factor model of personality. Anxiety (−0.50), depression (−0.73) and stress (−0.60) loaded together on a single factor termed "psychological well-being", but anxiety also had a considerable loading on the negative affectivity/neuroticism factor (0.49) (Table [3](#Tab3){ref-type="table"}).Table 3Correlations and results of a factor analysis of scale scores for the DS14, NEO-FFI, ECQ and HADS subscales and PSS scaleCorrelationNegative affectivitySocial inhibitionPattern matrixCardiac sample II (n = 157)IIIIIIIVVNegative affectivity--0.47\*0.79−0.14−0.09−0.070.04Social inhibition----0.11−0.950.11−0.050.05Neuroticism0.80\0.47\0.78−0.12−0.06−0.14−0.13Extraversion−0.48\−0.65\−0.090.570.12−0.020.17Agreeableness−0.33\−0.21\−0.28−0.030.07−0.350.17Conscientiousness−0.20\−0.25\−0.010.060.050.120.72Openness−0.02−0.07−0.020.060.01−0.45−0.09Rehearsal0.58\0.35\0.64−0.050.010.23−0.02Emotional inhibition0.25\0.50\−0.08−0.44−0.190.25−0.10Anxiety0.67\0.26\0.490.01−0.50−0.250.20Depression0.55\0.35\0.04−0.15−0.73−0.11−0.09Perceived stress0.38\0.18\0.040.05−0.600.23−0.09The highest loadings on the corresponding factor are presented in boldNEO-FFI NEO-five-factor inventory, ECQ Emotional control questionnaire, HADS Hospital anxiety and depression scale, PSS Perceived stress scale\* P \< 0.001 Prevalence of Type D personality {#Sec12} -------------------------------- Average scores on negative affectivity and social inhibition were equivalent in the two patient samples (negative affectivity: M = 8.6 (SD 5.6) vs. M = 8.8 (SD 5.9), t~(1,402)~ = 0.46, P = 0.65; social inhibition: M = 9.3 (SD 5.8) vs. M = 9.3 (SD 6.1), t~(1,402)~ = 0.11, P = 0.91; for cardiac sample I and II, respectively). Using the cut-off ≥ 10 for both subscales (Denollet, [@CR7]; Emons et al., [@CR17]), 26% of patients in cardiac sample I and 29% of patients in cardiac sample II, were classified as Type D individuals. Confounding effect of disease severity {#Sec13} -------------------------------------- Assessment of Type D personality was not confounded by severity of underlying coronary artery disease in cardiac sample I, as estimated by number of arteries affected by coronary artery disease from the coronary angiography results (Tau-c = 0.010, n = 1,237, P = 0.72; Fig. [2](#Fig2){ref-type="fig"}). About 1/3 of both non-Type D and Type D patients had normal arteries or atheroma with no significant occlusions, and with those individuals excluded from the analysis, Type D personality was still not associated with worse disease severity (Tau-c = −0.001, n = 838, P = 0.98).Fig. 2Coronary artery disease severity, stratified by Type D personality Assessment of Type D personality was also not related to disease classification in cardiac sample I (Tau-c = −0.02, n = 1,155, P = 0.45) nor cardiac sample II (Tau-c = −0.15, n = 135, P = 0.068). In both cases, disease classification was categorized as: no disease, hypertension, coronary artery disease, ≥1 heart attacks and heart failure. Association with health-related risk markers {#Sec14} -------------------------------------------- As a final step, we explored the relationship of Type D personality with psychopharmacological medication use, previous mental problems and smoking in cardiac sample II. Type D patients reported more psychopharmacological medication use (Fig. [3](#Fig3){ref-type="fig"}). When asked about use of sleeping pills, anxiety-reducing medication, antidepressants and sedatives, half of the cardiac patients with a Type D personality (51%) reported having used one or more of these medications compared to 29% of their non-Type D counterparts ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \chi_{(1,n\,=\,154)}^{2} $$\end{document}$ = 6.79, P = 0.009; OR 2.59, 95% CI 1.25--5.34, P = 0.010). Prevalence of previous mental problems did however not differ between Type D (19%) and non-Type D (14%) patients ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \chi_{(1,n = 149)}^{2} $$\end{document}$ = 0.584, P = 0.45). Type D patients were significantly more likely to smoke as compared with non-Type D patients (Fig. [3](#Fig3){ref-type="fig"}); i.e., 22% versus 6% ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \chi_{(1,n = 156)}^{2} $$\end{document}$ = 8.35, P = 0.004; OR 4.25, 95% CI 1.50--12.00, P = 0.006). In patients with a history of smoking, no differences were found between Type Ds and non-Type Ds regarding how many cigarettes they smoked per day (Tau-c = 0.11, n = 115, P = 0.26). However, a trend towards a longer history of smoking was noted in Type Ds (Tau-c = 0.15, n = 120; P = 0.056), but 76% of Type D smokers (former or current) reported having smoked for 20 years or more compared to 59% of non-Type D smokers.Fig. 3Prevalence of psychopharmacological medication use and smoking, stratified by Type D personality Discussion {#Sec15} ========== The objectives of the current study were to evaluate the psychometric properties and construct validity of the Icelandic DS14 scale, to test whether Type D assessment is confounded by disease severity in Icelandic angiography patients, and to explore the relationship between Type D and health-related risk markers. The findings supported the two-factor structure of the Icelandic DS14, and its validity and reliability in this sample of Icelandic heart patients. Principal axis factor analysis revealed internally consistent negative affectivity and social inhibition factors, and a confirmatory factor analysis confirmed the two-factor structure of the original scale (Denollet, [@CR7]) in a large sample of Icelandic cardiac patients. The current results supported the convergent and divergent validity of the Type D construct in the Icelandic setting. An exploratory factor analysis of scale scores showed that negative affectivity, neuroticism and rehearsal loaded on the same factor, while social inhibition, extraversion, and emotional inhibition loaded together on another factor, supporting the construct validity of the two factors of the DS14 (Denollet, [@CR7]; Fruyt & Denollet, [@CR18]) whilst also strengthening its cross-cultural validity. Furthermore, negative affectivity correlated strongly with anxiety, depression and moderately with perceived stress, confirming the presence of increased negative mood states within the negative affectivity trait. In addition, social inhibition was clearly associated with emotional inhibition as measured by the emotional control scale. In a recent study, Grande et al. ([@CR19]) advocated more testing of the construct validity of the social inhibition dimension, especially since it is the combination of social inhibition with negative affectivity that seems to make Type D personality a stronger predictor of adverse cardiac events compared with other single-dimensional negative affect factors, such as depression. In the context of Type D personality, the inhibition of emotions in social interaction is believed to play a key part in the association with adverse cardiac prognosis, by modulating the effect negative emotions have on cardiac prognosis (Denollet et al., [@CR10]). Others have also linked social inhibition with social avoidance (Yu et al., [@CR57]), lack of social boldness (Grande et al., [@CR19]) and suppressed anger (Denollet et al., [@CR9]). The prevalence of Type D personality of twenty-six and twenty-nine percent in the cardiac samples was comparable to that found in European and Chinese samples (Denollet, [@CR7]; Grande et al., [@CR20]; Gremigni & Sommaruga, [@CR21]; Pedersen & Denollet, [@CR33]; Pedersen et al., [@CR37]; Spindler et al., [@CR50]; Yu et al., [@CR57]). Assessment of Type D personality was not confounded by disease severity, as estimated by the number of coronary arteries affected with coronary artery disease and/or presence of significant narrowing at the main stem. This finding is in accordance with previous results in coronary artery disease and congestive heart failure patients, where no association has been found between Type D personality and indicators of disease severity, such as multivessel disease (Martens et al., [@CR28]), left ventricular ejection fraction (Denollet & Brutsaert, [@CR8]; de Jonge et al. [@CR5]) and biomedical markers (i.e. brain natriuretic peptide) (Pelle et al., [@CR39]). Similarly, Type D personality was not related to disease classification in either of the cardiac samples. The majority of former findings have generally also revealed that Type D personality is stable across time, and does not seem to be affected by changes in mood status or severity of cardiac disease (Martens et al., [@CR28]). The lack of association between Type D personality and extent of coronary artery disease does not necessarily diminish the status of Type D personality as a predictor for adverse cardiac prognosis. Conversely, these findings may merely indicate that the mechanisms relating Type D personality with adverse prognosis do not stem from worse disease severity, but through other pathways. Furthermore, if disease severity were in fact the pathway through which Type D personality affects cardiac prognosis, then the association between Type D and prognosis should diminish in strength or disappear altogether when multivariate adjustments for disease severity markers are conducted. This has however not been the case in previous studies, as is evident in the recent review by Denollet et al. ([@CR13]). Mediating mechanisms linking Type D with adverse cardiac prognosis reside more likely in behavioral and physiological processes. Potential behavioral factors include unhealthy lifestyle behaviors (Williams et al., [@CR56]), more smoking (Pedersen et al., [@CR35]), poor treatment adherence (Rozanski et al., [@CR43]; Williams et al., [@CR55]) and inadequate consultation behavior (Schiffer et al., [@CR47]), while physiological and biological processes may include elevated cortisol (Molloy et al., [@CR30]; Whitehead et al., [@CR54]), pro-inflammatory cytokines (Denollet et al., [@CR12]) and cardiovascular stress reactivity (Denollet et al., [@CR13]) to name a few. Type D patients may thus be less likely to follow their doctors recommendations regarding medications or changing unhealthy lifestyle behaviors, and perhaps less efficient in presenting their symptoms to their doctor, due to their high social inhibition. Such factors could possibly explain why these patients develop or experience a more adverse prognosis compared to their non-Type D counterparts. A recent study by Rozanski et al. ([@CR45]) has also reported that psychological risk factors (depression, hostility, social support, perceived stress, job strain, and optimism) were not associated with the extent of coronary atherosclerosis. This further supports the lack of association between Type D and extent of coronary artery disease in the current study, as the Type D construct generally summarizes such psychological risk factors in the general negative emotional distress it encompasses (Suls & Bunde, [@CR52]). Finally, even as some researchers have disputed that the relation of psychological factors with cardiovascular prognosis is confounded by worse somatic health, findings from a recent study have indicated that the Type D personality construct is less confounded by somatic health compared with depression (de Jonge et al. [@CR5]). Type D personality had strong ties to health-related risk markers in cardiac patients. Although no association was found between Type D personality and prevalence of reported previous mental problems in the current study, psychopharmacological medication use was higher among Type D patients compared to their non-Type D counterparts, and a high correlation emerged between negative affectivity and anxiety and depression. Previously, researchers have also found that post-myocardial infarction patients with a Type D personality were significantly more likely to use benzodiazepines as compared to non-Type D patients (Denollet et al., [@CR14]). The lack of association with former mental problems seems contradictory with the high correlation noted between negative affectivity and anxiety and depression. The assessment of previous mental problems may not adequately portray the number of previously diagnosed mental problems, due to the simplistic one question format assessment. We also found a relationship between Type D personality and smoking among cardiac patients. Incidence of current smoking was higher in the Type D patient group, and there were some indications that Type D smokers had a longer history of smoking compared to non-Type D smokers. Previously, it has been reported that cardiac patients with a Type D personality may be more likely to smoke (Pedersen et al., [@CR36]), and that Type D individuals are less likely to engage in healthy lifestyle behaviors (Williams et al., [@CR56]). These findings suggest that cardiac patients with Type D personality may struggle more with the lifestyle changes recommended by doctors to decrease likelihood of further cardiac events. In addition, previous results have indicated that heart failure patients with Type D personality are more likely to show inadequate consultation behavior compared to non-Type D patients (Pelle et al., [@CR38]; Schiffer et al., [@CR47]), which implies that self-management and medical adherence in these patients may be impaired as well. Nevertheless, research results have indicated that the adverse effect of Type D on cardiac prognosis (Pedersen et al., [@CR36]) and poor health status (Pedersen et al., [@CR35]) remains significant despite statistical adjustment for smoking and other mechanisms that may mediate the relationship between Type D and health outcomes. More research needs to be conducted to clarify which mediating mechanisms are behind Type D's association with adverse prognosis in cardiac patients, and to determine whether health-behavior and/or poor medical adherence play a significant role. Certain limitations restrict the interpretation of the present findings. First of all, the participant samples were not randomly selected. Yet, cardiac sample I included consecutive patients nationwide in Iceland, which diminished greatly the risk of selection bias in that sample. Another limitation is the self-report of psychopharmacological medication use, previous mental health problems and smoking, and the unavailability of these measures from cardiac sample I. Overall, the results of the present study indicated that the Icelandic DS14 is a psychometrically sound assessment tool that can be readily applied in epidemiological and clinical research. The Type D personality construct was prevalent in Icelandic cardiac patients, not confounded by disease severity, and related to certain health-related risk markers in this clinical population. The present research was supported by Rannís, The Icelandic Centre for Research (Reykjavík, Iceland) by a grant to Dr. Hrobjartur D. Karlsson, the Landspitali-University Hospital Research found, Iceland, with a grant to the project, and by the Netherlands Organisation for Scientific Research (The Hague, The Netherlands) with a VICI grant (453-04-004) to Dr. Johan Denollet and a VENI grant (451-05-001) to Dr. Susanne S. Pedersen. Conflict of interest {#d28e1901} ==================== There is no conflict of interest related to this study. Open Access {#d28e1906} =========== This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.	{ "pile_set_name": "PubMed Central" }
Tuamie - Masta Killa drops 9/17. Pre-order the limited cassette at www.grandgardenrecords.com ‘Masta Killa’ is Grand Garden’s first release and a look into the mind of producer Tuamie. Hailing from Richmond, VA Tuamie is one of the beat scene’s brightest young talents. A true “head” and lover of records Tuamie pride’s himself on making beats with unidentifiable samples. ‘Masta Killa’ is no generic beat tape mind you. The album is full of house, soul, and African rhythms generating a feeling of mid 90’s nostalgia while maintaining a contemporary sound. Tuamie has performed alongside Knxwldge, Ohbliv, P.U.D.G.E. and many more. Stay tuned for Tuamie's production on Vol. 4 of DJ House Shoes' "The Gift" series. This limited edition cassette release comes with a "plantable" download card that will grow flowers after planted in soil.	{ "pile_set_name": "Pile-CC" }
Cheater Payback-Chapter Seven Cathy told Bill to get her another towel, there was no need to say why because the old one was getting pretty soggy, to say the least. She folded it once and then got back into position. With open legs she reached over and grabbed hold of Rick’s pecker and pulled him with it, placing it at her cunt’s entrance. When Bill plunged into the very wet, well-lubricated, private place, her vaginal walls fluttered around it as he slid in, balls deep. It felt wonderful, and he could feel Cathy’s flesh spread while at the same time she was squeezing him with it. Cathy gave out a little laugh and asked, “Do you like that?” He answered her with a slap, slap, slap, slap noise of a dick and a wet pussy banging together. After a good long minute or so he was still going at her with his body. Cathy said “Rick, honey, take it easy, you aren’t going to wear my pussy out, you are just wearing yourself out. But, oh God your cock feels so good in there.” Bill was watching everything and did exactly what Cathy was hoping he would do, that being taking one of her legs and holding it up, pointing towards the ceiling. This allowed Rick better access and provided Bill a better scene for his perverted eyes. Cathy opened her legs wider and did what she had just been taught, that being pulling Rick into him hard and allowing his cock more penetration to squirt her deep inside her eggbox. She was also going to do this with her husband next chance he got. Anyway, Cathy was squirming and bouncing around, her tits jammed into his chest and her nails digging into his back like some sort of wildcat in heat. She was also cussing worse than a sailor with a lot of F, C, S, and P words. The nasty woman was an exciting and talented fuck. She had years of experience screwing and making babies in the marriage bed. As well as a few other places. She was nearing climax so she told Rick, “Don’t stop fucking me you S.O.B., faster, faster, fuck me hard, honey!” Slamming her naked body at him violently working on her orgasm. Bill was also helping her by pulling on her leg to meet their crotch slamming lewdness. Poor Rick was just along for the ride as he tried to keep his cum inside his balls for her. Cathy became limp as her body shivered and shuttered in pleasure as her jets inside released a load of girl cum soaking Rick’s already wet dick. With a smile of a satisfied woman on Cathy’s beautiful face she gave Rick a sexy kiss on the lips, and like a high school kid also gave him a hickey on his neck as her whole body continued to rock with sexual satisfaction. She said weakly, Go ahead Rick shoot your load in me now.” Rick went stiff as he shot off, he felt his cock going fwt fwt fwt fwt fwt, as five bolts of sperm went into her. He lied atop her as the two sweaty bodies hugged each other, exhausted and spent. Bill slowly eased Cathy’s leg down onto Rick and she rested it on his bottom. Bill had to wait patiently for Cathy to regurgitate so he could fuck her again. End of chapter seven.	{ "pile_set_name": "Pile-CC" }
Added with that hat, Twilight looks so dang adorable. Also, love the new battle outfit, hope we'll see it more often.	{ "pile_set_name": "OpenWebText2" }
<div class="subblock"> <h3><%= t('.owner_tools') %></h3> <div> <%= link_to t('.force_update'), act_content_path(action_name: 'manual_refresh'), method: :put, class: "btn info" %> <%= link_to t('.purge_children'), act_content_path(action_name: 'delete_children'), method: :put, class: "btn info" %> </div> </div>	{ "pile_set_name": "Github" }
How do I edit my profile? You have a profile on this site. It was created for you on registration. Having a profile means other users can recognize you when you leave a reply or like a comment. Please keep it up to date and all the fields filled. To edit your profile simply click on your name in the top right corner. Fill in any missing fields and make sure to click ‘Save Changes’ when you are finished.	{ "pile_set_name": "Pile-CC" }
Work It Work It But it was Melissa Fleis' royal-blue cowl-neck frock that earned her the win. Rightfully so. "I want to do away with typical 'office clothes,'" Fleis says, echoing a popular sentiment among so many busy ladies. "Working women today are looking for that edge in life and the workplace. I want to help them achieve it." Fleis, however, who had yet to win a challenge in the season, was shocked to have landed on top. Alex Wynne in top by Raul Osorio and skirt by Sonjia Williams; Lacee Teel in the winning dress by Melissa Fleis.	{ "pile_set_name": "Pile-CC" }
SO whose idea was it to play twister in the vineyards on a Sunday afternoon? Certainly not the staff and visitors at Keith Tulloch Wine in Pokolbin in the Hunter Valley yesterday, who were caught unawares when a tornado descended on the vines about 4.30pm. Cellar door saleswoman Jackie Goodman said the sun was out and everything appeared normal when the twister touched down and started to wreak havoc. “We didn’t even see it coming. It was so sunny outside and then a huge dark cloud came over the top with this enormous twister coming out of it down to the ground,” she said. media_camera An image from a video which captured the moment a weak tornado struck a winery in the Hunter Valley. “It lasted maybe half an hour. There was stuff flying through the air everywhere. It tore down one of our sheds so there were massive bits of roof flying around, there were sheets of metal, there were branches – it was crazy.” The vineyard lost a shed and about 100 vines, but no-one was injured. media_camera The aftermath following a tornado which hit Keith Tulloch winery at Pokolbin on Sunday. Photo courtesy of www.emmajanepitschphotography.com.au media_camera Metal from a shed roof at Keith Tulloch Wine at Pokolbin in Hunter Valley after a weak tornado ripped through the site on Sunday afternoon. Picture: Keith Tulloch Wine Weather Watch meteorologist Don White said tornadoes were rare but not unheard of in NSW. “Just don’t call it a mini-tornado. There’s no such thing as a mini-tornado, except maybe what you get when you stir a cup of tea with a spoon,” he said. Instead, Mr White described it as a “weak” tornado. “Tornadoes are rated on a scale of zero to five and this one would barely be a zero,” he said. “But it still did some damage.” media_camera Pictured is the Keith Tulloch winery at Cessnock which yesterday was severely damaged by a tornado. Photo courtesy of www.emmajanepitschphotography.com.au He explained that, in very basic terms, tornadoes formed when updrafts and downdrafts from a storm opposed each other to such an extent that they started to rotate. Yesterday’s was the result of a single severe storm cell passing over Pokolbin, dropping more than 20mm of rain on the area, while the nearby town of Cessnock got just 1mm. Tornado hits Pokolbin	{ "pile_set_name": "OpenWebText2" }
Q: How to add exception in SELinux? When SELinux is disabled, I have no issues, but when it's Enforced then I'm facing this [systemd] failed to get d-bus session: Failed to connect to socket /run/dbus/system_bus_socket: Permission denied Audit.log sealert -a /var/log/audit/audit.log 100% done found 2 alerts in /var/log/audit/audit.log -------------------------------------------------------------------------------- SELinux is preventing /usr/sbin/zabbix_agentd from connectto access on the unix_stream_socket /run/dbus/system_bus_socket. *** Plugin catchall (100. confidence) suggests ********************** If you believe that zabbix_agentd should be allowed connectto access on the system_bus_socket unix_stream_socket by default. Then you should report this as a bug. You can generate a local policy module to allow this access. Do allow this access for now by executing: # ausearch -c 'zabbix_agentd' --raw \| audit2allow -M my-zabbixagentd # semodule -i my-zabbixagentd.pp i created a policy as suggested above,restarted zabbix-agent, now from zabbix agent log getting [systemd] failed to get d-bus session: An SELinux policy prevents this sender from sending this message to this recipient, 0 matched rules; type="method_call", sender="(null)" (inactive) interface="org.freedesktop.DBus" member="Hello" error name="(unset)" requested_reply="0" destination="org.freedesktop.DBus" (bus) sealert -a /var/log/audit/audit.log 39% donetype=AVC msg=audit(1534885076.573:250): avc: denied { connectto } for pid=10654 comm="zabbix_agentd" path="/run/dbus/system_bus_socket" scontext=system_u:system_r:zabbix_agent_t:s0 tcontext=system_u:system_r:system_dbusd_t:s0-s0:c0.c1023 tclass=unix_stream_socket Invalid AVC allowed in current policy * A: Well, first you have to identify the denial you are getting from SELinux. The easiest (in my opinion) way to do that is via the sealert utility. First install the setroubleshoot-server package with: yum install setroubleshoot-server Then run: sealert -a /var/log/audit/audit.log You will probably get a lot of output, look for your specific denial, and follow the recommendations. But be sure to NOT allow things that shouldn't be allowed! Here is an exmple of a denial, and the suggested woraround from sealert (my emphasis): SELinux is preventing /usr/libexec/postfix/qmgr from using the rlimitinh access on a process. *** Plugin catchall (100. confidence) suggests ************************ you believe that qmgr should be allowed rlimitinh access on processes labeled postfix_qmgr_t by default. Then you should report this as a bug. You can generate a local policy module to allow this access. Do allow this access for now by executing: # ausearch -c 'qmgr' --raw \| audit2allow -M my-qmgr # semodule -i my-qmgr.pp Additional Information: Source Context system_u:system_r:postfix_master_t:s0 Target Context system_u:system_r:postfix_qmgr_t:s0 Target Objects Unknown [ process ] Source qmgr Source Path /usr/libexec/postfix/qmgr Port Host Source RPM Packages postfix-2.10.1-6.el7.x86_64 Target RPM Packages Policy RPM selinux-policy-3.13.1-102.el7_3.16.noarch Selinux Enabled True Policy Type targeted Enforcing Mode Enforcing Host Name centos Platform Linux centos 3.10.0-514.26.2.el7.x86_64 #1 SMP Tue Jul 4 15:04:05 UTC 2017 x86_64 x86_64 Alert Count 5 First Seen 2018-04-18 18:02:32 CEST Last Seen 2018-08-22 09:11:22 CEST Local ID 855f168c-1e47-4c6b-8a1e-f8fddce5d426 The example above concerns Postfix, again; look for your denial, and insert a local policy.	{ "pile_set_name": "StackExchange" }
{include file="orderforms/standard_cart/common.tpl"} <script> var _localLang = { 'addToCart': '{$LANG.orderForm.addToCart\|escape}', 'addedToCartRemove': '{$LANG.orderForm.addedToCartRemove\|escape}' } </script> <div id="order-standard_cart"> <div class="row"> <div class="pull-md-right col-md-9"> <div class="header-lined"> <h1>{$LANG.cartdomainsconfig}</h1> </div> </div> <div class="col-md-3 pull-md-left sidebar hidden-xs hidden-sm"> {include file="orderforms/standard_cart/sidebar-categories.tpl"} </div> <div class="col-md-9 pull-md-right"> {include file="orderforms/standard_cart/sidebar-categories-collapsed.tpl"} <form method="post" action="{$smarty.server.PHP_SELF}?a=confdomains" id="frmConfigureDomains"> <input type="hidden" name="update" value="true" /> <p>{$LANG.orderForm.reviewDomainAndAddons}</p> {if $errormessage} <div class="alert alert-danger" role="alert"> <p>{$LANG.orderForm.correctErrors}:</p> <ul> {$errormessage} </ul> </div> {/if} {foreach $domains as $num => $domain} <div class="sub-heading"> <span>{$domain.domain}</span> </div> <div class="row"> <div class="col-sm-6"> <div class="form-group"> <label>{$LANG.orderregperiod}</label> <br /> {$domain.regperiod} {$LANG.orderyears} </div> </div> <div class="col-sm-6"> <div class="form-group"> <label>{$LANG.hosting}</label> <br /> {if $domain.hosting}<span style="color:#009900;">[{$LANG.cartdomainshashosting}]</span>{else}<a href="cart.php" style="color:#cc0000;">[{$LANG.cartdomainsnohosting}]</a>{/if} </div> </div> {if $domain.eppenabled} <div class="col-sm-12"> <div class="form-group prepend-icon"> <input type="text" name="epp[{$num}]" id="inputEppcode{$num}" value="{$domain.eppvalue}" class="field" placeholder="{$LANG.domaineppcode}" /> <label for="inputEppcode{$num}" class="field-icon"> <i class="fa fa-lock"></i> </label> <span class="field-help-text"> {$LANG.domaineppcodedesc} </span> </div> </div> {/if} </div> {if $domain.dnsmanagement \|\| $domain.emailforwarding \|\| $domain.idprotection} <div class="row addon-products"> {if $domain.dnsmanagement} <div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}"> <div class="panel panel-default panel-addon{if $domain.dnsmanagementselected} panel-addon-selected{/if}"> <div class="panel-body"> <label> <input type="checkbox" name="dnsmanagement[{$num}]"{if $domain.dnsmanagementselected} checked{/if} /> {$LANG.domaindnsmanagement} </label><br /> {$LANG.domainaddonsdnsmanagementinfo} </div> <div class="panel-price"> {$domain.dnsmanagementprice} / {$domain.regperiod} {$LANG.orderyears} </div> <div class="panel-add"> <i class="fa fa-plus"></i> {$LANG.orderForm.addToCart} </div> </div> </div> {/if} {if $domain.idprotection} <div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}"> <div class="panel panel-default panel-addon{if $domain.idprotectionselected} panel-addon-selected{/if}"> <div class="panel-body"> <label> <input type="checkbox" name="idprotection[{$num}]"{if $domain.idprotectionselected} checked{/if} /> {$LANG.domainidprotection} </label><br /> {$LANG.domainaddonsidprotectioninfo} </div> <div class="panel-price"> {$domain.idprotectionprice} / {$domain.regperiod} {$LANG.orderyears} </div> <div class="panel-add"> <i class="fa fa-plus"></i> {$LANG.orderForm.addToCart} </div> </div> </div> {/if} {if $domain.emailforwarding} <div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}"> <div class="panel panel-default panel-addon{if $domain.emailforwardingselected} panel-addon-selected{/if}"> <div class="panel-body"> <label> <input type="checkbox" name="emailforwarding[{$num}]"{if $domain.emailforwardingselected} checked{/if} /> {$LANG.domainemailforwarding} </label><br /> {$LANG.domainaddonsemailforwardinginfo} </div> <div class="panel-price"> {$domain.emailforwardingprice} / {$domain.regperiod} {$LANG.orderyears} </div> <div class="panel-add"> <i class="fa fa-plus"></i> {$LANG.orderForm.addToCart} </div> </div> </div> {/if} </div> {/if} {foreach from=$domain.fields key=domainfieldname item=domainfield} <div class="row"> <div class="col-sm-4">{$domainfieldname}:</div> <div class="col-sm-8">{$domainfield}</div> </div> {/foreach} {/foreach} {if $atleastonenohosting} <div class="sub-heading"> <span>{$LANG.domainnameservers}</span> </div> <p>{$LANG.cartnameserversdesc}</p> <div class="row"> <div class="col-sm-4"> <div class="form-group"> <label for="inputNs1">{$LANG.domainnameserver1}</label> <input type="text" class="form-control" id="inputNs1" name="domainns1" value="{$domainns1}" /> </div> </div> <div class="col-sm-4"> <div class="form-group"> <label for="inputNs2">{$LANG.domainnameserver2}</label> <input type="text" class="form-control" id="inputNs2" name="domainns2" value="{$domainns2}" /> </div> </div> <div class="col-sm-4"> <div class="form-group"> <label for="inputNs3">{$LANG.domainnameserver3}</label> <input type="text" class="form-control" id="inputNs3" name="domainns3" value="{$domainns3}" /> </div> </div> <div class="col-sm-4"> <div class="form-group"> <label for="inputNs1">{$LANG.domainnameserver4}</label> <input type="text" class="form-control" id="inputNs4" name="domainns4" value="{$domainns4}" /> </div> </div> <div class="col-sm-4"> <div class="form-group"> <label for="inputNs5">{$LANG.domainnameserver5}</label> <input type="text" class="form-control" id="inputNs5" name="domainns5" value="{$domainns5}" /> </div> </div> </div> {/if} <div class="text-center"> <button type="submit" class="btn btn-primary btn-lg"> {$LANG.continue}  <i class="fa fa-arrow-circle-right"></i> </button> </div> </form> </div> </div> </div>	{ "pile_set_name": "Github" }
1. Introduction {#sec1-cancers-12-00185} =============== Diffuse large B-cell lymphoma (DLBCL) comprises about 40% of all lymphomas, constituting the most prevalent type of non-Hodgkin lymphoma. It can arise de novo or result from the malignant transformation of a more indolent lymphoma. According to The 2016 revision of the World Health Organization (WHO) classification of lymphoid neoplasms there are 13 subtypes of lymphoma defined as specific entities, designating the rest as DLBCL not otherwise specified (NOS), which account for the vast majority of DLBCLs \[[@B1-cancers-12-00185]\]. The standard treatment approach consists of immunochemotherapy (rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone---R-CHOP), which guarantees an overall survival (OS) of more than 60% for DLBCL-NOS cases. In particular, a subgroup of young patients with favourable-prognosis disease can even achieve the same clinical benefit with fewer cycles of R-CHOP \[[@B2-cancers-12-00185]\]. However, up to 40% of patients suffer relapse or refractory (R/R) disease \[[@B3-cancers-12-00185]\] and for them the standard salvage approach consists of autologous stem cell transplantation, even if long-term disease control is achieved in fewer than 50% of cases \[[@B4-cancers-12-00185]\]. Survival is particularly poor for patients relapsing within one year after R-CHOP with fewer than 15% of patients achieving a durable remission \[[@B5-cancers-12-00185],[@B6-cancers-12-00185],[@B7-cancers-12-00185]\]. Recently chimeric antigen receptor (CAR) T-cell therapies have been approved as alternative curative options for patients with relapsing or refractory disease. CAR T cells represent a new class of cellular immunotherapy involving ex vivo genetic modification of patients' T cells, triggering T-cell activation and cytotoxicity \[[@B8-cancers-12-00185]\], that demonstrated good efficacy in B-cell malignancies treatment, including DLBCL \[[@B9-cancers-12-00185],[@B10-cancers-12-00185]\]. In this context, a prevision of poor OS is attributed to relapsing cases and to patients with refractory disease \[[@B6-cancers-12-00185]\] for which even CAR T-cell therapy fails \[[@B11-cancers-12-00185]\]. Therefore, it is essential to search for clinical parameters and biomarkers that could help to better DLBCL patients' characterization and stratification. Nowadays, thanks to the availability of comprehensive genomic and transcriptomic analyses a wealth of information is generated, rendering the concept of personalized therapy more realistic. In the attempt to put some order in the most recent discoveries on DLBCL research, we reviewed the latest experimental studies in this field, focusing on the most important findings helping in the management of lymphoma patients from the perspective of personalized medicine. 1.1. Standard Prognosticators for DLBCL {#sec1dot1-cancers-12-00185} --------------------------------------- One of the most commonly used prognostic tools is the International Prognostic Index (IPI) \[[@B12-cancers-12-00185]\], whose validity and reliability has been enhanced by several upgrades \[[@B13-cancers-12-00185]\]. However, it evaluates only five clinical parameters (age, lactate dehydrogenase, performance status, number of extranodal sites, and Ann Arbor stage), without considering the biologic characteristics of the tumour. The first and nowadays most commonly used biologic prognosticator of DLBCL tumours is the cell-of-origin (COO) determination based on gene expression profiling (GEP), which subdivides most DLBCL-NOS patients into two main categories, namely germinal center B-cell-like (GCB), if presenting with expression features similar to germinal center cells, and activated B-cell-like (ABC) DLBCL \[[@B14-cancers-12-00185]\], when presenting features similar to activated B-lymphocytes. This subdivision is relevant for therapy and prognosis, as ABC cases show a worse outcome as regards progression-free survival (PFS) and OS after treatment with R-CHOP standard therapy \[[@B14-cancers-12-00185],[@B15-cancers-12-00185],[@B16-cancers-12-00185]\] in comparison to GCB patients. However, GEP through microarrays poses a challenge because it is available only for a small fraction of patients whose mRNA can be extracted from fresh or frozen tissues. The attempts to substitute GEP with immunohistochemistry (IHC) applicable to formalin-fixed, paraffin-embedded (FFPE) tissue samples \[[@B17-cancers-12-00185],[@B18-cancers-12-00185],[@B19-cancers-12-00185],[@B20-cancers-12-00185],[@B21-cancers-12-00185],[@B22-cancers-12-00185]\] evidenced another series of inherent difficulties linked to the extreme variability of results, even when the same algorithm (Hans, Choi, Colomo, Muris, Pileri, or Tally) was applied \[[@B23-cancers-12-00185]\]. Indeed, when the two techniques were compared, it was evident that the classification of DLBCL based on the COO was different. Five years ago a new approach named Lymph2Cx was proposed for GCB/ABC COO classification; based on a panel of 20 genes and applicable to mRNA extracted from FFPE tissue samples, it is conducted on the NanoString platform and replicates the results of conventional GEP, demonstrating its superiority to IHC algorithms in various series of DLBCL cases \[[@B24-cancers-12-00185],[@B25-cancers-12-00185],[@B26-cancers-12-00185],[@B27-cancers-12-00185]\]. In the context of GEP, a German research group recently analysed data generated from expression microarray analyses of 873 different types of lymphoma, including DLBCL, with the purpose of clarifying their phenotypic characteristics \[[@B28-cancers-12-00185]\]. Through this approach, the investigators demonstrated that the transcriptome panorama of B-cell lymphomas consists more in a continuum of expression states than of clearly separated phenotypes, and in which every layer represents a different lymphoma and individual cases \[[@B28-cancers-12-00185]\]. Focusing on DLBCL, a series of models employed GEP for classifying patients: Monti et al. subdivided cases into three groups that were identified in oxidative phosphorylation, B-cell receptor/proliferation, and host response \[[@B29-cancers-12-00185]\]; Dybkaer et al. isolated B cells from reactive tonsils and identified B-cell-associated gene signatures (BAGS), highlighting for each an association with molecular findings \[[@B30-cancers-12-00185]\]. Other researchers instead focused their efforts applying GEP in the study of the microenvironment of lymphoma cells \[[@B31-cancers-12-00185],[@B32-cancers-12-00185]\] and in the search of specific immune signatures \[[@B33-cancers-12-00185]\]. Indeed, over time a series of NanoString-based expression assays has been suggested; for example, the Michaelsen group recently proposed a new NanoString-based assay for BAGS classification to overcome the difficulty of microarray-based GEP, in order to better categorize DLBCL in diverse B-cell subtypes \[[@B34-cancers-12-00185]\]. Analysing microarray data from 970 patients belonging to four different cohorts, they first selected genes and then created and tested a new NanoString-based BAGS2Clinic assay for quick and easy-to-use BAGS profiling. Then, they tested the assay in an independent cohort of 88 lymph node biopsies and confirmed that it showed a good correspondence with the original BAGS classifier, having an overall accuracy of 84% and a subtype-specific accuracy ranging between 80% and 99%. It seems that BAGS classification could highlight important features of tumour biology and aspects about resistance to immuno- and chemotherapy that can be employed when choosing novel treatment strategies for DLBCL patients \[[@B34-cancers-12-00185]\]. However, albeit meticulous, even COO classification through GEP reserves diverse exceptions, and variation in patient outcome persists even within each COO subtype, posing the main difficulty in management of patients and raising the question of the deep study of the extreme molecular heterogeneity that features DLBCL \[[@B35-cancers-12-00185]\]. Consequently, several studies in the last years attempted to discover further stratification parameters serving to make a better patient categorization, and additional to the existing ones that presented some critical issues. Many prognostic markers have been considered, such as MYC gene alterations, which characterize from 5% to 15% of de novo DLBCL and confer a worse prognosis and higher risk of central nervous system involvement \[[@B36-cancers-12-00185]\], as well as TP53 mutation, Epstein--Barr virus infection, CD5 expression, CD30 expression, BCL2 rearrangement or expression, MHC class II expression, and others \[[@B37-cancers-12-00185],[@B38-cancers-12-00185],[@B39-cancers-12-00185],[@B40-cancers-12-00185],[@B41-cancers-12-00185],[@B42-cancers-12-00185],[@B43-cancers-12-00185],[@B44-cancers-12-00185],[@B45-cancers-12-00185],[@B46-cancers-12-00185],[@B47-cancers-12-00185],[@B48-cancers-12-00185]\], each presenting with contradicting data regarding their prognostic relevance. All things considered, at the current moment, genomic and transcriptomic profiling through next-generation sequencing (NGS) is surely the most powerful tool to investigate the molecular heterogeneity, as well as to find new potential biomarkers useful for diagnosis, risk determination, and treatment choice in DLBCL. However, in clinical practice, most investigations are conducted through the so-called "low-throughput techniques" (e.g., fluorescence in situ hybridization---FISH) and microarrays. Such approaches are acceptable if considering the old classification procedures that restricted the analyses to the search for a limited number of alterations, but now that fine molecular profiling of each individual case is possible, the implementation of NGS is becoming necessary also in the daily clinical workflow, maybe restricting the analyses to the search for specific molecular alterations. 1.2. Discovering New Prognostic Biomarkers and Models {#sec1dot2-cancers-12-00185} ----------------------------------------------------- In the last years a series of discovery NGS researches was conducted trying to collect sequencing-derived information and to find focal alterations predicting prognosis, or in some cases, to elaborate models for DLBCL classification and prognostication ([Table 1](#cancers-12-00185-t001){ref-type="table"}). In a large comprehensive exome and transcriptome sequencing of 1001 DLBCL cases \[[@B49-cancers-12-00185]\] Reddy and colleagues identified a set of 150 driver genes, most of which were then functionally characterized with an unbiased CRISPR screen of DLBCL cell lines to define oncogenes promoting cell growth. Through this information they drew up a prognostic model based on the presence of genetic alterations that was found to be better than current prognostic methods such as COO determination, IPI, and dual MYC and BCL2 expression. According to this model, genetic and/or expression aberrations of MYC defined the patient group with the worst prognosis; on the contrary, CD70 alterations in GCB-DLBCLs characterized the group with the better outcome \[[@B49-cancers-12-00185]\]. In a similar work by Schmitz and colleagues, NGS was adopted to unveil driver genes with recurrent alterations \[[@B50-cancers-12-00185]\]. They performed whole-exome sequencing (WES), RNA-seq, gene copy number analysis and targeted resequencing of 372 genes of 574 DLBCL cases, mostly pre-treated (96.5%), of which 51.4% were ABC and 20% unclassified (non-ABC, non-GCB). They developed a specific algorithm to identify genetic subtypes on the basis of the co-occurrence of genetic aberrations, and defined four prevalent subtypes that they termed MCD (co-occurrence of MYD88L265P and CD79B mutations), BN2 (BCL6 fusions and NOTCH2 mutations), N1 (NOTCH1 mutations), and EZB (EZH2 mutations and BCL2 translocations). Each subtype featured differences in gene-expression signatures, sensitivity to immunochemotherapy and outcome, BN2 and EZB subtypes being associated with favourable survival, and MCD and N1 subtypes to inferior outcomes. Indeed, MCD and BN2 subtypes seemed to depend on a chronic active BCR signalling pathway, opening an option for targeted therapeutic inhibition \[[@B50-cancers-12-00185]\]. Another similar 2018 research by Chapuy et al. analysed 304 samples from DLBCL patients to find recurrent mutations, low-frequency alterations, somatic copy number alterations, and structural variants \[[@B51-cancers-12-00185]\] identifying a series of genetic drivers that led to another new molecular classification. Through consensus clustering they characterized five DLBCL subsets, which included a novel group of ABC-DLBCL lymphomas of extrafollicular/marginal zone origin with low-risk and associated to NOTCH2 mutations (C1); a group of ABC-DLBCL with gains in BCL2 and/or mutations in MYD88L265P, CD79B, PIM1, and PRDM1, and associated with an unfavourable outcome (C5); two distinct subsets of GCB-DLBCL with different outcomes and targetable alterations (C3 group with aberrations affecting PTEN and epigenetic mediators such as KMT2D, CREBBP, and EZH2 and poor outcomes; and C4 group with alterations of signal transducers such as BCR--PI3K, NF-κB, or RAS--JAK, of transcription activators such as BRAF and STAT3, in histone genes, and genes involved in immune evasion (CD83, CD70, and CD58), and with favourable outcomes); and an ABC/GCB-independent group with biallelic inactivation of TP53, CDKN2A loss, and genomic instability, associated with poor outcomes (C2). The characteristics of the five subgroups identified also correlate with outcome in an independent manner in regard to IPI, suggesting new chances of therapeutic options and providing a roadmap for the identification of actionable DLBCLs \[[@B51-cancers-12-00185]\]. Comparing the last two proposed molecular classifications it seems that the C1, C3, and C5 groups overlap with the BN2, EZB, and MCD groups of the work by Schmitz et al \[[@B50-cancers-12-00185]\]. However, there are also differences, such as the C2 and C4 groups that did not present similarities with those in the other research. Indeed, both classifications differed from the molecular classification by Reddy and colleagues, in which MYC status was correlated with clinical outcome \[[@B49-cancers-12-00185]\]. Indeed, each model presents some critical issues: the model by Reddy et al. gives a prognostic value to each individual marker assessed, but, given the lack of clear clusters, it is hard to use for therapeutic purposes. The drawback of the study by Schmitz is that is only focuses on ABC type; the study of Chapuy et al. instead encompasses all DLBCL, however conformational studies are still lacking. The utility of investigating only MYD88/CD79B mutations to improve DLBCL classification and prognostication was explored in a set of 250 DLBCL cases \[[@B52-cancers-12-00185]\]. The authors analyzed MYD88/CD79B mutations through NGS or allele-specific PCR, MYC/BCL2/BCL6 rearrangements by FISH, and EBV infections by EBER-ISH, identifying MYD88 and CD79B mutations in 29.6% and 12.3%, MYC, BCL2, and BCL6 rearrangements in 10.6%, 13.6%, and 20.3%, and EBV in 11.7% of cases, respectively. This study revealed that MYD88-mutated cases presented a significantly inferior five-year OS compared to wild-type; indeed, patients without any of the analysed alterations showed a superior OS compared to others carrying at least one aberrancy. In multivariable analysis, evaluating clinical-pathologic characteristics, outcome, and prognosis according to IPI, MYD88 mutations retained the adverse prognostic impact. Thus, investigating MYD88 mutations in DLBCL presents clinical utility as they feature a distinct molecular subtype with adverse prognosis \[[@B52-cancers-12-00185]\]. Further, MYD88 mutations, together with CD79A, CD79B, and CARD11 aberrations, are known to trigger chronic activation of the B-cell receptor (BCR) signalling pathway \[[@B65-cancers-12-00185],[@B66-cancers-12-00185],[@B67-cancers-12-00185],[@B68-cancers-12-00185]\]. Immunoglobulin M (IgM) is expressed in 90% of the ABC-like DLBCL subtype, and together with CD79A and CD79B, constitutes the BCR signalling complex, another mechanism of BCR aberrant chronic activation \[[@B69-cancers-12-00185]\]. A recent DNA copy number analysis of 1000 DLBCL cases identified gains of 18q21.2 as the most frequent genetic alteration in the ABC-like group, and recognized the TCF4 (E2-2) transcription factor gene as the main target of the genomic aberrations \[[@B53-cancers-12-00185]\]. With in vitro and in vivo experiments the effects of TCF4 overexpression were studied, observing its binding to IGHM and MYC gene enhancers and the augmented expression of the corresponding transcripts and proteins. Indeed, it was demonstrated that inhibition of TCF4 activity through the BET inhibitor ARV771 triggered death of the ABC-like DLBCL cells. Thus, this information represents a rationale for the employment of BET inhibitors for the subset of patients carrying this alteration \[[@B53-cancers-12-00185]\]. All the above-mentioned studies allowed the use of genomic aberrations to identify subgroups associated with distinct clinical outcomes, but it is not always possible offer a genetic classification to all DLBCL patients. In the attempt to solve this problem a series of other researches have been carried out. A 2019 study by Wang et al. employed WES data to establish mutant-allele tumour heterogeneity (MATH) \[[@B57-cancers-12-00185]\]. Based on the median expression level, patients were divided into low and high MATH score classes in which the higher MATH score group was associated with a higher risk of progression as compared to a lower MATH score, both in the discovery and in the validation set. The authors conclude that MATH has a prognostic value that could be considered in the management of DLBCL patients; a higher score of MATH has proven to be an independent risk prognostic factor in predicting recurrence \[[@B57-cancers-12-00185]\]. Another recent work instead studied the somatic hypermutation (SHM) mutational activities showing that they delineated the COO in DLBCL \[[@B55-cancers-12-00185]\]. Normally SHM acts during B-cell development targeting an immunoglobulin variable region \[[@B70-cancers-12-00185]\]; altered SHM hits several of the DLBCL driver genes \[[@B70-cancers-12-00185],[@B71-cancers-12-00185],[@B72-cancers-12-00185]\]. Alkodsi et al. found that the expression of 36 SHM target genes featured four novel SHM subtypes, strongly associated and overlapping with genetic subtypes already characterized by Schmitz et al., and that were significantly associated with OS and PFS of DLBCL patients treated with immunochemotherapy \[[@B55-cancers-12-00185]\]. Their stratification separates the GCB-DLBCL class into two major subtypes: SHM1, characterized by a high frequency of not always concurrent BCL2 and MYC aberrations and mutations in chromatin modifying genes, and including cases with poor outcome after standard R-CHOP therapy, that could be directed to alternative therapies; and SHM3, featuring mutations in the JAK-STAT pathway and a better outcome to standard cure. The ABC class was divided into SHM4, presenting with BCL6 fusions and mutations in CD70 and BCL10; and SHM2, presenting with the worst outcome and characterized by mutations in the BCR signalling pathway, that could be treated with kinase inhibitors. Through multivariate analysis of survival, they revealed that the SHM subtypes conferred a prognostic impact independently from the COO classification and IPI. Moreover, a distinct clinical outcome was observed for the SHM subtypes in the same COO subtype, and interestingly, even within unclassified DLBCL. Furthermore, they identified associations of each SHM subtype with driver mutations and oncogenic signalling pathways, proposing the possibility of choosing targeted therapy. Thus, SHM pattern represents a marker for the molecular and clinical classification of DLBCL \[[@B55-cancers-12-00185]\]. Also Arthur et al. in 2018 focused on SHM activity and analysed through WGS a discovery cohort of 153 DLBCL tumour/normal pairs, and performed data validation on an internal validation cohort of 338 cases and on an external validation cohort of over 1000 additional cases to find frequently mutated coding and non-coding loci, likely targeted by aberrant SHM \[[@B56-cancers-12-00185],[@B73-cancers-12-00185]\]. Through further analysis of matched RNA sequencing (RNA-seq) data, they suggested the potential cis-regulatory effects on coding genes of the alterations found \[[@B71-cancers-12-00185],[@B74-cancers-12-00185]\]. These analyses revealed recurrent mutations in the 3'UTR of NFKBIZ, responsible for oncogene deregulation, and NF-κB pathway activation in the ABC subclass; instead, in the GCB subgroup they evidenced small amplifications accompanied by over-expression of FCGR2B (the Fcγ receptor protein IIB), associated with poor outcomes \[[@B56-cancers-12-00185]\]. 1.3. Discovering Causes of Transformation and Chemoresistence {#sec1dot3-cancers-12-00185} ------------------------------------------------------------- In 2014 Pasqualucci and researchers through WES and copy-number analysis performed a pioneering work highlighting aberrations of CDKN2A/B, MYC and TP53 as major drivers of transformation of follicular lymphoma (FL) to an aggressive malignancy, typically DLBCL \[[@B58-cancers-12-00185]\] ([Table 1](#cancers-12-00185-t001){ref-type="table"}). Further, a subsequent work showed that one third of transformed FL harbor a MYC rearrangement \[[@B75-cancers-12-00185]\]. More recently, Gonzalez-Rincon et al. performed targeted NGS on 22 matched samples of pre-transformed FL/transformed DLBCL patients and on 20 non-transformed FL patients \[[@B59-cancers-12-00185]\]. Through this approach they identified several recurrently mutated genes with roles in B-cell differentiation, GC architecture and migration that were enriched at transformation, such as LRP1B, GNA13, and, in particular, POU2AF1, whose mutations seemed to characterize transformed forms rather than de novo DLBCL cases. Overall, they observed that pre-transformed FLs samples were more mutated and presented greater subclonal heterogeneity than non-transformed forms. Specifically, four genes differed between patients who did and did not show transformation: NOTCH2, DTX1, UBE2A and HIST1H1E; the mutation of these genes was related to a shorter time to transformation. With this information, the authors conclude, it could be easier to identify patients at higher risk of transformation \[[@B59-cancers-12-00185]\]. With the purpose of investigating the pathogenic causes of chemoresistance and relapse in DLBCL, a 2014 work sequenced VDJ junctions in 14 pairs of matched diagnosis--relapse tumours \[[@B60-cancers-12-00185]\]. The results of this study proposed two mechanisms of clonal evolution in which the early-divergent mode found two distinct clones, the diagnostic one and the relapsing one, that diverged early; and the late-divergent mode, in which relapse clones descended directly from diagnostic clones with minor divergence. Indeed, they identified in epigenetic modifiers such as KMT2D the potential early driving mutation targets, and in immune escape alterations the relapse-associated events \[[@B60-cancers-12-00185]\]. A following research analyzed 38 R/R DLBCL biopsies obtained at the time of progression after immunochemotherapy with WES and compared the obtained mutation frequencies to an unrelated cohort of 138 diagnostic DLBCLs, with the aim of identifying relapse-associated genes. Through this approach they evidenced TP53, FOXO1, MLL3 (KMT2C), CCND3, NFKBIZ, and STAT6 as top candidate genes implicated in therapeutic resistance. Indeed, they detected mutations that may affect sensitivity to novel therapeutics, such as MYD88 and CD79B mutations in a portion of R/R ABC patients, and STAT6 mutations in one third of R/R GCB patients that were associated with activated JAK/STAT signaling, increased phospho-STAT6 protein expression, and increased expression of STAT6 target genes \[[@B61-cancers-12-00185]\]. Another research highlighted JAK-STAT pathway involvement in the relapsed samples; the authors performed WES on 14 matched primary/relapse samples from six DLBCL patients and recorded a mild increase of mutations in relapsed samples as compared to primary tumour specimens; 264 genes possibly related to therapy resistance were identified, such as tyrosine kinases, glycoproteins, and JAK-STAT pathway genes, as well as PIM1, SOCS1, and MYC, already known to be related to a risk for treatment failure \[[@B62-cancers-12-00185]\]. Furthermore, recently two other large-scale differential multi-omics studies were conducted on R/R DLBCL patients \[[@B63-cancers-12-00185]\]. In the former, Fornecher et al. integrated quantitative proteomics and targeted RNA-seq data obtained from a cohort of R/R versus chemosensitive DLBCL patients and listed a set of 22 transcripts/proteins pairs, whose expression levels significantly differed between the two groups. In this list appeared genes involved in metabolism such as Hexokinase 3, in the microenvironment such as IDO1, CXCL13, in cancer cells proliferation, migration and invasion or the BCR signalling pathway such as CD79B \[[@B63-cancers-12-00185]\]. In the latter research, Rushton et al. collected samples from 134 R/R patients enrolled in three clinical trials and performed a combination of exome sequencing and target panel sequencing of lymphoma-associated genes on circulating tumour DNA (ctDNA) extracted from plasma samples and tissue biopsies \[[@B64-cancers-12-00185]\]. They found that R/R patients were enriched for mutations in five genes; TP53, IL4R, HVCN1, RB1, and MS4A1. Apart from TP53, already described in R/R cases \[[@B54-cancers-12-00185]\], they focused on the others showing that IL4R mutations may trigger constitutively activation of JAK/STAT signalling and were associated to inferior OS; HVCN1 modulates the B-cell receptor (BCR) function, and truncated HVCN1 isoforms have been demonstrated to enhance BCR signaling; MS4A1 encodes CD20, the target of Rituximab, and its mutations either truncate CD20, or destabilize a common transmembrane helix. Collectively, they found that DLBCL patients with such mutations present a higher risk of treatment failure \[[@B64-cancers-12-00185]\]. 1.4. Double Hit or Triple Hit B-Cell Lymphomas {#sec1dot4-cancers-12-00185} ---------------------------------------------- The debate about research into aggressive mature B-cell lymphomas with MYC, BCL2 and/or BLC6 aberrations, defined as high-grade B-cell lymphoma with double or triple hit (HGBL-DH/TH), deserves a special section as their detection constitutes a principal goal according to the last WHO classification \[[@B76-cancers-12-00185]\]. Quite recently, two research groups tried independently to recognize HGBL-DH/TH cases using gene expression signatures. Applying a gene expression--based classifier to a cohort of 928 DLBCL patients, Sha et al. identified a molecular high-grade (MHG) subgroup comprising 83 patients (9%), 75 of which were afferent to the GCB subtype \[[@B77-cancers-12-00185]\]. They revealed a subcategory of DH lymphomas and MYC rearrangement in one half of the total. GEP analysis identified proliferative features similar to centroblasts. PFS analysis at 36 months was 37% for the MHG subgroup after R-CHOP compared with 72% for others. Indeed, DH lymphomas not afferent to the MHG subgroup showed no evidence of a worse outcome than other GCB-like patients. Furthermore, they analysed the benefits of the addition of bortezomib to standard R-CHOP therapy; the collected data suggested a possible positive response to bortezomib \[[@B77-cancers-12-00185]\]. In another work, Ennishi et al. studied RNA-seq data deriving from 157 GCB-DLBCL cases, including 25 HGBL-DH/TH-BCL2 cases, to elaborate a gene expression signature identifying HGBL-DH/TH-BCL2 from other GCB-DLBCLs \[[@B78-cancers-12-00185]\]. Through this approach they elaborated a 104-gene panel with which 27% of all GCB-DLBCLs were grouped by the same expression signature, even if only one half harbored MYC and BCL2 rearrangements (HGBL-DH/TH-BCL2). They evidenced that, regardless of the HGBL-DH/TH-BCL2 status, the so-called double-hit signature-positive (DHITsig+) patients were characterized by inferior outcomes after immunochemotherapy as compared to negative patients. Indeed, they projected a new NanoString assay (DLBCL90) that should be useful in routine diagnostics to easily identify DHIT-positive cases \[[@B78-cancers-12-00185]\]. Later, Hilton et al evaluated through WES 20 DHITsig+GCB-DLBCL cases apparently lacking MYC and/or BCL2 rearrangements and revealed six tumours with cryptic MYC or BCL2 rearrangements that were FISH negative \[[@B79-cancers-12-00185]\]. Copy-number analysis revealed MYC and MIR17HG gains or amplifications, and focal deletions of the PVT1 promoter, both of which may contribute to dysregulation of MYC and its downstream pathways. These results support the role of the GEP signature for identifying GCB-DLBCL with poor outcomes \[[@B79-cancers-12-00185]\]. Through the expression signatures found, most HGBL-DH/TH were identified, emphasizing that, regardless of genetic or epigenetic aberrations, these patients present similar gene expression features. This observation highlights the concept that the mechanisms of alteration of the physiologic function of MYC and/or BCL2 are diverse and still emerging. Apart from structural aberrations such as translocation or gene amplification, the MYC role can be altered by transcriptional and post-transcriptional modifications, by the activation of enhancer/superenhancer elements \[[@B80-cancers-12-00185],[@B81-cancers-12-00185]\] as well as by mutations \[[@B82-cancers-12-00185]\]. So, it is well known that there are diverse MYC alteration mechanisms, and other new ones are being discovered. For example, very recently Gallardo et al. showed a novel mechanism of MYC signalling aberrant activation \[[@B83-cancers-12-00185]\]. They explored the biological consequences of overexpression of hnRNP K, an RNA-binding protein, whose expression is altered in cancer. They analysed the clinical implications of hnRNP K overexpression in 75 DLBCL patients without MYC alterations, observing hnRNP K overexpression in DLBCL patients even without MYC aberrations and its association with a short OS and PFS. Furthermore, hnRNP K overexpression in transgenic mice induced the development of lymphomas and reduced survival. Indeed, through global screening experiments and biochemical assays, they showed that hnRNP K is capable of post-transcriptionally and translationally regulating MYC. This aspect renders hnRNP K overexpressing-cells sensitive to BET-bromodomain-inhibition both in vitro and in transplantation models, opening out a new treatment strategy for DLBCL patients \[[@B83-cancers-12-00185]\]. From a diagnostic point of view, because sometimes HGBL-DH/TH DLBCL lacks aggressive morphological and/or immunohistochemical characteristics, the doubt arises whether FISH testing for MYC, BCL2, and BCL6 genes should be performed for every DLBCL case to detect DH status. A limitation to FISH testing was proposed only for GCB and double-protein expressor (DPE) (i.e., cases with MYC and BCL2 protein overexpression) DLBCL cases, thus reducing the analyses to 15% of patients \[[@B84-cancers-12-00185]\], but until now studies on large cohorts of patients are lacking. In their report, Scott et al. evaluated the prevalence of HGBL-DH/TH and the data resulting from FISH, COO (Lymph2Cx gene expression assay and/or Hans algorithm), and IHC testing in a large cohort of 1128 DLBCL cases deriving from three clinical trials and a population-based registry \[[@B85-cancers-12-00185]\]. Overall, 8% of the DLBCL analysed cases were HGBL-DH/TH and mostly GCB (13.3%) rather than ABC (1.7%). They demonstrated that the MYC rearrangement (MYC-R) featured 12.2% of cases that were mostly, but not totally, GCB DLBCLs: MYC-R alone and MYC/BCL6 HGBL-DH were observed in both ABC and GCB DLBCLs; instead, MYC/BCL2 and MYC/BCL2/BCL6 HGBL-DH/TH characterized only GCB. The data collected by the authors suggested that the best method for identifying all HGBL-DH/TH tumours is to perform FISH for the MYC rearrangement for all cases; when FISH testing is positive, BCL2 and BCL6 gene aberrations should be investigated \[[@B85-cancers-12-00185]\]. Another option is limiting FISH screening to GCB DLBCLs, thus reducing FISH experiments to half of DLBCL patients, still allowing the detection of about 99% HGBL-DH/TH with BCL2 rearrangements. However, this approach would prevent identifying rare MYC/BCL6 HGBL-DH \[[@B36-cancers-12-00185],[@B86-cancers-12-00185]\] and ABC/non-GCB cases with isolated MYC rearrangements. Indeed, the selection of DLBCL cases based on DPE status and/or COO did not allow about 35% of all HGBL-DH to be detected. Thus, FISH screening for MYC, BCL2, and BCL6 should be performed in routine diagnostics, together with gene expression assays and NGS; alternatively, the optimum is testing for MYC rearrangements, followed by BCL2 and BCL6 analyses if the former is positive \[[@B85-cancers-12-00185]\]. However, FISH testing for MYC rearrangements frequently does not allow breakpoint characterization and MYC-partner gene identification. In an interesting study conducted by Chong et al., targeted sequencing of MYC, BCL2, BCL6 and the immunoglobulin (IG) loci was applied in 112 DLBCL cases with a MYC aberration to explore the rearrangement at base pair resolution and to identify the partner gene identity \[[@B87-cancers-12-00185]\]. They characterized the partner gene in 88 cases and identified a breakpoint cluster region upstream of the MYC coding region and in intron 1. In this region, mostly breaks for translocations involving IGH (80%) occurred, whereas breaks involving non genic rearrangements were located downstream of the gene locus with different partners such as IGL and IGK. They identified BCL6, ZCCHC7, and RFTN1 as recurrent MYC partners, never previously described. Indeed, they tested two commercially available FISH break-apart assays for the search of MYC rearrangements, and found discordant data in 32% of the examined patients. In HGBL-DH cases most (65%) of the MYC rearrangements presented non-IG partners and the breakpoints were located outside the genic cluster region in 72% of cases. Furthermore, patients with de novo HGBL-DH and MYC-IG aberrations featured a trend toward progression and to shorter OS as compared to patients with MYC--non-IG rearrangements, thus associating MYC rearrangement architecture to the clinical outcome \[[@B87-cancers-12-00185]\]. More recently, another work confirmed these data: by analyzing a large cohort of 2383 DLBCL patients, Rosenwald et al. identified MYC-R in 264 (11%) cases, and evidenced that the negative prognostic impact of MYC-R is largely observed in patients with MYC DH/TH disease in which MYC is translocated to an IG partner \[[@B88-cancers-12-00185]\]. HGBL-DH/TH lymphomas are a specific subcategory according to the WHO classification, owing to their particular worse outcome \[[@B89-cancers-12-00185]\]. As regards DH lymphomas, MYC and BCL2 rearrangements frequently trigger the corresponding protein overexpression, characterizing a specific group called DPE lymphomas \[[@B90-cancers-12-00185],[@B91-cancers-12-00185]\], clinically featuring rapid progression and poor outcome. Recently, a study by Uchida et al. showed the positive effect of the BCL2 inhibitor venetoclax for the therapy of this subgroup of lymphomas \[[@B92-cancers-12-00185]\]. In vitro studies on DH and DPE lymphoma-derived cell lines revealed that the survival of neoplastic cells seems to depend on BCL2 activity rather than that of MCL1, a protein with a pro-survival function. In this context, they demonstrated that venetoclax interrupts the interaction between BCL2 and BIM, a pro-apoptotic protein, induces dephosphorylation of BCL2, and represses MCL1 protein expression. In primary lymphoma cell cultures, venetoclax was able to induce apoptosis even at low doses \[[@B92-cancers-12-00185]\], showing venetoclax as a promising strategy for the treatment of DH-DPE lymphomas. Nonetheless, the first clinical studies showed that as monotherapy it probably has no room, and even when combined with a trail inhibitor doesn't seem effective in relapsed DLBCL \[[@B93-cancers-12-00185]\]. However, further investigations are needed before coming to definitive conclusions. 1.5. NGS Application in Clinical Practice: Liquid Biopsy {#sec1dot5-cancers-12-00185} -------------------------------------------------------- In the future liquid biopsy will likely be the tool that can render NGS investigations more feasible and realistic. Analyzing circulating cell-free DNA (cfDNA) containing DNA released by the tumour cells (ctDNA), liquid biopsy is a non-invasive investigation that, joined to NGS sensitivity and specificity, will probably revolutionize cancer diagnosis, prognosis, and treatment. ctDNA has been demonstrated to be as accurate as genotyping of the diagnostic biopsy to detect somatic mutations in DLBCL \[[@B94-cancers-12-00185]\]; indeed, ctDNA analysis has proven able to define tumour burden \[[@B95-cancers-12-00185],[@B96-cancers-12-00185]\] and identify prognostic and actionable biomarkers \[[@B95-cancers-12-00185],[@B96-cancers-12-00185],[@B97-cancers-12-00185],[@B98-cancers-12-00185],[@B99-cancers-12-00185],[@B100-cancers-12-00185]\]. Indeed, it reflects the real tumour genomic heterogeneity, as demonstrated by the observation of varies mutations maybe originating from different tumour-associated localizations. Further, through liquid biopsy the response to therapy and minimal residual disease can be monitored, as well as transformation or chemoresistance emerging by tracking genetic evolution through ctDNA analysis over time \[[@B94-cancers-12-00185],[@B96-cancers-12-00185]\]. A 2019 work conducted liquid biopsy through targeted-NGS on a set of 390 lymphoma- and cancer-relevant genes in 50 lymphoma patients in order to establish the mutation profiles of different lymphoma subtypes and evaluate the correlation between the cfDNA concentration and other clinical indexes such as serum LDH and IPI \[[@B101-cancers-12-00185]\]. The cfDNA concentration in the plasma was significantly correlated with the clinical indices in DLBCL; indeed, the differences between GCB-DLBCL, non-GCB-DLBCL and natural killer/T-cell lymphoma were evident, confirming that NGS-based cfDNA mutation profiling is capable of discriminating different lymphoma subtypes as well as performing COO classification \[[@B96-cancers-12-00185],[@B101-cancers-12-00185]\], thus helping to direct precision medicine actions \[[@B101-cancers-12-00185]\]. Recently, ctDNA level measurement has recently been integrated in a new risk assessment method called CIRI (Continuous Individualized Risk Index), that dynamically evaluates individual outcome probabilities employing risk predictors obtained over time, producing real-time risk assessments during the patient's disease course. CIRI for monitoring DLBCL patients considers a total of six risk factors, including the IPI, COO, interim imaging (iPET), along with ctDNA measurements prior to cycles one, two, and three of therapy, and has been demonstrated to improve outcome prediction compared to conventional risk models, thus enabling therapy selection in the perspective of personalized medicine \[[@B102-cancers-12-00185]\]. 1.6. Discovering Personalized Treatment Approaches {#sec1dot6-cancers-12-00185} -------------------------------------------------- In the last years, the clinical management of patients with malignant lymphoma has benefited from research on tumour genomics and biology, particularly in the context of monoclonal antibodies and small molecule inhibitors \[[@B53-cancers-12-00185],[@B103-cancers-12-00185],[@B104-cancers-12-00185],[@B105-cancers-12-00185],[@B106-cancers-12-00185]\], despite some disappointing results of phase II/III trials on some promising agents (e.g., obinutuzumab and bortezomib) \[[@B107-cancers-12-00185]\] for which the underlying mechanisms are not well understood. Moreover, a problem of the first line studies is that in relapsed setting drugs have a short duration of responses and no plateau. Hence, any benefit seen in relapse setting does not necessarily translate in a durable increase in cure/remission in first line. Indeed, the efficacy of some drugs could be reduced because of incorrect combination with chemotherapeutic agents or insufficient dosage, as well as because of tumour-specific peculiarities \[[@B108-cancers-12-00185]\]. In the future, NGS implementation in the routine clinical diagnostics will render tumour genetic profiling within everyone's reach, offering the chance of a choice of tailored treatment strategies. However, despite the enormous excitement about the hypothesis of using targeted agents for patient personalized treatment, there are a series of inherent difficulties to be surmounted. Randomized trials on the addition of targeted drugs (ibrutinib, everolimus, bortezomib, and lenalidomide) to standard chemotherapy did not demonstrate a clear advantage \[[@B109-cancers-12-00185],[@B110-cancers-12-00185],[@B111-cancers-12-00185],[@B112-cancers-12-00185]\], and in some circumstances the use of targeted agents alone has been hypothesized. In other cases, the opportunity of drug combinations has been discussed \[[@B113-cancers-12-00185]\], as a better response can be obtained than with each drug alone. Indeed, although nowadays a number of new potent drugs are available, it is equally true that there could be a wide list of drug combinations that could be employed for patient treatment. The opportunity of using drug combinations that attack important cancer-signalling pathways at the same time from multiple fronts raises the chance of therapeutic success, especially in the treatment of tumours such as DLBCL that present with complex genetic heterogeneity. Indeed, this approach can reduce treatment resistance, which can frequently be due to pathway redundancies, cancer cell heterogeneity, and disease evolution \[[@B114-cancers-12-00185],[@B115-cancers-12-00185]\]. A clear example that confirms this concept is R-CHOP, which has recently been demonstrated to be effective and curative thanks to low cross-resistance, rather than synergy among drugs \[[@B116-cancers-12-00185]\]. However, today only a narrow list of approved drug combinations is available; indeed, they mostly derive from empirical clinical experience rather than rational design. To meet this need, some computational models have been developed that integrate the tumour genomic signatures with pharmacological profiles of drugs. In 2018, Preuer et al. developed a deep neural network model, DeepSynergy, to elaborate drug combinations integrating the data deriving from gene expression analysis of 39 cancer cell lines with the chemical peculiarities of 38 anti-cancer drugs \[[@B117-cancers-12-00185]\]. However, some authors observed that this method uses large numbers of known synergistic drug combinations, frequently not providing a hypothesis of the potential mechanism of a specific drug combination synergy. Other approaches were then developed in order to identify the underlying molecular mechanisms of disease; one example is Combinatorial Drug Assembler (CDA) \[[@B118-cancers-12-00185]\], a pathway-based model elaborated to discover drug combinations targeting pathways that overlap with tumour-enriched signalling pathways using differentially expressed genes. Another model is TIMMA \[[@B119-cancers-12-00185]\], which identifies drugs targeting multiple driver pathways by elaborating and combining drug screening data and drug target interactions into a target inhibition network framework. However, the survival pathways to be targeted were identified based on empirical selection, not considering genomic data. Recently, some investigators proposed a new computational system biology tool that they called DrugComboExplorer, which combines specific genomic characteristics of cancer types (i.e., signalling pathways, interactome and pharmacological data) with pharmacogenomic profiles of 5585 drugs and bioactive compounds from the NIH LINCS program (Library of Integrated Network-based Cellular Signatures) \[[@B120-cancers-12-00185]\]. Indeed, by adopting a data-driven strategy and by combining multi-omics data (DNA seq, gene copy number, DNA methylation, and RNA-seq data) of individual cancer patients, this tool unveils new regulatory signalling pathway mechanisms (i.e., driver signalling networks) and is able to perform large-scale drug combination prediction (15,593,320 available drug combinations). In vitro validation experiments on DLBCL and prostate cancer cell lines, in order to evaluate the reliability and the predictive power of their bioinformatics tool, confirmed its utility in identifying targetable cancer driver pathways and prioritizing potential drug combinations useful to attack them \[[@B120-cancers-12-00185]\]. Surely, this kind of approach is still in its infancy as the authors admit, but further investigations are ongoing to try to apply these models to specific cancer cases in clinical practice in order to identify personalized drug combinations and more efficient treatment plans for individual patients \[[@B120-cancers-12-00185]\]. Then, large scale collaborations should be scheduled integrating mulit-omics data, Bayesian trial design, and early shared endpoints based on, for example, CIRI or any interim guided models to test in vivo the reliability of these drug combination-predicting models ([Figure 1](#cancers-12-00185-f001){ref-type="fig"}). 2. Conclusions {#sec2-cancers-12-00185} ============== The attentive observer has surely realized that there is currently a dichotomy between the potentialities deriving from the recent discoveries for DLBCL diagnosis, prognosis, and treatment, and patient management in real clinical life. Despite discoveries of new drugs, R-CHOP remains the standard treatment approach, and targeted therapy is considered mostly for R/R patients. This circumstance will probably persist for a while, but when the biological background becomes clearer, when genome-wide screening has become within everyone's reach, and when targeted drugs have demonstrated their real benefits, personalized medicine will become feasible also for DLBCL. In this panorama, a great improvement in clinical management of patients will certainly derive from the synergy of data obtained from liquid biopsy, providing information about therapy options stitched onto the patient's specific disease. Probably, today we are still far from this goal, as standardizations and clinical trial designs are still needed to render molecularly driven approaches really achievable. In any case, the bases are there, allowing us to pursue the goal of realizing targeted therapy for DLBCL. The authors would like to thank Mary Victoria Pragnell, B.A., for language revision of the manuscript. This work was supported by the 'Il sorriso di Antonio' Association (Corato, Italy) and Associazione Italiana contro le Leucemie (AIL)-BARI. The authors declare no conflict of interest. ![Today a series of technologies are available for DLBCL profiling. Through their integration each patient can benefit from a better diagnostic and prognostic framework, including non-invasive disease tracking on ctDNA analysis with liquid biopsy. From the perspective of personalized medicine, the treatment option will be stitched onto the patient after a multi-omic analysis of the disease's specific biologic features. This information will be then combined with drug-specific peculiarities to generate a list of targeted drug combinations for the choice of the best therapy for each patient.](cancers-12-00185-g001){#cancers-12-00185-f001} cancers-12-00185-t001_Table 1 ###### Summary of the most relevant recent studies about DLBCL molecular classification and prognostication. Reference Kind of Study Main Molecular Findings Clinical Implications --------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- New Prognostic Biomarkers and Models Reddy et al., Cell 2017 \[[@B49-cancers-12-00185]\] Exome and transcriptome sequencing of 1001 DLBCL cases Identification of 150 driver genes set, definition of a prognostic model better than current ones -MYC mutations or aberrant expression: worst prognosis-CD70 alterations: better outcome Schmitz et al., NEJM 2018 \[[@B50-cancers-12-00185]\] WES, RNA-seq, gene copy number analysis and targeted sequencing of 372 genes in 574 DLBCL cases Development of a specific algorithm identifying four genetic subtypes: -MCD (MYD88L265P and CD79B mutations),-BN2 (BCL6 fusions and NOTCH2 mutations),-N1 (NOTCH1 mutations),-EZB (EZH2 mutations and BCL2 translocations) -BN2 and EZB: favourable outcome-MCD and N1: inferior outcome-MCD and BN2 subtypes depend on BCR signalling pathway activation (targeted therapeutic option) Chapuy et al., Nat Med 2018 \[[@B51-cancers-12-00185]\] WES and targeted sequencing on 304 DLBCL patients Identification of five DLBCL subsets:-C1 (NOTCH2 mutations)-C2 (TP53 and CDKN2A alterations, genomic instability)-C3 (PTEN, KMT2D, CREBBP, and EZH2 aberrations)-C4 (BCR--PI3K, NF-κB, or RAS--JAK pathway alterations, BRAF, STAT3, CD83, CD70, and CD58 mutations)-C5 (BCL2, MYD88L265P, CD79B, PIM1, and PRDM1 alterations) -C1: low-risk-C2: poor outcome-C3: poor outcome-C4: favourable outcome-C5: unfavourable outcome Vermaat et al., Haematologica 2019 \[[@B52-cancers-12-00185]\] NGS, allele-specific PCR and FISH on 250 DLBCL cases Identification of:-MYD88 and CD79B mutations in 29.6% and 12.3%-MYC, BCL2, and BCL6 rearrangements in 10.6%, 13.6%, and 20.3%, respectively MYD88 mutations: adverse prognostic impact Jain et al., Sci. Transl. Med 2019 \[[@B53-cancers-12-00185]\] DNA copy number analysis of 1000 DLBCL cases Identification of 18q21.2 gains as the most frequent genetic alteration in the ABC-like group, with involvement of TCF4 (E2-2) transcription factor gene The inhibition of TCF4 activity through BET inhibitors could be employed in the treatment of this patient subset Intlekofer et al., Blood Cancer 2018 \[[@B54-cancers-12-00185]\] Targeted NGS on 198 DLBCL cases Identification of a median number of six genetic aberrations per case, with 97% of patients presenting at least one alteration and 54% of cases more than one (e.g., MYD88, CREBBP, CD79B, EZH2) -Less common aberrations (BRAF, CD274 (PD-L1), IDH2, and JAK1/2) could be employed as potential therapeutic targets-TP53 alterations: more frequently associated to lack of response to first-line chemotherapy and involved in R/R DLBCL Alkodsi et al., Leukemia 2019 \[[@B55-cancers-12-00185]\] WGS, RNA-seq, and gene expression from literature DLBCL cohorts The expression of 36 SHM target genes identifies four SHM subtypes:-SHM1 (BCL2, MYC, and chromatin modifying genes aberrations)-SHM2 (BCR signalling pathway mutations)-SHM3 (JAK-STAT pathway mutations)-SHM4 (BCL6 fusions and mutations in CD70 and BCL10) -SHM1: poor outcome after standard R-CHOP therapy-SHM2: worst outcome, could be treated with kinase inhibitors-SHM3: better outcome to standard cure-SHM4: worst outcome, similar to SHM2 Arthur et al., Nat. Commun. 2018 \[[@B56-cancers-12-00185]\] Integrative analysis of whole genomes, exomes, and transcriptomes on thousands of DLBCL cases Identification of:-recurrent NFKBIZ 3' UTR mutations causing NF-κB pathway activation in the ABC subgroup-Small amplifications associated with over-expression of FCGR2B, in the GCB subgroup These results revealed new driver DLBCL mutations, improving diagnostic assays and offering new possibilities for the development of targeted therapeutics Wang et al., Carcinogenesis 2019 \[[@B57-cancers-12-00185]\] WES on 22 early stage DLBCL and validation on 35 primary DLBCL cases Identification of two MATH score classes: low and high MATH score groups according to the median expression level -The higher MATH score group was associated with a higher risk of progression-The MATH score has a prognostic value that could be considered in the management of DLBCL patients Causes of Transformation and Chemoresistance Pasqualucci et al., Cell Rep. 2014 \[[@B58-cancers-12-00185]\] WES and SNP array analysis on 12 FL samples at diagnosis and on 39 transformed FL Identification of CDKN2A/B, MYC and TP53 as major drivers of transformation of FL to an aggressive malignancy, typically DLBCL The genomic profile of transformed FL shares similarities with de novo DLBCL-GCB but also displays unique gene mutations with diagnostic and therapeutic implications González-Rincón et al., PLoS One 2019 \[[@B59-cancers-12-00185]\] Targeted NGS on 22 pre-transformed /transformed and on 20 non-transformed FL cases Transformed FL are characterized by several recurrently mutated genes with roles in B-cell differentiation, GC architecture and migration (LRP1B, GNA13 and POU2AF1) -Four genes differed between patients who did and did not show transformation (NOTCH2, DTX1, UBE2A and HIST1H1E)-the mutation of these genes was related to a higher risk of transformation Jiang et al., Genome Biol. 2014 \[[@B60-cancers-12-00185]\] High-throughput sequencing of rearranged VDJ junctions in 14 pairs of matched diagnosis-relapse DLBCL Two proposed mechanisms of clonal evolution:-the early-divergent mode with two distinct clones (the diagnostic and the relapsing one) that early diverged;-the late-divergent mode, in which relapse clones descended directly from diagnostic clones with minor divergence Although DLBCL relapse may result from multiple tumour evolutionary mechanisms, each mechanism could provide rationale for therapies Morin et al., Clin. Cancer Res. 2016 \[[@B61-cancers-12-00185]\] WES on 38 R/R DLBCL biopsies and on an unrelated cohort of 138 diagnostic DLBCLs Identification of TP53, FOXO1, MLL3 (KMT2C), CCND3, NFKBIZ, and STAT6 as top candidate genes implicated in therapeutic resistance Detection of mutations (MYD88 and CD79B) that may affect sensitivity to novel therapeutics Nijland et al., Cancers (Basel). 2018 \[[@B62-cancers-12-00185]\] WES on 14 matched primary/relapse samples from six DLBCL patients Identification of 264 genes possibly related to therapy resistance, including tyrosine kinases, transmembrane glycoproteins, and genes involved in the JAK-STAT pathway Identification of resistance-related genes such as PIM1, SOCS1, and MYC, that confer a risk for treatment failure Fornecker et al., Sci. Rep. 2019 \[[@B63-cancers-12-00185]\] Integrated quantitative proteomics and targeted RNA-sequencing in 8 R/R DLBCL cases versus 12 chemosensitive DLBCL patients Identification of a set of 22 transcripts/proteins pairs, whose expression levels significantly differed between the two analysed groups Identification of new biomarkers related to chemoresistance, new potential drug targets: Hexokinase 3, IDO1, CXCL13, S100 proteins, CD79B Rushton et al., Hematol. Oncol. 2019 \[[@B64-cancers-12-00185]\] WES and targeted NGS on plasma samples and tissue biopsies from 134 R/R patients R/R patients were enriched for mutations in five genes: TP53, IL4R, HVCN1, RB1 and MS4A1 DLBCL patients with mutations in these five genes present a higher risk of treatment failure Abbreviations: WES, whole-exome sequencing; RNA-seq, transcriptome sequencing; NGS, next-generation sequencing; R/R, relapse or refractory; MATH, mutant-allele tumour heterogeneity; SNP, single nucleotide polymorphism; FL, follicular lymphoma; VDJ, Variable Diversity Joining.	{ "pile_set_name": "PubMed Central" }
describe Wordmove::Doctor::Mysql do let(:movefile_name) { 'multi_environments' } let(:movefile_dir) { "spec/fixtures/movefiles" } let(:doctor) { described_class.new(movefile_name, movefile_dir) } context ".new" do it "implements #check! method" do expect_any_instance_of(described_class).to receive(:check!) silence_stream(STDOUT) { doctor.check! } end it "calls mysql client check" do expect(doctor).to receive(:mysql_client_doctor) silence_stream(STDOUT) { doctor.check! } end it "calls mysqldump check" do expect(doctor).to receive(:mysqldump_doctor) silence_stream(STDOUT) { doctor.check! } end it "calls mysql server check" do expect(doctor).to receive(:mysql_server_doctor) silence_stream(STDOUT) { doctor.check! } end it "calls mysql database check" do # expect(doctor).to receive(:mysql_database_doctor) silence_stream(STDOUT) { doctor.check! } end end end	{ "pile_set_name": "Github" }
The invention relates generally to Internet Protocol (IP) packet communication methods and apparatus and more particularly to point to point protocol (PPP) packet communication methods and apparatus. Internet Protocol (IP) based wireless communication architectures are known. As shown in FIG. 1, in the future the link between a base transceiver station (BTS) 100 and a selection/distribution unit (SDU) 102 will be based on IP that communicates point to point protocol (PPP) packets 101. The SDU may be part of a base site controller (BSC) or other suitable network element. The TIA/EIA/IS-634 standard (e.g., Part 4. Revision A xe2x80x9cCore Protocol Detailsxe2x80x9d) defines the application protocols and the messages shared between the SDU and the BTS 100. These messages between applications 103 will be transported over an IP network 104. In the IS-634 standard, the interface between the SDU and the BTS is called the A3 interface. For the user traffic exchanged between the SDU and the BTS, IS-634 assumes that the transport layer provides the call-context information. This information is not included in the IS-634 message itself. Since the current system is circuit switched, the slot position in the connection between the BTS and the SDU provides this information and in the proposed packetized system, an AAL2 header provides the call-context information. In the IP based system, the unique call-context reference will be specified by using user datagram protocol (UDP) between the SDU and the BTS. A mobile station 105 communicates with the BTS 100 as known. The UDP port number along with the IP address will provide the unique call-context information. The protocol stack 106 between the SDU and the BTS is shown in FIG. 1. An SDU consists of multiple SDU elements. Each SDU element terminates one call. The following four tuple: (IP address of the SDU 108, Port number of the SDU 110, IP address of the BTS 112, Port number on the BTS 114), provides a unique call context for each leg of a call. The IP address and UDP port numbers provide the unique call-context for each IS-634 frames 116. A point to point protocol (PPP) header 118 and PPP CRC information 120 is also used. In most of the current systems and systems which will be deployed for the next few years, a T1 1.544 Mbps link 122 forms the backhaul link from the BTS 100 to the core network. This link 122 is very expensive and should be able to carry data for as many calls as possible. Hence, the key problem is to compress the data and decrease the header overhead as much as possible. As known in the art, link 122 is terminated using Channel Service Units/Data Service Units (CSU/DSU) 124 and 126. A standard way to carry IP packets over T1 links is to use point to point protocol (PPP) as a link layer protocol over the T1 link. In the default mode, PPP prepends 5 bytes of header and 2 bytes of trailer to each IP packet; thus the default PPP overhead is 7 bytes. When the two ends of the link negotiate to reduce the header of PPP, the PPP overhead can be reduced to 5 bytes: Flag byte+2-Protocol type bytes+2-CRC bytes. (it cannot be assumed that the protocol type field could be reduced to 1 byte, as the protocol byte field for compressed TCP and UDP payloads occupy 2 bytes). In addition UDP header compression is described by RFC 2508. In this case, the compressed UDP header is 2 bytes. Thus the overhead per IS-634 frame is 7 bytesxe2x80x942 bytes compressed UDP header and 5 bytes PPP overhead. There is also a checksum feature of the UDP header. However, this PPP overhead can be unnecessarily large and can unnecessarily reduce the available bandwidth over the T1. Another type of multiplexing scheme is described in ITU-T I.363.2, B-ISDN ATM Adaptation Layer: Type AAL2. This is a multiplexing scheme for point to point asynchronous transfer mode (ATM) virtual connections, whereby voice packets from multiple users may be contained in a single ATM cell payload 200. Each AAL2 user packet 202, 204, 206 that is multiplexed onto a given AAL2 virtual connection has a unique call-context reference, a Connection Identifier (CID). An example protocol stack 208 for this scheme is shown in FIG. 2. Also, there have been several proposals for multiplexing real time transfer protocol (RTP) streams in the Internet. In the proposed designs, interest has also been expressed for reusing the RTP multiplexing scheme for improving the efficiency of transporting data on the BTS backhaul link. In the Internet, RTP multiplexing schemes have been proposed as methods to multiplex a number of low bit rate audio streams into a single RTP/UDP/IP connection between IP telephony gateways 300 and 302. The telephony gateways 300 and 302 may couple to Public telephone Networks (PTNs) 304. The deployment scenario for these multiplexing schemes is shown in FIG. 3. The RTP multiplexing schemes are used to multiplex traffic between the two gateways 300 and 302 to transport data efficiently over the Internet. A requirement for the multiplexing schemes is that all the RTP streams 306, 308 being multiplexed originate and terminate at the same end-points, i.e. the IP address in the IP/UDP headers 310, 312 are the same. In all the proposals, each multiplexed stream is identified by a channel identifier 314 which is used to identify the payload belonging to that stream. The format and placement of the channel identifier differs between the different scenarios. A lookup table 316 can be used as a mechanism to multiplex or demultiplex IP packets. One possible case of reusing the RTP multiplexing scheme for the BTS backhaul link is shown in FIG. 4. Much like in the AAL2 multiplexing case, there is an initial level of signaling which involves the SDU, packet control unit 400 PCU and the BTS (BTS includes the network interface board (NIB). This signaling sets up the two maps 402, 404 as shown in FIG. 4. In the upstream direction, the map 404 at the NIB enables the NIB to map from the multi-channel carrier card (MCC) (signal processor and channel coding card) device address that it receives in the packet from the BTS to the C_ID. At the packet control unit (PCU), a mapping is used to the SDU device address from the C_ID received on the link from the BTS. A router 406 suitably routes IS-634 packets to the appropriate SDU. The opposite occurs for downstream traffic. If the SDU sits on an IP network, this would mean recreating the UDP/IP header for the SDU device. This is very different from the process occurring in the Internet RTP multiplexing scheme. Recreating IP/UDP headers is a more complicated task than using the C_ID to identify one stream in a multiplexed RTP stream. Another possibility of using RTP Multiplexing is shown in FIG. 5. In this scheme the SDU multiplexes the user information destined to one BTS into one multiplexed RTP stream 500 using routers 502 and 504. The disadvantages of this scheme are that the scheme cannot multiplex traffic destined to one BTS from different SDUs. In addition, the multiplexing gain may not be very high at the SDU. Typically there are two or three SDU serving 100 BTSs. Also, unless an RTP header is used for achieving synchronization between the SDU and the BTS, the RTP header is useless and one might have to implement real-time transfer control protocol (RTCP) at the SDU and the BTS to be able to use RTP. Accordingly a need exists for a method and apparatus for reducing PPP packet sizes communicated over a communication link.	{ "pile_set_name": "USPTO Backgrounds" }
Q: Normal subgroup question/example Give an example(s) of a group $G$ and $H\leq G$ (i.e., $H$ is a subgroup of $G$) where $H$ is not normal in $G$. What about $S_3$ and $\langle(1\;2)\rangle=\{(1),(1\;2)\}$? [Since $(1\;2\;3)(1\;2)(1\;3\;2)=(2\;3)\not\in\langle(1\;2)\rangle$] Does this work? Any other ideas? A: It is not rare to see examples of subgroups of a given group, which are not normal subgroups. I'll give you one from finite groups. Consider this finite group of order $8$, call it $G$. Then $2\in G$ and $H=\{0,1\}$ is a subgroup of $G$. But $H$ is not normal, since $$2H=\{2,4\}\ne\{2,3\}=H2.$$	{ "pile_set_name": "StackExchange" }
(AP Photo/Mary Altaffer) On Thursday, the National Academies of Sciences, Engineering, and Medicine will release its report on “The Economic and Fiscal Consequences of Immigration.” According to the report, first generation immigrants as a group increase the nation’s fiscal deficit. In other words, the government benefits they receive exceed the taxes paid. The National Academies’ report provides 75-year fiscal projections for new immigrants and their descendants. The fiscal impact varies greatly according to the education level of the immigrant. Low-skill immigrants are shown to impose substantial fiscal costs that extend far into the future. The future government benefits they will receive greatly exceed the taxes they will pay. On average, a nonelderly adult immigrant without a high school diploma entering the U.S. will create a net fiscal cost (benefits received will exceed taxes paid) in both the current generation and second generation. The average net present value of the fiscal cost of such an immigrant is estimated at $231,000, a cost that must be paid by U.S. taxpayers. The concept of “net present value” is complex: it places a much lower value on future expenditures than on current expenditures. One way to grasp net present value is that it represents the total amount of money that government would have to raise today and put in a bank account earning interest at 3 percent above the inflation rate in order to cover future costs. Thus, as each adult immigrant without a high school diploma enters the country, the government would need to immediately put aside and invest $231,000 to cover the future net fiscal cost (total benefits minus total taxes) of that immigrant. Converting a net present value figure into future outlays requires information on the exact distribution of costs over time. That data is not provided by the National Academies. However, a rough estimate of the future net outlays to be paid by taxpayers (in constant 2012 dollars) for immigrants without a high school diploma appears to be around $640,000 per immigrant over 75 years. The average fiscal loss is around $7,551 per year (in constant 2012 dollars). Slightly more than 4 million adult immigrants without a high school diploma have entered the U.S. since 2000 and continue to reside here. According to the estimates in the National Academies report, the net present value of the future fiscal costs of those immigrants is $920 billion. This means government would have to immediately raise taxes by $920 billion and put that sum into a bank account earning 3 percent plus inflation per year to cover the future fiscal losses that will be generated by those immigrants. To cover the future cost, each taxpaying U.S. household, on average, would have to pay an immediate lump sum of over $10,000. Costs would go up in the future as more than 200,000 additional adult immigrants without a high school diploma arrive in the country each year. Again, converting a net present value figure into future outlays requires information on the exact timing of future costs that are not provided by the National Academies. However, a rough estimate of the future net outlays (benefits minus taxes) for the 4 million adult immigrants without a high school degree who have entered the U.S. since 2000 is perhaps $2.6 trillion. One might argue that these estimates are exaggerated because many immigrants may return to their country of origin. But the report estimates already have a re-emigration rate of 31 percent built in. A surge of low-skill immigrant workers may push down wages and thereby reduce consumer costs. But the National Academies report indicates such consumer gains would be modest, and if the wages of less-educated immigrants are driven down, the wages of less-educated U.S. workers will fall as well. Any consumer gains would come at the cost of wage losses for the most vulnerable American workers. One might also argue that is it misleading to assign the costs of government “public goods” such as defense and interest of the national debt to recent immigrants. But the National Academies estimates exclude such public goods costs. Advocates of ongoing, massive low-skill immigration have suggested that low-skill immigrants generate large-scale economic externalities that benefit U.S. workers. The National Academies report finds minimal evidence of such effects. The continuing inflow of low-skill immigrants into the U.S. creates large fiscal burdens for U.S. taxpayers in both the present and the future. Robert Rector, a leading authority on poverty, welfare programs and immigration in America for three decades, is The Heritage Foundation’s senior research fellow in domestic policy. Jamie Bryan Hall is a senior policy analyst in the Center for Data Analysis at The Heritage Foundation. His research focuses on immigration and other issues in support of the Institute for Family, Community, and Opportunity.	{ "pile_set_name": "OpenWebText2" }
Q: powershell script to add text to existing aspx file I'm trying to find resources to help me write a powershell script to add text to an existing aspx file but can't seem to find anything. Does anybody have any suggestions or is there anybody that can help me some other way? Update: So it's out there, I'm using version 1.0. I have: $lines = Get-Content foo.aspx $lines = "<head>asfdsfsafd</head>" + $lines $lines \| Out-File "c:\documents and settings\...\foo.aspx" -Encoding utf8 but it wipes out everything originally in foo.aspx and creates <head>asfdsfsafd</head><head>asfdsfsafd</head>. How do I fix it so it keeps the original stuff in foo and add stuff to the beginning of the file rather than end? Update: I've figured out how to add text with: $lines = add-content -path "C:\Documents and Settings\..\foo.aspx" -value "Warning...." but want the text to go at the beginning of the aspx file Update: I found a function that does what I want and I'm all set. A: You can get the content (array of strings) of the ASPX file using Get-Content: $lines = Get-Content foo.aspx Or you can get the content as a single string which is sometimes more useful if you want to use a regex that spans lines: $content = Get-Content foo.aspx -raw As far as changing the content, you have all sorts of options: $content = "text before " + $content $content += "text after" $content = $content -replace 'regex pattern','replacement text' And then to write back out to the file: $content \| Out-File foo.aspx -Encoding <UTF8 or ASCII or UNICODE>	{ "pile_set_name": "StackExchange" }
Caffeic acid-assisted cross-linking catalyzed by polyphenol oxidase decreases the allergenicity of ovalbumin in a Balb/c mouse model. Ovalbumin (OVA) is the most abundant egg white protein, but is also a major egg allergen. Desensitization of OVA may be a good way to control an egg allergy. In this study, caffeic acid-assisted cross-linked OVA catalyzed by polyphenol oxidase (PPO) was prepared, the effect of cross-linking on the allergenicity of OVA was tested in a Balb/c mouse model. Mice were orally sensitized with OVA or cross-linked OVA using cholera toxin as adjuvant. Clinical signs of allergy, specific antibody levels, serum histamine levels, mast cell protease-1 (mMCP-1) concentrations, morphological structure of duodenum, and cytokines were determined after mice were challenged with OVA or cross-linked OVA. Both OVA and cross-linked OVA induced allergic diarrhea in Balb/c mice, however, histological symptoms of small intestine were much milder in mice fed with cross-linked OVA than in those fed with OVA. A tendency toward decreased allergen-specific IgE, IgG, IgG1 and IgG2a levels, as well as serum histamine and mMCP-1 concentration were observed in cross-linked OVA group, accompanied by an inhibition of IL-4, IL-5, IL-13 and IFN-γ production in the stimulated spleen cell. It could be concluded that caffeic acid-assisted PPO-catalyzed cross-linking significantly reduced the potential allergenicity of OVA, but may not completely eliminate it.	{ "pile_set_name": "PubMed Abstracts" }
Q: How to approach animations and OpenGL There are tons of tools and instructions for making 3d models and animations in various software products. My question is: in video-game engines, when would you use a pre-rendered animation, and when would you use armature data in the model to manipulate your model in to the desired action? Secondary questions: Are there any games that even use the model's rigging, in-game, or is everything pre-rendered? Are there any human-readable file formats that contain armature data? Lastly, from a OpenGL-level and up perspective, how would you implement a system for animating something like walking? I am building an OpenGL graphics engine from scratch as a personal project, so if answers can cater to that context, it would be fantastic. A: Yeah, most games use a model's rigging and apply animation tracks to the bones in real time based on things happening in the game or player input. Animations can also be blended between to make new animations or transition from one animation to another. Animations can also be combined such that the lower half of a body is playing one animation and the upper half is playing a different animation. There is also something called parametric animation where a lot more of the animations are derived from a smaller set of animated bone data. There is also various levels of physics based animation such as ragdoll and inverse kinematics. I've specialized as an animation programmer at previous employers, check out this more detailed info based on my experiences and observations: http://blog.demofox.org/2012/09/21/anatomy-of-a-skeletal-animation-system-part-1/	{ "pile_set_name": "StackExchange" }
Google is completely redesigning AdWords - uptown http://searchengineland.com/adwords-redesign-first-look-246074 ====== eggy In Dart and Angular 2. I have to take a look at Dart again. I thought it was going to be left to wither and die, but with Flutter and now this, I have to go back and take another look. The tooling was fun, and they are developing or have developed a 'strong mode' for stronger typing. ------ rylest14 Love the new interface - going to make Adwords much more user friendly!	{ "pile_set_name": "HackerNews" }
1. Field of the Invention The present invention relates to a transmission document edition device that edits transmission documents described in markup languages, a received document processing device that receives and processes the transmission documents, and a communication document processing system that includes the transmission document edition device and the received document processing device. 2. Description of the Conventional Art As a markup language, the SGML (Standard Generalized Markup Language) that is standardized by the ISO (International Organization for Standardization) has been used. The SGML is designed for document interchanges and is expressed as a group of elements called tags to describe the contents and the structure of a document. In the SGML, the contents of a document is precisely described. As a result, it is possible and easy to analyze such a document using a computer. With the development of the Internet, the documents in the HTML (Hypertext Markup Language) that is based on the SGML have been interchanged. Such a document described in the HTML, i.e., an HTML document, is displayed using a Web browser that is a software for processing documents in the HTML. The HTML is standardized by the W3C (World Wide Web Consortium). The HTML Ver.3.2 has been standardized, and now standardization of the HTML Ver.4.0, which is the HTML for the next generation, is now being discussed. (The HTML is disclosed in detail on the home page with the URL (Uniform Resource Locator) xe2x80x9chttp://www.w3c.org/xe2x80x9d.) The HTML Ver.4.0 enables the processing corresponding to an input operation using the Web browser to be described in the program called xe2x80x9cscriptxe2x80x9d. As a result, a wider variety of expression may be realized using the HTML Ver.4.0. For instance, it is possible to change the color of certain part of a document with the click of a mouse. Conventionally, such an HTML document, which is transmitted via the Internet, was only received and displayed by personal computers, workstations, or the like. Recently, mobile communication terminals such as a portable remote terminal installed with a Web browser have begun to process such an HTML document. Mobile communication terminals, however, have smaller display screens than personal computers, and the display areas are limited compared with those of personal computers. As a result, when displaying an HTML document that is originally created for personal computers or workstations, mobile communication terminals cannot display the HTML document as it is intended to be displayed. In order to solve the problem, it is necessary to create different HTML documents for different types of communication terminals. As described above, it is possible to describe the processing corresponding to an input operation using the Web browser in an HTML document. Such an HTML document can include information on input units that mobile communication terminals are not equipped with. In this case, the operations using the input units may not be realized by mobile communication terminals. For instance, an operation input with a mouse may not be realized by pagers, which are equipped with no mouse. It is accordingly an object of the present invention to provide a transmission document edition device that edits a transmission document from a general purpose document that is described in a markup language and a plurality of pieces of device information each piece of which includes information on the processing of the general purpose document for one specification of mobile communication terminal. Another object of the present invention is to provide a transmission document edition device that simulates the display of a transmission document by a plurality of specifications of mobile communication terminal and the processing corresponding to a user input operation. A further object of the present invention is to provide a received document processing device that enables a mobile communication terminal that receives a transmission document edited by the transmission document edition device to display the received transmission document in the most suitable manner and to perform processing corresponding to a user input operation. Yet another object of the present invention is to provide a communication document processing system that changes a transmission document edited by the transmission document edition device into another transmission document for a specification of mobile communication terminal in order to reduce the load of the specification of mobile communication terminal and transmits the changed transmission document to the specification of mobile communication terminal. The above-mentioned first object is achieved by a transmission document edition device that edits a transmission document to be transmitted to receiver devices of a plurality of specifications from a general purpose document described in a markup language, that may include: a document storage unit for storing the general purpose document described in the markup language; a device specification information storage unit for storing a plurality of pieces of device specification information, each piece of which a receiver device of a different specification refers to when processing the general purpose document according to marks in the markup language; and a transmission document creation unit for reading the general purpose document stored in the document storage unit and the plurality of pieces of device specification information stored in the device specification information storage unit and for creating the transmission document in which the general purpose document and the plurality of pieces of device specification information are related to each other. It is possible for the transmission document edition device to create one transmission document that mobile communication terminals of the plurality of specifications may process. As a result, it is unnecessary to create a different transmission document for each specification of mobile communication terminal. The first object may be achieved by the transmission document edition device, wherein a piece of device specification information includes information defining input and/or information defining output for a specification of receiver device, wherein information defining input includes each operation of a receiver device of a specification and a processing of the general purpose document accompanying an operation for each operation, and information defining output includes processing conditions for displaying the general purpose document in a manner suitable for the specification of receiver device, and the transmission document creation unit reads information defining input and/or information defining output for each of the plurality of specifications of receiver device from the device specification information storage unit, and has the read information defining input and/or the read information defining output be included in the transmission document in a manner in which information defining input and/or information defining output for a specification of receiver device is distinguishable. It is possible for the transmission document edition device to create one transmission document that includes a plurality of pieces of device specification information for the plurality of specifications of mobile communication terminal. As a result, a mobile communication terminal may perform the same processing as processing the general purpose document in a transmission document created only for the specification of the mobile communication terminal. In addition, a mobile communication terminal may process the general purpose document using the operation key on the mobile communication terminal. The first object may also be achieved by the transmission document edition device, wherein the transmission document creation unit describes an identifier showing a specification of receiver device using a first tag, information defining output using a second tag, and information defining input using a third tag, wherein each of the first tag, the second tag, and the third tag corresponds to a mark in the markup language. The first object may also be achieved by the transmission document edition device that may include transmission unit for transmitting the transmission document that the transmission document creation unit has created to the receiver devices of the plurality of specifications. As a result, a mobile communication terminal that receives a transmission document may distinguish the necessary piece of device specification information using tags and extract the distinguished device specification information. The above-mentioned second object is achieved by the transmission document edition device that may include: a transmission document storage unit for storing the transmission document that the transmission document creation unit has created; an acceptance unit for accepting a designation of a specification of receiver device for which a simulation is run from an operator; and a simulation execution unit for reading a piece of device specification information for the accepted specification of receiver device and the general purpose document from the transmission document stored in the transmission document storage unit, for creating a simulation document from the read general purpose document according to the read piece of device specification information, and for displaying the created simulation document. It is possible for the transmission document edition device to check a display document displayed by a mobile communication terminal as a simulation document. As a result, a transmission document may be created efficiently. The second object may be achieved by the transmission document edition device, wherein the general purpose document includes a plurality of document elements, the read piece of device specification information includes processing conditions for displaying the general purpose document in a manner suitable for the accepted specification of receiver device, and the simulation execution unit includes a simulation document creation unit for selecting each document element designated by the processing conditions from the general purpose document and for creating the simulation document from the selected document element. As a result, each document element in a simulation document may be checked. The second object may also be achieved by the transmission document edition device, wherein the processing conditions include display screen size information, document element selection information, and scroll information for the accepted specification of receiver device, and the simulation document creation unit includes: a general purpose document reading unit for reading the general purpose document from the transmission document stored in the transmission document storage unit; a document element selection unit for selecting each document element designated by the document element selection information; and a document element arrangement unit for arranging the selected document element on a virtual screen. The second object may also be achieved by the transmission document edition device, wherein the simulation document creation unit further includes a simulation document display unit for having a display screen, for creating a frame on the display screen according to the display screen size information, for cutting part of the virtual screen on which the document element arrangement unit has arranged the selected document element according to the display screen size information and the scroll information, and for displaying the part of the virtual screen within the frame. As a result, a simulation document may be displayed on the same display screen as in a receiver mobile communication terminal. The second object may also be achieved by the transmission document edition device that may include: a simulation information storage unit for storing simulation information in which first operation keys on the receiver devices of the plurality of specifications correspond to second operation keys on the transmission document edition device, wherein the general purpose document includes a user operation and a content of a processing accompanying the user operation, the piece of device specification information includes information that describes an operation of a first operation key corresponding to the user operation, the acceptance unit includes an operation key acceptance unit for accepting an operation of a second operation key from the operator, the simulation execution unit includes: an operation key conversion unit for converting the accepted second operation key operation into a corresponding operation of a first operation key; and a simulation document changing unit for changing the displayed simulation document according to a content of a processing that corresponds to a user operation corresponding to the first operation key operation and for displaying the changed simulation document. As a result, the operation that is performed when an operation key on a mobile communication terminal (a first operation key) is operated may be performed using an operation key on the transmission document edition device (a second operation key), and a displayed simulation document may be changed according to the operation of second operation keys. The second object may also be achieved by the transmission document edition device, wherein the processing is written in a program that is described in a virtual machine language, and the simulation document changing unit changes the displayed simulation document according to the program. As a result, a program may be executed using the HTML browser. The second object may also be achieved by the transmission document edition device, wherein the document element selection unit selects each document element to which a tag identified in the document element selection information is attached. As a result, each document element to be displayed may be easily selected. The above-mentioned third object is achieved by a received document processing device that receives a received document in which a general purpose document that is described in a markup language and a plurality of pieces of device specification information, each piece of which a received document processing device of a different specification refers to when processing the general purpose document according to marks in the markup language, are related to each other, the received document processing device that may include: a received document storage unit for storing the received document that the received document processing device has received; a received document reading unit for reading the received document that the received document storage unit stores; a first identification unit for identifying the plurality of pieces of device specification information and the general purpose document in the read received document; a second identification unit for identifying a piece of device specification information for the received document processing device in the plurality of pieces of device specification information; a display screen; and a display control unit for processing, when receiving the received document, the general purpose document that the first identification unit has identified on referring to the piece of device specification information that the second identification unit has identified, for creating a display document, and for displaying the created display document on the display screen. Such a received document processing device that receives a received document transmitted to received document processing devices of the plurality of specifications may display a document suitable for the received document processing device and change the displayed document. The third object may be achieved by the received document processing device according to claim 12, wherein the identified piece of device specification information includes information defining input and/or information defining output for the received document processing device, wherein the information defining input includes each operation of the received document processing device and a processing of the general purpose document accompanying an operation for each operation, and the information defining output includes processing conditions for displaying the general purpose document in a manner suitable for the received document processing device, and the general purpose document includes a plurality of document elements, and the display control unit includes: a first display control unit for selecting each document element designated by the processing conditions from the general purpose document and for creating the display document from the selected document element; and/or a second display control unit for changing the created display document according to a processing that corresponds to an operation key on the received document processing device and is described in the general purpose document. As a result, such a received document processing device may receive a received document, display a display document, and change the display document according to the user operations. The third object may also be achieved by the received document processing device, wherein the processing conditions include display screen size information, document element selection information, and scroll information for the received document processing device, the first display control unit includes: a document element selection unit for selecting each document element designated by the document element selection information; and a document element arrangement unit for arranging the selected document element on the display screen according to the display screen size information and the scroll information. As a result, a display document suitable for such a received document processing device may be easily displayed and changed. The third object may also be achieved by the received document processing device, wherein the document element selection unit selects each document element to which a tag identified in the document element selection information is attached, wherein each tag is a mark in the markup language. As a result, the document element may be selected more easily. The third object may also be achieved by the received document processing device that is one of a pager and a mobile phone. As a result, pagers or mobile phones may receive the same received document as personal computers receive and may display a document suitable for pagers or mobile phones. The third object may also be achieved by the received document processing device, wherein a processing is written in a program that is described in a virtual machine language, and the second display control unit changes the display document according to the program. As a result, a program may be easily executed using the HTML browser. The above-mentioned fourth object is achieved by the information providing server device that may include a document element selection unit for selecting each document element that is necessary for the specification of received document processing device from the transmission document, wherein the general purpose document includes a plurality of document elements, and the piece of device specification information corresponding to the specification of received document processing device includes document element selection information on each document element necessary for the specification of received document processing device. Such an information providing server device may convert a transmission document that the transmission document edition device has edited into another transmission document suitable for a mobile communication terminal of one specification. As a result, the load of the specification of mobile communication terminal may be reduced. The present invention may be realized by a computer-readable storage medium for storing a program that realizes a function of editing a transmission document that is to be transmitted to received document processing devices of a plurality of specifications from a general purpose document described in a markup language, wherein the program realizes: a device specification information obtaining unit for obtaining a plurality of pieces of device specification information each piece of which a received document processing device of a different specification refers to when processing the general purpose document according to marks in the markup language; and a transmission document creation unit for creating the transmission document in which the general purpose document that is described in the markup language and the plurality of pieces of device specification information that the device information obtaining unit has obtained are related to each other. As a result, a transmission document edition device that edits a transmission document to be transmitted to the received document processing devices of the plurality of specifications from a general purpose document described in a markup language and a plurality of pieces of device specification information for the plurality of specifications of mobile communication terminal may be realized.	{ "pile_set_name": "USPTO Backgrounds" }
Research aims to reduce water footprint and increase shelf life of potted and cut herb production August 5, 2014 New research from the University of Southampton is aiming to reduce the water footprint and increase shelf life of potted and cut herb production in the UK. Focusing on a range of potted and cut herbs, including flat-leaved parsley, basil and coriander, the aim is to reduce the use of irrigation water during crop production, while improving the flavour and quality of the herbs. It has already been shown in other growing systems that substantial water savings can be made without detrimental impacts on crop quality. The project is led by Professor Gail Taylor from the University of Southampton and builds on research findings from a BBSRC IPA (Industrial Partnering Award) with Vitacress Ltd. The project was awarded from the Annual Sainsbury's Supermarket Agricultural R&D Grant - where growers, suppliers and researchers are asked to compete for a pot of £1 million provided by Sainsbury's. More than 18 million pots of herbs are produced in the UK each year and much of this production is undertaken by Vitacress under glass in Sussex. Cut herbs are grown widely in the UK summer and overseas in winter. Professor Taylor says: "It's hard to imagine a world without fresh herbs and yet this product has only been on our supermarket shelves for the past ten years or so and much remains to be learned to optimise the use of water in cultivation. We will use the latest technologies in thermal and remote imaging to assess precisely when irrigation should be applied, targeting water to best effect and helping Sainsbury's to achieve their targets for the 20 x 20 Sustainability Plan, which includes a robust water stewardship commitment from suppliers and also a target to double the amount of British food sold. "This research, we hope, will contribute to both of these aspirations, while at the same time increasing our fundamental knowledge on the way in which plants use water." The research team includes Professor Gail Taylor, Mark Chapman, Hazel Smith and Libby Rowland from the University of Southampton, in partnership with Steve Rothwell from Vitacress Salads Ltd and Calum Kelly and Rob Honeysett from Sainsbury's Supermarkets Ltd. The popular culinary herbs oregano and rosemary are packed with healthful compounds, and now lab tests show they could work in much the same way as prescription anti-diabetic medication, scientists report. In their new study ... British supermarket chain Sainsbury's has announced that it plans to power one of its grocery stores using only biogas generated from its own food waste. The store in Cannock, West Midlands is approximately one mile away ... China's rapid socioeconomic growth continues to tax national water resources – especially in the agricultural sector – due to increasing demands for food. And, because of the country's climate and geography, irrigation ... Recommended for you Five million years ago, the Colorado River met the Gulf of California near the present-day desert town of Blythe, California. The evidence, say University of Oregon geologists, is in the sedimentary rocks exposed at the edges ... Pressure, temperature and fluid composition play an important role in the amount of metals and other chemicals found in wastewaters from hydraulically fractured gas reservoirs, according to Penn State researchers. Pioneering work being carried out in a cave in New Mexico by researchers at McMaster University and The University of Akron, Ohio, is changing the understanding of how antibiotic resistance may have emerged and how doctors ... (Phys.org)—A team of researchers with the European Commission's Joint Research Centre and Google Switzerland has combined historical data with modern mapping engines to produce high-resolution maps of the world's surface ... The ice sheet covering Greenland is four times bigger than California—and holds enough water to raise global sea-level more than twenty feet if most of it were to melt. Today, sea levels are rising and the melting of Greenland ... 0 comments Please sign in to add a comment. Registration is free, and takes less than a minute. Read more Click here to reset your password. Sign in to get notified via email when new comments are made.	{ "pile_set_name": "Pile-CC" }
11 Shares 0 11 0 German spy agency the BND, said that Saudi Arabia was becoming more “impulsive” in its foreign policy, a claim rebuffed on Thursday by the German government. The agency was in particular critical of Saudi’s defense minister, Mohammad bin Salman Al Saud. A government spokesman said "The published assessment does not reflect the position of the German government.” The spokesman added a reaffirmation of Germany’s position that sees Saudi Arabia as an essential partner "in a crisis-ridden world," adding that the relationship is important "especially on the way to peace in Syria.” He made it clear that Germany holds the Saudis in esteem, but from a more practical perspective, as a regional solution and effective fight against the ISIS is precedented on Saudi cooperation, according to the spokesman. The BND briefing that caused the stir was first published in German media. It alleges that changes in Saudi foreign policy have been exaggerated since King Salman came to power in January, and was particularly critical of Saudi’s increasing military intervention in Yemen. Saudi Arabia has led a coalition of nine Arab states carrying out airstrikes and a naval blockade on Yemen since March 2015 to influence the outcome of the country’s civil war. Since the Saudi-led coalition began its airstrike campaign, 78% or 20 million Yemenis have been under attack, in desperate need of food, water and medical aid. The situation has been called a “humanitarian disaster” by human rights groups. The BND further mentioned Saudi Arabia’s decision to back Syrian rebels and Saudi policies in Bahrain, Lebanon and Iraq. The briefing warned against the new leadership in Saudi Arabia saying "What was previously a cautious diplomatic stance of the elder leaders in the royal family is being replaced by an impulsive policy of intervention," further claiming that the Saudis were losing faith in the US’ ability to support their same sides of power. As recently as July, the German Foreign Minister Frank-Walter Steinmeier, speaking with Al Arabiya News praised among other things, the Saudi role in aiming for stability in the region and fighting against Iran’s proxy fighters like Lebanon’s Hizbollah. “Germany and Saudi Arabia have been partners for many years. We know each other well and trust each other. We both hold a leading position in our respective regions. We are both members of the G20. Our governments are firmly committed to working closely together, be it on crisis management in the Middle East or on topics such as energy and climate protection. There is mutual respect between our two governments,” the Foreign Minister said.	{ "pile_set_name": "OpenWebText2" }
A minor-league baseball team apologized late Monday for "some misleading and offensive editing" in a Memorial Day tribute video that aired at its stadium. The Class AAA Fresno Grizzlies said the video, which was broadcast between the two games of its doubleheader Monday, was intended to be "a moving tribute" to the armed forces. But as the voice of President Ronald Reagan mentioned "enemies of freedom," the video showed an image of Rep. Alexandria Ocasio-Cortez, D-N.Y., between images of North Korean dictator Kim Jong-un and former Cuban president Fidel Castro. MUST-SEE:Outfielder throws out two runners, hits home run LEFT IN SOCKS:Indians pitcher Oliver Perez waits out unusual delay Fresno, a minor-league affiliate of the Washington Nationals, said the editing "made a statement that was not our intent and certainly not our opinion." The club apologized to servicemen and women for what it called "the undue distraction on such a solemn day." "We're embarrassed we allowed this video to play without seeing it in its entirety first," the Grizzlies wrote on Twitter. "We unconditionally apologize to Rep. Ocasio-Cortez (@AOC) in addition to our fans, community and those we hurt. It was a mistake and we will ensure that nothing like it ever happens again." Grizzlies spokesperson Paul Braverman confirmed to USA TODAY Sports on Tuesday that the club aired this 3-minute, 35-second video on YouTube at Chukchansi Park, and that the employee responsible for selecting the video has been identified. Braverman said the employee is remorseful and the club will likely not broadcast videos from the internet at its stadium moving forward "in an abundance of caution." Ocasio-Cortez responded to the video in a series of tweets Tuesday evening, writing in part that "words matter, and can have consequences for safety." "What people don’t (maybe do) realize is when orgs air these hateful messages, my life changes bc of the flood of death threats they inspire," she wrote. "I‘ve had mornings where I wake up & the 1st thing I do w/ my coffee is review photos of the men (it’s always men) who want to kill me." Contact Tom Schad at [email protected] or on Twitter @Tom_Schad.	{ "pile_set_name": "OpenWebText2" }
Under an agreement signed by George W. Bush, the U.S. was to withdraw forces from Iraq by the end of 2011. American military officials, fearful that Iraq might unravel without U.S. supervision, wanted to keep 20,000 to 25,000 troops in the country after that. Obama now claims that maintaining any residual force was impossible because Iraq’s parliament would not give U.S. soldiers immunity from prosecution. Given how unpopular America’s military presence was among ordinary Iraqis, that may well be true. But we can’t fully know because Obama—eager to tout a full withdrawal from Iraq in his reelection campaign—didn’t push hard to keep troops in the country. As a former senior White House official told Peter Baker of The New York Times, “We really didn’t want to be there and [Maliki] really didn’t want us there.… [Y]ou had a president who was going to be running for re-election, and getting out of Iraq was going to be a big statement.” In recent days, Republicans have slammed Obama for withdrawing U.S. troops from Iraq. But the real problem with America’s military withdrawal was that it exacerbated a diplomatic withdrawal that had been underway since Obama took office. The decline of U.S. leverage in Iraq simply reinforced the attitude Obama had held since 2009: Let Maliki do whatever he wants so long as he keeps Iraq off the front page. On December 12, 2011, just days before the final U.S. troops departed Iraq, Maliki visited the White House. According to Nasr, he told Obama that Vice President Tariq al-Hashimi, an Iraqiya leader and the highest-ranking Sunni in his government, supported terrorism. Maliki, argues Nasr, was testing Obama, probing to see how the U.S. would react if he began cleansing his government of Sunnis. Obama replied that it was a domestic Iraqi affair. After the meeting, Nasr claims, Maliki told aides, “See! The Americans don’t care.” In public remarks after the meeting, Obama praised Maliki for leading “Iraq’s most inclusive government yet.” Iraq’s Deputy Prime Minister, Saleh al-Mutlaq, another Sunni, told CNN he was “shocked” by the president’s comments. “There will be a day,” he predicted, “whereby the Americans will realize that they were deceived by al-Maliki … and they will regret that.” A week later, the Iraqi government issued a warrant for Hashimi’s arrest. Thirteen of his bodyguards were arrested and tortured. Hashimi fled the country and, while in exile, was sentenced to death. “Over the next 18 months,” writes Pollack, “many Sunni leaders were arrested or driven from politics, including some of the most non-sectarian, non-violent, practical and technocratic.” Enraged by Maliki’s behavior, and emboldened by the prospect of a Sunni takeover in neighboring Syria, Iraqi Sunnis began reconnecting with their old jihadist allies. Yet, in public at least, the Obama administration still acted as if all was well.	{ "pile_set_name": "OpenWebText2" }
Q: How and when to use Ember.Application register and inject methods? I'm trying to understand how to use Ember.Application register & inject methods What use case are these functions designed for? How are they to be used and when? I'd really like to know! A: Ember by default does dependency injection when it boots your application using mostly conventions, for example if you use ember-data then an instance of the store class is injected in every route and controller in your application, so you can later get a reference by simply doing this.get('store') inside any route or controller. For example here is a code extract where the default store get's registered (taken from the source) Ember.onLoad('Ember.Application', function(Application) { Application.initializer({ name: "store", initialize: function(container, application) { application.register('store:main', application.Store); ... } container.lookup('store:main'); } }); And then injected (source) Application.initializer({ name: "injectStore", initialize: function(container, application) { application.inject('controller', 'store', 'store:main'); application.inject('route', 'store', 'store:main'); application.inject('dataAdapter', 'store', 'store:main'); } ... }); In other words register and inject are methods to register dependencies and inject them yourself. Let's assume you have a Session object which you populate after a server request on application start, and which you want to have a reference to in every controller, you could do something like this: var App = Ember.Application.create({ ready: function(){ this.register('session:current', App.Session, {singleton: true}); this.inject('controller', 'session', 'session:current'); } }); App.Session = Ember.Object.extend({ sessionHash: '' }); This code would set the session property of every controller instance to a singleton instance of App.Session, so you could in any controller do this.get('session') and get a reference to it, and since it's defined as a singleton it would be always the same session object. With register you can register controllers, models, views, or any arbitrary object type. inject, in the other hand, can inject onto all instances of a given class. For example inject('model', 'session', 'session:current') would also inject the session property with the session:current instance into all models. To inject the session object, let's say onto the IndexView you could do inject('view:index', 'session', 'session:current'). Although register and inject are very powerful you should use them wisely and only in the case you really know there is no other way to achieve your goal, I guess the lack of documentation is an indicator for discouragement. Update - No good explanation without a working example Since It's mostly a must to provide a working example with an explanation, there it goes: http://jsbin.com/usaluc/6/edit. Notice how in the example we can simply access the mentioned sessionHash by referring to the current controller's session object with {{controller.session.sessionHash}} in every route we are in, this is the merit of what we have done by registering and injecting the App.Session object in every controller in the application. Hope it helps. A: A common use case is to provide the current loggedin user property to controllers and routes as in https://github.com/kelonye/ember-user/blob/master/lib/index.js and https://github.com/kelonye/ember-user/blob/master/test/index.js	{ "pile_set_name": "StackExchange" }
Arbroath 0 Alloa Athletic 3 By Footymad PreviewerLast updated : 02 October 2004 Viewed : Alloa deservedly won this basement battle to put some breathing space between themselves and Arbroath at the foot of division two. Alloa had the advantage of playing with the Gayfield Park wind in the first half and controlled the early proceedings. A neat one-two between Stuart Callaghan and Andy Brown opened up the Arbroath defence, and Neil Inglis did well to push Brown's shot wide for a corner. Alloa went on to force six corners before the break, and from an in-swinging Callaghan corner Michael Daly should have scored but headed wide from two yards. Arbroath's only chance of the first half was a Stuart MacDonald free-kick that curled just wide from 20 yards. However, despite their dominance, Alloa's first goal had more than a touch of fortune about it. A speculative effort by Callaghan struck John Cusick leaving the stranded Inglis helpless and the home side a goal down. After the interval, Alloa continued to look the more dangerous side and doubled their lead after 52 minutes. A swift counter attack resulted in a Dougie Hill cross only being half cleared by Chris McLeod, and Callaghan side-footed home from the edge of the box. Callaghan was unlucky not to hit his hat-trick when Kevin McMullen cleared his in-swinging corner on to his own bar. However, with seven mintues remaining, Alloa wrapped up the game. A Callaghan corner again struck the bar and appeared to bounce off Steven Rennie and into the net, although Callaghan is claiming the goal.	{ "pile_set_name": "Pile-CC" }
class NSArray : NSObject, NSCopying, NSMutableCopying, NSSecureCoding, NSFastEnumeration { var count: Int { get } func object(at index: Int) -> AnyObject init(objects objects: UnsafePointer<AnyObject?>, count cnt: Int) init?(coder aDecoder: NSCoder) func copy(with zone: NSZone = nil) -> AnyObject func mutableCopy(with zone: NSZone = nil) -> AnyObject class func supportsSecureCoding() -> Bool func encode(with aCoder: NSCoder) func countByEnumerating(with state: UnsafeMutablePointer<NSFastEnumerationState>, objects buffer: AutoreleasingUnsafeMutablePointer<AnyObject?>, count len: Int) -> Int } extension NSArray : ArrayLiteralConvertible { } extension NSArray : SequenceType { } extension NSArray { convenience init(objects elements: AnyObject...) } extension NSArray { @objc(_swiftInitWithArray_NSArray:) convenience init(array anArray: NSArray) } extension NSArray : CustomReflectable { } extension NSArray { func adding(_ anObject: AnyObject) -> [AnyObject] func addingObjects(from otherArray: [AnyObject]) -> [AnyObject] func componentsJoined(by separator: String) -> String func contains(_ anObject: AnyObject) -> Bool func description(withLocale locale: AnyObject?) -> String func description(withLocale locale: AnyObject?, indent level: Int) -> String func firstObjectCommon(with otherArray: [AnyObject]) -> AnyObject? func getObjects(_ objects: AutoreleasingUnsafeMutablePointer<AnyObject?>, range range: NSRange) func index(of anObject: AnyObject) -> Int func index(of anObject: AnyObject, in range: NSRange) -> Int func indexOfObjectIdentical(to anObject: AnyObject) -> Int func indexOfObjectIdentical(to anObject: AnyObject, in range: NSRange) -> Int func isEqual(to otherArray: [AnyObject]) -> Bool @available(watchOS 2.0, ) var firstObject: AnyObject? { get } var lastObject: AnyObject? { get } func objectEnumerator() -> NSEnumerator func reverseObjectEnumerator() -> NSEnumerator @NSCopying var sortedArrayHint: NSData { get } func sortedArray(_ comparator: @convention(c) (AnyObject, AnyObject, UnsafeMutablePointer<Void>) -> Int, context context: UnsafeMutablePointer<Void>) -> [AnyObject] func sortedArray(_ comparator: @convention(c) (AnyObject, AnyObject, UnsafeMutablePointer<Void>) -> Int, context context: UnsafeMutablePointer<Void>, hint hint: NSData?) -> [AnyObject] func sortedArray(using comparator: Selector) -> [AnyObject] func subarray(with range: NSRange) -> [AnyObject] func write(toFile path: String, atomically useAuxiliaryFile: Bool) -> Bool func write(to url: NSURL, atomically atomically: Bool) -> Bool func objects(at indexes: NSIndexSet) -> [AnyObject] @available(watchOS 2.0, ) subscript(_ idx: Int) -> AnyObject { get } @available(watchOS 2.0, ) func enumerateObjects(_ block: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Void) @available(watchOS 2.0, ) func enumerateObjects(_ opts: NSEnumerationOptions = [], using block: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Void) @available(watchOS 2.0, ) func enumerateObjects(at s: NSIndexSet, options opts: NSEnumerationOptions = [], using block: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Void) @available(watchOS 2.0, ) func indexOfObject(passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> Int @available(watchOS 2.0, ) func indexOfObject(_ opts: NSEnumerationOptions = [], passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> Int @available(watchOS 2.0, ) func indexOfObject(at s: NSIndexSet, options opts: NSEnumerationOptions = [], passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> Int @available(watchOS 2.0, ) func indexesOfObjects(passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> NSIndexSet @available(watchOS 2.0, ) func indexesOfObjects(_ opts: NSEnumerationOptions = [], passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> NSIndexSet @available(watchOS 2.0, ) func indexesOfObjects(at s: NSIndexSet, options opts: NSEnumerationOptions = [], passingTest predicate: (AnyObject, Int, UnsafeMutablePointer<ObjCBool>) -> Bool) -> NSIndexSet @available(watchOS 2.0, ) func sortedArray(comparator cmptr: NSComparator) -> [AnyObject] @available(watchOS 2.0, ) func sortedArray(_ opts: NSSortOptions = [], usingComparator cmptr: NSComparator) -> [AnyObject] @available(watchOS 2.0, ) func index(of obj: AnyObject, inSortedRange r: NSRange, options opts: NSBinarySearchingOptions = [], usingComparator cmp: NSComparator) -> Int } struct NSBinarySearchingOptions : OptionSetType { init(rawValue rawValue: UInt) let rawValue: UInt static var firstEqual: NSBinarySearchingOptions { get } static var lastEqual: NSBinarySearchingOptions { get } static var insertionIndex: NSBinarySearchingOptions { get } } extension NSArray { convenience init(object anObject: AnyObject) convenience init(array array: [AnyObject]) convenience init(array array: [AnyObject], copyItems flag: Bool) convenience init?(contentsOfFile path: String) convenience init?(contentsOf url: NSURL) } extension NSArray { func getObjects(_ objects: AutoreleasingUnsafeMutablePointer<AnyObject?>) } class NSMutableArray : NSArray { func add(_ anObject: AnyObject) func insert(_ anObject: AnyObject, at index: Int) func removeLastObject() func removeObject(at index: Int) func replaceObject(at index: Int, with anObject: AnyObject) init(capacity numItems: Int) } extension NSMutableArray { func addObjects(from otherArray: [AnyObject]) func exchangeObject(at idx1: Int, withObjectAt idx2: Int) func removeAllObjects() func remove(_ anObject: AnyObject, in range: NSRange) func remove(_ anObject: AnyObject) func removeObjectIdentical(to anObject: AnyObject, in range: NSRange) func removeObjectIdentical(to anObject: AnyObject) @available(watchOS, introduced=2.0, deprecated=2.0) func removeObjects(fromIndices indices: UnsafeMutablePointer<Int>, numIndices cnt: Int) func removeObjects(in otherArray: [AnyObject]) func removeObjects(in range: NSRange) func replaceObjects(in range: NSRange, withObjectsFrom otherArray: [AnyObject], range otherRange: NSRange) func replaceObjects(in range: NSRange, withObjectsFrom otherArray: [AnyObject]) func setArray(_ otherArray: [AnyObject]) func sort(_ compare: @convention(c) (AnyObject, AnyObject, UnsafeMutablePointer<Void>) -> Int, context context: UnsafeMutablePointer<Void>) func sort(using comparator: Selector) func insert(_ objects: [AnyObject], at indexes: NSIndexSet) func removeObjects(at indexes: NSIndexSet) func replaceObjects(at indexes: NSIndexSet, with objects: [AnyObject]) @available(watchOS 2.0, ) func sort(comparator cmptr: NSComparator) @available(watchOS 2.0, ) func sort(_ opts: NSSortOptions = [], usingComparator cmptr: NSComparator) } extension NSMutableArray { }	{ "pile_set_name": "Github" }
1. Field of the Invention This invention relates to a helicopter rotor of the bearingless type, having an airfoil shaped blade attached to a flexible spar, specifically designed and fabricated to accommodate the torsion deflections of pitch change, and the bending requirements due to lead/lag and flap/droop blade excursions. This invention is specifically directed to the group of bearingless rotors wherein the flexible spar is rotatably driven by suitable attachment to the rotor hub and rotor drive shaft. The specific geometric shape of the spar is not important to this invention, and is shown in the accompanying figures as rectangular. Likewise, it is not important whether the spar be continuous across the rotor axis to attach to opposed blades, or whether each spar be unitary and joined only to one blade. For the latter configuration there may be an odd number of blades. 2. Description of the Prior Art Prior art patents familiar to the inventors and pertaining to hingeless rotor blade attachments and controls have generally been directed to tail rotor applications where pitch, lead/lag and flapping motions are less than those of main rotors. In attempting to transfer rotor technology developed for tail rotors to a main rotor application, concern had to be addressed to the adverse influence of these larger excursions, and especially to the pitch coupling effect due to inplane or lead/lag blade motions. The longer, wider, and heavier main rotor blade undergoes significant bending in first advancing into the direction of flight and then retreating from it as it completes it cycle of rotation at a constant driven rotor speed and undergoing commanded cyclic pitch changes as well as being impinged upon by wind gusts at any point on the azimuth. Starting and stopping produces still further inplane bending. The concept of using blade motions to introduce a proportional blade pitch change in a direction to stabilize the blade is known, as well as the concept of elimination or prevention of such pitch coupling. A specific rotor configuration to which our invention may be applied is shown in U.S. Pat. No. 4,008,980 to Noehren et al, which is used in the UH-60A helicopter. The specific "snubber bearing" of that rotor head is depicted as FIG. 5 in U.S. Pat. No. 4,087,203 to Ferris. The main objective of the teaching of this latter patent is similar to that of our invention; namely to provide structure that accommodates pitch change relative motion (torsion) between the flexible spar and rigid torque tube, minimizes the pitch coupling effect of the blade flapping wherein relative bending takes place between the spar and torque tube, and prevents pitch change motions due to lead or lag excursions when blade spar inplane motion occurs relative to the torque tube. In an embodiment wherein blade pitch change is introduced by means of a torque tube enveloping a flexible spar, and wherein the attachment to the rotor hub follows the teaching of the U.S. Pat. No. 3,874,815 to Baskin, use of this invention also appears beneficial, provided the linkage is suitably mounted at the virtual hinge axis of the blade spar such that the root end of the torque tube can be restrained from vertical motion.	{ "pile_set_name": "USPTO Backgrounds" }
San Jerónimo (Los Barbosa) San Jerónimo (Los Barbosa) is a locality and municipal agency of San Martín de Hidalgo Municipality, Jalisco, Mexico. As of the 2010 census, the village had a total population of 355, making it the eleventh-largest locality in the municipality and the second-largest in the territorial sub-committee. San Jerónimo is the home of the state-funded San Jerónimo Dam which cost It is situated 45 miles southwest of Guadalajara, and 80 miles east of Puerto Vallarta. History The village of San Jerónimo was first annotated as one of the settlements comprising the jurisdiction of Cocula in 1744. Demographics 2010 According to the 2010 Censo General de Población y Vivienda, San Jerónimo (Los Barbosa) had a population of 355 inhabitants, of which 164 were male and 191 were female. There were 103 inhabited houses. Government San Jerónimo is one of the 18 municipal agencies of San Martín de Hidalgo Municipality and belongs to the territorial sub-committee of Santa Cruz de las Flores. A municipal agent and a municipal sub-agent preside over San Jerónimo in the administrative and representative sense and are appointed and removed by the municipal council. San Jerónimo is located in the 18th Local Electoral District. Agriculture San Jerónimo was incorporated into an ejido on March 25, 1925, with a total of 582 hectares of communal land. Unincorporated communities La Madera, part of the village Planta de Beneficio, former settlement outside the village See also El Cerrito de los Tapia References External links San Jerónimo's official website Information of San Jerónimo Information of the Municipality Category:Populated places in Jalisco	{ "pile_set_name": "Wikipedia (en)" }
June 30th, 2012 Ugh! As i move things around to pack them or get rid of them, i am finding dustbunnies o'plenty. tons of them. Now i feel like i can't get anything clean enough. I have been scrubbing all day. And i still feel like it is horrible. I think my obsessive compulsive tendencies are rearing their ugly heads again:( It hasn't happened in a long while, but as things get more unorganised and chaotic it is difficult to completely suppress them.	{ "pile_set_name": "Pile-CC" }
While we regret to inform you that CarePages will be shutting down, due to an overwhelming response from our members seeking additional account support we will be extending access to CarePages and its content until December 31, 2017. For further assistance, please contact [email protected]. ADVERTISEMENT Profile benfiaschi34's Profile Location: 75157 - United States of America About Me: Single brew coffee makers were invented to make it easier for coffee drinkers to get their daily fix. Coffee companies have stepped up to the plate by offering an endless variety of roasts for consumers. The best k cup coffee depends on personal preference. k cup latte	{ "pile_set_name": "Pile-CC" }
A TEENAGER who imported drugs on the dark web so he could 'experiment' with their effects was told to 'grow up' by a judge. Recorder Gareth Evans told Charlie Juson he did not believe the 19-year-old had imported the drugs entirely for his own use. However, he said the crown prosecution service had not charged Juson with intent to supply so he must proceed to sentence on the basis he sought the drugs for personal use. Juson's barrister, Silas Reid, said Juson had been described as a 'psychonaut' by a police expert which translates as a 'sailor of the soul', someone who experiments with altered states of consciousness. Juson admitted importing a drug of class A into the country from Holland, three counts of possession of a controlled drug of class A, three of possession of a controlled drug of class B and three of possession of a controlled drug of class C when he appeared at Worcester Crown Court on Friday. Christopher Lester, prosecuting, said Border Force intercepted a suspicious package from Holland bound for Juson's home address in Highmore Street, Hereford on October 24 last year. When it was opened MDMA ecstasy tablets were found inside and the package was passed to police who carried out a warrant at Juson's home. There they found more drugs, including 2.5g of ketamine worth about £50, £5 of amphetamines, a further wrap of ketamine worth £20 and three packages of drugs that contained hallucinogenic mushrooms and mephedrone. Juson, who had no previous convictions, made full admissions in interview. Police found evidence that Juson had accessed the dark web to get the drugs from Holland. Juson said people had contacted him asking about the drugs but he had never responded. Silas Reid, defending, said the case did not fit easily within the guidelines and described Juson as a 'psychonaut', 'someone who tries as many different drugs as they can get their hands on'. Mr Reid said Juson's father died at the age of 16 because of a condition the defendant had inherited. "His arrest was a salutary lesson and then some" he told the court. Juson had received counselling, a service which would be available to him in future. Recorder Gareth Evans QC said: "This is a very unusual case. "The first offence is, on the face of it, a very serious matter, importing drugs into this country but the crown prosecution service did not charge you with being in possession of any drugs with the intention of supplying. "The case always has been that they're all for personal use and I will sentence you on that basis but please don't think for one moment I believe it." He added: "It was an experiment. The experiment is over. Grow up." Recorder Evans sentenced him to eight months in prison suspended for two years and ordered him to pay £340 costs and a £140 victim surcharge. He must also complete 200 hours of unpaid work in the community. Recorder Evans further ordered the forfeiture and destruction of the drugs seized by police.	{ "pile_set_name": "OpenWebText2" }
package io.quarkus.it.panache; import java.io.Serializable; import java.util.Objects; import javax.persistence.Entity; import javax.persistence.Id; import javax.persistence.IdClass; import io.quarkus.hibernate.orm.panache.PanacheEntityBase; @Entity @IdClass(ObjectWithCompositeId.ObjectKey.class) public class ObjectWithCompositeId extends PanacheEntityBase { @Id public String part1; @Id public String part2; public String description; static class ObjectKey implements Serializable { private String part1; private String part2; public ObjectKey() { } public ObjectKey(String part1, String part2) { this.part1 = part1; this.part2 = part2; } @Override public boolean equals(Object o) { if (this == o) return true; if (o == null \|\| getClass() != o.getClass()) return false; ObjectKey objectKey = (ObjectKey) o; return part1.equals(objectKey.part1) && part2.equals(objectKey.part2); } @Override public int hashCode() { return Objects.hash(part1, part2); } } }	{ "pile_set_name": "Github" }
Jim O'Briant wrote about the lack of web sites for certain jazz clubs. Problem may be that these "Jazz Clubs" are little more than ego trips for a small group of folks who really don't give a damn about the music and whether or not it attracts new blood. In fact, when they do have jazz concerts, many draw about 60 people, charge only about $6 to get in to hear 4 hours worth of tired old garage band music. Then they proclaim "this music is dead". Baloney . . . it is they who are dead. Cheers, Steve	{ "pile_set_name": "Pile-CC" }
374 So.2d 929 (1979) Richard GRAHAM v. STATE. 4 Div. 685. Court of Criminal Appeals of Alabama. March 27, 1979. Rehearing Denied April 17, 1979. 930 David C. Emery, Ozark, for appellant. William J. Baxley, Atty. Gen., and Edwin L. Yates, Asst. Atty. Gen., for the State, appellee. LEIGH M. CLARK, Retired Circuit Judge. Appellant was indicted for murder in the first degree of "Donna M. Wilcynski, by stabbing her with a knife or other sharp instrument." A jury found him guilty of murder in the first degree as charged and fixed his punishment at life imprisonment. He was sentenced accordingly. Appellant submits as the only issue on appeal: "Whether or not sufficient evidence was presented to sustain the verdict of first degree murder." We have no doubt that there was bountiful evidence that the alleged victim was brutally slain, in the manner charged in the indictment, by some fiend, and that the homicide was murder in the first degree. The only controverted issue on the trial was whether defendant-appellant committed the homicide. The record indicates, and almost conclusively shows, that there was no eyewitness to the homicide other than the victim and her murderer(s); that they were the only persons in the apartment of the victim at Byrd Apartments, Ozark, when she was killed, between 11:00 P.M. and midnight on April 11, 1978. Her death resulted from multiple stab wounds in various parts of her body, from front to back and from head to feet. They were so extensive and numerous that the physician who examined her body was unable to number them. He grouped them in a description of them in his testimony as shown by six complete pages of the record. That she was dead before or immediately after the completion of the stabbing of her, there can hardly be any doubt. Her body was not discovered until late in the afternoon on April 12, 1978, after neighboring apartment dwellers had become concerned about her, one of them noting that her automobile was at its accustomed place at the apartment, that she was nowhere to be seen, that her apartment was locked and that efforts to get her to the door were futile. One of them called an officer and soon thereafter a number of them arrived. Upon arrival of the officers, a master key was obtained, and thereby her apartment was entered by one of the officers, who found her body in the bathtub. He promptly secured the scene and sent for an investigator of the Police Department of Ozark, 931 who soon arrived; he looked at the body in the bathtub, and then observed a three-year-old child in the bedroom of the apartment. He then called the coroner and personnel from the crime laboratory and secured the building for a thorough and accurate on-the-premises criminal investigation by experienced personnel, which was assiduously performed, continuing for about two hours at the scene. Blood samples were obtained, latent fingerprints were lifted, numerous photographs were taken, samples of hair were gathered from the apartment and other physical items of evidence were taken into custody. The victim's body in the bathtub was lying on its back. All but the face was covered with sheets and other coverings from her bed. Upon removal of the bed coverings, her body was completely nude. There was no water in the bathtub; the drain thereof was closed. The floor of the bathroom was dry, but the carpet or rug in the hall was soaked with water, and the carpet or rugs in the victim's bedroom and in the child's bedroom were wet. A test made by an officer showed that water from the overflowing bathtub would run into portions of the floor of the apartment that were wet. Bloodstains were found at several places in the apartment, including the mattress and the box springs of victim's bed, the floor, walls, curtains, and on the outside handle of the door to the apartment. The furniture in the bedroom appeared to be ransacked. The living room appeared to be normal. There were pry marks on the outside of a window to the apartment. The evidence, consisting of the testimony of twenty-seven witnesses and numerous exhibits, is almost, if not entirely, free of substantial conflict. Witnesses for the State may be grouped: (1) Those testifying as to conduct of defendant while at Byrd Apartments on Sunday, April 9, 1978, (2) Those testifying as to his conduct at Byrd Apartments the night of the murder, April 11, 1978, (3) A few who heard noises in the victim's apartment between 11:00 P.M. and midnight, April 11, (4) Expert and lay witnesses as to the condition and contents of the victim's apartment at the time her body was discovered therein in the late afternoon of April 12, (5) Witnesses, chiefly expert witnesses, as to (a) the condition of the corpse, (b) fingerprints, (c) samples of blood found in the victim's apartment, (d) samples of hair from victim's apartment, (e) what was revealed by a search of defendant and his home, (f) statements made by defendant after the murder and (g) what was found in defendant's automobile that he was driving the night of the murder. Evidence on behalf of defendant consisted of defendant's own testimony as to his conduct on Sunday, April 9, and on the night of the murder and the testimony of his wife, which pertained chiefly to his conduct prior to his going to the Byrd Apartments on April 11 and his return to their home after midnight of the night of the murder. Some of the witnesses for the State who testified as to the presence and conduct of defendant at the Byrd Apartments on Sunday, April 9, 1978, said they saw him at the courtyard with his young son Sunday morning; that there was a "cookout" party that afternoon and that defendant and his son and the victim and her daughter, the child who was in the victim's apartment the night of the murder, were at the party; that defendant played with Mrs. Wilcynski's child, and inquired of some at the party as to Mrs. Wilcynski. There was some evidence that he attempted to converse with Mrs. Wilcynski but that she did not talk with him. Captain William Dortch, of the United States Army, a friend of appellant (a warrant officer of the Army) had an apartment at the Byrd Apartments. Defendant was visiting Captain Dortch on Sunday, April 9. According to defendant's testimony, he was invited by Captain Dortch to stay for the cookout late that afternoon. 932 Appellant returned to the apartment complex on the evening of April 11. As much of the testimony is merely cumulative as to undisputed facts, no attempt will be made to particularize the testimony of all of the individual witnesses or to name all of them. Mrs. June Napier, who had seen appellant in the courtyard on Sunday afternoon, testified also that as she was unloading groceries from her automobile on the night of the murder, appellant approached her, picked up a bag of groceries and stated that he would help her take them up the stairs. She said, "I told him that was all right, that I could get them and he said, `Well, I understand how it is. It's awful hard to raise children alone, isn't it?' and I told him that I wasn't alone. ". . . "I took the groceries in the house and he just came in with a sack of groceries and put them down and ". . . "He was talking to me and I can't remember what he was saying, because I was in a hurry and trying to get dinner ready before Vincent [her husband] came home. I was a few minutes late, and my little girl cut her finger. She just came out of the bathroom, and I hadn't put up Vincent's things, and she got a razor blade and cut her finger with it, and he picked her up and took her in the bathroom and fixed it up. Then he was just talking to her and I was putting away my groceries and stuff, and a while later Vincent came in." Mrs. Napier further testified that while defendant was in the apartment and before her husband returned, she was going "back and forth getting things out of the car and trying to get dinner ready" and that she noticed defendant drinking a bottle of beer. She said that when her husband arrived, a friend, Jeff Parker, was with him and that defendant remained at the apartment and sat down and talked with Mr. Napier and Jeff Parker. She did not stay with the three men but went into the bedroom. While the door of the bedroom was closed, she heard her husband say, "Don't go in there, because my wife is nursing the baby," and when she heard him say that she "just pulled my blouse down and laid the baby down, and he came in there and put his arm around me, and he said, `Which way is the bathroom.'" She then left the bedroom and went into the room where her husband was, and she assumed defendant went into the bathroom, which other evidence shows that he did. According to additional testimony of Mrs. Napier, she was not certain as to the time defendant left the apartment of the Napiers'. She remembered that he was still there at 10:00 o'clock, and that she had gone downstairs to get some clothes out of the drier and when she returned he had gone. She said he must have gone "around 10:45, or something like that" or that it "must have been about 10:30." She said that "about a quarter to eleven," while she was returning from her automobile with some clothes of her husband to be washed, and was going up the stairs to the floor of her apartment, she saw defendant near the stairwell across from Mrs. Wilcynski's apartment. While at or near the stairwell he said to Mrs. Napier: "What hours does your husband work? When can I see you again? What is your phone number?" Instead of replying to defendant, Mrs. Napier said that she just "went on up the stairs," that "I didn't say anything to him, it scared me." She saw him no more that night. Mr. Vincent Napier testified that as he returned to the apartment that night, accompanied by Jeff Parker, he saw defendant sitting at the table in the dining room with a beer; he walked past defendant, went to the kitchen and talked with his wife and returned and introduced himself to the defendant. They sat and talked, and Napier and Parker and defendant played dominoes. Mrs. Napier had gone into the back bedroom where the baby was; the defendant went toward the bathroom, and he told defendant to knock on the door, that 933 his wife might be nursing the baby; after two or three minutes defendant came back to the table where they were playing dominoes. He said that about nine o'clock, defendant went for a can opener and returned in about five minutes, that defendant left "around eleven ... maybe a little before or after." His wife returned to the apartment from her trip downstairs to the automobile, shortly after the defendant left. Captain Bill Dortch testified that he lived on the same floor of the apartment as Mrs. Wilcynski and about three or four apartments from her. He had known defendant in connection with their military work. He had not lived at the Byrd Apartments long. He lived alone. Defendant had visited him the Sunday before the murder and had helped him move to the apartment. On the day of the murder, defendant came to the apartment at about 5:30 P.M. Dortch owned a motorcycle that he "used to store... right under the stairwell." Defendant left Dortch's apartment "around 7:30 or 8:00." He was going to get something to eat, some hamburgers for both of them; he returned "between 8:30 and 9:00" but only stayed a few minutes. Further testimony was as follows: "Q He came back to your apartment at what time? "A He came backyou mean after the second time? "Q Right. "A That was 10:30, because I was laying on the couch waiting for him to bring the food, and when the door opened I got up. "Q Is there any special reason that you know it was 10:30? "A Yeah, because I was lying on the couch and I was expecting hamburgers, and I checked my watch, and I said, `Well, it is kind of late to worry about the hamburgers.' "Q When he came back at 10:30 what did you and he do? "A Well, just discussed what he was doing and why he didn't have the hamburgers. "Q Okay, did youhow many drinks had you had that night? "A MaybeI would say about two drinks that night, because I wasn't feeling good. That's why I was lying on the couch. "Q Okay, and you say that Mr. Graham left your apartment some time between 12:00 and 12:30, is this correct? "A That is correct. "Q But you are not sure of the time between 12:00 and 12:30? "A That is correct. "Q Is there any special way that you could point down that he left your apartment between 12:00 and 12:30? "A Well, the reason why I say between 12:00 and 12:30 is because after he left, I went in the ice box and got something to eat, and thensee my door was still unlocked, because I didn't walk with him to the door. He just closed the door himself, and after I finished eating, then I went and locked the door and checked the time and it was 12:35. I know it didn't take that long for me to go right to the refrigerator." At one time during the testimony of Captain Dortch, he said: "Q Did you go to sleep during the time that he was there and the time he "A Yeah, I was sleeping part of the time." Clyde Hamilton, Jr., seven years old, testified that on the night of the murder, while he was looking for his frisbee in the apartment house hallway, he saw defendant come out of an apartment at the same time that Mrs. Wilcynski came out of her apartment and defendant "went up to her and started talking to her, but then when he went up, I left." He didn't know the time that this occurred, but stated it was after dark. Clyde's father testified that Clyde, Jr., was out of the apartment looking for his frisbee from "almost exactly 8:30 by my watch" and came back in about fifteen or twenty minutes with his frisbee. He had previously seen defendant at Byrd Apartments, once at the cookout on April 9 and again in between "7:10 and 7:30" when 934 defendant was "withI don't know the man's name but he was a captain and he lived in apartment 15; a black man, and they were outside, on the sidewalk and I spoke to them as I went by." John McGraw, who lived in apartment No. 9 next door to Mrs. Wilcynski's apartment, testified that as he returned to his apartment from work "about 10:30" he saw defendant standing in front of the victim's door next to the stairwell talking to some lady. He said the lady was going up the stairs; that defendant asked the lady if she would like to go to "a party or park" but that the lady said "something like, `I will have to ask my husband'"; that the lady went up the stairs. There were three witnesses as to noises in the victim's apartment on the night of the murder: (a) Mrs. Rose Teich testified that between 11:00 and 11:30 she heard Mrs. Wilcynski scream, a short, sharp scream. She said she screamed about four or five times; that her husband went downstairs to investigate and returned saying "I can't see anything." (b) John Hamby, who also lived in an apartment next to the victim's, testified that about "11:40 or 11:41" he heard noise, a banging, in her apartment, and he thought "somebody was taking a shower in the apartment." (c) A stipulation between the parties was agreed upon and admitted in evidence as the sworn testimony of William Tharp, that "about 11:35 or 11:37" when he returned to his apartment the night of the murder he heard "a long lingering scream next door, then it got quiet." The victim's mother testified that no jewelry was missing from the apartment after the murder. A large number of hairs were obtained from the scene of the murder, some from the victim, some from the bed and some from other places in the apartment. Many hairs were obtained from defendant, after he was taken into custody, from various portions of his body. There were also some hairs taken from defendant's dog. State Toxicologist John Kilborn examined the hairs taken from the apartment and the hairs obtained from the head and other areas of defendant and compared the two groups of hairs. He testified in part as follows: "Q Will you tell the jury the similarities that you found from the known hairs from Richard Graham's head and from the scene; step by step, the things that were identical. "A Well, out of all the 286 hairs I found, there were 3 that can be identified as Negroid hairs. Two of these are very small and really considered too small to make any type of comparison; only identified the race. The third hair which was submitted, contained in a plastic bag, labeled `from the top sheet,' this hair was compared with the hair of Mr. Graham, found that all of these characteristics were identical. We found that there was a medium type cuticle with ragged scale pattern, and the diameter was identical and the variation in diameter was very little, it was identical between the known and the unknown, the pigmentation of the hairthere extreme clumping of the pigment granules and these granules were located on the edge of the hair. The medulla was absent. There was no evidence of artificial treatment, like dying or bleaching. On the cross section, both hairs were extremely flat, and the pigmentation was identical. In the hair received from the scene, or submitted to me as identified from the scene, hair was not a complete hair, it was a broken hair. There was no root to examine, and the tipthe tip was indeed present, it was very frayed, and I couldn't ascertain whether or not the tip was present. "Q Then your conclusion of comparison is what? "A That microscopically the hair identified to me from the top sheet is identical to that of Mr. Graham's head hair." On cross-examination of Mr. Kilborn he testified that hair can be transferred from person to person and as to the possibility thereof without any physical contact. The latter part of his testimony on cross-examination was as follows: 935 "Q Johnny, if on 9 April, 1978, Rick Graham had been playing with the child of Donna Wilkinski, is it possible that a hair from his head was transferred to the child, who in turn, transferred it to that apartment? "A Well, without actual knowledge of the circumstances it would be difficult for me to say. I would once again say that hairs can be transferred. "Q Johnny, is it possible that this hair came from another individual other than Rick Graham? "A Yes, sir, this is possible." M. R. Nowicki testified that he was with defendant on the day before defendant was arrested, which other evidence shows was approximately one week after the murder, at the office of the Ft. Rucker preschool, that they discussed some matters at the preschool with reference to the work there and in the course of the conversation, the witness asked defendant to call him thereafter and defendant then asked for the phone number of the witness. His testimony continued as follows: "I gave it to him, and he said, `Where is that?', and I said, `It's at the Headquarters Building,' and he said, `Oh, you are up there now?', and I said, `Yes.' He went on to say, `I suppose you have heard my name mentioned up there lately?', I said in a kidding manner, `No more than usual, what did you do this time?' I had not heard anything prior to that time. He said to me, `Well, I am the number one suspect in a murder case in Ozark.' . . . "A He further said to me, `I was there.' He paused and he said, `I was at her apartment that night.'" State Toxicologist Chap McCracken, Jr., who performed an autopsy on the body of Mrs. Wilcynski and testified extensively as to his examination of her body and the scene of the murder, testified also that in the process of the investigation of the murder he examined the automobile that defendant had purportedly driven the night of the murder. As to this, his testimony was in part as follows: "Q Did you find any bloodstains in Richard Graham's automobile? "A Yes, I did. "Q And where did you find them? "A I found two small red-brown stains on the steering wheel of the automobile. They gave a positive presumptive test for the presence of blood, and small sizes of stains precluded more specific examination. "Q Could you tell the age of that? "A They were relatively fresh. "Q What? "A Relatively fresh, not ancient. "Q Did you find any more blood in there? "A No, sir." By the testimony of State's witnesses, it was shown that the initial investigators of the crime found a "partial shoe print" on the carpet of the apartment of the victim. The section of the carpet with the partial shoe print was removed and admitted in evidence. As to it, Mr. Dale Carter, a criminalist and director of the Enterprise Laboratory of the Alabama Department of Toxicology and Criminal Investigation, testified: "A It's a piece of carpet with a partial footprintreddish stained footprint on it. "Q And do the reddish stains show positive presumptive tests for blood? "A Yes, sir. "Q And where did you extract that piece of carpet? "A It was identified as being from the living room by the wall of the outside window. "Q Now, on this piece of carpet, did you measure the size of the partial shoe print? "A Yes, sir, I did as best I could. "Q Okay. "A Three and a half inches at the widest and eight and a half at the longest. ". . . . "Q Now, in your opinion, was this print made by a tennis shoe? "A In my opinion, this print was made by a shoe having a smooth sole and heel with no pattern. 936 "Q So then you would further state in your opinion that this print was not made by a tennis shoe? "A I can't state that because I have seen smooth bottom tennis shoes, even though they are not common. I myself own a pair." When State Toxicologist McCracken was asked on cross-examination whether the shoe print in the carpet was made by a tennis shoe, he replied, "If it were a flat soled tennis shoe, it could have. They are not common, but they are not uncommon." When asked whether it matched any of the shoes in the apartment occupied by the victim, he said, "I did not see anything it matched." Mrs. Graham, wife of defendant, testified that her husband came home "around one o'clock" the night of the murder. He ate something and went to bed. She said he had on "a white sweat shirt, a blue jeans, and sneakers" or tennis shoes. She did not wash any of the clothes prior to the time the search warrant was executed; "his blue jeans were still on the bar where he left it at, I did not wash it."; his shirt and his socks were sitting on the table when the search was commenced. She said that one of the officers looked at the same pants he had on the night of the murder. She said that the officers executing the search warrant went "through all of his shoes and all of his clothes and everything." According to her testimony, defendant had not worn the pants introduced in evidence, upon which there was testimony as to blood, in a "long time," that the pants were in a small box sitting in the corner in the kitchen on the floor, when the officers found them, that they were with a bunch of old clothes that she had taken to a garage sale to try to sell and had brought back home. Her husband was not wearing the pants the night of the murder. On the day before the search was made, her husband was in the kitchen cutting a cake and cut his finger. She told him to put a bandage on his finger, but he said, "It will heal faster if you don't put something on it." On cross-examination, she said she did not know whether her husband washed the shirt he wore the night of the murder between that time and the day of the search. According to the testimony of defendant, he and his son spent most of Sunday morning and afternoon at the Byrd Apartments, where he went to visit Captain Dortch, who asked him to stay over for the cookout. Except in the respect that he claimed that he was not as immodest and extrovertive in his behaviour as some of the testimony for the State indicated, there was no substantial conflict between his testimony and that of witnesses for the State. He said that his son, Christopher, played with "Therese," the victim's daughter. After some time he went outside and played with them and other children. He gave them "pony rides on my knee." He said, "I had my son sitting on one lap and had "Teresa" over here to get her up on the other leg and give them a ride. She didn't want to get up at one time, so I didn't force her." Mrs. Wilcynsky came out and brought some cold drinks for all the children. He had a conversation with Mrs. Wilcynski and asked one of the men he knew about her. He said he left the apartments about 5:00 P.M., which was earlier than some of the witnesses for the State said he left. According to the testimony of defendant, he arrived at Captain Dortch's apartment about 5:20 or 5:25 P.M. April 11. They sat around and talked until between 7:30 and 8:00. He had had a drink with Captain Dortch. Captain Dortch suggested at that time that defendant get them something to eat. As he went out of the apartment, he saw Mrs. Napier's daughter, Emily, and was having a conversation with her, when he saw Mrs. Napier arrive. He went into detail as to his conversation with Mrs. Napier. He started up the stairs with the bag of groceries and went with her and Emily into the apartment. There was little difference between his testimony and the testimony of Mr. and Mrs. Napier as to what happened at the apartment of the Napiers. He left about 9:00 P.M. to go to Captain Dortch's apartment to get a can opener, and as he left Captain Dortch's apartment with the 937 can opener, he saw Mrs. Wilcynski at the stairwell next to her apartment. He mentioned to her about the good time that his son had had playing with Mrs. Wilcynski's daughter the preceding Sunday. He said he did not go into Mrs. Wilcynski's apartment but went directly back to the apartment of the Napiers. He left that apartment again "shortly after 10:00." While going to Captain Dortch's apartment, he saw Mrs. Napier coming into the apartment building near the stairwell next to Mrs. Wilcynski's apartment and had conversation with her for a few moments and went to Captain Dortch's apartment and stayed there until "about 12:30." There was little difference between the testimony of defendant and that of Mr. Nowicki as to the conversation between the two. The defendant knew at that time that he was a suspect; his house had been searched and he had heard his name called in connection with the murder. The chief difference in his testimony and that of Mr. Nowicki was that defendant said that he had been at the "apartments where she lived on that night," instead of "at her apartment." According to further testimony of defendant, he wears a "size 10 or 10 ½" shoe. The shoes he had on at trial were eleven and five-eights inches long and four inches wide on the outside. On the night of the murder he had on a white sweat shirt, with the emblem "U. S. Army Aviation School" on it, a pair of athletic shorts with a similar emblem on the corner in white print and a pair of black and white sneakers, or "tennis shoes, or gym shoes, or whatever you call them." He exhibited to the jury his finger that he said he cut with a knife on Thursday morning after the murder. He did not put a bandaid on it right away but did after he saw that it wasn't going to stay closed. When the officers came out and searched his house they looked at about everything there, about all his clothes, "at least one of every pair of my shoes," took them out to the driveway and examined them and then started "bringing it back in one by one after they were satisfied with it, until they finally got to that light pair of pants that they found in the kitchen." They had obtained the pants from a box in the kitchen with a bunch of old clothes. His testimony as to them was substantially the same as that of his wife. He had not worn the particular pants, according to his recollection, since about six months or a year prior to the murder. Defendant moved for an exclusion of the evidence at the end of State's evidence, requested in writing and was refused the general affirmative charge in the defendant's favor at the conclusion of all the evidence, and filed a motion for a new trial, which the trial court overruled. There seems to be little difference of view between the parties as to the applicable principles to be applied as to the sufficiency of the evidence to justify denial of a motion to exclude the evidence, the refusal of the general affirmative charge requested in writing, or the denial of a motion for a new trial presenting an issue as to the sufficiency or weight of the evidence. The difference between them is as to the application of those principles to the evidence in this case, each arguing for his [its] side of the issue, without reference to any precedent in which the evidence was similar or the circumstances comparable. In most cases in which there is a serious dispute as to the sufficiency of the evidence to support a guilty verdict, there is a sharp conflict in the evidence as to material facts, some of the witnesses swearing one way and others another. In such cases, the task of an appellate court is generally easier than otherwise, for it can then lean more comfortably upon the responsibility of the trial court, as well as the trial jury, both of whom are in a better position to determine which witnesses have testified truthfully and which falsely. We do not have such a situation in the instant case, in which there is little, if any, material conflict in the evidence. On the question of the guilt or innocence of defendant of the crime charged, the evidence against him is entirely circumstantial; the evidence in his favor is both direct and circumstantial. It is a mistake, a common one, to denigrate the nature of circumstantial 938 evidence by considering it as inferior to direct evidence. That fallacy has been denounced, with the clarity of a clarion, by some of the greatest judicial minds of Alabama, state and federal, speaking from a wealth of wisdom and experience. Included, in the sequence of their statements, are Judge Seybourn H. Lynne, in United States v. Bostwick, N.D.Ala. (on appeal at 5 Cir., 218 F.2d 790); the late Judge Aubrey M. Cates, Jr., in Sumeral v. State, 39 Ala.App. 638, 106 So.2d 270; Judge J. Russell McElroy, as now found in the third edition of his treatise on Alabama evidence, Gamble, McElroy's Alabama Evidence, § 212.01, and Judge John O. Harris, now our Presiding Judge, in Creel v. State, 53 Ala.App. 504, 301 So.2d 267, and subsequent cases. In comparing the relative strength of circumstantial and direct evidence and in declining to give preference to either, the reference is to the two kinds of evidence in general. It is axiomatic that in some cases the direct evidence may be stronger than the circumstantial evidence therein and in other cases the circumstantial evidence may be stronger than the direct evidence therein. At times, where there are both kinds of evidence that are irreconcilable and lead to opposite determinations as to the truth that is proved by the evidence taken as a whole, either direct evidence or circumstantial evidence may prevail over the other. To say that each "is entitled to the same weight" as the other is not to say that in every case each has the same weight as the other. It can be readily seen that circumstantial evidence can be more credible than direct evidence, for circumstances, when shown to be true, are disinterested and unbiased, while direct evidence must come from witnesses who are often either interested or biased, or both, or for other innate human weakness are unreliable in purportedly stating what they have seen or heard. Circumstantial evidence is often strong enough to so discredit direct evidence as to show that the direct evidence is not true, whether intentionally or mistakenly untrue. But if there is true direct evidence, such as truthful testimony of a witness that he, in fact, saw a person commit a crime, such testimony is not vitiated by circumstantial evidence, however unquestionably true it is and however strong it may be to the contrary. To conclude otherwise is to defy the principle that truth is never inconsistent with truth. The foregoing considerations lead us to special consideration of direct evidence in the case that is in conflict with strong circumstantial evidence of defendant's guilt. We should, and we do, in our general consideration of the evidence, include the direct evidence of defendant that is diametrically opposed to a conclusion of guilt, but for the special consideration of this time we refer particularly to the testimony of one of the witnesses for the State, Captain Bill Dortch. In its argument in its brief on appeal as to the testimony of Captain Dortch, appellee states: "Bill Dortch stated that Appellant returned to his apartment at approximately 10:30 p. m. and stayed until 12:00 or 12:30 a. m. Dortch also testified that he was sleeping during part of this time. Appellant, in his brief, maintains that this testimony established his alibi. This testimony, however, was contradicted by Mrs. Napier, who stated that she encountered the Appellant at 11:00 p. m. while she was returning from her car...." Although Dortch's answer to one question asked him on direct examination could understandably lead to the conclusion reached in the second sentence of the above quoted statement in appellee's brief, such conclusion is shown to be incorrect by a consideration of his testimony as a whole. By this it is not meant that there was any conflict in his testimony, merely that an answer of the witness, when considered in connection with the question asked him, was ambiguous, which ambiguity was clarified by other testimony of the witness. We have hereinabove set forth the particular question and answer and now repeat it: "Q Did you go to sleep during the time that he was there and the time he "A Yeah, I was sleeping part of the time." 939 It is to be observed that the witness by his answer interrupted counsel before he had completed the question. The witness obviously jumped at his conclusion as to what was meant by the question, which conceivably could be reasonably interpreted as appellee has done, but for other testimony that leads to a different conclusion: "Q Okay, did Mr. Graham, between 10:30 and whatever time he left, did he leave at any time when he was in your apartment? "A No. "Q Were you and him carrying on a conversation the whole time? "A Yes, sir. "Q Were you looking at him this whole time? "A He was physically there. "Q And you were not asleep any of this time between 10:30 and 12:00? "A When he came in the door, he woke me up. "Q Between 10:30 and the time he left your apartment; you testified to between 12:00 and 12:30, not leave your apartment between 12:00 and 12:30. "A That's correct." The weakness of alibi testimony generally has been perennially considered. In many, if not most, cases there was such uncertainty or vagueness about the time of the crime or the time of the presence of defendant at another place that it could reasonably be said that he could have been at the place of the crime at the time of its commission. In many of the cases witnesses testifying as to an alibi were closely related to defendant and their interest in the outcome tended to discredit them. In almost all of such cases, the witnesses were not witnesses called by the State. The fact that Captain Dortch was called by the State as a witness does not in and of itself make his testimony any more credible than if he had been called by defendant, but it is a factor to be considered, along with all the other evidence and the respective contentions of the parties. It is to be seen that appellant's argument to the discredit of his alibi testimony is not correctly premised. Different from most cases in which an alibi is claimed and supported by considerable evidence, it seems to us that we are here faced with the positive testimony of a witness which, if true, establishes the presence of defendant at an apartment different from the one in which the murder was committed at the same time the murder was committed, and that fact would establish his innocence. It seems to us that the most reasonable conclusion to reach from the testimony of Captain Dortch is that defendant was not in the apartment of the victim of the murder at the time she was killed and, therefore, he did not kill her, or that Captain Dortch knowingly testified falsely. Whatever our individual thoughts may be on the subject, the record in and of itself, to which alone we can look, does not support the latter alternative. We view his evidence as strongly in favor of defendant on the merits of the case. There is nothing in the evidence or in the briefs of parties to lead us otherwise. We would not be justified in looking elsewhere for an answer. One of the grounds of the motion for a new trial referred to the evidence as to part of a hair from the bed of the victim that expert testimony showed had the same physical qualities and characteristics as hair from defendant's head. The Court in its order overruling defendant's motion for a new trial said: "The Court will take judicial notice of the scientific fact that a positive identification cannot be made by comparing a hair sample of an unknown origin with a hair sample of known origin. However, hair does possess a unique series of characteristics and a disputed hair can be compared for similarities with other human hair whose origin is known. Therefore, the Court finds that it was competent for the State Toxicologist, who was familiar with and an expert on the properties of human hair, to testify as to his analysis of the hair found at the scene of the crime and the hair taken from the body and head of the defendant." Though there was some value to the State in the testimony as to the resemblance of a 940 piece of hair taken from the bed of the victim and hair from defendant's head, it seems that it is not questioned that "positive identification" of defendant was not made by that comparison. It seems to us that neither side gained much by such testimony, even though each side gained some. The gain for the State is emphasized by the State's insistence as to the amount of its value as evidence. On the other hand, there is something to be said for the fact that out of the large number of hairs that were taken from the scene of the crime, there was only one piece of a hair tested that resembled defendant's hair and that only three hairs were Negroid. Moreover, the presence of a piece of defendant's hair in the bed of the victim is not irreconcilable with his claimed innocence, when due consideration is given to the undisputed evidence that defendant had played with the victim's three-year-old child two days before the murder. The evidence as to small stains on the steering wheel of defendant's automobile a few days after the murder that "gave a positive presumptive test for the presence of blood" is heavily relied upon by appellee, as it doubtless was on the trial. The toxicologist said that the "small sizes of stains precluded more specific examination," that the stains were relatively fresh. Whether fresher than the blood of the victim murdered two days before, there is no evidence. Appellee also refers to the blood upon a leg of appellant's pants as evidence in its favor. It is a circumstance calculated to be in favor of appellee when considered in connection with all the other evidence, but we find no answer to the position taken by appellant that the particular trousers were not the trousers that were worn by him the night of the murder. Whether true or not and whether strong or not, the evidence is undisputed that he was wearing shorts.[1] Not only did he say so, but Clyde Hamilton, Jr., when questioned about seeing defendant talking with Mrs. Wilcynski at the door of her apartment, testified: "Q Clyde, you say you saw him talking with her there at the door, and you didn't see him go in, did you? "A (Shaking head negatively). "Q Did you see Donna when she came walking around the apartment? "A No, she came out and she had short cut pantsLevis, she cut them and I didn't know where she was going. "Q And what did this man sitting here have on, do you remember? "A He had short blue pants, and I don't remember what kind. "Q Do you remember his shirt? Was it a white shirt, a sweat shirt, do you know what I mean? "A Yeah, but it wasn'tI don'tit was a short sleeve shirt, you know, what you said, but I don't know what color it was." On the subject of the clothing worn by defendant the night of the murder, the following testimony was given by Mr. Vincent Napier, with whom defendant spent considerable time: "Q Okay, what kind of clothes was Mr. Graham wearing that night? "A He had a sweat shirt, and maybe jeans or something casual [which we interpret casual]. I'm not sure. He was dressed like he might have been working out or something. "Q Okay, do you recall if he had on jeans? "A No, I couldn't say jeans orI'm not for sure. "Q What about his shoes? "A No, sir. "Q But you say you do remember he looked like he had been working out or jogging? "A Something like that, or exercising. "Q Those are the type of clothes he had on that night? "A Yes, sir." The jury was entitled to the evidence presented to it as to that which stood the presumptive test as to blood on the steering wheel and on the trousers, but in our effort 941 to determine whether the evidence is sufficient to meet the test to which it must be subjected on this appeal, it is our view that it is not strong. This in light of all the evidence but without giving much weight to the evidence as to defendant's having cut his finger as constituting the source of any blood upon his trousers. Although the prosecution obtained an order of court requiring fingerprints of defendant that were made, there is no evidence tending to connect defendant with the crime by any of the numerous fingerprints lifted from the scene of the crime. No effort is attempted to be made to explain the presence of the partial footprint on the carpet of the victim's apartment. To say that it was defendant's would be purely a guess. The evidence indicates, although it does not conclusively show, that it was not. We conclude that there is much circumstantial evidence to support the verdict. A determination of its exact weight as compared with direct evidence, and some circumstantial evidence, to the contrary, may be extremely difficult, but it cannot prevail unless it is so strong that it cannot reasonably be reconciled with the theory that defendant is innocent. It is not sufficient to support a conviction if it does not exclude to a moral certainty every other reasonable hypothesis but that of the guilt of the accused. Failure to meet that test resulted in a reversal in Sumeral v. State, supra, and such test has heretofore been uniformly applied. Ellison v. State, 254 Ala. 428, 48 So.2d 176 (1950); Burgett v. State, 37 Ala.App. 469, 70 So.2d 429 (1954); Byrd v. State, 37 Ala.App. 121, 73 So.2d 376, cert. denied 261 Ala. 697, 73 So.2d 378 (1954); Whatley v. State, 37 Ala.App. 706, 75 So.2d 182 (1954); Bluth v. State, 38 Ala.App. 692, 92 So.2d 685 (1957); Smith v. State, Ala.Cr.App., 342 So.2d 422 (1977). We would be required to say, as difficult as it may be to do so with satisfaction, whether there was sufficient evidence to warrant a refusal of the general affirmative charge in favor of defendant, if there had been no motion for a new trial raising the question of the sufficiency of the evidence. As there was such a motion for a new trial and it was overruled, we need only apply the test whether, after giving the learned trial judge the favorable presumption that is due him, the verdict is so contrary to the weight of the evidence that it is clear that it is palpably wrong or unjust. Skinner v. State, 22 Ala.App. 457, 116 So. 806 (1928); Davis v. State, 33 Ala. App. 299, 34 So.2d 15, cert. denied, 250 Ala. 240, 34 So.2d 17 (1948); Barker v. State, 55 Ala.App. 322, 315 So.2d 129, cert. denied, 294 Ala. 752, 315 So.2d 130 (1975); Smith v. State, Ala.Cr.App., 342 So.2d 422 (1977). The test we are to apply is not whether we think that appellant is guilty. A verdict finding a defendant guilty in a criminal case is wrong and unjust, even though defendant is guilty, if the evidence of his guilt is not strong enough to meet the legal test required as stated above. Such a verdict, when properly challenged, cannot stand, even though there is strong reason to believe that if all of the true facts were known and shown in evidence guilt would be conclusively established. After giving the trial court the favorable presumption to which it is entitled, we conclude that, irrespective of whether appellant is guilty, the verdict is so contrary to the weight of the evidence that it is clear that the verdict is palpably wrong and unjust. By so holding we do not say that there is disagreement between us and the jury as to the guilt of defendant, but that the verdict is palpably wrong and unjust by reason of the extent of its contrariety to the weight of the evidence now before us. The defendant's motion for a new trial should have been granted. The foregoing opinion was prepared by Retired Circuit Judge LEIGH M. CLARK, serving as a judge of this Court under the provisions of § 6.10 of the New Judicial Article (Constitutional Amendment No. 328). His opinion is hereby adopted as that of the Court. The judgment of the trial court is hereby reversed and rendered. REVERSED AND RENDERED. *942 HARRIS, P. J., and BOOKOUT and BOWEN, JJ., concur. TYSON and DeCARLO, JJ., dissent. TYSON and DeCARLO, Judges, dissenting. While we agree that the evidence in this cause against the appellant is largely circumstantial, nevertheless we are of the opinion that the evidence is sufficient to support the verdict. NOTES [1] The writer has examined the exhibit that constitutes the pants upon which the stain of blood was found. They are ankle-length and are labeled, "100% polyester."	{ "pile_set_name": "FreeLaw" }
1. Technical Field The present invention relates to a semiconductor device that includes a multilayer interconnect structure. 2. Related Art To cope with the recent growing demand for higher operating speed for semiconductor chips, various studies are being aggressively made on employing a material having a lower dielectric constant to form an interlayer dielectric in place of a silicon oxide film (dielectric constant K=approx. 4.3), to thereby reduce parasitic capacitance between interconnect lines. Examples of applicable low dielectric constant (hereinafter abbreviated as low-k) insulating material include HSQ, MSQ, and aromatic-containing organic resins, which have a dielectric constant of approx. 3. Besides, for achieving a still lower dielectric constant, porous materials that include minute pores are lately being developed. Employing such low-k materials to form the interlayer dielectric allows reducing crosstalk between the interconnect lines, thus achieving higher operating speed of the chips. The low-k films, however, generally have low film strength, and insufficient adhesion properties. Besides, because of the lack of strength, the low-k film is prone to be scraped off during a CMP (Chemical Mechanical Polishing) process, in a region where interconnect lines are not densely distributed. Now, when fabricating semiconductor chips, a plurality of circuit chips are first formed on a wafer, and then the wafer is diced into individual chips. By the dicing process, dicing sections of the semiconductor chips are exposed. Accordingly, a seal ring region is provided along the periphery of each circuit chip, so as to prevent intrusion of water or moisture through the dicing sections. JP-A 2004-297022 discloses a structure of a semiconductor chip provided with a seal ring constituted of vias and interconnects disposed along the outer periphery. In this structure, the seal ring is continuously disposed so as to be connected to all layers, including the lower layers and upper layers of the semiconductor chip, to thereby prevent the intrusion of water or moisture through the dicing sections (FIG. 2 of JP-A 2004-297022). Generally, in a semiconductor device, upper layers are formed in an insulating layer constituted of silicon oxide film, which is sufficiently rigid, serving as the interlayer dielectric, while lower layers are formed in an interlayer dielectric constituted of a low-k film, for reducing the interconnect capacitance. The low-k film lacks in mechanical strength and adhesion properties, as stated above. Besides, the low-k film is prone to absorb moisture. Therefore, improvement in mechanical strength and moisture resistance with respect to the lower layers of the semiconductor device is an important issue to be addressed. On the other hand, since the upper layers include the wider interconnects and the larger vias in general, the size of the seal ring region is determined according to the size of the interconnects and vias in the upper layers. Therefore, it is desirable to have the interconnects and vias in the upper layers disposed so as to prevent the seal ring region from excessively expanding.	{ "pile_set_name": "USPTO Backgrounds" }
The common inhalation anesthetic isoflurane induces apoptosis and increases amyloid beta protein levels. The common inhalation anesthetic isoflurane has previously been reported to enhance the aggregation and cytotoxicity of the Alzheimer disease-associated amyloid beta protein (Abeta), the principal peptide component of cerebral beta-amyloid deposits. H4 human neuroglioma cells stably transfected to express human full-length wild-type amyloid precursor protein (APP) were exposed to 2% isoflurane for 6 h. The cells and conditioned media were harvested at the end of the treatment. Caspase-3 activation, processing of APP, cell viability, and Abeta levels were measured with quantitative Western blotting, cell viability kit, and enzyme-linked immunosorbent assay sandwich. The control condition consisted of 5% CO2 plus 21% O2 and balanced nitrogen, which did not affect caspase-3 activation, cell viability, APP processing, or Abeta generation. Two percent isoflurane caused apoptosis, altered processing of APP, and increased production of Abeta in H4 human neuroglioma cell lines. Isoflurane-induced apoptosis was independent of changes in Abeta and APP holoprotein levels. However, isoflurane-induced apoptosis was potentiated by increased levels of APP C-terminal fragments. A clinically relevant concentration of isoflurane induces apoptosis, alters APP processing, and increases Abeta production in a human neuroglioma cell line. Because altered processing of APP leading to accumulation of Abeta is a key event in the pathogenesis of Alzheimer disease, these findings may have implications for use of this anesthetic agent in individuals with excessive levels of cerebral Abeta and elderly patients at increased risk for postoperative cognitive dysfunction.	{ "pile_set_name": "PubMed Abstracts" }
Derek Duncan Derek Henry Junior Duncan (born 23 April 1987) is an English footballer who plays as a winger or as a left back for VCD Athletic . Career Duncan was signed by Grays Athletic on a one-year contract on 25 May 2007, following his release by Leyton Orient. The left-winger left Grays Athletic by mutual consent, just a month after he signed, after his agent offered him to other Football League clubs. Duncan was signed by Paul Lambert in the summer of 2007 and joined Wycombe Wanderers, where he failed to make a league appearance before having his contract terminated by mutual consent in January 2009. On the same day it was announced that he had left Wycombe Wanderers, it was announced that the winger had signed for Ebbsfleet United until the end of the 2008–09 season. The following day Duncan made his debut for Ebbsfleet in their 1–0 home league win over Rushden & Diamonds. Duncan signed for AFC Wimbledon on 15 June 2009, but after one season at Kingsmeadow he signed for former club Ebbsfleet, on 6 July 2010. On 29 July 2011, it was announced he had signed for Conference South side Woking. At the start of 2012–13 season he signed for Conference South side Maidenhead United. Isthmian League side VCD Athletic recruited Duncan for the 2016-17 season. He featured throughout the first part of the season, before picking up a straight-red card sending off on 1 January 2017 versus local rivals Phoenix Sports. References External links Category:1987 births Category:Living people Category:English footballers Category:Association football wingers Category:Leyton Orient F.C. players Category:Lewes F.C. players Category:Grays Athletic F.C. players Category:Wycombe Wanderers F.C. players Category:Ebbsfleet United F.C. players Category:AFC Wimbledon players Category:Woking F.C. players Category:Maidenhead United F.C. players Category:Thamesmead Town F.C. players Category:English Football League players Category:National League (English football) players Category:Isthmian League players Category:Footballers from Upton Park, London	{ "pile_set_name": "Wikipedia (en)" }
Harris K and Brandon at Tomorrow Is Another Day, Louis Marzin at Wilhelmina and Frank shot by Trinity Ellis and styled by Mischa Notcutt with pieces from Cottweiler, for the latest issue of Seventh Man magazine.	{ "pile_set_name": "Pile-CC" }
SALT LAKE CITY - The Church of Jesus Christ of Latter-day Saints is under national scrutiny again, this time from Businessweek, whose cover story this week investigates "How the Mormons Make Money." The article suggests that the LDS church doesn't contribute many resources to charity and that they leverage volunteer hours for profit. Images that accompany the article are causing as much controversy, if not more, as the article's words. [READ: How the Mormons Make Money on Businessweek.com] The periodical's cover has an image of John the Baptist with hands on LDS founder Joseph Smith and Oliver Cowdry with a voice bubble saying, "...And thou shalt build a shopping mall, own stock in Burger King, and open a Polynesian theme park in Hawaii that shall be largely exempt from the frustrations of tax..." The LDS church responded to the cover story, saying, "The Bloomberg Businessweek cover is in such poor taste it is difficult to even find the words to comment on it." The story describes the church's $2 billion investment in the recently-opened City Creek Center. Jason Mathis with the Downtown Alliance says that the investment didn't come from tithes of the LDS faithful. "City Creek Center was built without tithing dollars and really provided thousands of jobs for construction workers at a time when construction was really hit hard," said Mathis. Utah Valley University religious studies professor Ken White says business and industry are a focus of the LDS church. "It's a basic tenet you should be busy, you should be actively engaged in what you're doing and be the best you can be in what you're doing," said White. "You can see they use a lot of resources for good things, things that we would justify from a religious standpoint." FOX 13 couldn't find an example of another mainstream religion that is as invested in business as the LDS church. Thrivent Financial, a faith-based organization for Lutherans, operates as an investment organization and is listed as one of the Fortune 500 biggest corporations in the country.	{ "pile_set_name": "OpenWebText2" }
Q: Where in the Windows phone device is SQLite db file located/stored? I'm working on a WP8 app involving SQLite. So when the code for creating and populating the database is executed, I want to be sure the db file is really created on the device and also verify its contents using an SQLite browser. In creating the database, I specified the location ApplicationData.Current.LocalFolder but I've no idea where exactly in the device that points to. Which location in the device can I find the SQLite db file? A: Go to Program Files (x86)\Microsoft SDKs\Windows Phone\v8.0\Tools\IsolatedStorageExplorerTool. Go to this folder and run one of the below commands: ISETool.exe ts xd 8a40681d-98fc-4069-bc13-91837a6343ca c:\data\myfiles command, if you are running the application on emulator. ISETool.exe ts de 8a40681d-98fc-4069-bc13-91837a6343ca c:\data\myfiles command, if you are running the application on device. The third argument is the application product ID, you can get it in the WMAppManifest.xml file, App tag, ProductId attribute. The product ID of the given example is 8a40681d-98fc-4069-bc13-91837a6343ca. Now, if everything is okay, you should have a copy of the Isolated Storage content in the c:\data\myfiles; And the database file should be there too. Then you can add your database file in your project with Add Existing Item option. Remember to change the Copy to Ouput Directory property of the added .sqlite file to Copy if newer.	{ "pile_set_name": "StackExchange" }
Q: 1000Base-T Server NIC speed slows down to 100Base-T when sending data to a 100Base-T device I am conducting experiments to explore how data transmission is being influenced by the network speeds of the receivers. Here is my setup, I have an Ubuntu server A connected to a Gigabit switch with 2 other clients (B and C). All machines have been installed with a gigabit NIC card While Clients A B are operating at 1000mbps, client C is configured to run at 100Mbps by ethtool using the following command ethtool -s eth0 speed 100 duplex full With this setup, i have attempted to send a 500MB file from A to clients B and C at the same time via SCP. I have expected the data transmission rate between A and C to be 100mbps, and A and B to be 1000mbps. However in reality, the transmission rate of A to both B and C has been dropped to 100mbps. My question is: is this behavior to be expected? If so, is there a way to send data from A to B and C concurrently at different network speeds? A: I believe that this is one of the boundary conditions that some network hardware manufacturers may or may not choose to implement wisely. a lot of it depends on the switch mode, per-port-buffer size, and backplane speed, as well as host metrics like the nic, systembus, and CPU speed. SCP requires encryption/decryption so the host system bus, Nic bus, and CPU capacity are all factors. if the recieving pc can't keep up with the flow, it sends source-quench flow control messages to the switch, which slows down output to that port, which may cause the switch buffers to fill up, and may result in the switch relaying source-quench messages to the sending system, instructing it to slow down. source quench occurs at layer 2, so there is little or no differentiation between the two flows; it has to slow down both of them. the port-buffer for the sending host is likely full as well, meaning that data can only be sent into it at the rate it can be sent on to the slower destination. in the end, it all depends on the grade of your equipment. if you are connecting rack servers over fiberchannel to a enterprise grade switch, and then into a smaller distribution switch, then I would not expect this problem. if you are using 3 old pc's connected by ratty cat5e to a couple $100 netgear switches, then I would completely expect it.	{ "pile_set_name": "StackExchange" }
Scientists have proved that even the most seemingly innocent chat with a woman can be enough to send male sex hormones soaring. A team from the University of Chicago paid students to come into their lab under the pretence of testing their saliva chemistry. While there, the students got to chat to a young female research assistant. Saliva tests showed the brief interaction was enough to raise testosterone levels by as much as 30%. The more a man's hormone level shot up, the more attractive he later admitted to finding the research assistant. And perhaps more tellingly, the research assistant herself was able to identify those men who found her attractive. The men who she judged to be doing the most to try to impress her proved to be those who registered the biggest jump in testosterone levels. However, little or no change was detected in the saliva of students who chatted with other men. Animal reaction Testosterone has long been closely linked with the male libido. The researchers say their work is the first time that hard evidence has been produced in this way. It is known that the release of testosterone in animals can embolden them, triggering courtship or aggressive behaviour. The Chicago team believe the same may be true in humans. However, lead researcher Dr James Roney said it was also possible that the release of the hormone was stimulated by a stress reaction. Dr Roney told BBC News Online: "The findings are consistent with the existence of brain mechanisms that are specialised for the regulation of courtship behaviour and thus respond to cues from potential mates with coordinated behavioural and hormonal reactions. "One might call these reactions components of a "mating response" which, if confirmed by future research, could be as basic and significant as, say, the well-known "fight or flight" reaction." Dr Nick Neave, of the Human Cognitive Neuroscience Unit at Northumbria University, said the study was "very interesting". "Other researchers have found changes in male hormone levels after watching erotic movies but this seems to be the first that has attempted to assess hormone changes when males meet women on a more 'normal' level." Dr Benjamin Campbell, an expert in anthropology at Boston University, said it was possible that testosterone made men more bold by suppressing activity in an area of the brain called the amygdala, which controls the stress reaction. Testosterone levels peak in a man by his early twenties, and then gradually diminish. Men who are married or in long-term relationships have lower testosterone levels than those still playing the field. The research is published in the journal Evolution and Human Behavior.	{ "pile_set_name": "Pile-CC" }
Subsea pipelines need to be elevated with respect to the sea floor proximate the pipeline on occasion for numerous reasons. It is often advantageous for such a tool to be capable of securely cradling the pipeline.	{ "pile_set_name": "USPTO Backgrounds" }
Break The Rules And Patterns There are all kinds of Patterns we could recognize in games, some of which are written here (SaveGamePatterns, CategoryHolisticDesignPattern?). Boss fights are a pattern. Attack combos are a pattern. It is very rare for a game that consists only of patterns and rules from other games to be a hit. (Although it does happen, as you'll see a me-too clone like Warcraft sell just as well as Dune 2.) A game must have something that sets it apart. So what's the point of writing down rules and patterns? It's a good idea for software engineering, where someone who comes up with a clever new way of doing the same old thing deserves to get bashed over the head with a stick, but it may not be what you want for anything creative. But I'll argue that formalism is still useful: First: you can't break the rules until you know what they are. If Ron Gilbert hadn't recognized that punishment was a pattern in adventure games of old, it may not have occurred to him to violate that pattern. (Actually an AntiPattern) Second: if you want to ship a game on time, you cannot afford to innovate in very many areas. The innovation in your game should probably be its focus, and everything else should fall back on tried-and-true. Or, from Better_By_Design?, June 2003: "A foolish consistency is the hobgoblin of little minds, adored by little statesmen and philosophers and divines." - Ralph Waldo Emerson	{ "pile_set_name": "Pile-CC" }
KITCHENER — Waterloo Region is getting $15.1 million in federal funding for improvements to the bus system, including new vehicles and equipment upgrades. "That's 18 brand new buses on the streets of our community," said Waterloo MP Bardish Chagger, Minister of Small Business and Tourism, at the announcement in Kitchener on Thursday. The seven approved projects will ensure "safe, reliable and modern transit," Chagger told the gathering in regional headquarters. Along with buying new buses for the Grand River Transit fleet, money is earmarked for the installation of voice radio equipment and replacement of on-board cameras on transit vehicles, and improvements near stops including lighting and walkways to bolster safety and accessibility. "We've already had significant support on the rapid transit side," said Coun. Tom Galloway, chair of the regional planning and works committee. "Here we have significant support for conventional transit." This is the second part of a federal funding commitment to public transit in the region through the Canada-Ontario Public Transit Infrastructure Fund. The first part, announced last August, focused primarily on the region's new light rail system. In total, the investment is worth $35 million. "The two work very much together," Galloway said. "It is one fare, one system." Both rapid and conventional transit are essential in the region's efforts to manage population growth and limit urban sprawl, he said. "We decided transit was a big part of the solution," Galloway said. The new buses will be for iXpress routes that will connect with the light rail system. Trains are expected to start travelling the route from Conestoga Mall in Waterloo to Fairview Park mall early next year, after some delays. The federal funding is good news for taxpayers, Galloway said, since the region already had most of the projects in the capital budget forecast. "Pretty well all these projects were on that list," he said. "We're very pleased." Mike Murray, chief administrative officer, said the region is building "a world-class transit system." Loading... Loading... Loading... Loading... Loading... Loading... He said the transit system is key for both residents to participate in the community, and for growth management. "And that has to be a fully integrated system," Murray said. "That's really what we're trying to build, so that is serves the whole community."	{ "pile_set_name": "OpenWebText2" }
Y-Stent-Assisted Coiling With Low-Profile Neuroform Atlas Stents for Endovascular Treatment of Wide-Necked Complex Intracranial Bifurcation Aneurysms. Y-stent-assisted coiling is one of the eligible techniques for the treatment of complex bifurcation aneurysms. In majority of previous literature, Y-stenting has been performed using stents that could be delivered through large profile microcatheters that are often difficult to manipulate during navigation through sharply angled side branches. Attempts to navigate with these large profile catheters might cause serious complications during Y-stenting procedure. To investigate the safety, feasibility, and efficacy of Y-stent-assisted coiling procedure with Neuroform Atlas stents for the treatment of complex bifurcation aneurysms; Neuroform Atlas is a recently introduced open-cell stent that can be delivered though low-profile microcatheters. We identified the patients with intracranial bifurcation aneurysms treated by Y-stent-assisted coiling procedure with Neuroform Atlas stents. We assessed the immediate postoperative and follow-up clinical and angiographic outcomes. We also investigated the periprocedural and delayed complications. A total of 30 aneurysms in 30 patients were included in the study. Y-stenting was successfully performed without any technical complications in all cases (100%). Immediate postprocedural angiography revealed total aneurysm occlusion in 83.3% of patients. The mean angiographic follow-up time was 11.8 mo. The last follow-ups showed complete occlusion in 93.3% of patients. There was no mortality in this study. A procedure-related complication developed in 6.7% and resulted in permanent morbidity in 3.3% of patients. Neuroform Atlas stent combines the advantages of low-profile deployment microcatheters with an open-cell structure to achieve a successful Y-stenting procedure. Y-stent-assisted coiling with Neuroform Atlas stents provides a safe and effective endovascular treatment for wide-necked complex bifurcation aneurysms.	{ "pile_set_name": "PubMed Abstracts" }
Residence 6 features a grand 2-car garage with plenty of storage, 3 bedrooms, 3 baths and approximately 1,786 sq. ft. of living space. Enter the home and head upstairs to the main living area. This ideal second floor features a large great room with a walk-out balcony, dining room, and a gourmet kitchen complete with a working island, convenient pantry, and abundant cabinet space. Bedroom 3, a full bath, and coat closet complete the main living area. Head up to the third floor and you’ll find a private master suite with a large walk-in closet, bedroom 2, and convenient laundry closet. Community Info Prynt Taylor Morrison is proud to announce its newest community at Prynt in Milpitas. Featuring 11 unique three-story floor plans, Prynt offers a unique opportunity for homebuyers to select from a wide variety of thoughtfully designed floor plans. These brand new townhome-style condos will range from approximately 1,695 to 2,549 square feet with 2 to 3 bedrooms, and 2.5 to 3.5 bathrooms. Prynt is conveniently located near extensive parks, top employment centers, and prime retail spots. Residents will take advantage of walking distance to retail stores, coffee shops, movie theaters, parks and grocery stores within a one mile radius. Home to the Great Mall, Milpitas offers the largest indoor outlet and value shopping destination in Northern California. It’s premiere location also allows for convenient access to medical facilities. Kaiser Permanente Milpitas Medical Offices are less than half a mile from the community and the Regional Medical Center of San Jose is just five miles south along Highway 680. Located in the heart of Silicon Valley, Prynt is within an easy commute to major Bay Area employment centers. The community has easy access to Highways 880, 237, 101 and 680. Commuters will also enjoy close proximity to BART (Bay Area Rapid Transit) which is 12 miles north of the community. Sign up for updates and receive the latest news regarding grand opening, sales release date, pricing and announcements for this community. Join the Prynt interest list today! At NewHomeSource.com, we update the content on our site on a nightly basis. We seek to ensure that all of the data presented on the site regarding new homes and new home communities is current and accurate. However, we do not assume any liability for inaccuracies. It is your responsibility to independently verify the information on the site.	{ "pile_set_name": "Pile-CC" }
We have cloned a 9.5-kbp fragment of an oncogene present in a human fibrosarcoma cell line (HT-1080). The cloned fragment is present in all tested HT-1080-derived transformants, and is different from another fragment of the same oncogene (14 kbp) previously isolated. When both fragments are put together, the construction shows a molecular structure similar to that of the N-ras oncogene present in human neuroblastoma cell lines.	{ "pile_set_name": "NIH ExPorter" }
Role of hepatic and intestinal cytochrome P450 3A and 2B6 in the metabolism, disposition, and miotic effects of methadone. The disposition of the long-acting opioid methadone, used to prevent opiate withdrawal and treat short- and long-lasting pain, is highly variable. Methadone undergoes N -demethylation to the primary metabolite 2-ethyl-1,5-dimethyl-3,3-diphenylpyrrolinium (EDDP), catalyzed in vitro by intestinal, hepatic, and expressed cytochrome P450 (CYP) 3A4. However, the role of CYP3A4 in human methadone disposition in vivo is unclear. This investigation tested the hypothesis that CYP3A induction (or inhibition) would increase (or decrease) methadone metabolism and clearance in humans. Healthy volunteers were studied in a randomized, balanced, 4-way crossover study. They received intravenous (IV) midazolam (to assess CYP3A4 activity) and then simultaneous oral deuterium-labeled and IV unlabeled methadone after pretreatment with rifampin (INN, rifampicin) (hepatic/intestinal CYP3A induction), troleandomycin (hepatic/intestinal CYP3A inhibition), grapefruit juice (selective intestinal CYP3A inhibition), or nothing. Methadone effects were measured by dark-adapted pupil diameter. CYP isoforms catalyzing methadone metabolism by human liver microsomes and expressed CYPs in vitro were also evaluated. Methadone had high oral bioavailability (70%) and low intestinal (22%) and hepatic (9%) extraction, and there was a significant correlation ( r = 0.94, P <.001) between oral bioavailability and intestinal (but not hepatic) availability. Rifampin decreased bioavailability and oral and IV methadone plasma concentrations and increased IV clearance (4.42 +/- 1.00 mL. kg -1. min -1 versus 1.61 +/- 0.67 mL. kg -1. min -1, P <.05) and oral clearance (8.50 +/- 3.68 mL. kg -1. min -1 versus 2.05 +/- 0.92 mL. kg -1. min -1, P <.05), EDDP/methadone area under the curve (AUC) ratios, EDDP formation clearances, and hepatic extraction (0.27 +/- 0.06 versus 0.09 +/- 0.04, P <.05). Troleandomycin and grapefruit juice decreased the EDDP/methadone AUC ratio after oral methadone (0.17 +/- 0.10 and 0.14 +/- 0.06 versus 0.27 +/- 0.20, P <.05) but not IV methadone and had no effect on methadone plasma concentrations, IV clearance (1.29 +/- 0.41 mL. kg -1. min -1 and 1.48 +/- 0.55 mL. kg -1. min -1 ) or oral clearance (2.05 +/- 1.52 mL. kg -1. min -1 and 1.89 +/- 1.07 mL. kg -1. min -1 ), or other kinetic parameters. There was no correlation between methadone clearance and hepatic CYP3A4 activity. Pupil diameter changes reflected plasma methadone concentrations. In vitro experiments showed a predominant role for both CYP3A4 and CYP2B6 in liver microsomal methadone N -demethylation. First-pass intestinal metabolism is a determinant of methadone bioavailability. Intestinal and hepatic CYP3A activity only slightly affects human methadone N -demethylation but has no significant effect on methadone concentrations, clearance, or clinical effects. Greater rifampin effects, compared with troleandomycin and grapefruit juice, on methadone disposition suggest a major role for intestinal transporters and for other CYPs, such as CYP2B6. Interindividual variability and drug interactions affecting intestinal transporter and hepatic CYP3A and CYP2B6 activity may alter methadone disposition.	{ "pile_set_name": "PubMed Abstracts" }
Introduction ============ Better adjuvant therapy, improved metal implants, and innovative surgical techniques have led surgeons to consider limb salvage surgery as an alternative treatment for malignant bone tumour other than amputation. Orthopaedic oncology patients have a chance for an active, disease-free life after limb salvage surgery. In the first evidence-based study, Simon et al. had reported the benefits of limb-salvaging procedures for bone tumours.[@b1-rado-46-03-189] Their multicentre study reported the rates of local recurrence, metastasis and survival in 227 patients with osteosarcoma in the distal femur and suggested that the Kaplan-Meier curves of the patients without recurrence were not statistically different between limb-salvaging surgery and amputation patients during a 5.5-year follow-up. Limb-salvage surgery was considered as safe as an amputation in the management of patients with high-grade osteosarcoma. The goal of limb-salvaging surgery is to preserve the function of limbs, prevent tumour recurrence, and enable the rapid administration of chemotherapy or radiotherapy.[@b2-rado-46-03-189] It can be reached with meticulous technique, detailed operative planning, and the use of endoprosthetic replacements and/or bone grafting. For a successful limb-salvage surgery in high-grade malignant tumour, such as sarcomas, a wide margin is necessary to obtain a local control.[@b3-rado-46-03-189]--[@b5-rado-46-03-189] Since marginal and intralesional margins are related to local recurrence, the reconstruction with limb-salvaging options should be carefully considered. The clinical outcome of the limb-salvage surgery with arthroplasty is closely related to the accuracy of the surgical procedure. To improve the final outcome, one must take into account the length of the osteotomy plane, as well as the alignment of the prosthesis with respect to the mechanical axis in order to keep the balance of the soft tissues. Furthermore, the parameters measured with the 3D imagine must be used during the individual manufacture of implant in order to reconstruct the skeletal structure accurately. Therefore, geometric data (such as length of leg, offset) and morphologic data are required. Magnetic resonance imaging (MRI) was beneficial for tumour detection and consequently staging of musculoskeletal neoplasia. MRI became an ideal imaging modality for musculoskeletal neoplasia because of superior soft-tissue resolution and multiplanar imaging capabilities and had a significant impact on the ability to appropriately stage lesions and adequately plan for limb-salvage surgery.[@b6-rado-46-03-189],[@b7-rado-46-03-189] In contrast, multi-slice spiral computed tomography (CT) could provide super three-dimensional morphological delineation of the diseased bone. Theoretically, the complimentary use of these two imaging modalities could give the surgeon a more accurate way to implement preoperative planning than the conventional application of 2D images. The purpose of this prospective study was to report our initial experience with limb salvage surgery for orthopaedic oncology patients by using both MR imaging and multi-slice spiral CT for preoperative planning. Patients and methods ==================== Patients and preparation ------------------------ The study protocol has complied with all relevant national regulations and institutional policies and has been approved by the local institutional ethics committee. Informed consent was obtained from all patients before the procedure. Patients with malignant bone tumours of lower/upper limb were enrolled in the study. Preoperative work-up consisted of history and clinical examination, routine laboratory tests and an aesthetic assessment, plain radiography of the limb, 64-slice spiral CT scan of the limb and chest, Technetium-99m bone scan, and, in all of the cases, MRI of the affected limb. Antibiotics were administrated before the surgery. Biopsy was performed for pathological examination. Chemotherapy was commenced 6 weeks before the surgery in those cases which were diagnosed as osteosarcoma and dedifferentiated chondrosarcoma. Patients were classified according to the Enneking staging system.[@b8-rado-46-03-189],[@b9-rado-46-03-189] The patients received a detailed narrative of conventional, surgical and amputation options after the limb salvage surgery at their own request. Nine consecutive patients with lower/upper limb malignant tumour of bone (5 women, 4 man, mean age 28.6 years, range: 19--52 years) were treated with limb-salvaging procedures. Lesion size (longitudinal direction), location and histology are summarized in [Table 1](#t1-rado-46-03-189){ref-type="table"}. MR imaging ---------- MR images were performed at a 1.5-T superconductive unit (Gyroscan Intera, Philips Medical Systems, Netherlands) and a synergy surface coil was used. The sequences included transverse, sagittal and coronal turbo spin echo T1- and fat-suppressed T2-weighted images. The parameters of these sequences were TR/TE=400 /20 ms for T1-weighted imaging, TR/TE=3500 /120 ms for T2-weighted imaging and a field of view of 480 mm×480 mm for sagittal imaging and 40 mm×40 mm for transverse imaging and 480 mm×480 mm for coronal imaging with a matrix of 512×512, 4--6 signals acquisition and a slice thickness/gap = 5/0.5 mm. Contrast enhanced sagittal, coronal and transverse T1-weighted imaging were obtained after the intravenous injection of gadopentetate dimeglumine (Magnevist, Schering, Berlin, Germany) with a dosage of 0.2 mmol/kg of body weight. Multi-slice spiral CT --------------------- CT scan was performed by using a 64-slice spiral CT (Sensation 64, Siemens Medical Systems, Germany). The raw data obtained using an axial collimation of 64×0.6 mm, a pitch of 1.0, a tubular voltage of 120 KV and a tubular current of 360 mAs, were reconstructed into contiguous 1-mm thick slices with an increment of 0.5 mm and a field of view of 376 mm × 376 mm and a matrix of 512 × 512 by using the standard soft tissue and bone algorithm. These thin-slice images were postprocessed by using the techniques of multiplanar reformation (MPR) and volume rendering (VR) to demonstrate the lesion details and perform related measurements. Preoperative planning --------------------- All preoperative radiographs were evaluated by one radiologist and two consultant orthopaedic surgeons, who were members of the surgical team performing the operations. First, the osteotomy plane was determined separately on CT and MRI. On orthogonal coronal enhanced MR images and CT MPR images, the bulk margin of the tumour in the medullary cavity was defined according to the different signal characteristics or attenuation of the tumour itself and the marrow oedema around the tumour. Then, the maximum distance from the top of the greater trochanter to this tumour margin was measured on orthogonal coronal T1-weigthted MRI images, if the tumour was located in the proximal part of femur. The maximum distance from the knee joint line to the tumour margin was measured for the tumours located in the distal part of femur. The maximum distance was defined as the intramedullary extension of the primary tumour and subsequently was used as a reference for the CT measurement. The osteotomy plane on CT MPR images was defined 30 mm distal from the margin of tumour. This distance was also used to determine the length of the extra medullary part of the prosthesis. After the osteotomy plane had been determined, the detailed shape of the medullary cavity of the preserved part of the femur was assessed using the orthogonal MPR technique for determining the diameter and length of the intra medullary part of prosthesis. Diameters of the medullary cavity at the level of the osteotomy plane and the level of the narrowest plane were measured to determine the diameter of the intra medullary stem of the prosthesis. The length of the intra- medullary stem of the prosthesis should be well matched to the length of medullary cavity of the preserved part of femur, which would be optimal if it had an equal length to the extra medullary part of prosthesis. Finally, the centre axis of the femoral shaft measured on CT was used as a reference. Offset, the distance from the central axis of the femoral shaft and the rotation centre of the femoral head, was the index used to determine the neck length of the prosthesis. Surgery ------- All patients underwent en bloc resection and customized prosthetic reconstruction. An anterolateral incision encircling the biopsy scar was used. Limb-salvage surgery consisted of intentional marginal excision, preserving important structures such as major neurovascular bundles, tendons, and ligaments. The osteotomy plane, 30 mm distal from the primary tumour was confirmed based on MRI for all patients. For patients with lesion in the proximal part of femur/humerus, the customized prosthesis was secured using methylmethacrylate cement after the resection. For patients with the tumour in the distal part of the femur, en bloc resection including the tibial plateau was performed and the customized prosthesis was secured using methylmethacrylate cement in both the tibia and femur after the resection. The extensor mechanism was reconstructed by reattachment of the patellar tendon to the slot on the tibial component. After surgery, functional rehabilitation and neoadjuvant chemotherapy were performed. Postoperative measurement ------------------------- After surgery, the patients were followed with a mean of 13 months (range, 9 to 20 months). The postoperative assessment of prosthesis was performed on plain radiography. The central axis of the femoral or humeral shaft and offset were defined. The vertical distance from the line between the top of bilateral ischial tuberosities to the femoral condylar plane was assessed to evaluate the change of the length of the lower limbs. The change of the length of the upper limbs was not assessed for those humeral tumour cases. Functional evaluation was performed in all patients using the 30-point functional classification system of the Musculoskeletal Tumour Society.[@b8-rado-46-03-189] Statistical analysis -------------------- Data were expressed as mean ± SD. All measured values were normally distributed (Kolmogorov-Smirnov test). A paired Student's t test was used to evaluate the differences between preoperative planning and post-operative measurements. Values for p \< 0.05 were considered statistically significant. The statistical analysis was done with SPSS, version 12.0 (SPSS, Inc.). Results ======= The mean postoperative functional evaluation score was 23.3 ± 2.7 (range, 15--27) according to Enneking's evaluation. Excellent or good function was achieved in all patients and all patients had preserved stable joint ([Table 2](#t2-rado-46-03-189){ref-type="table"}). There were no local recurrences, metastases or aseptic loosening determined by bone scan, CT scan, ultrasonic examination and laboratory tests in all patients until the end of the follow-up. Accuracy of determination for tumour's boundary ----------------------------------------------- To determine the accuracy of tumour boundary defined by MRT and CT, the specimens were collected from 1cm, 2cm proximal to the tumour plane and 1cm, 2cm distal as determined by MRI and CT and were examined for histopathology ([Figure 1](#f1-rado-46-03-189){ref-type="fig"},[2](#f2-rado-46-03-189){ref-type="fig"}). There was significant difference in tumour extension between MRI and CT measurements (P\<0.05). The tumour extension measured on MRI was not statistically different from the actual extension (P\>0.05), while the extension measured on CT was less than the actual extension ([Table 3](#t3-rado-46-03-189){ref-type="table"}). Accuracy of reconstruction of the limb length --------------------------------------------- Before and after operation, there was no significant difference in the length and offset of affected lower limb ([Table 4](#t4-rado-46-03-189){ref-type="table"}, [Figure 3](#f3-rado-46-03-189){ref-type="fig"}, [4](#f4-rado-46-03-189){ref-type="fig"}). Discussion ========== The effect of CT combined with MRI on the determination of invasiveness range of malignant bone tumour ------------------------------------------------------------------------------------------------------ Preoperative imaging plays an important role in determining the stage of bone tumours and then an appropriate choice of therapy for affected patients. An appropriate imaging protocol should always begin with plain radiography. If an aggressive or malignant lesion was suspected, further evaluation with cross-sectional imaging such as CT or MR imaging was needed. CT and MRI are imaging methods, often combined in diagnostic procedures of many oncology tumours.[@b10-rado-46-03-189],[@b11-rado-46-03-189] CT is useful for a detailed assessment of subtle bony lesions and anatomically complex bones. MRI is particularly useful for determining the tumour extension within medullary compartments and is able to detect tumour involvement of the adjacent muscle compartments, neurovascular structures, and joints. Fat-suppressed T2-weighted imaging proton-density weighted imaging, and contrast-enhanced T1-weighted sequences were frequently used to evaluate neurovascular bundle involvement.[@b12-rado-46-03-189]--[@b13-rado-46-03-189] Currently, MR imaging has become the modality of choice in the local staging of the primary bone tumour. Many studies have investigated the accuracy of MRI in determining the infiltration range of osteosarcoma. Sundaram et al. first reported that MRI would not overestimate the range of osteosarcoma, compared with histology.[@b14-rado-46-03-189] Compared with gross and microscopy examination, MRI did not overestimate or underestimate the extent of the tumour, and the false positive and false negative rate were zero. Later, O'Flanagan et al. found that MRI could determine the aggression radius of osteosarcoma within the accuracy of 1cm.[@b15-rado-46-03-189] For high-grade sarcomas, a wide margin is essential to obtain the local control in order to achieve a successful limb-salvage surgery.[@b16-rado-46-03-189]--[@b17-rado-46-03-189] Meyer et al. designed the osteotomy plane according to MRI and found that osteotomy plane could be successfully determined by MRI.[@b18-rado-46-03-189] In the present study, the aggression radius of the tumour determined by MRI and the postoperative histological examination was comparable and MRI is superior to CT for determining the tumour extension. Moreover, we found that the result of MRI was slightly larger than the actual extent. The reasons might be that the low signals of peri-tumour oedema was also assigned to the radius of the tumour, resulting in overestimation of tumour size or the preoperative chemotherapy further reduced the aggression radius of the tumour. This result was consistent with the report of O'Flanagan, who found that the aggression radius of the tumour could be evaluated accurately in coronal and sagittal views of T1-weighted images. In contrast it would be overestimated on T2-weighted or fat-suppressed T2-weighted images because of the presence of the peri-tumour oedema. We suggest that MRI was better to demonstrate peri-tumour oedema in comparison to the histological findings. Since this study does not include a long-term follow-up and a large number of patients, a further study is necessary to determine the eventual effect of MRI osteotomy plane on the long-term survival rate. The value of three-dimensional CT in the reconstruction of limbs ---------------------------------------------------------------- There is a huge variety in the human skeleton structure as to the size and shape. Therefore, an implant needs to be custom-made to be more suitable for the patient's bone structure and mechanical requirements. One major challenge is to restore the leg length adequately after the operation.[@b19-rado-46-03-189] The leg length discrepancy can affect the joint stability, can cause sciatica and low back pain, and inequable stress on the hip.[@b20-rado-46-03-189] Anja et al reported that in 1171 cases of total hip replacement most patients with the length of the difference less than 1 cm walked without limp, while 1/4 patients with more than 2cm difference suffered from claudication.[@b21-rado-46-03-189] Morrey found that inappropriate eccentricity was one of the factors that could induce dislocation of prosthesis.[@b22-rado-46-03-189] Therefore, reducing the eccentricity would increase the risk of dislocation. Dorr et al. found that both lack of strength of abductor muscles and impingement of the hip, were the important reasons for dislocation.[@b23-rado-46-03-189] Clinically, many factors could lead to hip dislocation. In the presence of the release of soft tissue around the hip and lack of strength of abductor, the decreased offset would significantly increase the incidence of hip impingement syndrome and dislocation, which would increase the instability of the hip joint and may lead to dislocation after slight changes in posture. A smaller offset might lead to excessive loads on prosthesis, and increase the incidence of proximal femoral osteolysis, prosthetic loosening and revision. Theoretically, increasing the offset can reduce the joint reaction force and then may reduce wearing of polyethylene.[@b24-rado-46-03-189] Each additional 10 mm of the offset can reduce 10% of the abductor force and 10% less force for the acetabular cup. But if the offset is too large, it can easily lead to malposition of the implant, trochanter projections, local bursitis and pain, and also can affect the transfer of stress and lead to the unequal length of limb. With the advent of multi-slice spiral CT, the development of an individualized prosthesis became realistic. High accuracy of CT provides a reliable basis for designing the individual prostheses. In this study, the three-dimensional reconstruction of CT images was performed. After the osteotomy plane was initially determined on MRI, the detailed morphological parameters were measured on MPR othorgonal planes. The prosthesis was accordingly designed. This combined use of MRI and CT measurement provided high precision for the fit of the prosthesis and excellent functional results.[@b25-rado-46-03-189] Conclusions =========== Preoperative evaluation and planning, meticulous surgical technique, and adequate postoperative management are essential for the bone tumour management. In the present study, MRI was found to be superior to CT for determining the tumour extension; the combined use of MRI and CT measurement provided high precision for the fit of the prosthesis and excellent functional results. ![CT and MRI determining of tumour extension. A male, 31-year-old patient with chondrosarcoma in the proximal femur. Coronal MPR image (1), Volume rendering image (2) fat-suppressed coronal T1-weighted image (3) and T1-weighted image (4) showed the tumour in the proximal femur. Distance from the rotation centre of femoral head to the tumour margin in orthogonal coronal CT image and coronal T2-weigthted image was 4.2 10.0 cm respectively. The tumour boundary as determined by MRI and CT were in line c and h respectively. Line a, b, d and e represent the plane 1cm, 2cm around tumour and 1cm, 2 cm to the normal tissue distant from the plane determined by CT. Line f, g, i and j were the plane 1cm, 2cm around tumour and 1cm, 2cm to the normal tissue distant from the plane determined by MRI respectively. A-J are corresponding histologic images (HE, ×200) of line a-j. There was no tumour cells found on the plane h, i, j (Figures H, I, J).](rado-46-03-189f1){#f1-rado-46-03-189} ![CT and MRI determining of tumour extension. A female, 19-year-old patient with osteosarcoma in the distal femur. Coronal MPR image (1), volume rendering CT image (2), coronal enhanced T1-weighted image (3) and fat-suppressed T2-weighted image (4) showed the tumour in the proximal femur. Distance from the gap of the knee to the tumour margin in orthogonal coronal CT image and on orthogonal coronal T2-weigthed image was respectively 7.2 cm and 8.4 cm. The boundary of tumour as determined by MRI and CT were shown in line c and f respectively. Line i, h, d and b were the plane 1cm, 2cm around tumour and 1cm, 2cm to the normal tissue as determined by CT respectively. Line g, e and a were the plane 1cm, 2cm around tumour and 1cm to the normal tissue as determined by MRI. A--J are corresponding histologic images (HE, ×200) of line a--j. No tumour cells were found on the plane a, b, c (Figures A, B, C).](rado-46-03-189f2){#f2-rado-46-03-189} ![Postoperative assessment of prosthesis. A female, 19-year-old patient with osteosarcoma in the distal femur. Preoperative anterior-posterior plain film (A) and postoperative anterior-posterior plain film (B) reveal that the length and alignment were accurate after reconstruction. The red line showed the alignment of lower limb.](rado-46-03-189f3){#f3-rado-46-03-189} ![Postoperative assessment of prosthesis. A male, 31-year-old patient with chondrosarcoma in the proximal femur. Preoperative volume rendering images (A) and postoperative anterior-posterior plain film (B) demonstrate that the length and offset were accurately reconstructed.](rado-46-03-189f4){#f4-rado-46-03-189} ###### Lesion features in six patients NO. Primary tumor Sex Age(y) Tumor characteristics Tumor edge disparity between CT and MR(cm) --------- ------------------- --------- ------------ --------------------------- ------------------------------------------------ ------ ----- 1 Osteosarcoma M 20 Proximal Femur 6.5 6.0 0.5 2 Chondrosarcoma F 29 Proximal Femur 7.1 5.5 1.6 3 Osteosarcoma F 21 Distal Femur 15.5 13.3 2.2 4 Chondrosarcoma M 31 Proximal Femur 10.0 4.2 5.8 5 Osteosarcoma F 19 Proximal Femur 8.5 7.0 1.5 6 Osteosarcoma F 52 Distal Femur 9.0 7.6 1.4 7 Osteosarcoma M 41 Distal Femur 12.9 11.0 1.9 8 Osteosarcoma F 22 Proximal humerus 14.2 12.3 1.9 9 Osteosarcoma M 22 Proximal humerus 13.0 11.5 1.5 measured on MRI; measured on CT imaging. ###### Functional evaluation according to the 30-point functional classification system of the Musculoskeletal Tumour Society Classification(points) Patients Score -------------------------- ---------------------------- -------------------- -------------------------- -------------- ---------------------------------------- ---------------------------------------- --------- Pain None Intermediate Modest Intermediate Moderate Severe 4.5±0.7 Emotional Acceptance Enthusiastic Intermediate Satisfied Intermediate Accepts Dislikes 4.4±0.5 Function NO Restriction Intermediate Recreational Restriction Intermediate Partial Disability Total Disability 4.6±0.5 Supports None Intermediate Brace Intermediate One cane, One crutch Two canes, two crutches 3.8±0.5 Walking Ability Unlimited Intermediate Limited Intermediate Inside only Unable 4.3±0.7 Gait Normal Intermediate Minor Cosmetic problem Intermediate Major cosmetic problem. Minor handicap Major cosmetic problem. Major handicap 3.7±1.0 The score of postoperative functional evaluation was given as the mean and the standard deviation, which showed that excellent or good function was achieved in all patients. ###### Accuracy of CT and MRI for determining the tumour extension Tumor margin on CT Tumor margin on MRI Position from tumor margins on CT Position from tumor margins on MRI --------------------------------------------------------------- ------------------------ ------------------------- --------------------------------------- ---------------------------------------- --- --- --- --- --- --- Positive result determined by histopathologic examination 9 7 1 9 9 9 0 1 9 9 Negative result determined by histopathologic examination 0 2 8 0 0 0 9 7 0 0 The specimens were collected from 1cm, 2cm proximal to the tumours and 1cm, 2cm distal as determined by MRI and CT and were examined for histopathology (which were simplified to 1cm, 2cm, −1cm, −2cm respectively). In 9 cases, which were underestimated by CT, positive result of histopathology was determined on 1-cm-point which was distal from CT-determined boundary. In 2 cases, which were overestimated by MRI, negative result of histopathology was determined on MR-determined boundary (overestimate). ###### Preoperative and postoperative measurements of leg length and offset No. Contraleral side Preoperative planning Postoperative measurement Disparity between preoperative and postoperative measurement --------- ---------------------- --------------------------- ------------------------------- ------------------------------------------------------------------ ------ ----- ----- ----- 1 39.2 4.1 38.7 4.2 39.4 4.0 0.7 0.2 2 36.0 4.0 37.1 4.2 36.6 4.4 0.5 0.2 3 38.0 3.6 38.0 3.6 38.0 3.6 0.5 0 4 37.3 3.4 37.0 3.4 36.5 3.2 0.5 0.2 5 36.5 3.5 36.0 3.6 35.5 4.0 0.5 0.4 6 37.5 3.7 37.0 3.7 37.2 3.7 0.2 0 7 37.9 3.9 37.7 3.9 37.4 3.9 0.3 0 [^1]: Jie Xu and Jun Shen contrebuted equally to this work. [^2]: Disclosure: No potential conflicts of interest were disclosed.	{ "pile_set_name": "PubMed Central" }
Small bowel malignant lymphoma complicating celiac sprue and the mesenteric lymph node cavitation syndrome. Malignant small intestinal lymphoma may complicate or antedate clinical recognition of celiac sprue. However, histologic diagnosis of lymphoma is made especially difficult in the presence of small bowel ulceration. A 70-yr-old man with celiac sprue and a history of dermatitis herpetiformis was initially seen for recurrent diarrhea; panmalabsorption with steatorrhea and protein-losing enteropathy were documented. Subsequent studies showed ectopic gastric mucosa in the small bowel, hyposplenism with mesenteric lymph node cavitation, and small bowel erosions and ulceration. Despite strong clinical suspicion for more than 2 yr, only 1 of 88 small bowel biopsy specimens was positive for lymphoma. At autopsy, shortly after histologic diagnosis of lymphoma, extensive small bowel involvement and infiltration were observed. This is the first report of lymphoma complicating the recently described nonneoplastic lymphoreticular syndrome associated with celiac sprue characterized by splenic atrophy and mesenteric lymph node cavitation.	{ "pile_set_name": "PubMed Abstracts" }
WASHINGTON -- The IRS said Friday that the number of taxpayers whose tax information may have been stolen by computer hackers now exceeds 700,000 - more than double the agency's previous estimate. The tax collecting agency said 390,000 more taxpayer accounts may have been compromised than the 334,000 it warned about a year and a half ago. The breach was first discovered in May 2015, and the increase first reported by The Wall Street Journal. The sensitive information can be used for identity theft or to claim fraudulent tax refunds. The thieves accessed a system called "Get Transcript," where taxpayers can get tax returns and other filings from previous years. In order to access the information, the thieves cleared a security screen that required knowledge about the taxpayer. Get Breaking News Delivered to Your Inbox The IRS says it is immediately moving to notify taxpayers, offering identity theft protection services and giving them access to a program that assigns them special ID numbers that they must use to file their tax returns. "The IRS is committed to protecting taxpayers on multiple fronts against tax-related identity theft," said IRS Commissioner John Koskinen. "We are moving quickly to help these taxpayers." In addition, hackers have tried to access almost 600,000 additional IRS accounts in an attempt to gain private information on taxpayers. The IRS has earlier said that agency investigators believe the identity thieves are part of a sophisticated criminal operation based in Russia.	{ "pile_set_name": "OpenWebText2" }
Jacob et Wilhelm Grimm Contes J'ai lu Librio Flammarion Dépôt légal : juin 2015 © E.J.L., 2015 pour le supplément pédagogique ISBN numérique : 9782290117965 ISBN du pdf web : 9782290117972 Le livre a été imprimé sous les références : ISBN : 9782290112465 Ce document numérique a été réalisé par PCA Présentation de l'éditeur : Il était une fois un meunier, un gentil garçon, une fille paresseuse ; il était une fois un soldat, un maître sorcier, une adorable fillette que tout le monde aimait ; un bûcheron pauvre et ses deux enfants ; un roi, une reine et leur fille unique ; une jeune fille aux souliers rouges : il était une fois de merveilleux contes issus des récits poétiques de la culture allemande. Ce recueil rassemble les plus célèbres contes des frères Grimm, parmi lesquels La Belle au Bois Dormant, Jeannot et Margot, Cendrillon, Le Petit Chaperon rouge, Le Voyage du Petit-Poucet, Le Fiancé brigand, Le Conte du crapaud. Couverture : Le Petit Chaperon rouge s'arrête pour cueillir des fleurs. Illustration par John HASSAL (1868-1948 ) © Collection Grob/Kharbine Tapabor Biographie de l'auteur : Jacob (1785 - 1863) et Wilhelm Grimm (1786 - 1859) Écrivains et philologues allemands, les deux frères rassemblèrent et publièrent les contes et légendes germaniques, transformant ainsi une tradition orale en oeuvre immortelle. DANS LA MÊME COLLECTION _Les Éparges_ , Librio no 1130 _La Peine de mort_ , Librio no 1129 _Un humaniste, et autres nouvelles à chute_ , Librio no 1128 _La Parure_ , Librio no 1104 _Alcools,_ Librio no 1094 _Le Tour du monde en 80 jours_ , no 1059 _Le Silence blanc_ , Librio no 856 _Médée_ , Librio no 527 _Phèdre_ , Librio no 301 _L'Odyssée_ , Librio no 300 _Le Chat noir_ , Librio no 213 _L'Ingénu_ , Librio no 180 _Pierre et Jean_ , Librio no 151 _L'Étrange Cas du Dr Jekyll et Mr. Hyde_ , Librio no 113 _Orphée_ , Librio no 75 _Le Dernier Jour d'un condamné_ , Librio no 70 _La Princesse de Clèves_ , Librio no 57 _Candide_ , no 31 _Boule de Suif_ , Librio no 27 _Le Cid_ , Librio no 21 _Le Bateau ivre_ , Librio no 18 _Roméo et Juliette_ , Librio no 9 # Blanche-Neige Il était une fois, en plein hiver, quand les flocons descendaient du ciel comme des plumes et du duvet, une reine qui était assise et cousait devant une fenêtre qui avait un encadrement de bois d'ébène, noir et profond. Et tandis qu'elle cousait négligemment tout en regardant la belle neige au-dehors, la reine se piqua le doigt avec son aiguille et trois petites gouttes de sang tombèrent sur la neige. C'était si beau, ce rouge sur la neige, qu'en le voyant la reine songea : « Oh ! si je pouvais avoir un enfant aussi blanc que la neige, aussi vermeil que le sang et aussi noir de cheveux que l'ébène de cette fenêtre ! » Bientôt après, elle eut une petite fille qui était blanche comme la neige, vermeille comme le sang et noire de cheveux comme le bois d'ébène, et Blanche-Neige fut son nom à cause de cela. Mais la reine mourut en la mettant au monde. Au bout d'un an, le roi prit une autre femme qui était très belle, mais si fière et si orgueilleuse de sa beauté qu'elle ne pouvait supporter qu'une autre la surpassât. Elle possédait un miroir magique avec lequel elle parlait quand elle allait s'y contempler : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Qui est la femme la plus belle ?_ Et le miroir lui répondait : _Vous êtes la plus belle du pays, Madame_. Alors la reine était contente, car elle savait que le miroir disait la vérité. Blanche-Neige cependant grandissait peu à peu et devenait toujours plus belle ; et quand elle eut sept ans, elle était belle comme le jour et bien plus belle que la reine elle-même. Et quand la reine, un jour, questionna son miroir : _Miroir, gentil miroir, dis-moi, dans le royaume Quelle est de toutes la plus belle ?_ Le miroir répondit : _Dame la reine, ici vous êtes la plus belle,_ _Mais Blanche-Neige l'est mille fois plus que vous_. La reine sursauta et devint jaune, puis verte de jalousie ; à partir de cette heure-là, elle ne pouvait plus voir Blanche-Neige sans que le cœur lui chavirât dans la poitrine tant elle la haïssait. L'orgueil poussa dans son cœur, avec la jalousie, comme pousse la mauvaise herbe, ne lui laissant aucun repos ni de jour, ni de nuit. Elle appela un chasseur et lui dit : « Tu vas prendre l'enfant et l'emmener au loin dans la forêt : je ne veux plus la voir devant mes yeux. Tu la tueras et tu me rapporteras son foie et ses poumons en témoignage. » Le chasseur obéit et emmena l'enfant ; mais quand il tira son couteau de chasse pour le plonger dans le cœur innocent de Blanche-Neige, elle se mit à pleurer et lui dit : — Oh ! laisse-moi la vie sauve, mon bon chasseur : je m'enfuirai à travers bois et ne reparaîtrai jamais ! Elle était si belle que le chasseur s'apitoya et lui dit : « Sauve-toi, ma pauvre petite ! » Il était certain, au-dedans de lui-même, que les bêtes sauvages auraient tôt fait de la dévorer ; mais il n'en avait pas moins le cœur soulagé d'un gros poids en évitant ainsi de la tuer de sa main ; et comme un marcassin passait par là, il l'abattit et le dépouilla, rapportant son foie et ses poumons à la reine, en guise de preuve. Il fallut que le cuisinier les mît au sel et les fît cuire, après quoi la mauvaise femme les mangea, croyant se repaître du foie et des poumons de Blanche-Neige. Dans la vaste forêt, la malheureuse fillette était désespérément seule et tellement apeurée qu'elle regardait, pour ainsi dire, derrière chaque feuille sur les arbres, ne sachant que faire ni que devenir. Elle commença à courir, s'écorchant aux épines et sur les pierres pointues, voyant sauter devant elle les bêtes sauvages qui venaient la frôler, mais qui ne lui faisaient pas de mal. Tant que ses petits pieds voulurent bien la porter, elle courut ainsi droit devant elle, et quand tomba la nuit, n'en pouvant plus, elle eut la chance de voir une toute petite maison où elle entra pour se reposer. Tout était petit dans cette maison en miniature, mais si propre et si charmant que c'est impossible de le dire. Il y avait une petite table qui était déjà mise, avec sa nappe blanche et sept petites assiettes ayant chacune son couvert : le petit couteau, la petite cuillère, la petite fourchette et le petit gobelet. Sept petits lits s'alignaient côte à côte le long du mur, bien faits, et tous avec de beaux draps blancs et frais. Blanche-Neige avait si grand-faim et si terriblement soif qu'elle prit et mangea un petit peu dans chaque petite assiette, puis but une gorgée de vin dans chaque petit gobelet ; à chaque place aussi, elle avait pris une bouchée de pain. Après, comme elle était si fatiguée, elle voulut se coucher, mais aucun des petits lits n'était à sa taille : celui-ci était trop long, celui-là trop court, un autre trop étroit ; bref, elle les essaya tous, et le septième enfin lui alla parfaitement. Elle y resta couchée, fit sa prière et s'endormit. Les maîtres du petit logis ne rentrèrent chez eux que lorsqu'il faisait déjà nuit noire, et c'étaient les sept nains qui piochent et creusent les montagnes pour trouver les filons de minerai. Ils allumèrent leurs petites bougies et s'aperçurent, avec la lumière, que quelqu'un était entré chez eux, parce que tout n'était pas parfaitement en ordre ni exactement comme ils l'avaient laissé en partant. — Qui s'est assis sur ma petite chaise ? demanda le premier. — Qui a mangé dans ma petite assiette ? fit le second. — Qui a pris un morceau de mon petit pain ? dit le troisième. — Qui m'a pris un peu de ma petite potée ? s'étonna le quatrième. — Qui a sali ma petite fourchette ? questionna le cinquième. — Qui s'est servi de mon petit couteau ? interrogea le sixième. — Qui a bu dans mon petit gobelet ? s'inquiéta le septième enfin. Le premier, en regardant un peu partout autour de lui, vit alors qu'il y avait un creux dans son lit et il s'exclama : « Qui s'est allongé sur mon petit lit ? » Les six autres accoururent et s'écrièrent tous, les uns après les autres : « Dans mon lit aussi quelqu'un s'est couché ! » Tous, sauf le septième, toutefois, qui arriva devant son lit et vit Blanche-Neige qui y était couchée et qui dormait. Il appela les autres qui galopèrent jusque-là et poussèrent des cris de surprise et d'admiration en levant haut leurs petits bougeoirs pour éclairer Blanche-Neige. — Ô mon Dieu ! Ô mon Dieu ! s'exclamaient-ils tous, la belle enfant ! Comme elle est mignonne ! Comme elle est jolie ! Leur joie était si grande qu'ils ne voulurent pas la réveiller et la laissèrent dormir dans le lit où elle était. Le septième nain s'en alla dormir avec ses compagnons, une heure avec chacun et la nuit fut passée. Au jour, quand Blanche-Neige se réveilla, elle eut grand-peur en voyant les sept nains ; mais ils se montrèrent très amicaux avec elle et lui demandèrent : — Comment t'appelles-tu ? — Je m'appelle Blanche-Neige, leur répondit-elle. — Comment es-tu venue dans notre maison ? Elle leur raconta que sa marâtre avait voulu la faire mourir, mais que le chasseur lui avait laissé la vie sauve et qu'elle avait couru toute la journée sans s'arrêter, jusqu'au moment qu'elle avait trouvé leur maisonnette. — Veux-tu prendre soin de notre ménage ? lui demandèrent les nains. Tu ferais la cuisine, les lits, la lessive, la couture, le tricot, et si tu tiens tout bien propre et bien en ordre, nous pourrions te garder avec nous et tu ne manquerais de rien. — Oh ! oui, de tout mon cœur ! dit Blanche-Neige. (Et elle resta avec eux.) Elle leur faisait le ménage et leur tenait la petite maison bien propre et bien en ordre, et les nains s'en allaient le matin chercher dans la montagne les minéraux et l'or ; ils ne revenaient qu'à la nuit, et il fallait alors que leur repas fût prêt. Toute la longue journée Blanche-Neige restait seule, et les gentils petits nains l'avertirent prudemment et lui dirent : « Tiens-toi bien sur tes gardes à cause de ta belle-mère : elle ne tardera pas à savoir que tu es ici. Ne laisse donc entrer personne ! » La reine, en effet, quand elle crut avoir mangé le foie et les poumons de Blanche-Neige, ne douta plus dans sa pensée d'être de nouveau la première et la plus belle du royaume. Elle s'en alla devant son miroir et lui parla : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Alors le miroir répondit : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est belle plus que vous, et mille fois au moins !_ Elle frémit, car elle savait que le miroir ne pouvait pas dire un mensonge, et elle sut ainsi que le chasseur l'avait trompée et que Blanche-Neige vivait toujours. Alors elle se mit à réfléchir et à réfléchir encore au moyen de la supprimer, car si la reine n'était pas la plus belle de tout le pays, la jalousie la dévorait et ne la laissait pas en repos. Et pour finir, quand elle eut forgé quelque chose, elle se barbouilla le visage et se rendit méconnaissable en s'habillant comme une vieille colporteuse. Accoutrée et grimée de la sorte, elle passa les sept montagnes jusque chez les sept nains et frappa à la porte en lançant le cri de la colporteuse : « De beaux articles à vendre ! Rien que du beau, je vends ! » Blanche-Neige vint regarder à la fenêtre et cria : — Bonjour, ma bonne dame, qu'est-ce que vous vendez ? — Du bel article, du bon article, répondit-elle, du lacet de toutes les couleurs ! En même temps elle en tirait un pour le montrer : un beau lacet tressé de soies multicolores. « Cette brave femme, pensa Blanche-Neige, je peux la laisser entrer ! » Elle déverrouilla et la fit entrer pour lui acheter le beau lacet multicolore qu'elle voulait mettre à son corset. — Mais mon enfant, de quoi as-tu l'air ? s'exclama la vieille. Viens ici, que je lace un peu proprement ! Blanche-Neige, sans méfiance, vint se planter devant la vieille et la laissa lui mettre le nouveau lacet ; mais la vieille passa si vite le lacet et le serra si fort que Blanche-Neige ne put plus respirer, suffoqua et tomba comme morte. — Et voilà pour la plus belle ! ricana la vieille qui sortit précipitamment. Le soir venu (mais ce n'était pas bien longtemps après) les sept nains rentrèrent à la maison : quel ne fut pas leur effroi en voyant leur chère Blanche-Neige qui gisait sur le sol, inerte et immobile comme si elle était morte ! Ils la redressèrent tout d'abord, et voyant comme elle était sanglée dans son corset, ils se hâtèrent d'en couper le lacet ; le souffle lui revint petit à petit et elle se ranima peu à peu. Lorsque les nains apprirent ce qu'il lui était arrivé, ils lui dirent : « Cette vieille colporteuse n'était nulle autre que la maudite reine. À l'avenir, garde-toi bien et ne laisse entrer nul être vivant quand nous n'y sommes pas ! » La méchante femme, de son côté, aussitôt rentrée chez elle s'en alla devant son miroir et le questionna : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Et le miroir répondit comme devant : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est plus belle que vous, et mille fois au moins !_ Son sang s'arrêta quand elle entendit ces paroles qui lui révélaient que Blanche-Neige, une fois encore, avait pu échapper à la mort. « À présent, pensa-t-elle, je vais composer quelque chose à quoi tu n'échapperas pas ! » Recourant alors aux artifices des sorcières qu'elle connaissait bien, elle fabriqua un peigne empoisonné. Ensuite elle se grima et s'habilla en vieille femme, mais avec un autre air que la fois précédente. Ainsi travestie, elle passa les sept montagnes pour aller jusque chez les sept nains, frappa à la porte et cria : — Beaux articles à vendre ! Beaux articles ! Blanche-Neige regarda dehors et cria : — Allez-vous-en plus loin ! Je ne dois laisser entrer personne dans la maison ! — Il n'est pas défendu de regarder ! répondit la fausse vieille en tirant le peigne empoisonné pour le lui faire voir à travers la fenêtre. La petite le trouva si beau qu'elle ne put pas résister et qu'elle ouvrit la porte pour acheter le peigne à cette vieille femme. — Et à présent laisse-moi faire, lui dit la vieille, je vais te peigner un peu comme il faut ! La pauvre Blanche-Neige, sans réfléchir, laissa faire la vieille, qui lui passa le peigne dans les cheveux ; mais à peine avait-elle commencé que le poison foudroya Blanche-Neige, qui tomba de tout son long et resta là, sans connaissance. — Et voilà pour toi, merveille de beauté ! ricana la vieille qui s'éloigna bien vite. Par bonheur, la nuit ne tarda pas à venir et les sept nains à rentrer. En voyant Blanche-Neige étendue sur le sol, ils pensèrent tout de suite à l'affreuse marâtre, cherchèrent ce qu'elle avait bien pu faire et trouvèrent le peigne empoisonné ; dès qu'ils l'eurent ôté de ses cheveux, Blanche-Neige revint à elle et leur raconta ce qu'il lui était arrivé. De nouveau, ils la mirent en garde et lui recommandèrent de ne jamais plus ouvrir la porte à qui que ce soit. Quant à la reine, aussitôt son retour, elle alla s'asseoir devant son miroir et demanda : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Et le miroir répondit encore comme auparavant : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est plus belle que vous, et mille fois au moins !_ Quand le miroir eut ainsi parlé, la reine trembla de rage et de fureur et s'écria : — Il faut que Blanche-Neige meure, même si je dois y laisser ma vie ! Alors elle alla s'enfermer dans une chambre secrète où personne n'entrait jamais, et là, elle confectionna un terrible poison avec lequel elle fit une pomme empoisonnée, mais alors empoisonnée ! Extérieurement, elle était très belle, bien blanche avec des joues rouges, et si appétissante que nul ne pouvait la voir sans en avoir envie ; mais une seule bouchée, et c'était la mort. Lorsque ses préparatifs furent achevés avec la pomme, la reine se brunit la figure et se costuma en paysanne, puis se rendit chez les sept nains en passant les sept montagnes. Quand elle eut frappé à la porte, Blanche-Neige passa la tête par la fenêtre et lui dit : — Je ne peux laisser entrer personne au monde : les sept nains me l'ont défendu. — Cela m'est égal, dit la paysanne, je saurai bien me débarrasser quand même de mes pommes. Tiens, je vais t'en donner une ! — Non, merci, dit Blanche-Neige. Je ne dois rien accepter non plus. — Aurais-tu peur du poison ? dit la paysanne. Regarde : je coupe la pomme en deux ; la moitié rouge, c'est pour toi, et la blanche, je la mange, moi. Parce que la pomme avait été faite si astucieusement que la moitié rouge était seule empoisonnée. Blanche-Neige avait grande envie de cette belle pomme, et quand elle vit la paysanne croquer à belles dents dans sa moitié de pomme, elle ne put pas résister et tendit le bras pour prendre l'autre moitié. Mais à peine la première bouchée fut-elle dans sa bouche qu'elle tomba morte sur le plancher. La reine l'examina avec des regards cruels et partit d'un grand éclat de rire, en s'écriant cette fois avec satisfaction : — Blanche comme neige, rouge comme sang, noire comme le bois d'ébène, ce coup-ci les nains ne pourront plus te ranimer ! Et dès qu'elle fut devant son miroir, elle le questionna : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Alors et enfin, le miroir répondit : _Vous êtes la plus belle du pays, Madame !_ Et là, son cœur envieux fut apaisé, autant que peut être apaisé un cœur envieux. Les nains, quand ils revinrent le soir à la maison, trouvèrent Blanche-Neige étendue sur le plancher ; mais cette fois elle n'avait plus de souffle et elle était vraiment morte. Ils la relevèrent ; ils cherchèrent bien partout s'ils ne trouvaient pas quelque chose d'empoisonné ; ils lui défirent son corset ; ils peignèrent ses cheveux ; ils la lavèrent avec de l'eau, puis avec du vin : mais rien de tout cela n'y fit ; morte elle était, la chère petite, et morte elle resta. Ils la couchèrent sur une civière, et tous les sept, ils restèrent à côté et la pleurèrent pendant trois jours. Puis ils pensèrent à l'enterrer ; mais elle était encore aussi fraîche que si elle eût été vivante et elle avait encore toutes ses couleurs et ses belles joues rouges. — Nous ne pouvons pas l'enfouir comme cela dans la terre noire ! dirent-ils. Alors ils lui firent faire un cercueil de verre afin qu'on pût la voir de tous les côtés, puis ils l'y couchèrent et écrivirent dessus son nom en lettres d'or, en grandes, belles lettres capitales, sous lesquelles ils écrivirent encore qu'elle était une princesse, fille de roi. Ensuite ils portèrent le cercueil au haut de la montagne ; et depuis ce moment-là il y eut toujours l'un des sept qui y resta pour la garder. Et les bêtes y venaient aussi et pleuraient Blanche-Neige : d'abord ce fut une chouette, puis un corbeau, et une colombe en dernier. Longtemps, longtemps Blanche-Neige resta là, dans son cercueil de verre, sans changer du tout ; le temps passa et passa, mais elle était toujours aussi fraîche, aussi blanche que neige, aussi vermeille que le sang, aussi noire de cheveux que l'ébène poli, et elle avait l'air de dormir. Et puis un jour, il arriva qu'un prince, qui s'était égaré dans la forêt, passa la nuit dans la maison des nains. Il vit sur la montagne le cercueil dans lequel était exposée Blanche-Neige, qu'il admira beaucoup, et il lut aussi ce qui était écrit dessus en grandes lettres d'or. Alors il dit aux nains : — Laissez-moi emporter le cercueil : je vous donnerai en échange ce que vous voudrez. — Pour tout l'or du monde, tu ne pourras nous l'acheter ! répondirent-ils. — Alors donnez-le-moi, reprit le prince, parce que je ne puis pas vivre sans admirer Blanche-Neige, et je la traiterai et la vénérerai comme ma bien-aimée, comme ce que j'ai de plus cher au monde ! Les bons nains, en entendant ses paroles, s'émurent de compassion pour lui et lui donnèrent le cercueil. Le prince le fit prendre par ses serviteurs, qui le chargèrent sur leurs épaules et l'emportèrent. Mais voilà qu'ils trébuchèrent contre une racine en le portant, et la secousse fit rendre à Blanche-Neige le morceau de pomme qui lui était resté dans le gosier. Ainsi libérée, elle ouvrit les yeux, souleva le couvercle de verre et se redressa, ayant retrouvé la vie. — Ô mon Dieu, mais où suis-je ? s'exclama-t-elle. — Tu es près de moi ! lui répondit le prince tout heureux, avant de lui raconter ce qui s'était passé. Puis il dit : — Je t'aime et tu m'es plus chère que tout au monde. Viens, accompagne-moi au château de mon père : tu seras mon épouse. Alors Blanche-Neige s'éprit de lui et elle l'accompagna, et leurs noces furent célébrées dans la magnificence et la somptuosité. Mais à ce grand mariage princier, la reine terrible et maudite marâtre de Blanche-Neige fut invitée aussi ; et quand elle se fut richement habillée et parée, elle alla devant son miroir pour lui poser sa question : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Qui est la femme la plus belle ?_ Et le miroir lui répondit : _Dame la reine, ici vous êtes la plus belle,_ _Mais la nouvelle reine est mille fois plus belle_. Un juron échappa à l'horrible femme qui fut prise d'effroi, d'un tel effroi qu'elle ne savait plus que devenir. Pour commencer, son idée fut de ne pas aller du tout aux fêtes du mariage ; mais elle ne put y tenir et il fallut qu'elle y allât, dévorée par la jalousie, pour voir cette jeune reine. Lorsqu'elle fit son entrée, elle reconnut immédiatement Blanche-Neige, et la peur qu'elle en eut la cloua sur place, sa terreur l'empêcha de bouger. Mais on lui avait déjà préparé des souliers de fer qui étaient sur le feu, à rougir : on les lui apporta avec des tenailles et on les mit devant elle, l'obligeant à s'en chausser et à danser, à danser dans ces escarpins de fer rouge jusqu'à sa mort, qui suivit bientôt. # Les Trois Fileuses Il était une fois une fille paresseuse et qui ne voulait pas filer ; sa mère avait beau dire et faire ce qu'elle voulait, elle ne parvenait à rien avec elle. À la fin, la mère perdit patience et s'emporta d'une si grande colère qu'elle battit sa fille ; et la fille poussa des cris et pleura sans retenue. La reine, qui passait justement par là, entendit ces pleurs et ces gémissements ; elle fit arrêter son carrosse, entra dans la maison et demanda à la mère pourquoi sa fille pleurait à en ameuter tout le voisinage. Honteuse d'avoir à révéler la paresse de sa fille, la femme déclara : « C'est que je n'arrive pas à lui faire lâcher son fuseau ! Elle est là qui file et qui file sans arrêt, et moi je suis pauvre et je ne puis pas lui fournir le lin. — Je n'aime rien tant que le bruit de rouet qui tourne, dit la reine, et je me plais à entendre filer. Laissez votre fille venir avec moi au château : j'ai du lin en quantité et elle pourra filer autant qu'il lui plaira. » La mère en fut bien aise dans son cœur, et la reine emmena la jeune fille. Quand elles furent au château, la reine conduisit la jeune fille à trois chambres qui, du plancher au plafond, étaient pleines du plus beau lin. « Tout le lin que tu vois là, dit la reine, tu vas me le filer à présent ; et quand tu auras fini, tu auras mon fils aîné comme mari ; si pauvre que tu sois, je n'y prendrai pas garde : ton zèle persévérant te suffira comme dot. » La jeune fille en eut froid dans le dos, car tout le lin qu'il y avait là, jamais elle ne pourrait arriver à le filer, même si elle vivait pendant trois cents ans et travaillait sans s'arrêter du matin au soir sans sauter un seul jour ! Elle n'en laissa rien voir ; mais dès qu'elle fut seule, elle se mit à pleurer et resta trois longs jours dans ses larmes, sans seulement bouger le petit doigt. Le troisième jour, la reine reparut et fut très étonnée en voyant que la jeune fille n'avait rien fait du tout ; mais la jeune fille s'excusa en prétendant que son chagrin d'être loin de chez elle et de sa mère l'avait troublée et empêchée de s'y mettre. La reine s'en contenta, mais au moment de s'en aller lui dit : « Demain, il faut que tu commences à travailler. » Dès qu'elle fut seule à nouveau, la jeune fille se demanda désespérément comment elle allait se tirer d'affaire et quel moyen elle pourrait utiliser, mais elle ne trouvait rien et, dans son angoisse, elle alla se planter à la fenêtre. Elle vit alors trois vieilles femmes qui approchaient : la première avec un pied plat, la seconde avec une lèvre qui lui tombait sur le menton, et la troisième avec un pouce comme une palette. Elles s'arrêtèrent sous la fenêtre, regardèrent vers la jeune fille et lui demandèrent ce qu'il lui manquait. Elle se plaignit de son affaire, et les femmes lui proposèrent de venir à son aide en lui disant : « Pourvu que tu nous invites à ton mariage, que tu n'aies pas honte de nous et que tu nous appelles tes cousines, et aussi que tu nous fasses asseoir à ta table, nous allons te filer ton lin et ce sera vite fait. — Volontiers et de tout cœur, répondit-elle. Venez et commencez le travail tout de suite. » Elle fit donc entrer les trois étranges femmes et leur aménagea une place libre dans la première pièce, où elles s'installèrent et se mirent aussitôt à filer. La première tirait l'étoupe et faisait tourner le rouet, la seconde mouillait le fil, et la troisième le retordait et l'égalisait avec le pouce sur la table : à chaque coup, c'était un écheveau entier qui tombait sur le sol, et du lin le plus fin filé ! Elle veilla à cacher les trois fileuses à la reine, tout en lui montrant, chaque fois qu'elle venait, la quantité de lin filé ; et la reine ne pouvait pas mettre fin à ses louanges. La première chambre vidée, ce fut le tour de la seconde, puis de la troisième, qui fut terminée en un rien de temps ; après quoi les trois femmes prirent congé de la jeune fille et lui rappelèrent en s'en allant : « N'oublie pas ce que tu nous as promis : ce sera ton bonheur. » Quand la jeune fille eut fait voir à la reine les chambres vides et les tas de lin filé, le jour des noces fut arrêté et le fiancé fut enchanté d'avoir une femme aussi active et d'une telle habileté, et il l'en félicita grandement. — J'ai trois cousines, lui dit la jeune fiancée, et comme je leur dois beaucoup, je ne voudrais pas les oublier dans mon bonheur : puis-je les inviter au mariage, et aurai-je la permission de les faire asseoir à ma table ? — Pourquoi ne le permettrions-nous pas ? répondirent la reine et son fils aîné. Lors donc que commença la fête nuptiale, les trois vieilles filles arrivèrent dans le plus bizarre accoutrement et l'épousée les accueillit en disant : « Soyez les bienvenues, mes chères cousines ! — Oh ! dit le prince à sa jeune femme, comment peux-tu avoir une aussi laide parenté ? » Puis, se tournant vers celle qui avait le pied plat, il lui demanda : — D'où vous vient un pied aussi large ? — Le rouet, lui répondit-elle, c'est le rouet. Il se tourna vers la seconde et demanda : — D'où vous vient cette lèvre qui pend ? — Le fil, répondit-elle, c'est de mouiller le fil. Il demanda à la troisième : — D'où vous vient ce pouce énorme ? — De retordre, répondit-elle, c'est de retordre le fil en l'étirant. Alors le fils aîné du roi en fut tout effrayé et déclara : — Jamais, au grand jamais, à partir d'aujourd'hui, ma belle épouse ne touchera à un rouet ! Grâce à quoi elle en fut quitte avec l'odieux filage du lin. # Chat et souris associés Un chat avait lié connaissance avec une souris et lui en avait tant dit et raconté sur l'amour immense et la grande amitié qu'il lui portait, que pour finir elle avait consenti à ce qu'ils vivent ensemble dans la même maison, où ils partageraient tous les soins et soucis du ménage. « Mais pour l'hiver, il nous faut faire provision, sinon on va souffrir la faim, affirma le chat ; toi, petite souris, tu ne peux pas te risquer à courir sans cesse de tous côtés, ou tu vas finir par tomber dans un piège ! » Le conseil étant sage, on le suivit sur l'heure en achetant, pour provision, un petit pot empli de graisse. Mais ils ne savaient pas où le ranger. Enfin, et après mûre réflexion, le chat parla : « Je ne vois pas de meilleur endroit que l'église pour le bien garder : personne n'aurait l'audace d'en enlever quelque chose ; nous irons donc le cacher là-bas, sous l'autel, et nous n'y toucherons plus tant qu'il ne nous sera pas devenu nécessaire. » Et ainsi le petit pot de graisse fut mis en sécurité. Il ne devait pourtant pas se passer beaucoup de jours avant que le chat s'y sentît poussé par l'envie, et il parla ainsi à la souris : « À propos, je voulais te dire, petite souris, ma cousine me demande comme parrain : elle a mis au monde un fiston tout blanc avec des taches rousses, et c'est moi qui dois le tenir sur les fonts baptismaux. Tu veux bien, n'est-ce pas, t'occuper seule de la maison et me laisser sortir aujourd'hui ? – Mais bien sûr, répondit la souris, vas-y, et si tu manges quelque chose de bon, pense à moi, et n'oublie pas non plus que quelques gouttes du bon vin doux des relevailles ne seraient pas pour me déplaire ! » Mais il n'y avait rien de vrai dans tout cela : le chat n'avait pas plus de cousine qu'il n'était invité comme parrain. Il s'en alla tout droit à l'église, se glissa jusqu'au pot de graisse qu'il commença à lécher, et lécha tant et si bien qu'il en ôta toute la fine graisse du dessus. Cela fait, il s'en alla se promener sur les toits de la ville, inspectant tout, puis se coucha et paressa au soleil en se pourléchant chaque fois qu'il songeait au petit pot de graisse. Ce ne fut pas avant le soir qu'il s'en revint à la maison. « Ah, te voilà ! dit la souris, tu as sûrement passé une bonne journée... » Et le chat répondit que tout avait été pour le mieux. « Et quel nom a-t-on donné à l'enfant ? demanda la souris. – "Dessus-Parti", laissa tomber le chat d'un ton sec. – "Dessus-Parti !" s'écria la souris, quel drôle de nom c'est là, vraiment étrange ! Est-ce qu'il est usuel dans votre famille ? – Et alors ? répondit le chat, il n'est pas plus mal que Chipe-miettes, comme s'appellent ceux qui t'ont baptisée. » Peu de temps après, le chat fut repris par son envie. « Il faut que tu me rendes service et que tu t'occupes seule encore de la maison, dit-il à la souris ; je suis une deuxième fois invité à être parrain, et comme l'enfant est né avec un collier blanc, je ne peux pas refuser. » La brave petite souris consentit de bonne grâce, mais le chat rampa derrière le mur d'enceinte jusqu'à l'église, et engloutit la moitié du pot. « Rien n'a plus de saveur que ce qu'on mange seul », se dit-il ; et il était bien content et satisfait de son ouvrage. Quand il rentra, la souris questionna : « Et de quel nom a-t-on baptisé cet enfant-là ? – Mivide, répondit le chat. – Mivide ! reprit la souris, mais que me dis-tu là ? De ma vie, je n'ai entendu ce nom et je parierais qu'il ne se trouve pas dans le calendrier. » Le chat ne tarda pas à se sentir de nouveau l'eau à la bouche en rêvant de la gourmandise. « Les bonnes choses vont par trois, dit-il à la souris, je dois encore être parrain ; l'enfant est complètement noir, avec seulement le bout des pattes blanches et pas un seul poil blanc sur tout le corps, ce qui n'arrive guère qu'une fois tous les deux ans. Tu me laisses sortir, n'est-ce pas ? — Dessus-Parti, Mivide, répondit la souris, quels curieux noms, en vérité, et qui me laissent toute pensive... — À toujours rester à la maison dans ta robe gris foncé à longue queue, tu te fais des idées, déclara le chat ; voilà ce qui arrive quand on reste des jours et des jours sans sortir. » La souris s'activa pendant que le chat n'était pas là, fit le ménage et mit tout en ordre dans la maison ; et le gros chat gourmand nettoya tout le pot de graisse et le laissa bien net. « Quand il ne reste rien, alors on est tranquille ! » se dit-il à lui-même, et gros et gras, et satisfait, il ne rentra à la maison qu'avec la nuit. La première question de la souris fut pour lui demander quel nom on avait donné à l'enfant. « C'est un nom qui ne te plaira guère, dit le chat : on l'a appelé Toutnet. — Toutnet ! s'écria la souris. Celui-là, c'est bien le plus problématique de tous les noms et je ne l'ai jamais vu imprimé nulle part. Toutnet, qu'est-ce que cela peut bien vouloir dire ? » Et elle hocha gravement la tête avant de se mettre en rond pour dormir. À partir de ce moment-là plus personne ne demanda au chat d'être parrain ; mais quand l'hiver fut venu et qu'on ne trouva plus rien dehors, la souris pensa à leurs provisions et dit : « Tu viens, chat ? Nous allons chercher le pot de graisse que nous avons mis en réserve et on va bien se régaler. — Oh, pour ça oui ! dit le chat, tu vas t'en régaler, et ce sera pour ta fine langue comme si tu la mettais à la fenêtre. » Ils se mirent donc en route et quand ils arrivèrent, le pot de graisse se trouvait bien à sa place, mais il était vide. « Ah ! s'exclama la souris, maintenant je comprends ce qui s'est passé et tout est clair à présent : toi, au moins, tu es un véritable ami ! Tu as tout dévoré quand tu étais le soi-disant parrain : d'abord Dessus-Parti, et ensuite Mivide, et ensuite... — Veux-tu te taire ! coupa le chat. Encore un mot et c'est toi que je croque ! » Mais la malheureuse souris avait déjà lâché le « Toutnet » qu'elle avait sur la langue et le chat, aussitôt, avait bondi sur elle, l'avait prise et avalée d'un coup. Ainsi va le monde, vois-tu. # La Belle au Bois Dormant # (ou la Princesse Fleur-d'Épine) Il y avait dans le temps un roi et une reine qui se répétaient chaque jour : « Ah ! si seulement nous avions un enfant ! » Mais ils n'en avaient toujours pas. Un jour que la reine était au bain, il advint qu'une grenouille sauta de l'eau pour s'avancer vers elle et lui parler : — Ton vœu sera exaucé, lui annonça-t-elle ; avant un an, tu mettras une fille au monde. Ce que la grenouille avait dit se produisit, et la reine donna naissance à une fille ; et l'enfant était tellement jolie que le roi ne se tenait plus de joie et fit donner une grande fête. Il ne se contenta pas d'y inviter ses parents, amis et connaissances, mais il voulut aussi que les fées y eussent part afin qu'elles fussent favorables et bienveillantes à l'enfant. On en comptait treize dans le royaume, mais comme il n'y avait que douze assiettes d'or au palais, pour leur servir le festin, il fallut en laisser une chez elle. La fête eut lieu et le festin se déroula au milieu des splendeurs, puis, quand tout finissait, les fées revêtirent l'enfant de leurs dons merveilleux : de l'une, la vertu ; de l'autre, la beauté ; de la troisième, la richesse ; et ainsi de suite pour tout ce qu'on peut souhaiter et avoir au monde. La onzième venait juste de prononcer son incantation, quand brusquement entra la treizième : celle qui n'avait pas été invitée et qui voulait se venger. Sans un salut ni seulement un regard pour personne, elle lança à voix haute sur le berceau cette parole : « La princesse, quand elle aura quinze ans, se piquera avec un fuseau et tombera morte. » Sans un mot de plus, elle fit demi-tour et quitta la chambre. Dans l'effroi général, la douzième fée, qui avait encore à prononcer son vœu, s'avança vers le berceau ; elle ne pouvait pas annuler la malédiction, mais elle pouvait en atténuer les effets, aussi prononça-t-elle : — Ce n'est pas dans la mort que sera plongée la princesse, mais dans un sommeil profond de cent années. Le roi, qui eût bien voulu préserver son enfant chérie du mauvais sort, fit ordonner que tous les fuseaux soient brûlés dans le royaume tout entier. Les dons des fées se réalisèrent pleinement chez l'enfant qui devint si belle, si vertueuse, si gracieuse et si intelligente que tous ceux qui seulement la voyaient se sentaient obligés de l'aimer. Le jour de ses quinze ans, il se trouva que le roi et la reine furent absents et que la jeune princesse resta toute seule au château, où elle se mit à errer çà et là, visitant les chambres et les galeries, les salons et les resserres selon sa fantaisie et son humeur. Sa promenade la conduisit finalement dans un très vieux donjon, dont elle gravit marche à marche l'étroit escalier tournant pour arriver devant une petite porte, tout en haut. Il y avait une vieille clé rouillée dans la serrure, et quand elle la fit tourner, la porte s'ouvrit d'un coup, lui découvrant une chambrette où se tenait une vieille femme assise, le fuseau à la main, occupée à filer son lin avec beaucoup d'ardeur. — Bonjour, petite grand-mère, lui dit la princesse, que fais-tu là ? — Je file, dit la vieille avec un bref mouvement de tête. — Et cette chose-là, qui danse si joyeusement, qu'est-ce que c'est ? fit la demoiselle en s'emparant du fuseau pour essayer de filer elle aussi. Mais elle l'avait à peine touché que l'incantation prenait son plein effet et qu'elle se piquait le doigt. Ce fut à peine si elle sentit la piqûre, car déjà elle tombait sur le lit, derrière elle, et s'y trouvait plongée dans le plus profond sommeil. Ce sommeil profond se répandit sur le château entier, à commencer par le roi et la reine qui venaient de rentrer et se trouvaient encore dans la grand-salle, où ils se mirent à dormir, et avec eux toute la cour. Alors les chevaux s'endormirent dans les écuries, et les chiens dans la cour d'entrée, et les pigeons sur le toit, et les mouches même sur le mur, et le feu lui aussi, qui cessa de flamber dans la cheminée, et qui se fit silencieux et s'endormit ; le rôti sur la broche cessa de grillotter, et le cuisinier qui allait tirer l'oreille du marmiton pour quelque bêtise, le laissa et dormit. Même le vent se coucha, et plus la moindre feuille ne bougea sur les arbres tout autour du château. Mais autour du château la broussaille épineuse se mit à croître et à grandir, à s'épaissir et à monter année après année, si bien que le château en fut d'abord tout entouré, puis complètement recouvert ; c'était à tel point qu'on ne le voyait plus du tout, non, pas même la bannière sur la plus haute tour. Et peu à peu, dans le pays, circula la légende de la belle Fleur-d'Épine endormie sous les ronces, car tel était le nom qu'on avait donné à la princesse ; et des princes y venaient de temps à autre, qui voulaient se forcer un passage à travers les buissons pour pénétrer dans le château. Mais c'était impossible parce que les buissons d'épines, comme avec des mains, se tenaient fermement ensemble, et les jeunes gens y restaient accrochés ; ils ne pouvaient plus s'en défaire et finissaient par mourir là de la plus misérable des morts. Après bien des années et encore bien des années, il arriva qu'un fils de roi passa dans le pays et entendit ce que racontait un vieillard sur ce massif d'épines, et comment il devait y avoir un château par-dessous, dans lequel une princesse d'une beauté merveilleuse, appelée Fleur-d'Épine, dormait depuis cent ans déjà ; et avec elle dormaient aussi le roi, la reine et la cour tout entière. Ce prince avait également entendu raconter par son grand-père que de nombreux fils de rois étaient déjà venus et avaient essayé de passer à travers la broussaille, mais qu'ils en étaient tous restés prisonniers, mourant là d'une affreuse mort. Le jeune prince n'en déclara pas moins : « Je n'ai pas peur : je veux y aller et voir la belle princesse Fleur-d'Épine ! » Le bon vieillard put bien le lui déconseiller tant qu'il voulut, il n'écouta rien et n'entendit rien de ce qu'on lui disait. Mais en vérité, les cent années se trouvaient justement révolues et le jour était arrivé, que la princesse devait se réveiller. Quand le prince avança vers la haute roncière, il ne trouva plus rien devant lui que de belles et grandes fleurs épanouies, qui s'écartaient d'elles-mêmes pour lui ouvrir le passage, et qui se resserraient derrière lui en refermant leur masse épaisse. Dans la cour du château, il vit les chevaux couchés dans leurs stalles comme au-dehors, les grands chiens de chasse blancs et roux, qui dormaient ; sur le toit il vit des pigeons qui avaient tous la tête sous l'aile. À l'intérieur du château, quand il entra, les mouches dormaient sur le mur ; le cuisinier, dans sa cuisine, avait toujours le bras tendu, comme s'il voulait attraper le petit marmiton, et la servante était assise avec la poule noire qu'elle allait plumer ; il pénétra dans la grand-salle du trône, où il vit toute la cour royale endormie et couchée çà et là ; et plus haut, près du trône, le roi lui-même et la reine étaient allongés. Il s'avança encore et s'en alla plus loin ; tout était si calme et si parfaitement silencieux qu'on s'entendait respirer ; et pour finir, le prince monta dans le vieux donjon, ouvrit la porte de la chambrette haute où la belle princesse Fleur-d'Épine dormait. Couchée là, elle était si merveilleusement belle qu'il ne pouvait pas en détourner ses yeux ; il se pencha sur elle et lui donna un baiser. À la caresse de ce baiser, Fleur-d'Épine ouvrit les yeux, et la belle se réveilla tout à fait, regarda le prince d'un regard tendre et amoureux. Alors ils redescendirent ensemble et quand ils furent en bas, le roi se réveilla, puis la reine et toute la cour sortirent de leur sommeil, et tous s'entre-regardaient avec des yeux ronds. Les chevaux dans la cour se relevèrent et s'ébrouèrent ; les chiens de chasse bondirent en frétillant de la queue ; les pigeons sur le toit tirèrent leur tête de sous l'aile, inspectèrent les environs et prirent leur vol ; les mouches recommencèrent à grimper le long des murs, cependant que le feu reprenait dans la cuisine et, flambant clair, remettait la cuisson en train ; le rôti à la broche grésilla de nouveau, et le cuisinier expédia une bonne taloche au marmiton, le faisant criailler, tandis que la servante se remettait à plumer sa volaille. Alors furent célébrées avec splendeur les noces du prince avec la belle princesse, que la légende et les gens avaient nommée Fleur-d'Épine, et ce fut le bonheur pour eux jusqu'à la fin de leurs jours. # Le Fiancé brigand Il était une fois un meunier qui avait une fille bien jolie, et lorsqu'elle fut grande, il souhaita qu'elle n'eût plus de soucis et fût bien mariée. « Si quelque prétendant convenable vient me la demander, pensait-il, je la lui donnerai. » Et peu de temps après se présenta un prétendant qui paraissait fort riche et auquel le meunier, ne voyant rien à objecter, promit sa fille. La jeune fille, par contre, ne sentait pas pour lui le vrai penchant qu'une fiancée doit avoir pour son fiancé, et elle n'avait aucune confiance en lui : elle éprouvait comme une horreur dans le fond de son cœur à chaque fois qu'elle le voyait ou seulement pensait à lui. — Tu es ma fiancée et tu ne viens même pas me faire une visite chez moi ? lui dit-il une fois. — Je ne sais pas où est votre maison, lui répondit-elle. — Au plus épais de la forêt se trouve une maison, dit le fiancé. Cherchant d'autres prétextes, elle prétendit ne pas être capable d'en trouver le chemin. Mais le fiancé coupa court et lui dit : — Il faut que tu viennes dimanche prochain, j'ai déjà fait mes invitations ; et pour que tu t'y retrouves dans la forêt, je te tracerai le chemin en y mettant des cendres. Le dimanche venu, il fallut bien qu'elle se mît en route, mais l'angoisse lui serrait la gorge sans qu'elle sût au juste pourquoi ; et comme elle voulait être sûre de pouvoir retrouver sa route, elle emporta ses pleines poches de lentilles et de petits pois. Dès qu'elle entra dans la forêt, elle suivit le chemin que marquait la cendre, mais tout en avançant, elle jetait de temps à autre, à droite et à gauche, quelques graines par terre. Elle marcha presque toute la journée pour arriver au cœur sombre de la forêt, au plus épais des bois, où se dressait une maison solitaire, qui ne lui plut pas du tout à cause de son air ténébreux et sinistre. Elle y entra, mais ne trouva personne à l'intérieur et resta là, écoutant régner le grand silence, quand soudain une voix cria : _Chez les brigands tu es entrée !_ _Va-t'en, va-t'en, la fiancée_. La jeune fille leva les yeux et vit que la voix venait d'un oiseau dans une cage suspendue au mur. Et l'oiseau de nouveau cria : _Va-t'en, va-t'en, la fiancée_ _Chez les brigands tu es entrée !_ Passant alors d'une pièce à l'autre, la jolie fiancée visita toute la maison qu'elle trouva entièrement vide et sans âme qui vive. Elle descendit même à la cave pour finir, et là, il y avait une vieille, vieille femme qui était assise et qui branlait la tête. — Pouvez-vous me dire si mon fiancé habite bien ici ? demanda la jeune fille. — Hélas, ma pauvre enfant ! dit la vieille, où t'es-tu donc fourrée ? Tu es ici dans un repaire de bandits, un coupe-gorge, une maison d'assassins. Tu croyais être une fiancée qui va bientôt fêter ses noces, mais c'est avec la mort que tu vas les fêter ! Tu vois ce grand chaudron ? Je devais le remplir et le mettre au feu quand tu serais tombée entre leurs mains, et ils t'auraient coupée en morceaux pour t'y faire cuire et te manger, parce que ce sont des ogres. Mais j'ai pitié de toi et je te sauverai ! Autrement tu étais perdue. La vieille la conduisit alors et la fit se cacher derrière un grand tonneau où l'on ne pouvait pas la voir. — Ne fais pas plus de bruit qu'une souris, lui recommanda-t-elle, ne bouge pas de là, ne fais pas le moindre mouvement, sans quoi c'en est fini de toi. Cette nuit, quand les bandits seront endormis, nous nous enfuirons toutes les deux : c'est l'occasion que j'attendais depuis longtemps. À peine était-ce dit, que déjà les bandits rentraient chez eux : toute la bande de ces scélérats qui traînaient avec eux une autre jeune fille ; ils étaient ivres et n'écoutaient ni ses cris, ni ses plaintes, ni ses gémissements. Ils lui donnèrent du vin à boire : trois verres, qu'ils la forcèrent d'absorber, un verre de rouge, un verre de blanc et un verre de jaune, qui lui fit éclater le cœur. Ils lui arrachèrent alors ses riches vêtements, la couchèrent sur une table et coupèrent son beau corps en morceaux, à coups de hache, puis salèrent les morceaux en les couvrant de gros sel. La pauvre fiancée, derrière le gros tonneau, tremblait de tous ses membres en voyant quel sort les bandits lui auraient réservé. L'un d'eux, qui venait de voir une bague d'or au doigt de la morte, voulut la prendre, mais ne réussit pas tout de suite à la faire glisser du doigt ; alors il empoigna la hache et lui trancha ce doigt d'un coup furieux qui l'envoya voler en l'air et retomber, finalement, sur les genoux de la malheureuse qui tremblait derrière le gros tonneau. Le bandit attrapa une chandelle et se mit à chercher après, mais sans rien trouver. — As-tu regardé derrière le tonneau ? lui suggéra l'un des autres bandits. Sur quoi la vieille femme leur cria à tous : — À table maintenant, venez manger ! Vous pouvez bien attendre à demain matin pour chercher : le doigt ne va pas s'envoler tout seul ! — Elle a raison ! dirent les bandits, abandonnant la recherche pour aller manger et boire. La vieille femme avait mis un somnifère dans leur vin et ils ne tardèrent pas à se coucher tous dans la cave, dormant et ronflant comme les brutes qu'ils étaient. La jeune fiancée, en entendant ces ronflements, sortit de derrière son tonneau et dut enjamber les corps serrés des dormeurs qui encombraient la cave ; elle avait terriblement peur d'en réveiller un au passage, mais grâce à Dieu, elle traversa sans dommage, et la vieille l'entraîna vivement en haut, ouvrit la porte, et elles s'enfuirent aussi vite qu'elles le pouvaient, courant presque pour s'éloigner de la maison des assassins. Le vent avait dispersé les cendres qui marquaient le chemin, mais les lentilles et les pois avaient germé et poussé, si bien qu'avec le clair de lune, elles purent le suivre sans difficulté ; et elles marchèrent toute la nuit durant pour arriver enfin au moulin avec le petit matin. La jeune fille raconta tout ce qu'il lui était advenu à son père, muet d'étonnement. Vint le jour que devaient se célébrer les noces, et le fiancé arriva. Mais le meunier n'avait pas manqué d'inviter tous ses parents et amis en grand nombre. Quand tout le monde fut à table, chacun dut raconter une histoire et tous le firent, l'un après l'autre. Mais la mariée restait assise et ne disait rien. — Eh bien, mon cœur, tu ne sais donc rien dire ? Raconte-nous aussi quelque chose ! lui dit le fiancé. — Alors je vais vous raconter un rêve, dit-elle. Je marchais seule dans une grande forêt et j'ai fini par arriver à une étrange maison où il n'y avait personne, pas une âme de bas en haut ; mais au mur, dans une cage, il y avait un oiseau qui criait : _Chez les brigands tu es entrée !_ _Va-t'en, va-t'en, la fiancée_. « Une fois je l'entendis, et encore une autre fois, mais je ne faisais que rêver, mon chéri. Alors je suis entrée dans toutes les chambres, et toutes les chambres étaient complètement vides ; il y avait quelque chose d'affreusement sinistre dans cette maison déserte. Alors je suis descendue à la cave pour finir, et là il y avait une vieille, vieille femme à la tête branlante. Je lui ai demandé : "Est-ce que mon fiancé habite ici, dans cette maison ?" Elle m'a répondu : "Hélas ! ma pauvre enfant, tu es tombée dans un repaire de bandits. Ton fiancé habite ici, en effet, mais il va te tuer et te couper en morceaux ; et moi je devrai te faire cuire et il te mangera." C'était dans mon rêve, mon chéri, rien qu'un rêve que je faisais, tu comprends ? Alors la vieille femme m'a cachée derrière un grand tonneau pour que personne ne me voie, et j'étais à peine là, que déjà les bandits rentraient chez eux avec une malheureuse jeune fille qu'ils traînaient à leur suite. Ils lui donnèrent à boire trois sortes de vins : du rouge, du blanc et du jaune, qui lui fit éclater le cœur. C'est ce que j'ai rêvé, mon chéri, rien d'autre que mon rêve. Alors ils lui ont enlevé ses riches vêtements et ils ont coupé son beau corps en morceaux sur une table, et ils ont répandu du sel dessus. Mon chéri, c'est seulement ce que j'ai rêvé. Il y avait à son doigt une bague d'or, que l'un de ces bandits a vue et a voulu prendre, mais comme la bague ne venait pas assez vite, il lui a coupé le doigt d'un coup de hache. Mais le doigt a sauté et volé en l'air par-dessus le grand tonneau pour venir me tomber sur les genoux. « Et ce doigt avec la bague, le voici ! » conclut-elle brusquement en prenant le doigt dans sa poche pour le montrer à toute l'assistance. Le bandit, qui était devenu blanc de craie tout au long de son histoire, se leva brusquement et voulut se sauver, mais l'assistance était nombreuse et le tint bien. Ils l'immobilisèrent et le livrèrent à la justice. Et ce fut ainsi qu'il finit avec toute sa bande, jugé et condamné pour tous les crimes commis. # Jeannot et Margot Tout près d'une grande forêt vivaient un pauvre bûcheron, sa femme et leurs deux enfants : un garçon qui s'appelait Jeannot, et une fillette qui se nommait Margot. Le bûcheron gagnait si peu qu'il n'avait presque rien à leur donner à manger d'ordinaire, mais lorsqu'il y eut la famine dans la contrée, ce fut même le pain quotidien qui manqua. Un soir qu'il ne pouvait dormir à cause de ses soucis et qu'il se retournait dans son lit en soupirant à cause de ses tristes pensées, il dit à sa femme : « Qu'allons-nous devenir ? Et comment pourrions-nous faire manger nos enfants quand nous n'avons rien à manger nous-mêmes ? — Sais-tu quoi, mon homme ? Demain matin, de très bonne heure, nous emmènerons les enfants dans la forêt, là où elle est le plus épaisse. Nous leur préparerons un feu là-bas, et nous leur donnerons encore à chacun un dernier petit bout de pain, puis nous irons à notre travail et nous les laisserons seuls. Ils ne retrouveront plus le chemin de la maison et nous en serons débarrassés. — Non, femme, je ne peux pas faire cela ! dit-il. Comment prendrais-je sur mon cœur de laisser mes enfants tout seuls dans la forêt, avec les bêtes sauvages qui ne tarderaient pas à venir les dévorer ? — Idiot que tu es ! dit la femme. Nous allons donc mourir de faim tous les quatre, et il ne te reste plus qu'à raboter les planches pour nos cercueils ! » Sans lui laisser ni trêve ni repos, elle continua et insista jusqu'à ce qu'il eût consenti. — Mais quand même, dit l'homme, ces pauvres enfants me font regret. Les deux enfants, qui ne pouvaient pas dormir à cause de la faim, avaient tout entendu de ce que la marâtre avait dit à leur père. Margot, en pleurant des larmes amères, dit à Jeannot : « À présent, c'en est fini de nous ! — Console-toi, Margot, ne te mets pas en peine, dit Jeannot : j'aurai tôt fait de nous tirer de là. » Et quand les parents furent endormis, il se glissa à bas du lit, enfila sa petite veste, courut jusqu'à la porte-coupée, dont il ouvrit le bas, et passa dehors. C'était en plein clair de lune et le gravier, devant la maison, faisait luire ses petits cailloux comme autant de sous neufs. Jeannot se baissa et en ramassa tant qu'il put en mettre dans ses petites poches ; puis il rentra et dit à Margot : « Tranquillise-toi, ma chère petite sœur, tu peux dormir en paix et avoir confiance : Dieu ne nous abandonnera pas. » Puis il se remit au lit. À la pointe du jour, bien avant le lever du soleil, la femme s'en venait réveiller les deux enfants : « Debout ! Debout, paresseux, leur dit-elle, nous allons dans la forêt pour y faire du bois. » Ensuite elle leur donna à chacun un petit bout de pain en leur disant : « Comme cela, vous aurez un petit quelque chose pour midi ; mais ne le mangez pas avant, parce qu'il n'y aura rien d'autre. » Margot serra le pain sous son tablier puisque Jeannot avait les cailloux dans ses poches ; et en route pour la forêt. Après un petit bout de chemin, Jeannot s'arrêta et se retourna pour jeter un coup d'œil du côté de la maison, puis encore un peu plus loin, et encore, et encore il recommençait la même chose. — Qu'est-ce que tu as à toujours regarder et traîner en arrière ? lui dit son père. Tâche de faire attention et n'oublie pas de faire marcher tes jambes ! — Oh ! père, c'est mon petit chat blanc que je regardais : il est monté sur le toit et veut me dire adieu. — Idiot, dit la femme, ce n'est pas ton chat : c'est le soleil levant qui luit sur la cheminée ! Mais Jeannot n'avait ni regardé, ni vu son petit chat ; il avait seulement tiré chaque fois un petit caillou blanc de sa poche pour le jeter sur le chemin. Lorsqu'ils furent arrivés au beau milieu de la forêt, le père dit : « À présent, les enfants, vous allez me ramasser du bois : je vais vous faire un feu pour que vous n'ayez pas froid. » Jeannot et Margot rapportèrent du bois mort et en firent tous les deux une petite montagne. Le feu fut allumé, et quand la flamme fut bien haute, la femme dit : « Vous, les enfants, couchez-vous près du feu et reposez-vous pendant que nous allons plus loin faire du bois. Nous viendrons vous chercher quand nous aurons fini. » Jeannot et Margot se tinrent sagement près du feu, et quand ce fut midi, chacun mangea son petit bout de pain. Ils croyaient que leur père n'était pas loin, parce qu'ils entendaient les coups de la cognée ; mais ce n'était pas sa hache qu'ils entendaient frapper : c'était une grosse branche qu'il avait attachée de telle sorte que le vent la fît battre çà et là. Et comme ils étaient restés là longtemps, ils eurent les yeux lourds de fatigue et ils finirent par s'endormir. Quand ils se réveillèrent, c'était déjà nuit noire. Margot commença à pleurer en disant : « Comment allons-nous faire à présent pour sortir de la forêt ? » Mais Jeannot la réconforta et lui dit : « Attends seulement que la lune se lève, ce ne sera pas long, et nous trouverons bien le chemin. » Et quand la pleine lune fut levée, Jeannot prit Margot par la main et emmena sa petite sœur en suivant le chemin tracé par les cailloux blancs, qui luisaient comme des sous neufs. Ils marchèrent toute la nuit et n'arrivèrent qu'à la pointe du jour devant la maison de leur père. Ils frappèrent à la porte et la femme vint ouvrir ; et quand elle vit que c'étaient Jeannot et Margot, elle s'écria : « Méchants enfants ! Dormir si longtemps dans la forêt, en voilà des façons ! Nous avons cru que vous vouliez ne plus jamais revenir. » Le père, par contre, se réjouit de les revoir, car son cœur lui pesait de les avoir laissés comme cela, tout seuls. Mais au bout de très peu de temps ce fut de nouveau la misère chez eux, et le besoin était dans tous les coins ; et de nouveau les enfants entendirent leur mère qui parlait avec leur père et qui lui disait : « Voilà que tout est encore mangé : une demi-miche de pain, c'est tout ce qu'il nous reste, et après c'est fini la musique. Il faut expédier les enfants, mais cette fois nous les mènerons bien plus profond dans la forêt pour qu'ils n'arrivent pas à retrouver le chemin ; autrement, pas de salut pour nous. » L'homme se sentit un gros poids sur le cœur et pensa : « Mieux vaudrait partager avec les enfants ta dernière bouchée ! » Sa femme ne voulut rien entendre de ce qu'il pouvait dire ; elle le rabroua, au contraire, le houspilla et l'accabla de reproches. Qui a dit A doit aussi dire B, et puisqu'il avait consenti la première fois, il fallut bien qu'il cédât la seconde aussi. Mais les enfants ne dormaient pas non plus, et ils avaient surpris tout le dialogue. Aussi Jeannot se leva-t-il quand les vieux se furent endormis, comme la fois d'avant, voulant se glisser dehors. Mais cette fois la mère avait fermé les deux parties de la porte et il ne put sortir. Néanmoins, il réconforta sa petite sœur et lui dit : « Ne t'inquiète pas, Margot, tu n'as pas besoin de pleurer et tu peux dormir tranquille : Dieu nous assistera encore. » Au petit matin, la femme vint tirer les enfants du lit, mais le petit bout de pain qu'ils reçurent était encore un plus petit bout que l'autre fois. En route vers la forêt, Jeannot l'émietta dans sa poche et s'arrêta de temps à autre pour en jeter une miette sur le chemin. — Jeannot, qu'est-ce que tu restes en arrière à regarder n'importe quoi ? gronda le père. Allons, avance ! — C'est mon petit pigeon blanc que je regardais, dit Jeannot : il est perché sur le toit et veut me dire adieu. — Idiot, ce n'est pas ton petit pigeon, dit la femme : c'est le soleil levant qui luit sur la cheminée ! Ce qui n'empêcha pas le garçon de jeter de place en place toutes les miettes de son pain sur le chemin. La femme emmena les enfants bien plus au cœur de la forêt, dans un endroit qu'ils n'avaient jamais vu de leur vie. Un grand feu fut préparé de nouveau et la mère leur dit : « Restez là, les enfants, et quand vous serez fatigués, vous n'aurez qu'à dormir un peu : nous allons faire du bois un peu plus loin et ce soir, quand nous aurons fini, nous viendrons vous chercher. » Lorsque ce fut midi, Margot partagea son peu de pain avec Jeannot, puisqu'il avait semé son morceau miette par miette tout le long du chemin. Après, les enfants s'endormirent et le temps passa ; l'après-midi s'écoula, puis le soir, mais personne ne revint près des pauvres petits. Quand ils se réveillèrent enfin, c'était déjà nuit noire, et Jeannot consola sa petite sœur en lui disant : « Attends seulement que la lune se lève, Margot, alors nous pourrons voir les miettes que j'ai répandues et qui nous montreront le chemin jusqu'à la maison. » La lune monta et ils se levèrent, mais ils ne trouvèrent plus une seule miette de pain nulle part, car les milliers de becs des milliers d'oiseaux qui volent tout partout, dans la forêt ou la campagne, les avaient avalées. « Nous trouverons bien notre chemin quand même, va ! » dit Jeannot à Margot. Mais ils ne le trouvèrent pas. Ils marchèrent toute la nuit et encore toute la journée du matin jusqu'au soir, mais ils n'étaient toujours pas sortis de la grande forêt ; et comme ils n'avaient rien mangé que quelques rares petits fruits qu'ils avaient pu trouver par terre, quelle faim ils avaient ! Ils étaient tellement fatigués que leurs jambes ne voulaient plus les porter. Alors ils se laissèrent tomber au pied d'un arbre et s'y endormirent. Le matin fut vite là, et c'était déjà leur troisième journée loin de la maison paternelle. Ils se remirent en marche, mais ce fut pour s'enfoncer toujours plus profondément dans la forêt ; s'il ne leur venait pas un prompt secours, ils allaient infailliblement mourir d'épuisement. Or, vers midi, ils aperçurent sur une branche un bel oiseau blanc comme neige, et il chantait si joliment qu'ils s'arrêtèrent pour l'écouter. Son chant fini, l'oiseau ouvrit ses ailes et voleta devant eux, et ils le suivirent jusqu'auprès d'une maisonnette, sur le toit de laquelle il alla se poser. En approchant encore, ils virent que la maisonnette avait des murs de pain d'épice et un toit de biscuit ; quant aux fenêtres, elles étaient de sucre filé. — Nous allons croquer dedans, que c'en est une bénédiction ! Moi je mange un bout de toit, dit Jeannot, et toi, Margot, tu peux manger de la fenêtre, c'est tout sucré. Il se mit sur la pointe des pieds pour atteindre le toit, et s'en cassa d'abord un petit bout pour voir si c'était bon, tandis que Margot s'agrippait à la fenêtre et se mettait à en grignoter. Alors une douce voix sortit de l'intérieur : _Et j'te grignote et grignotons,_ _Qui me grignote ma maison ?_ Tranquillement, les enfants répondirent : _C'est le vent, c'est le vent,_ _C'est le céleste enfant._ Et ils continuèrent à manger sans se laisser troubler ni déranger. Jeannot, qui avait trouvé le toit fort à son goût, s'en cassa du coup un bon morceau, et Margot, de son côté, avait ôté de la fenêtre toute une belle vitre ronde, s'était assise par terre et s'en régalait tout son soûl. Mais voilà que la porte s'ouvre d'un coup, et qu'une vieille encore plus vieille que les pierres s'avance à petits pas dehors, en béquillant sur sa béquille. Jeannot et Margot en furent si violemment épouvantés qu'ils en laissèrent tomber ce qu'ils avaient dans les mains. Mais la vieille branla tête et dit : « Hé, hé ! mes chers enfants, qui vous a amenés ici ? Mais entrez donc, voyons ! et restez chez moi, il ne vous arrivera rien de mal. » Elle les prit par la main tous les deux et les conduisit dans sa maisonnette. Là, ils eurent devant eux de bonnes choses à manger, du lait et des crêpes au sucre, des pommes et des noix ; puis ils eurent deux beaux petits lits blancs pour se coucher, et ils se crurent au ciel. Mais si la vieille avait été si aimable, c'était seulement pour faire semblant : en réalité c'était une méchante sorcière qui guettait les enfants, et c'était justement pour les attirer qu'elle avait construit sa maisonnette de pain d'épices. Une fois qu'ils étaient en son pouvoir, elle les tuait, les faisait cuire et les mangeait, ce qui était pour elle un jour de fête. Les sorcières ont les yeux rouges et la vue si basse qu'elles n'y voient que de tout près ; mais elles ont une espèce de flair, comme les animaux, et elles savent très bien quand on approche d'elles. Ainsi quand Jeannot et Margot arrivèrent dans les environs, elle avait ricané méchamment et dit en se réjouissant d'avance : « Je les tiens, ceux-là, ils ne m'échapperont plus ! » Le lendemain matin, très tôt, elle se leva avant le réveil des enfants, et quand elle les vit dormir si gentiment, avec leurs bonnes joues rouges, elle se chuchota à elle-même : « Un fameux morceau que je vais avoir là ! » Alors elle empoigna Jeannot de ses mains sèches et le porta dans une petite remise où elle l'enferma derrière une porte grillée : il pouvait bien crier tant qu'il voulait, cela ne servait à rien. Ensuite elle revint secouer Margot pour la réveiller, et elle lui cria : « Debout, paresseuse, puise de l'eau et fais cuire quelque chose de bon pour ton frère qui est là-bas, dans la remise, où il faut qu'il engraisse. Parce que dès qu'il sera assez dodu, je le mangerai. » Et Margot eut beau pleurer très amèrement, cela ne servit à rien et rien n'y fit : elle dut faire ce que la méchante sorcière voulait. Dès lors, pour le malheureux Jeannot, fut préparée la meilleure cuisine ; Margot, par contre, n'avait rien que les os à sucer, ou la carapace des écrevisses. Chaque matin, la vieille se traînait jusqu'à la petite remise et criait : « Jeannot, passe-moi tes doigts dehors, que je tâte pour savoir si tu seras bientôt assez gras. » Mais Jeannot lui tendait un petit os, et la vieille, avec sa vue trouble, ne voyait rien et croyait que c'était son doigt, s'étonnant qu'il ne voulût toujours pas engraisser. Au bout de quatre semaines, comme il était toujours aussi maigre, la vieille s'impatienta et ne voulut pas attendre plus longtemps. — Holà, Margot ! cria-t-elle à la fillette, tâche de ne pas traîner et apporte de l'eau ! Maigre ou gras, le Jeannot, je le tue demain pour le faire cuire. Ah ! comme elle se désola, la pauvre petite sœur, quand elle dut porter de l'eau ! Et comme elles ruisselaient, les larmes, tout le long de ses joues ! « Mon Dieu, mon Dieu, gémissait-elle, viens donc à notre secours ! Si seulement les bêtes sauvages dans la forêt nous avaient dévorés, au moins nous serions morts ensemble ! — Épargne-moi tes piailleries, dit la vieille, cela ne sert à rien du tout. » Le lendemain, de très bonne heure, Margot fut dehors et dut suspendre le chaudron rempli d'eau et allumer le feu dessous. « Avant tout, dit la vieille, nous allons faire cuire le pain : j'ai déjà fait chauffer le four et la pâte est pétrie. » Et elle poussa la malheureuse Margot devant l'entrée du four, où l'on voyait déjà sortir les flammes du grand feu qui brûlait. « Faufile-toi dedans, dit la sorcière, et vois un peu si c'est assez chaud pour qu'on enfourne le pain. » Oui, et quand Margot serait dedans, elle fermerait la porte sur elle et pousserait encore le feu pour qu'elle y rôtisse, et alors elle la mangerait aussi. Mais Margot avait compris ce qu'elle avait dans l'idée, et elle dit : « Je ne sais pas comment m'y prendre pour entrer là-dedans. Que faut-il faire ? — Stupide dinde ! s'exclama la vieille, l'ouverture est bien assez grande ! Regarde : je pourrais moi-même y passer ! » Et en même temps, elle s'accroupissait devant le four et s'y poussait à petits coups pour y engager la tête. Alors Margot la poussa un grand coup pour la faire basculer dedans, ferma la porte de fer et bloqua le gros verrou. Houla ! quels hurlements affreux elle se mit à pousser là-dedans ! Mais Margot s'éloigna de toute la vitesse de ses petites jambes et il fallut bien que la maudite sorcière brûlât et pérît misérablement. Margot s'était précipitée directement vers Jeannot, ouvrant bien vite la petite remise en lui criant : « Jeannot, nous sommes libres ! La vieille sorcière est morte ! » Tel un oiseau hors de sa cage, il était sorti dès que la porte s'était ouverte ; et quelle joie pour eux ! et comme ils tombèrent dans les bras l'un de l'autre, s'embrassèrent et gambadèrent comme des fous ! Maintenant qu'ils n'avaient plus rien à craindre, ils entrèrent dans la maison de la sorcière, où il y avait dans tous les coins des coffres pleins de perles et de pierres précieuses. — C'est encore mieux que les petits cailloux blancs ! remarqua Jeannot, tout en en remplissant ses poches à craquer. — Moi aussi, je veux rapporter quelque chose à la maison, dit Margot, qui en prit plein son tablier. — Mais à présent allons-nous-en, dit Jeannot, parce qu'il faut d'abord sortir de cette forêt de sorcières. Ils s'en allèrent et marchèrent pendant quelques heures, mais là, ils furent arrêtés par une large rivière. — Nous ne pouvons pas traverser, dit Jeannot : je ne vois ni pont, ni gué. — Et pas le plus petit bateau non plus, ajouta Margot. Mais je vois là un canard blanc, et si je lui demande, il va bien nous aider. _Canard blanc, canard blanc,_ _Ici Margot et Petit-Jean._ _Aucun sentier et pas de pont,_ _Porte-nous sur ton beau dos rond_. Ainsi avait-elle appelé, et le canard s'était aussi approché. Jeannot s'installa sur son dos, se tournant aussitôt pour dire à sa petite sœur de venir s'y asseoir aussi. « Non, non, dit-elle, ce serait trop lourd pour le petit canard : il faut qu'il nous porte l'un après l'autre pour traverser. » Et c'est ce que fit le brave petit canard ; et quand ils furent de l'autre côté, ils marchèrent encore un petit moment, et voilà qu'autour d'eux la forêt était de moins en moins étrangère, plus connue et toujours plus connue à mesure qu'ils avançaient, jusqu'au moment où ils aperçurent de loin la maison de leur père. Ils y coururent, entrèrent en trombe dans la chambre et se jetèrent au cou de leur père. Le pauvre homme n'avait pas eu une heure de bon temps depuis qu'il avait laissé ses enfants dans la forêt ; mais la femme était morte. En secouant son tablier, Margot fit cascader les perles et les pierres précieuses qui roulèrent de tous côtés, cependant que Jeannot les tirait par poignées de ses poches et les faisait rouler aussi. De leurs soucis, dès lors, ils ne surent plus rien ; et ils vécurent ensemble en perpétuelle joie. Mon conte est fini, trotte la souris, celui qui la prendra pourra se faire un grand bonnet, un grand bonnet de sa fourrure, et puis voilà ! # Le Conte du crapaud Il était une fois un petit garçon qui avait tous les jours, pour son goûter, une brioche et un petit bol de lait que lui donnait sa mère ; il emportait son bol et sa brioche et s'en allait manger dehors. Dès qu'il commençait à manger, le crapaud familier de la maison se glissait hors d'une fente du mur et arrivait, penchait sa petite tête dans le lait et partageait son goûter. C'était une joie pour le petit garçon ; et quand il était là avec son bol, si d'aventure le crapaud ne venait pas tout de suite, il l'appelait : _Crapaud, crapaud, petit crapaud,_ _Viens manger ton gâteau !_ _Arrive vite, s'il te plaît_ _Te régaler avec mon lait !_ Alors le crapaud trottait vite vers l'enfant et s'en donnait à cœur joie. Mais il lui montrait aussi sa gratitude en lui apportant toutes sortes de choses tirées de son trésor secret : des pierres étincelantes, des perles ou de petits jouets d'or. Seulement le crapaud ne touchait pas aux miettes de brioche et se contentait de laper le lait, alors l'enfant s'arma de sa petite cuillère et lui frappa légèrement la tête en lui disant : « Mange les miettes ! Tu dois manger les miettes aussi ! » La mère, dans sa cuisine, entendit parler son enfant et vint voir avec qui il était en conversation ; mais quand elle le vit occupé à frapper sur la tête d'un crapaud avec sa petite cuillère, elle attrapa une grosse bûche avec laquelle elle écrasa la brave petite bête. À partir de ce moment tout changea pour l'enfant : tant que le crapaud était venu manger avec lui, il grandissait en force et en généreuse santé, alors que maintenant il perdait ses belles couleurs et maigrissait de jour en jour. Il ne fallut pas longtemps pour entendre crier l'oiseau de la mort et pour voir le rouge-gorge ramasser les brindilles et les feuilles d'une couronne mortuaire ; quelques jours plus tard, l'enfant était couché dans son cercueil. C'était fini. ## Un autre conte du crapaud Une orpheline qui filait sa quenouille, assise au pied du mur d'enceinte de la ville, vit un crapaud sortir de son trou dans le mur ; vite, elle étala devant lui son foulard de soie bleue, que les crapauds aiment énormément et sur quoi ils marchent de préférence. Dès qu'il l'eut aperçu, le crapaud fit demi-tour, puis revint peu après, apportant une petite couronne d'or qu'il posa sur le foulard de soie avant de regagner son trou de nouveau. La fillette prit la couronne, qui était faite d'un délicat filigrane d'or et qui brillait merveilleusement. Le crapaud s'en revint peu de temps après, et quand il s'aperçut que la couronne n'y était plus, son désespoir fut tel qu'il alla se frapper la tête contre le mur, recommençant et recommençant jusqu'à ce qu'il eût épuisé ses forces et tombât mort. Si la fillette n'avait pas enlevé la couronne, le crapaud n'eût certainement pas manqué d'apporter bien d'autres trésors de son trou. # Cendrillon Il y avait un homme riche dont la femme était tombée malade ; et quand elle se sentit approcher de sa fin, elle appela à son chevet son unique fillette et lui dit : « Mon enfant chérie, reste toujours pieuse et bonne, et tu pourras compter sur l'aide du Bon Dieu ; et moi, du haut du ciel, je te regarderai et te protégerai. » Après ces paroles, elle ferma les yeux et mourut. Chaque jour, désormais, la fillette se rendit sur la tombe de sa mère, et chaque jour elle pleurait, s'appliquant à rester pieuse et bonne. Quand l'hiver vint, il mit un blanc manteau de neige sur la tombe ; et quand le soleil du printemps l'eut enlevé, le père prit une seconde femme. Cette femme avait amené dans la maison ses deux filles, qui étaient jolies et blanches de visage, mais vilaines et noires de cœur. Et pour la pauvre enfant du premier lit, ce fut une période affreuse qui commença. — Cette dinde idiote, est-ce qu'elle va rester avec nous ? dirent-elles. Elle n'a pas sa place au salon ! Il faut gagner son pain quand on veut le manger. Allez ouste ! Hors d'ici, la fille de cuisine ! Elles lui ôtèrent ses beaux vêtements, lui mirent un vieux tablier gris et la chaussèrent de sabots de bois, puis se moquèrent d'elle en la poussant dans la cuisine. « Oh ! la fière princesse, qu'elle est bien attifée, voyez-moi ça ! » Alors elle dut travailler dur du matin jusqu'au soir, se lever tôt, tirer de l'eau, allumer le feu, faire la cuisine et la vaisselle, la lessive et tous les gros travaux. Les deux sœurs, au surplus, n'arrêtaient pas de lui faire toutes les misères possibles et imaginables, riaient d'elle à tout propos, lui jetaient les pois ou les lentilles dans la cendre pour qu'elle eût à rester là encore à les trier une fois de plus. Le soir, quand elle était exténuée de sa journée, elle n'avait pas de lit pour se coucher, mais devait s'étendre par terre, sur la pierre du foyer, dans les cendres ; et comme elle en était toujours souillée et salie, les sœurs l'appelaient Cendrillon. Un jour que le père devait se rendre à la foire, il demanda à ses deux belles-filles ce qu'elles voulaient qu'il leur en rapportât. « De belles robes ! » dit l'une. « Des perles et des joyaux ! » dit l'autre. — Et toi, Cendrillon, qu'aimerais-tu ? demanda-t-il à sa fille. — La première branche qui cinglera votre chapeau en cours de route, père, coupez-la pour moi, répondit-elle. Il acheta donc pour ses deux belles-filles de jolies toilettes, des perles et des pierres précieuses ; et il s'en revenait, quand en passant à cheval dans un bosquet, une branche de noisetier lui cingla le chapeau et le lui fit tomber à terre. Il coupa le rameau et l'emporta. Arrivé à la maison, il donna aux deux sœurs ce qu'elles avaient voulu, et à Cendrillon le rameau de noisetier. Cendrillon l'en remercia et s'en alla planter la petite branche sur la tombe de sa mère ; elle pleurait si fort que ses larmes mouillèrent et arrosèrent le rameau, qui prit racine, poussa et devint un fort bel arbre. Cendrillon s'y rendait chaque jour trois fois, pleurant et priant sous le bel arbre, et toujours un petit oiseau blanc venait s'y poser ; et si elle formulait un souhait, le petit oiseau de l'arbre lui jetait aussitôt ce qu'elle avait souhaité. Il advint, une fois, que le roi donna une grande fête de trois jours, à laquelle étaient invitées toutes les jolies filles du pays, afin que son fils pût se choisir une fiancée. Quand les deux sœurs apprirent qu'elles étaient invitées aussi, elles furent tout excitées et appelèrent Cendrillon aussitôt : « Coiffe-nous, lui dirent-elles, fais briller nos chaussures et serre-nous bien dans nos ceintures : nous allons pour le mariage au palais du roi. » Cendrillon obéit, mais en pleurant, tant elle eût aimé les accompagner au bal ; aussi alla-t-elle en demander la permission à sa belle-mère. — Toi, Cendrillon ? fit la belle-mère. Sale et dégoûtante comme tu l'es, tu voudrais être de la noce ? Tu n'as ni robe ni souliers, et tu voudrais aller danser ? Mais comme elle ne se laissait pas décourager et continuait de la supplier, la belle-mère finit par lui dire, pour avoir la paix : « Bon, tu pourras venir si, en deux heures de temps, tu réussis à ramasser et à trier le pot de lentilles que je vais renverser dans les cendres. » Le pot versé, Cendrillon gagna le jardin par la porte de derrière et appela : — Gentils pigeons, mignonnes tourterelles, et vous tous les petits oiseaux de sous le ciel, venez vite à mon aide et trions comme il faut : _Les bonnes dans le petit pot,_ _Les autres dans votre jabot_. Deux blancs pigeons entrèrent d'abord par la fenêtre de la cuisine, puis vinrent les tourterelles et enfin tous les petits oiseaux du ciel, en rangs pressés, battant des ailes, pour se poser tout partout sur les cendres. Les pigeons penchèrent un peu la tête et commencèrent à pic, pic, pic, piqueter les lentilles, et les autres se mirent aussi à pic, pic, pic, piqueter les lentilles pour les tirer de la cendre et les rassembler dans le pot. Il ne s'était pas passé une heure que déjà tout était fini et que tous les oiseaux s'étaient envolés de nouveau. Tout heureuse, Cendrillon s'empressa d'aller montrer le pot à sa marâtre, croyant qu'elle allait, elle aussi, se rendre avec les autres à la fête du roi. — Non, Cendrillon, dit celle-ci : tu n'as pas de robe à te mettre et tu ne sais pas danser. Tout le monde se moquerait de toi. Mais pour qu'elle cessât de pleurer, la marâtre lui promit : — Si tu me tries deux pleins pots de lentilles dans la cendre en une heure de temps, alors tu pourras venir. Car en elle-même, elle se disait : « Cela, jamais elle n'arrivera à le faire ! » Dès qu'elle eut éparpillé les deux pots de lentilles dans les cendres, Cendrillon courut au jardin par la porte de derrière et appela : — Gentils pigeons, mignonnes tourterelles, et vous tous les petits oiseaux de sous le ciel, venez vite à mon aide et trions comme il faut : _Les bonnes dans le petit pot,_ _Les autres dans votre jabot_. Deux blancs pigeons entrèrent d'abord par la fenêtre de la cuisine, puis vinrent les tourterelles et enfin tous les petits oiseaux du ciel, en rangs serrés, battant des ailes, pour se poser tout partout sur les cendres. Les pigeons penchèrent un peu la tête et commencèrent à pic, pic, pic, piqueter les lentilles, et les autres se mirent aussi à pic, pic, pic, piqueter les lentilles pour les tirer de la cendre et les ramasser dans les pots. Il ne s'était pas passé une demi-heure que tout était fini et que tous les oiseaux s'envolèrent de nouveau. Joyeuse, Cendrillon s'empressa d'aller montrer les pots à sa marâtre, croyant aller avec les autres à la fête du roi. — Tout cela ne sert à rien, dit celle-ci : tu n'as pas de robe à te mettre et tu ne sais pas danser ; tu ne peux donc pas venir avec nous. Tu nous ferais honte. Elle lui tourna le dos et gagna la porte avec ses deux filles orgueilleuses et altières. Lorsqu'il n'y eut plus personne à la maison, Cendrillon alla sur la tombe de sa mère, se mit sous le noisetier et dit : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Alors l'oiseau lui fit descendre une robe d'argent et d'or ainsi que des pantoufles brodées de soie et d'argent. Elle se hâta de revêtir la robe et alla à la fête des noces. Ni sa belle-mère, ni ses demi-sœurs ne la reconnurent, pensant plutôt que ce devait être là quelque fille de roi étrangère au pays, tant elle était belle dans sa robe d'or. Elles ne songeaient pas le moins du monde à Cendrillon, qu'elles croyaient toujours à la maison, en train de fouiller dans les cendres pour en trier les lentilles. Le fils du roi vint à sa rencontre, la prit par la main et dansa avec elle. Il ne voulut même danser avec nulle autre, et c'est pourquoi il ne lui lâchait pas la main ; et si quelque autre cavalier venait pour l'inviter à son tour, le prince lui disait : « C'est ma cavalière. » Jusqu'au soir elle dansa, puis elle voulut rentrer chez elle, mais le prince lui dit qu'il irait avec elle et l'accompagnerait, tant il était curieux de voir de quelle famille venait cette jolie jeune fille. Il l'accompagna, en effet, mais au dernier moment elle lui échappa et sauta dans le pigeonnier. Le prince attendit que revînt le père et lui dit que la jeune inconnue avait sauté dans le pigeonnier. « Serait-ce Cendrillon ? » se demanda le père, qui réclama une hache et une pioche pour ouvrir en deux le pigeonnier. Mais il n'y avait personne à l'intérieur ; et quand ils entrèrent dans la maison, Cendrillon, dans son costume misérable et souillé, était couchée sur la cendre, avec une méchante veilleuse à huile qui clignotait dans la cheminée. Elle avait, en effet, bien vite sauté du pigeonnier par-derrière et couru jusqu'au noisetier, où elle avait quitté sa robe magnifique pour la déposer sur la tombe, et le petit oiseau l'avait remportée tandis qu'elle retrouvait la cuisine et son vieux tablier gris pour se coucher sur la cendre, dans l'âtre. Le lendemain, comme recommençait la fête, dès que ses parents et les deux sœurs altières eurent quitté la maison, Cendrillon courut au noisetier et dit : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Alors l'oiseau lui fit descendre une robe encore beaucoup plus splendide et magnifique que celle de la veille. Et quand elle apparut à la fête ainsi parée, tout le monde s'étonna et s'émerveilla de sa beauté. Le fils du roi, qui avait attendu sa venue, la prit aussitôt par la main et ne dansa qu'avec elle. Et si quelque autre cavalier venait pour l'inviter, il lui disait : « C'est ma danseuse. » Quand elle voulut rentrer, le soir venu, le prince l'accompagna, car il voulait voir dans quelle maison elle entrait. Mais elle lui échappa et sauta dans le jardin derrière la maison. Il y avait là un grand bel arbre tout chargé de magnifiques poires, et elle grimpa si prestement entre ses branches, vive comme un écureuil, que le prince ne sut pas où elle avait bien pu passer. Mais il attendit que revînt le père et lui dit que la jolie inconnue avait disparu, mais qu'il croyait qu'elle s'était cachée dans le grand poirier. Le père se dit en lui-même : « Serait-ce Cendrillon ? » et se fit apporter une hache, entama l'arbre tout autour et l'abattit ; mais il n'y avait personne dedans. Et quand ils entrèrent dans la cuisine, Cendrillon était là, couchée dans la cendre comme toujours. Elle avait sauté de l'arbre par-derrière, en effet, et rapporté vite, vite, sa robe magnifique au petit oiseau du noisetier pour reprendre son vieux tablier gris. Le troisième jour, quand ses parents et les sœurs furent partis, Cendrillon retourna sur la tombe de sa mère et dit au noisetier : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Et la robe que l'oiseau lui fit descendre, cette fois, était si merveilleuse et d'une telle magnificence que jamais elle n'avait rien eu qui lui ressemblât ; et les escarpins n'étaient faits que d'or. Parée de la sorte, elle fit son entrée à la fête et tout le monde béa d'admiration, ne sachant plus que dire. Le fils du roi ne dansa qu'avec elle, et si quelqu'un d'autre venait pour l'inviter, il disait : « C'est ma cavalière. » Le soir venu, Cendrillon voulut s'en aller et le prince voulut l'accompagner, mais elle s'esquiva si lestement qu'il ne put la suivre. Seulement le prince avait recouru à la ruse et fait enduire de poix toutes les marches du perron, et tandis qu'elle dégringolait l'escalier en volant presque, sa pantoufle gauche y resta collée. Le fils du roi prit cet escarpin, qui était minuscule, délicat, et entièrement fait d'or. Le lendemain matin, le prince alla trouver le père et lui dit : « Je ne veux point d'autre épouse que celle à qui cette chaussure d'or ira. » Ce fut une grande joie pour les deux sœurs, car elles avaient un joli pied. L'aînée alla dans sa chambre avec l'escarpin, qu'elle voulait chausser. Sa mère était présente. Mais le soulier était trop petit et le pouce n'y pouvait entrer. La mère s'empressa de lui tendre un couteau : « Coupe-le, lui dit-elle ; quand tu seras reine, tu n'auras plus besoin de marcher. » La jeune fille se coupa l'orteil et enfila son pied dans la chaussure, quelque vive que fût la douleur, puis sortit retrouver le prince. Il la prit sur son cheval et partit avec elle comme sa fiancée ; mais ils devaient passer non loin de la tombe où deux colombes, perchées sur le noisetier, se mirent à glousser bien fort : _Roucou-oucou, roucou-oucou_ _Dans la pantoufle le sang coule :_ _L'escarpin était trop petit,_ _La fiancée est au logis_. Jetant un coup d'œil au pied chaussé, le prince vit que le sang en ruisselait. Il fit faire demi-tour à son cheval et ramena la fausse fiancée à sa maison, disant que ce n'était pas elle qu'il devait épouser, et que l'autre sœur devait essayer l'escarpin. La seconde sœur alla dans sa chambre avec l'escarpin et réussit très bien à y enfiler ses orteils, mais ce fut le talon qui refusa d'entrer. Oui, le talon était trop gros. Alors la mère lui tendit le couteau et lui dit : « Coupe un bout du talon : quand tu seras reine, tu n'auras plus besoin de marcher. » La jeune fille s'enleva un morceau du talon et força son pied dans la chaussure, quelque vive que fût la douleur, puis sortit retrouver le prince. Il la prit sur son cheval et partit avec elle comme sa fiancée. Mais quand ils furent non loin du noisetier, les deux colombes roucoulèrent de plus belle : _Roucou-oucou, roucou-oucou_ _Dans la pantoufle le sang coule :_ _L'escarpin était trop petit,_ _La fiancée est au logis_. De nouveau, le prince jeta un coup d'œil sur le pied chaussé, vit que le sang coulait, coulait si fort que le bas blanc en était tout rougi. Alors il tourna bride et ramena la fausse fiancée à la maison. — Ce n'est pas celle-là non plus que je dois épouser, dit-il. N'avez-vous pas d'autre fille ? — Non, dit le père, il n'y a plus ici que ce pauvre souillon de Cendrillon, la fille de ma première femme, qui est là-bas, dans la cuisine ; mais celle-là ne saurait être la fiancée, c'est impossible ! Le fils du roi déclara néanmoins qu'il fallait l'envoyer chercher, mais la mère s'interposa : « Non, non, elle n'est pas présentable : elle est beaucoup trop sale pour se laisser voir ! » Le prince insista : il y tenait absolument, et il fallut qu'on allât la chercher. Cendrillon voulut d'abord se laver les mains et le visage, puis elle vint s'incliner devant le fils du roi, qui lui tendit l'escarpin d'or. Ensuite elle s'assit sur un escabeau, sortit son pied du pesant sabot de bois et le chaussa de la pantoufle qui le moulait parfaitement. Quand elle se releva, en voyant son visage, le prince la reconnut et s'exclama : « C'est elle, la véritable fiancée ! » La belle-mère et les deux demi-sœurs en pâlirent de rage, mais le prince prit Cendrillon sur son cheval et partit avec elle. Et quand ils passèrent non loin du noisetier, les deux colombes blanches roucoulèrent doucement, quoique assez haut pour se faire entendre : _Roucou-oucou, roucou-oucou_ _La pantoufle n'a rien du tout :_ _Sa fiancée est avec lui,_ _L'escarpin n'est pas trop petit_. Puis les colombes quittèrent l'arbre et vinrent se poser gracieusement sur les épaules de Cendrillon, une à droite et l'autre à gauche, et elles restèrent là. Le jour des noces de Cendrillon avec le fils du roi, à l'heure de la cérémonie, arrivèrent les deux sœurs pour l'accabler de flatteries et de doux compliments, car elles voulaient s'insinuer dans ses bonnes grâces et avoir part à son bonheur. Le cortège gagnait l'église derrière les fiancés, et la sœur aînée marchait à droite de Cendrillon, la cadette à sa gauche ; alors la colombe de droite et la colombe de gauche leur piquèrent à chacune un œil. À la sortie de l'église, par contre, l'aînée marchait à gauche de Cendrillon et la cadette à droite ; alors les deux colombes leur piquèrent à chacune l'autre œil. Et c'est ainsi que, par la cécité jusqu'à leur dernier jour, elles ont été punies de leur méchanceté et de leur fausseté. # L'Oiseau d'Ourdi # (ou Barbe-Bleue dans la poésie populaire allemande) Il était une fois un maître sorcier qui se donnait l'apparence d'un pauvre et s'en allait mendier de maison en maison pour s'emparer des jolies filles. Nul au monde ne savait où il les emportait, et jamais plus elles ne revenaient de là-bas. Un jour, il se présenta à la porte de quelqu'un qui avait trois filles, jolies toutes les trois ; et il avait l'air d'un misérable mendiant tout loqueteux et presque à bout de forces, avec une vieille besace sur le dos qui semblait faite pour emporter les dons de la charité. Il mendia humblement un petit quelque chose à manger, et quand la fille aînée vint pour lui apporter un morceau de pain, il la toucha seulement du bout du doigt, ce qui l'obligea à sauter elle-même dans la besace. Aussitôt l'homme s'éloigna à grandes et solides enjambées, gagnant rapidement une sombre forêt au milieu de laquelle il avait sa maison. Là, dans cette maison, tout était merveilleux, et la jeune fille avait tout ce qu'elle pouvait désirer ou même souhaiter, car il lui donnait tout. « Mon trésor, lui dit-il, ton cœur ici n'aura plus rien à désirer : tu verras comme tu seras bien chez moi. » Quelques jours passèrent, puis il lui dit : — Je dois m'absenter et te laisser seule, mais ce ne sera pas long. Voici toutes les clefs de la maison : tu peux aller partout, à la seule exception d'une chambre, à laquelle correspond cette petite clef-ci. Dans celle-là, je t'interdis d'entrer sous peine de mort. Il lui confia également un œuf en lui disant : — Cet œuf, garde-le-moi précieusement et porte-le de préférence toujours sur toi, car s'il venait à se perdre, cela provoquerait un énorme malheur. Elle prit les clefs ainsi que l'œuf, promettant d'exécuter tout à la lettre. Une fois le maître parti, elle alla ici et là visiter la maison du haut en bas, admirant tout ce qu'il y avait à admirer, les chambres qui étincelaient d'or et d'argent, des merveilles telles qu'il lui semblait n'avoir jamais rien vu d'aussi beau, ni seulement rêvé de pareilles splendeurs. Elle arriva aussi, pour finir, devant la porte interdite et voulut passer outre ; mais la curiosité la retint, la tracassa, ne la laissa pas en repos. Elle considéra la petite clef, qui ressemblait aux autres, l'introduisit dans la serrure et la tourna un tout petit peu, mais la porte s'ouvrit d'un coup. Et que vit-elle, lorsqu'elle entra ? Au milieu de la chambre, un grand bac plein de sang où nageaient des membres humains, et à côté un gros billot avec une hache étincelante. Elle eut un tel sursaut d'effroi que l'œuf, qu'elle tenait à la main, lui échappa et tomba dans le bac sanglant. Elle le reprit bien vite et voulut le nettoyer du sang qui le tachait, mais elle eut beau laver, frotter, essuyer : il n'y avait rien à faire, le sang réapparaissait toujours. Peu de temps après, l'homme rentra de son voyage et sa première demande fut pour les clefs et pour l'œuf. Elle les lui tendit en tremblant, et il s'aperçut tout de suite, en voyant les taches sur l'œuf, qu'elle était entrée dans la chambre sanglante. — Puisque tu es entrée contre ma volonté dans la chambre, lui dit-il, tu vas maintenant y retourner contre ta volonté ! Tu as fini de vivre. Il la jeta à terre, la traîna par les cheveux dans la terrible pièce, lui trancha la tête sur le billot puis lui coupa les membres en inondant le plancher de son sang, et les jeta avec les autres dans le grand bac. — Maintenant je vais aller chercher la seconde ! dit à haute voix le maître sorcier, qui reprit aussitôt son apparence de pauvre mendiant et revint, comme tel, devant la porte de la maison où il avait pris la première demoiselle. La seconde lui apporta un morceau de pain, il la toucha du doigt et l'emporta comme l'autre. Elle ne connut pas un meilleur sort que sa sœur, car elle aussi se laissa pousser par la curiosité, ouvrit la porte et vit la chambre sanglante avant de le payer de sa vie. Alors le sorcier s'en alla chercher la troisième sœur, qui était plus intelligente et plus rusée. Après qu'il lui eut remis les clefs et l'œuf et se fut en allé, elle prit soin tout d'abord de mettre l'œuf en sûreté, puis elle visita toute la maison pour entrer finalement, elle aussi, dans la chambre interdite. Hélas ! que n'y vit-elle pas ? Ses deux sœurs bien-aimées gisaient là, horriblement assassinées et coupées en morceaux, dans le bac sanglant avec d'autres corps ! Courageusement elle s'avança et chercha leurs membres épars, les rassembla et les remit comme il convenait : la tête, le tronc, les bras et les jambes ; et dès que les corps furent complets, quand ils eurent tous leurs membres sans que rien ne manquât, la vie revint et les parties se ressoudèrent, si bien que les deux sœurs ouvrirent leurs yeux et se retrouvèrent bien vivantes. Quelle joie ! quelles embrassades ! quel bonheur pour toutes trois ! À son retour de voyage, l'homme réclama les clefs et l'œuf, sur lequel il ne décela pas la moindre tache de sang. Alors il dit : — Tu as subi l'épreuve : tu seras donc mon épouse. Il n'avait plus aucun pouvoir sur elle et devait, au contraire, faire absolument tout ce qu'elle désirait. — Très bien, dit-elle, mais tu devras d'abord porter une pleine besace d'or à mon père et à ma mère ; et cette besace, c'est sur ton dos que tu devras la porter, afin que ce présent ait un sens et une réelle valeur. Pendant ce temps, moi, je ferai les préparatifs de la noce. Elle courut alors retrouver ses sœurs, qu'elle avait cachées dans un cabinet, et leur dit : — L'heure et l'instant sont venus, et je peux vous sauver ! Le maudit va lui-même vous ramener, à son insu, à la maison en vous portant sur son dos. Mais dès que vous serez à la maison, envoyez-moi vite du secours ! Elle les mit toutes deux au fond d'une besace, puis elle les couvrit d'or, de façon qu'on ne puisse pas les voir, puis elle appela le maître sorcier et lui dit : — Voilà la besace que tu vas porter, mais ne t'arrête pas en chemin et ne cherche pas à te reposer : je te verrai de ma petite fenêtre d'en haut et je te surveillerai ! Le sorcier chargea la lourde besace sur son dos et se mit en route aussitôt, mais elle pesait si lourd que la sueur lui en coulait du front et lui inondait le visage. Il s'arrêta et s'assit pour se reposer un moment, mais une voix lui cria de l'intérieur de la besace : « Je te vois de ma petite fenêtre ! Tu te reposes ! Allons, marche ! » Il se releva et se remit en route, croyant que c'était sa fiancée qui lui avait crié cela depuis la lucarne, là-bas. Une nouvelle fois, il essaya de se reposer, mais cette fois encore la voix cria : « Je te vois de ma petite fenêtre ! Tu te reposes ! Veux-tu bien te remettre en marche ! » Puis chaque fois qu'il faisait mine de s'arrêter, succombant sous la charge, la voix le rappelait à l'ordre et il lui fallait marcher, de telle sorte qu'il finit par arriver à bout de souffle et en gémissant à la maison des parents, où il déposa son or et, avec l'or, les deux sœurs saines et sauves. Dans la maison du sorcier, pendant ce temps, la fiancée préparait la noce et invitait tous les amis de la maison à y prendre part. Puis elle prit une tête de mort qui grimaçait de toutes ses dents, la para de bijoux et lui mit une couronne de fleurs avant d'aller la poser devant la fenêtre du grenier comme si elle regardait dehors. Quand tout fut prêt, elle se plongea elle-même dans un tonneau de miel, puis alla se rouler dans l'édredon qu'elle avait éventré, de sorte qu'elle eut l'air d'un oiseau étrange, mais plus du tout d'un être humain ; et alors elle quitta la maison pour rentrer chez elle. En chemin, elle rencontra un premier groupe d'invités de la noce, qui lui demanda : _Ô toi, l'oiseau d'Ourdi, d'où viens-tu par ici ?_ — _Tout droit de la maison de l'Ourdisseur Ourdi_. — _Que fait là-bas la jeune fiancée ?_ — _De haut en bas, la maison préparée_ , _À la lucarne elle est allée_ _Pour voir venir les invités_. Plus loin, elle rencontra le fiancé lui-même qui s'en revenait d'un pas lourd et lent, tellement il était fatigué. Comme les autres, il l'interrogea : _Ô toi, l'oiseau d'Ourdi, d'où viens-tu par ici ?_ — _Tout droit de la maison de l'Ourdisseur Ourdi_. — _Que fait là-bas ma jeune fiancée ?_ — _De haut en bas, la maison préparée_ , _À la lucarne elle est allée_ _Pour voir venir son fiancé_. Regardant tout là-bas, au grenier, le fiancé y vit dans la lucarne la tête de mort couronnée de fleurs et ornée de bijoux ; mais comme c'était si loin encore, il crut que c'était, en effet, sa fiancée qui le regardait venir, et il la salua en lui faisant signe joyeusement. Mais dès qu'il se trouva avec les invités à l'intérieur de la maison, les frères et les parents des trois sœurs arrivèrent justement, accourant au secours de la fiancée. La sachant maintenant sauvée, ils fermèrent toutes les portes et les issues de la maison de façon que personne ne pût en sortir, puis ils y mirent le feu. Et le maître sorcier avec toute sa bande y périt dans les flammes. # Le Petit Chaperon Rouge # (version bavaroise) Il était une fois une adorable petite fillette que tout le monde aimait rien qu'à la voir, et plus que tous, sa grand-mère, qui ne savait que faire ni que donner comme cadeaux à l'enfant. Une fois, elle lui donna un petit chaperon de velours rouge et la fillette le trouva si joli, il lui allait tellement bien, qu'elle ne voulut plus porter autre chose et qu'on ne l'appela plus que le Petit Chaperon Rouge. Un jour, sa mère lui dit : — Tiens, Petit Chaperon Rouge, voici un morceau de galette et une bouteille de vin : tu iras les porter à ta grand-mère ; elle est malade et affaiblie, et elle va bien se régaler. Vas-y tout de suite, avant qu'il ne fasse trop chaud ; et sois bien sage en chemin et ne saute pas à droite ou à gauche pour aller tomber et me casser la bouteille de grand-mère, qui n'aurait plus rien. Et puis, dis bien bonjour en entrant et ne regarde pas d'abord dans tous les coins ! — Je serai sage et je ferai tout pour le mieux, promit le Petit Chaperon Rouge à sa mère, avant de lui dire au revoir et de partir. Mais la grand-mère habitait à une bonne demi-heure du village, tout là-bas, dans la forêt ; et lorsque le Petit Chaperon Rouge entra dans la forêt, ce fut pour rencontrer le loup. Mais elle ne savait pas que c'était une si méchante bête et elle n'avait pas peur. — Bonjour, Petit Chaperon Rouge, dit le loup. — Merci à toi et bonjour aussi, loup. — Où vas-tu de si bonne heure, Petit Chaperon Rouge ? — Chez grand-mère. — Que portes-tu sous ton tablier, dis-moi ? — De la galette et du vin, dit le Petit Chaperon Rouge ; nous l'avons cuite hier et je vais en porter à grand-mère, parce qu'elle est malade et que cela lui fera du bien. — Où habite-t-elle, ta grand-mère, Petit Chaperon Rouge ? demanda le loup. — Plus loin dans la forêt, à un quart d'heure d'ici ; c'est sous les trois grands chênes, et juste en dessous, il y a des noisetiers, tu reconnaîtras forcément, dit le Chaperon Rouge. Fort de ce renseignement, le loup pensa : « Un fameux régal, cette mignonne et tendre jeunesse ! Grasse chère, que j'en ferai : meilleure encore que la grand-mère, que je vais engloutir aussi. Mais attention, il faut être malin si tu veux les déguster l'une et l'autre. » Telles étaient les pensées du loup tandis qu'il faisait un bout de conduite au Petit Chaperon Rouge. Puis il dit, tout en marchant : — Toutes ces jolies fleurs dans le sous-bois, comment se fait-il que tu ne les regardes même pas, Petit Chaperon Rouge ? Et les oiseaux, on dirait que tu ne les entends pas chanter ! Tu marches droit devant toi comme si tu allais à l'école, mais c'est pourtant rudement joli, la forêt ! Le Petit Chaperon Rouge donna un coup d'œil alentour et vit danser les rayons du soleil entre les arbres, et puis partout, partout des fleurs qui brillaient. « Si j'en faisais un bouquet pour grand-mère, se dit-elle, cela lui ferait plaisir aussi ; il est tôt et j'ai bien le temps d'en cueillir. » Sans attendre, elle quitta le chemin pour entrer dans le sous-bois et cueillir des fleurs : une ici, l'autre là, mais la plus belle était toujours un peu plus loin, et encore plus loin dans l'intérieur de la forêt. Le loup, pendant ce temps, courait tout droit à la maison de la grand-mère et frappait à sa porte. — Qui est là ? cria la grand-mère. — C'est moi, le Petit Chaperon Rouge, dit le loup ; je t'apporte de la galette et du vin, ouvre-moi ! — Tu n'as qu'à tirer le loquet, cria la grand-mère. Je suis trop faible pour aller t'ouvrir. Le loup tira le loquet, poussa la porte et entra pour s'avancer tout droit, sans dire un mot, jusqu'au lit de la grand-mère, qu'il avala. Il mit ensuite sa chemise, s'enfouit la tête sous son bonnet de dentelle et se coucha dans son lit, puis tira les rideaux de l'alcôve. Le Petit Chaperon Rouge avait couru de fleur en fleur, mais à présent son bouquet était si gros que c'était tout juste si elle pouvait le porter. Alors elle pensa à sa grand-mère et se remit bien vite en chemin pour arriver chez elle. La porte était ouverte et cela l'étonna ; mais quand elle fut dans la chambre, tout lui parut de plus en plus bizarre et elle se dit : « Mon Dieu, comme tout est étrange aujourd'hui ! D'habitude, je suis si heureuse quand je suis chez grand-mère ! » Elle salua pourtant : — Bonjour, grand-mère ! Mais comme personne ne répondait, elle s'avança jusqu'à son lit et écarta les rideaux. La grand-mère était là, couchée, avec son bonnet qui lui cachait presque toute la figure, et elle avait l'air si étrange. — Comme tu as de grandes oreilles, grand-mère ! — C'est pour mieux t'entendre, répondit-elle. — Comme tu as de gros yeux, grand-mère ! — C'est pour mieux te voir, répondit-elle. — Comme tu as de grandes mains ! — C'est pour mieux te prendre, répondit-elle. — Oh ! grand-mère, quelle grande bouche et quelles terribles dents tu as ! — C'est pour mieux te manger, dit le loup, qui fit un bond hors du lit et avala le pauvre Petit Chaperon Rouge d'un seul coup. Sa voracité satisfaite, le loup retourna se coucher dans le lit et s'endormit bientôt, ronflant plus fort que fort. Le chasseur, qui passait devant la maison, l'entendit et pensa : « Qu'a donc la vieille femme à ronfler si fort ? Il faut que tu entres et que tu voies si elle a quelque chose qui ne va pas. » Il entra donc et, s'approchant du lit, vit le loup qui dormait là. — C'est ici que je te trouve, vieille canaille ! dit le chasseur. Il y a un moment que je te cherche !... Et il allait épauler son fusil, quand, tout à coup, l'idée lui vint que le loup avait peut-être mangé la grand-mère et qu'il pouvait être encore temps de la sauver. Il reposa son fusil, prit des ciseaux et se mit à tailler le ventre du loup endormi. Au deuxième ou au troisième coup de ciseaux, il vit le rouge chaperon qui luisait ; deux ou trois coups de ciseaux encore, et la fillette sautait dehors en s'écriant : « Oh, la, la, quelle peur j'ai eue ! Comme il faisait noir dans le ventre du loup ! » Et bientôt après, sortait aussi la vieille grand-mère, mais c'était à peine si elle pouvait encore respirer. Le Petit Chaperon Rouge courut chercher de grosses pierres qu'ils fourrèrent dans le ventre du loup ; et quand il se réveilla et voulut bondir, les pierres pesaient si lourd qu'il s'affala et resta mort sur le coup. Tous les trois étaient bien contents : le chasseur prit la peau du loup et rentra chez lui ; la grand-mère mangea la galette et but le vin que le Petit Chaperon Rouge lui avait apportés, se retrouvant bientôt à son aise. Mais pour ce qui est du Petit Chaperon Rouge, elle se jura : « Jamais plus de ta vie tu ne quitteras le chemin pour courir dans les bois, quand ta mère te l'a défendu. » On raconte encore qu'une autre fois, quand le Petit Chaperon Rouge apportait de nouveau de la galette à sa vieille grand-mère, un autre loup essaya de la distraire et de la faire sortir du chemin. Mais elle s'en garda bien et continua à marcher tout droit. Arrivée chez sa grand-mère, elle lui raconta bien vite que le loup était venu à sa rencontre et qu'il lui avait souhaité le bonjour, mais qu'il l'avait regardée avec des yeux si méchants : « Si je n'avais pas été sur la grand-route, il m'aurait dévorée ! » ajouta-t-elle. — Viens, lui dit sa grand-mère, nous allons fermer la porte et la bien cadenasser pour qu'il ne puisse pas entrer ici. Peu après, le loup frappait à la porte et criait : « Ouvre-moi, grand-mère ! C'est moi, le Petit Chaperon Rouge, qui t'apporte des gâteaux ! » Mais les deux gardèrent le silence et n'ouvrirent point la porte. Tête-Grise fit alors plusieurs fois le tour de la maison à pas feutrés, et, pour finir, il sauta sur le toit, décidé à attendre jusqu'au soir, quand le Petit Chaperon Rouge sortirait, pour profiter de l'obscurité et l'engloutir. Mais la grand-mère se douta bien de ses intentions. — Prends le seau, mon enfant, dit-elle au Petit Chaperon Rouge ; j'ai fait cuire des saucisses hier, et tu vas porter l'eau de cuisson dans la grande auge de pierre qui est devant l'entrée de la maison. Le Petit Chaperon Rouge en porta tant et tant de seaux que, pour finir, l'auge était pleine. Alors la bonne odeur de la saucisse vint caresser les narines du loup jusque sur le toit. Il se pencha pour voir et renifler, se pencha et renifla, renifla et se pencha si bien en tendant le cou, qu'à la fin il glissa et ne put plus se retenir. Il glissa du toit et tomba droit dans l'auge de pierre où il se noya. Allégrement, le Petit Chaperon Rouge regagna sa maison, et personne ne lui fit le moindre mal. # Le Vieux Sultan Un paysan avait un chien fidèle qui s'appelait Sultan, mais il était vieux et avait perdu toutes ses dents, si bien qu'il ne pouvait plus rien mordre. Et un jour, devant sa porte, le paysan dit à sa femme : « Demain matin, je prends le fusil et je vais tuer le vieux Sultan qui n'est plus bon à rien. » La femme s'émut de compassion pour la bonne vieille bête fidèle et dit : — Lui qui nous a si bien et si fidèlement servis pendant de si longues années, nous pourrions bien lui accorder le pain de la grâce ! — Eh quoi ? dit l'homme, tu n'y penses pas ! Il n'a plus une dent dans la gueule et aucun voleur n'a peur de lui ; c'est bien son heure de partir à présent. Il nous a servis, mais aussi cela lui a valu la bonne pâtée dont il s'est nourri ! Le pauvre vieux chien, couché au soleil non loin de là, entendit tout et fut bien triste d'apprendre qu'il devait mourir le lendemain matin. Il avait un bon ami en la personne du loup, et, le soir, il se faufila jusqu'à la forêt pour aller lui confier sa peine et le triste destin qui l'attendait. — Écoute, camarade, reprends courage ! Je vais t'aider dans ta détresse et j'ai une bonne idée : le matin, de très bonne heure, ton maître s'en va faire les foins avec sa femme, et ils emmènent leur enfant avec eux, puisqu'il n'y a personne à la maison pour le garder ; ils le couchent à l'ombre d'une haie pendant qu'ils travaillent. Tu n'auras qu'à te coucher du côté du petit comme si tu voulais le garder, et moi je sortirai de la forêt pour venir enlever l'enfant ; alors tu te précipiteras derrière moi et tu me poursuivras comme pour me le reprendre ; je le laisserai tomber et tu le rapporteras à tes maîtres, qui croiront que tu l'as sauvé et qui te seront bien trop reconnaissants pour vouloir te faire ensuite le moindre mal : tout au contraire, tu rentreras en complète grâce et ils ne te laisseront plus jamais manquer de rien. Cette idée plut beaucoup au chien et tout se passa comme prévu. Le père poussa des cris pendant que le loup fuyait à travers champs avec l'enfant dans sa gueule ; mais quand le vieux Sultan le rapporta, il ne se tenait plus de joie et il caressa le bon chien en lui disant : « Aussi longtemps que tu vivras, tu seras bien nourri et bien traité ; jamais on ne touchera même à un poil de ta fourrure ! » Et, se tournant vers sa femme, il lui dit : « Va vite à la maison et prépare-lui une bonne soupe au lait bien trempée, qu'il n'ait pas de mal à se donner pour la mâcher, et donne-lui mon oreiller : je lui en fais cadeau pour qu'il soit bien couché. » À partir de ce moment, le vieux Sultan eut la vie si belle qu'il n'avait plus rien à désirer. Le loup vint un peu plus tard lui faire visite et se félicita de la bonne tournure des choses. — Mais je compte bien, mon vieux, que tu fermeras l'œil si d'aventure je viens prendre au troupeau de ton maître un joli mouton bien dodu, ajouta-t-il. La vie devient de plus en plus dure de nos jours ! — Cela non, n'y compte pas ! répondit le chien. Je reste fidèle à mon maître et je ne peux pas consentir à cela ! Le loup pensa qu'il ne parlait pas sérieusement et, la nuit même, se glissa dans la bergerie pour emporter son mouton. Mais le fidèle Sultan avait averti son maître des mauvaises intentions du loup, et le maître était là qui l'attendait, armé d'un fléau avec lequel il lui caressa douloureusement l'échine. Le loup ne put que s'enfuir, mais il cria au chien : « Attends seulement un peu : tu vas me payer cela, faux frère ! » Le lendemain matin, déjà, le sanglier, envoyé par le loup, vint provoquer le chien en duel dans la forêt pour régler cette affaire d'honneur. Le vieux Sultan ne put trouver d'autre témoin que le vieux chat, un très vieux chat qui n'avait que trois pattes. Quand ils s'en allèrent tous les deux vers la forêt pour le duel, le pauvre vieux chat marchait péniblement sur ses trois pattes, et la douleur lui faisait tenir sa queue toute droite. Le loup et son témoin le sanglier se trouvaient déjà sur le terrain, et quand ils virent de loin approcher leur adversaire, ils crurent qu'il s'était armé d'une épée en prenant la queue droite du chat pour une arme. Et quand ils virent d'un peu plus près le chat boiteux qui s'avançait en plongeant de la tête à chaque pas, ils crurent que celui-là ramassait des pierres pour les jeter sur eux. Pris de peur tous les deux, ils se défilèrent : le sanglier fonça dans un épais fourré pour s'y cacher, et le loup monta dans un arbre pour se tenir à l'abri. En arrivant sur le terrain du duel, le chien et le chat furent très étonnés de n'y trouver personne. Ils cherchèrent des yeux alentour. Or, le sanglier était si gros qu'il n'avait pas réussi à se dissimuler entièrement dans le fourré, et ses oreilles dépassaient. Le chat, si vieux qu'il fût, en les voyant bouger, crut que c'était une souris qui bougeait là et lui sauta dessus, mordant à belles dents dans cette proie inespérée. Avec un hurlement de douleur, le sanglier s'enfuit en quittant sa cachette au triple galop, mais non sans leur crier : « Dans l'arbre, le fautif est là-haut, dans l'arbre ! » Levant les yeux, le vieux chien et le vieux chat aperçurent le loup, en effet, qui se sentit si honteux de sa couardise, si humilié de s'être montré si lâche, qu'il accepta la paix que le chien lui offrait. # Margot-la-Malice Il y avait une cuisinière appelée Margot qui portait des chaussures à talons rouges, et quand elle les mettait pour sortir, elle se dandinait et se tournait de droite et de gauche en se disant, toute joyeuse, qu'elle était vraiment jolie fille. Quand elle rentrait à la maison, par bonne humeur, elle buvait un bon petit coup ; et comme le vin met en appétit, elle choisissait le meilleur de ce qu'elle avait cuisiné pour le goûter ; mais elle goûtait toujours, jusqu'à ce qu'elle n'eût plus faim du tout. « C'est un devoir pour la cuisinière, disait-elle, de savoir quel goût a ce qu'elle fait. » Et comme cela, elle avait toujours le meilleur de tout. Un jour, son maître lui annonça : — Margot, ce soir j'ai un invité ; tu nous feras rôtir deux chapons bien tendres et savoureux. — Je m'y mets tout de suite, monsieur ! répondit Margot, qui s'en alla choisir deux jolis chapons qu'elle tua, ébouillanta, pluma, vida, prépara et enfila sur la broche, attendant le soir pour les mettre au feu. Les chapons commencèrent à bien dorer et bientôt furent à point, mais l'invité n'était toujours pas là. Alors Margot cria à son maître : — Si l'invité n'arrive pas, il va falloir que je retire les chapons du feu ; mais c'est un crime et une désolation de ne pas les manger quand ils sont cuits à point, juteux et parfaits ! — Bon, dit le maître, je fais un saut dehors pour ramener l'invité. Dès que le maître eut le dos tourné, Margot retira la broche de devant le feu et mit les chapons de côté, puis elle se dit : « À rester comme cela devant le feu de braise, on se donne soif à force de transpirer. Et qui sait maintenant quand ils vont venir ? En attendant, je vais faire un saut à la cave et boire un petit coup. » Elle y courut, attrapa une cruche pour la remplir, se souhaita bonne santé et que Dieu la bénisse, sur quoi elle but un long trait. Mais comme la cruche n'était pas vide, elle se dit à haute voix : « Le vin se tient bien : et il n'est pas bon de le couper ! » Alors elle but tout le reste à longs traits. « Ça, c'était vraiment un bon coup, bien sérieux ! » Elle remonta ensuite, remit les chapons à rôtir, après les avoir bien beurrés et arrosés, et tout gaiement, elle fit tourner la broche. La peau, joliment croustillante et dorée, chantait que les chapons étaient cuits à point. — Mais on ne sait jamais, dit Margot, il pourrait y manquer un petit quelque chose et ce serait trop dommage ! Alors elle goûta en y mettant le doigt, qu'elle lécha. — Mon Dieu que ces chapons sont bons ! s'exclama-t-elle. C'est un vrai péché de ne point les manger immédiatement ! Ils sont parfaits. Parfaits ! Elle courut à la fenêtre pour voir si le maître n'arrivait pas. Mais non ! Il n'y avait personne en vue. Elle revint aux chapons et tourna la broche. — Là ! en voilà un qui a l'aile qui commence à brûler ! Le mieux, c'est encore que je la mange tout de suite ! Elle la coupe et la mange, la trouve si savoureuse qu'elle se dit : « L'autre, il faut que je la coupe aussi, autrement le maître va trouver cela bizarre. » Et quand elle eut englouti les deux ailes, elle courut encore à la fenêtre ; mais personne ne venait. — Si cela se trouve, pensa-t-elle, ils sont peut-être entrés quelque part et ne viendront pas dîner ici ! Mais ne t'en fais pas, Margot : il y en a un qui est de toute façon entamé ; alors tu vas boire un bon petit coup et là-dessus, finir de le manger ! Tu seras plus tranquille quand il sera tout mangé, et puis c'est péché que de laisser se perdre et dessécher un aussi succulent chapon qui est un véritable don de Dieu ! Elle fit un second saut, jusqu'à la cave, où elle se rafraîchit fort noblement le gosier, puis s'en revint, gaillarde et joyeuse, manger le chapon en entier. — Où est le premier, l'autre doit suivre, se dit-elle alors : ils vont ensemble, il n'y a pas de doute, et ce qui est bon pour l'un va pour l'autre également. Je crois qu'un autre petit coup ne me ferait pas de mal, ma petite Margot. Aussitôt elle descendit s'humecter le palais bien vigoureusement, puis elle fit prendre au second chapon le chemin qu'avait suivi le premier. Elle venait juste de finir son petit festin personnel quand son maître rentra. — Pressons-nous, Margot ! lui cria-t-il, notre invité arrive à l'instant ! — Bien monsieur, je vais servir ! dit Margot. Le maître, pendant ce temps, vérifia s'il y avait tout ce qu'il fallait sur la table et s'empara du grand couteau à découper qu'il alla aiguiser dans le couloir. L'invité arriva, frappant civilement à la porte extérieure, et Margot y courut. Voyant que c'était l'invité, elle mit un doigt sur sa bouche et lui chuchota : « Ne faites pas de bruit et filez vite avant que mon maître ne vous voie, sinon cela va mal aller pour vous ! Il vous a invité à dîner, c'est vrai, mais c'est uniquement dans l'idée de vous couper les deux oreilles. Écoutez-le : il est en train d'aiguiser son couteau ! » Dès qu'il eut entendu le bruit du couteau qu'on aiguisait dans le couloir, l'invité fit demi-tour et prit ses jambes à son cou pour dévaler l'escalier et filer dans la rue. Margot ne perdit pas le nord et se précipita vers son maître en criant : — Eh bien, ils sont jolis, les gens que vous invitez ! — Pourquoi dis-tu cela, Margot ? Qu'est-ce qu'il y a ? — Oui, oui, du joli monde ! reprit Margot. Celui-là m'a arraché les deux chapons que je venais servir, et le voilà parti avec ! — En voilà des façons ! grogna le maître tout dépité à la pensée de ses deux succulents chapons rôtis. Si seulement il m'en avait laissé un, que j'aie quelque chose à manger ! Vite, il cria à l'autre de s'arrêter, et l'autre n'en fit rien, mais courut de plus belle. Alors le maître se lança à sa poursuite, tenant toujours le couteau dans sa main, et tout en courant il lui criait : « Pas les deux ! Pas les deux ! » voulant dire par là qu'il ne réclamait qu'un seul des deux chapons. Mais après ce que lui avait dit la Margot, le fuyard comprit que son hôte n'en voulait qu'à une de ses oreilles et ne lui couperait pas les deux. Sur quoi il se mit à courir comme s'il avait le feu aux trousses, car il tenait, lui, à les ramener toutes les deux chez lui, ses oreilles. # Le Voyage du Petit-Poucet Un tailleur avait un fils qui était né minuscule et n'avait jamais dépassé la taille du pouce d'un homme ; c'était pourquoi on l'avait appelé le Petit-Poucet. Mais si petit qu'il fût, il avait du cœur au ventre et plus de courage que bien des grands. — Père, dit-il un jour, je veux et je dois m'en aller pour voir du pays et connaître le monde. — Tu as raison, fiston ! répondit le père qui prit une longue aiguille à tricoter, y souda une garde de cire à cacheter qu'il fondit sur la chandelle, et la lui tendit. Tiens ! voilà au moins une épée pour te défendre sur ta route ! lui dit-il. Le minuscule tailleur, qui voulait partager le dernier repas avec ses parents, sauta jusqu'à la cuisine pour voir un peu ce que Madame sa mère avait cuisiné comme festin d'adieu. — Madame ma mère, que nous donnes-tu aujourd'hui à manger ? demanda-t-il. — Regarde toi-même ! dit la mère. Alors le Petit-Poucet sauta dans la cheminée et regarda dans le chaudron ; mais comme il avait trop tendu le cou en se penchant sur la marmite, la vapeur qui montait du bouillon l'enleva et l'emporta par la cheminée. Un moment, il chevaucha les airs sur cette vapeur puis il redescendit par terre ; et le petit tailleur, qui se trouvait du coup au milieu du monde extérieur, commença son voyage et s'en alla d'abord s'engager chez un maître tailleur ; mais dans cette maison, la nourriture ne lui plaisait pas. — Madame la maîtresse, si vous ne nous donnez pas une meilleure nourriture, dit le Petit-Poucet, je m'en irai d'ici et demain de bonne heure, j'écrirai à la craie sur votre porte : « Trop de pommes de terre et pas assez de viande ; adieu, roi des patates ! » — Qu'est-ce que tu veux encore, petite sauterelle ? cria la maîtresse de maison en colère, empoignant un torchon pour en frapper notre Poucet. Mais le petit tailleur sauta se mettre à l'abri sous le dé, glissa un œil au-dehors et tira la langue à la maîtresse. — Je vais t'apprendre ! cria-t-elle en prenant le dé entre ses doigts pour s'emparer de l'insolent. Mais le dé était vide, car déjà le Petit-Poucet avait sauté se cacher dans le torchon ; et quand elle secoua le torchon pour le trouver, il s'était glissé dans une fente de la table. — Hé, hé ! Madame la maîtresse ! l'appela-t-il en sortant sa petite tête. Elle voulut le frapper d'un coup de torchon, mais il était déjà dans le tiroir, où elle finit quand même par le trouver, le prendre et le jeter dehors. Le petit tailleur s'en alla sans souci, marchant droit devant lui, et arriva ainsi dans une grande forêt, où il fit la rencontre de bandits qui s'apprêtaient à dévaliser le trésor du roi. En voyant le petit bout d'homme, ils se dirent : « Voilà un marmouset qui pourrait bien passer par un trou de serrure et qui nous servirait fort bien de passe-partout ! » — Holà ! toi, le géant Goliath, cria l'un d'eux, cela te dirait-il de venir avec nous à la salle du trésor ? Tu te glisserais à l'intérieur et tu nous passerais l'argent. Le Petit-Poucet réfléchit un moment, finit par accepter et s'en fut avec eux à la salle du trésor, dont il examina la porte du haut en bas pour voir si elle n'avait pas une bonne petite fente quelque part. Il ne lui fallut pas longtemps pour découvrir ce qu'il cherchait : une fente assez large pour qu'il pût s'y glisser. Il allait s'y engager, quand l'une des deux sentinelles en faction devant la porte l'aperçut et dit à son compagnon de garde : — Dis donc, qu'est-ce que c'est que cette vilaine araignée qui court par là ? Je vais l'écraser sous ma botte ! — Laisse donc aller cette pauvre bête qui ne t'a rien fait ! répondit l'autre soldat. Pendant ce temps, le Petit-Poucet avait heureusement passé à travers la fente et se trouvait à l'intérieur de la chambre du trésor. Il alla ouvrir la fenêtre, sous laquelle attendaient les voleurs, et il commença à leur jeter les écus d'or un à un. Il était en plein travail quand il entendit le roi qui venait admirer ses richesses, et vite, vite, il se cacha. Le roi remarqua bien que nombre de beaux écus d'or manquaient, mais il n'arrivait pas à comprendre qui avait bien pu les voler, puisque rien n'était fracturé et que toutes les serrures et tous les verrous étaient intacts et parfaitement fermés. Au bout d'un moment, le roi s'en alla et dit aux sentinelles devant la porte : « Ayez l'œil, vous autres, il y a quelqu'un qui en veut à mon or. » La porte refermée, Petit-Poucet s'était remis au travail, mais les sentinelles, de l'extérieur, entendirent les écus qui dansaient à l'intérieur et qui sonnaient cling ! cling ! cling ! Ils se précipitèrent à l'intérieur pour s'emparer du voleur. Ouiche donc ! Le Petit-Poucet les avait entendus dans leur lourde hâte, et il s'était montré beaucoup plus rapide, sautant dans un coin pour se cacher derrière un bel écu brillant. Il s'était glissé dessous et personne ne pouvait le voir ; alors il s'offrit le luxe d'appeler les gardes pour se moquer d'eux : « Hé ! hé ! Je suis ici ! » Les sentinelles accoururent, mais le temps qu'elles arrivent, il était déjà sous un autre écu, dans un autre coin, et leur criait : « Ho ! ho ! Je suis là ! » Les soldats y bondirent, mais le Petit-Poucet ne les avait pas attendus et criait d'un troisième endroit : « Ohé ! Je suis ici ! » Puis ailleurs, et encore ailleurs, et ainsi de suite jusqu'à ce que les soldats, exaspérés et las d'être moqués, s'en allèrent et reprirent leur garde devant la porte du trésor. Aussitôt les pièces d'or reprirent le chemin de la fenêtre et tous les écus y passèrent prestement, jusqu'à ce que le trésor fût parfaitement vide. La dernière pièce, Petit-Poucet l'expédia de toutes ses forces, sauta dessus et s'en alla avec elle par la fenêtre pour venir tomber au milieu des autres. Les bandits ne tarissaient pas d'éloges et multipliaient leurs félicitations : « Tu es un grand héros, finirent-ils par lui dire, veux-tu être notre chef ? » Le Petit-Poucet les remercia mais s'excusa, car, leur dit-il, il voulait d'abord voir le monde. Quand ils firent le partage du butin, notre minuscule tailleur ne put rien prendre qu'un petit sou, n'ayant pas la force de porter autre chose avec lui. Il boucla alors le ceinturon de son épée, souhaita le bonjour à la bande et prit la route entre ses jambes. Ici ou là, il entra travailler chez certains maîtres tailleurs, mais ce genre de travail ne lui plaisait guère et, pour finir, il loua ses services comme valet dans une auberge. Mais là, ce furent les servantes qui le prirent en grippe parce qu'elles n'arrivaient jamais à l'apercevoir, alors qu'il voyait tout ce qu'elles faisaient en cachette, se trouvant toujours là pour les surprendre et aller raconter aux patrons combien d'assiettées elles avaient mangées à table ou ce qu'elles avaient chipé dans le garde-manger pour leur compte personnel. « Tu n'y perdras rien pour attendre, pensèrent-elles, et nous te le ferons payer ! » Elles complotèrent, en cherchant quelque vilain tour à lui jouer. Un jour que l'une d'elles était en train de faucher dans le jardin, voyant le Petit-Poucet batifoler et gambader parmi les hautes herbes de la pelouse, elle s'empressa de faucher l'endroit et de le ramasser avec l'herbe, qu'elle alla bien vite porter aux vaches, en cachette. Parmi les vaches, il y en avait une grosse et noire, qui l'avala avec son herbe, mais sans lui faire de mal. Dans le ventre de la bête, il ne se plaisait pas, mais pas du tout, parce que c'était tout sombre et qu'il n'y avait pas la moindre lumière dans ces noires ténèbres. Quand on vint traire la vache, il se mit à crier : _Traich, trich, train_ _Le seau n'est-il pas bientôt plein ?_ Mais nul ne l'entendit à cause du bruit que faisait le lait en fusant dans le seau, et cela ne servit de rien. Un peu plus tard arriva l'aubergiste dans son étable : « Demain, dit-il devant la grosse vache noire, on va tuer et bouchoyer cette bête. » Petit-Poucet, dans le ventre de la vache, fut pris d'une telle peur qu'il se mit à crier de toute sa petite voix claire : — Laissez-moi d'abord sortir ! Je suis dedans ! — Mais où es-tu ? demanda le maître, qui avait fort bien entendu cette voix, mais ne savait pas d'où elle pouvait venir. — Dans la noire ! Dans la noire ! cria le Poucet. Mais le maître ne le comprit pas et s'en alla tout bonnement. Le lendemain matin la vache fut abattue, saignée et découpée. Par bonheur le Petit-Poucet passa entre les coups de hache et les coups de couteau sans y laisser sa vie, mais il resta prisonnier de la chair à saucisses ; et lorsque le boucher s'approcha et se mit à hacher, le marmouset hurla de toute la force de ses petits poumons : « Pas trop menu ! pas trop menu ! Je suis au milieu de la viande ! » Mais à quoi bon ? Avec le bruit que faisait le hachoir, personne ne pouvait rien entendre. Petit-Poucet se trouvait à présent jeté dans son plus grand péril, mais le péril donne du nerf et fait marcher les jambes : à force de sauter et de bondir de-ci de-là pour éviter le pire, il réussit à passer entre les couteaux du hachoir sans dommage pour ses membres, et il sauva sa peau. Sa peau et rien de plus, car sortir de là, il ne le pouvait pas, quoi qu'il fit : la vie qu'il venait de sauver n'avait au bout du compte pas d'avenir ailleurs qu'à l'intérieur d'une saucisse. Ce domicile était plutôt exigu, à vrai dire, et il lui fallut, de plus, se trouver suspendu dans la cheminée pour y être fumé, ce qui fit que le temps de cet interminable séjour lui parut plutôt long ! Mais enfin, en plein hiver, arriva le jour qu'il fut dépendu, car la saucisse était destinée à l'assiette d'un client. Aussi, quand l'aubergiste, dans sa cuisine, se mit à couper la saucisse en tranches, le Petit-Poucet fit-il bien attention de ne pas avancer sa tête au-dehors pour ne pas risquer de se faire couper le cou. Libéré, enfin, il respira le bon air du dehors et bondit pour se sauver. Car dans cette maison où il en avait tant vu, il n'avait pas l'intention de rester une seconde de plus : sa seule hâte et son unique pensée étant de reprendre la route pour aller voir du pays. Pourtant sa liberté ne fut pas de longue durée. En pleine campagne, il se trouva nez à nez avec un renard qui l'avala sans même y prendre garde, tout en rêvant à autre chose. — Eh ! monsieur le renard ! hurla le petit homme, je suis déjà au beau milieu de votre gosier, laissez-moi reprendre ma liberté ! — Tu as raison, répondit le renard, te manger toi, c'est tout autant que rien. Mais il faut que tu me promettes toutes les poules du poulailler de ton père, si tu veux que je te laisse aller. — De tout mon cœur ! répondit le Petit-Poucet. Les poules, tu les auras toutes jusqu'à la dernière, je te le promets ! Alors le renard lui rendit sa liberté et le porta lui-même jusque chez lui, dans la maison paternelle. Et quand le père retrouva son cher petit bout de fils, il fut si heureux qu'il donna bien volontiers ses poules au renard. — Et en plus, annonça triomphalement le Petit-Poucet à son père, je te rapporte une bonne petite somme d'argent ! Et il lui tendit la pièce d'un sou qu'il avait gagnée au cours de son périple. — Mais pourquoi le renard s'était-il vu donner toutes les malheureuses poules sans qu'elles eussent rien à dire ? — Eh bien, petit idiot, ton père aussi aime mieux son enfant que les poules de son poulailler ! # La Lumière bleue Il était une fois un soldat qui avait, pendant de longues années, fidèlement servi le roi ; mais il fut licencié quand la guerre fut terminée, en dépit des nombreuses blessures qui avaient fait de lui un invalide. Le roi s'adressa à lui en personne et lui dit : « Tu peux rentrer chez toi, je n'ai plus besoin de tes services ; mais tu n'as plus d'argent à attendre à présent, les soldes n'étant versées qu'à ceux qui sont à mon service. » Accablé de soucis et ne sachant comment gagner sa vie, le soldat s'éloigna et marcha tout le jour. Le soir, il se trouva dans une forêt où il vit, dans l'obscurité, briller une lumière ; il s'en approcha et arriva ainsi à une maison qu'habitait une sorcière. — Donne-moi asile pour la nuit, lui demanda-t-il, et si peu que ce soit à boire et à manger, sinon je vais tomber d'inanition ! — Holà ! s'écria la sorcière, qui est-ce qui donne quelque chose à un soldat vagabond ? Pourtant je vais me montrer charitable et t'accepter, à condition que tu fasses ce que je te demande. — Que veux-tu ? demanda le soldat. — Que tu me bêches mon jardin demain, dit la sorcière. Il accepta et travailla, le lendemain, autant qu'il le put et de toutes ses forces, mais le soir survint avant qu'il eût terminé son ouvrage. — Bon ! lui dit la sorcière, je vois bien que tu ne pourrais pas en faire plus aujourd'hui et je vais te garder une nuit de plus, à condition que demain, tu me fendes mon bois. Le soldat fendit du bois toute la journée et le soir, la sorcière lui offrit de le coucher une nuit encore. — Tu n'auras qu'à me faire un tout petit travail demain, lui dit-elle : j'ai un vieux puits à sec derrière la maison, au fond duquel j'ai laissé tomber ma lumière ; c'est une chandelle qui brûle avec une flamme bleue et qui ne s'éteint pas. Il te suffira de me la remonter. Le lendemain, la vieille femme le mena à son vieux puits et l'y fit descendre dans un panier attaché à la corde. Il trouva tout de suite la lumière bleue et fit un signe pour se faire remonter. La vieille femme le hissa en tirant la corde, mais quand il fut à la hauteur de la margelle, elle tendit la main pour prendre la lumière. — Non, déclara le soldat qui se méfiait de ses mauvaises intentions, tu n'auras ta chandelle que lorsque j'aurai, moi, les deux pieds sur la terre ferme ! Furieuse, la sorcière lâcha la corde et s'en alla, le laissant tomber au fond du puits où il se retrouva, le malheureux, sans pourtant s'être rien cassé ni fait de mal ; la lumière bleue éclairait toujours, mais à quoi cela lui servait-il ? Là où il était, il n'avait plus qu'à attendre la mort. Tout à ses tristes pensées, il fourra machinalement la main dans sa poche et y trouva sa pipe à demi bourrée. « Ce sera ma dernière consolation ! » se dit-il, et il l'alluma à la flamme bleue pour en tirer quelques bonnes bouffées. Quand la fumée eut envahi le fond du puits, un petit homme surgit tout soudain devant lui et demanda : — Maître, que désires-tu ? Quels sont tes ordres ? — Moi, s'étonna le soldat, quels ordres aurais-je à donner ? — Je dois faire tout ce que tu désires, répondit le petit homme. — Très bien, dans ce cas, tire-moi d'abord de ce puits ! Le nain le prit par la main et le conduisit par un chemin souterrain, mais sans oublier d'emporter avec lui la lumière bleue ; en cours de route, il lui montra les trésors accumulés et cachés là par la sorcière, et le soldat se bourra les poches d'or et en emporta autant qu'il pouvait en porter. Une fois dehors, il dit au petit homme : — Entre à présent chez la vieille sorcière, attache-la et livre-la à la justice ! Quelques instants plus tard, il la vit passer en coup de vent, à cheval sur un chat sauvage et poussant des hurlements affreux, puis le petit homme reparaissait presque aussitôt pour lui annoncer : — Tout est terminé et la sorcière est déjà pendue au gibet. Quels sont tes ordres à présent, maître ? — Rien pour l'instant, répondit le soldat ; tu peux rentrer chez toi. Mais trouve-toi à ma disposition immédiate aussitôt que je t'appellerai ! — Il te suffira d'allumer ta pipe à la lumière bleue, et je serai là, lui répondit le petit homme qui disparut aussitôt. Le soldat s'en revint à la ville d'où il était parti, choisit la meilleure auberge, se fit faire un bel habit, après quoi il se fit donner par l'aubergiste la chambre la plus confortable et la plus luxueuse qu'on pouvait lui préparer. Une fois que tout fut prêt, quand il fut lui-même bien installé, le soldat appela le petit homme et lui dit : — Le roi, que j'avais servi avec fidélité, m'a licencié en me laissant crever de faim : c'est pourquoi je voudrais à présent me venger ! — Que dois-je faire ? questionna le petit homme. — Ce soir, tard, quand la princesse sera couchée et endormie, tu me l'amèneras jusqu'ici, dans son sommeil, pour qu'elle me fasse office de servante. — Pour moi, répondit le petit homme, la chose n'est que facile ; mais pour toi, elle est pleine de danger dans ses conséquences, car si jamais cela se sait, tu ne t'en tireras pas à bon compte. Le douzième coup de minuit sonnait encore quand la porte s'ouvrit brusquement : le petit homme arriva dans la chambre du soldat, portant la princesse. — Ah ! te voilà ! s'exclama le soldat. Alors mets-toi au travail, et en vitesse ! Attrape le balai et fais-moi le ménage de ma chambre ! Dès qu'elle eut fini de balayer, il lui commanda de venir jusqu'à son fauteuil, allongea les jambes et dit : « Tire-moi mes bottes ! » Il les lui lança ensuite à travers la figure et elle dut les ramasser, les lui décrotter, les lui faire briller et reluire impeccablement. Les yeux mi-clos, sans une protestation ni un soupir, elle fit tout ce qu'il lui ordonna jusqu'au premier chant du coq ; alors le petit homme la remporta au palais royal et la recoucha dans son lit. Le matin, après son réveil, la princesse s'en fut trouver son père et lui raconta qu'elle avait eu un rêve étrange. — J'ai été emportée comme par un éclair dans les rues, lui dit-elle, et amenée dans la chambre d'un soldat auquel j'ai dû servir de domestique, obéissant à tous ses ordres et lui faisant les travaux les plus rebutants : il m'a fallu lui balayer sa chambre et lui cirer ses bottes. Ce n'était qu'un rêve, ajouta-t-elle, et pourtant je suis aussi exténuée que si je l'avais réellement vécu. — Le rêve aussi pourrait avoir été réel, dit le roi, et je te donnerai un conseil : bourre ta poche de petits pois et perce-la d'un petit trou qui les laisse passer ; comme cela, si l'on vient te chercher de nouveau, ils marqueront la trace de ton passage dans les rues. Mais tandis que le roi parlait ainsi, le petit homme était là, invisible, et il entendit tout. Dans la nuit, quand il emporta la princesse endormie par les rues, il y eut bien quelques petits pois qui tombèrent, par-ci par-là, de sa poche ; mais l'indication qu'ils pouvaient donner était nulle, car le malin petit homme en avait parsemé toutes les rues. Et jusqu'au chant du coq, de nouveau, la princesse dut travailler et obéir comme la plus humble des servantes. Le lendemain matin, le roi envoya ses gens pour relever sa trace, mais à quoi pouvaient-ils aboutir, quand, dans toutes les rues, ils trouvèrent les enfants des pauvres en train de ramasser des petits pois et déclarant, émerveillés : — Il en a plu cette nuit ! — Il faut que nous trouvions autre chose, décida le roi. Ce soir, en allant te coucher, tu resteras chaussée ; et avant de revenir de là-bas, tu cacheras l'une de tes chaussures : je saurai bien faire en sorte qu'elle soit retrouvée. Le petit homme noir, cette fois encore, avait surpris la conversation ; le soir, quand le soldat désira qu'il allât encore chercher la princesse, il voulut le détourner de son projet en lui disant qu'il ne voyait pas le moyen de déjouer cette ruse, et que si la chaussure était découverte chez lui, cela ne pourrait que tourner très mal. « Fais ce que je te dis ! » répondit le soldat ; et la princesse, pour la troisième nuit consécutive, dut accomplir sa besogne de servante. Mais avant d'être retransportée au palais, elle avait caché sa chaussure sous le lit. Le lendemain matin, le roi fit rechercher par toute la ville la chaussure de sa fille, qui fut trouvée chez le soldat ; mais il avait lui-même, sur les instances du petit homme, quitté la ville quelques instants auparavant. Il n'en fut pas moins rejoint, arrêté et jeté en prison, alors que, dans la précipitation de sa fuite, il avait oublié et laissé derrière lui ce qu'il avait de plus précieux : son or et la lumière bleue ; il n'avait plus en poche qu'un unique ducat. Dans ses chaînes, debout à la fenêtre de son cachot, il vit passer l'un de ses anciens camarades dans la rue et frappa au carreau pour attirer son attention. Lorsque le camarade se fut approché assez près pour l'entendre, il lui cria : « Sois bon, et va me chercher le petit baluchon que j'ai laissé à l'auberge : je te donnerai un ducat. » Le camarade courut à l'auberge et lui rapporta peu après son bien tant désiré. Dès qu'il se retrouva seul, le soldat tira sa pipe et l'alluma à la lumière bleue pour faire venir le petit homme noir. « Sois sans crainte, dit le petit homme à son maître ; laisse-les faire et t'emmener où ils voudront, pourvu que tu aies avec toi la lumière bleue. » Le soldat comparut le lendemain devant le tribunal, et le juge prononça contre lui la sentence de mort, bien qu'il ne fût coupable de rien. Comme on allait l'emmener sur les lieux du supplice, il demanda au roi une ultime grâce. — Laquelle ? s'enquit le roi. — Qu'il me soit permis de fumer une dernière pipe en cours de route. — Tu peux en fumer trois, déclara le roi, mais ne va pas t'imaginer que je te ferai grâce de la vie ! Alors le soldat sortit sa pipe et l'alluma à la lumière bleue pour en tirer deux ou trois bouffées, et déjà le petit homme se trouvait là, devant lui, serrant un petit gourdin dans sa petite main. — Que commande mon maître ? demanda-t-il. — Bâtonne-moi ces mauvais juges et leurs sbires à les laisser sur le carreau, dit-il, et n'épargne pas le roi qui m'a si indignement traité ! Le petit homme tomba sur eux comme la foudre, frappant ici et là, en zigzag, et à peine son gourdin en avait-il touché un qu'il restait cloué au sol, n'osant plus bouger. Le roi, dans son épouvante, en fut réduit aux supplications et aux prières, allant jusqu'à faire don au soldat, pour seulement avoir la vie sauve, de son royaume et de sa fille comme épouse. # SUPPLÉMENT PÉDAGOGIQUE ## Fiche élève 1 : souvenez-vous des contes de votre enfance ! ### 1. Langue a. Trouvez deux homophones du mot « conte ». b. Employez chacun de ces trois termes dans trois phrases de votre invention permettant d'en saisir le sens. ### 2. Vous avez déjà lu des contes à l'école primaire. Vous souvenez-vous des titres ? ### 3. Voici des noms de conteurs célèbres. Faites une recherche dans un dictionnaire des noms propres, au C.D.I. ou sur un moteur de recherche pour compléter le tableau suivant : Nom \| Siècle \| Langue d'écriture \| Un titre au choix ---\|---\|---\|--- Charles Perrault \| \| \| Amadou Hampâté Bâ \| \| \| Lewis Carroll \| \| \| Jacob et Wilhelm Grimm \| \| \| Roald Dahl \| \| \| Hans Christian Andersen \| \| \| Anonyme \| \| \| « Ali Baba et les quarante voleurs » N'hésitez pas à lire ces contes. ## Fiche élève 2 : observez ! ### 1. Décrivez la première de couverture. ### 2. Grâce à cette couverture, qu'imaginez-vous trouver dans ce recueil ? Le saviez-vous ? Un recueil est un livre qui recueille, qui réunit plusieurs écrits. On peut trouver par exemple des recueils de poésies, de récits portant sur un thème choisi, ou encore des recueils de lois. Les mots « anthologie », « florilège », « annales » ou « compilation » sont des synonymes du terme « recueil ». ## Fiche élève 3 : entrez dans l'histoire ! ### 1. Recopiez et remplissez le tableau ci-dessous pour comprendre comment sont ancrées les histoires. Conte \| Premiers mots du récit \| Lieu du récit (s'il est exprimé) \| Époque du récit (si elle est exprimée) \| Les deux principaux temps verbaux utilisés ---\|---\|---\|---\|--- « Blanche-Neige » \| \| \| \| « Les Trois Fileuses » \| \| \| \| « Le Fiancé brigand » \| \| \| \| « La Lumière bleue » \| \| \| \| ### 2. Que ressentez-vous lorsque vous entendez la formule d'entrée « il était une fois » ? Bilan Le cadre spatio-temporel d'un conte est indéterminé. En effet, l'histoire se déroule dans un passé lointain et un lieu géographique imprécis. La formule d'entrée, souvent utilisée, permet de s'immerger dans un monde imaginaire. Le saviez-vous ? On doit la formule d'entrée « il était une fois » à Charles Perrault. Elle est réutilisée dans de nombreuses langues, notamment en anglais ( _once upon a time_ ), en allemand ( _es war einmal_ ) ou encore en italien ( _c'era una volta_ ). On retrouve souvent la même structure de phrase « il était une fois, quelqu'un qui... », ou encore « il était une fois, quelque part... ». ## Fiche élève 4 : avez-vous bien lu ? ### 1. « Blanche-Neige » a. Pourquoi Blanche-Neige s'appelle-t-elle ainsi ? b. Pour quelle raison le chasseur ne la tue-t-il pas ? c. Quel stratagème le chasseur met-il en place afin de faire croire à la reine qu'il lui a obéi ? d. Quel est le métier des sept nains ? Citez le texte pour justifier votre réponse. e. Quels sont les trois différents pièges que la reine tend à Blanche-Neige pour la tuer ? ### 2. « Les Trois Fileuses » a. Quel est le principal défaut de l'héroïne ? b. Chacune des fileuses a un défaut physique. Quels sont-ils ? c. À quelle condition les trois fileuses viennent-elles au secours de l'héroïne ? ### 3. « La Lumière bleue » a. Quelle est l'injustice que subit le soldat au début du conte ? b. Que se passe-t-il lorsque le soldat allume sa pipe à l'aide de la lumière bleue ? c. Quel est le souhait, très risqué, du soldat ? d. Par quel stratagème le roi parvient-il à retrouver ce soldat ? e. Quel est le dénouement pour le soldat ? ## Fiche élève 5 : observez les personnages ### 1. Recopiez et remplissez le tableau ci-dessous pour comprendre comment sont élaborés les personnages des contes. Conte \| Nom du personnage \| Caractéristiques physiques (expressions à relever dans le texte) \| Caractéristiques morales (expressions à relever dans le texte) ---\|---\|---\|--- « Jeannot et Margot » \| La vieille \| \| « Cendrillon » \| Cendrillon \| \| « Margot-la-Malice » \| Margot-la-Malice \| \| ### 2. Trouvez un synonyme et un antonyme de chaque caractéristique relevée. ### Bilan Les personnages des contes sont souvent stéréotypés : leur aspect physique correspond à leur caractère. Le nom du personnage peut révéler une caractéristique physique (Le Petit Chaperon rouge, Blanche-Neige, Cendrillon, etc.), un trait de caractère (la méchante sorcière, Margot-la-Malice), ou encore une fonction (le Roi, la Reine, le Père, etc.). La mémorisation des noms est ainsi facilitée lors de la transmission orale des contes. ## Fiche élève 6 : décrivez ### 1. Revoyez les différentes valeurs de l'imparfait. ### 2. Préparation de rédaction En binôme ou en petits groupes, listez différentes expressions qui peuvent être utilisées dans une description pour remplacer les verbes « être » et « avoir ». Cette liste vous permettra d'enrichir votre rédaction. ### 3. Rédaction Décrivez à l'imparfait une sorcière ou une princesse de votre invention. Votre production sera composée de deux paragraphes : l'un mettant en valeur ses caractéristiques physiques, l'autre ses caractéristiques morales. N'oubliez pas de donner un nom à votre personnage. Vous pouvez pour cela vous aider d'une image (trouvée dans un livre de contes, ou sur Internet). ## Fiche élève 7 : étudiez le merveilleux Le mot « merveilleux » vient du latin _mirabilia_ qui signifie « les choses qui étonnent ». ### 1. « L'Oiseau d'Ourdi » Quel objet est magique ? Pourquoi est-il magique ? ### 2. « Blanche-Neige » Pourquoi peut-on dire que le miroir de la reine est merveilleux ? ### 3. « Jeannot et Margot » et « La Lumière bleue » Quel est le type de personnage merveilleux que l'on retrouve dans ces deux contes ? ### 4. « La Lumière bleue » Quel est le personnage surnaturel ? ### 5. « Contes du crapaud » Que fait d'extraordinaire le crapaud de chacun de ces deux contes ? ### 6. « Cendrillon » Pourquoi peut-on dire que la métamorphose de Cendrillon est magique ? ### Bilan En littérature, on appelle merveilleux l'irruption du surnaturel dans un récit. Les éléments merveilleux peuvent être des objets (un tapis volant, une baguette magique, des bottes de sept lieues, etc.), des personnages (un ogre, une fée, une sorcière, etc.) ou des événements (comme une métamorphose ou un ensorcellement). ## Fiche élève 8 : retenez l'orthographe Votre professeur vous dictera un passage du conte « Chat et souris associés » situé entre le début du texte et « le petit pot de graisse fut mis en sécurité ». ### Comment préparer une dictée ? 1. Lisez plusieurs fois le passage et comprenez-le bien (si nécessaire, cherchez la définition des mots inconnus, comme celle du verbe « consentir »). 2. Observez les difficultés orthographiques (comme dans le mot « audace ») et soulignez-les. 3. Faites une première dictée sur une partie du texte avec vos parents ou un camarade. 4. Listez les erreurs commises, cherchez-en l'explication (revoyez par exemple la différence entre « ou » et « où ») et mémorisez-en la graphie correcte (si besoin, recopiez les mots difficiles pour vous plusieurs fois). 5. Faites-vous dicter ce passage à nouveau, jusqu'à ne plus faire d'erreur. 6. Recommencez les étapes 3 à 5 avec une autre partie de l'extrait. Après votre préparation, vous devez pouvoir écrire entièrement cet extrait et connaître les « pièges » à éviter pour ne plus faire d'erreur. ## Fiche élève 9 : étudiez la structure – « La Belle au bois dormant » ### 1. La situation initiale Que s'apprête à célébrer le royaume ? ### 2. L'élément perturbateur Quel événement perturbe la fête ? ### 3. Les péripéties a. Effectuez une recherche afin de comprendre ce qu'est un fuseau. b. Qu'arrive-t-il à la princesse ? c. Quelles sont les conséquences de cet événement pour le royaume ? d. Pourquoi peut-on dire que le prince fait preuve de courage lorsqu'il décide d'aller retrouver la princesse Fleur-d'Épine ? ### 4. L'élément de résolution Quel exploit accomplit le prince ? ### 5. La situation finale Pourquoi peut-on dire que le conte se termine bien ? ### Bilan Les contes sont souvent construits à partir d'un même schéma. Ces cinq différentes étapes sont modulables. Les connaître permet de mieux comprendre le déroulement de l'action, et de les utiliser comme support de brouillon lorsque l'on veut soi-même écrire un conte. ## Fiche élève 10 : étudiez la morale ### 1. « L'Oiseau d'Ourdi » a. Quelle leçon doit-on tirer du conte ? b. Cette leçon, la morale de l'histoire, est-elle exprimée clairement ou le lecteur doit-il la déduire lui-même ? ### 2. « Cendrillon » a. Quelle leçon doit-on tirer de « Cendrillon » ? b. Est-elle exprimée clairement ou le lecteur doit-il la déduire lui-même ? ### 3. À chaque conte, sa (ou ses) morale(s) Saurez-vous relier les contes aux morales qui leur correspondent ? Attention, il peut y avoir plusieurs morales pour un même conte. Conte \| Morale ---\|--- « Jeannot et Margot » \| Il ne faut pas s'attacher à ce qui est éphémère, comme la beauté. « Chat et souris associés » \| Il ne faut pas rejeter les personnes dont l'apparence physique est hors du commun. « Cendrillon » \| L'ingratitude est toujours punie. « Les Trois Fileuses » \| Quels que soient les accords passés, c'est toujours le plus fort qui vainc. « La Lumière bleue » \| Il faut se soutenir au sein d'une même famille. « Blanche-Neige » \| Il ne faut pas accepter de cadeaux d'inconnus. \| La méchanceté et l'hypocrisie sont punies, la bonté, elle, est récompensée. ### Bilan Outre le divertissement du lecteur à travers une histoire imaginaire, les contes ont pour objectif de lui transmettre une leçon. Si cette leçon est exprimée clairement, il s'agit d'une morale explicite ; si c'est au lecteur de la déduire, il s'agit d'une morale implicite. ### Pour aller plus loin Visionnez le spot publicitaire pour la marque Badoit, qui reprend et transforme le conte de « Cendrillon ». 1. Quelle nouvelle morale cette publicité propose-t-elle au conte ? 2. Quelles caractéristiques de la boisson cette publicité présente-t-elle ? ## Fiche élève 11 : interrogez-vous sur la fonction des contes 1. Pour qui sont écrits les contes des frères Grimm ? 2. À quoi ces contes vous permettent-ils de réfléchir de façon générale ? 3. Dans quels autres courts écrits littéraires retrouve-t-on une morale ? 4. Pourquoi utilise-t-on des histoires imaginaires pour faire réfléchir petits et grands ? ## Fiche élève 12 : exprimez-vous ### Exposé En binôme, étudiez la reprise d'un conte dans une autre œuvre (littéraire, picturale, théâtrale, cinématographique, musicale, etc.). Pour cela, vous pouvez par exemple effectuer une recherche sur un conte que vous avez choisi dans le recueil ou parmi les lectures cursives. 1. Notez les références précises des deux œuvres (date, nom de l'artiste, pays de l'artiste). 2. Quelles sont les différences de forme entre les deux versions ? 3. Y a-t-il des différences entre l'histoire des deux versions ? Si oui, quelles sont les principales modifications ? 4. Quelle version préférez-vous ? Pourquoi ? ### Pour aller plus loin – Livres _Les Mille et Une Nuits_ , abrégés par V. Charpentier, éd. École des loisirs, 2005. Amadou Hampâté Bâ, _Petit Bodiel et autres contes de la savane_ , éd. Stock, 2006. Antoine de Saint Exupéry, _Le Petit Prince_ , éd. Gallimard, 1946. J.M.G. Le Clézio, _Mondo et autres histoires_ , éd. Gallimard, 1982. Erik Orsenna, _La grammaire est une chanson douce_ , éd. Stock, 2001. L. Frank Baum, _Le Magicien d'Oz_ , éd. Gallimard, 1998. – Téléfilms Jacques Demy, _Peau d'âne_ , 1970. Jean Cocteau, _La Belle et la Bête_ , 1946 (en noir et blanc). Paul Grimault, _Le Roi et l'Oiseau_ , 1980 (dessin animé avec des textes de Jacques Prévert, d'après _La Bergère et le Ramoneur_ d'Andersen). Les adaptations par Disney de nombreux contes ( _Alice au pays des merveilles_ , _Cendrillon_ , _Blanche Neige_ , etc.). TABLE Blanche-Neige Les Trois Fileuses Chat et souris associés La Belle au Bois Dormant ou la Princesse Fleur-d'Épine Le Fiancé brigand Jeannot et Margot Le Conte du crapaud Cendrillon L'Oiseau d'Ourdi (ou Barbe-Bleue dans la poésie populaire allemande) Le Petit Chaperon Rouge (version bavaroise) Le Vieux Sultan Margot-la-Malice Le Voyage du Petit-Poucet La Lumière bleue Supplément pédagogique Dans la même collection Notes . On ne sait généralement plus aujourd'hui que c'était le nom d'un chaudron qui restait dans l'âtre. . Annonceur : Danone. Produit : Badoit. Période : octobre 2002. Agence : Louis XIV DDB. Description : Cendrillon, revu et corrigé. On pourra trouver cette publicité notamment sur le lien suivant : http://www.ina.fr/video/PUB2393649115	{ "pile_set_name": "Books3" }
In order for printers to operate effectively, they must be able to perform different tasks during a print cycle, such as picking up a sheet of paper, feeding it into the printer and expelling it after printing. To perform such tasks, printers generally have different motor-driven gear trains. For example, to pick up a sheet of paper, a printer may have one gear train that, when engaged, triggers a mechanism that can pick up the next sheet of paper. The printer would have another gear train to eject the sheet of paper after printing. Accordingly, printers generally include numerous gears and different gear trains. Additionally, a printer may include a multiplexer to engage different gear trains. For example, the printer described in U.S. Pat. No. 4,728,963, naming Steve O. Rasmussen et al. as inventors, includes a multiplexer. In that printer, the multiplexer has three multiplexer gears. A different multiplexer gear is required for each different task that the printer can perform. Each multiplexer gear is engaged by moving a trigger. Different printer tasks are actuated by engaging different multiplexer gears. A problem with printers having multiplexer gears and multiple gear trains is that numerous, complex and costly gear mechansims are required. This invention offers a printer capable of performing different tasks without requiring complex gear trains and multiplexer gears. In other words, the invented printer includes a carriage-actuated clutch that may be used to trigger different tasks. Thus, the invented printer may be manufactured much less expensively and with fewer parts than existing printers. As stated, one task that a printer must perform is to pick a sheet of paper and feed it into the printer. To accomplish this a printer must have a paper-feed mechanism. One type of paper-feed mechanism, as described in U.S. Pat. No. 4,728,963, includes a spring-biased plate that articulates between raised and lowered positions. Paper is stacked on the plate and when a certain gear train is engaged, the plate is allowed to articulate to its raised position. In its raised position, drive rollers contact the top sheet on the stack and feed it into the printer. Thereafter, the gear train causes the plate to articulate to its lowered position. As stated, such a paper-feed mechanism may be triggered by a multiplexer and requires a separate multiplexer gear and a complex and costly gear train. The invented printer includes a paper-feed mechanism that can be triggered by the same carriage-actuated clutch that may be used to trigger other functions. Additionally, the paper-feed mechanism of the invented printer does not require a gear train that causes the plate to articulate between raised and lowered positions. Thus, the invented printer includes a simpler and more economical paper-feed mechanism than is present in existing printers.	{ "pile_set_name": "USPTO Backgrounds" }
South Sudanese nationality law The South Sudanese nationality law dates back to 7 July 2011, when South Sudan declared independence. It is based upon the Constitution of South Sudan. Acquisition of South Sudanese citizenship South Sudanese citizenship can be acquired in the following ways: : By descent if at least one of the parents is a South Sudanese citizen. : By birth in South Sudan (unless citizenship of another country has been acquired by descent), or a child found in South Sudan whose parents are unknown. By naturalisation South Sudanese nationality law was adopted immediately after the secession of South Sudan from Sudan and Article 8 states that: "(1) A person born before or after this Act has entered into force shall be considered a South Sudanese National by birth if such person meets any of the following requirements— (a) any Parents, grandparents or great-grandparents of such a person, on the male or female line, were born in South Sudan; or (b) such person belongs to one of the indigenous ethnic communities of South Sudan. (2) A person shall be considered a South Sudanese National by birth, if at the time of the coming into force of this Act— (a) he or she has been domiciled in South Sudan since 1.1.1956; or (b) if any of his or her parents or grandparents have been domiciled in South Sudan since 1.1.1956. (3) A person born after the commencement of this Act, shall be a South Sudanese National by birth if his or her father or mother was a South Sudanese National by birth or naturalization at the time of the birth of such a person. (4) A person who is or was first found in South Sudan as a deserted infant of unknown Parents shall, until the contrary is proved, be deemed to be a South Sudanese National by birth." Dual citizenship South Sudan allows its citizens and other countries citizens to hold foreign citizenship in addition to their South Sudanese or home citizenship. Some countries, however, do not permit multiple citizenship e.g. adults who acquired South Sudanese and Japanese citizenship by birth must declare, to the latter's Ministry of Justice, before turning 22, which citizenship they want to keep. Travel freedom of South Sudanese citizens Visa requirements for South Sudanese citizens are administrative entry restrictions by the authorities of other states placed on citizens of South Sudan. As of 1 January 2017, South Sudanese citizens had visa-free or visa on arrival access to 145 countries and territories, ranking the South Sudanese passport 96th in terms of travel freedom (tied with Ethiopian, Kosovan and Lebanese passports) according to the Henley visa restrictions index. References Category:Foreign relations of South Sudan Category:Nationality law Category:South Sudanese law	{ "pile_set_name": "Wikipedia (en)" }
Everyone knows that 80’s action movies are the best action movies ever! Adventure, explosions, cars, power-ballads, excitement, justice, ninjas, bad science, guns, flags, and outrageous fun: all finished within an hour and a half. Well, now you can make one with just a couple of friends and six-sided dice! 90 Minutes Of Mayhem uses an intuitive, rules-lite game engine to ensure that your roleplaying group can collaboratively tell an entire movie within an hour and a half, whilst still having the full experience of the greatest decade for action and adventure! Features: #A simple Five Step Character Creation System! #One simple game mechanic to resolve everything! #A full guide to directing your 80s action movie! Please note: friends and six-sided dice are not included with your purchase The new 32 page Full Theatrical release version of the one sheet game is now available now from the Etsy Store for £5.50 (plus P&P). It is also available from Niche Comics in Huntington, The Cambridge Army & Navy Stores in Cambridge, and Nostalgia & Comics in Birmingham. And if you liked the game then please fill out the Audience Response Card, and your Stars and Movies may well turn up in the inevitable Directors Cut!! FAQ About ThE Theatrical Release Q: What are the differences between this and the Test-Audience edition? A: Each section has been expanded, we put in some more bits based on feedback/problems people were having with the first one, added in a lot more gags, and got some more awesome art added by Laura Watton. It's also now a 32 page A5 book, rather than a one sided sheet of paper with tiny, tiny text. Q: Other than the book, what do I need to run 90 Minutes of Mayhem? A: You're going to need friends to play it with, along with 5 dice, a pen, and a bit of paper per person. Probably a time keeping device of some description as well. Q: Does 90 Minutes of Mayhem finally have a formal damage system? A: Yes, we finally put one in. It's all explained in the book. Q: What's the difference between The Beat Sheet, The Pitch, and The Script? A: This is now really carefully explained in the book. Q: Can I play makes action films from other decades? A: Yes, even though everyone still knows the best ones were made in the 80's we have added in a lot more alternatives in the book. There are also different beatsheets to play with and a whole page of alternative genres. Q: How long does it take to make a movie? A: Pre-Production (actors making Stars, The Director putting together a pitch) should be about 10 to 15 minutes at the most. The movie itself should take 90 Minutes. Anything less is a TV Movie, anything else is sending the audience to sleep.	{ "pile_set_name": "OpenWebText2" }
Support for Relatives Bereaved by Psychiatric Patient Suicide: National Confidential Inquiry Into Suicide and Homicide Findings. International suicide prevention strategies recommend providing support to families bereaved by suicide. The study objectives were to measure the proportion of cases in which psychiatric professionals contact next of kin after a patient's suicide and to investigate whether specific, potentially stigmatizing patient characteristics influence whether the family is contacted. Annual survey data from England and Wales (2003-2012) were used to identify 11,572 suicide cases among psychiatric patients. Multivariate regression analysis was used to describe the association between specific covariates (chosen on the basis of clinical judgment and the published literature) and the probability that psychiatric staff would contact bereaved relatives of the deceased. Relatives were not contacted after the death in 33% of cases. Contrary to the hypothesis, a violent method of suicide was independently associated with greater likelihood of contact with relatives (adjusted odds ratio=1.67). Four patient factors (forensic history, unemployment, and primary diagnosis of alcohol or drug dependence or misuse) were independently associated with less likelihood of contact with relatives. Patients' race-ethnicity and recent alcohol or drug misuse were not associated with contact with relatives. Four stigmatizing patient-related factors reduced the likelihood of contacting next of kin after patient suicide, suggesting inequitable access to support after a potentially traumatic bereavement. Given the association of suicide bereavement with suicide attempt, and the possibility of relatives' shared risk factors for suicide, British psychiatric services should provide more support to relatives after patient suicide.	{ "pile_set_name": "PubMed Abstracts" }
Q: Does my "hollow list" structure exist already? I came up with an implementation in c for arrays which can be extremely large yet only use an amount of memory proportional to how much data you have written to it. What I want to know is if there is a name for this kind of list or structure. Here is my code in C for the structure and example use: #include <stdlib.h> #include <stdbool.h> #include <stdio.h> typedef struct hollow_list hollow_list; struct hollow_list{ unsigned int size; void value; bool written; hollow_list children; }; //Creates a hollow list and allocates all of the needed memory hollow_list hollow_list_create(unsigned int size){ hollow_list output; output = (hollow_list) {.size = size, .value = (void ) 0, .written = calloc(size, sizeof(bool)), .children = calloc(size, sizeof(hollow_list))}; return output; } //Frees all memory of associated with a hollow list and its children void hollow_list_free(hollow_list l, bool free_values){ int i; for(i = 0; i < l->size; i++){ hollow_list_free(l->children + i, free_values); } if(free_values){ free(l->value); } free(l); } //Reads from the hollow list and returns a pointer to the item's data void hollow_list_read(hollow_list l, unsigned int index){ if(index == 0){ return l->value; } unsigned int bit_checker; bit_checker = 1<<(l->size - 1); int i; for(i = 0; i < l->size; i++){ if(bit_checker & index){ if(l->written[i] == true){ return hollow_list_read(l->children + i, bit_checker ^ index); } else { return (void ) 0; } } bit_checker >>= 1; } } //Writes to the hollow list, allocating memory only as it needs void hollow_list_write(hollow_list l, unsigned int index, void value){ if(index == 0){ l->value = value; } else { unsigned int bit_checker; bit_checker = 1<<(l->size - 1); int i; for(i = 0; i < l->size; i++){ if(bit_checker & index){ if(!l->written[i]){ l->children[i] = hollow_list_create(l->size - i - 1); l->written[i] = true; } hollow_list_write(l->children + i, bit_checker ^ index, value); break; } bit_checker >>= 1; } } } int main(){ int a = 221; int b = 222; int c = 9; int d = 89; hollow_list h; h = hollow_list_create(30); hollow_list_write(&h, 221999999, &a); hollow_list_write(&h, 9999, &b); hollow_list_write(&h, 22999999, &c); hollow_list_write(&h, 1, &d); printf("%d\n", ((int ) hollow_list_read(&h, 221999999))); printf("%d\n", ((int ) hollow_list_read(&h, 9999))); printf("%d\n", ((int ) hollow_list_read(&h, 22999999))); printf("%d\n", ((int ) hollow_list_read(&h, 1))); printf("\n"); printf("\n"); printf("\n"); printf("%d\n", a); printf("%d\n", b); printf("%d\n", c); printf("%d\n", d); c = 56; printf("%d\n", ((int ) hollow_list_read(&h, 22999999))); } These lists seem to be really useful alternatives to linked lists, and fast too: the worst case scenario for a read or write to a list is O(log n) for a list of n elements. I'd be surprised if this kind of structure didn't already exist, but I would simply like to know what it is called so I could refer to it by it's proper name haha. A: This is a sparse array data structure, but I haven't seen this exact data structure before. It looks like your code builds a balanced binary tree, but with a particularly clever representation in memory. One difference between other balanced binary trees is that the running time of your approach is $O(\lg m)$ where $m$ is the largest index written, whereas other balanced binary tree data structures (e.g., red-black trees) have a $O(\lg n)$ running time where $n$ is the number of indices written to. Since $m \ge n$, in principle your approach might be slower if $n$ is small (few elements have been written) but the indices are large. However in practice I don't expect this to make much difference, ordinarily.	{ "pile_set_name": "StackExchange" }
JEWISH NEW YEAR VALUES – POSITIVE THOUGHTS Never heard of Old Values running for President but we bet he or she would do a better job than those currently running. Rabbi Regev of Temple Sinai in Oakland ca was refreshingly inclusive in his... In the Course of One Administration…. From Pat Tillman to Colin Kaepernick- Football’s version of Obama ? From A Color Blind Society To One Focused on Race But wait, it’s not only about Colin Kaepernick . In South Carolina a high school... The New KKK in reverse Milwaukee Police Chief Speaks from Experience & SOLUTIONS for Trump to Get On Track Police Chief David Clark is from Milwaukee County and thereby capable of directly commenting on the latest ‘race... RoadTo Success Surprising to see Rock actually present a positive,true message that even Obama and so-called black leaders rarely do http://buff.ly/29sQzlu ***************************** Social Survey – Win Money :TELL US IF YOU AGREE WITH OUR PROPOSED SOLUTION... We weren’t going to post this ‘ant-white rant’ by so-called comic Jesse Williams but we thought it would speak for itself: Anyone with good judgment will come away with, hopefully, her own opinion that this is the kind of thing that DOES...	{ "pile_set_name": "Pile-CC" }
Q: Input text showing on next row On http://www.bigbasket.com, the Input for "Qty" is coming on the next row in case of IE9. Its fine on IE7/8, FF and Chrome. But for some reason it is breaking on IE9. A: The issue might be the fact that you are not using the label correctly. The Label should contain the text "qty", and the input should not be inside the label. E.g. <label for="p10000159_qty">Qty:</label> <input id="p10000159_qty" class="qtyTxtField" name="pqty" maxLength="2" value="1" type="text"> EDIT it works if you either reduce the width of .qtyTextField by 3px, or take off margin-left:3px. It is shifting onto the next row because there's not enough room on that row for IE.	{ "pile_set_name": "StackExchange" }
Q: Looping within a regular expression can regex able to find a patter to this? {{foo.bar1.bar2.bar3}} where in the groups would be $1 = foo $2 = bar1 $3 = bar2 $4 = bar3 and so on.. it would be like re-doing the expression over and over again until it fails to get a match. the current expression i am working on is (?:\{{2})([\w]+).([\w]+)(?:\}{2}) Here's a link from regexr. http://regexr.com?3203h -- ok I guess i didn't explain well what I'm trying to achieve here. let's say I am trying to replace all .barX inside a {{foo . . . }} my expected results should be $foo->bar1->bar2->bar3 A: This should work, assuming no braces are allowed within the match: preg_match_all( '%(?<= # Assert that the previous character(s) are either \{\{ # {{ \| # or \. # . ) # End of lookbehind [^{}.]* # Match any number of characters besides braces/dots. (?= # Assert that the following regex can be matched here: (?: # Try to match \. # a dot, followed by [^{}]* # any number of characters except braces )? # optionally \}\} # Match }} ) # End of lookahead%x', $subject, $result, PREG_PATTERN_ORDER); $result = $result[0];	{ "pile_set_name": "StackExchange" }
SANTA BARBARA -- In a conciliatory gesture to a grieving family, authorities are dismissing a criminal complaint over "stolen candles" against Isla Vista stabbing victim Cheng Yuan "James" Hong, which stemmed from a bizarre January spat with roommate and eventual mass murderer Elliot Rodger. Santa Barbara County District Attorney Joyce E. Dudley told this newspaper that late Friday morning, she filed a motion to dismiss the case involving Hong, one of six people Rodger killed one week earlier. She said the infraction was minor enough to be outweighed by the healing benefit to Hong's San Jose family. "It's in the best interest of justice," Dudley said. "It's so small. I believe it's important to the Hongs that their son has no criminal history whatsoever. It's the right thing to do." Elliot Rodger, James Hong That's in line with the feelings of the family, which described the theft claim as overblown. It gained a wide profile when in the wake of the killings, the Santa Barbara County Sheriff's Office reported Rodger initiated a citizen's arrest of Hong after accusing him of stealing $22 worth of candles. Hong was booked and released and later paid a fine. But Hong's brother said Rodger initiated the conflict when he took away Hong's measuring cup out of annoyance over his cooking, and Hong responded by grabbing Rodger's candles to force a trade. "In response, Elliot called the police," said Hong's brother, who asked not be named to protect his family's privacy. "What kind of person would call the police for such a petty argument?" Advertisement Dudley said she was willing to go as far as asking the governor to issue Hong a pardon and explored that option before determining she could clear Hong's record locally. Hong, a Lynbrook High School alum, was one of three people stabbed to death by Rodger in their apartment the night of May 23 before Rodger got into his car and continued a rampage through Isla Vista where he shot and killed three people and injured more than a dozen others.	{ "pile_set_name": "Pile-CC" }
Q: How to select an element using jquery? I am trying to select my radio button value within multiple divs but i don't know. Also, append text within table but it doesn't work. maybe my syntax is wrong? I've also tried appendTo() but same. nothing appears on the screen input radio is located.. <div id="wrap"> <div id="section1"> <table class="question"> <tr><td><input type="radio" value="yes" name="tv"/></td><td><p id="position"></p></td></tr> </table> </div> </div> And below is my jquery source in script.js $('#section1.input:radio["tv"]').change(function(){ if ($(this).val() == 'yes') { $('#position').append("test appending"); }); A: Your selector is totally wrong. input shouldn't be prefixed by a dot, it isn't a CSS class ; You need a space between #section1 and input, since the input is a child of your div ; You forgot name= in the brackets. Try something like: $('#section1 input:radio[name="tv"]').change(function(){ if ($(this).val() == 'yes') { $('#position').append("test appending"); } }); <script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script> <div id="wrap"> <div id="section1"> <table class="question"> <tr> <td> <input type="radio" value="yes" name="tv"/></td><td><p id="position"></p> </td> </tr> </table> </div> </div>	{ "pile_set_name": "StackExchange" }
DJs brings in help to review Myer merger Retailer David Jones will undertake a thorough assessment of a merger proposal put by rival Myer. David Jones has appointed consultants to help it review the proposal, and identify any benefits for the two retailers. The review will also assess the benefits of David Jones proceeding on a stand-alone basis. Nonetheless, the latest statement from David Jones represents a significant shift for the company after it stated last year there would be no fair value to its shareholders in merging with Myer. David Jones said that, given the Myer proposal was based on a share swap, and if talks between the two companies proceeded, an assessment would be made of Myer's business, requiring Myer's co-operation. David Jones chairman Gordon Cairns said it was imperative that his company undertook this initial strategic work prior to talks with Myer. "It will enable us to have a full understanding of the value that can be delivered to our shareholders if David Jones were to merge with Myer, versus the value that can reasonably be expected to be delivered to our shareholders if the company continues with its Future Strategic Direction Plan on a stand-alone basis," Mr Cairns said. "Once this work is completed, we will be in a position to engage in a meaningful way with Myer." The latest developments in the proposed merger follow David Jones chief executive Paul Zahra reversing his decision to quit the company, and Myer chief executive Bernie Brookes' re-appointment to his job. David Jones director Leigh Clapham also ended his role with the company on Tuesday. He and fellow director Steve Vamos, plus chairman Peter Mason, announced in February they would step down after controversial share purchases by Mr Clapham and Mr Vamos. Mr Mason and Mr Vamos have already left the company. Mr Clapham said it had been a privilege to work with David Jones. "I believe that I have acted in the best interests of the company at all times and it is clearly the right time for me to step down and wish the company well in the implementation of its Future Strategic Direction Plan," he said. David Jones shares gained four cents to $3.33 while Myer shares dropped one cent to $2.65.	{ "pile_set_name": "Pile-CC" }
204 B.R. 18 (1997) In re KELLY FOOD PRODUCTS, INC., Debtor. G & G SALES CORPORATION, Plaintiff, v. KELLY FOOD PRODUCTS, INC., Defendant. RED RIVER VALLEY POTATO MARKETING ASSOCIATION, Plaintiff, v. KELLY FOOD PRODUCTS, INC., Defendant. Bankruptcy Case No. 96-72781, Adversary Nos. 96-7198, 96-7199. United States Bankruptcy Court, C.D. Illinois. January 10, 1997. 19 Richard P. Klaus, Champaign, IL, for G & G Sales. Stephen P. McCarron, Louis W. Diess, III, Washington, DC, for Red River Valley. Barry M. Barash, Galesburg, IL, for Debtor. Timothy J. Howard, Peoria, IL, for First of America Bank. OPINION LARRY L. LESSEN, Bankruptcy Judge. The two issues before the Court are (i) the scope of protection provided by preserving the benefits of a PACA trust through the newly-authorized method of placing a statutorily-prescribed statement on a bill or invoice statement as opposed to preserving one's rights through the traditional written 20 notice, and (ii) whether a PACA statutory trust is a "true trust" or merely a disguised security agreement. Kelly Food Products, Inc. ("Kelly") is a Chapter 11 Debtor-in-possession. First of America Bank-Illinois, N.A. ("FOA") is Kelly's largest secured creditor with a first priority security interest in virtually all of Kelly's assets, including inventory and accounts receivable. FOA currently holds approximately $330,000 of Kelly's cash assets, to which Plaintiffs claim they are entitled under the provisions of the Perishable Agricultural Commodities Act ("PACA"), 7 U.S.C. § 499e. FOA concedes that its first priority security interest in the subject $330,000 would be inferior to a valid PACA trust claim. This matter is before the Court on Plaintiffs' Motion for Turnover wherein Plaintiffs assert that, as the only protected PACA claimants, they are entitled to have the $330,000 being held by FOA turned over to them. Kelly objects to the turnover, claiming that the funds are not PACA trust assets because the new method of preserving trust claims, through placing the prescribed language on the invoice or bill, limits the assets subject to the trust claims to the particular inventory and proceeds from their inventory which, Kelly further asserts (and is essentially conceded), are long gone. Kelly cites In re Zois, 201 B.R. 501 (Bankr.N.D.Ill.1996) for the proposition that the res of a PACA trust on perishable goods disappears as the perishable goods perish. Plaintiffs counter that the sole purpose and effect of the new subsection was to create another way for suppliers to preserve their rights in the trust and that the new subsection has no bearing on the nature or extent of the PACA trust. PACA creates a non-segregated floating trust on perishable commodities that permits the commingling of trust assets without defeating the trust. In re Zois, supra at 509; Endico Potatoes, Inc. v. CIT Group/Factoring, Inc., 67 F.3d 1063, 1067 (2d Cir.1995); JSG Trading Corp. v. Tray-Wrap, Inc., 917 F.2d 75, 78 (2d Cir.1990). In order to preserve the trust, 7 U.S.C. § 499e(c)(3) requires that the seller give the purchaser written notice of intent to preserve the PACA trust benefits and file that notice with the Secretary of Agriculture within a prescribed period of time. The PACA notice must be in writing, state that it is a notice of intent to preserve PACA trust benefits and include certain prescribed information. In November 15, 1995, 7 U.S.C. § 499e was amended to add subsection (c)(4), which provided an alternative method of preserving the benefits of the PACA trust. Under this amendment, a beneficiary may use ordinary and usual billing or invoice statements to provide notice of the supplier's intent to preserve the trust. To accomplish preservation of the trust benefits under this subsection, the bill or invoice must contain on its face the following language: The perishable agricultural commodities listed on this invoice are sold subject to the statutory trust authorized by section 5(c) of the Perishable Agricultural Commodities Act, 1930 (7 U.S.C. 499e(c)). The seller of these commodities retains a trust claim over these commodities, all inventories of food or other products derived from these commodities, and any receivables or proceeds from the sale of these commodities until full payment is received. 7 U.S.C. § 499e(c)(4). In this case, it is conceded that the Plaintiffs preserved their rights under the trust provisions of 7 U.S.C. § 499e(c) through the method set forth in subsection (c)(4) with the required language. Plaintiff G & G Sales Corporation ("G & G") asserts a PACA trust claim in the amount of $259,860.06 and Plaintiff Red River Valley Potato Marketing Association ("Red River") asserts a PACA trust claim is the amount of $181,455.03. On the issue of the scope of the new method of trust preservation under PACA, this appears to be a question of first impression in the federal courts. While there is no judicial precedent interpreting this new subsection, the legislative history provides solid evidence of Congress' intent. H.R.Rep. No. 207, 104th Cong., 1st Sess., at 9 (1995) states in part as follows: The amendments to the PACA trust provisions contained in this legislation are intended to strengthen and improve the operation of the trust and eliminate the 21 expense to USDA in administering these provisions. . . . To enhance the operation of the trust, an alternate method of preserving trust benefits has been included in the bill. The current requirement to file a trust notice with the USDA is eliminated. Instead, the legislation makes clear that a licensee may use standard invoices or other billing statements to provide notice to the buyer of intent to preserve trust benefits . . . Under current law, the trust is in effect at the time of shipment of the perishable commodity. The unpaid supplier, seller or agent must provide notice of trust coverage to the buyer in order to preserve these trust benefits. Consistent with this principle, this legislation, under paragraph 4 of section 5(c) of PACA, provides that the suppliers, seller, or agent may perfect its trust claim by giving notice to the buyer on the invoice or billing statement. This change to the Act provides both a convenience and cost savings to the unpaid supplier, seller or agent. The Committee intends the effect of notice provided through the use of usual billing or invoice statements to be the legal equivalent to the current practice of providing notice subsequent to the payment date by means independent of the billing statement or invoice. (Emphasis added). It is quite clear that Congress' intent in adding § 499e(c)(4) was to provide a simpler and, for the government, a less expensive way for suppliers to preserve their trust rights. It is equally clear that Congress had no intent to redefine what constitutes the trust res under PACA. If Congress had intended to redefine or limit the trust res, it could have and should have amended § 499e(c)(2), which defines trust res, rather than dealing with the issue in a subsection relating only to preservation. In addition, the last sentence of the legislative history set forth above is very clear about the effect of the amendment it says that the new method of trust preservation is the legal equivalent of the then current practice of filing notice set forth in subsection (c)(3). It says nothing about providing lesser or different protection through the new alternative manner of preservation. Clearly, if it had been Congress' intent to do what Kelly has asserted, the legislative history would not say that the new method of trust preservation is the legal equivalent of filing notice; moreover, the statute, or at least the legislative history, would have explicitly stated that the alternative method of preservation, though available, provides much more limited protection to suppliers. In fact, in the context of perishable agricultural commodities, the protection provided by § 499e(c)(4) under Kelly's interpretation would be so fleeting as to be virtually meaningless in many contexts where the useful life of the products is only a matter of days. Virtually no informed perishable commodity supplier would use § 499e(c)(4) because of the greatly reduced benefit as compared to the traditional manner of preservation and corresponding trust. Finally, if Kelly's position were correct, Congress would have set a dangerous (and well-camouflaged) trap for unwary sellers with its 1995 amendment, completely undercutting the purpose of PACA, which was enacted to protect such sellers. Kelly's reliance on In re Zois, supra, in support of its position is misplaced. Kelly accurately cites Zois for the holding that a PACA trust res consisting of perishable goods disappears as the perishable goods perish. However, this holding does not purport to define or limit the scope of a PACA trust res or alter how a supplier avails itself of PACA protection; in fact, Judge Schmetterer's opinion in Zois is in accord with other published precedent on the issues of what constitutes the res of a PACA trust and how a supplier protects its interest in the trust. Zois acknowledges that "(t)here is no necessity to specifically identify all of the trust assets through each step of the asset accrual and disposal process. Since commingling is contemplated, all trust assets would be subject to the claims of unpaid seller-suppliers and agents to the extent of the amount owed them." Zois, supra at 509, citing H.R.Rep. No. 98-543 (1983), reprinted in 1984 U.S.C.C.A.N. 405. In addition, Zois acknowledges that a "PACA (t)rust consists of perishable goods, products derived from those goods, and all receivables or proceeds from the sale of those goods." Zois, supra 22 at 508, citing 7 U.S.C.A. § 499e(c)(2). Accordingly, the fact that Zois recognizes that a PACA trust res may diminish through both liquidation and rotting does little to advance Kelly's position. The second question raised is Kelly's interest in the subject $330,000. Kelly asserts that it has an interest in the funds superior to that of FOA by virtue of the trustee's strong-arm powers under 11 U.S.C. § 551, which Kelly may exercise as a debtor-in-possession pursuant to 11 U.S.C. § 1107(a). However, Kelly concedes that it has no strong-arm powers if the $330,000 is subject to a "true trust"; Kelly argues that the PACA trust is not a "true trust", but is more like a "floating lien" or a "disguised security agreement" under the Uniform Commercial Code. Defendant's Points & Authorities, pp. 5-6. Plaintiffs counter that the PACA trust is a "true trust" and, such being the case, Kelly has no interest in the funds and, consequently, no standing to object to the Motion for Turnover. On the question of whether the PACA trust is a "true trust", the federal courts have unanimously answered the question in the affirmative. See Matter of Snyder, 184 B.R. 473, 475 (D.Md.1995) (the PACA trust satisfies all of the requirements of an express trust); In re Harper, 150 B.R. 416, 418-19 (Bankr.E.D.Tenn.1993) (PACA trust satisfies express trust requirements); In re Nix, 1992 WL 119143, p. 9. (M.D.Ga.) (PACA creates a true trust). Kelly failed to provide, and this Court was unable to find, any case which held that the PACA trust was anything other than a "true trust". Accordingly, Kelly's theory, though innovative, is without any precedential support and hence must be rejected. To summarize, the subject $330,000 is not subject to Kelly's strong-arm powers pursuant to 11 U.S.C. § 551 because it has been properly preserved in a PACA trust, which the Court finds to be a true trust and not a disguised security agreement. Hence, Kelly, by its own admission, has no interest in the $330,000 in the hands of FOA. Even if it had been determined that Kelly had an interest in the funds, the Court finds that, by properly preserving their trust claims pursuant to 7 U.S.C. § 499e(c)(4), Plaintiffs' trust claims are not limited only to receivables attributable to the specific goods described in their invoices, but rather extend to the subject $330,000 as well. As stated above, G & G asserts a PACA trust claim in the amount of $259,860.06 and Red River's PACA trust claim is for $181,455.03. Hence, the aggregate amount of valid PACA trust claims is $441,315.09. Plaintiffs and FOA have previously agreed that $20,000 of the available funds should be held back for future administrative costs in collecting accounts receivable, leaving approximately $310,000 available for distribution to valid PACA trust claimants. As G & G's trust claim constitutes 58.88311% of the total valid trust claims, G & G is entitled to 58.88311% of the funds collected by FOA (less $20,000 holdback), or approximately $182,537.64 ($310,000 × .5888311). Red River's claim is 41.11689% of the total valid trust claims; hence Red River is entitled to 41.11689% of the funds collected by FOA (less $20,000 holdback), or approximately $127,462.36 ($310,000 × .4111689). For the reasons set forth above, Plaintiffs' Motion for Emergency Relief and Immediate Turnover of Trust Funds is granted. This Opinion is to serve as Findings of Fact and Conclusions of Law pursuant to Rule 7052 of the Rules of Bankruptcy Procedure.	{ "pile_set_name": "FreeLaw" }
Q: cannot load such file -- app.rb (LoadError) Just deployed a ruby app using capistrano. I'm pretty sure I did everything as usual. Passenger though outputs the following: cannot load such file -- app.rb (LoadError) config.ru:1:in `require' config.ru:1:in `block in <main>' /home/deploy/apps/blog/shared/bundle/ruby/2.0.0/gems/rack-1.5.2/lib/rack/builder.rb:55:in `instance_eval' /home/deploy/apps/blog/shared/bundle/ruby/2.0.0/gems/rack-1.5.2/lib/rack/builder.rb:55:in `initialize' config.ru:1:in `new' config.ru:1:in `<main>' /home/deploy/.rvm/gems/ruby-2.0.0-p353/gems/passenger-4.0.29/helper-scripts/rack-preloader.rb:108:in `eval' /home/deploy/.rvm/gems/ruby-2.0.0-p353/gems/passenger-4.0.29/helper-scripts/rack-preloader.rb:108:in `preload_app' /home/deploy/.rvm/gems/ruby-2.0.0-p353/gems/passenger-4.0.29/helper-scripts/rack-preloader.rb:153:in `<module:App>' /home/deploy/.rvm/gems/ruby-2.0.0-p353/gems/passenger-4.0.29/helper-scripts/rack-preloader.rb:29:in `<module:PhusionPassenger>' /home/deploy/.rvm/gems/ruby-2.0.0-p353/gems/passenger-4.0.29/helper-scripts/rack-preloader.rb:28:in `<main>' Application root /home/deploy/apps/blog/current The app.rb actually is in this directory. A: Use the below in your config.ru instead require "./app" run Sinatra::Application It is path issues	{ "pile_set_name": "StackExchange" }
// // CSSlider.m // AppSlate // // Created by Taehan Kim on 12. 01. 26.. // Copyright (c) 2012년 ChocolateSoft. All rights reserved. // #import "CSSlider.h" @implementation CSSlider -(id) object { return ((UISlider)csView); } //=========================================================================== #pragma mark - -(void) setMinimumBarColor:(UIColor)color { if( [color isKindOfClass:[UIColor class]] ) [((UISlider)csView) setMinimumTrackTintColor:color]; } -(UIColor) getMinimumBarColor { return ((UISlider)csView).minimumTrackTintColor; } -(void) setMaximumBarColor:(UIColor)color { if( [color isKindOfClass:[UIColor class]] ) [((UISlider)csView) setMaximumTrackTintColor:color]; } -(UIColor) getMaximumBarColor { return ((UISlider)csView).maximumTrackTintColor; } -(void) setThumbColor:(UIColor)color { if( [color isKindOfClass:[UIColor class]] ) [((UISlider)csView) setThumbTintColor:color]; } -(UIColor) getThumbColor { return ((UISlider)csView).thumbTintColor; } -(void) setMinimumValue:(NSNumber)number { if( [number isKindOfClass:[NSNumber class]] ) [((UISlider)csView) setMinimumValue:[number floatValue]]; else if( [number isKindOfClass:[NSString class]] ) [((UISlider)csView) setMinimumValue:[(NSString)number length]]; } -(NSNumber) getMinimumValue { return @( ((UISlider)csView).minimumValue ); } -(void) setMaximumValue:(NSNumber)number { if( [number isKindOfClass:[NSNumber class]] ) [((UISlider)csView) setMaximumValue:[number floatValue]]; else if( [number isKindOfClass:[NSString class]] ) [((UISlider)csView) setMaximumValue:[(NSString)number length]]; } -(NSNumber) getMaximumValue { return @( ((UISlider)csView).maximumValue ); } -(void) setThumbValue:(NSNumber)number { CGFloat toValue; if( [number isKindOfClass:[NSNumber class]] ) toValue = [number floatValue]; else if( [number isKindOfClass:[NSString class]] ) toValue = [(NSString)number length]; else{ EXCLAMATION; return; } if( toValue > ((UISlider)csView).maximumValue ) toValue = ((UISlider)csView).maximumValue; if( toValue < ((UISlider)csView).minimumValue ) toValue = ((UISlider)csView).minimumValue; [((UISlider)csView) setValue:toValue animated:YES]; } -(NSNumber) getThumbValue { return @( ((UISlider)csView).value ); } -(void) setContinuosChange:(NSNumber)boolVal { if( [boolVal isKindOfClass:[NSNumber class]] ) [((UISlider)csView) setContinuous:[boolVal boolValue]]; } -(NSNumber) getContinuosChange { return@( ((UISlider)csView).continuous ); } #pragma mark - -(id) initGear { if( !(self = [super init]) ) return nil; csView = [[UISlider alloc] initWithFrame:CGRectMake(0, 0, 400, MINSIZE)]; [csView setBackgroundColor:[UIColor clearColor]]; [csView setUserInteractionEnabled:YES]; csCode = CS_SLIDER; isUIObj = YES; [((UISlider)csView) setMinimumValue:0]; [((UISlider)csView) setMaximumValue:10]; [((UISlider)csView) setValue:5]; [((UISlider)csView) setContinuous:NO]; [((UISlider)csView) setMinimumTrackTintColor:[UIColor darkGrayColor]]; [((UISlider)csView) setMaximumTrackTintColor:[UIColor whiteColor]]; [((UISlider)csView) setThumbTintColor:[UIColor whiteColor]]; [((UISlider)csView) addTarget:self action:@selector(valueChanged:) forControlEvents:UIControlEventValueChanged]; DEFAULT_CENTER_D; NSDictionary d0 = ALPHA_D; NSDictionary d1 = MAKE_PROPERTY_D(@"Value", P_NUM, @selector(setThumbValue:),@selector(getThumbValue)); NSDictionary d2 = MAKE_PROPERTY_D(@"Minimum Value", P_NUM, @selector(setMinimumValue:),@selector(getMinimumValue)); NSDictionary d3 = MAKE_PROPERTY_D(@"Maximum Value", P_NUM, @selector(setMaximumValue:),@selector(getMaximumValue)); NSDictionary d4 = MAKE_PROPERTY_D(@"Minimum Bar Color", P_COLOR, @selector(setMinimumBarColor:),@selector(getMinimumBarColor)); NSDictionary d5 = MAKE_PROPERTY_D(@"Maximum Bar Color", P_COLOR, @selector(setMaximumBarColor:),@selector(getMaximumBarColor)); // NSDictionary d6 = MAKE_PROPERTY_D(@"Thumb Color", P_COLOR, @selector(setThumbColor:),@selector(getThumbColor)); NSDictionary d7 = MAKE_PROPERTY_D(@"Continuos Change", P_BOOL, @selector(setContinuosChange:),@selector(getContinuosChange)); pListArray = @[xc,yc,d0,d1,d2,d3,d4,d5,d7]; NSMutableDictionary MAKE_ACTION_D(@"Changed Value", A_NUM, a1); NSMutableDictionary MAKE_ACTION_D(@"Minimum Value", A_NUM, a2); NSMutableDictionary MAKE_ACTION_D(@"Maximum Value", A_NUM, a3); actionArray = @[a1, a2, a3]; return self; } -(id)initWithCoder:(NSCoder )decoder { if( (self=[super initWithCoder:decoder]) ) { [((UISlider)csView) addTarget:self action:@selector(valueChanged:) forControlEvents:UIControlEventValueChanged]; } return self; } #pragma mark - Gear's Unique Actions -(void) valueChanged:(id) sender { SEL act; NSNumber nsMagicNum; CGFloat myValue = ((UISlider)sender).value; // 1. value changed act = ((NSValue)((NSDictionary)actionArray[0])[@"selector"]).pointerValue; if( nil != act ){ nsMagicNum = ((NSDictionary)actionArray[0])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; if( nil != gObj ){ if( [gObj respondsToSelector:act] ) [gObj performSelector:act withObject:@(myValue)]; else EXCLAMATION; } } // 2. did min value act = ((NSValue)((NSDictionary)actionArray[1])[@"selector"]).pointerValue; if( nil != act && myValue == ((UISlider)sender).minimumValue ) { nsMagicNum = ((NSDictionary)actionArray[1])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; if( nil != gObj ){ if( [gObj respondsToSelector:act] ) [gObj performSelector:act withObject:@(myValue)]; else EXCLAMATION; } } // 3. did max value act = ((NSValue)((NSDictionary)actionArray[2])[@"selector"]).pointerValue; if( nil != act && myValue == (NSUInteger)((UISlider)sender).maximumValue ) { nsMagicNum = ((NSDictionary)actionArray[2])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; if( nil != gObj ){ if( [gObj respondsToSelector:act] ) [gObj performSelector:act withObject:@(myValue)]; else EXCLAMATION; } } } #pragma mark - Code Generatorz // If not supported gear, return NO. -(BOOL) setDefaultVarName:(NSString ) _name { return [super setDefaultVarName:NSStringFromClass([self class])]; } -(NSString) sdkClassName { return @"UISlider"; } -(NSString) addTargetCode { return [NSString stringWithFormat:@" [%@ addTarget:self action:@selector(%@ValueChanged) forControlEvents:UIControlEventValueChanged];\n",varName,varName]; } -(NSString) actionCode { NSMutableString code = [[NSMutableString alloc] initWithFormat:@"-(void)%@ValueChanged\n{\n",varName]; SEL act; NSNumber nsMagicNum; act = ((NSValue)((NSDictionary)actionArray[0])[@"selector"]).pointerValue; if( act ) { nsMagicNum = ((NSDictionary)actionArray[0])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; const char sel_name_c = sel_getName(act); NSString selNameStr = [NSString stringWithCString:sel_name_c encoding:NSUTF8StringEncoding]; if( [selNameStr hasSuffix:@"Action:"] ) { [code appendFormat:@" %@\n",[gObj actionPropertyCode:selNameStr valStr:[NSString stringWithFormat:@"%@.value",varName]]]; } else [code appendFormat:@" [%@ %@@(%@.value)];\n",[gObj getVarName],@(sel_name_c),self.getVarName]; } act = ((NSValue)((NSDictionary)actionArray[1])[@"selector"]).pointerValue; if( act ) { nsMagicNum = ((NSDictionary)actionArray[1])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; const char sel_name_c = sel_getName(act); NSString selNameStr = [NSString stringWithCString:sel_name_c encoding:NSUTF8StringEncoding]; if( [selNameStr hasSuffix:@"Action:"] ) { [code appendFormat:@" %@\n",[gObj actionPropertyCode:selNameStr valStr:[NSString stringWithFormat:@"%@.value",varName]]]; } else [code appendFormat:@" if( %@.minimumValue == %@.value )[%@ %@@(%@.value)];\n",self.getVarName,self.getVarName,[gObj getVarName],@(sel_name_c),self.getVarName]; } act = ((NSValue)((NSDictionary)actionArray[2])[@"selector"]).pointerValue; if( act ) { nsMagicNum = ((NSDictionary)actionArray[2])[@"mNum"]; CSGearObject gObj = [USERCONTEXT getGearWithMagicNum:nsMagicNum.integerValue]; const char sel_name_c = sel_getName(act); NSString selNameStr = [NSString stringWithCString:sel_name_c encoding:NSUTF8StringEncoding]; if( [selNameStr hasSuffix:@"Action:"] ) { [code appendFormat:@" %@\n",[gObj actionPropertyCode:selNameStr valStr:[NSString stringWithFormat:@"%@.value",varName]]]; } else [code appendFormat:@" if( %@.maximumValue == %@.value )[%@ %@@(%@.value)];\n",self.getVarName,self.getVarName,[gObj getVarName],@(sel_name_c),self.getVarName]; } [code appendString:@"}\n"]; return code; } @end	{ "pile_set_name": "Github" }
Selective coupling with K+ currents of muscarinic acetylcholine receptor subtypes in NG108-15 cells. The primary structures of two muscarinic acetylcholine receptor (mAChR) species, designated as mAChR I and mAChR II, have been elucidated by cloning and sequence analysis of DNAs complementary to the porcine cerebral and cardiac messenger RNAs, respectively. mAChR I and mAChR II expressed in Xenopus oocytes differ from each other both in acetylcholine-induced response and in antagonist binding properties. These results, together with the differential tissue location of the two mAChR mRNAs, have indicated that pharmacologically distinguishable subtypes of the mAChR represent distinct gene products. The primary structures of two additional mammalian mAChR species, designated as mAChR III and mAChR IV, have subsequently been deduced from the nucleotide sequences of the cloned cDNAs or genomic DNAs. We report here that mAChR I and mAChR III expressed in NG108-15 neuroblastoma-glioma hybrid cells, but not mAChR II and mAChR IV, efficiently mediate phosphoinositide hydrolysis, activation of a Ca2+-dependent K+ current and inhibition of the M-current, a voltage-dependent K+ current sensitive to muscarinic agonists.	{ "pile_set_name": "PubMed Abstracts" }
Q: How to fire following command from vc++? I want to change image's exif data. For that I've used Exiv2.exe. Now I want to fire command from my program which is written in vc++ 08. For modify GPS data of image, exive command is exiv2 -M"set Exif.GPSInfo.GPSLatitude 4/1 15/1 33/1" D:\test\image.jpg I've placed exiv2.exe into system32 folder. And this command works fine from command prompt. For example, C:\Users\Me>exiv2 -M"set Exif.GPSInfo.GPSLatitude 4/1 15/1 33/1" D:\test\image.jpg Now how can I fire this same command from my c++ program? Thanks in advance... A: Finally got it, const char *change_latitude = "exiv2 -M\"set Exif.GPSInfo.GPSLatitude 14/1 15/1 13/1\" D:\\test\\image.jpg"; system(change_latitude); In this example assumption is : exiv2.exe in system32 folder. Thanks...	{ "pile_set_name": "StackExchange" }
791 N.E.2d 568 (2003) 339 Ill. App.3d 1086 274 Ill.Dec. 476 The PEOPLE of the State of Illinois, Plaintiff-Appellee, v. Michael SLOVER, Jr., Michael Slover, Sr., and Jeanette Slover, Defendants-Appellants. No. 4-02-0892. Appellate Court of Illinois, Fourth District. June 6, 2003. 569 Danile D. Yuhas and John M. McCarthy, both of State Appellate Defender's Office, of Springfield, for appellants. Scott Rueter, State's Attorney, of Decatur (Norbert J. Goetten, Robert J. Biderman, and Denise M. Ambrose, all of State's Attorneys Appellate Prosecutor's Office of counsel), for the People. Justice TURNER delivered the opinion of the court: In May 2002, a jury convicted defendants, Michael Slover, Jr., Michael Slover, Sr., and Jeanette Slover, of the first degree murder of Karen Slover. Michael, Jr., and Michael, Sr., were also convicted of concealment of a homicidal death. All three defendants were sentenced to prison and filed a notice of appeal with this court. In September 2002, the State filed a motion to release defense exhibits for scientific testing. The trial court granted the motion and found no just reason for delaying the appeal. On appeal, defendants argue the trial court had no jurisdiction to order testing of defense exhibits because those exhibits are part of the record on appeal. The State argues defendants' appeal must be dismissed because the trial court's order did not constitute a final order or judgment from which defendants could appeal. We affirm. I. BACKGROUND In May 2002, a jury convicted defendants Michael Slover, Jr., and his parents, Michael Slover, Sr., and Jeanette Slover, of the first degree murder of Michael, Jr.'s former wife, Karen Slover. Michael, Jr., and Michael, Sr., were also convicted of concealment of a homicidal death. In June 2002, the trial court sentenced all three defendants to 60 years' imprisonment. Michael, Jr., and Michael, Sr., also received five-year prison sentences for their convictions of concealment of a homicidal death. In July 2002, defendants filed motions to reduce their sentences, which the trial court denied. Thereafter, defendants filed a notice of appeal (No. 4-02-0587). In September 2002, the State filed a motion, naming all three defendants, to 570 release defense exhibits for scientific testing. The motion indicated three defense exhibits admitted during defendants' trial contained some animal hairs unsuitable for identification, along with some possible cat hairs, that were taken by police from a 1992 Bonneville. Further, Mary Slover, the daughter of Michael, Sr., and Jeanette, and the sister of Michael, Jr., formerly lived at a house in Springfield that a forensic scientist identified to have cat and dog hairs following an investigatory examination. The State indicated a petition had been filed under the Juvenile Court Act of 1987 (705 ILCS 405/1-1 through 7-1 (West 2000)) in Macon County case No. 00-JA-12, alleging the biological son of Michael, Jr., and the adopted son of Mary was a neglected and abused minor. The State had filed an expedited petition for termination of parental rights. The State indicated the doctor who performed canine deoxyribonucleic acid (DNA) testing in the defendants' murder case was willing to perform feline DNA testing of the State's enumerated exhibits and the cat hair from Mary's former residence. The State submitted "the release of the three defense exhibits for feline DNA testing would advance the interests of justice in the pending juvenile case of [No.] 00-JA-12." In September 2002, the trial court held a hearing on the State's motion. Defendants' counsel argued the trial court had no jurisdiction as their appeals had been filed. If the court did have jurisdiction, defendants argued, the State wanted to subject the cat hair to destructive testing, which would be prejudicial to defendants if the appellate court ordered further proceedings in the trial court. The trial court found it had jurisdiction to rule on the matter, stating it had authority to enter orders with regard to property in its custody. The court also found the State presented good cause for destructive testing of the evidence. As a condition of the testing, the court required a photograph taken to identify the exhibits. Defense counsel requested the clerk be directed to file a notice of appeal. The trial court found its order was governed by the civil appeal rules pursuant to Supreme Court Rule 612 (177 Ill.2d R. 612). In its written order pursuant to Supreme Court Rule 304(a) (155 Ill.2d R. 304(a)), the court concluded there was no just reason for delaying the appeal. Per defense counsel's request, the trial court stayed its order until further order by the court. This appeal followed. In October 2002, Jeanette filed a motion to join in the interlocutory appeal. She later filed a notice of appeal in November 2002. In February 2003, this court allowed Jeanette's motion for leave to file a late notice of appeal. II. ANALYSIS A. Appellate Court Jurisdiction Before we determine whether the trial court had jurisdiction to consider the State's motion, we must determine whether this court has jurisdiction to consider defendants' appeal. In their appellate brief, defendants contend this court has jurisdiction pursuant to Supreme Court Rules 603 and 606 pertaining to criminal appeals (134 Ill.2d R. 603; 188 Ill.2d R. 606). The State argues we must dismiss defendants' appeal. The trial court issued an order pursuant to Supreme Court Rule 304(a), finding no just reason for delaying appeal of its order granting the State's motion to release defense exhibits for scientific testing. Supreme Court Rule 304(a) provides, in part, as follows: "If multiple parties or multiple claims for relief are involved in an action, an appeal may be taken from a final judgment as to one or more but fewer than 571 all of the parties or claims only if the trial court has made an express written finding that there is no just reason for delaying either enforcement or appeal or both. * * In the absence of such a finding, any judgment that adjudicates fewer than all the claims or the rights and liabilities of fewer than all the parties is not enforceable or appealable and is subject to revision at any time before the entry of a judgment adjudicating all the claims, rights, and liabilities of all the parties." 155 Ill.2d R. 304(a). When the criminal appeal rules govern, Rule 304(a) does not apply. In re D.D., 337 Ill.App.3d 998, 1008, 272 Ill.Dec. 706, 788 N.E.2d 10, 17 (2002). However, an appellate court's jurisdiction to consider an appeal "does not derive solely from a party's invocation of the correct supreme court rule." In re O.H., 329 Ill.App.3d 254, 257, 263 Ill.Dec. 718, 768 N.E.2d 799, 801 (2002). Moreover, the trial court indicated the civil appeal rules applied after looking for guidance under Supreme Court Rule 612, setting forth the procedural matters that are governed by civil appeal rules. The court noted civil appeal rules applied to the removal of records from the reviewing court. Supreme Court Rule 372 (155 Ill.2d R. 372), a civil appeal rule applicable to criminal appeals, focuses on the removal of the record from the appellate court, not the removal of exhibits from the record on appeal for scientific testing. However, the similarity between the procedural matters of removing records from the reviewing court and allowing testing of an exhibit that is part of the record on appeal is enough to enable the case to fall within the civil appeal rules. Here, the order allowing destructive testing of the exhibits created a final judgment. As this amounted to a procedural matter, along with the trial court's written order pursuant to Rule 304(a), we conclude this case is properly before us. B. Trial Court Jurisdiction Generally, "[t]he filing of a notice of appeal transfers jurisdiction to the appellate court instanter and simultaneously divests the trial court of jurisdiction to enter additional orders of substance in a case." People v. Kolzow, 332 Ill.App.3d 457, 459, 265 Ill.Dec. 532, 772 N.E.2d 903, 904 (2002). The trial court may not then enter orders changing or modifying a judgment or its scope or interfering with the review of the judgment. Kolzow, 332 Ill. App.3d at 459, 265 Ill.Dec. 532, 772 N.E.2d at 905. The trial court does retain jurisdiction to determine matters that are collateral or incidental to the judgment being appealed. Brownlow v. Richards, 328 Ill. App.3d 833, 837, 263 Ill.Dec. 31, 767 N.E.2d 482, 485 (2002). In this case, the trial court's order did not modify the judgment or interfere with the review of that judgment. Further, the court's order did not dispose of the issues defendants had invoked our jurisdiction to review in their murder appeal. Thus, defendants' criminal appeal did not automatically divest the trial court of jurisdiction in regard to the State's motion. Defendants argue the trial court did not have jurisdiction to order the scientific testing of defense exhibits. We disagree. Defendants contend the physical evidence, such as the cat hair, is part of the record on appeal based on Supreme Court Rule 608 (177 Ill.2d R. 608), and thus the trial court could not make substantive rulings on that evidence. Rule 608(a) provides, in part, as follows: "The clerk of the circuit court shall prepare the record on appeal upon the filing of a notice of appeal and in all cases in which a death sentence is imposed. * * * The record on appeal must contain the following: 572 * * (10) exhibits offered at trial and sentencing, along with objections, offers of proof, arguments, and rulings thereon; except that physical and demonstrative evidence, other than photographs, which do not fit on a standard size record page shall not be included in the record on appeal unless ordered by a court upon motion of a party or upon the court's own motion." 177 Ill.2d R. 608(a). Supreme Court Rule 608 addresses the requirements the clerk of the circuit court must adhere to in preparing the record on appeal. However, it does not address whether the trial court has the authority to order the testing of exhibits used at trial while the case is presently on appeal. For that determination, we look toward our supreme court's general administrative order on recordkeeping in the trial courts. Pursuant to its general administrative authority, the supreme court has stated: "PART I RECORD OF THE CASE The records of the case to be prepared and maintained by the clerk shall be as follows: * * * G. EXHIBITS Unless otherwise ordered, * * * exhibits received in evidence shall be: 1. Retained by the clerk while the right of appeal exists. In criminal, traffic, ordinance, and conservation cases in which the defendant has been found guilty[,] exhibits shall also be retained until the defendant has paid the fine, served his sentence, or has been released from probation or parole. 2. Released by the Clerk: a. When the time for appeal has passed, provided that, in criminal, traffic, ordinance[,] and conservation cases in which the defendant has been found guilty, exhibits shall not be released until the defendant has paid the fine, served his sentence[,] or has been released from probation or parole. b. At any time by order of the judge who presided at the trial of the case, or by order of the chief judge." Administrative Office of the Illinois Courts, General Administrative Order on Recordkeeping in the Circuit Courts, adopted by the Supreme Court of Illinois on May 20, 1968, as amended, effective April 23, 2003, at iv, xii. Based on the supreme court's pronouncement, we find a trial court has jurisdiction to determine whether exhibits used at trial should be submitted for scientific testing while the remainder of the case is on appeal. C. Order Releasing Defense Exhibits A trial court has the inherent power to maintain and control its records. In re Marriage of Johnson, 232 Ill.App.3d 1068, 1072, 174 Ill.Dec. 209, 598 N.E.2d 406, 409 (1992). With this in mind, the trial court must use its discretion in determining whether exhibits should be released by the clerk. See, e.g., Doe v. Carlson, 250 Ill.App.3d 570, 574, 189 Ill.Dec. 205, 619 N.E.2d 906, 909 (1993) (trial court has the discretion to impound judicial records after weighing the interests involved in accessing the record or keeping access restricted); Johnson, 232 Ill.App.3d at 1072-73, 174 Ill.Dec. 209, 598 N.E.2d at 409 (access to judicial records is left to sound discretion of trial court based on the relevant facts and circumstances of the case). When confronted with a motion to release exhibits for scientific testing, the trial court must balance the competing interests, *573 including, but not limited to, the possible prejudice to the defendant, the State's desire to advance the interests of justice, and the State's need for testing to accomplish its planned and stated objective. In the case sub judice, the State established in its motion that Dr. Joy Halverson indicated she was capable of performing and willing to perform DNA testing on animal hairs from defense exhibits and cat hairs from Mary Slover's former residence. The State alleged the testing would advance the interests of justice in the pending juvenile case and the determination of whether the parental rights of Mary and Michael, Jr., should be terminated. Specifically, the State alleged the evidence could point to Mary's connection with the Karen Slover murder or its concealment. Defendants, on the other hand, argued at the hearing that destructive testing would be prejudicial in the event of a retrial. However, the State noted the evidence was not large enough for a jury to assess, unlike a "big coat" or "bloody knife." Also, the State indicated the conclusions made after scientific testing could benefit the defense. In its decision, the trial court found "good cause" for the scientific testing. The court also required as a condition of the scientific testing that a photograph be taken of any exhibits of sufficient quality to identify them. We find the trial court did not abuse its discretion in allowing scientific testing of the defense exhibits. The trial court was presented with the State's need for the evidence and the possible prejudicial impact such testing might have on defendants. The court weighed each position, made an additional requirement to keep a record of the evidence, and ruled accordingly. As the State presented evidence that scientific testing could further the interests of justice and defendants were unconvincing in their claim of prejudice, the trial court did not abuse its discretion in granting the State's motion. III. CONCLUSION For the reasons stated, we affirm the trial court's judgment. Affirmed. STEIGMANN and APPLETON, JJ., concur.	{ "pile_set_name": "FreeLaw" }
759 F.2d 474 MOLEX, INCORPORATED, Plaintiff-Appellee,v.James NOLEN and James Nolen d/b/a Western Cable, Defendant-Appellant. No. 84-1332. United States Court of Appeals,Fifth Circuit. May 6, 1985. Mark A. Nacol, John G. Tatum, Dallas, Tex., for defendant-appellant. Locke, Purnell, Boren, Laney & Neely, C. Michael Moore, Nancy A. Strehlow, Dallas, Tex., for plaintiff-appellee. Appeal from the United States District Court for the Northern District of Texas. Before GEE, POLITZ and WILLIAMS, Circuit Judges. PER CURIAM: 1 Nolen appeals the award of an injunction against him, advancing various contentions that we discuss below. Facts 2 Molex Incorporated, a Delaware corporation with its principal place of business in Illinois, makes cable assemblies. In 1978, Molex hired James Nolen, a Texas citizen, as its sales representative in the Dallas-Fort Worth area. Tandy Corporation is a large electronics firm located in that area. Nolen's job required him to try to sell Molex's cable assemblies to Tandy, which he succeeded in doing. Once Tandy was established as a Molex customer, Nolen, as the Molex sales representative responsible for the Tandy account, was also responsible for maintaining a good relationship between the two companies. 3 In mid-1980, Molex began to have problems delivering its cable assemblies to Tandy. In November of that year, Nolen had formed a company first called Western Controls, and later called Western Cable (Western). Through Western, Nolen sold cable assemblies directly to Tandy--assemblies made from Molex parts. Nolen paid for the parts with checks signed "James Baucom." There was no "James Baucom" at Western; Nolen admits to forging all of these signatures. Nolen also used the name "James Baucom" when selling the Western cable assemblies to Tandy. These (and other) deceptions were necessary because Nolen had omitted to resign from Molex before beginning his career as the sole proprietor of Western. His double life thus enabled Nolen to receive a commission from Molex for the Molex parts he sold to himself as Western, and then to receive the profits from the cable assemblies he sold to Tandy; his knowledge of Molex's pricing made it possible for Nolen (acting as Western) to undersell Molex. On occasion, Nolen charged Molex for business lunches with his doppelganger James Baucom; "Baucom" was leasing cable manufacturing tools from Molex. 4 In July 1981, having established Western as Tandy's cable assembly supplier, Nolen left Molex. He continued to purchase Molex parts, and to sell cable assemblies to Tandy, as "Baucom;" between November 1980 and December 1983, Nolen's sales of cable assemblies totalled $1.7 million. 5 When Molex discovered Nolen's perfidy, it brought an action against him alleging diversion of corporate opportunity, unfair competition, and interference with contractual and business relationships. Molex sought money damages and an injunction barring Nolen from dealing with Molex customers and from disclosing Molex information or parting with Molex property. Nolen defended this action by various means, means that included perjury; he now admits to having lied at his deposition. The case was tried to a jury. It found for Molex and awarded Molex both actual and exemplary damages. Molex is unlikely to collect these damages because Nolen has taken voluntary bankruptcy. The trial court entered judgment on the jury's verdict and issued an injunction permanently barring Nolen from selling cable assemblies to Tandy. Nolen now appeals both the judgment and the injunction. Analysis 6 Nolen first contends that the trial court's injunction is impermissibly vague, overbroad, and beyond the scope of the pleadings. Except in one respect, this contention is meritless. Nolen's first assertion of vagueness is grounded on the trial court's failure to define "cable assemblies." No definition was necessary; Nolen knows full well what cable assemblies are. The trial court was required simply to "frame its injunction so that those enjoined will know what conduct the court has prohibited." Meyer v. Brown & Root Construction Co., 661 F.2d 369, 373 (5th Cir.1981), citing International Longshoremen's Assoc. v. Philadelphia Marine Trade Assoc., 389 U.S. 64, 76, 88 S.Ct. 201, 208, 19 L.Ed.2d 236 (1967). This the trial court did. 7 Nolen argues that the injunction is overbroad because it is not limited to the specific Tandy divisions to which Nolen sold Molex cable assemblies. He provides no authority for this argument, probably because there is none. Texas courts have routinely permitted injunctions to issue barring employees from soliciting the customers of their former employers; see, e.g., Stocks v. Banner American Corp., 599 S.W.2d 665, 668 (Tex.Civ.App.--Texarkana 1980, no writ); Johnson v. American Speedreading Academy, Inc., 526 S.W.2d 163, 166 (Tex.Civ.App.--Dallas 1975). This Court approved such an injunction in Zoecon Industries v. American Stockman Tag Co., 713 F.2d 1174, 1180 (5th Cir.1983). The trial court was thus fully within its discretion in barring Nolen from selling cable assemblies to Tandy, indubitably a customer of Nolen's former employer. 8 Nolen also argues that the injunction is overbroad because it is not limited to those sorts of cable assemblies manufactured by Molex. He cites Norton v. Integral Corp., 584 S.W.2d 932, 935 (Tex.Civ.App.--Austin, 1979), in support of this argument. In Norton, however, the language held overbroad was "electrical equipment in the center pivot sprinkler industry," 584 S.W.2d at 935. The Norton court ordered it changed to "cable con." "Cable con" is obviously no more specific, and no narrower, than "cable assembly." Nolen's argument is therefore without supporting authority; it was not error for the trial court to bar him from selling "cable assemblies."Nolen further contends that the injunction should be lifted because it deprives him of a livelihood and because it is against the public interest. Both contentions are frivolous, and patently unworthy of serious consideration. It is also unnecessary to discuss whether (or how) the injunction goes beyond the scope of the pleading: the assertion appears only in the caption to this section of Nolen's brief and is not mentioned at all in the text. 9 We do find merit in one complaint of vagueness: the injunction forbids Nolen to deal in various respects with "Tandy Corporation or any affiliate or subsidiary of Tandy Corporation...." The phrase is mildly ambiguous; we reform it to read "or any affiliate or subsidiary of Tandy Corporation as of the date of this judgment, March 9, 1984." Except in this minor respect, we conclude that the trial court's injunction was neither vague nor overbroad, and no reasonable reader of the record could conclude that it went beyond the scope of the pleadings. 10 Nolen next assigns as error the trial court's grant of a permanent injunction; he contends that the injunction should have been limited in duration. The only relevant authority cited in connection with this contention is Hyde Corp. v. Huffines, 158 Tex. 566, 314 S.W.2d 763 (1958). Nolen imaginatively construes Hyde to mandate the grant of a limited, rather than a permanent, injunction whenever the defendant has requested one. Both common sense and the actual language of Hyde refute this novel construction: 11 The trial judge upon proper findings has correctly determined that this is a case for injunctive relief. He has ordered that the usual equitable order issue, e.g. the perpetual injunction. It would seem to follow that if an injunction of limited duration be substituted therefore ..., an abuse of discretion in issuing the perpetual injunction would have to be shown. No such showing was made in this case. 12 314 S.W.2d at 780-81 (citation omitted) (emphasis added). Nolen has made no such showing either. His conduct is indistinguishable in any relevant aspect from that of the defendants in Zoecon and in Elcor Chemical Corp. v. Agri-Sul, Inc., 494 S.W.2d 204 (Tex.Civ.App.--Dallas 1973, writ ref'd n.r.e.); permanent injunctions were upheld in both cases. These cases, and the absence of countervailing authority, clearly indicate that the trial court was well within its authority in granting a permanent injunction to Molex. 13 Nolen's last attack on the injunction is similarly baseless; his assertion that the injunction was issued without a finding of irreparable harm is simply wrong. The trial court explicitly made such a finding. 14 Nolen makes various assignments of error in connection with the trial court's finding of irreparable harm. The first, that there was no such finding, is refuted above. The last, that the injunction is defective absent a finding of irreparable harm, is irrefutable as a general proposition but inapplicable to this case. The rest are not entirely clear, but seem to allege first, that no evidence existed to support a finding of irreparable harm, and second, that the issue of irreparable harm should have been submitted to the jury. The first contention is frivolous. Although Nolen acknowledges irreparable harm to be a question of fact, he appears to believe that our review of the trial court's finding of this fact is governed by something other than the clearly erroneous standard of Rule 52(a), Fed.R.Civ.P. His belief is itself clearly erroneous. Bryan v. Kershaw, 366 F.2d 497, 499 (5th Cir.1966), cert. denied, 386 U.S. 959, 87 S.Ct. 1030, 18 L.Ed.2d 108 (1967). The trial court's finding is clearly correct. Under Texas law, the irreparable harm required for a permanent injunction is defined as "an injury which cannot be compensated or for which compensation cannot be measured by any certain pecuniary standard." Parkem Industrial Services, Inc. v. Garton, 619 S.W.2d 428, 430 (Tex.Civ.App.--Amarillo 1981). Nolen's bankruptcy meets the first prong of his definition; Texas cases construe "cannot be compensated" to include situations in which the "defendant is incapable of responding in damages." R.H. Sanders Corp. v. Haves, 541 S.W.2d 262, 265 (Tex.Civ.App.--Dallas 1976, no writ), citing County of Harris v. Southern Pacific Transportation Co., 457 S.W.2d 336, 339 (Tex.Civ.App.--Houston 1970, no writ); Grayson Enterprises, Inc. v. Texas Key Broadcasters, Inc., 388 S.W.2d 204, 208 (Tex.Civ.App.--Eastland 1965, no writ). 15 Nolen's theft of Molex's customer Tandy meets the second prong of the definition. In Jeter v. Associated Rack Corp., 607 S.W.2d 272 (Tex.Civ.App.--Texarkana 1980), cert. denied, 454 U.S. 965, 102 S.Ct. 507, 70 L.Ed.2d 381 (1981), the court affirmed permanent injunctive relief on facts very similar to these, stating "[i]t is our further opinion that future damages would have been difficult if not impossible to ascertain and thus the trial court was justified in granting injunctive relief." 607 S.W.2d at 278. Although they do not contain language paralleling that of Jeter, cases such as Zoecon, Hyde, and Elcor, in which permanent injunctive relief was affirmed, plainly support the proposition that irreparable harm may be shown in customer theft situations. Given these authorities, and the peculiarly aggravated circumstances of this case, it cannot be said that the trial court's finding of irreparable harm was clearly erroneous. 16 Nolen next complains that the issue of irreparable harm should have been submitted to the jury; as a question of fact it certainly could have been. Miller v. Lone Star Tavern, Inc., 593 S.W.2d 341, 344 (Tex.Civ.App.--Waco 1979). Our review of the record reveals, however, that Nolen neither requested submission of the issue to the jury nor objected to the absence of the issue in the special interrogatories given to the jury. Rule 49(a), Fed.R.Civ.P., therefore bars Nolen's assignment of error on this point. That rule provides as follows: 17 The court may require a jury to return only a special verdict in the form of a special written finding upon each issue of fact. In that event the court may submit to the jury written questions susceptible of categorical or other brief answer or may submit written forms of the several special findings which might properly be made under the pleadings and evidence; or it may use such other method of submitting the issues and requiring the written findings thereon as it deems most appropriate. The court shall give to the jury such explanation and instruction concerning the matter thus submitted as may be necessary to enable the jury to make its findings upon each issue. If in so doing the court omits any issue of fact raised by the pleadings or by the evidence, each party waives his right to a trial by jury of the issue so omitted unless before the jury retires he demands its submission to the jury. As to an issue omitted without such demand the court may make a finding; or, if it fails to do so, it shall be deemed to have made a finding in accord with the judgment on the special verdict. 18 The Rule is unambiguous and this Court has given its words their plain meaning. See, e.g., John R. Lewis, Inc. v. Newman, 446 F.2d 800, 804-05 (5th Cir.1971). Under Rule 49(a) and our cases construing it, Nolen waived his right to a jury trial on the issue of irreparable harm. 19 Nolen's attack on the sufficiency of the evidence supporting the jury findings against him is completely without merit. The standard of review used by this Court to evaluate allegations of insufficient evidence was explained in a recent case: 20 The role of this Court is not to adjudicate the facts de novo, nor is it our task to second-guess the conclusion of the members of the jury who had the important opportunity to evaluate the demeanor of the witnesses. The appellants urge that there is substantial evidence to support judgment in their favor. This may or may not be the case, but the contention is not germane. The record shows clear and substantial evidence to support the jury's findings for appellee. The facts and inferences do not "point so strongly and overwhelmingly in favor of one party that the Court believes that reasonable men could not arrive at a contrary verdict...." Boeing Co. v. Shipman, 411 F.2d 365, 374 (5th Cir.1969) (en banc). The trial judge therefore acted properly in denying the motion for directed verdict and in entering judgment consistent with the jury's verdict. 21 Thomas v. City of New Orleans, 687 F.2d 80, 83 (5th Cir.1982); see also NCH Corp. v. Broyles, 749 F.2d 247 (5th Cir.1985). Nolen points to no specific portions of the record as supporting his contentions. Our review of it reveals that in no respect does it fail to support the jury findings. Those findings, and the relevant evidence are summarized as follows. 22 a) Nolen acquired trade secrets or confidential business information from Molex. The information Nolen acquired from Molex about Tandy and other Molex customers falls within the category of either trade secrets or confidential information, as does the information he acquired about Molex's pricing. Zoecon, Hyde, Elcor, supra. 23 b) Nolen misappropriated and used Molex's trade secrets or confidential business information for his own use or benefit. Nolen attacked this finding by arguing that he didn't know the information was secret. The simple answer to Nolen's argument is that the jury was not required to believe him and did not. 24 c) Nolen wrongfully disclosed Molex's trade secrets or confidential information to others. Nolen shared his information about Tandy with his employees at Western. 25 d) Nolen's misappropriation and use of Molex's trade secrets or confidential information was the proximate cause of loss to Molex and benefit to Nolen. Molex lost Tandy as a customer, and Nolen gained Tandy as a customer. 26 e) Nolen had a fiduciary relationship with Molex. Under Texas law, "[t]he term includes those informal relations which exist whenever one party trusts and relies upon another." Kinzbach Tool Co., Inc. v. Corbett-Wallace Corp., 138 Tex. 565, 160 S.W.2d 509, 512-13 (1942). The Texas Supreme Court held a salesman to have a fiduciary relationship with his employer in Kinzbach. Molex obviously trusted and relied on Nolen, as the sales representative responsible for the Tandy account, in its dealings with Tandy. 27 f) Nolen breached his fiduciary duty to Molex. On this record, it would have been astounding had the jury found otherwise. 28 g) Nolen's breach of his fiduciary duty to Molex during the term of his employment with Molex was the proximate cause of loss or damage to Molex, or benefit or value to Nolen. Again, this proposition is too obvious to require discussion. 29 h) The sum of $112,500 would reasonably compensate Molex for its loss or for Nolen's profits. The trial court correctly instructed the jury that it could award damages to Molex on the "reasonable royalty" theory. See Universal Computing Co. v. Lykes-Youngstown Corp., 504 F.2d 518, 536-39 (5th Cir.1974); Sikes v. McGraw Edison Co., 665 F.2d 731, 737 (5th Cir.), cert. denied, 458 U.S. 1108, 102 S.Ct. 3488, 73 L.Ed.2d 1369 (1982). Nolen's total sales were $1.5 million; the jury awarded Molex 7 1/2 percent of that amount, or $112,500. This award was consistent with expert testimony presented by Molex; it was also approximately equal to the total amount actually received by Nolen from Molex and Western during the relevant period. There was thus ample evidence to support the award. 30 i) Nolen's actions were maliciously or wantonly or oppressively done. Nolen's assertion that he acted in good faith merits no discussion. 31 j) Molex should be awarded $250,000 as exemplary damages for Nolen's actions. In Russell v. Truitt, 554 S.W.2d 948 (Tex.Civ.App.--Ft. Worth 1977, writ ref'd n.r.e.), an action for breach of fiduciary duty, the court affirmed exemplary damages of $55,000, nearly seven times the actual damages of $8,000. In so doing, the court stated,The question of excessiveness of exemplary damages depends on the facts of the particular case and is largely within the discretion of the jury. Among the factors to be considered are "the nature of the wrong, the character of the conduct involved, the degree of culpability of the wrongdoer, the situation and sensibilities of the parties concerned, and the extent to which such conduct offends a public sense of justice and propriety." Cain v. Fontana, 423 S.W.2d 134, 139 (Tex.Civ.App.--San Antonio 1967, writ ref'd n.r.e.); Schutz v. Morris, 201 S.W.2d 144, 147 (Tex.Civ.App.--Austin 1947, no writ). 32 554 S.W.2d at 955. The award in this case, twice the actual damages, is certainly not so large as to "indicate that it is a result of passion, prejudice or corruption, or that evidence has been disregarded." Crutcher-Rolfs-Cummings, Inc. v. Ballard, 540 S.W.2d 380, 389 (Tex.Civ.App.--Corpus Christi 1976, writ ref'd n.r.e.), cert. denied, 433 U.S. 910, 97 S.Ct. 2978, 53 L.Ed.2d 1095 (1977). It is affirmed. Conclusion 33 The judgment of the trial court is modified in the respect noted at page 5 and, as modified, is 34 AFFIRMED.	{ "pile_set_name": "FreeLaw" }
Consistency is contrary to nature, contrary to life. The only completely consistent people are dead – Aldous Huxley Looking for a half-season motto for these New York Rangers? Good ol’ Aldous pretty much sums it up. For this is a team that has uniquely redefined inconsistency on ice: Franchise record-setters the first six weeks, slipping through the sobering doldrums of December, now in a restorative midseason rebuild that brings philosophical questions for the Garden Faithful at the statistical halfway point. Is this glass half-empty or half-full? Has it been halfway decent or half-hearted? Are the Rangers haves or have-nots? It is a debate with as much variation and division as we have seen in the Metro Division, where the Rangers have gone from 7-up to 16-down – a standings swing of 23 points in just 23 games, dating to Nov. 23. So what happened, other than an otherworldly stretch of Capital punishment from a team that has shown equal parts will and skill? From my vantage point between the benches, there was a noticeable inconsistency in the Rangers’ battle level since their astonishing 16-3-2 start. Couple that with a December schedule on the ice and on the road that permitted only six full-squad off-day practices, and you have what could now be seen as an inevitable leveling off. Excuse? Some might say that. Explanation? Absolutely. But it’s also indicative of a team that, as we have seen the past two seasons under Alain Vigneault, is among a small handful of legitimate Stanley Cup favorites when their collective work ethic and attention to detail is peaking. But without proper practice time, that sharpness often dulls. In hockey, and pretty much any other sport. From what I see and hear at ice level, the Rangers’ passion has always been in place. There is spirit, there is encouragement and there is togetherness (which was the unofficial buzzword during the aforementioned doldrums). And so, there is reason to believe that this group grasps this situation and will much more resemble the October/November team than the month that followed. Or, as that equally erudite poet Adam Duritz once sang, “It’s been a long December but there’s reason to believe, maybe this year will be better than the last.” BETWEEN THE BENCHES The question I am most often asked by hockey fans and friends, other than how much that puck to the face hurt nearly three years ago, is this: What are the best things you hear between the benches? More often than not, the A-plus material is reported on the air, albeit edited for family viewing. As you might expect, frustration is the prevalent emotion expressed on ice, usually in short, four-letter bursts, and most notably after a missed scoring opportunity or a bad turnover or injury. But every now and then, the interaction between opponents presents humorous or eye-opening snapshots. For instance, the time Mats Zuccarello – late in a game the Rangers had comfortably tucked away – encouraged an opponent to “score some goals, I have you in my fantasy league.” That brought a smile from the foe, even as defeat was imminent. Or the time “Zucc” told Sidney Crosby that Evgeni Malkin was his favorite Penguin. Crosby had no response. As you would expect, Tanner Glass is a lightning rod for bench-jockeying, often trying to knock star players off their mental game as often as he tries to knock any player off their skates. Glass’ general intellect (he’s an Ivy Leaguer from Dartmouth) and knowledge of every nugget of a player’s career is often put to use in the quest to gain even the slightest advantage for his team. But what amazes me most is that when the gloves actually drop, nothing is said. No words during or after the fight, except perhaps for a “good job” if it’s warranted. Then there is Dylan McIlrath, who has wasted no time establishing himself as a physical and verbal presence. Recently, while yelling at the opposition bench, a player said to McIlrath, “Who the (bleep) are you? I don’t even know who you are.” McIlrath calmly responded: “Fight me. You’ll learn who I am real quick.” Because of my ability to watch replays on a monitor in the box, players from both sides often ask about borderline hits, or goal calls or offsides. In the preseason, Flyers center Claude Giroux asked if a call against his team was legitimate. I didn’t think it was and I told him that. “That’s OK, our PK could really use the help.” What also stands out from my standing-room-only spot is the human side of the players, coaches and trainers. When a Ranger comes to the bench injured, head trainer Jim Ramsey kicks into part-time mind-reader mode, not wanting to approach the player unless it’s significant enough for that player to not persevere through on his own. It’s a fascinating give-and-take, especially because players never want to admit injury. They really are most remarkable athletes. There also is a lot of encouragement and in-game coaching from coaches to players and from one player to another. The coaches’ use of iPads on the bench has brought instant teaching moments into the 21st century, but there’s still nothing like player-to-player communication. In fact, the most consistently vocal and upbeat player on the Rangers bench might come as a surprise: It’s Keith Yandle, who hasn’t even been with the team for a full year And just a few weeks ago, in the midst of a frustrating loss to the Rangers, Ottawa tough guy Chris Neil tried to throw a late-game message-sending hit on a Ranger between the benches. He missed, and in doing so, his stick slammed into my box and clipped me on the shoulder. I watched as Neil headed to the bench, slammed the door in anger and sat with his head down on the Senators bench. About 10 seconds later, Neil leaned over and said: “Hey buddy. Sorry about the stick. My bad.” I thought that was pretty amazing, given where his mindset was at that split second. While those moments and others are noteworthy, you might be surprised to hear that the majority of the in-game communication consists of simple line-change orders from Vigneault, brief and specific instruction from assistants Ulf Samuelsson and Scott Arniel, mostly even-tempered messages of motivation and largely level-headed discussions with officials about why something was or wasn’t called. It’s not nearly the “Slap Shot“-level dialogue that you might imagine. Of course, there are exceptions. And when they occur, I’ll be there to report them. REACH OUT In fact, we plan to make this little literature soirée a weekly feature here on MSGNetworks.com. Feel free to share your Rangers thoughts, comments, questions with me on Twitter: @jaygeemsg. I always look forward to interacting with the Faithful. Thanks for reading Vol. I.	{ "pile_set_name": "OpenWebText2" }
Lawsuit Settlement Hit November 26, 1985 Four senators asked the Interior Department yesterday not to go ahead with a proposed settlement of a lawsuit filed by the Westlands Water District in California until the interior secretary answers questions about it. In a letter to Interior Secretary Donald P. Hodel, the senators asked whether the settlement would continue the unauthorized federal irrigation water supply to 156,000 acres and whether the public would get a chance to comment on the proposed settlement. Interior Department spokesman Carl Gagliardi said he was unaware of any plans to publish the settlement before Hodel decides whether to approve it. The Westlands district sued the department in 1978 to force its Bureau of Reclamation to make a permanent contract to replace temporary agreements supplying water to the disputed acreage. Former Interior secretary James G. Watt concluded that the water could not be provided without congressional authorization. The senators said the 1982 Reclamation Reform Act required that new water contracts and amendments to existing contracts be open to public participation, and asked Hodel whether he intended to submit the Westlands agreement "for public scrutiny" before approving it. The group of senators pointed to news reports indicating that "the agreement will provide water to Westlands past the year 2000 at less than $10 an acre foot, a fraction of its actual cost . . . . What is the justification for such a generous subsidy?" They also asked whether the agreement called for elimination of a projected $70 million deficit in Westlands' repayments to the federal government and whether the agreement addressed Westlands' responsibility for selenium contamination of the Kesterson Wildlife Refuge by irrigation runoff water. The senators also asked whether any environmental impact statements had been prepared.	{ "pile_set_name": "Pile-CC" }
AGO4 is specifically required for heterochromatic siRNA accumulation at Pol V-dependent loci in Arabidopsis thaliana. In plants, 24 nucleotide long heterochromatic siRNAs (het-siRNAs) transcriptionally regulate gene expression by RNA-directed DNA methylation (RdDM). The biogenesis of most het-siRNAs depends on the plant-specific RNA polymerase IV (Pol IV), and ARGONAUTE4 (AGO4) is a major het-siRNA effector protein. Through genome-wide analysis of sRNA-seq data sets, we found that AGO4 is required for the accumulation of a small subset of het-siRNAs. The accumulation of AGO4-dependent het-siRNAs also requires several factors known to participate in the effector portion of the RdDM pathway, including RNA POLYMERASE V (POL V), DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2) and SAWADEE HOMEODOMAIN HOMOLOGUE 1 (SHH1). Like many AGO proteins, AGO4 is an endonuclease that can 'slice' RNAs. We found that a slicing-defective AGO4 was unable to fully recover AGO4-dependent het-siRNA accumulation from ago4 mutant plants. Collectively, our data suggest that AGO4-dependent siRNAs are secondary siRNAs dependent on the prior activity of the RdDM pathway at certain loci.	{ "pile_set_name": "PubMed Abstracts" }
Louisiana Gov. Bobby Jindal isn’t expected to announce his candidacy for president until June 24, but he’s already firing shots at future competitors. In response to Sen. Rand Paul’s comments in late May on the origins of ISIS, Jindal called him "outlandish," "illogical," and "unsuited to be Commander-in-Chief." Paul advisor Doug Stafford shot back at Jindal, saying, "It’s ironic Gov. Jindal would level such a charge when he flip-flops on crucial issues like Common Core and national security, and he has cratered his own state’s economy and budget." This is not the first time critics have accused of Jindal for doing a 180 on Common Core — the state-based educational standards aimed at improving student readiness for college and the workplace. (Read our past fact-checks of claims and flips relating to Common Core.) In light of his upcoming candidacy, we wondered: How does Jindal’s position on Common Core register on our Flip-O-Meter? It’s important to note that we are not making a value judgment about flip-flopping; we're just noting whether a change of position has occurred. Jindal support Common Core was launched in June 2009 as a collaboration between 49 states and territories. Louisiana adopted the standards in 2010 with Jindal’s blessing. In 2012, he handpicked John White, a strong supporter of Common Core, as state superintendent of education. At an event for business leaders in January of that year, Jindal lauded the Common Core standards as a step forward for education in his state that "will raise expectations for every child." Jindal echoed the sentiment early into his second term. Jindal stood by Common Core at a groundbreaking ceremony in 2013, amid an ongoing fight over the standards in his state and even after the Republican National Committee renounced the program. Though he never mentioned the initiative by name, Jindal said that "too many" governors, teachers, students and parents "have fought too hard for too many years to put Louisiana on that map (toward more rigorous education standards). And we're not going backwards." Then, he disowned the initiative. Jindal opposition Jindal himself acknowledges his change of heart, which he says is due to the federal government’s stepping in. His spokesperson Mike Reed told us, "Gov. Jindal supported (Common Core) when he believed it to be a state-led effort. Later, when he discovered it was a centralized federal effort, he opposed it and began working to remove Common Core from Louisiana." We’ve fact-checked several statements that suggest Common Core is a federal program or mandate. It’s not. States can improve their chances of winning federal money if they adopt educational standards; the Obama administration included that as criteria for its "Race to the Top" program. But Common Core itself remains a state-based, voluntary program. Nevertheless, by April 2014, Jindal was clearly in the opposition camp. "I'm from the school that believes education is a matter best left for local control," Jindal wrote in an op-ed for USA Today. "The notion of Washington determining curricula is something most states are simply not interested in. It's a non-starter." A month later, Jindal grew more emphatic in his distaste for Common Core, comparing it to centralized planning in Russia. He also tweeted: We will not be bullied by fed govt. Common Core advocates claim it not a fed takeover, but Sec. Duncan's comments & actions prove otherwise. — Gov. Bobby Jindal (@BobbyJindal) June 17, 2014 Beyond rhetoric, Jindal has actively tried to rock the schoolhouse standards. He sued the Obama administration over the national implementation of Common Core in 2014 (and he’s been sued for his repudiation). He asked Common Core to withdraw from the state. He broke with his own education head, an "exceptional" and "unusual" move, according to Ashley Jochim, who studies Common Core at the Center for Reinventing Public Education. He proposed an opt-out option for students in early 2015. He issued an executive order to repeal Common Core in Louisiana in 2014 and came up with a legislative plan as well. In late May, Jindal signed off on a compromise between Louisiana legislators that allows state review and revision of the federal standards with public oversight. But, according to his spokesperson, that doesn’t mean Jindal’s done with his efforts to permanently give Common Core the boot in the Bayou. "We support the compromise because it ensures we have local control going forward. The next step will be to elect leaders who are committed to getting rid of Common Core," Reed told us, noting that Jindal’s lawsuit against the Obama administration is moving forward. Experts say there’s no question Jindal reversed his position on Common Core. "Gov. Jindal has clearly flip-flopped on the issue. He went from singing the praises of Common Core to leading the charge for removing the standards in Louisiana. Because of Jindal, the state has made almost a complete U-turn on the standards," said James Shuls, a professor of education and policy at the University of Missouri in St. Louis. Jindal’s change of position has also been noted by CNN, the Huffington Post, the Washington Times, the Washington Post’s editorial board and the Times-Picayune. Our rating Jindal was once an ardent supporter of Common Core (and one of the first adopters of the initiative) but has since become one of its staunchest critics, mounting lawsuits and legislation against the initiative. Despite his endorsement of a compromise in his state, Jindal remains an opponent to the core. We rate Jindal’s position on Common Core a Full Flop.	{ "pile_set_name": "OpenWebText2" }
Timothy (tortoise) Timothy (c. 1844 – 3 April 2004) was a Mediterranean spur-thighed tortoise who was thought to be approximately 160 years old at the time of her death. This made her the UK's oldest known resident. In spite of her name, Timothy was female; it was not properly known how to sex tortoises in the 19th century. Timothy was named after a tortoise owned by Gilbert White. Timothy was believed to have been born in the Mediterranean shores of Turkey and was found aboard a Portuguese privateer in 1854, aged around 10, by Captain John Guy Courtenay-Everard of the Royal Navy. The tortoise served as a mascot on a series of navy vessels until 1892. She was ship's mascot of during the first bombardment of Sevastopol in the Crimean War (she was the last survivor of this war), then moved to followed by . After her naval service she retired to live out her life on dry land, taken in by the Earl of Devon at his home, Powderham Castle. From 1935 she lived in the castle's rose garden and was owned by Camilla Gabrielle Courtenay (1913–2010), the daughter of the 16th Earl of Devon. On her underside was etched "Where have I fallen? What have I done?", English translation of the Courtenay family motto ubi lapsus, quid feci. In 1926, Timothy's owners decided that he should mate, and it was then discovered that "he" was actually female. Despite this information, mating attempts were unsuccessful. Timothy is buried at Powderham Castle. See also Jonathan (tortoise), believed to be the oldest living reptile . Lin Wang References External links Category:1844 animal births Category:2004 animal deaths Category:Individual tortoises Category:Animal mascots Category:Military animals Category:English mascots Category:Individual animals in England Category:History of the Royal Navy Category:Military animals of World War I	{ "pile_set_name": "Wikipedia (en)" }
I sent some POSW coins from my coinomi wallet to exchange. One transaction has created 2 outputs however the one which holds 124 coins is showing as "unspent". Why does it gets stuck in block chain ? As per attached image the block itself has many confirmed confirmations. Do I need to contact my wallet provider or exchange in this case ? I have correct receiving address in place and POSW coins are being moved to POSW wallet address. How long does it takes for coins to be in " Spent" stage. I earlier faced this issue with bitcoin and now it is with POSW coins. Hi Willtech when you state "unspent until another transaction is made as to input the fund" what does this actually mean ? – adikhannaJan 29 at 17:25 The address where 125 coins are going is exchange address given to me by exchange. Recipient has received means it is with exchange ? – adikhannaJan 29 at 17:27 @adikhanna Yes, if the address is exactly the address given to you by the exchange, for exactly the same cryptocurrency then yes, the coins are with the exchange. My answer is not quite as you have quoted, but to say further, "unspent until another transaction is made as to input the fund into the supply for a new transaction." i.e. spending the funds. It means the funds are held by the address until they are used. – WilltechJan 30 at 8:08 "unspent until another transaction is made" by you means that my 125 coins UTXO has to be tied with new input for this to reflect in my account ? I am new to this so let me know if what I am saying is correct or not ? How long does exchange usually take to tie this transaction to new input ? Is it done manually ? If you know by any means every exchange has a different ways to deal with UTXO ? – adikhannaJan 30 at 13:03 @adikhanna Once the original transaction is confirmed in a block the funds should be showing in your account. A new transaction would take the funds out again. Please check the output address on the original transaction carefully to ensure that it is precisely correct and contact the exchange for assistance. – WilltechJan 31 at 7:37	{ "pile_set_name": "Pile-CC" }
Just after 4 p.m. on Thanksgiving eve, a boy steps off a school bus. Then he walks – with some help, but not too much – into his West Central home. Once inside, he sits on the couch. He smiles. A little later, he gets into his dad’s car. He gets out of the car. He gets his haircut. He smiles again. He shakes a stranger’s hand. Doctors said this boy, 15-year-old Daniel Chappell, would never do any of these things. While Chappell doesn’t have one clear diagnosis, he suffers from a number of genetically related health problems. His initial prognosis had been far more bleak. Someday, maybe if everything went right, Daniel would sit up unassisted, doctors told Micheal Chappell when he became Daniel’s long-term legal guardian in the early 2000s. “I always say Danny is just a miracle. He’s a miracle child,” said Lee Williams, a longtime friend of Daniel and Micheal. “The fact that he has beat all the odds … is just amazing.” Knowing Daniel’s history, and his doctors’ low expectations, makes the scene Wednesday night all the more memorable. Daniel and Micheal sit on a couch in their home, listening to “Cat in the Hat” narrated on an iPad. Micheal helps Daniel navigate the colorful scene on the screen. Although Micheal is not legally Daniel’s adoptive parent, he might as well be. He’s lived with and cared for Daniel since the boy was 2 years old. Daniel is legally separated from his biological parents. Daniel’s health care needs are paid for by Medicaid. “Where is the fish?” Micheal asks Daniel. “Daniel, can you show me the fish?” After several false starts, Daniel jabs the animated fish with his finger. Then, switching gears, and apps, Micheal asks Daniel if he wants sweet potatoes for dinner. Daniel pushes a large red “yes” button repeatedly. “He loves sweet potatoes,” Micheal said. “He’s said 14 different words in his life,” he adds. In fact, the last time Daniel spoke was five years ago, on Thanksgiving. He said, “thank you.” ‘His own place in this community’ While Daniel may not be able to speak, he’s developed a vibrant and engaging personality – a personality that’s connected him with people throughout the Spokane area. At Dan’s Barber and Styling Salon on Monroe Street, Daniel is a regular. “Oh! Look who’s here, oh my goodness,” Johannah Flambouras said Wednesday night as Daniel walked in. Flambouras has been cutting Daniel’s hair for years. She knows how to work with the boy, and Daniel has grown comfortable with her. “Dad doesn’t have to hold him down as much,” she said of how Daniel’s changed in the years she’s known him. She’s seen him develop more communication skills and grow comfortable interacting with the world. She smiled thinking of Daniel’s happy dance, which he often launches into as she vacuums the hair from his scalp and neck. That’s his favorite part. “Daniel has his own identity and his own place in this community,” Micheal said. Overcoming the odds Dr. Deb Harper was Daniel’s pediatrician when he was born. Normally, Harper said, she’s optimistic about children and their ability to overcome serious health and developmental problems. That was not the case with Daniel. She was one of the doctors who told Micheal that his son would never sit up unassisted. “I was quite pessimistic about Daniel’s ability to move on,” she said. She cared for Daniel as an infant, and then, when Micheal started caring for Daniel, she lost track of the boy. Four years later, she was sitting in her home when Daniel unexpectedly crawled back into her life. One day, Harper’s husband, who is a Realtor, brought another Realtor by their home for a visit. It was Micheal, and Daniel was with him. The 4-year-old boy was crawling around Harper’s living room floor. Nearly blind, but crawling, on his own. She recognized him as the little boy who, years ago, she’d thought would never sit up. “I was absolutely knocked silly,” she said. “Part of this is that I was wrong … and part of it is that Micheal Chappell did a hell of a job with this kid.” Amazing changes Like Harper, those who know and love Daniel are quick to praise Micheal. “It’s quite a job he took on, bringing that little boy into his life,” said Kevin Gardner, a member of the band Spare Parts. “I couldn’t have done that. I’m not patient enough.” Micheal met Daniel by chance while working as a Realtor. Daniel was 16 months old, with little mobility and the physical characteristics of an infant. Though they shared no familial bond, Micheal, who had no children of his own, found his mind turning again and again to Daniel, who went by a different name and was in foster care at the time. The foster mother was seeking a permanent home for the boy. Through repeated encounters, familiarity grew into a mutual attachment until finally Micheal, who was single at the time, made the decision to take full responsibility of the boy. Though he never formally adopted Daniel, he considers him his son. Gardner first met Daniel about 10 years ago while playing at Madeleine’s Cafe in downtown Spokane. He noticed Micheal and Daniel sitting at the very front table. “You could tell that he had some physical problems. But the first thing you notice was how patient Micheal was with him,” Gardner said. Daniel loves Spare Parts, and since that first show years ago, he’s attended many of their concerts. Gardner said in the beginning Daniel didn’t respond much to the music, but over time he’s become more animated and visibly engaged. He’ll start swinging his arms and he gets a “joyful look on his face,” Gardner said. “It’s just been pretty cool,” he said. “I’ve been so amazed at the changes in that little guy over time.” Micheal brushes off the praise, instead focusing on Daniel: his resilience and his will to not only survive, but thrive. “You know he never gives up,” he said. “He looks out and he looks up.” The learning process At Salk Middle School, where Daniel goes to school, that resilience is starting to pay off. Daniel is learning to communicate more of his needs, desires and thoughts, said Kelli Nygren, Daniel’s special education teacher. “I think my goal as his teacher is to help him show off what he knows,” she said. “But then also to help him interact with the world as fully as he can, as opposed to it just happening to him.” Nygren helps Daniel learn to communicate, often using an iPad or rudimentary sign language. Two weeks ago Daniel rode a three-wheeled bike on his own for the first time. He’s also recently started doing, with her help, basic addition. Kelli Nygren / The Spokesman-Review When asked what Daniel is able to understand, Nygren demurs, pointing to the fact that a year ago Daniel’s accomplishments of the past month would have seemed impossible. “When he first started with me, did I think he knew how to do addition?” she asked, laughing. “We were just getting him used to eating.” And, despite his disabilities, Daniel is remarkably similar to other children, Nygren said. “He can be mischievous. He has a sense of humor. He acts just like a teenage boy in so many ways,” she said. “Kind of goofing around and not really wanting to work. A little bit of attitude (sometimes).” That’s the little boy Micheal felt moved to help years ago. The one who laughs, goofs around and teases. The curious one, who loves music, sweet potatoes and getting his hair cut. The one who is just like any other 15-year-old. And, as Daniel develops and learns, the rest of the world is seeing him for who he truly is. “He’s the driver of his destiny,” Micheal said. “If he can overcome and get going, who are we not to?”	{ "pile_set_name": "OpenWebText2" }
Bhawanipore F.C. Bhawanipore Club is an Indian football club from Bhowanipore, Kolkata, West Bengal. The club has been established in 1910. It has been accepted into the I-League 2nd Division, the 2nd tier of football in India. History Bhawanipore Football Club was founded in 1910 in Bhowanipore, Kolkata. In January 2012 they were officially certified by the All India Football Federation to participate in the I-League 2nd Division, the second tier of football in India. After playing 6 games during the season Bhawanipore ended in 6th place out of 7 in Group C and thus failed to move to the Final half. Stadium Bhawanipore Football Club currently plays at the 20,000 seater Kalyani Stadium in Kalyani. Fans A club recognised Bhowanipore fan club by the name West Bengal Palace, has been in support since 2019. The Kalyani Stadium Main Stadium has seen an average attendance of 40,000. The players and the coach have often acknowledged the fans' support in the success and called them The 12th Man. Kit manufacturers and shirt sponsors Rivalry South Kolkata Derby Players Current squad Current technical staff Record Key Tms. = Number of teams Pos. = Position in league Attendance/G = Average league attendance Head coach's record updated on 20 January 2020 Honours Leagues I-League 2nd Division (1):Runner-Up 2014-15 (1):3Ed Prize 2013-14 Cup Bordoloi Trophy (1):Winners 2013 External links Club logo References Category:Football clubs in India Category:Association football clubs established in 1910 Category:1910 establishments in India	{ "pile_set_name": "Wikipedia (en)" }
Wonju Stadium Wonju Stadium is a multi-purpose stadium in Wonju, South Korea. It is currently used mostly for football matches. The stadium has a capacity of 20,000 people and was opened in 1980. External links Wonju Sports Facilities Management Center Category:Sports venues in Gangwon Province, South Korea Category:Football venues in South Korea Category:Gangwon FC Category:Ulsan Hyundai FC Category:Multi-purpose stadiums in South Korea Category:Sports venues completed in 1980 Category:K League 1 stadiums	{ "pile_set_name": "Wikipedia (en)" }
I read the L is supposed to have some great improvements with ART. Has anyone tried using ART with the rooted debloated/deodexed ROMs? What differences did you notice? Sent from my SM-G900V using XDA Free mobile app I used ART on the stock rom, rooted, and the only difference I saw was a significant decrease in the available memory (internal). I went from about 86% free using Delvek to 76% free when I changed to ART. I used TiBu to clear Delvek but that didn't improve the available memory at all. Not sure why the big difference, but it was significant. XDA Developers was founded by developers, for developers. It is now a valuable resource for people who want to make the most of their mobile devices, from customizing the look and feel to adding new functionality.Are you a developer?	{ "pile_set_name": "Pile-CC" }
Nigeria election body declares official vote results Nigeria’s electoral commission has announced the official results of the country’s presidential election, declaring opposition leader Mohammadu Buhari the winner of the polls. Buhari, a 72-year-old former military ruler from the All Progressives Congress (APC) Party, won 15,424,921 votes or 53.95 percent of the 28,587,564 total valid ballots cast, the Independent National Electoral Commission (INEC) said on Wednesday. “Muhammadu Buhari… having satisfied the requirement for the law and scored the highest number of votes is hereby declared the winner,” INEC Chairman Attahiru Jega said. Jonathan had conceded defeat to Buhari and congratulated him in a statement released on Tuesday. The vote was the eighth election since Africa’s most populous country won independence from Britain in 1960. It is the first time in Nigeria’s history that a challenger has defeated a sitting president. Buhari ruled Nigeria from January 1984 until August 1985 following a military coup in December 1983. In the recent election, he received more votes in Nigeria’s northwestern states, hit hardest by the acts of violence committed by Takfiri Boko Haram terrorists. In Borno state, for instance, he won 94 percent of the votes. Many had criticized Jonathan’s handling of the violence. Boko Haram extremists have claimed responsibility for a number of deadly shooting attacks and bombings in various parts of Nigeria since the beginning of their militancy in 2009, which has so far left over 13,000 people dead and 1.5 million displaced. People in the oil-rich West African country turned out en masse to vote on Saturday. The election was extended to Sunday, on the account that ballot papers arrived late or imported card readers failed to recognize the fingerprints of the voters.	{ "pile_set_name": "Pile-CC" }
QS prev_prev_son==- { "b^","ch^","d^","dh^","f^","g^","hh^","jh^","k^","p^","s^","sh^","t^","th^","v^","z^","zh^" } QS prev_prev_vc==+ { "aa^","ae^","ah^","ao^","aw^","ax^","ay^","eh^","er^","ey^","ih^","iy^","ow^","oy^","uh^","uw^" } QS prev_prev_cvox==+ { "b^","d^","dh^","g^","jh^","l^","m^","n^","ng^","r^","v^","w^","y^","z^","zh^" } QS prev_prev_ccor==+ { "ch^","d^","dh^","jh^","l^","n^","r^","s^","sh^","t^","th^","z^","zh^" } QS prev_prev_cont==+ { "dh^","f^","hh^","l^","r^","s^","sh^","th^","v^","w^","y^","z^","zh^" } QS prev_prev_vrnd==- { "aa^","ae^","ah^","aw^","ax^","ay^","eh^","er^","ey^","ih^","iy^" } QS prev_prev_ccor==+&&son==- { "ch^","d^","dh^","jh^","s^","sh^","t^","th^","z^","zh^" } QS prev_prev_cvox==- { "ch^","f^","hh^","k^","p^","s^","sh^","t^","th^" } QS prev_prev_cont==+&&ccor==+ { "dh^","l^","r^","s^","sh^","th^","z^","zh^" } QS prev_prev_cont==-&&cvox==+ { "b^","d^","g^","jh^","m^","n^","ng^" } QS prev_prev_csib==+ { "ch^","jh^","s^","sh^","z^","zh^" } QS prev_prev_vlng==s { "ae^","ah^","eh^","ih^","uh^" } QS prev_prev_vfront==2 { "ah^","aw^","ax^","ay^","er^" } QS prev_prev_cvox==-&&ctype==f { "f^","hh^","s^","sh^","th^" } QS prev_prev_cvox==+&&cplace==a { "d^","l^","n^","r^","z^" } QS prev_prev_cplace==l { "b^","m^","p^","w^" } QS prev_prev_vheight==1 { "ih^","iy^","uh^","uw^" } QS prev_prev_vlng==l { "aa^","ao^","iy^","uw^" } QS prev_prev_vrnd==-&&vheight==3 { "aa^","ae^","aw^","ay^" } QS prev_prev_cvox==+&&clab==+ { "b^","m^","v^","w^" } QS prev_prev_cont==+&&cplace==a { "l^","r^","s^","z^" } QS prev_prev_vfront==2&&vheight==2 { "ah^","ax^","er^" } QS prev_prev_ctype==s&&cplace==a { "d^","t^" } QS prev_prev_vfront==1&&vheight==2 { "eh^","ey^" } QS prev_prev_cvox==-&&cplace==p { "ch^","sh^" } QS prev_prev_name==ey { "ey^" } QS prev_prev_name==f { "f^" } QS prev_prev_name==pau { "pau^" } QS prev_vc==- { "^b-","^ch-","^d-","^dh-","^f-","^g-","^hh-","^jh-","^k-","^l-","^m-","^n-","^ng-","^p-","^r-","^s-","^sh-","^t-","^th-","^v-","^w-","^y-","^z-","^zh-" } QS prev_son==- { "^b-","^ch-","^d-","^dh-","^f-","^g-","^hh-","^jh-","^k-","^p-","^s-","^sh-","^t-","^th-","^v-","^z-","^zh-" } QS prev_vc==+ { "^aa-","^ae-","^ah-","^ao-","^aw-","^ax-","^ay-","^eh-","^er-","^ey-","^ih-","^iy-","^ow-","^oy-","^uh-","^uw-" } QS prev_cvox==+ { "^b-","^d-","^dh-","^g-","^jh-","^l-","^m-","^n-","^ng-","^r-","^v-","^w-","^y-","^z-","^zh-" } QS prev_ccor==+ { "^ch-","^d-","^dh-","^jh-","^l-","^n-","^r-","^s-","^sh-","^t-","^th-","^z-","^zh-" } QS prev_cont==+ { "^dh-","^f-","^hh-","^l-","^r-","^s-","^sh-","^th-","^v-","^w-","^y-","^z-","^zh-" } QS prev_vrnd==- { "^aa-","^ae-","^ah-","^aw-","^ax-","^ay-","^eh-","^er-","^ey-","^ih-","^iy-" } QS prev_cont==- { "^b-","^ch-","^d-","^g-","^jh-","^k-","^m-","^n-","^ng-","^p-","^t-" } QS prev_ccor==+&&son==- { "^ch-","^d-","^dh-","^jh-","^s-","^sh-","^t-","^th-","^z-","^zh-" } QS prev_cvox==- { "^ch-","^f-","^hh-","^k-","^p-","^s-","^sh-","^t-","^th-" } QS prev_ctype==f { "^dh-","^f-","^hh-","^s-","^sh-","^th-","^v-","^z-","^zh-" } QS prev_cvox==+&&son==- { "^b-","^d-","^dh-","^g-","^jh-","^v-","^z-","^zh-" } QS prev_cont==+&&ccor==+ { "^dh-","^l-","^r-","^s-","^sh-","^th-","^z-","^zh-" } QS prev_cont==+&&cvox==+ { "^dh-","^l-","^r-","^v-","^w-","^y-","^z-","^zh-" } QS prev_ccor==+&&cvox==+ { "^d-","^dh-","^jh-","^l-","^n-","^r-","^z-","^zh-" } QS prev_son==+ { "^l-","^m-","^n-","^ng-","^r-","^w-","^y-" } QS prev_cont==-&&cvox==+ { "^b-","^d-","^g-","^jh-","^m-","^n-","^ng-" } QS prev_cplace==a { "^d-","^l-","^n-","^r-","^s-","^t-","^z-" } QS prev_ccor==+&&ctype==f { "^dh-","^s-","^sh-","^th-","^z-","^zh-" } QS prev_csib==+ { "^ch-","^jh-","^s-","^sh-","^z-","^zh-" } QS prev_vfront==3 { "^aa-","^ao-","^ow-","^oy-","^uh-","^uw-" } QS prev_vrnd==+ { "^ao-","^ow-","^oy-","^uh-","^uw-" } QS prev_vfront==1 { "^ae-","^eh-","^ey-","^ih-","^iy-" } QS prev_cont==+&&ccor==+&&cvox==+ { "^dh-","^l-","^r-","^z-","^zh-" } QS prev_ccor==+&&cvox==- { "^ch-","^s-","^sh-","^t-","^th-" } QS prev_cont==-&&cvox==- { "^ch-","^k-","^p-","^t-" } QS prev_son==-&&clab==+ { "^b-","^f-","^p-","^v-" } QS prev_vrnd==-&&vlng==s { "^ae-","^ah-","^eh-","^ih-" } QS prev_vlng==l { "^aa-","^ao-","^iy-","^uw-" } QS prev_cont==+&&son==+ { "^l-","^r-","^w-","^y-" } QS prev_ctype==r { "^er-","^r-","^w-","^y-" } QS prev_cvox==-&&ctype==s { "^k-","^p-","^t-" } QS prev_vrnd==-&&vlng==d { "^aw-","^ay-","^ey-" } QS prev_son==+&&cplace==a { "^l-","^n-","^r-" } QS prev_ctype==n { "^m-","^n-","^ng-" } QS prev_cont==-&&cplace==a { "^d-","^n-","^t-" } QS prev_ctype==r&&son==+ { "^r-","^w-","^y-" } QS prev_cvox==-&&csib==+ { "^ch-","^s-","^sh-" } QS prev_cont==+&&cvox==+&&cplace==a { "^l-","^r-","^z-" } QS prev_ccor==+&&cvox==-&&ctype==f { "^s-","^sh-","^th-" } QS prev_vheight==1&&vlng==s { "^ih-","^uh-" } QS prev_son==+&&clab==+ { "^m-","^w-" } QS prev_cvox==-&&clab==+ { "^f-","^p-" } QS prev_cvox==+&&son==-&&clab==+ { "^b-","^v-" } QS prev_ctype==s&&cplace==a { "^d-","^t-" } QS prev_cvox==-&&cplace==a { "^s-","^t-" } QS prev_cont==-&&cvox==+&&clab==+ { "^b-","^m-" } QS prev_cont==+&&son==+&&cplace==a { "^l-","^r-" } QS prev_vfront==1&&vheight==2 { "^eh-","^ey-" } QS prev_vheight==2&&vlng==s { "^ah-","^eh-" } QS prev_ctype==a { "^ch-","^jh-" } QS prev_cont==-&&cvox==+&&cplace==a { "^d-","^n-" } QS prev_cvox==+&&cplace==v { "^g-","^ng-" } QS prev_cont==+&&cvox==+&&cplace==p { "^y-","^zh-" } QS prev_name==ao { "^ao-" } QS prev_name==ax { "^ax-" } QS prev_name==dh { "^dh-" } QS prev_name==hh { "^hh-" } QS prev_name==l { "^l-" } QS prev_name==n { "^n-" } QS prev_name==pau { "^pau-" } QS prev_name==r { "^r-" } QS prev_name==sh { "^sh-" } QS prev_name==t { "^t-" } QS prev_name==x { "^x-" } QS prev_name==z { "^z-" } QS vc==- { "-b+","-ch+","-d+","-dh+","-f+","-g+","-hh+","-jh+","-k+","-l+","-m+","-n+","-ng+","-p+","-r+","-s+","-sh+","-t+","-th+","-v+","-w+","-y+","-z+","-zh+" } QS son==- { "-b+","-ch+","-d+","-dh+","-f+","-g+","-hh+","-jh+","-k+","-p+","-s+","-sh+","-t+","-th+","-v+","-z+","-zh+" } QS vc==+ { "-aa+","-ae+","-ah+","-ao+","-aw+","-ax+","-ay+","-eh+","-er+","-ey+","-ih+","-iy+","-ow+","-oy+","-uh+","-uw+" } QS cvox==+ { "-b+","-d+","-dh+","-g+","-jh+","-l+","-m+","-n+","-ng+","-r+","-v+","-w+","-y+","-z+","-zh+" } QS ccor==+ { "-ch+","-d+","-dh+","-jh+","-l+","-n+","-r+","-s+","-sh+","-t+","-th+","-z+","-zh+" } QS cont==+ { "-dh+","-f+","-hh+","-l+","-r+","-s+","-sh+","-th+","-v+","-w+","-y+","-z+","-zh+" } QS vrnd==- { "-aa+","-ae+","-ah+","-aw+","-ax+","-ay+","-eh+","-er+","-ey+","-ih+","-iy+" } QS cont==- { "-b+","-ch+","-d+","-g+","-jh+","-k+","-m+","-n+","-ng+","-p+","-t+" } QS ccor==+&&son==- { "-ch+","-d+","-dh+","-jh+","-s+","-sh+","-t+","-th+","-z+","-zh+" } QS cvox==- { "-ch+","-f+","-hh+","-k+","-p+","-s+","-sh+","-t+","-th+" } QS cont==+&&cvox==+ { "-dh+","-l+","-r+","-v+","-w+","-y+","-z+","-zh+" } QS cplace==a { "-d+","-l+","-n+","-r+","-s+","-t+","-z+" } QS vheight==2 { "-ah+","-ax+","-eh+","-er+","-ey+","-ow+","-oy+" } QS clab==+ { "-b+","-f+","-m+","-p+","-v+","-w+" } QS csib==+ { "-ch+","-jh+","-s+","-sh+","-z+","-zh+" } QS vfront==3 { "-aa+","-ao+","-ow+","-oy+","-uh+","-uw+" } QS ctype==s { "-b+","-d+","-g+","-k+","-p+","-t+" } QS vfront==1 { "-ae+","-eh+","-ey+","-ih+","-iy+" } QS vlng==d { "-aw+","-ay+","-ey+","-ow+","-oy+" } QS vlng==s { "-ae+","-ah+","-eh+","-ih+","-uh+" } QS cvox==-&&ctype==f { "-f+","-hh+","-s+","-sh+","-th+" } QS cplace==p { "-ch+","-jh+","-sh+","-y+","-zh+" } QS vheight==3 { "-aa+","-ae+","-ao+","-aw+","-ay+" } QS ctype==f&&csib==+ { "-s+","-sh+","-z+","-zh+" } QS vlng==l { "-aa+","-ao+","-iy+","-uw+" } QS cont==+&&son==+ { "-l+","-r+","-w+","-y+" } QS ctype==r { "-er+","-r+","-w+","-y+" } QS cvox==+&&clab==+ { "-b+","-m+","-v+","-w+" } QS cvox==+&&ctype==f { "-dh+","-v+","-z+","-zh+" } QS cplace==v { "-g+","-k+","-ng+" } QS son==+&&cplace==a { "-l+","-n+","-r+" } QS cvox==+&&csib==+ { "-jh+","-z+","-zh+" } QS cont==+&&son==+&&cplace==a { "-l+","-r+" } QS cont==-&&cvox==+&&cplace==a { "-d+","-n+" } QS cont==+&&cvox==+&&cplace==p { "-y+","-zh+" } QS vrnd==+&&vheight==1 { "-uh+","-uw+" } QS name==aa { "-aa+" } QS name==aw { "-aw+" } QS name==ax { "-ax+" } QS name==ay { "-ay+" } QS name==ch { "-ch+" } QS name==dh { "-dh+" } QS name==f { "-f+" } QS name==g { "-g+" } QS name==hh { "-hh+" } QS name==ih { "-ih+" } QS name==k { "-k+" } QS name==l { "-l+" } QS name==n { "-n+" } QS name==ow { "-ow+" } QS name==oy { "-oy+" } QS name==p { "-p+" } QS name==r { "-r+" } QS name==s { "-s+" } QS name==t { "-t+" } QS name==v { "-v+" } QS name==z { "-z+" } QS next_vc==- { "+b=","+ch=","+d=","+dh=","+f=","+g=","+hh=","+jh=","+k=","+l=","+m=","+n=","+ng=","+p=","+r=","+s=","+sh=","+t=","+th=","+v=","+w=","+y=","+z=","+zh=" } QS next_son==- { "+b=","+ch=","+d=","+dh=","+f=","+g=","+hh=","+jh=","+k=","+p=","+s=","+sh=","+t=","+th=","+v=","+z=","+zh=" } QS next_vc==+ { "+aa=","+ae=","+ah=","+ao=","+aw=","+ax=","+ay=","+eh=","+er=","+ey=","+ih=","+iy=","+ow=","+oy=","+uh=","+uw=" } QS next_cvox==+ { "+b=","+d=","+dh=","+g=","+jh=","+l=","+m=","+n=","+ng=","+r=","+v=","+w=","+y=","+z=","+zh=" } QS next_ccor==+ { "+ch=","+d=","+dh=","+jh=","+l=","+n=","+r=","+s=","+sh=","+t=","+th=","+z=","+zh=" } QS next_cont==+ { "+dh=","+f=","+hh=","+l=","+r=","+s=","+sh=","+th=","+v=","+w=","+y=","+z=","+zh=" } QS next_vrnd==- { "+aa=","+ae=","+ah=","+aw=","+ax=","+ay=","+eh=","+er=","+ey=","+ih=","+iy=" } QS next_cont==- { "+b=","+ch=","+d=","+g=","+jh=","+k=","+m=","+n=","+ng=","+p=","+t=" } QS next_ccor==+&&son==- { "+ch=","+d=","+dh=","+jh=","+s=","+sh=","+t=","+th=","+z=","+zh=" } QS next_cvox==- { "+ch=","+f=","+hh=","+k=","+p=","+s=","+sh=","+t=","+th=" } QS next_ctype==f { "+dh=","+f=","+hh=","+s=","+sh=","+th=","+v=","+z=","+zh=" } QS next_cont==+&&cvox==+ { "+dh=","+l=","+r=","+v=","+w=","+y=","+z=","+zh=" } QS next_ccor==+&&cvox==+ { "+d=","+dh=","+jh=","+l=","+n=","+r=","+z=","+zh=" } QS next_cont==-&&son==- { "+b=","+ch=","+d=","+g=","+jh=","+k=","+p=","+t=" } QS next_son==+ { "+l=","+m=","+n=","+ng=","+r=","+w=","+y=" } QS next_cont==-&&cvox==+ { "+b=","+d=","+g=","+jh=","+m=","+n=","+ng=" } QS next_vheight==2 { "+ah=","+ax=","+eh=","+er=","+ey=","+ow=","+oy=" } QS next_clab==+ { "+b=","+f=","+m=","+p=","+v=","+w=" } QS next_ctype==s { "+b=","+d=","+g=","+k=","+p=","+t=" } QS next_vfront==1 { "+ae=","+eh=","+ey=","+ih=","+iy=" } QS next_vfront==2 { "+ah=","+aw=","+ax=","+ay=","+er=" } QS next_ccor==+&&cvox==+&&son==- { "+d=","+dh=","+jh=","+z=","+zh=" } QS next_vheight==1 { "+ih=","+iy=","+uh=","+uw=" } QS next_cont==-&&ccor==+&&son==- { "+ch=","+d=","+jh=","+t=" } QS next_ctype==f&&csib==+ { "+s=","+sh=","+z=","+zh=" } QS next_cont==+&&son==+ { "+l=","+r=","+w=","+y=" } QS next_ctype==r { "+er=","+r=","+w=","+y=" } QS next_cvox==+&&clab==+ { "+b=","+m=","+v=","+w=" } QS next_cont==+&&cplace==a { "+l=","+r=","+s=","+z=" } QS next_cvox==-&&ctype==s { "+k=","+p=","+t=" } QS next_son==+&&cplace==a { "+l=","+n=","+r=" } QS next_ctype==n { "+m=","+n=","+ng=" } QS next_vfront==1&&vlng==s { "+ae=","+eh=","+ih=" } QS next_ctype==r&&son==+ { "+r=","+w=","+y=" } QS next_cvox==+&&ctype==s { "+b=","+d=","+g=" } QS next_cont==+&&cvox==+&&cplace==a { "+l=","+r=","+z=" } QS next_vfront==3&&vlng==l { "+aa=","+ao=","+uw=" } QS next_cplace==d { "+dh=","+th=" } QS next_son==+&&clab==+ { "+m=","+w=" } QS next_vrnd==-&&vheight==1 { "+ih=","+iy=" } QS next_ctype==s&&cplace==a { "+d=","+t=" } QS next_cvox==-&&cplace==a { "+s=","+t=" } QS next_vrnd==-&&vlng==l { "+aa=","+iy=" } QS next_cont==+&&son==+&&cplace==a { "+l=","+r=" } QS next_cvox==+&&cplace==v { "+g=","+ng=" } QS next_cont==-&&ccor==+&&cvox==- { "+ch=","+t=" } QS next_cvox==+&&son==-&&cplace==a { "+d=","+z=" } QS next_son==-&&cplace==l { "+b=","+p=" } QS next_vrnd==+&&vlng==l { "+ao=","+uw=" } QS next_csib==+&&cplace==a { "+s=","+z=" } QS next_name==ax { "+ax=" } QS next_name==dh { "+dh=" } QS next_name==hh { "+hh=" } QS next_name==iy { "+iy=" } QS next_name==l { "+l=" } QS next_name==n { "+n=" } QS next_name==ng { "+ng=" } QS next_name==p { "+p=" } QS next_name==r { "+r=" } QS next_name==s { "+s=" } QS next_name==t { "+t=" } QS next_name==w { "+w=" } QS next_name==y { "+y=" } QS next_next_son==- { "=b@","=ch@","=d@","=dh@","=f@","=g@","=hh@","=jh@","=k@","=p@","=s@","=sh@","=t@","=th@","=v@","=z@","=zh@" } QS next_next_ccor==+&&son==- { "=ch@","=d@","=dh@","=jh@","=s@","=sh@","=t@","=th@","=z@","=zh@" } QS next_next_cont==-&&son==- { "=b@","=ch@","=d@","=g@","=jh@","=k@","=p@","=t@" } QS next_next_cont==-&&cvox==+ { "=b@","=d@","=g@","=jh@","=m@","=n@","=ng@" } QS next_next_clab==+ { "=b@","=f@","=m@","=p@","=v@","=w@" } QS next_next_cont==-&&ccor==+ { "=ch@","=d@","=jh@","=n@","=t@" } QS next_next_vheight==3 { "=aa@","=ae@","=ao@","=aw@","=ay@" } QS next_next_vlng==l { "=aa@","=ao@","=iy@","=uw@" } QS next_next_ctype==r { "=er@","=r@","=w@","=y@" } QS next_next_son==-&&cplace==a { "=d@","=s@","=t@","=z@" } QS next_next_cvox==+&&ctype==f { "=dh@","=v@","=z@","=zh@" } QS next_next_cont==+&&cplace==a { "=l@","=r@","=s@","=z@" } QS next_next_vlng==a { "=ax@","=er@" } QS next_next_vheight==1&&vlng==l { "=iy@","=uw@" } QS next_next_vrnd==-&&vlng==l { "=aa@","=iy@" } QS next_next_name==er { "=er@" } QS next_next_name==n { "=n@" } QS next_next_name==x { "=x@" } QS pos_in_syl_fw==1 { "@1_" } QS pos_in_syl_fw==4 { "@4_" } QS pos_in_syl_fw<=1 { "@x_","@1_" } QS pos_in_syl_bw==1 { "_1/A:" } QS pos_in_syl_bw==2 { "_2/A:" } QS pos_in_syl_bw==3 { "_3/A:" } QS prev_syl_stress==1 { "/A:1_" } QS prev_syl_accented==0 { "_0_" } QS prev_syl_length==0 { "_0/B:" } QS prev_syl_length==3 { "_3/B:" } QS prev_syl_length<=0 { "_0/B:" } QS syl_stress==0 { "/B:0-" } QS syl_stress==1 { "/B:1-" } QS syl_length==2 { "-2@" } QS syl_length<=2 { "-x@","-1@","-2@" } QS syl_length<=3 { "-x@","-1@","-2@","-3@" } QS syl_pos_in_word_fw==1 { "@1-" } QS syl_pos_in_word_fw<=1 { "@x-","@1-" } QS syl_pos_in_word_bw==1 { "-1&" } QS syl_pos_in_word_bw==2 { "-2&" } QS syl_pos_in_word_bw<=2 { "-x&","-1&","-2&" } QS syl_pos_in_phrase_fw<=1 { "&x-","&1-" } QS syl_pos_in_phrase_bw==5 { "-5#" } QS syl_pos_in_phrase_bw<=1 { "-x#","-1#" } QS syl_pos_in_phrase_bw<=4 { "-x#","-1#","-2#","-3#","-4#" } QS syl_pos_in_phrase_bw<=9 { "-x#","-1#","-2#","-3#","-4#","-5#","-6#","-7#","-8#","-9#" } QS num_stressed_syls_in_phrase_before_this_syl<=5 { "#x-","#1-","#2-","#3-","#4-","#5-" } QS num_stressed_syls_in_phrase_after_this_syl<=8 { "-x$","-1$","-2$","-3$","-4$","-5$","-6$","-7$","-8$" } QS num_accented_syls_in_phrase_before_this_syl<=2 { "$x-","$1-","$2-" } QS dist_to_prev_stressed_syl_in_phrase==1 { "!1-" } QS dist_to_prev_stressed_syl_in_phrase==2 { "!2-" } QS dist_to_next_stressed_syl_in_phrase==1 { "-1;" } QS dist_to_prev_accented_syl_in_phrase<=3 { ";x-",";0-",";1-",";2-",";3-" } QS dist_to_next_accented_syl_in_phrase<=2 { "-x\|","-0\|","-1\|","-2\|" } QS syl_vowel_vfront==3 { "\|aa/C:","\|ao/C:","\|ow/C:","\|oy/C:","\|uh/C:","\|uw/C:" } QS syl_vowel_vheight==1 { "\|ih/C:","\|iy/C:","\|uh/C:","\|uw/C:" } QS syl_vowel_vrnd==-&&vlng==s { "\|ae/C:","\|ah/C:","\|eh/C:","\|ih/C:" } QS syl_vowel_vlng==l { "\|aa/C:","\|ao/C:","\|iy/C:","\|uw/C:" } QS syl_vowel_vfront==1&&vlng==s { "\|ae/C:","\|eh/C:","\|ih/C:" } QS syl_vowel_vheight==1&&vlng==s { "\|ih/C:","\|uh/C:" } QS syl_vowel_vlng==a { "\|ax/C:","\|er/C:" } QS syl_vowel_vheight==1&&vlng==l { "\|iy/C:","\|uw/C:" } QS syl_vowel_vrnd==-&&vlng==l { "\|aa/C:","\|iy/C:" } QS syl_vowel_vheight==3&&vlng==d { "\|aw/C:","\|ay/C:" } QS syl_vowel==aa { "\|aa/C:" } QS syl_vowel==ae { "\|ae/C:" } QS syl_vowel==ao { "\|ao/C:" } QS syl_vowel==eh { "\|eh/C:" } QS syl_vowel==er { "\|er/C:" } QS syl_vowel==ih { "\|ih/C:" } QS syl_vowel==iy { "\|iy/C:" } QS syl_vowel==ow { "\|ow/C:" } QS syl_vowel==oy { "\|oy/C:" } QS syl_vowel==uw { "\|uw/C:" } QS next_syl_accented==1 { "+1+" } QS next_syl_length<=2 { "+0/D:","+1/D:","+2/D:" } QS prev_word_gpos==content { "/D:content_" } QS num_syls_in_prev_word==2 { "_2/E:" } QS num_syls_in_prev_word<=0 { "_0/E:" } QS word_gpos==aux { "/E:aux+" } QS word_gpos==cc { "/E:cc+" } QS word_gpos==content { "/E:content+" } QS word_gpos==det { "/E:det+" } QS word_gpos==in { "/E:in+" } QS word_gpos==pps { "/E:pps+" } QS word_gpos==wp { "/E:wp+" } QS num_syls_in_word<=2 { "+x@","+1@","+2@" } QS word_pos_in_phrase_fw==1 { "@1+" } QS word_pos_in_phrase_fw<=1 { "@x+","@1+" } QS word_pos_in_phrase_fw<=2 { "@x+","@1+","@2+" } QS word_pos_in_phrase_fw<=3 { "@x+","@1+","@2+","@3+" } QS num_content_words_in_phrase_before_this_word==2 { "&2+" } QS num_content_words_in_phrase_before_this_word==5 { "&5+" } QS dist_to_prev_content_word_in_phrase<=0 { "#x+","#0+" } QS dist_to_prev_content_word_in_phrase<=2 { "#x+","#0+","#1+","#2+" } QS dist_to_next_content_word_in_phrase==1 { "+1/F:" } QS next_word_gpos==0 { "/F:0_" } QS next_word_gpos==det { "/F:det_" } QS next_word_gpos==in { "/F:in_" } QS next_word_gpos==wp { "/F:wp_" } QS num_syls_in_next_word==1 { "_1/G:" } QS num_syls_in_next_word<=3 { "_0/G:","_1/G:","_2/G:","_3/G:" } QS num_syls_in_prev_phrase==0 { "/G:0_" } QS num_words_in_prev_phrase==1 { "_1/H:" } QS num_words_in_prev_phrase==2 { "_2/H:" } QS num_words_in_prev_phrase<=1 { "_0/H:","_1/H:" } QS num_syls_in_phrase==2 { "/H:2=" } QS num_syls_in_phrase<=8 { "/H:x=","/H:1=","/H:2=","/H:3=","/H:4=","/H:5=","/H:6=","/H:7=","/H:8=" } QS num_syls_in_phrase<=11 { "/H:x=","/H:1=","/H:2=","/H:3=","/H:4=","/H:5=","/H:6=","/H:7=","/H:8=","/H:9=","/H:10=","/H:11=" } QS num_syls_in_phrase<=13 { "/H:x=","/H:1=","/H:2=","/H:3=","/H:4=","/H:5=","/H:6=","/H:7=","/H:8=","/H:9=","/H:10=","/H:11=","/H:12=","/H:13=" } QS num_syls_in_phrase<=17 { "/H:x=","/H:1=","/H:2=","/H:3=","/H:4=","/H:5=","/H:6=","/H:7=","/H:8=","/H:9=","/H:10=","/H:11=","/H:12=","/H:13=","/H:14=","/H:15=","/H:16=","/H:17=" } QS num_words_in_phrase<=4 { "=x^","=1^","=2^","=3^","=4^" } QS num_words_in_phrase<=11 { "=x^","=1^","=2^","=3^","=4^","=5^","=6^","=7^","=8^","=9^","=10^","=11^" } QS phrase_pos_in_utt_fw<=2 { "^x=","^1=","^2=" } QS phrase_end_tone==NONE { "\|NONE/I:" } QS num_syls_in_next_phrase==4 { "/I:4=" } QS num_syls_in_next_phrase<=0 { "/I:0=" } QS num_syls_in_next_phrase<=2 { "/I:0=","/I:1=","/I:2=" } QS num_syls_in_next_phrase<=4 { "/I:0=","/I:1=","/I:2=","/I:3=","/I:4=" } QS num_words_in_next_phrase<=0 { "=0/J:" } QS num_words_in_next_phrase<=3 { "=0/J:","=1/J:","=2/J:","=3/J:" } QS num_words_in_next_phrase<=4 { "=0/J:","=1/J:","=2/J:","=3/J:","=4/J:" } QS num_words_in_next_phrase<=5 { "=0/J:","=1/J:","=2/J:","=3/J:","=4/J:","=5/J:" } QS num_syls_in_utt==8 { "/J:8+" } QS num_syls_in_utt==16 { "/J:16+" } QS num_syls_in_utt<=8 { "/J:1+","/J:2+","/J:3+","/J:4+","/J:5+","/J:6+","/J:7+","/J:8+" } QS num_syls_in_utt<=10 { "/J:1+","/J:2+","/J:3+","/J:4+","/J:5+","/J:6+","/J:7+","/J:8+","/J:9+","/J:10+" } QS num_syls_in_utt<=14 { "/J:1+","/J:2+","/J:3+","/J:4+","/J:5+","/J:6+","/J:7+","/J:8+","/J:9+","/J:10+","/J:11+","/J:12+","/J:13+","/J:14+" } QS num_words_in_utt==7 { "+7-" } QS num_words_in_utt==12 { "+12-" } QS num_words_in_utt<=5 { "+1-","+2-","+3-","+4-","+5-" } QS pos_in_word_fw==1 { "/K:1_" } QS pos_in_word_fw==2 { "/K:2_" } QS pos_in_word_fw<=1 { "/K:x_","/K:1_" } QS pos_in_word_fw<=2 { "/K:x_","/K:1_","/K:2_" } QS pos_in_word_fw<=3 { "/K:x_","/K:1_","/K:2_","/K:3_" } QS pos_in_word_bw==1 { "_1" } QS pos_in_word_bw==3 { "_3" } QS pos_in_word_bw==5 { "_5" } QS pos_in_word_bw<=1 { "_x","_1" } QS pos_in_word_bw<=3 { "_x","_1","_2","_3" } QS pos_in_word_bw<=4 { "_x","_1","_2","_3","_4" } QS pos_in_word_bw<=5 { "_x","_1","_2","_3","_4","_5" } {}[2] { 0 syl_pos_in_phrase_bw<=1 -1 -3 -1 cont==-&&cvox==+&&cplace==a -2 -15 -2 name==ax -4 -18 -3 prev_name==x -9 -51 -4 ctype==s -5 -16 -5 vlng==d -6 -38 -6 pos_in_syl_fw==1 -8 -7 -7 name==dh -13 -42 -8 name==ih -10 -36 -9 vc==- -12 -11 -10 vheight==3 -28 -20 -11 ctype==s -23 -37 -12 name==ax -21 -81 -13 cvox==- -19 -14 -14 name==hh -30 -53 -15 name==n -26 -91 -16 pos_in_syl_fw<=1 -27 -17 -17 cvox==- -33 -25 -18 prev_cont==+&&cvox==+ -45 -83 -19 cvox==+&&clab==+ -34 -35 -20 word_gpos==aux -29 -41 -21 phrase_end_tone==NONE -22 -24 -22 prev_ccor==+&&ctype==f -44 -59 -23 cvox==-&&ctype==f -32 -61 -24 vlng==s -63 -137 -25 name==t -105 -70 -26 prev_name==n -73 -66 -27 prev_son==- -46 -48 -28 cont==+&&cvox==+ -31 -39 -29 next_cont==+&&son==+&&cplace==a -50 -111 -30 prev_son==- -64 -96 -31 ctype==r -43 -234 -32 pos_in_word_bw==1 -88 -62 -33 syl_pos_in_phrase_fw<=1 -187 -228 -34 vlng==s -94 -67 -35 cont==+&&son==+ -128 -112 -36 prev_cont==+&&son==+ -97 -189 -37 name==t -100 -54 -38 pos_in_word_fw==1 -78 -194 -39 prev_cvox==- -40 -80 -40 cvox==+&&ctype==f -69 -49 -41 prev_son==- -173 -222 -42 prev_vc==+ -65 -193 -43 prev_cont==-&&cvox==+ -47 -166 -44 num_words_in_next_phrase<=0 -135 -52 -45 pos_in_word_fw==1 -86 -237 -46 name==t -172 -90 -47 vrnd==+&&vheight==1 -56 -77 -48 name==t "dur_s2_1" -200 -49 next_cvox==- -115 -85 -50 syl_vowel==aa -76 -298 -51 next_vc==+ -214 -152 -52 prev_cvox==-&&cplace==a -71 -162 -53 syl_vowel_vheight==1&&vlng==l -74 -79 -54 pos_in_syl_fw<=1 -55 -252 -55 prev_cvox==- -230 -460 -56 clab==+ -57 -258 -57 vheight==2 -58 -60 -58 prev_name==hh -102 -293 -59 num_words_in_next_phrase<=0 -279 -95 -60 prev_cont==+&&son==+&&cplace==a -82 -84 -61 prev_son==- -98 -147 -62 cont==+&&son==+&&cplace==a -93 -568 -63 syl_vowel_vlng==l -169 -109 -64 prev_syl_length<=0 -72 -206 -65 prev_cont==-&&cvox==+&&cplace==a -132 -516 -66 prev_prev_vrnd==-&&vheight==3 -318 -89 -67 syl_vowel_vheight==1&&vlng==s -68 -110 -68 word_gpos==content -140 -259 -69 ctype==r -163 -117 -70 syl_stress==0 -123 -144 -71 prev_cvox==-&&clab==+ -180 -465 -72 next_son==+ -106 "dur_s2_2" -73 pos_in_word_fw==1 -129 -127 -74 prev_name==pau -75 -266 -75 next_vrnd==-&&vheight==1 -372 -317 -76 next_ctype==n -148 -141 -77 word_gpos==content -122 -167 -78 prev_cont==+&&ccor==+&&cvox==+ -142 -146 -79 num_syls_in_prev_word<=0 -219 "dur_s2_3" -80 next_vrnd==- -301 -159 -81 next_son==+ -467 -327 -82 next_name==r -226 "dur_s2_4" -83 next_son==+ -248 -312 -84 prev_prev_vlng==l -118 "dur_s2_5" -85 ccor==+ "dur_s2_6" -120 -86 syl_pos_in_word_bw==1 -360 -87 -87 next_son==+&&cplace==a -423 -131 -88 cont==+&&son==+ -121 -92 -89 next_cvox==- -321 -437 -90 next_ccor==+&&son==- -134 -633 -91 next_ctype==s&&cplace==a -113 -305 -92 prev_son==- -398 -525 -93 cplace==v -136 "dur_s2_7" -94 vc==+ -116 -124 -95 prev_cvox==-&&cplace==a -196 -571 -96 name==f -157 -304 -97 next_name==ng -108 -204 -98 name==hh -99 -256 -99 next_next_name==x -154 -401 -100 cvox==+ -179 -101 -101 pos_in_word_bw<=1 -217 -195 -102 cont==- -103 -277 -103 prev_vc==- -104 -211 -104 next_cvox==-&&cplace==a "dur_s2_9" "dur_s2_8" -105 next_ccor==+ -233 -197 -106 name==ch -107 "dur_s2_10" -107 prev_vrnd==- -390 -278 -108 prev_name==hh -186 -349 -109 next_ctype==r -183 -410 -110 pos_in_word_fw==1 "dur_s2_11" -174 -111 prev_cvox==-&&clab==+ -188 -587 -112 syl_pos_in_phrase_fw<=1 -133 -441 -113 next_vc==+ -150 -114 -114 pos_in_word_fw==1 -647 -350 -115 next_name==dh -165 -392 -116 prev_vc==+ -224 -119 -117 prev_vlng==l -253 -184 -118 word_gpos==content "dur_s2_12" -325 -119 cvox==+&&csib==+ -238 -336 -120 csib==+ "dur_s2_13" -319 -121 name==dh -125 -294 -122 next_cont==- -249 -338 -123 prev_cont==-&&cplace==a -210 -376 -124 syl_stress==1 -330 -130 -125 cvox==+&&clab==+ -126 "dur_s2_14" -126 cplace==a -316 -156 -127 prev_name==pau -314 "dur_s2_15" -128 name==v -257 -199 -129 next_cont==+&&cplace==a -145 -504 -130 word_gpos==aux -164 -299 -131 next_name==l -261 -356 -132 prev_son==- -326 -216 -133 prev_cvox==- -139 -177 -134 prev_prev_vfront==1&&vheight==2 -207 "dur_s2_16" -135 next_vc==- -182 -254 -136 csib==+ -220 -225 -137 syl_vowel==ih -151 -138 -138 pos_in_word_fw==1 -161 -492 -139 prev_syl_length==3 -383 -255 -140 dist_to_prev_content_word_in_phrase<=0 -153 -176 -141 syl_vowel==ae -292 -191 -142 name==oy -143 -609 -143 syl_vowel_vheight==3&&vlng==d -198 -215 -144 prev_son==- -149 "dur_s2_17" -145 next_ccor==+ -171 -598 -146 name==ow -231 -155 -147 name==hh -359 -574 -148 prev_cont==+&&son==+&&cplace==a -269 -341 -149 pos_in_word_fw==1 -291 "dur_s2_18" -150 next_cplace==d -168 "dur_s2_19" -151 next_cont==+&&son==+ -181 -377 -152 next_vheight==1 -438 -389 -153 next_cvox==+&&clab==+ -232 -160 -154 next_vc==+ -208 -628 -155 prev_name==dh "dur_s2_21" "dur_s2_20" -156 next_cont==-&&ccor==+&&cvox==- -190 "dur_s2_22" -157 next_son==+ -158 "dur_s2_23" -158 prev_cont==+&&cvox==+ -241 -284 -159 word_gpos==content "dur_s2_24" -178 -160 prev_son==- -409 -391 -161 next_name==ng -308 "dur_s2_25" -162 prev_prev_cvox==-&&ctype==f -346 "dur_s2_26" -163 next_son==- -322 -250 -164 vrnd==- -306 -418 -165 ccor==+&&son==- -271 -236 -166 son==- -175 "dur_s2_27" -167 prev_ctype==r -192 -205 -168 next_name==l -311 -429 -169 name==ay -170 -276 -170 pos_in_word_bw<=1 -329 -280 -171 prev_vc==- -223 -613 -172 name==k -513 -209 -173 next_word_gpos==in "dur_s2_29" "dur_s2_28" -174 word_pos_in_phrase_fw<=1 -309 -527 -175 word_gpos==cc -267 -498 -176 pos_in_syl_bw==3 "dur_s2_30" -243 -177 prev_name==t -524 -553 -178 name==r -552 -221 -179 pos_in_syl_fw==1 -273 -547 -180 prev_ctype==n -264 "dur_s2_31" -181 syl_vowel_vfront==1&&vlng==s -452 -282 -182 next_vfront==1&&vlng==s -419 -339 -183 word_gpos==aux -246 "dur_s2_32" -184 next_son==- "dur_s2_33" -185 -185 word_gpos==content -382 -285 -186 next_name==r -262 "dur_s2_34" -187 prev_csib==+ -203 -497 -188 prev_cont==+&&cvox==+&&cplace==p -251 "dur_s2_35" -189 word_gpos==content -387 -202 -190 next_son==- -501 -343 -191 word_gpos==content "dur_s2_37" "dur_s2_36" -192 syl_vowel==uw -388 -365 -193 syl_vowel==er -536 "dur_s2_38" -194 num_syls_in_prev_word<=0 -337 "dur_s2_39" -195 prev_name==ax -395 "dur_s2_40" -196 prev_name==z "dur_s2_41" -584 -197 clab==+ "dur_s2_42" -462 -198 pos_in_word_bw==1 -239 -469 -199 prev_vrnd==- -272 -470 -200 next_son==- -335 -201 -201 num_words_in_prev_phrase==1 "dur_s2_44" "dur_s2_43" -202 next_cvox==+&&cplace==v -240 "dur_s2_45" -203 syl_stress==1 -320 -402 -204 syl_stress==0 "dur_s2_46" -619 -205 next_clab==+ -244 -475 -206 csib==+ "dur_s2_48" "dur_s2_47" -207 next_next_son==-&&cplace==a -434 "dur_s2_49" -208 next_son==- "dur_s2_51" "dur_s2_50" -209 next_son==+ -413 "dur_s2_52" -210 prev_ctype==f -340 "dur_s2_53" -211 prev_name==r -212 -213 -212 name==s -218 -533 -213 syl_stress==1 -461 "dur_s2_54" -214 next_ctype==f -286 -290 -215 next_vrnd==- -302 "dur_s2_55" -216 prev_cvox==+&&son==-&&clab==+ "dur_s2_56" -654 -217 prev_name==pau -281 "dur_s2_57" -218 next_vrnd==-&&vlng==l -427 "dur_s2_58" -219 dist_to_prev_stressed_syl_in_phrase==1 -576 -357 -220 son==- -520 -509 -221 prev_son==-&&clab==+ -447 -468 -222 num_syls_in_next_phrase==4 "dur_s2_60" "dur_s2_59" -223 next_ctype==s -425 "dur_s2_61" -224 name==l -562 -229 -225 prev_son==- -313 "dur_s2_62" -226 word_gpos==wp -227 -643 -227 next_son==- -369 -471 -228 clab==+ "dur_s2_64" "dur_s2_63" -229 next_name==iy -542 -345 -230 num_syls_in_next_word==1 -412 "dur_s2_65" -231 next_cvox==-&&ctype==s -393 -245 -232 next_name==n -611 -508 -233 syl_pos_in_phrase_fw<=1 -260 "dur_s2_66" -234 next_vc==+ -235 -606 -235 syl_stress==1 -315 -566 -236 prev_ccor==+&&son==- -242 "dur_s2_67" -237 prev_cplace==a -328 -495 -238 prev_prev_name==f -287 "dur_s2_68" -239 prev_cvox==-&&ctype==s -478 -380 -240 num_words_in_prev_phrase==2 -283 "dur_s2_69" -241 ctype==f&&csib==+ "dur_s2_71" "dur_s2_70" -242 name==z -494 -554 -243 num_words_in_prev_phrase<=1 "dur_s2_73" "dur_s2_72" -244 vlng==l -640 -247 -245 name==ay "dur_s2_75" "dur_s2_74" -246 name==aa -303 "dur_s2_76" -247 next_cont==- -367 "dur_s2_77" -248 prev_cplace==a "dur_s2_78" -421 -249 next_ctype==f -558 -405 -250 next_ctype==f&&csib==+ -531 "dur_s2_79" -251 prev_son==+&&clab==+ -347 -507 -252 syl_stress==1 -275 "dur_s2_80" -253 prev_cont==-&&cvox==+ -263 -378 -254 next_cvox==+&&ctype==s -295 "dur_s2_81" -255 prev_prev_vrnd==- "dur_s2_83" "dur_s2_82" -256 next_next_cont==-&&cvox==+ -583 "dur_s2_84" -257 prev_cont==-&&cplace==a -463 "dur_s2_85" -258 son==- -307 -265 -259 syl_stress==1 -416 -433 -260 syl_stress==0 -577 -368 -261 num_syls_in_next_word<=3 "dur_s2_87" "dur_s2_86" -262 prev_cvox==+&&son==-&&clab==+ -394 -569 -263 next_son==+&&clab==+ -614 -596 -264 prev_son==- "dur_s2_88" -274 -265 next_son==- "dur_s2_90" "dur_s2_89" -266 next_vrnd==-&&vheight==1 "dur_s2_92" "dur_s2_91" -267 vlng==l -268 -453 -268 next_name==n "dur_s2_93" -624 -269 prev_name==dh -354 -270 -270 prev_word_gpos==content "dur_s2_94" -600 -271 next_son==+ "dur_s2_96" "dur_s2_95" -272 syl_vowel_vlng==a "dur_s2_98" "dur_s2_97" -273 next_next_name==x -543 "dur_s2_99" -274 prev_cont==-&&cvox==+ "dur_s2_100" -457 -275 prev_prev_vc==+ "dur_s2_102" "dur_s2_101" -276 prev_name==l -473 "dur_s2_103" -277 name==ch -404 "dur_s2_104" -278 next_vc==+ "dur_s2_105" -300 -279 prev_word_gpos==content "dur_s2_106" -342 -280 syl_stress==0 "dur_s2_108" "dur_s2_107" -281 syl_stress==1 -440 -472 -282 next_cvox==+ -397 -540 -283 next_ccor==+&&cvox==+ -358 "dur_s2_109" -284 prev_cplace==a "dur_s2_110" -491 -285 prev_name==ao "dur_s2_112" "dur_s2_111" -286 next_son==-&&cplace==l -324 -502 -287 name==l -288 -289 -288 prev_vheight==2&&vlng==s -431 "dur_s2_113" -289 next_vc==- -506 "dur_s2_114" -290 next_next_vheight==1&&vlng==l -456 -489 -291 prev_name==l -351 "dur_s2_115" -292 prev_son==- "dur_s2_117" "dur_s2_116" -293 prev_syl_length==0 -589 "dur_s2_118" -294 prev_cont==-&&cvox==+ "dur_s2_120" "dur_s2_119" -295 prev_cvox==-&&ctype==s -503 -296 -296 prev_prev_vfront==2 -297 "dur_s2_121" -297 next_word_gpos==det -344 "dur_s2_122" -298 prev_cont==+&&cvox==+&&cplace==a -557 "dur_s2_123" -299 num_syls_in_prev_phrase==0 "dur_s2_125" "dur_s2_124" -300 ccor==+ "dur_s2_126" -483 -301 syl_pos_in_word_bw<=2 "dur_s2_127" -400 -302 next_name==l -374 "dur_s2_128" -303 prev_cont==- -355 "dur_s2_129" -304 prev_cont==-&&cplace==a "dur_s2_131" "dur_s2_130" -305 pos_in_syl_bw==2 "dur_s2_132" -379 -306 word_gpos==det -439 "dur_s2_133" -307 next_name==p -399 "dur_s2_134" -308 next_ccor==+&&cvox==+&&son==- -477 "dur_s2_135" -309 next_cont==-&&son==- -323 -310 -310 syl_pos_in_phrase_bw==5 "dur_s2_137" "dur_s2_136" -311 next_name==hh -517 "dur_s2_138" -312 next_cont==+ "dur_s2_140" "dur_s2_139" -313 num_syls_in_next_phrase<=0 "dur_s2_141" -537 -314 next_ctype==r&&son==+ -455 "dur_s2_142" -315 next_cont==+ "dur_s2_143" -484 -316 prev_son==- -604 "dur_s2_144" -317 prev_son==+ -430 -570 -318 pos_in_word_fw<=2 -381 "dur_s2_145" -319 next_name==hh -385 -331 -320 prev_cvox==+&&cplace==v -653 "dur_s2_146" -321 pos_in_word_fw<=3 "dur_s2_148" "dur_s2_147" -322 next_name==r -334 "dur_s2_149" -323 prev_vfront==1 -371 "dur_s2_150" -324 next_word_gpos==wp -560 "dur_s2_151" -325 dist_to_next_stressed_syl_in_phrase==1 "dur_s2_152" -450 -326 prev_syl_stress==1 -428 "dur_s2_153" -327 next_cont==+ "dur_s2_154" -649 -328 prev_vrnd==+ -549 "dur_s2_155" -329 pos_in_syl_fw==1 -332 "dur_s2_156" -330 syl_pos_in_word_fw<=1 -515 -364 -331 pos_in_syl_fw==4 "dur_s2_158" "dur_s2_157" -332 syl_vowel==er -333 "dur_s2_159" -333 prev_cont==+&&ccor==+&&cvox==+ -650 "dur_s2_160" -334 prev_vfront==3 -572 -605 -335 pos_in_syl_bw==1 "dur_s2_162" "dur_s2_161" -336 cont==+ "dur_s2_164" "dur_s2_163" -337 word_gpos==pps -442 -595 -338 prev_name==t "dur_s2_166" "dur_s2_165" -339 prev_ccor==+&&cvox==- -490 "dur_s2_167" -340 syl_pos_in_phrase_fw<=1 -415 "dur_s2_168" -341 prev_prev_vfront==2&&vheight==2 "dur_s2_170" "dur_s2_169" -342 next_syl_accented==1 -348 "dur_s2_171" -343 next_name==s -518 "dur_s2_172" -344 num_syls_in_next_phrase<=4 "dur_s2_173" -639 -345 prev_cont==+&&cvox==+ -631 "dur_s2_174" -346 prev_prev_vlng==s -612 "dur_s2_175" -347 vfront==3 "dur_s2_176" -486 -348 prev_cvox==-&&csib==+ -539 "dur_s2_177" -349 pos_in_word_bw<=5 "dur_s2_178" -448 -350 syl_pos_in_phrase_bw<=9 "dur_s2_180" "dur_s2_179" -351 next_name==r -352 "dur_s2_181" -352 prev_vrnd==-&&vlng==d -353 "dur_s2_182" -353 prev_ctype==r -510 "dur_s2_183" -354 prev_cont==-&&cvox==- "dur_s2_185" "dur_s2_184" -355 syl_stress==1 -406 -555 -356 syl_length<=2 "dur_s2_187" "dur_s2_186" -357 num_syls_in_phrase<=13 "dur_s2_189" "dur_s2_188" -358 syl_length<=3 "dur_s2_190" -532 -359 next_next_name==x -449 "dur_s2_191" -360 next_cont==+&&son==+ -361 "dur_s2_192" -361 prev_cvox==- "dur_s2_193" -362 -362 next_next_cont==-&&son==- "dur_s2_194" -363 -363 syl_pos_in_word_bw==2 "dur_s2_196" "dur_s2_195" -364 next_cont==+&&cvox==+ "dur_s2_198" "dur_s2_197" -365 prev_ccor==+&&son==- -366 "dur_s2_199" -366 next_cont==+&&cvox==+&&cplace==a "dur_s2_201" "dur_s2_200" -367 num_stressed_syls_in_phrase_after_this_syl<=8 "dur_s2_203" "dur_s2_202" -368 pos_in_word_fw<=1 -585 "dur_s2_204" -369 syl_vowel==eh -370 -528 -370 next_clab==+ "dur_s2_206" "dur_s2_205" -371 prev_vc==- "dur_s2_208" "dur_s2_207" -372 syl_vowel_vfront==3 -373 "dur_s2_209" -373 prev_cont==-&&cvox==+ -407 -638 -374 name==aw -375 "dur_s2_210" -375 prev_cont==-&&cvox==+&&clab==+ -420 "dur_s2_211" -376 prev_prev_cont==-&&cvox==+ -424 "dur_s2_212" -377 syl_vowel_vfront==1&&vlng==s "dur_s2_214" "dur_s2_213" -378 prev_cont==-&&cvox==+&&clab==+ -593 "dur_s2_215" -379 num_words_in_next_phrase<=3 "dur_s2_216" -534 -380 next_cont==+&&son==+ "dur_s2_218" "dur_s2_217" -381 dist_to_prev_content_word_in_phrase<=2 "dur_s2_220" "dur_s2_219" -382 next_cont==+&&cvox==+ "dur_s2_222" "dur_s2_221" -383 next_next_cvox==+&&ctype==f -384 -411 -384 prev_vrnd==+ "dur_s2_224" "dur_s2_223" -385 next_ctype==f&&csib==+ "dur_s2_225" -386 -386 word_gpos==content "dur_s2_227" "dur_s2_226" -387 next_son==- "dur_s2_229" "dur_s2_228" -388 next_cont==+ -474 "dur_s2_230" -389 num_words_in_next_phrase<=5 "dur_s2_231" -476 -390 syl_pos_in_word_fw==1 "dur_s2_232" -482 -391 prev_cont==-&&cvox==+ "dur_s2_234" "dur_s2_233" -392 pos_in_word_fw<=3 "dur_s2_236" "dur_s2_235" -393 name==ay "dur_s2_238" "dur_s2_237" -394 next_name==l -417 -499 -395 prev_ctype==n -599 -396 -396 num_syls_in_next_phrase<=2 "dur_s2_240" "dur_s2_239" -397 syl_vowel==eh -426 "dur_s2_241" -398 prev_vc==+ -548 -511 -399 next_cvox==+&&clab==+ -541 "dur_s2_242" -400 prev_ccor==+ "dur_s2_243" -618 -401 name==f -634 "dur_s2_244" -402 clab==+ "dur_s2_245" -403 -403 prev_vc==- "dur_s2_246" -580 -404 next_son==- -651 -459 -405 next_clab==+ -487 "dur_s2_247" -406 word_gpos==det "dur_s2_249" "dur_s2_248" -407 word_gpos==aux "dur_s2_250" -408 -408 prev_vrnd==- -573 "dur_s2_251" -409 num_syls_in_utt==16 -505 "dur_s2_252" -410 syl_vowel==ao "dur_s2_254" "dur_s2_253" -411 word_pos_in_phrase_fw<=2 -567 "dur_s2_255" -412 prev_prev_cont==+&&ccor==+ "dur_s2_257" "dur_s2_256" -413 next_cont==- -414 -526 -414 syl_vowel==eh "dur_s2_259" "dur_s2_258" -415 prev_cont==- -545 "dur_s2_260" -416 next_word_gpos==0 -597 "dur_s2_261" -417 word_gpos==det -632 "dur_s2_262" -418 syl_pos_in_word_fw<=1 "dur_s2_263" -451 -419 prev_cvox==- -446 "dur_s2_264" -420 pos_in_word_bw<=3 "dur_s2_266" "dur_s2_265" -421 next_name==s -422 "dur_s2_267" -422 prev_son==- "dur_s2_269" "dur_s2_268" -423 next_cont==+ "dur_s2_271" "dur_s2_270" -424 prev_ctype==n "dur_s2_273" "dur_s2_272" -425 next_cvox==+ -454 "dur_s2_274" -426 prev_cont==+&&son==+ "dur_s2_276" "dur_s2_275" -427 prev_son==- "dur_s2_277" -466 -428 dist_to_next_accented_syl_in_phrase<=2 "dur_s2_279" "dur_s2_278" -429 next_next_vlng==l "dur_s2_281" "dur_s2_280" -430 prev_ctype==f -575 "dur_s2_282" -431 syl_pos_in_word_fw<=1 "dur_s2_283" -432 -432 ccor==+ -538 "dur_s2_284" -433 pos_in_word_fw==1 -622 "dur_s2_285" -434 prev_syl_length<=0 -435 -436 -435 next_cvox==- -615 -546 -436 prev_prev_name==pau "dur_s2_287" "dur_s2_286" -437 next_name==hh -592 "dur_s2_288" -438 num_syls_in_utt==8 "dur_s2_290" "dur_s2_289" -439 phrase_pos_in_utt_fw<=2 "dur_s2_291" -544 -440 prev_cont==+ "dur_s2_293" "dur_s2_292" -441 word_gpos==in "dur_s2_295" "dur_s2_294" -442 next_name==l -443 "dur_s2_296" -443 name==ay -444 "dur_s2_297" -444 num_syls_in_word<=2 -445 -594 -445 next_vheight==2 "dur_s2_299" "dur_s2_298" -446 prev_word_gpos==content "dur_s2_301" "dur_s2_300" -447 prev_prev_cont==+&&cplace==a -535 "dur_s2_302" -448 dist_to_next_content_word_in_phrase==1 "dur_s2_304" "dur_s2_303" -449 prev_cont==+&&ccor==+ -586 "dur_s2_305" -450 prev_name==l "dur_s2_307" "dur_s2_306" -451 pos_in_word_bw==1 "dur_s2_309" "dur_s2_308" -452 prev_prev_ctype==s&&cplace==a "dur_s2_311" "dur_s2_310" -453 next_name==y -481 "dur_s2_312" -454 pos_in_word_fw==2 -464 "dur_s2_313" -455 prev_cont==- "dur_s2_315" "dur_s2_314" -456 next_cvox==-&&cplace==a "dur_s2_317" "dur_s2_316" -457 prev_prev_ccor==+&&son==- -458 "dur_s2_318" -458 prev_prev_cvox==+ "dur_s2_319" -621 -459 ccor==+ "dur_s2_321" "dur_s2_320" -460 next_next_name==x "dur_s2_323" "dur_s2_322" -461 next_next_vrnd==-&&vlng==l "dur_s2_325" "dur_s2_324" -462 prev_vc==+ "dur_s2_327" "dur_s2_326" -463 prev_prev_cvox==+ -519 -637 -464 syl_vowel_vrnd==-&&vlng==l "dur_s2_329" "dur_s2_328" -465 prev_cont==- "dur_s2_331" "dur_s2_330" -466 prev_name==sh "dur_s2_333" "dur_s2_332" -467 next_clab==+ -500 "dur_s2_334" -468 pos_in_word_bw<=5 "dur_s2_336" "dur_s2_335" -469 syl_vowel==ow "dur_s2_338" "dur_s2_337" -470 syl_vowel_vfront==1&&vlng==s -652 "dur_s2_339" -471 next_cont==-&&ccor==+&&son==- "dur_s2_341" "dur_s2_340" -472 pos_in_syl_fw<=1 "dur_s2_342" -642 -473 next_cvox==- -644 "dur_s2_343" -474 prev_son==- "dur_s2_345" "dur_s2_344" -475 next_cont==+&&son==+ "dur_s2_347" "dur_s2_346" -476 num_words_in_utt<=5 "dur_s2_349" "dur_s2_348" -477 prev_cont==+&&son==+ "dur_s2_351" "dur_s2_350" -478 prev_ccor==+&&cvox==+ -479 "dur_s2_352" -479 next_name==l "dur_s2_353" -480 -480 vrnd==- "dur_s2_355" "dur_s2_354" -481 prev_son==+&&cplace==a -625 -641 -482 next_vfront==2 -578 "dur_s2_356" -483 syl_vowel_vrnd==-&&vlng==s "dur_s2_358" "dur_s2_357" -484 next_next_ctype==r -485 "dur_s2_359" -485 next_name==hh "dur_s2_361" "dur_s2_360" -486 pos_in_word_bw<=4 "dur_s2_362" -629 -487 prev_ccor==+&&son==- "dur_s2_363" -488 -488 next_ccor==+ "dur_s2_365" "dur_s2_364" -489 num_syls_in_utt<=8 -635 "dur_s2_366" -490 prev_prev_cont==+ -579 "dur_s2_367" -491 pos_in_word_bw==3 "dur_s2_369" "dur_s2_368" -492 next_son==+&&cplace==a -493 "dur_s2_370" -493 prev_prev_vheight==1 "dur_s2_372" "dur_s2_371" -494 next_cvox==+ "dur_s2_374" "dur_s2_373" -495 next_name==l -496 "dur_s2_375" -496 prev_cvox==+ "dur_s2_377" "dur_s2_376" -497 name==g "dur_s2_379" "dur_s2_378" -498 next_next_clab==+ "dur_s2_381" "dur_s2_380" -499 pos_in_word_bw<=3 "dur_s2_383" "dur_s2_382" -500 next_cvox==+&&son==-&&cplace==a "dur_s2_385" "dur_s2_384" -501 num_syls_in_phrase==2 "dur_s2_387" "dur_s2_386" -502 num_words_in_next_phrase<=4 "dur_s2_389" "dur_s2_388" -503 prev_cvox==- -620 "dur_s2_390" -504 next_csib==+&&cplace==a "dur_s2_392" "dur_s2_391" -505 syl_pos_in_phrase_bw==5 -530 "dur_s2_393" -506 syl_vowel_vheight==1&&vlng==l "dur_s2_395" "dur_s2_394" -507 pos_in_syl_bw==1 "dur_s2_397" "dur_s2_396" -508 next_next_vlng==l "dur_s2_399" "dur_s2_398" -509 name==v "dur_s2_401" "dur_s2_400" -510 prev_prev_cvox==- -582 "dur_s2_402" -511 ctype==r -512 "dur_s2_403" -512 prev_vheight==1&&vlng==s "dur_s2_405" "dur_s2_404" -513 name==p -630 -514 -514 next_cvox==+ "dur_s2_407" "dur_s2_406" -515 syl_pos_in_word_bw==2 "dur_s2_409" "dur_s2_408" -516 prev_prev_ccor==+ -581 "dur_s2_410" -517 next_cont==-&&cvox==+ -551 "dur_s2_411" -518 num_syls_in_next_phrase==4 "dur_s2_413" "dur_s2_412" -519 prev_name==l "dur_s2_415" "dur_s2_414" -520 num_syls_in_next_phrase<=0 "dur_s2_416" -521 -521 prev_prev_cvox==-&&cplace==p -522 "dur_s2_417" -522 name==n -523 "dur_s2_418" -523 prev_vrnd==- "dur_s2_420" "dur_s2_419" -524 word_gpos==content "dur_s2_422" "dur_s2_421" -525 prev_ctype==s&&cplace==a "dur_s2_424" "dur_s2_423" -526 num_words_in_phrase<=11 "dur_s2_426" "dur_s2_425" -527 next_ccor==+&&son==- "dur_s2_428" "dur_s2_427" -528 next_cont==+ "dur_s2_429" -529 -529 prev_ctype==r&&son==+ "dur_s2_431" "dur_s2_430" -530 prev_name==l "dur_s2_433" "dur_s2_432" -531 syl_vowel==ow -601 "dur_s2_434" -532 num_content_words_in_phrase_before_this_word==2 "dur_s2_436" "dur_s2_435" -533 num_content_words_in_phrase_before_this_word==5 "dur_s2_438" "dur_s2_437" -534 next_next_cont==-&&ccor==+ -626 "dur_s2_439" -535 prev_cplace==a "dur_s2_441" "dur_s2_440" -536 num_syls_in_phrase<=11 "dur_s2_443" "dur_s2_442" -537 cplace==p "dur_s2_445" "dur_s2_444" -538 prev_vlng==l "dur_s2_447" "dur_s2_446" -539 num_syls_in_utt<=14 "dur_s2_449" "dur_s2_448" -540 syl_vowel==eh "dur_s2_451" "dur_s2_450" -541 word_gpos==in -610 "dur_s2_452" -542 prev_cont==+&&ccor==+&&cvox==+ "dur_s2_454" "dur_s2_453" -543 prev_vc==+ "dur_s2_456" "dur_s2_455" -544 next_next_cont==+&&cplace==a "dur_s2_458" "dur_s2_457" -545 syl_vowel_vheight==1 "dur_s2_460" "dur_s2_459" -546 next_syl_accented==1 "dur_s2_462" "dur_s2_461" -547 next_ctype==r&&son==+ -603 "dur_s2_463" -548 cplace==p "dur_s2_465" "dur_s2_464" -549 next_name==n -550 "dur_s2_466" -550 word_pos_in_phrase_fw<=3 "dur_s2_468" "dur_s2_467" -551 next_next_vlng==a "dur_s2_470" "dur_s2_469" -552 pos_in_word_bw<=3 "dur_s2_472" "dur_s2_471" -553 prev_prev_cvox==- "dur_s2_474" "dur_s2_473" -554 word_gpos==content "dur_s2_475" -602 -555 syl_vowel==iy -556 -655 -556 prev_son==+ "dur_s2_477" "dur_s2_476" -557 prev_ccor==+&&cvox==+ "dur_s2_479" "dur_s2_478" -558 prev_ccor==+&&son==- "dur_s2_480" -559 -559 next_cont==+&&son==+ "dur_s2_482" "dur_s2_481" -560 next_name==t -561 "dur_s2_483" -561 next_name==l "dur_s2_485" "dur_s2_484" -562 son==+&&cplace==a -564 -563 -563 prev_name==l -565 "dur_s2_486" -564 prev_son==- "dur_s2_487" -590 -565 next_vrnd==-&&vheight==1 "dur_s2_489" "dur_s2_488" -566 pos_in_word_bw==1 "dur_s2_491" "dur_s2_490" -567 prev_vc==+ "dur_s2_493" "dur_s2_492" -568 ctype==r "dur_s2_495" "dur_s2_494" -569 syl_stress==1 "dur_s2_497" "dur_s2_496" -570 prev_ctype==r "dur_s2_499" "dur_s2_498" -571 num_words_in_utt==7 "dur_s2_501" "dur_s2_500" -572 next_clab==+ -627 "dur_s2_502" -573 prev_son==- "dur_s2_504" "dur_s2_503" -574 next_vrnd==-&&vheight==1 "dur_s2_506" "dur_s2_505" -575 prev_prev_csib==+ -617 "dur_s2_507" -576 dist_to_prev_stressed_syl_in_phrase==2 "dur_s2_509" "dur_s2_508" -577 prev_vc==- "dur_s2_511" "dur_s2_510" -578 word_pos_in_phrase_fw==1 "dur_s2_513" "dur_s2_512" -579 prev_cont==- "dur_s2_515" "dur_s2_514" -580 prev_prev_son==- "dur_s2_517" "dur_s2_516" -581 prev_name==n -608 "dur_s2_518" -582 prev_prev_cvox==+&&clab==+ "dur_s2_520" "dur_s2_519" -583 dist_to_prev_stressed_syl_in_phrase==1 "dur_s2_522" "dur_s2_521" -584 prev_prev_vrnd==- "dur_s2_524" "dur_s2_523" -585 prev_cont==-&&cvox==+ "dur_s2_526" "dur_s2_525" -586 next_vfront==3&&vlng==l "dur_s2_528" "dur_s2_527" -587 word_gpos==in "dur_s2_529" -588 -588 prev_prev_cvox==+&&cplace==a "dur_s2_531" "dur_s2_530" -589 prev_prev_csib==+ "dur_s2_533" "dur_s2_532" -590 cont==+ -591 "dur_s2_534" -591 pos_in_word_bw<=3 "dur_s2_536" "dur_s2_535" -592 next_syl_accented==1 "dur_s2_538" "dur_s2_537" -593 prev_cvox==+&&son==- "dur_s2_540" "dur_s2_539" -594 next_next_vrnd==-&&vlng==l "dur_s2_542" "dur_s2_541" -595 prev_prev_cvox==+ "dur_s2_544" "dur_s2_543" -596 prev_prev_ccor==+&&son==- "dur_s2_546" "dur_s2_545" -597 next_syl_length<=2 "dur_s2_548" "dur_s2_547" -598 num_accented_syls_in_phrase_before_this_syl<=2 "dur_s2_550" "dur_s2_549" -599 prev_cvox==+&&son==- "dur_s2_552" "dur_s2_551" -600 num_syls_in_phrase<=17 "dur_s2_554" "dur_s2_553" -601 next_cvox==+&&cplace==v "dur_s2_556" "dur_s2_555" -602 prev_prev_cplace==l "dur_s2_558" "dur_s2_557" -603 syl_stress==1 "dur_s2_560" "dur_s2_559" -604 cvox==+ "dur_s2_561" -623 -605 next_clab==+ "dur_s2_563" "dur_s2_562" -606 next_vfront==1&&vlng==s -607 "dur_s2_564" -607 next_next_son==-&&cplace==a "dur_s2_566" "dur_s2_565" -608 syl_pos_in_phrase_bw<=4 "dur_s2_568" "dur_s2_567" -609 prev_ctype==a "dur_s2_570" "dur_s2_569" -610 prev_cont==+&&ccor==+ "dur_s2_572" "dur_s2_571" -611 dist_to_prev_accented_syl_in_phrase<=3 "dur_s2_574" "dur_s2_573" -612 prev_prev_name==ey "dur_s2_576" "dur_s2_575" -613 prev_name==r "dur_s2_578" "dur_s2_577" -614 num_syls_in_prev_word<=0 "dur_s2_580" "dur_s2_579" -615 next_syl_length<=2 "dur_s2_581" -616 -616 next_vfront==1 "dur_s2_583" "dur_s2_582" -617 num_syls_in_prev_word==2 "dur_s2_585" "dur_s2_584" -618 next_next_son==- "dur_s2_587" "dur_s2_586" -619 prev_ccor==+&&cvox==-&&ctype==f "dur_s2_589" "dur_s2_588" -620 next_ctype==f&&csib==+ "dur_s2_591" "dur_s2_590" -621 num_syls_in_utt<=10 "dur_s2_593" "dur_s2_592" -622 next_next_name==er "dur_s2_595" "dur_s2_594" -623 cont==+&&cvox==+&&cplace==p "dur_s2_597" "dur_s2_596" -624 vfront==1 "dur_s2_599" "dur_s2_598" -625 syl_length==2 "dur_s2_601" "dur_s2_600" -626 num_words_in_phrase<=4 -645 "dur_s2_602" -627 pos_in_syl_bw==1 "dur_s2_604" "dur_s2_603" -628 next_next_name==n "dur_s2_606" "dur_s2_605" -629 next_next_ccor==+&&son==- "dur_s2_608" "dur_s2_607" -630 prev_vfront==1&&vheight==2 "dur_s2_610" "dur_s2_609" -631 pos_in_word_fw<=3 "dur_s2_612" "dur_s2_611" -632 next_name==s "dur_s2_614" "dur_s2_613" -633 prev_name==n "dur_s2_616" "dur_s2_615" -634 prev_cont==-&&cvox==+ "dur_s2_618" "dur_s2_617" -635 num_words_in_utt==7 -636 "dur_s2_619" -636 num_words_in_utt==12 "dur_s2_621" "dur_s2_620" -637 next_vrnd==+&&vlng==l "dur_s2_623" "dur_s2_622" -638 syl_vowel==ae "dur_s2_625" "dur_s2_624" -639 prev_syl_accented==0 "dur_s2_627" "dur_s2_626" -640 prev_prev_ctype==s&&cplace==a "dur_s2_629" "dur_s2_628" -641 prev_prev_vlng==s "dur_s2_631" "dur_s2_630" -642 pos_in_word_bw==5 "dur_s2_633" "dur_s2_632" -643 vfront==1 "dur_s2_635" "dur_s2_634" -644 prev_son==+&&clab==+ "dur_s2_637" "dur_s2_636" -645 prev_vrnd==-&&vlng==s "dur_s2_638" -646 -646 next_next_vheight==3 "dur_s2_640" "dur_s2_639" -647 next_vheight==1 -648 "dur_s2_641" -648 next_name==ax "dur_s2_643" "dur_s2_642" -649 prev_cont==-&&cplace==a "dur_s2_645" "dur_s2_644" -650 syl_vowel==oy "dur_s2_647" "dur_s2_646" -651 next_name==w "dur_s2_649" "dur_s2_648" -652 pos_in_word_fw==1 "dur_s2_651" "dur_s2_650" -653 num_stressed_syls_in_phrase_before_this_syl<=5 "dur_s2_653" "dur_s2_652" -654 num_syls_in_phrase<=8 "dur_s2_655" "dur_s2_654" -655 next_cont==-&&ccor==+&&son==- "dur_s2_657" "dur_s2_656" }	{ "pile_set_name": "Github" }
Updating a previous report, Indianapolis Colts TE Brandon D. Williams (head) has been released from the hospital after being diagnosed with a concussion. He suffered the injury during the team's Week 15 contest.	{ "pile_set_name": "Pile-CC" }
Introduction {#s1} ============ Iron (Fe) deficiency is among the most prevalent micronutrient deficiencies in humans. Since plants constitute the primary source of nutrients for a large part of the world's population, the improvement of plants in terms of nutrient bioavailability is considered a priority [@pone.0099234-deBenoist1]. Micronutrients like Fe are often present in an un-soluble form in the soil. Plants are able to mobilize such nutrients for uptake into the roots. Plants can also mobilize Fe from internal stores. Understanding the regulation of Fe acquisition and internal Fe utilization is of high importance for precision breeding of crops that are improved to either tolerate growth on alkaline and calcareous soils with poor Fe bio-availability or to accumulate a higher content of this micronutrient in bio-available form in the edible plant parts. Genetic traits have been associated with micronutrient content and usage in plants, for example [@pone.0099234-Uauy1], [@pone.0099234-Baxter1]. Another trait was found in soybean as being linked to transcription factor genes encoding the soybean homologs of BHLH38 and BHLH39 [@pone.0099234-Peiffer1]. The potential importance of these two transcription factor genes for Fe mobilization had previously been uncovered in studies on the plant model Arabidopsis thaliana. BHLH38 and BHLH39 belong to the so-called subgroup Ib(2) BHLH genes [@pone.0099234-Pires1] and they are functionally redundant [@pone.0099234-Wang1]--[@pone.0099234-Wang2]. In fact, BHLH38 and BHLH39 are tandem duplicates on the chromosome, and they share similarity with two other BHLH genes, namely BHLH100 and BHLH101 [@pone.0099234-Wang1], [@pone.0099234-Heim1]--[@pone.0099234-ToledoOrtiz1]. All these four subgroup Ib(2) BHLH genes are highly induced by low Fe supply in roots and leaves while they are not usually found expressed under sufficient Fe supply [@pone.0099234-Wang1]. Expression of BHLH39 and BHLH101 in response to iron can be followed using the public microarray data in Arabidopsis [@pone.0099234-Bauer1]--[@pone.0099234-Yang1] and it was found that they occur in a co-expression network along with several Fe homeostasis genes like FERRIC REDUCTASE OXIDASE3 (FRO3), NATURAL RESISTANCE-ASSOCIATED MACROPHAGE PROTEIN4 (NRAMP4) and NICOTIANAMINE SYNTHASE4 (NAS4) [@pone.0099234-Ivanov1]. From the co-expression with Fe homeostasis genes it can be concluded that the subgroup Ib(2) BHLH transcription factor genes likely perform regulatory functions in the context of Fe homeostasis and internal Fe mobilization. The bHLH protein POPEYE (PYE, belonging to another bHLH subgroup) is also induced by Fe deficiency within this co-expression network and it acts as a negative regulator of FRO3, NRAMP4 and NAS4, presumably to avoid over-activation of Fe mobilization [@pone.0099234-Long1]. PYE is regulated by BRUTUS (BTS) that is also found in this co-expression network [@pone.0099234-Ivanov1], [@pone.0099234-Long1]. bHLH subgroup Ib(2) can physically interact with the bHLH FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT) [@pone.0099234-Wang2], [@pone.0099234-Yuan1]. FIT is expressed specifically in roots and has been shown to be essential for Fe uptake [@pone.0099234-Bauer2]--[@pone.0099234-Yuan2] by regulating the expression of the genes encoding ARABIDOPSIS H^+^-ATPASE2 (AHA2) [@pone.0099234-Ivanov1], Fe reductase FERRIC OXIDASE2 (FRO2) [@pone.0099234-Jakoby1], [@pone.0099234-Robinson1] and the IRON-REGULATED TRANSPORTER1 (IRT1) [@pone.0099234-Jakoby1], [@pone.0099234-Eide1]. From ectopic FIT expression experiments along with yeast promoter activation assays and inducible FIT activation in plants, it can be concluded that FIT targets FRO2 and IRT1 gene promoters [@pone.0099234-Jakoby1], [@pone.0099234-Yuan2], [@pone.0099234-Meiser1], [@pone.0099234-Sivitz2]. However, FIT induces IRT1 and FRO2 only upon Fe deficiency even when overexpressed [@pone.0099234-Jakoby1], [@pone.0099234-Meiser1]. The activation of FIT at low Fe can be explained with the presence of bHLH subgroup Ib(2) factors. Indeed, the double overexpression of FIT together with either bHLH subgroup Ib(2) protein leads to an increase of Fe acquisition responses under sufficient Fe supply conditions, and it was therefore proposed that the function of bHLH subgroup Ib(2) might be to induce Fe deficiency responses in conjunction with FIT [@pone.0099234-Wang2], [@pone.0099234-Yuan1]. However, the occurrence of BHLH subgroup Ib(2) genes in the PYE coexpression network, their non-expression upon sufficient Fe (where FIT and IRT1 are active although at low level) and their high induction upon Fe deficiency not only in roots but also in leaves (in contrast to Fe acquisition genes) renders this hypothesis questionable. Moreover, contradictory results have been published with regard to the function of bHLH subgroup Ib(2) proteins. In one report, double bhlh100 bhlh101 knockout mutants were demonstrated to develop a more severe leaf chlorosis than the wild type upon Fe deficiency, while no phenotype was apparent upon Fe sufficiency. Although some Fe homeostasis genes appeared mis-expressed, the gene knockouts did not affect the plants' abilities for Fe uptake and the regulation of FRO2 and IRT1 upon sufficient or deficient Fe supply [@pone.0099234-Sivitz1]. In contrast to that, in another report, bHLH subgroup Ib(2) knockouts including bhlh100 bhlh101 and a triple knockout bhlh39 bhlh100 bhlh101 were demonstrated to affect Fe acquisition responses and to have low FRO2 and IRT1 expression upon sufficient or deficient Fe supply [@pone.0099234-Wang3]. This latter finding was rather puzzling, and it was not further explained how this finding fits to the observation that the BHLH genes are not normally expressed upon sufficient Fe supply, when Fe also needs to be acquired via FRO2 and IRT1 [@pone.0099234-Jakoby1], [@pone.0099234-Vert1]. Thus, the function of the bHLH subgroup Ib(2) transcription factors in Fe uptake is still open for debate. Very interestingly, it has been shown that BHLH38 and BHLH39 were induced after application of salicylic acid ( = SA) by the SA-inducible Dof ( = DNA binding with one finger) transcription factor OBF BINDING PROTEIN3 (OBP3) [@pone.0099234-Kang1]. Binding of OBP3 to promoter elements in BHLH38 and BHLH39 genes and their subsequent activation was demonstrated (in these studies BHLH38 and BHLH39 were named OBP3 RESPONSIVE GENE2, ORG2, and OBP3 RESPONSIVE GENE3, ORG3) [@pone.0099234-Kang1]. Jasmonic acid negatively affects the onset of Fe mobilization and the induction of FRO2 and IRT1 [@pone.0099234-Maurer1], while ethylene enhances the responses [@pone.0099234-Garca1]--[@pone.0099234-Lingam1]. Since SA, jasmonic acid and ethylene act in stress response networks, the possibility exists that perhaps, there is a link between SA and the up-regulation of Fe deficiency responses. Here, we made use of the triple knockout mutant bhlh39 bhlh100 bhlh101 (3xbhlh) that we constructed to investigate the functions of these BHLH genes in the Fe deficiency response and to further shed light on the question whether SA is involved in mediating the onset of Fe uptake via the induction of BHLH subgroup Ib(2) genes. We discuss that BHLH39, BHLH100 and BHLH101 are essential for a subset of Fe deficiency responses but not including up-regulation of IRT1 and FRO2. We suggest that these transcription factors are involved in adapting stress responses and internal metabolic responses to Fe deficiency. Materials and Methods {#s2} ===================== Plant Materials {#s2a} --------------- Wild type was Col-0. The 3xbhlh mutant line was generated from the single T-DNA insertion mutants bhlh39-1 (SALK_025676), bhlh100-1 (SALK_074568) and bhlh101-1 (SALK_011245) [@pone.0099234-Wang1]. A homozygous bhlh39-1 plant was crossed with a bhlh100-1 bhlh10-1 double mutant plant. In the F2 progeny a triple homozygous bhlh39-1 bhlh100-1 bhlh101-1 plant was identified by genotyping and multiplied to obtain a triple homozygous line, hereafter named 3xbhlh. The SA mutant line npr1-1 (hereafter named npr1) with a defect in a central regulator component of SA signaling resulting in the failure of the expression of the PR1 gene was obtained from the NASC stock center (N3726) [@pone.0099234-Cao1]. The lines NaHG and sid2-2 were provided by Fred Ausubel, Massachusetts General Hospital [@pone.0099234-Ferrari1]. Plant Growth {#s2b} ------------ Arabidopsis seeds were surface-sterilized with 6% NaOCl, 0.1% Triton-X for 10 minutes, and washed 5 times with distilled water. Seeds were stratified for 2 days in 0.1% plant agar in the dark at 4°C. For the 6-day growth assay seeds were placed on Hoagland agar medium containing 50 µM FeNaEDTA (sufficient Fe supply, hereafter termed +Fe) or 0 µM FeNaEDTA (deficient Fe supply, hereafter termed −Fe), germinated and grown for 6 d under long-day conditions with 8 h dark and 16 h light [@pone.0099234-Lingam1]. On day 6, seedlings were harvested for analysis. For the 2-week growth assay, seeds were germinated and seedlings grown for 14 d on Hoagland agar medium as described above containing 50 µM FeNaEDTA, then transferred for 3 days to fresh medium containing either 0 µM FeNaEDTA (−Fe) or 50 µM FeNaEDTA (+Fe). Then, leaves and roots were harvested separately for RNA or protein analysis. If indicated in the text 100 µM methyl-salicylic acid (hereafter named SA, Sigma-Aldrich, USA) was added to the growth medium and plants exposed for the indicated time. Physiological Analysis {#s2c} ---------------------- The degree of leaf chlorosis was assessed according to a previously published procedure [@pone.0099234-Schuler2]. The leaf chlorosis scale is mentionned in the figure legend of [Fig. 1](#pone-0099234-g001){ref-type="fig"}. ![Leaf chlorosis phenotypes of the 3xbhlh mutant.\ A, 10-old WT and 3xbhlh plants grown at +Fe and −Fe; bar = 5 mm; B, Strength of leaf chlorosis; the leaf chlorosis scale used was 1 = green, 2 = green, partially yellow, 3 = yellow-green, 4 = yellow; 5 = white-yellow; n = 12; C, Fe content per leaf dry mass; n = 4; indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT.](pone.0099234.g001){#pone-0099234-g001} For metal determination, plant parts exposed to plant medium were washed with 100 mM Ca(NO~3~)~2~ prior to harvest to eliminate metal residues from the growth medium. Plant material was dried overnight at room temperature, then for 1 d at 120°C and powdered with an achat mortar. Quantification of metal contents of the plant samples was performed using atomic absorption spectroscopy coupled with a graphite tube atomizer as described [@pone.0099234-Lingam1]. Four technical replicate measurements were carried out with weighted samples of 50--120 µg for every atomisation (2300°C) and mean mass per dry weight values were calculated for each biological sample. Four biological replicates were produced and mean values calculated. Iron reductase activity assays were performed using a liquid ferrozine assay [@pone.0099234-Klatte1] and biological replicates were performed as described in the figure legends. Statistical analysis was performed using the t-test. Gene Expression using Reverse Transcription-qPCR {#s2d} ------------------------------------------------ Reverse transcription-quantitative real-time PCR was performed as previously described [@pone.0099234-Klatte2]. Briefly, DNase-treated RNA was used for cDNA synthesis. SYBR green I-based real-time PCR analysis was performed by using the TaKaRa Premix (TaKaRa, Japan) in the real-time ICycler (Bio-Rad, USA). For each gene, the absolute quantity of initial transcript was determined by standard curve analysis using mass standards. Absolute expression data was normalized against the averaged expression values of the internal control gene EF1BALPHA2 [@pone.0099234-Klatte2]. Each biological cDNA sample was tested in two technical replicates and the values averaged. Statistical analysis was performed by ANOVA using the values of biological replicates. Information on oligonucleotide primer sequences is available in [Table S1](#pone.0099234.s005){ref-type="supplementary-material"}. Gene Expression using Microarray Analysis {#s2e} ----------------------------------------- Wild type and 3xbhlh seedlings were grown in the 6-day growth system at --Fe, treated for six hours with 100 µM SA or were mock-treated and harvested for RNA preparation. Three biological replicates were generated. RNA was purified using the Qiagen kit and checked for integrity. Microarray hybridization was performed using the Agilent one-color gene expression V4 chip (4×44 k) for Arabidopsis thaliana. Microarray chip hybridization and processing were done by ATLAS Biolabs GmbH, Berlin, Germany. The obtained data were further processed, checked for quality and filtered using the GeneSpring Software, Agilent Technologies, USA, according to the GeneSpring protocol. Full microarray data are available from the NCBI site of Gene Expression Omnibus under the series GSE41774. Interesting probes were identified based on fold change analysis with a fold change cut-off of 1.5 in four pairs of conditions which were 3xbhlh versus wild type, 3xbhlh + SA versus wild type + SA, wild type + SA versus wild type and 3xbhlh + SA versus 3xbhlh. Probes were retained if they passed the moderated t-test with p\<0.05. The differentially regulated probes of the four pairs of conditions were then used to construct Venn diagrams to identify groups with unique and commonly regulated probes. Probe names of these groups were converted into Arabidopsis gene ID numbers. The groups of differentially expressed genes were then further analyzed using Venn diagrams, the ATTED co-expression tool [@pone.0099234-Obayashi1], the GOrilla GO annotation tool [@pone.0099234-Eden1] and the Genevestigator tool [@pone.0099234-Zimmermann1]. Results {#s3} ======= The 3xbhlh Mutant was Sensitive to Fe Deficiency but not Affected in Fe Acquisition and Fe Transport to Shoots {#s3a} ---------------------------------------------------------------------------------------------------------------- To analyze the functions of BHLH subgroup Ib(2) genes, we generated a multiple loss of function mutant. The triple homozygous bhlh39-1 bhlh100-1 bhlh101-1 knockout mutant, hereafter named 3xbhlh, was fully fertile and did not express any full-length BHLH39, BHLH100 and BHLH101 transcripts while it expressed BHLH38 at a higher level at Fe deficiency (hereafter termed −Fe) in roots and leaves. BHLH38 was also found induced in the 3xbhlh mutant roots at sufficient Fe (hereafter termed +Fe) compared to wild-type roots ([Fig. S1A, B](#pone.0099234.s001){ref-type="supplementary-material"}). In the same experiment, all four BHLH genes were highly expressed at --Fe in wild type plants, while they were not expressed or expressed at low level at +Fe ([Fig. S1A, B](#pone.0099234.s001){ref-type="supplementary-material"}), as expected [@pone.0099234-Wang1]. The increased BHLH38 expression in the 3xbhlh mutant especially at --Fe might be due to a feedback control conferred by the triple loss of function phenotype. To determine whether the triple 3xbhlh mutant had any Fe deficiency phenotype at + or --Fe, we grew 3xbhlh and wild type plants at +Fe and --Fe. Morphological alterations in root and shoot growth were not apparent at +Fe. However, at --Fe, the 3xbhlh mutant plants had a stronger leaf chlorosis than wild type, while root growth was normal ([Fig. 1A, B](#pone-0099234-g001){ref-type="fig"}). This observation suggested that 3xbhlh mutants might be perhaps Fe deficient. This assumption was tested and could be rejected after the determination of shoot Fe contents. Neither under + nor --Fe, we could detect any differences in Fe content in the mutant versus the wild type ([Fig. 1C](#pone-0099234-g001){ref-type="fig"}), suggesting that the mutant was not Fe deficient. After retransfer of 3xbhlh mutants from --Fe to +Fe the leaf chlorosis phenotype disappeared within 1--2 days (data not shown). This observation confirmed that indeed the triple 3xbhlh mutant was able to acquire Fe. We verified this point by analyzing gene expression of Fe acquisition genes. We observed that IRT1, FRO2 and FIT were significantly up-regulated at --Fe in wild type and 3xbhlh plants, and that no significant difference in the expression levels between wild type and mutant was detected ([Fig. 2A](#pone-0099234-g002){ref-type="fig"}). A reduced expression of these Fe acquisition genes is typical for mutants affected in the regulation of Fe deficiency responses, such as the chlorotic fit mutant [@pone.0099234-Jakoby1]. Fe reductase activity was also detected at comparable levels in mutant and wild type ([Fig. 2B](#pone-0099234-g002){ref-type="fig"}). An increase of Fe reductase activity was noted at --Fe but due to high standard deviations it was not found significant, but clearly was not lower than in the wild type ([Fig. 2B](#pone-0099234-g002){ref-type="fig"}; [@pone.0099234-Jakoby1]). ![Molecular and physiological Fe acquisition responses of the 3xbhlh mutant.\ A, Gene expression of FIT, FRO2, IRT1 in roots; B, Fe reductase activity; C, NRAMP4, FRO3, OPT3, NAS4, gene expression in roots; D, NRAMP4, FRO3, OPT3, NAS4, gene expression in leaves; 14 d-old plants were transferred for three days to + and −Fe. Roots were harvested for analysis. n = 4; \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT. Gene expression was studied using reverse transcription-qPCR.](pone.0099234.g002){#pone-0099234-g002} In addition, we tested whether two of the PYE-regulated Fe homeostasis genes of the PYE/BHLH39/BHLH101 co-expression network that function in internal Fe mobilization were affected in the mutant. No differences in gene expression were noted for NRAMP4 and FRO3 in roots and leaves ([Fig. 2C, D](#pone-0099234-g002){ref-type="fig"}). Taken together, 3xbhlh mutant plants were fully capable of regulating internal and external Fe mobilization, Fe acquisition and Fe transport genes despite of the lack of the three transcription factors. The 3xbhlh mutant was also able to mobilize Fe from roots into the shoots. Thus, the strong leaf chlorosis of the triple mutant at --Fe cannot be the consequence of a defect in Fe acquisition and mobilization responses. SA and SA Signaling do not Affect Fe Deficiency Responses {#s3b} --------------------------------------------------------- Since the BHLH39, BHLH100 and BHLH101 genes were dispensable for Fe uptake, but yet the plants showed a chlorosis phenotype at --Fe, we reasoned that the chlorosis phenotype could be the result of an altered adaptation to Fe deficiency stress. Since previous reports established a connection between the BHLH subgroup Ib(2) genes and SA signaling [@pone.0099234-Kang1] we hypothesized that perhaps SA responses interfered with Fe deficiency regulation via the bHLH subgroup Ib(2) proteins in the process of adaptation to --Fe. To test this hypothesis, we analyzed available gene expression data of OBP3 (At3g55370), the regulator of BHLH38 and BHLH39 [@pone.0099234-Kang1]. OBP3 is not in a co-expression network with any known Fe-regulated metal homeostasis genes. However, its expression was reported to occur in the root stele where the subgroup Ib(2) gene promoters are also active [@pone.0099234-Wang1], [@pone.0099234-Brady1]. SA plays a role throughout plant development and hence this could require an adaptation to Fe homeostasis [@pone.0099234-RivasSanVicente1]. To test a possible interference of SA and Fe signaling, we first tested using the seedling growth assay whether the SA response gene PATHOGENESIS RELATED1 (PR1) as a marker for SA responses [@pone.0099234-Cao1], OBP3 and BHLH38 were regulated by SA and Fe deficiency treatments in wild type and 3xbhlh mutant plants. As expected, PR1 was induced by 100 µM SA in the wild type, while BHLH38 was induced by --Fe ([Fig. 3A](#pone-0099234-g003){ref-type="fig"}). These two marker genes were not per se induced by the respective other treatment, and in two out of three experiments, the expression levels were not affected in the 3xbhlh mutant ([Fig. 3A](#pone-0099234-g003){ref-type="fig"}). OBP3 was hardly induced by SA treatment and did not show any regulation by Fe or in response to the 3xbhlh mutant. We did also not detect any differences in gene expression levels of IRT1, FRO2 and FIT at + versus --SA treatment ([Fig. 3B](#pone-0099234-g003){ref-type="fig"}). Therefore, we conclude that a clear SA response did not take place upon --Fe and that the 3xbhlh mutant did not show an altered SA response upon SA application. ![Gene expression of Fe deficiency and SA response genes in 3xbhlh and wild type plants in response to SA and Fe.\ A, BHLH38, OBP3, PR1; B, FIT, FRO2, IRT1; 3xbhlh and wild type seedlings were grown for 6 d at + and −Fe and exposed for 6 h to 100 µM SA (+SA) or were mock-treated (−SA). Whole seedlings were harvested for analysis. n = 2; \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT; § indicates a significant change (p\<0.05) of +SA versus --SA. Gene expression was studied using reverse transcription-qPCR.](pone.0099234.g003){#pone-0099234-g003} Since it is possible, that SA might have a more subtle effect in the regulation of Fe deficiency responses, we also tested Fe deficiency gene regulation in various SA mutants grown under + and −Fe supply. The non-repressor of pr1 (npr1) mutant is defective in SA signaling [@pone.0099234-Cao1]. sid2 mutant plants are defective in SA production due to lack of isochorismate synthesis, and NahG plants overexpress a bacterial SA hydroxylase so that SA is rapidly transformed into catechol and consequently does not accumulate [@pone.0099234-Ferrari1]. We found that in these mutants Fe acquisition genes IRT1, FRO2 and FIT were up-regulated by --Fe as in the wild type ([Fig. 4A](#pone-0099234-g004){ref-type="fig"}). IRT1 was slightly up-regulated at +Fe in npr1 compared to the wild type in one experiment. BHLH38 and BHLH39 expression was not affected in the mutants ([Fig. 4B](#pone-0099234-g004){ref-type="fig"}). ![Gene expression of Fe deficiency response genes in various SA mutants and wild type plants.\ A, FIT, FRO2, IRT1; B, BHLH38, BHLH39; SA mutants and wild type seedlings were grown for 11 d at + and −Fe. Roots were harvested for analysis. n = 2; \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of SA mutant versus WT. Gene expression was studied using reverse transcription-qPCR.](pone.0099234.g004){#pone-0099234-g004} Hence, we exclude an apparent effect of SA treatment or SA signaling on Fe deficiency regulation. The up-regulation of BHLH subgroup Ib(2) genes under --Fe was not likely the consequence of a SA signal. Wild Type and 3xbhlh Mutants Differ in Gene Expression Patterns at --Fe and in the Presence of SA {#s3c} --------------------------------------------------------------------------------------------------- To get further hints on the Fe deficiency phenotype we performed a transcriptome comparison between 3xbhlh and wild type seedlings ([Fig. S2](#pone.0099234.s002){ref-type="supplementary-material"}). This analysis was conducted under --Fe conditions since we expected most of the differential gene expression to occur at --Fe as deduced from the 3xbhlh leaf chlorosis phenotype at --Fe. SA was included as a treatment to search for changes in gene expression in response to SA. 6-day old seedlings were grown on --Fe, transferred for 6 h to + or −100 µM SA containing --Fe medium and harvested. Microarray analysis was performed using the Agilent V4 gene chip (26.283 Arabidopsis genes). In parallel, we used the same RNA samples to perform real time quantitative reverse transcription-PCR to assess the technical quality of the method and the biological quality of the samples in this experiment ([Fig. S2](#pone.0099234.s002){ref-type="supplementary-material"}). At first, we identified from the microarray data those genes that showed differential regulation at least 1.5-fold between wild type and the 3xbhlh mutant in the absence and presence of SA in a statistically significant manner. The differentially regulated genes were grouped according to expression patterns using Venn diagrams ([Fig. 5](#pone-0099234-g005){ref-type="fig"}). 198 genes were identified as being regulated between mutant and wild type ([Table S2](#pone.0099234.s006){ref-type="supplementary-material"}; [Fig. 5](#pone-0099234-g005){ref-type="fig"}). 25 of these genes were only found deregulated in the mutant in the absence of SA (group I) and 61 genes only in the presence of SA (group II). 112 genes were regulated between mutant and wild type in the presence and absence of SA (group III). An important control for the quality of our microarray hybridization experiment was represented by the BHLH39, BHLH100 and BHLH101 genes which we found down-regulated in the 3xbhlh mutant compared to the wild type in the group III, as was expected ([Table S2](#pone.0099234.s006){ref-type="supplementary-material"}). On the other hand, 9892 genes were differentially regulated between + and − SA in the wild type or in the 3xbhlh mutant ([Fig. 5](#pone-0099234-g005){ref-type="fig"}). Among these latter genes 1718 were only differentially expressed in response to SA in the wild type (group IV), while 1472 other genes were specifically affected by SA in the mutant (group V) ([Table S3](#pone.0099234.s007){ref-type="supplementary-material"}; [Fig. 5](#pone-0099234-g005){ref-type="fig"}). 6702 genes were regulated by SA in wild type and in the 3xbhlh mutant (group VI) and were not further investigated as they reflected purely SA-dependent genes. ([Fig. 5](#pone-0099234-g005){ref-type="fig"}). The high numbers of SA-regulated genes might indicate that the SA treatment affected the transcriptomes in a strong manner than did the 3xbhlh mutations. However, we found that genes of groups IV and V were only mis-regulated by a maximum level of 5-fold ([Table S3](#pone.0099234.s007){ref-type="supplementary-material"}). On the other hand, among the small number of genes mis-regulated between mutant and wild type (groups I--III) some genes reached differential expression up to 60-fold ([Table S2](#pone.0099234.s006){ref-type="supplementary-material"}). ![Venn diagram showing overlap of differentially regulated genes identified in microarray analysis.\ Four lists of genes that were differentially expressed at least 1.5-fold between the indicated conditions were used to construct the Venn diagram. The genes of groups I--V are listed in [Tables S3](#pone.0099234.s007){ref-type="supplementary-material"}, [S4](#pone.0099234.s008){ref-type="supplementary-material"}. Groups I to III contain genes differentially expressed between 3xbhlh and wild type. Groups IV and V contain genes that show differential regulation between + and --SA treatment but not between wild type and mutant.](pone.0099234.g005){#pone-0099234-g005} Analysis of Functional Categories Differentially Regulated between 3xbhlh and Wild Type Plants (Groups I to III) {#s3d} ------------------------------------------------------------------------------------------------------------------ Next, we assessed whether any specific functional pathways were affected in the 3xbhlh mutant. At first, we analyzed the functions of the genes of groups I, II and III by analyzing whether specific gene ontology categories were hit among them using the GOrilla tool [@pone.0099234-Eden1]. Among the DOWN-regulated genes of group I we found weak enrichment of categories related to lactate metabolism and cell wall, and among the UP-regulated genes of group I of categories RNA metabolism and transcription ([Table S4](#pone.0099234.s008){ref-type="supplementary-material"}-1, S4-2). In group II we found an enrichment for the categories flavonoid biosynthesis, UV responses, inositol metabolism and transpiration among the UP-regulated genes ([Table S4-1](#pone.0099234.s008){ref-type="supplementary-material"}, [S4-2](#pone.0099234.s008){ref-type="supplementary-material"}). In group III the categories metal response and copper binding were among the DOWN-regulated genes and again inositol metabolism among the UP-regulated genes ([Table S4-1, 4-2](#pone.0099234.s008){ref-type="supplementary-material"}). This analysis indicates that loss of the BHLH subgroup Ib(2) functions in the 3xbhlh mutant at --Fe resulted in altered stress regulation and adaptation to stress. Then, we checked whether the three groups I--III contained known Fe-regulated genes. In a previous work, we have grown six day-old Arabidopsis seedlings in + and −Fe conditions in the same system as utilized here. From these previous experiments we have obtained a list of iron-regulated genes in the seedlings [@pone.0099234-Bauer1], [@pone.0099234-Schuler1], [@pone.0099234-Ivanov1]. The list of Fe-regulated genes in wild type seedlings published in [@pone.0099234-Bauer1] was used to compare with the list of genes in groups I--III. To our surprise we could only find 29 Fe-regulated genes among the 197 genes of the groups I--III, which corresponded to only 15% of these genes ([Fig. 6A](#pone-0099234-g006){ref-type="fig"}). Interestingly, these 15% of the 3xbhlh-regulated genes could be further subdivided into 9 genes that were up-regulated by --Fe in the wild type and up-regulated in the mutant versus the wild type at --Fe as well as 15 genes that were down-regulated by --Fe in the wild type and down-regulated in the mutant versus the wild type at --Fe. Hence, the expression patterns of these 24 genes reflected the situation that the 3xbhlh mutant was more sensitive to Fe deficiency than the wild type and that the Fe deficiency leaf chlorosis response was enhanced. Very interestingly, five genes showed an opposite expression pattern of being highly expressed at --Fe in the wild type, but expressed at low level in the 3xbhlh mutant versus the wild type. These five genes were At1g53310 encoding PPC1, At3g07720, encoding a putative Kelch-repeat protein, At3g12900, an oxidoreductase gene, At4g31940 encoding CYP82C4 and At3g58810 encoding the metal transporter MTPA2. Therefore, it can be assumed that these five genes could represent specific target genes of the transcription factors bHLH39, bHLH100 and bHLH101. We also noted that the genes encoding the Fe acquisition machinery in Arabidopsis like IRT1 and FRO2 were not found among the differentially expressed genes which confirms above expression studies. We used the 29 genes to build co-expression networks using the ATTED tool [@pone.0099234-Obayashi1], and in total we could identify four co-expression networks ([Fig. 6B](#pone-0099234-g006){ref-type="fig"}, [Fig. S3](#pone.0099234.s003){ref-type="supplementary-material"}). One network contained four out of the five putative bHLH targets. As mentioned above, this co-expression network was previously identified as the FIT target network [@pone.0099234-Ivanov1]. Another network contained six genes up-regulated at --Fe and in the chlorotic triple mutant and one gene down-regulated in these respective conditions. This network was enriched with gene functions in flavonoid synthesis, secondary metabolism and circadian rhythm. A third network contained seven genes being down-regulated by --Fe and in the triple mutant, and this network was enriched for circadian rhythm functions. The fourth co-expression network comprised another five genes that were down-regulated at --Fe and in the 3xbhlh mutant, and enrichment was found for photosynthetic functions and secondary metabolism. Similar functional categories were also evident for the 29 genes when using GOrilla as a GO annotation tool, namely metal response, inositol metabolism, protein folding, photosystem II and other chloroplast functions and circadian clock ([Table S4-3, S4-4](#pone.0099234.s008){ref-type="supplementary-material"}). In summary, co-expression analysis, functional annotation and enrichment analysis indicated that the expression of the 24 Fe-regulated genes was different in 3xbhlh as a consequence of the increased leaf chlorosis of the triple mutant at --Fe, while the expression of five co-expressed genes indicates that they might be targets of the transcription factors in roots. ![Regulation of the subset of 29 Fe-regulated genes out of groups I, II and III identified in microarray analysis.\ The list of Fe-regulated genes in wild type seedlings that we had published earlier [@pone.0099234-Bauer1] was used to compare with the list obtained in this work for the groups I--III. 29 genes of the groups I--III were found Fe-regulated in [@pone.0099234-Bauer1]. A, Regulation patterns, annotation and co-expression of the subset of 29 genes; the regulation at +Fe versus --Fe in the wild type is represented in the left-most column (in dark green up = up-regulated, in red down = down-regulated); the regulation in the 3xbhlh mutant versus WT is shown in the middle column (in light green up = up-regulated and in yellow or violet down = down-regulated; note that the yellow color indicates that these genes do not follow in the 3xbhlh mutant the regulation expected from --Fe versus +Fe in the left column and hence could be direct targets of bHLH39, bHLH100 and bHLH101). The Arabidopsis gene identification (AGI) numbers and annotations are shown on the right side, whereby the color code indicates the belonging to different co-expression networks as determined using the ATTED tool (ref), represented in B; B, Co-expression network analysis of the 29 genes; the ATTED tool was utilized for construction; the different networks are highlighted in color and the AGI numbers belonging to those networks are highlighted by the same color in A. The grey color indicates genes that are part of isolated co-expression networks. A high-resolution image of the co-expression networks is shown in [Fig. S3](#pone.0099234.s003){ref-type="supplementary-material"}.](pone.0099234.g006){#pone-0099234-g006} On the other hand, 85% of the genes of group I--III were not regulated by Fe deficiency. It was then interesting to determine whether these genes represented specific pathways. The functional categories were again related to inositol metabolism, circadian rhythm and UV response ([Table S4-3, S4-4](#pone.0099234.s008){ref-type="supplementary-material"}). Hence, the Fe-regulated and non-Fe-regulated genes of groups I to III play functions in regulating adaptive stress processes suggesting that these functions are central for the bHLH proteins. Validation of Differential Gene Expression in Groups I to III by Reverse Transcription-qPCR {#s3e} ------------------------------------------------------------------------------------------- To verify the regulatory expression patterns identified in the microarray experiments, we verified some of the gene expression results by reverse transcription-qPCR studies, especially by studying the Fe-regulated genes. Reverse transcription-qPCR was performed on the same biological samples as used for the microarray ([Fig. S2](#pone.0099234.s002){ref-type="supplementary-material"}). We also used the samples derived from plants grown at +Fe that we had raised in parallel. Three biological replicates have been analyzed. Due to the low number of three samples the differences were not found to be significant with p\<0.05 in all expected cases, which we designated then as "tendency". We found a tendency for up-regulation of IRT1, FRO2 and BHLH038 at --Fe versus +Fe irrespective of genotype and SA treatment which was significant for IRT1 at −Fe versus +Fe in the 3xbhlh mutant ([Fig. S4A](#pone.0099234.s004){ref-type="supplementary-material"}, B, C). PR1 expression was significantly increased in all +SA versus --SA samples, as expected ([Fig. S4D](#pone.0099234.s004){ref-type="supplementary-material"}). Hence, these control gene expression results confirm that the plants had reacted as expected to Fe and salicylic acid supply in the experiment. Then, we studied gene expression of the Fe-regulated targets of the bHLH factors from groups I--III, namely of the four coexpressed genes At3g07720, CYP82C4, At3g12900 and MTPA2 as well as of PPC1. All five genes showed a tendency to be up-regulated by --Fe in the wild type and in the 3xbhlh mutant compared to +Fe, which was significant with p\<0.05 for CYP82C4 in 3xbhlh and for At3g12900 ([Fig. 7A--E](#pone-0099234-g007){ref-type="fig"}; compare to [Fig. 6](#pone-0099234-g006){ref-type="fig"}, yellow co-expression network and PPC1). The expression of these five genes had a tendency to be lower in the mutant than in the wild type at --Fe. In the presence of SA the five genes were similarly regulated than in the absence of SA, whereby the basal expression levels at +Fe in the wild type were found higher in tendency at +SA than at −SA for At3g07720 and MTPA2. ![Gene expression of Fe and 3xbhlh-regulated genes (groups I--III), identified from microarray analysis.\ A, At3g07720; B, CYP82C4; C, At3g12900; D, MTPA2; E, PPC1; F, LHY1; G, At1g07050; H, PSAF; The genes in A--E were identified as potential downstream targets of bHLH subgroup Ib(2) factors, while the genes in F--H indicated a more intense response to --Fe in the mutant (compare to [Fig. 6](#pone-0099234-g006){ref-type="fig"}). 3xbhlh and wild type seedlings were grown for 6 d at + and −Fe and exposed for 6 h to 100 µM SA (+SA) or were mock-treated (−SA). Whole seedlings were harvested for analysis. n = 3; the --Fe cDNA samples were derived from the RNAs used in the microarray ([Fig. S2](#pone.0099234.s002){ref-type="supplementary-material"}); \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT; § indicates a significant change (p\<0.05) of +SA versus --SA. Gene expression was studied using reverse transcription-qPCR.](pone.0099234.g007){#pone-0099234-g007} Next, we verified gene expression of the Fe-regulated group III genes, namely LHY1, PSAF and At1g07050 ([Fig. 7F--H](#pone-0099234-g007){ref-type="fig"}; compare to [Fig. 6](#pone-0099234-g006){ref-type="fig"}, green, violet and pink coexpression networks, respectively). We found that LHY1 followed a tendency to be more expressed at --Fe versus +Fe in the mutant and in the presence of SA. At1g07050 and PSAF followed a tendency to be expressed at lower level at --Fe versus +Fe, especially in the 3xbhlh mutant. Taken together, the reverse transcription-qPCR data confirmed in their tendency the gene regulation changes detected in the comparative transcriptome analysis. This result underlined the technical and biological reproducibility, however the number of only three biological replicates did not allow obtention of p\<0.05 statistical values in each comparison. Analysis of Functional Categories Differentially Regulated between + and −SA (Groups IV and V) {#s3f} ---------------------------------------------------------------------------------------------- Different genes were regulated by SA in the wild type (group IV) and 3xbhlh plants (group V). We used again the GOrilla tool [@pone.0099234-Eden1] to analyze whether specific categories were hit in the two cases. In group IV we identified the categories RNA and post-transcriptional genes silencing, organelle organization, GTP activity and chloroplast functions among the DOWN-regulated genes in the wild type, while the categories lipid metabolism, cellular starvation response and transition metal transport were hit among the UP-regulated genes ([Table S4-1, 4-2](#pone.0099234.s008){ref-type="supplementary-material"}). In group V the categories DNA replication, transmembrane receptor signaling, cell division, histone modification, protein binding and chloroplast thylakoid were hit among the DOWN-regulated genes and defense and heat response, signaling, kinase activity and ADP binding were identified as pathways among the UP-regulated genes ([Table S4-1, 4-2](#pone.0099234.s008){ref-type="supplementary-material"}). Hence from the high number of regulated genes and the categories we deduce that SA affects stress responses and cell division in a different manner in the wild type and the 3xbhlh mutant upon SA treatment. Thus, the 3xbhlh mutant is in a different manner sensitive to SA than the wild type. Discussion {#s4} ========== In this report we show that BHLH subgroup Ib(2) genes BHLH39, BHLH100 and BHLH101 acted in the adaptation to the stress caused by the Fe deficiency but not for Fe acquisition itself. Although BHLH38 and BHLH39 may act in the SA pathway we did not find any evidence that SA responses interfered with Fe deficiency regulation via the BHLH genes. Contradictory reports in the literature rendered it difficult to establish a clear function for BHLH subgroup Ib(2) genes in the regulation of Fe deficiency responses in Arabidopsis. On one side, it was shown that a triple mutant bhlh39 bhlh100 bhlh101 was affected in the ability to up-regulate Fe reductase activity upon --Fe [@pone.0099234-Wang3], while a double mutant bhlh100 bhlh101 was not [@pone.0099234-Sivitz1]. However, in both these studies the mutants were described to display a leaf chlorosis at --Fe but not at +Fe. Here we demonstrate that the 3xbhlh triple mutant bhlh39 bhlh100 bhlh101 developed a leaf chlorosis only at --Fe but not at +Fe. We found and confirmed that this phenotype was clearly not associated with a reduced uptake of Fe. When we analyzed the triple 3xbhlh mutant we observed that this mutant was able to mobilize and acquire Fe, in contrast to the report mentioned above [@pone.0099234-Wang3]. The first evidence came from the fact that the leaf chlorosis was restrained to --Fe, while no such phenotype was observed at +Fe. The 3xbhlh mutants had similar Fe levels as the wild type, and hence, these plants were able to utilize Fe at +Fe like the wild type. In addition, the 3xbhlh mutants were able to induce FIT, IRT1 and FRO2 at --Fe versus +Fe. The three Fe uptake genes did also not occur among the groups I--III that comprised the genes differentially expressed between mutant and wild type. Fe reductase activity was clearly inducible in the triple mutant at least to the same extent as in the wild type. An alternative possibility to explain the increased leaf chlorosis of 3xbhlh mutant compared to wild type plants at --Fe could be linked with a reduced ability of the mutant to utilise internal iron. However, we did not find evidence that typical genes for internal Fe utilization were changed in their expression, like NRAMP4 [@pone.0099234-Lanquar1], FRO3 [@pone.0099234-Mukherjee1], OPT3 [@pone.0099234-Stacey1] and NAS4 [@pone.0099234-Koen1], [@pone.0099234-Palmer1]. Taken together, we can say that the leaf chlorosis of 3xbhlh plants was not the consequence of impaired Fe uptake and utilisation. Since BHLH38 was still expressed in the 3xbhlh mutant, even to a higher level than in the wild type, we cannot conclude that none of the subgroup Ib(2) BHLH genes are required for Fe uptake or Fe mislocalization. Since BHLH38 is hardly expressed at +Fe (when Fe is available for uptake), it is not likely required for Fe uptake, either. Due to the tandem location of BHLH38 and BHLH39 in the genome, a quadruple insertion mutant with a full knockout of all BHLH functions cannot be readily generated to confirm this. We predict that a quadruple mutant would have more severe leaf chlorosis symptoms than the wild type at --Fe. The question remains what is the cause of the increased leaf chlorosis of 3xbhlh mutants at --Fe. One clue to that question could come from the functions of the genes that we found differentially expressed in the mutant versus the wild type. Five genes were regulated in an opposite manner in the 3xbhlh mutant than in the wild type in response to iron. These genes might be targets for bHLH39, bHLH100 and bHLH101, namely PPC1, At3g07720, the oxidoreductase At3g12900, CYP82C4 and MTPA2. The latter four are coexpressed with target genes of the transcription factor FIT, such as IRT1. However, some of the FIT targets of the co-expression network were found here not be mis-regulated in the 3xbhlh mutant. This result can be explained. We suggest that the four bHLH transcription factors of the subgroup Ib(2) show functional divergence. bHLH38 in conjunction with FIT namely acts on the induction of the targets IRT1 and FRO2, while bHLH39, bHLH100 and bHLH101 presumably together with FIT more specifically target the other genes in this co-expression network that we have found here. Another set of Fe-regulated genes of groups I--III, which are differentially expressed in the mutant versus the wild type, indicated that the Fe deficiency responses were augmented in the mutant. For example, genes which are up-regulated at --Fe versus +Fe in the wild type showed an exaggerated up-regulation response in the comparison of mutant versus wild type at --Fe. Or, genes which are down-regulated at --Fe versus +Fe in the wild type showed a stronger down-regulation response in the mutant versus wild type at --Fe. From these expression patterns it is unlikely that these genes are regulated directly by the bHLH subgroup Ib proteins since otherwise we would have expected opposite trends of regulation between +/−Fe and mutant/wild type. The differential regulation of these genes is rather a pleiotropic effect due to the 3xbHLH mutations. Since the most obvious phenotype was the increased leaf chlorosis, the differential regulation of these genes was likely an effect of the severe leaf chlorosis. Indeed, several of these genes have functions in the leaves related to the clock and in chloroplasts. Previous reports have established an effect of iron deficiency on the biological clock [@pone.0099234-Chen1]--[@pone.0099234-Salome1]. On the other hand, 170 genes were differentially expressed between mutant and wild type without that any differential expression of these genes had been noted in response to Fe supply in previous experiments [@pone.0099234-Bauer1]. Therefore, we deduce that the three BHLH genes regulate an adaptation response to the stress caused by the Fe deficiency. This would also explain why these BHLH genes are only activated at --Fe, but not at +Fe, and why they are induced in leaves and in roots. And in addition, it explains that in the absence of the genes in the 3xbhlh mutant such a high number of genes are differentially expressed whereby in the wild type the expression appears unchanged. A further question is what could be the function of the 170 genes not regulated by Fe supply. One possibility could have been that these 170 genes are regulated by salicylic acid, a stress hormone. BHLH38 and BHLH39 have been brought into the context of SA regulation [@pone.0099234-Kang1], and as a stress hormone SA signaling could be effective upon Fe deficiency stress. However, we exclude that the 170 genes are SA-regulated since none of them was in the intersections with the 50 times higher number of SA-regulated genes in the Venn diagrams, as revealed in our microarray experiments. The main functional categories that these 170 genes belong to are inositol metabolism, circadian rhythm again and UV responses. Hence, it can be concluded that the bhlh functions are important for adapting leaf responses to Fe deficiency stress. The absence of proper regulation would thus result in a more increased leaf chlorosis due to improper adaptation. Since the bHLH genes of the subgroup Ib(2) are expressed in leaves and there induced by Fe deficiency, it is plausible to predict that the leaf regulation is the main function of the bHLH genes which takes place independent of FIT. In conclusion, it will be very interesting in the future to study the connection between leaf responses as an adaptation to Fe deficiency conferred by bHLH subgroup Ib(2) proteins. Supporting Information {#s5} ====================== ###### Gene expression of BHLH subgroup Ib genes in 3xbhlh and wild type plants in response to Fe. A, in roots; B, in leaves; 3xbhlh and wild type seedlings were grown for 14 d at +Fe and exposed for 3 d to + or −Fe. Roots and leaves were harvested for analysis. n = 4; \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT. Gene expression was studied by reverse transcription-qPCR. (TIFF) ###### Click here for additional data file. ###### Overview of one biological replicate set of microarray and reverse transcription-qPCR experiments; 3xbhlh and wild type seedlings were grown for 6 d at + and −Fe and exposed for 6 h to 100 µM SA (+SA) or were mock-treated (−SA). RNA and cDNA was prepared from all samples for use in reverse transcription-qPCR analysis (see [Fig. 7](#pone-0099234-g007){ref-type="fig"}). Microarray analysis was only conducted with --Fe samples (see [Fig. 5](#pone-0099234-g005){ref-type="fig"}, [6](#pone-0099234-g006){ref-type="fig"}). For reverse transcription-PCR and microarray analysis a total of three biological replicates was performed. (TIFF) ###### Click here for additional data file. ###### High-resolution image of the co-expression network analysis of the 29 Fe-regulated genes out of groups I, II and III. The ATTED tool was utilized for construction. Further analysis and additional information are provided in [Fig. 6](#pone-0099234-g006){ref-type="fig"}. (TIF) ###### Click here for additional data file. ###### Gene expression of Fe deficiency and SA marker genes in the samples used for microarray analysis. A, FIT; B, IRT1; C, FRO2; D, PR1; 3xbhlh and wild type seedlings were grown for 6 d at + and −Fe and exposed for 6 h to 100 µM SA (+SA) or were mock-treated (−SA). Whole seedlings were harvested for analysis. n = 3; the --Fe cDNA samples were derived from the RNAs used in the microarray ([Fig. S2](#pone.0099234.s002){ref-type="supplementary-material"}); \* indicates a significant change (p\<0.05) of −Fe versus +Fe; + indicates a significant change (p\<0.05) of 3xbhlh versus WT; § indicates a significant change (p\<0.05) of +SA versus --SA. Gene expression was studied using reverse transcription-qPCR. (TIF) ###### Click here for additional data file. ###### Primer sequences. (DOT) ###### Click here for additional data file. ###### List of genes of the groups I, II and III with differential expression between 3xbhlh and wild type at --Fe in the presence and absence of 100 µM SA. (XLS) ###### Click here for additional data file. ###### List of genes of the groups IV and V with differential expression of either 3xbhlh or wild type at --Fe in the presence and absence of 100 µM SA. (XLS) ###### Click here for additional data file. ###### GO annotation of the differentially regulated genes of groups I to V. (XLS) ###### Click here for additional data file. This work has been funded by the Saarland University and the Heinrich Heine University Düsseldorf. Funding by the Deutsche Forschungsgemeinschaft grant No. DFG-Ba1610/5-1 to PB is kindly acknowledged. The authors thank Dr. Claudia Fink-Straube, Saarbrücken, for iron content determination. We thank Angelika Anna for excellent technical assistance regarding plant growth. [^1]: Competing Interests:The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: PB. Performed the experiments: FM MN. Analyzed the data: FM MN PB. Wrote the paper: PB. [^3]: Current address: Department of Anaesthesiology, Intensive Care and Pain Therapy, Saarland University Medical Center and Saarland University Faculty of Medicine, Homburg, Germany	{ "pile_set_name": "PubMed Central" }
[Complications in mediastinoscopy - a possibility of direct therapy]. Complications in diagnostic mediastinoscopy are between 0, 7 percent and 1,8 per cent. Lesions of the great vessels end letal in most cases. A possibility is reported how to treat lesions of the tracheobronchial system in emergency cases with lyophilised dura and a histoacryl-adhesive for tissue.	{ "pile_set_name": "PubMed Abstracts" }
1. Field of the Invention This invention relates to a system for remotely providing object location. 2. Background Vehicle locators are well known. They may be used to locate a single vehicle. However, in daily life, we need an object locator to locate a variety of the target objects in a list. Moreover, all object locators are standing alone devices. Nowadays the existing device like cellular phone set, personal digital assistant, or car alarm remote is very commonly used. We may embed the object locator in the existing device to share its hardware, software, memory and display, etc., and becomes its additional application. The target object to be located may not necessarily be a vehicle. It may be an equipment or machine moving around and stationary, perhaps carried by a person. To locate the equipment or machine means locating the person carrying it. Using a list to keep the identification of each equipment or machine shall help us to locate a person in the list one by one.	{ "pile_set_name": "USPTO Backgrounds" }
Passive solar glass home: watching the sun move - kirstendirksen http://faircompanies.com/videos/view/passive-solar-glass-home-watching-sun-move/ ====== jbrun If you are keen on this, see Amory Lovins talk on buildings: Short version: <http://www.youtube.com/watch?v=DvmHJNeif24> Long Version: [http://www.youtube.com/watch?v=O5txQlEI7bc&feature=chann...](http://www.youtube.com/watch?v=O5txQlEI7bc&feature=channel) ------ electromagnetic Rather impressive, but genuinely simple. He maximized sunlight in the winter while minimising it in the summer and increased the buildings connection to the earth below frost level where the ground stays a constant 14C/57F year round. ------ timmaah My dad built the house I grew up in like this in the mid 70's. Big south facing windows with large overhang. Brick wall sucks up the heat for the night. Our greenhouse had huge 20ft high cylinders filled with dyed black water. Worked great. What happened in the 80s and 90s to make this not as popular? ~~~ kirstendirksen Passive solar used to be the way everyone built... at least before way back with the Ancient Greeks and Chinese. But when we stopped relying on sun for energy, most of us stopped building this way. I would guess passive solar gained popularity in the seventies due to more attention to energy conservation (oil crisis and all) and then when oil got cheap again, it wasn't so trendy. Hope that's not that case now. Though cheap oil and global warming aside, I'd still prefer to live in a home heated by the sun and cooled by the earth. AC gives me a headache and I much prefer the feel of sun through a window than the blast of central heating. ------ kjell Earthships are worth a look for anyone who wonders why the average modern house is so wasteful.	{ "pile_set_name": "HackerNews" }
All necessary action taken, says National Payments Corpn. of India. National Payments Corporation of India (NPCI), the domestic payment gateway, has urged debit card customers whose data has been compromised, not to panic as all the necessary actions have been taken to deal with the fiasco. “Necessary corrective actions already have been taken and hence there is no reason for bank customers to panic,” said A.P Hota, MD & CEO, NPCI. The advisory issued by the NPCI to banks for re-issue of cards is more a preventive exercise, he added. According to a statement issued by the NPCI, 641 customer complaints from 19 banks have been received and the amount involved is Rs. 1.3 crore. According to RBI norms, if the customer is not responsible for a fraudulent transaction, then the bank will be liable to pay compensation. “All affected banks have been alerted by all card networks that a total card base of about 3.2 million could have been possibly compromised,” the statement said. The total debit card base of the country is 697 million. According to the NPCI, the problem was detected when some bank customers complained that their cards were used fraudulently mainly in China and U.S. while customers were in India. Suspecting that it could be a case of card data compromise, all the three payment gateways that operate in India — RuPay, Visa and MasterCard — swung into action in September. “It was established through the analysis after such frauds were reported that there was a possible compromise at one of the payment switch provider’s system. Based on the analysis, NPCI and other schemes identified the period of compromise and the possible card numbers which could have been compromised during that period,” the NPCI said. State Bank of India (SBI), the country’s largest lender which is in the process of replacing over 0.6 million debit cards, corroborated the NPCI’s views. “Card network companies NPCI, Mastercard and Visa had informed various banks in India about a potential risk to some cards in India owing to a data breach. Accordingly, State Bank of India (SBI) has taken precautionary measures and has blocked cards of certain customers identified by the networks,” the SBI said. Hitachi said it had appointed an external audit agency certified by Payment Card Industry (PCI) in the first week of September, to check the security of systems for any breach or compromise based on a few suspected transactions that were highlighted by banks for whom it manages ATM networks. Yes Bank has also appointed a Certified Information Systems Auditor (CISA) for a forensic audit of its systems and processes. “Yes Bank has proactively undertaken a comprehensive review of its ATMs, and there is no evidence of a breach or compromise on Yes Bank ATMs,” the bank said. “Yes Bank continues to work with relevant stakeholders to ensure utmost safety and security of its ATM network and payment services which are completely safe to use,” it added.	{ "pile_set_name": "OpenWebText2" }
Utah Jazz, Miller family to install new video screens to add to the fans' experience. By Bill Oram The Salt Lake Tribune Published June 18, 2013 11:29 am This is an archived article that was published on sltrib.com in 2013, and information in the article may be outdated. It is provided only for personal research purposes and may not be reprinted. The kiss cam is about to get a whole lot more intimate. The Utah Jazz on Monday unveiled plans for an upgraded audio and video system at EnergySolutions Arena, including upgraded high-definition screens above center court, LED (light-emitting diode) rings around the top of the lower bowl and auxiliary screens in the corners of the arena. The screens over center court are 10 times larger on the sides than the current scoreboard, which was installed in 2001. The cosmetic update is the most visible component of $15 million in renovations to the 22-year-old arena and, team executives said, will significantly enhance the fan experience at the multipurpose venue, which hosts 1.2 million people annually. "We know that those 1.2 million guests are going to come and have the kind of experience that can't be found anywhere else," said Jim Olson, senior vice president for sales and marketing. The Jazz partnered with Utah-based Yesco, which has built signs including the video board at the Wynn Resort in Las Vegas, as well as video screens in college arenas, including the Spectrum at Utah State University. Yesco executives Jeff and Mike Young said the project is the company's largest ever in Utah larger than the iconic rings of the 2002 Winter Olympics and will be accomplished by a team of more than 100 local workers. All of the video components are expected to be installed before the start of the NBA exhibition season in mid-October. "This is the best sign system display technology in the world," Jeff Young said, "and we are overjoyed to be partners with the Miller family to make this dream come true." Three days after promising a "major facility announcement," Steve Miller, president of Miller Sports Properties, which operates the Jazz, revealed the plans for the overhaul, but said any other upgrades to the NBA's seventh-oldest arena are five to 15 years down the road. "This is going to give us enough runway to get into the future," Miller said. "EnergySolutions Arena is going to be where the Jazz play basketball and any enhancements that we make are to that end." The upgrades announced Monday represent some of the most significant since the arena opened in 1991 as the Delta Center. In 2006, EnergySolutions bought the naming rights to the venue. The screens above center court will measure 42 feet long and 24 feet high on the sides, and 26-by-17 on the ends facing each baseline. Screens on the soon-to-be former scoreboard were 10-by-10. Jazz President Randy Rigby said the No. 1 complaint of fans had been low-quality video. "These kind of moves tell people this team is very serious ... really giving people the experience," he said. Executives spent the past year trying to strike the right balance in overhauling the off-court product, including traveling to other arenas. The Houston Rockets and the Indiana Pacers, for example, have the largest video screens in the NBA, but Rigby said it was not the Jazz's aim to simply be the biggest. "We have such a great facility here," Rigby said, "we wanted to make sure the dimensions actually complement the game and not overpower it. I think the team has done a remarkable job of doing that very thing." Rigby lauded the fiscally conservative Miller family, which owns the Jazz, for opening the checkbook for the project, a trend in the past year that has included ramping up international scouting and more recently bringing in more players for pre-draft and free agent workouts. "This is the type of announcement that we rarely make because of the investment that it takes the financial investment," Miller said. "But this is something that we're willing to do because of what it means to the fan experience and for the franchise overall." [email protected] Twitter: @tribjazz EnergySolutions Arena upgrades • The Jazz will install center-court video screens that on the sides will be 10-times larger than the 12-year old scoreboard. • In addition to video boards throughout the arena, the franchise is also upgrading the building's audio system. • The audio/video upgrades are part of a $15 million renovation package, which will include new kitchens on suite levels.	{ "pile_set_name": "Pile-CC" }
Project Tango Hands-On: Computer Vision Is So Much Cooler Than You Think Google's Project Tango tablet can see in 3D, but I didn't really understand why I, human person, would actually care about the technology beyond an abstract appreciation of the ideas behind it. Until I strapped one to my face, with an Oculus Rift-like head mask. Until I strapped the mask on, I never believed that Project Tango could be more than just a concept. At best, I thought, it would end up being a gimmick, sold to sucker consumers who didn't know how to shop. I was so wrong. Announced earlier this year, Project Tango wants "to give mobile devices a human scale understanding of space and motion." It uses a motion-sensing camera, a 3D depth camera (basically a really sophisticated Kinect), as well as a regular visual camera. All of the data is pulled in and processed in real-time by two computer vision processors. The tablet version of the hardware uses Nvidia's Tegra K. In the words of one Google employee, "it's basically the most powerful tablet in the world right now." And the tech works very well! During Lee's presentation today, he says that the team has achieved just 1 per cent drift when using the tablets to map complicated spaces by walking around in them. But it goes beyond just developer edition dreams. Project Tango's technical lead Johnny Lee announced that in addition to the dev-focused tablets, ATAP is working with LG to make a consumer version for 2015. For normals. Seriously. Why would a regular person ever want to use a Tango device, even if it can see like a human and fit in your pocket? What does that mean in practical terms? How does it transcend gimmick status? Today I got my hands on a number of the apps and tools Google's been working on to explore that very question. The one that made me giggle (joyful, not mocking) the most was an augmented reality headset built by Durious. The company already makes a Dive headset that lets you insert a phone so you can use it for VR experiences like an Oculus Rift. At Google I/O, though, Durious showed off a prototype developed especially for Project Tango, as well as a little demonstration app, that overlays an aquarium in front of your face. Fishes flying around right in front of Google's booth personnel. You can even move in and out of the water by kneeling and standing up. It takes all of the 3D gaming and immersive experience potential of the Oculus Rift but steps it up because it can see the world in front of you as well. Sure, the application is a little silly, but it shows you the potential of what's possible with Google Tango used as a head mounted display. It's also an interesting expansion on the other VR concept Google is showing off at I/O. The simple concept uses a very basic cardboard design to turn your smartphone into a VR headset — so it's basically like a Dive made out of cardboard instead of Dive. Gaming is one of the main development focuses for Project Tango team, and they have gone to lengths to build out a few different gaming experiences as well as partnering with studios like Epic Games. At I/O, Google showed off a few sample games, including a zombie killer in which you aim by moving the tablet around. Killing zombies is fun! But the most compelling experiences were some relatively empty maps you might find in a 3D shooter, which use Project Tango's 3D sensing capabilities. When you take a step forward in real life, the tablet notices you've moved and moves you inside the map you're looking at. As with the augmented reality experience above, it adds a new dimension to the the 360 VR you get from Oculus or Cardboard. cThen there are more utilitarian applications that let you map the real world in front of you. In one very simple app, you walk to the four corners of a room, and Google Tango rends a very precise SketchUp outline of the space. In another, designed by AutoCAD, you can precisely measure and model a room and its contents so that it's easier to do a little interior designing. No more going back and forth from the furniture store to measure something over and over. No more guess how much carpeting you need to buy. More than anything else, I was impressed at just how well the technology works. Some of the real-time rendering in front of you can be a little a choppy and buggy, but when it comes to the actual measurements that the technology is making, they're ultra-precise. Project Tango works, and it's got real-world potential. It just needs some regular people polish now. Over the last month or so I've spoken with several of the partner companies that actually built the technology that underlies Project Tango about what exactly Google hoped to do — and what it should do with Project Tango going forward. According to Farshid Sabet, SVP of Movidius, a company that makes one of the computer vision processors in the Tango smartphone from earlier this year, Google really wants to illustrate that the technology is more than just a professional tool or a wonky concept. And to make it more than tool for professionals, the software has to work in a dead simple way, because we're not going to put up with the hiccups the way a developer or a member of ATAP might. Today, I got my first taste of what Google's been cooking up, and I can't wait to try to whole thing. And what might be most amazing is that it won't be long before we all get to. Trending Stories Right Now A paper published Monday in a well-known science journal begins with the following sentence: “It is a truth universally acknowledged that a pair of grape hemispheres exposed to intense microwave radiation will spark, igniting a plasma.” A universally acknowledged truth indeed... but what causes this microwave marvel? Samsung came in swinging with its new S10 range yesterday. The largely-overhauled device has been given some huge upgrades - from the camera to all of the specs under the hood. But all of those shiny new features come at a price, especially in the flagship S10+. But is it actually worth it? We've compared it to one of the other most popular Android phones on the market - the Pixel 3 XL.	{ "pile_set_name": "Pile-CC" }
1. Field of the Invention The present invention relates generally to uninterruptible power supplies. More specifically, the preferred embodiments of the present invention relate to an uninterruptible power supply with controllable leakage current. 2. Background Discussion Uninterruptible power supplies (UPSs) are commonly used to provide power to critical equipment that must not experience even short duration brownouts or blackouts. For example, computer servers, computer networks, telecommunications electronics and medical devices are often powered by an uninterruptible power supply. A UPS device typically has an AC-DC-AC converter and backup battery that is activated in case the alternating current (AC) line power is temporarily disconnected or falls below a voltage threshold. FIG. 1 shows a conventional UPS circuit according to the background art. The conventional UPS circuit includes an input rectifier (having switches Q1, Q2) and an output inverter (having switches Q3, Q4) connected in series. The input rectifier converts AC input power to DC power, and the output inverter converts the DC power to AC output power. Typically, the switches Q1, Q2, Q3, Q4 will be MOSFET devices or insulated gate bipolar transistors (IGBTs), though switches Q1 Q2 can also be diodes. The switches Q1, Q2, Q3, Q4 are controlled by a gate drive circuit (not shown). Storage capacitors C1, C2 store DC power. Typically, an isolation transformer T is provided. The input rectifier switches Q1, Q2 receive AC line power and provide direct current (DC) power to the inverter switches Q3, Q4. The inverter switches Q3, Q4 are typically operated according to a pulse-width modulation (PWM) scheme. The PWM waveform is filtered by output inductor Lo and output capacitor Co to create a smooth AC output waveform. With this arrangement, the voltage and frequency of the AC output can be accurately controlled and will be independent of the AC input. Leakage current is often a problem with the conventional circuit of FIG. 1 and similar UPS circuits. Leakage current results when AC signals (egg from the PWM waveform produced by the inverter switches Q3, Q4) couple to ground, the device chassis, or nearby electronic components. A typical UPS providing a kilowatt of power may experience several hundred microamperes of leakage current. In some applications, leakage current can produce ground loop currents, noise, and disturbances in sensitive electronic circuits. Leakage current is particularly a problem in medical device electronics because medical devices are often very sensitive to noise and ground loop current. Leakage current can be dangerous in medical applications as it may cause a malfunction of critical life support or monitoring equipment. Accordingly, there is a need in the art for a UPS circuit that has reduced leakage current. It would be particularly beneficial to provide a UPS circuit that has a leakage current less than an adjustable maximum level. Also, it would be beneficial to provide a UPS circuit that allows the maximum leakage current to be controlled by a user.	{ "pile_set_name": "USPTO Backgrounds" }