Datasets:

moukaii

/

Tuberculosis_Dataset

like 16

PMC3779386_01

Male

A 44-year-old man presented to our department with a 1-month history of dyspnea and cough. There was no history of sputum, fever, loss of weight, and chest pain. He had smoked one pack cigarettes a day for 35 years. He had had mitral valve replacement 10-years ago and pericardiectomy 5-years ago. His current medications included diltiazem, warfarin, and digoxin. On physical examination, he appeared cyanotic. Blood pressure was 100/70 mmHg, heart rate was 116 beats/min, body temperature was 36.7 C. His arterial oxygen saturation on room air was 84%. Auscultation of the chest revealed inspiratory crackles bilaterally. His abdominal examination was unremarkable. There was obvious (+2) pitting edema on pretibial region. Laboratory findings revealed were normal except Na: 121 mmol/L, K: 4.8 mmol/L, aspartate aminotransferase (AST): 204 U/L, alanine aminotransferase (ALT): 203 U/L, lactate dehydrogenase (LDH): 808 U/L. The plain chest radiograph demonstrated diffuse opacities affecting both lungs. Thorax computed tomography (CT) scans revealed multiple mediastinal lymphadenopathies up to 22 mm [Figure 1]. In both upper lobes; there were diffuse, multifocal, patchy, ground-glass opacities resulting in a crazy-paving appearance [Figure 2]. There was no pathological finding of 18-fluorodeoxyglucose (18-FDG) uptake on positron emission tomography (PET) scan. There were biatrial dilatation, prosthetic mitral valve, and second-degree tricuspid insufficiency on his echocardiography. Pulmonary artery pressure was 45-50 mmHg, ejection fraction of the left ventricle was 60%, and so confirmed diastolic dysfunction. The patient underwent endobronchial ultrasound (EBUS) with bronchoalveolar lavage and lymph node transbronchial fine needle aspiration biopsies (TBNA) were performed to mediastinal lymph nodes bigger than 2 cm [Figure 3]. The lavage fluid was evaluated for routine cytology, gram stain and bacterial culture, acid fast stain and mycobacterial culture; all tests were negative. The cytology of bronchoalveolar lavage showed inflammatory features. Periodic acid Schiff (PAS) stain was performed for differential diagnosis of pulmonary alveolar proteinosis, but did not stain. The lymphadenopathy biopsies demonstrated no pathological changes. There were blood cells, bronchus epithelium cells, and lymphocytes. The patient was treated with intravenous furosemide and he improved rapidly. The largest lymphadenopathy size decreased to 9 mm and the ground-glass opacities disappeared on CT scan obtained 1 month after the diagnosis [Figure 4].

congestive heart failure, crazy-paving sign, mediastinal lymphadenopathy

PMC3961317_01

Male

The first patient was an 87-year-old male who presented with a one-week history of obstructive jaundice. Abdominal CT showed an ampullary mass surrounding the pancreatic head with a large juxtapapillary diverticulum, as well as the dilation of the extra- and intra-hepatic bile duct. ERCP revealed intradiverticular papilla, bile flow into the diverticulum from the major papilla and a nodular lesion around the diverticulum, with the formation of a shallow ulcer. Cannulation of the major papilla through ERCP failed. However, a biopsy was obtained from the nodule lesion and a well-differentiated adenocarcinoma was confirmed by pathological analysis. The patient was of advanced age and refused surgery. PTBS was performed. The patient recovered well following the procedure and was discharged from the hospital three days after surgery.

endoscopic retrograde cholangiopancreatography, intradiverticular papilla, malignant biliary stricture, percutaneous transhepatic biliary stenting

PMC3961317_02

Female

The second patient was a 68-year-old female referred to the Department of Interventional Radiology, Beijing Chaoyang Hospital (Beijing, China) by an endoscopist following failed ERCP. The patient refused surgery. Adenocarcinoma of the ampulla was confirmed by biopsy. PTBS was performed to resolve obstructive jaundice. The major papilla was located inside a large juxtapapillary diverticulum during the procedure (Figs. 1-2). The biliary stent was implanted successfully to cover the stenotic bile duct, with perfect cholangiographic results (Fig. 3). The patient experienced an uneventful post-procedural outcome. CT performed 4 days after PTBS showed the tumor surrounding the intradiverticular papilla (Fig. 4). Written informed consent was obtained prior to the interventional procedure in the two patients. PTBD was performed using right lobe punctures under fluoroscopic guidance in each patient. Access to the biliary tree was gained using standard interventional techniques and a 7F sheath was inserted to facilitate the following procedure. A 5F, 40-cm angled tip catheter (Kumpe; William Cook Europe ApS, Bjaeverskov, Denmark) was used in conjunction with a 0.035-inch hydrophilic guidewire (Radiofocus M; Terumo Corporation, Tokyo, Japan) to advance through the papillary stricture into the duodenum. The hydrophilic guidewire was exchanged for a 0.035-inch stiff guidewire (Amplatz Super Stiff; Boston Scientific, Natick, MA, USA). A 0.8x4.0-cm balloon (William Cook Eurpoe ApS) was advanced over the guidewire towards the duodenum to dilate the stricture and papilla orifice. Finally, a self-expanding metallic stent (Zilver; William Cook Eurpoe ApS) was inserted alongside the guidewire and through the papilla into the duodenum. PTBS was performed successfully without procedure-associated complications in the two patients. The patients remained well at the six-month post-procedure follow-up visit.

endoscopic retrograde cholangiopancreatography, intradiverticular papilla, malignant biliary stricture, percutaneous transhepatic biliary stenting

PMC9372495_01

Female

A 24-year-old female with Gravida 4 Para 3 pregnancy at 25 +- 2 weeks presented with a 5-day history of fever, bilateral chest pain pleuritic in nature, exertional shortness of breath, sweating, and palpitation starting 1 day after she received her second dose of the Pfizer-BioNTech COVID-19 vaccine. She had recovered from a mild COVID-19 infection (RT-PCR cycle threshold value: 25.7) requiring home isolation nine months prior to the current vaccination dose and was still on thyroxin 100 micrograms for hypothyroidism. In the emergency department, she was afebrile and hypotensive, with 80%-85% desaturating oxygen saturation (SPO2), bilateral bronchial breath sounds, and crepitations. A chest X-ray (Figure-1) revealed right lower lobe consolidation with extensive diffuse infiltrates. A computed tomography pulmonary angiogram scan (2) showed a dilated pulmonary trunk (3.35 cm), right lower lobe consolidation with an associated bilateral diffuse area of ground glass consolidation, a few enlarged mediastinal lymph nodes, and mild pleural effusion, with no major pulmonary embolism. Her white blood cell count was 22.09 x 109/L, with neutrophils 77%, lymphocytes 10%, monocytes 4%, band forms 8.0%, atypical lymphocytes 1.0%, and a C-reactive protein level of 344.66 mg/L. Her thyroid stimulating hormone, electrolytes, platelet count, coagulation profile, and liver and renal function tests were within normal limits. On day 2 of admission to the intensive care unit, the echocardiogram showed normal left ventricular systolic function, an ejection fraction >55%, and normal valves with no evidence of raised pulmonary artery pressure or left ventricular clot or pericardial effusion. The cardiology referral team recommended initiation of a therapeutic dose of enoxaparin 80 mg twice a day for myocarditis in view of nonspecific ST-T changes and a mild rise in troponin-I (4.700 ng/mL). She was electively intubated on day 2 because of persistent tachypnea and a PaO2/FiO2 ratio of <= 100 (PEEP >= 5 cmH20) on a high-flow nasal cannula and noninvasive ventilation. Antibiotics were escalated to meropenem 1 g thrice daily and vancomycin 1 g twice daily in view of worsening desaturation, a white blood cell count of 22.09 x 109/L and C-reactive protein 356 mg/L. She was also started on prednisolone 1 mg/kg/day once daily. Three serial endotracheal tube secretion cultures (days 1, 3, and 5), two serial blood cultures (days 1 and 4) and a urine culture (day 1) were sterile. RT-PCR for Mycobacterium tuberculosis, an acid-fast bacilli smear, and pneumocystis jirovecii antigen from deep tracheal aspirate were negative. Four serial samples analyzed by COVID-19 RT-PCR (days 1, 2, 3, 5, and 7) and two COVID-19 antigen tests (days 1 and 2) were negative. She was seronegative for Legionella pneumophilia, Mycoplasma Pneumoniae, Coxiella Burnettii, Chlamydia Pneumoniae, Adenovirus, respiratory syncytial virus, Influenza A, Influenza B, Parainfluenza IgG, and IgM antibodies. A throat swab culture was negative for GROUP A, C, and G Streptococcus. A high vaginal swab was negative for Trichomonas vaginalis, Gardnerella Vaginalis, Candida Spp., and Group B Streptococcus. Serological tests for cytomegalovirus, Epstein-Barr virus, hepatitis B, hepatitis C, and human immunodeficiency virus were all negative. Screening tests for anti-nuclear antibody, complement, anti-cardiolipin, anti ss2-glycoprotein, anti-phospholipid antibody, and rheumatoid factor were all negative. Consecutive procalcitonin levels sent for 10 days (days 1-10) were negative. She was extubated on day 8. The patient's relatives refused consent for lung biopsy and bronchoalveolar lavage, which may aid in the diagnosis of drug-induced interstitial lung disease/hypersensitive pneumonitis, in view of her improving parameters. Prednisolone was tapered and stopped over two weeks from the day of initiation, with no relapse. She was discharged to the ward on day 11 on oxygen-nasal cannula 3L/min and discharged from the hospital on day 14 on room air with good fetal movements. She eventually gave birth to a healthy male baby through a normal vaginal delivery at term.

ards, acute respiratory distress syndrome, covid-19, vaccine adverse event, vaccine-associated adverse event, mrna vaccine

PMC9960853_01

Male

A 53-year-old man was admitted to our hospital with 15 kg weight loss and anorexia over 6 months period. On admission, physical examination revealed clear consciousness, a temperature of 36.4 C, blood pressure of 104/66 mmHg, pulse rate of 92 beats/min, respiratory rate of 24/min, and oxygen saturation of 97% (room air). Chest auscultation revealed slight end-inspiratory fine crackles in both lungs. The heart sounds were normal. Chest radiography (CXR) revealed ground-glass opacities in both lung fields (Figure 1A). Chest computed tomography (CT) revealed diffuse ground-glass opacities with interlobular septal thickening (Figure 1D). The mediastinal lymph nodes were mildly enlarged. Mild hepatosplenomegaly and bilateral kidney enlargement were also observed (Figures 1G, 1H). Inflammatory markers were elevated as shown in Table 1. Hyponatremia and hypokalemia were also observed (Table 1). We considered sarcoidosis, lymphangitic carcinomatosis owing to gastric cancer, malignant lymphoma, lymphoproliferative disease, or anti-neutrophil cytoplasmic antibody (ANCA) - associated vasculitis as possible differential diseases. Tests performed to differentiate these diseases showed mildly elevated lactate dehydrogenase (LDH), soluble interleukin-2 receptor (sIL-2R), and angiotensin-converting enzyme (ACE) levels were observed (Table 1). During the hospital stay, an upper gastrointestinal endoscopy was performed, but no specific findings were observed. Therefore, sarcoidosis and SIADH were suspected. After admission, plasma and urine osmolalities, urine electrolytes, and hormone tests were performed (Table 1). He met the diagnostic criteria and was diagnosed with SIADH. Salt loading, fluid restriction, furosemide, and tolvaptan were administered to treat hyponatremia. Furthermore, the patient underwent bronchoscopy with bronchoalveolar lavage (BAL) in the right middle lobe and transbronchial biopsy (TBB) from the right upper lobe. The recovery rate of BAL was greater than 50%. BAL cytology showed elevated cell counts and lymphocyte count ratios with a decreased cluster of differentiation (CD) 4/CD8 ratio (Table 1). TBB showed lymphocyte infiltration, but no non-caseating epithelioid cell granulomas were seen in sarcoidosis (Figure 2). Gallium scintigraphy, ophthalmologic and cardiovascular examination revealed no findings suggestive of sarcoidosis. Bilateral kidney enlargement and electrolyte abnormalities suggested nephritis as a complication; therefore, a renal biopsy was performed. The pathological diagnosis was interstitial nephritis (Figure 3). With some improvement in symptoms and a strong desire to be discharged, the patient was temporarily discharged 14 days after admission with a directive for a thorough outpatient evaluation. However, seven days after discharge, he was readmitted to the hospital for management of decreased appetite, worsening fatigue, and worsening respiratory condition (oxygen saturation 90%, oxygen 3 L/min). The CXR and CT scans, in addition to diffuse ground-glass opacities, also showed the appearance of mass-like infiltrates with moderate pleural effusion in both lungs (Figures 1B, 1E). LDH and sIL-2R levels were mildly elevated (LDH 396 IU/L, sIL-2R 1,900 U/mL). Since LDH and sIL-2R are often elevated in patients with malignant lymphoma, considering the possibility of primary pulmonary malignant lymphoma or lymphoproliferative disease, VATS lung biopsy was performed on the seventh day of re-hospitalization. In VATS lung biopsy, the patient underwent partial resection of the right upper lobe. Subsequently, the biopsy specimen was cut into 1 cm thick slices in a plane perpendicular by the pathologist for flow cytometry, chromosome analysis, genetic testing and immunohistological examination. These examinations were performed using integrated analysis of malignant lymphoma, ML-NET (Figures 4, 5). Flow cytometry revealed that cells characterized by CD2, CD56 positivity, CD3, CD4, CD5, and CD7 were low in the small cell area. Hematoxylin-eosin staining showed an increase in medium-sized lymphocytes and slightly larger lymphocyte-like cells (Figure 6). Immunostaining showed CD3, CD56 (partial positive) (Figure 7) and CD8 (Figure 8), CD2, T-cell intracellular antigen-1 (TIA-1) (Figure 9), granzyme B (Figure 10) positive, CD20 negative, Epstein-Barr virus (EBV)-encoded RNA in situ hybridization (ISH) positive (Figure 11), poor proliferation (G-band), and no ALK mutated gene (fluorescence ISH). Furthermore, the viral load of EBV-DNA quantified by quantitative polymerase chain reaction using whole blood was 380,000 copies/mL. Resultantly, the patient was diagnosed with primary pulmonary ENKL. As our hospital did not have a hematologist, the patient was transferred to a high-volume center where a hematologist was available for chemotherapy, which was initiated on day 28 after the VATS lung biopsy. No bone marrow biopsy was performed during our hospitalization. After transfer to a high-volume center, he received chemotherapy with the SMILE regimen (dexamethasone, methotrexate, ifosfamide, l-asparaginase, and etoposide), which showed improvement in his symptoms.

case report, diffuse ground-glass opacities, flow cytometry, primary pulmonary extranodal natural killer/t-cell lymphoma nasal type, video-assisted thoracoscopic surgery

PMC9940204_01

Male

A 58-year-old Caucasian male with a medical history of hypertension, remote history of coccidioidomycosis, and tobacco use presented with acute-onset altered mental status and 70-pound unintentional weight loss over the previous 6 months. The patient was found to be in status epilepticus refractory to anti-epileptic drugs secondary to traumatic brain injury (TBI) from multiple ground-level falls, and magnetic resonance imaging (MRI) of the brain demonstrated bifrontal hemorrhagic contusions (larger on the left), scattered subarachnoid hemorrhages without demonstrable mass effect or midline shift, and few scattered tiny hypointense areas on gradient echo (Figure 1). Subsequent magnetic resonance angiography (MRA) showed no demonstrable intracranial aneurysm or occlusive vascular disease in the anterior or posterior circulations. The patient went into septic shock, presumably due to aspiration pneumonia and urinary tract infection, requiring vasopressors and intravenous antibiotics. He was intubated and transferred to the intensive care unit for acute respiratory failure, severe anion gap metabolic acidosis with pH 6.9, HCO3 8 mmol/L, and a corrected anion gap of 22 mmol/L, acute renal failure with a creatinine of 14.8 mg/dL, and hyperkalemia of 6.6 mmol/L (Table 1), and started on hemodialysis. Initial chest x-ray revealed left basilar atelectasis, left hemidiaphragm elevation, and a right upper lobe irregular calcification (Figure 2). The patient was also found to have pancytopenia and required multiple packed red blood cell and platelet transfusions. Given this along with recent weight loss, the team performed cancer workup that included a computed tomography (CT) without contrast of the abdomen and pelvis, which revealed hepatomegaly with a craniocaudal length of 21 cm, splenomegaly with a length of 18.2 cm, bilateral adrenal masses measuring 4 cm each, and enlarged pericaval lymph nodes with a length of 2.3 cm x 1.7 cm x 4 cm (Figures 3 and 4). Adrenal insufficiency was ruled out with morning cortisol of 23.1 microg/dL. A transthoracic echogram revealed no evidence of heart or valvular disease. Despite empiric antibiotics throughout the hospital course, the patient continued to maintain low-grade fevers. Initial laboratory values noted to have an elevated ferritin 1186 microg/L, and the patient remained transfusion dependent due to pancytopenias with hemoglobin 7.9 g/dL and platelets 66 x 109/L. Splenomegaly was seen on CT scan, raising the specter of possible hemophagocytic lymphohistiocytosis (HLH) in the setting of potential malignancy or possible infection. All cultures, including fungal cultures, from cerebrospinal fluid (CSF), blood, and urine had no growth. Laboratory results were negative for HIV, hepatitis B and C, syphilis, and QuantiFERON-TB Gold. Given the patient's history of coccidioidomycosis infection living in an endemic area, serology was ordered and showed immunodiffusion IgM weakly reactive and immunodiffusion IgG non-reactive, with complement fixation <1:2. A lumbar puncture was performed, which ruled out meningitis with an opening pressure of 19 cm H2O, white blood cell (WBC) count of 4 cells/microL, red blood cell (RBC) count of 55 cells/microL, glucose level of 55 mg/dL, and protein level of 66 mg/dL.

histoplasma capsulatum, bilateral adrenal masses, dissemination, fungus, hemophagocytic lymphohistiocytosis, infectious disease

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. CT images indicated bronchiectasis in both lungs, multiple calcified nodules and patchy infiltrates in the right lung before treatment (A,B,C).

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. CT images indicated bronchiectasis in both lungs, multiple calcified nodules and patchy infiltrates in the right lung before treatment (A,B,C).

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. CT images indicated bronchiectasis in both lungs, multiple calcified nodules and patchy infiltrates in the right lung before treatment (A,B,C).

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. The lung fields are slightly clearer and the right lung is less heavily infiltrated after the diagnosis and treatment for Microascus cirrosus for 2 months (D,E,F).

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. The lung fields are slightly clearer and the right lung is less heavily infiltrated after the diagnosis and treatment for Microascus cirrosus for 2 months (D,E,F).

PMC8346684_01

Female

A 72-year-old female presented with recurrent cough, yellow phlegm and intermittent hemoptysis for over 8 years. Initially, the patient began coughing frequently after a cold with purulent sputum, occasionally with blood-tinged sputum or mild hemoptysis. She was diagnosed with bronchiectasis after a chest computed tomography (CT) examination by local hospital eight years ago. Previous medical records indicated that no fungi were detected in bronchoalveolar lavage (BAL) fluid and sputum. Pulmonary symptoms were usually reduced or alleviated by empirical broad-spectrum antibiotics (levofloxacin, ceftriaxone/tazobactam, biapenem) for about one week and hemostatic therapy (Yunnan Baiyao Capsule, a traditional Chinese medicine) as needed. However, due to progressive aggravation of cough and purulent sputum, gradually appearance of breathlessness and chest tightness for the last two years, and most importantly, increased volume of hemoptysis from less than 10ml at the beginning to occasionally 30-60ml/24h, the patient admitted for further investigation in April 2019. The main symptom on admission was cough with purulent sputum accompanied by bright red blood, about 4-8 times a day and 5-10ml each time. Fever, chills, night sweat, rash or joint pain were denied. The patient reported a history of tuberculosis 10 years ago, and recovered after one year of anti-tuberculosis drug treatment. Beyond that, smoking or drinking were denied, nor did she have a history of hypertension, diabetes, cancers, chronic hepatitis, or blood disease. At the time of admission, physical examination revealed a thin woman with normal vital signs. The breath sounds of both lungs were coarse, bibasilar crackles were auscultated especially in the right lung. No rhonchi or wheezes. Blood routine suggested mild anemia (hemoglobin 9.8g/dL) with normal white blood cell count. As for inflammatory markers, the level of procalcitonin (PCT) was less than 0.05ng/mL, both erythrocytes sedimentation rate (ESR, 26 mm/h) and hypersensitive C-reactive protein (hs-CRP, 2.1mg/L) were increased slightly. No significant abnormalities were found in blood coagulation function, liver and kidney function, and anti-neutrophil cytoplasmic antibody. Chest CT indicated bronchiectasis accompanied by infection in the middle and lower lobe of the right lung, multiple patchy infiltrates of both lungs with increased mediastinal lymph nodes (Fig. 1A,B,C). Fiberoptic bronchoscopy before antibiotic administration (Fig. 2) showed a few dark red blood stains and a lot of purulent secretions in the bilateral bronchus, especially in the right middle lobe and the left superior lobar bronchus. After aspiration, the lumen was unobstructed and the mucosa was smooth. BAL fluid from the right middle bronchus was incubated on slants of Sabouraud 's dextrose agar, many white velvety and brownish-gray pigmented colonies grew after 10 days incubation (Fig. 3). Fungal PCR using 28S rDNA primers identified Microascus cirrosus. Sputum and BAL cultures grew normal flora, with no evidence of viral, mycobacterial, or additional fungal pathogens isolated; likewise, blood cultures remained negative. T-spot test and MTB/RIF GeneXpert detection assays were negative. Both galactomannan enzyme-linked immunosorbent assays and 1,3-beta-D-glucan tests were negative in serum and BAL fluid. Given these findings, the patient was diagnosed with a pulmonary fungal infection with bronchiectasis. So intravenous (oral after discharged) voriconazole 200 mg twice daily and aerosolized amphotericin B 12.5mg twice daily were initiated for empiric treatment in April 2019. The blood concentration of voriconazole when administered orally was 2.1 mug/mL (therapeutic window: 2-6 mug/mL). While on combinational antifungal treatment, the patient presented resolution of hemoptysis, as well as remission of cough, wheezing and chest tightness. Two months later, chest CT demonstrated a slight improvement (Fig. 1D,E,F). Repeat bronchoscopy on Day 77 denoted no distinct abnormality in the visible areas of bilateral bronchi, although BAL fluid grew mold identified again as M. cirrosus. No obvious side effects to liver function were observed in the first three months, but aspartate aminotransferase and gamma-glutaminase elevated 2-3 times on Day 93. The antifungal drugs were withdrawn and pulmonary symptoms did not relapse. Liver function returned basically normal three weeks later. The level of hemoglobin increased from 9.8g/dL to 10.9g/dL two months later and remained at 10.9g/dL after antifungal therapy was discontinued (on Day 102). Moreover, there was no radiologic progression during another 3 months (Fig. 1G and H,I) and one year (Fig. 1J,K,L) of follow-up.

antifungal treatment, bronchiectasis, microascus cirrosus, pulmonary infection

CT images of the patient. The lung fields are slightly clearer and the right lung is less heavily infiltrated after the diagnosis and treatment for Microascus cirrosus for 2 months (D,E,F).

PMC2730323_01

Male

A 36-year-old HIV-positive man, who had been treated at our hospital since 1995 for HIV, hepatitis C, and hemophilia, had profuse diarrhea (6-8 episodes/day), fever as high as 39.9 C, and 10 kg of body weight loss in 5 weeks. Laboratory findings included hemoglobin 9.6 g/dL, pseudocholinesterase 2,099 U/L, HIV-DNA virus count 500 copies/mL, CD4+ lymphocyte count 29 x 106/mL, and C-reactive protein 76 mg/L. Stained colon tissue samples, bone marrow punch, and liver biopsy showed abundant acid-fast bacilli. Endoscopic findings on colonoscopy were multiple polypoid lesions approximately 5 mm in size in the transverse and sigmoid colon. Microbiologic analyses included culture for mycobacteria (liquid media: BACTEC 460TB or MGIT [Becton, Dickinson and Company, Cockeysville, MD] and solid media produced in-house, all media without supplementation of mycobactin) from at least 21 specimens (blood, urine, sputum, biopsy, feces) over a 3-year period. Of these, eight specimens (blood, feces, and biopsy) were positive for mycobacteria in liquid media after 6 to 16 weeks of incubation. Subcultures remained negative on Lowenstein-Jensen slants but after approximately 4 weeks became positive on mycobactin-supplemented Middlebrook slants with colorless dysgonic colonies. Microscopic examination of these colonies showed acid-fast bacilli (Figure 1). For species identification, AccuProbe assays (Gen-Probe, San Diego, CA) for M. avium complex were performed on liquid media, all yielding strong positive results. However, repeated attempts to perform drug-susceptibility testing in the liquid BACTEC 460TB system were unsuccessful because of insufficient growth of the control. Since M. avium complex usually grows very well, the primary identification was questionable. Thus, polymerase chain reaction (PCR) for the amplification of a part of the mycobacterial gene coding for the ribosomal 16S RNA and additional sequencing was performed from two positive cultures. The resulting sequence was compared with those stored in the International Nucleotide Sequence Database, showing the signature sequence of M. avium/M. paratuberculosis, which is identical for both species and confirmed the AccuProbe results. For further differentiation between M. avium and MAP, PCR targeting the insertion sequence IS900 (primer: IS900-1: 5 TGTTCGGGGCCGTCGCTTAG; IS900-2: 5 -CGTTCCAGCGCCGAAAGTAT), which is present only in MAP strains, was done with the two most recent positive cultures. This assay showed clearly positive results from the two cultures tested and the MAP type strain, while the M. avium strains remained negative (Figure 2). Because acid-fast bacilli were identified in biopsy specimens, treatment was started with ethambutol, ciprofloxacin, clarithromycin, and rifabutin. Initially, no clinical improvement was observed, and the patient's weight loss and daily fever of 39C -40 C continued. When ciprofloxacin was replaced with levofloxacin, progression of the infection appeared to stop. However, the patient died from cardiorespiratory failure.

PMC3415051_01

Female

A 65-year old Moroccan woman was hospitalized for polyarthralgia and frontal headache. She had a past medical history of asthma for 10 years and was operated for hydatid cyst of the liver in 1998. She has no history of tuberculosis, no chronic abdominal pain. On physical examination, blood pressure was 140/70 mmHg and the heart rate 70/min. She has no fever and the peripheral pulses were all present. We noted an infiltrated purpura in the lower extremities and a wheezing in the pulmonary fields. She has areflexia and sensory involvement in the lower limbs. Hemoglobin was at 7.5 g/dl, MCV 80 fl, Reticulocyte count at 47.10X3/mm3, platelet count at 730 000/ microL (Normal 150-450 000) and white blood cell count 10000/ microL with neutrophil 4300, lymphocytes at 3600/ microL and eosinophil 1150/ microL (normal 100-500/ microL). Erythrocyt sedimentation rate was 130 mm first hour, C-reactive protein 38 mg/l (range < 6 mg/l), fibrinogen 6 g/l (2-4 g/l) and serum protein electrophoresis showed a polyclonal IgG 24 g/l (range 9-13 g/l) with normal immunofixation. There was renal failure with urea 3 mmol/l (normal 3 - 8.5), creatinemia 160 micromol/l (normal 45 -100) and creatinine clearance at 30 ml/min (Cockcroft formula). Urinalysis showed a microscopic haematuria at 20 000 cell/mm3 and proteinuria at 2.5g/24Hr. Cryoglobulinemia was negative, p-ANCA were present. Electromyography showed an axonal polyneuropathy of the 4 limbs. Skin biopsy revealed leukocytoclastic vasculitis with extra-vascular eosinophil. Thorax CT showed pulmonary infiltrates changes. Brain CT, temporal artery biopsy and ocular examination were all normal. Renal biopsy did not reveal vasculitis or inflammatory process, but an important type AA amyloid deposit. Salivary biopsy also showed AA amyloid deposit. She has no Familial Mediterranean fever, no history of tuberculosis or other chronic infections. The diagnosis of Churg Strauss associated with AA amyloidosis was established with five criteria of the American College of Rheumatology (ACR). Steroids were administered at a pulse of methyprednisolone 1g/day for 3 days followed by oral prednisone at 1 mg/kg/day for 4 weeks and progressively tapered. The patient was also treated with captopril. The clinical and biological response was obtained with disappearance of pain; eosinophil count decrease to 300/microL and negativity of proteinuria. At 26 months follow-up proteinuria remained negative.

churg-strauss syndrome, amyloidosis, purpura, vasculitis

PMC5266817_01

Male

A 72-year-old man was referred to our institution with a 4-month history of a voluminous mass in the upper portion of the nasal pyramid following a nasal trauma. He had been treated a few weeks earlier at a different ENT service for a massive spontaneous epistaxis. The patient also reported a long history of hematuria, previously attributed to renal tuberculosis occurring over 40 years before. At admission, a cranial CT scan showed a large soft tissue ethmoid mass extending to the right and left choanal region, the right orbit, the right frontal sinus, and an initial intracranial extension with partial erosion of the crista galli. MRI confirmed the evidence found at computed tomography (Figure 1). Fine needle aspiration showed typical epithelial tissue and clear-cytoplasm cells interpreted as pericytes. Preoperative local biopsy was not performed due to the history of severe epistaxis and the high risk of massive bleeding during the procedure. The patient underwent surgery with a trans-sinusal frontal approach using a bicoronal incision combined with an anterior midfacial degloving to excise the mass; however, the right orbital and especially the initial intracranial extension did not allow a complete removal of the neoplasm. Considerable bleeding occurred during surgery. The histological exam revealed a clear cell renal cell carcinoma (Figure 2). Based on these findings, the patient underwent a total body CT scan that showed a solitary 6 cm mass in the upper posterior pole of the left kidney. Bone scintigraphy also revealed increased uptake in the ethmoid and orbital region. Due to the poor general conditions, no surgery was performed to remove the primary tumor; the patient died 4 months later.

PMC6570645_01

Female

The patient is a 62-year-old postmenopausal woman diagnosed with a clinical stage 2B hormone receptor positive, HER2-negative left breast cancer. Primary tumor was 3 cm with a 2.5-cm mobile left axillary lymph node. She was otherwise healthy with no significant past medical history. Reported medications included vitamin D-3, citalopram, and zolpidem, and the patient denied use of over-the-counter medications, including herbs and supplements. On average, she reported consumption of seven glasses of wine/week. Her BMI was 30. Baseline liver function tests (LFTs) were in the normal range. Staging PET/CT showed no evidence of distant metastasis. The patient provided written informed consent prior to screening and again prior to enrollment in the I-SPY 2 TRIAL, a trial testing agents in combination chemotherapy in the neoadjuvant setting in patients with early breast cancer. The trial was approved by the UCSF Institutional Review Board, and written informed consent was obtained for publication of this case report. The goal of neoadjuvant chemotherapy in the treatment of early-stage breast cancer is to down-stage tumors, improve surgical options, and to assess response to therapy which provides valuable prognostic information. Patients in this multi-arm trial are randomized to receive standard chemotherapy or standard chemotherapy in combination with one of several experimental agents. The patient was randomized to an investigational treatment arm including weekly intravenous paclitaxel (80 mg/m2) in combination with oral pexidartinib 1200 mg daily for 12 weeks. The dose of pexidartinib was selected based on safety and efficacy data from a previously reported phase 1b trial of pexidartinib and weekly paclitaxel in patients with advanced solid tumors. Approximately 3 weeks after starting study therapy (3 doses of weekly paclitaxel and 27 oral daily doses of pexidartinib), the patient was admitted for fever up to 103 F. Initial laboratory studies were notable only for mildly elevated transaminases (ALT 65 U/L, AST 105 U/L) with normal white blood cell count, alkaline phosphatase (ALP), and total bilirubin (Tbili). The patient discontinued all study therapy immediately. Infectious workup, including blood and urine cultures, viral panel, and chest X-ray were unremarkable. The patient remained febrile to 103.5 F. LFTs continued to rise during the hospitalization, with day 3 studies showing ALT 158 U/L, AST 188 U/L, ALP 119 U/L, and Tbili 1.9 mg/dL (direct bilirubin 1.3 mg/dL). On hospital day (HD) 3, an abdominal ultrasound showed evidence of gallbladder wall thickening and trace peri-cholecystic fluid, but no evidence of cholelithiasis or biliary ductal dilatation. Abdominal/pelvis CT scan showed new diffuse heterogeneous enhancement of the liver with periportal edema and marked gallbladder wall thickening. Following the abdominal/pelvis CT scan, the patient was started on broad spectrum antibiotics for empiric treatment of acalculous cholecystitis. Hepatobiliary (HIDA) scan showed no focal perfusion defects and was consistent with cholestasis and a high functional obstruction of the common and cystic duct. Magnetic resonance cholangiopancreatography (MRCP) revealed heterogeneous enhancement of the liver without focal liver lesions. There was no intra- or extrahepatic bile duct dilatation and no contrast excretion into the biliary system. The patient underwent laparoscopic cholecystectomy on HD 6. An intraoperative cholangiogram was performed and did not show significant filling defects, extravasation, or dilatation of the visualized intra- and extrahepatic ducts. The final surgical pathology was consistent with acute cholecystitis. The LFTs continued to increase post cholecystectomy, with a rise in bilirubin out of proportion to the rise in transaminases. On HD10, ALT was 194 U/L, AST 250 U/L, ALP 377 U/L, and Tbili 10.9 mg/dL. Due to the continued steady rise in bilirubin, a diagnostic endoscopic retrograde cholangiopancreatography (ERCP) was performed on HD10, which revealed a cannulated common bile duct and normal appearing bile duct on cholangiogram. The intrahepatic biliary tree was filled and appeared normal. A liver core biopsy was performed on HD 11. The biopsy revealed mild cholestasis with small and attenuated bile ducts and focal duct loss. Representative images are shown in Fig. 1, along with a normal liver biopsy for comparison. The portal tracts contained minimal lymphocytic inflammation and no ductular reaction. The lobules showed grade 3 small droplet steatosis without ballooned hepatocytes or Mallory hyaline, and no significant hepatocyte necrosis. In particular, there was no evidence of malignancy. Trichrome stain showed no increased fibrosis. Copper stain was negative, and iron showed 1 + staining in hepatocytes. Overall the findings were of cholestasis with duct damage, and duct loss (only three of eight portal tracts containing ducts) (Fig. 1a). Based on these findings and the patient's clinical presentation, a diagnosis of acute drug-induced liver injury, suggestive of vanishing bile duct syndrome (VBDS) was made, most likely secondary to the experimental agent pexidartinib in combination with paclitaxel. The patient was started on ursodiol 1200 mg/day for progressive pruritis on HD 12. Prednisone 40 mg daily was started on HD 14, and she was discharged to home on HD 15. Following discharge, the patient was tapered off prednisone over the course of 1 month. She was started on the aromatase inhibitor, letrozole, 2 weeks after discharge from the hospital. Despite initial improvement in transaminases and ALP, her Tbili continued to rise and remained persistently elevated to a peak of 32.6, 5 months after discontinuation of pexidartinib. Six months after starting letrozole, she underwent left mastectomy and axillary lymph node dissection. Pathology revealed residual 2 -cm grade 2 invasive ductal carcinoma with a cellularity of 5%. Notably, 20 axillary nodes were negative for carcinoma demonstrating an excellent response to neoadjuvant systemic therapy. Over the following 13 months, the patient's LFTs remained abnormal with ALT/AST 150-200 U/L, ALP 350-400 U/L, and Tbili 20-25 mg/dL. During this time, her functional status deteriorated due to progressive fatigue, anorexia, pruritis, and depression. Greater than 50% of her time was spent in bed, and she lost 60 pounds. She remained on ursodiol and doxepin for pruritis, as well as monthly vitamin K injections. Due to chronicity and severity of her symptoms, the patient underwent orthotopic liver transplant 20 months after her initial diagnosis of severe DILI. The liver explant showed cirrhosis with cholestasis, loss of interlobular bile ducts, and extensive ductular reaction. Larger bile ducts appeared intact without duct damage. No significant steatosis was seen (grade 0). Overall, the findings were consistent with ductopenia, likely secondary to drug-induced vanishing bile duct syndrome (Fig. 1b, c). Following transplantation, the patient's LFTs and performance status improved precipitously. She is currently on chronic immunosuppression with everolimus and is thriving clinically 22 months post transplant. Her appetite and energy have significantly improved, pruritis has resolved, and she is at a healthy weight. She remains disease free from breast cancer on adjuvant letrozole. The trend in her LFTs pre- and post transplant are outlined in Fig. 2.

breast cancer, drug development

PMC8213113_01

Male

A 62-year-old male patient, farmer by occupation, presented to the orthopedic outpatient department with the complaint of painful gluteal mass with restricted hip movement for the past 12 years. He had undergone incision and drainage on couple of occasions at a local health-care center. On both of those occasions after a brief period of symptomatic relief, painful swelling reoccurred. On physical examination, a large cystic swelling associated with pain and reduced hip movement was observed over the left gluteal region. With the suspicion of osteoarticular tuberculosis, he had undergone antitubercular therapy without any symptomatic relief from the local hospital. Thus, osteoarticular tuberculosis was kept much lower as a differential diagnosis in this case. Plain radiograph revealed reduced joint space and cystic lesion with destruction of ischial tuberosity, acetabulum, and femoral head [Figure 1]. Other routine investigations revealed elevated erythrocyte sedimentation rate, C-reactive protein, and eosinophilia with absolute eosinophil count of 730/ml. Renal and liver function tests were found to be under normal range. Serum sample was received by the department of microbiology for hydatid serology to rule out possible parasitic infection. Hydatid serology using immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) (RIDASCREEN Echinococcus IgG, R-Biopharm AG, Germany) was performed following the manufacturer's instruction, and surprisingly, the optical density value was above the cutoff. Hydatid serology result was further correlated with computer tomography scan (CT-scan) and magnetic resonance imaging (MRI) of the pelvis. CT-scan and MRI revealed a multiloculated cyst with destruction of left ischial tuberosity, acetabulum, and femoral head. Few calcified foci were also noted supporting positive hydatid serology. Based on the above serological and radiological findings, a provisional diagnosis of primary pelvic hydatidosis was made. Surgery was planned and the patient underwent preoperative albendazole chemotherapy, followed by en bloc mass excision of the cyst without rupturing the cyst wall. The removed tissue with a cyst was sent to the department of pathology for histopathological analysis. Hematoxylin and eosin stainingrevealed a thick cyst wall with few daughter cysts, occasional calcified foci with intense inflammatory responses, and exuberant giant cell reaction against lamellated membranes [Figures 2 and 3] consistent with hydatid cyst. Postoperative period was uneventful and was subsequently discharged with advice of albendazole (10 mg/kg) chemotherapy for 3 months with a regular follow-up. During his last follow-up, the patient had no fresh complaints. He had better hip movement without pain and was walking with support.

echinococcus granulosus, gluteal mass, hydatid serology, pelvic echinococcosis

PMC3323268_01

Female

On January 2002, a 54-year-old, HIV-negative, white woman was referred to the outpatient pulmonary service because of persistent cough lasting >2 years and fatigue. She lived in an urban area, had smoked cigarettes (40 packs/year) for several years, but did not report any history of alcoholism or use of immunosuppressive drugs. Results of physical examination and routine laboratory tests, including a standard tuberculin skin test, were unremarkable. A chest x-ray showed considerable fibrotic interstitial changes associated with patchy parenchymal shadowing in both lower fields and multiple thin-walled cavitary lesions (0.7-3.5 cm) in both upper lobes. A computed tomographic (CT) scan of the chest confirmed the above lesions, including multifocal bronchiectases in the right middle lobe and multiple small nodules in the lower lobes. Smears for acid-fast bacilli (AFB) were positive on two bronchial washing samples. These specimens produced negative results when tested by a commercial strand displacement amplification assay (Becton Dickinson Biosciences, Sparks, MD) specific for MTB. Chemotherapy with isoniazid, rifampin, and ethambutol was started. Cultures produced a slow-growing, nonpigmented mycobacterium that was identified in June 2002 as M. lentiflavum, according to the HPLC pattern of mycolic acids. One more bronchial specimen collected in mid-June was AFB smear-positive and yielded the same organism as was detected in January. Isolates were considered clinically relevant, and chemotherapy was changed to ethambutol and clarithromycin. In December 2002, after 6 months of treatment, a CT scan did not show reduction of pulmonary lesions, although the general condition of the patient had slightly improved. Smears from one out of four additional bronchial washing samples were positive for AFB, and all specimens yielded the same mycobacterium previously detected. A more accurate evaluation of clinical isolates showed that their phenotypic pattern was different from that of M. lentiflavum by results of some biochemical tests and the absence of pigmentation. Further gene sequencing study of the 16S rDNA showed that our isolates exhibited 100% homology with the reference strain of M. triplex (ATCC 70071). In March 2003, although chemotherapy was well tolerated, microbiologic tests of two bronchoalveolar lavage (BAL) specimens continued to be AFB smear- and culture-positive. Consequently, chemotherapy was changed to include levofloxacin, ethambutol, and clarithromycin. In October 2003, chest x-ray examination and a CT scan showed a slight reduction in the size of lung cavities. The patient continues to receive medication, and the radiologic picture has not improved.

PMC6360013_01

Female

A 70-year-old white British women with previous unremarkable medical history presented to the emergency department (ED) with diarrhoea and vomiting for 1 week. Lives independent in a flat, walks without aids, her two daughters visit her regularly. Non-smoker and occasional alcohol consumption, (one glass of wine on the weekend). On admission to ED, observations showed blood pressure 93/45 mmHg, pulse 75, initial lactate 5 mmol/L, temperature 37.6 C. The patient was initially assessed and described daily episodes of nausea and vomiting with watery diarrhoea for the past 2 weeks that had become more frequent in the last 48 hours; she did not describe any other related symptoms and specifically no abdominal pain or urinary symptoms. The physical exam was unremarkable; she was started on intravenous fluids. Bloods on admission revealed WBC of 16,800 per microliter, sodium 132 mmol/L, potassium 2.6 mmol/L, urea level 13.9 mmol/L, creatinine 347 mmol/L, GFR calculated 11 (baseline 60), serum C reactive protein level 332 mg/L. The initial diagnosis was sepsis secondary to gastroenteritis (the department had seen several cases due to a norovirus outbreak that had closed one of the hospital wards) and prerenal acute kidney injury. 2 litres of fluid were administered and a urinary catheter inserted. The patient was initially referred to the medical unit. After a reassessment in ED, despite 2 litres of fluid there was no urine output in the catheter bag, blood pressure was 75/45 mmHg, lactate 2.5 mmol/L, the patient remained communicative without any other related symptoms. Multi-organ POCUS was performed in order to guide fluid management and rule out other sources of infection. The echocardiogram showed a normal contractile left ventricle with no obvious source of endocarditis, normal right ventricle and normal inferior vena cava (IVC). A passive leg-raising test was performed after measuring the initial Velocity Time Integral (VTI) with a second set of VTI measurements 2 minutes after the change in position showing an increment of 9%. Lung ultrasound showed scattered bibasal B lines, but no obvious consolidation. Abdominal ultrasound did not reveal dilated bowel and the aorta was normal. Hepato-biliary ultrasound showed a normal, non-distended gallbladder and normal common bile duct. However, renal and genitourinary ultrasound revealed a right kidney with moderate hydronephrosis (Figure 1) with an empty bladder (urinary catheter in place). Intravenous antibiotics were started and an abdomen and pelvis computed tomography (CT) was requested. The CT scan demonstrated a right proximal ureteric obstructive stone and moderate right-sided hydronephrosis (Figure 2). Despite being hypotensive, the patient remained with a heart rate between 65 and 75 during her admission in the resuscitation room. On further questioning, the patient mentioned that she was able to pass urine early in the morning but has not pass more urine since them. The urologist on-call was contacted and an emergency nephrostomy was immediately performed with pus aspirated. The patient was admitted to the intensive care unit and required vasopressor treatment over the next 24 hours. During admission, the bloods improved to WCC 13.2, CRP 74 and diarrhoea had settled. She remained apyrexial and was discharged home with a plan for an elective flexible ureterorenoscopy.

emergency department, hydronephrosis, point-of-case-ultrasound (pocus), sepsis, ultrasound

PMC9647331_01

Male

A 71-year-old Japanese man, with a medical history of hypertension and surgical treatment of left (age, 61 years) and right (age, 70 years) inguinal hernias, experienced swelling and pain in the region of his left inguinal incision. He visited a local hospital 6 days after symptom onset. An incarcerated hernia was suspected, and the patient was referred to a surgeon at our hospital the next day. His vital signs were unremarkable and he was afebrile. A physical examination revealed tenderness and swelling in the left inguinal region, where elastic, hard masses were palpable. Blood tests showed leukocytosis (8350/microL; normal range, 3500-8000/microL) and an elevated C-reactive protein level (10.19 mg/dL; normal, <0.16 mg/dL). Abdominal to pelvic computed tomography revealed a left inguinal hernia and confirmed 5-6 swollen left inguinal lymph nodes (Fig. 1), with maximum sizes of 1-4 cm. The soft tissue surrounding the swollen lymph nodes showed increased computed tomography density, but swollen lymph nodes were not found in other areas, including in the right inguinal region (Fig. 1). Therefore, infectious lymphadenitis of the left inguinal lymph node was suspected. The patient was referred to a plastic surgeon on the same day. Mucosal or cutaneous lesions were not found on the penis, scrotum, or the left lower limb, making metastatic carcinoma unlikely. The swollen lymph nodes were biopsied for bacteriological testing and pathological diagnosis. Upon biopsy, the swollen lymph nodes were fragile and discharged pus. Thus, the lymph nodes were partially resected. Bacterial examination of the pus failed to reveal the presence of microorganisms. The main histological finding in the resected lymph node was the presence of an abscess and suppurative lymphadenitis. The lymphoid follicles were inconspicuous, and multifocal abscesses were noted in the central portion of the lymph node (Fig. 2A, B). The lymph node capsule was inconspicuous and might have been replaced by suppurative inflammation or suppurative exudate (Fig. 2A, C). Dense fibrosis was not observed in the peripheral region of the lymph node. Many histiocytes had infiltrated the lymph node and several vague granulomas were suggested (Fig. 2D). The suppurative granulomas might have been present because of the dense histiocytic infiltrates around some abscesses. A few multinucleated histiocytes (Fig. 2B, inset) were observed in one abscess. The lymph node cortex consisted mainly of lymphocytes and plasma cells associated with proliferating vessels, suggestive of marked interfollicular hyperplasia (Fig. 2E). Plasma cells were located around the vessels (Fig. 2E), but did not show a sheet-like arrangement. Neutrophils were present in many vessels, suggesting endoarteritis (Fig. 2F) and phlebitis. Suppurative (granulomatous) lymphadenitis was observed in the lymph node. Bacterial, fungal, and mycobacterial infections were considered, with syphilitic infection and cat scratch disease included in the differential diagnoses. Gram, periodic acid-Schiff, and Ziehl-Neelsen stains failed to confirm the presence of microorganisms; however, some spiral microorganisms were suggested by Warthin-Starry staining. Immunohistochemically, numerous spiral microorganisms, positive for anti-Treponema pallidum polyclonal antibodies (1:800; Abcam, Cambridge, UK), were confirmed. The microorganisms were mainly present around or in the walls of the proliferating vessels (Fig. 3A-C) and were scattered throughout the suppurative areas. Negative results were found in the sections stained with anti-bacille Calmette-Guerin polyclonal antibodies (1:1000; DAKO, Glostrup, Denmark), anti-mycobacterial tuberculosis polyclonal antibodies (1:800; Abcam), and antibodies reactive to Bartonella henselae proteins (1:50; lone H2A10, Biocare Medical, Pacheco, CA). Therefore, syphilitic lymphadenitis was strongly suggested. After the pathological diagnosis, the patient met with a dermatologist, approximately 2 weeks after symptom onset. The medical interview revealed that the patient had engaged in sexual intercourse with a woman at a brothel approximately 2 weeks before symptom onset. His physical examination had not shown any skin lesions, and he had not noticed cutaneous itching or lesions following the presumed day of infection. Serological tests for rapid plasma regain (RPR, 75 RU; normal, 0-0.9 RU) and the T pallidum hemagglutination assay (32; normal, <1.0) were both positive; anti-human immunodeficiency virus antibodies were not detected. Therefore, the patient was diagnosed with primary syphilis. The patient was treated with oral amoxicillin (1.5 g/d) for 4 weeks, resulting in his RPR titer decreasing to 34 RU. An additional 2 weeks of antibiotic therapy resulted in successful treatment, as indicated by a further 4-fold reduction in RPR titer (to 6.9 RU). During this time, the left inguinal lymph nodes became non-palpable. The patient provided written consent for the publication of this report.

differential diagnosis, inguinal hernia, lymphadenitis, lymphadenopathy, pathology, syphilis

PMC9838225_01

Female

We describe the case of a 49-year-old female with a history of pericardial calcification, coronary artery disease, and multiple and chronic obstructive pulmonary disease who presented with a several-day history of worsening shortness of breath. On exam, she was noted to have Kussmaul's sign:impaired jugular vein distension:up to mid-neck, wheezing, and abdominal distention. On the echocardiogram, she was found to have ventricular interdependence, significant respirophasic variation on the mitral valve, diastolic hepatic vein reversal, and a dilated noncollapsible inferior vena cava (Figure 1). She underwent a coronary angiogram, which showed nonobstructive coronary artery disease but severe pericardial calcifications (Figure 2). A right heart catheterization was not performed due to the echocardiographic findings that were highly suggestive of CP physiology. On CT of the chest, she was found to have severe pericardial calcifications (Figures 3, 4). On cardiac MRI, she was found to have abnormal septal motion of the sigmoidization, septal bounce, and flattening during early diastole. Autoimmune workup (including an antinuclear antibody panel and rheumatoid factor) were negative along with erythrocyte sedimentation rate and C-reactive protein biomarkers. She tested negative for tuberculosis, had no cardiac surgery history, and no history of radiation. She did report a significant history of chest trauma with multiple motor vehicle accidents (with the first being in 2000 and the latest in 2016) and blunt force trauma due to altercations. She had been trialed on nonsteroidal anti-inflammatory drugs (5-day therapy of ketorolac), as well as steroids (5-day therapy of prednisone 40 mg daily), with no relief. She successfully underwent pericardiectomy with resolution of her symptoms. Pericardial biopsy showed fibroconnective tissue with extensive calcifications.

calcified pericardium, constrictive pericarditis, impaired cardiac output

PMC8531091_01

Female

A 63-year-old female with an anterior neck mass and mild hoarseness sought treatment at our clinic. The patient's condition was stable until mild hoarseness developed for no apparent reason 6 months prior to presentation at our clinic. However, the patient was not concerned by this symptom. Subsequently, the patient found a painless mass on her anterior neck. There were no other clinical symptoms, such as dyspnoea, neck pain, nervousness or rapid heartbeat. Six years prior, the patient underwent a proximal subtotal gastrectomy and lymph node dissection for Siewert III oesophagogastric junction cancer. The histologic type was moderately differentiated adenocarcinoma with ulceration. The cancer had grown into the serosa of the stomach (T3). Cancer cells were found in 8 nearby lymph nodes (N3), but no distant metastasis was observed. Therefore, the patient's disease was classified as T3N3M0, stage IIIb. Eight cycles of chemotherapy (5-FU and cisplatin) every 3 weeks were administered after surgery. The patient's condition remained stable each year during the follow-up period. No other personal or family history of disease was reported. Physical examination at admission revealed a solitary painless thyroid nodule, 2 cm by 3 cm, in the right lobe of the thyroid gland that moved up and down with swallowing. Tests revealed that the full blood count, liver function, renal function, thyroid function, and level of serum tumor markers, such as carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9), carbohydrate antigen 125 (CA125) and alpha-fetoprotein (AFP) were within normal ranges. Ultrasonography revealed a non-homogenous hypoechoic solid mass, 49 mm x 34 cm in size, with blurred boundaries and a rich blood flow signal, in the right lobe of the thyroid gland (Figure 1A). Several enlarged lymph nodes were found in the right neck (Figure 1B). Computed tomography (CT) revealed that the tumor occupied almost the entire right lobe of the thyroid gland, with heterogeneous enhancement on the arterial phase (Figure 2). Direct laryngoscopy showed that the appearance and movement of the left vocal cord appeared normal, while the right vocal cord had some dyskinesia. Given these results, a malignant tumor of the thyroid was suspected. Fine needle aspiration was suggested, but the patient refused this procedure and insisted on thyroid surgery. The patient underwent a right thyroidectomy, and the tumor was found to have invaded the right recurrent laryngeal nerve and trachea. Intraoperative frozen section analysis showed that the thyroid follicles had been diffusely infiltrated by poorly differentiated tumor cells with morphology resembling gastrointestinal lesions. The blood vessels and lymphatic vessels were filled with tumor cells. The following immunohistochemistry staining results were obtained (Figure 3): AE1/AE3 (+), CEA (+), CDX-2 (+), cytokeratin 7 (-), Ki-67 90% (+), calcitonin (-), thyroid transcription factor-1 (-), thyroglobulin (-), synaptophysin (-), chromogranin A (-), and neuron-specific enolase (-). The characteristics of these tumors more closely resembled those of metastatic gastric adenocarcinoma than primary thyroid malignancies. Based on the patient's history of gastric cancer, the histopathological evaluation and immunohistochemistry staining results, the patient was diagnosed with gastric cancer metastasis to the thyroid. There were no complications with the surgery. However, the patient refused further treatment and died from general deterioration within 6 months.

case report, diagnosis, gastric cancer, metastasis, prognosis, thyroid

PMC8258705_01

Male

A 21-year-old male (168 cm, 47.8 kg) with spinal muscular atrophy type III when diagnosed at 18-years old by genetic screening participated in this study. Written informed consent was obtained from the patient to perform the two types of gait training and to publish the obtained his anonymized data to be published in this article. All procedures were performed in accordance with the Declaration of Helsinki and were approved by the Hiroshima University's Committee on Ethics in Research (approval Number No. E-53). He presented with forearm distal muscle weakness, atrophy of the intrinsic muscles of the hand, and neuromuscular fatigue. The patient's baseline physical performance data are shown in Table 1. The age-matched normative values for knee extension strength and six minutes walking test (6MWT) are 2.82+-0.38 Nm/kg and 637 m. , The participants' knee extension strength (Right: 1.59 Nm/kg, Left; 1.32 Nm/kg) and 6MWT (567 m) were lower than the above value, and we have chosen the weaker leg to measure EMS recording. The participant performed maximal isometric voluntary contractions (MVC) of the knee extensors bilaterally at the pre- and post-intervention. Isometric knee extension was performed using a Biodex system (Biodex System 4; Biodex Medical Systems, Shirley, NY, USA). During contractions, both the hip and knee extension angles were positioned at 90 degrees. The MVC involved a gradual increase in knee extension torque from 0 Nm to his maximum torque over three seconds, with the maximum torque being held for two seconds. The participant performed at least two MVC trials with > 120 s of rest between trials and a warm-up for 10 min, including indoor walking and lower limb stretching before the MVC measurement. The peak MVC torque was used as the maximal effort and to calculate the target torque for the isometric sub-maximal ramp-up contractions. After MVC measurements, the participant performed an isometric submaximal ramp-up contraction of the knee extensors in the weaker leg one time from 0% to 80% of the MVC force with an increase rate of approximately 10% of the MVC per sec. , The participant-generated torque and target torque were displayed on a computer monitor. Prior to motor testing, the participant practiced the MVC and sub-maximal ramp-up contraction at least 10 min before the motor testing session began. The CoV of force (standard deviation (SD)/mean x 100, CV force) was calculated from the ramp up contraction task. During the sub-maximal contraction, multi-channel SEMG signals were detected from the weaker side of vastus lateralis (VL) muscle using a semi-disposable grid of 64 electrodes (ELSCH064NM2; OTBioelettronica, Torino, Italy) according to the same procedures used in previous studies. , , , The grid consisted of 13 columns and five rows of electrodes (diameter, 1mm; inter-electrode distance, 8mm in each direction), with one missing electrode in the upper left corner. The participant's thigh hair was removed, and the skin was cleaned with alcohol. The electrode was attached to the skin with a bi-adhesive sheet (KITAD064NM2; OTBioelettronica) after a conductive paste (Elefix Z-181BE; NIHON KOHDEN, Tokyo, Japan) was applied. The center of the electrode grid was positioned at the center of the line between the superior lateral edge of the patella and the greater trochanter protuberance. The columns of the electrode grid were placed parallel to the longitudinal axis of the VL muscle. A reference electrode was attached at the anterior superior iliac spine. , , , All procedures were performed by the same investigator. Monopolar multi-channel surface EMG signals (64 channels) were amplified by a factor of 1000, sampled at 2048 Hz, and digitized by a 12-bit analog-to-digital converter (EMG-USB2+, OTBioelettronica). The recorded monopolar signals were off-line bandpass filtered (10-500 Hz) and transferred to analysis software (MTALAB 2019a, MathWorks GK, MA, USA). Bipolar multi-channel SEMG signals (n = 59) along the columns were obtained from the 64 electrodes. The EMG signals were divided in epochs of one second centered at each 10% of MVC force increment from 10% to 80% of the MVC ramp-contraction to calculate the root mean square (RMS). Since the selected ramp rate was 10% of the MVC force per second, one epoch of the sampled signal was overlapped by 0.5 seconds between neighboring torque levels. We normalized the RMS estimates to the values obtained pre-intervention for each torque level. To characterize the heterogeneity in the multi-channel SEMG spatial distribution pattern at each epoch, we determined the modified entropy and correlation coefficients. The modified entropy of the spatial distribution of the DeltaSEMG amplitude was calculated over a 1-s epoch taken at 10% to 80% of the MVC during the ramp-up contraction. According to methods published by Farina et al., modified entropy was defined as the entropy of the signal power as follows: where p( i) is the square of the RMS value of channel i divided by the sum of the squares of all 59 RMS values at the given contraction level. Therefore, p( i) 2 represents the normalized power of each channel. Modified entropy is the normalized power of the EMG signal across the array and reflects the heterogeneity in the muscle activity. The CoV of the RMS was defined as the quotient of the SD of the Delta59 RMS measurements and the average of Delta59 RMS measurements at each given torque level. Both a decrease in modified entropy and an increase in CoV of RMS indicate increased heterogeneity in the multi-channel SEMG spatial distribution pattern within the electrode grid. , Measures of the CoV of the RMS and modified entropy provide insight into how the nervous system regulates muscle activation across the muscle irrespective of the magnitude. The patient performed two types of gait training separated by a period of one month between training to avoid training effect. HAL gait training The patient performed gait training using the HAL for 33 minutes (gait distance about 2200 m). The double leg type HAL was used for gait training, which was performed with two physical therapists for the operation of the HAL commands and support of the patient. During HAL gait training, a walking hoist (ALL IN ONE walking hoist, ROPOX, Denmark) was used to prevent falls and adjust the patient's posture. Treadmill gait training The patient performed gait training using the treadmill for 33 minutes (gait speed 4.0 km/h, gait distance about 2200 m). During gait training, Alter-G (Alter-G, Inc., Fremont, CA, USA) was used to prevent falls and adjust the patient's posture without providing weight bearing and clinician's support to leg movements.

electromyography, gait training, hybrid assistive limb, rehabilitation, spinal muscular atrophy type iii

PMC8474098_01

Female

The World Health Organisation. At the WHO's first international press conference on the new, as-yet unnamed coronavirus on 11 th February 2020 (source A2, Table 1), its Director-General began by emphasising the importance of handwashing and using paper tissues to catch sneezes. Whilst he went on to state (page 10) that "corona[virus 19] is airborne", he shortly afterwards corrected himself: "Okay. Sorry, I used the military word, airborne. It meant to spread via droplets or respiratory transmission. Please take it that way; not the military language. Thank you." (source A2, Table 1, page 12) As its current guidance on the topic (source A1, Table 1 ) states, the term 'military' reflects the WHO's advisory role on biological weapons, in which unknown respiratory pathogens are routinely classified as airborne threats:hence, potentially extremely perilous:until firm evidence allows them to be reclassified. The corrected message that SARS-CoV-2 was "not airborne" had limited impact initially - public health officials inspecting outbreaks in newly-affected countries donned scarce hazmat suits, for example. In the face of what appeared to be excessive caution by these countries, and in the context of a global shortage of PPE , the WHO found it necessary to underline its message with a 'fact check' Tweet (source A5, Table 1) on the 28 th March 2020 stating "COVID-19 is NOT airborne" to counter what it called 'fake news' about potential airborne spread and re-emphasise contact and droplet modes of transmission. This uncompromising message from the WHO in March 2020 may partly explain why politicians and policymakers in the West rapidly aligned with a droplet theory of transmission and ignored, downplayed, or rejected the work of scientists proposing an airborne route. Scientific briefings produced by the WHO (e.g., source A11, Table 1) and national policy bodies (see next sections) reveal longstanding errors in the science of bioaerosols which have been perpetrated in derivative publications over the years. In particular, three flawed assumptions, whose origins can be traced to the limitations of scientific equipment in the late 19 th and early 20 th centuries , distorted the thinking of policymakers and the non-expert scientists who were advising them: that there is a clear dichotomy between droplets (above five microns) and aerosols (below five microns); that the former explain transmission of respiratory diseases within two metres whereas the latter account only for transmission beyond that distance; and that transmission dynamics of bioaerosols in coughs, sneezes and exhaled air are linear and predictable , . These three oversimplifications may have been unconsciously seized upon by policymakers through a process of satisficing - that is, in the face of urgency, threat, and uncertainty, ensuring that their decisions made sense and were accountable within a selected range of parameters . Droplet theory, especially when anything below five microns was incorrectly defined as a droplet (in reality, particles of up to 100 microns can be carried long distances in the air), made possible the individualist "how to protect yourself..." message (source A4, Table 1) based on personal cleanliness and a simple physical distancing rule. If these were the key measures needed, the WHO would not have to concern itself with such matters as the chemistry of air composition, the physics of air flow, or the architecture of the built environment; it reduced the risk of mass panic at the idea of uncontrolled spread of a new and poorly-understood disease through the very air we breathe; and it made the worldwide shortage of PPE less urgent. The WHO's position on prevention of COVID-19 up to early 2021 was based largely on advice from its Infection Prevention and Control Research and Development Expert Group for COVID-19 (IPCRDEG-C19). Most members of that committee are hospital clinicians with specialist training in infectious diseases; they were also strong adherents to the tenets of evidence-based medicine, which is based on empiricist assumptions and reluctant to consider types of evidence beyond randomised controlled trials, as its briefing document on guideline development attests (source A20, Table 1). As public health professor Raina MacIntyre described in a blog (source A15, Table 1), these committee members are experts in topics such as wound management:for which droplet spread is predominant and handwashing is an effective intervention. A leading member of the IPCRDEG's Secretariat recently led an international handwashing campaign "to consistently improve hand hygiene practices as a whole-of-society approach to stop the spread of SARS-CoV-2" (source A18, Table 1 ). On 6 th July 2020, 238 aerosol scientists from around the world published an open letter addressed to international policymaking bodies:among which the WHO was implicitly highlighted:summarising studies undertaken by its signatories which had demonstrated "beyond any reasonable doubt" that the SARS-CoV-2 virus is released in particles small enough to be carried long distances in the air when people talk, cough, and even just exhale (source A8, Table 1 ). Three days later, following press coverage of the letter:some somewhat negative (source A9, Table 1 ) and some more positive (source A10, Table 1 ):the WHO published a new Scientific Brief on Transmission of SARS-CoV-2 (source A11, Table 1 ). This document, which remains current at the time of writing, acknowledged the existence of various aerosol studies but considered those studies flawed in various ways and concluded that "transmission of SARS-CoV-2 by this type of aerosol route [i.e. coughing, speaking, singing, breathing] has not been demonstrated" . A few weeks later, members of the IPCRDEG-C19 committee published an article (source A12, Table 1 ) with its Chair as lead author, declaring that "Multiple clinical and epidemiologic reports have now lent considerable support that the predominant route of human-to-human transmission of the SARS-CoV-2 is through respiratory droplets and/or contact routes and do not support significant airborne transmission" (7, page 2). The academic sources cited in that paper to substantiate the droplet theory were remarkably sparse: they consisted of a report of person-to-person transmission within a single family , a single hospital case in which air samples had been negative for the virus , and a single air flight in which nobody got infected . A letter to the editor (source A14, Table 1 ) argued that the paper was highly selective in its citation of evidence (e.g., it omitted several studies which had found viable virus in the air) and included some fundamental errors of reasoning (e.g., conflating what the authors took to be lack of evidence in favour of aerosol spread with evidence refuting such spread) . Some WHO documents contain a key logical fallacy that dominance of close-contact transmission excludes a major role for aerosols. For example, in its July scientific brief (source A11, Table 1), the WHO states: "Current evidence suggests that transmission of SARS-CoV-2 occurs primarily between people through direct, indirect, or close contact with infected people through infected secretions such as saliva and respiratory secretions, or through their respiratory droplets" . This flawed logic was widely reproduced in national-level scientific briefings. For example, the US Centers for Disease Control and Prevention's scientific brief from October 2020 states: "The epidemiology of SARS-CoV-2 indicates that most infections are spread through close contact, not airborne transmission" . As noted above, aerosol transmission occurs predominantly at close contact , so dominance of close-contact transmission cannot be taken as evidence that droplet mode dominates. Whilst the WHO has shifted its position substantially since the beginning of 2021 (for example, recommending ventilation of indoor spaces alongside handwashing and physical distancing from March 2021 - source A17, Table 1 ), its guidance at the time of writing remains primarily focused on measures to reduce close-range droplet transmission except in the specific circumstances of AGMPs, as its living guideline (source A16, Table 1 ) points out. A living systematic review of the role of airborne transmission commissioned by the WHO and including the Chair of the IPCRDEG-C19 as a co-author was published as a preprint on 24 th March 2021 (source A19, Table 1 ). It considered that no firm conclusions could be drawn about airborne transmission and observed that "Among case clusters for which airborne transmission is hypothesised, published detailed investigations cannot rule out that droplet and fomite transmission could also explain human-to-human transmission." (6, page 4). Notably, neither the living guideline nor the living systematic review included any aerosol scientists as co-authors. The members of the WHO's IPCRDEG had impressive credentials in the fields of both medical science and national policymaking. Its Chair, for example, is a Professor of Medicine and past President of the Canadian Infectious Disease Society, past Board Chairman of the Canadian Committee on Antibiotic Resistance, and a recipient of a Distinguished Service Medal from the Alberta Medical Association and the Order of Canada for Services to Medicine (source A21, Table 1). A Bourdieusian analytic lens would observe that the higher an individual's endowment of capitals, the stronger the stakes in a game they would have. In such a high-stakes game, highly endowed become the custodians of power, privilege, and boundary conditions of the game. Given their position of seniority and legitimacy within the field and the associated capitals, it would be difficult for them to challenge the rules of the game (the illusio) from within and to accept knowledge from the margins. United Kingdom. Our UK example centres around an open letter sent to the UK Prime Minister on 19 th February 2021, led by the Royal College of Nursing and signed by 18 other healthcare workers' organisations including paramedics, podiatrists, nutritionists, speech and language therapists, and porters (source B3, Table 1 ). The authors asked for better ventilation and higher-grade PPE across a wide range of healthcare settings and extending beyond AGMPs. The open letter challenged the UK's current COVID-19 Infection Prevention and Control (IPC) Guidance (source B1, Table 1 ), updated in January 2021, which restricted higher-grade PPE to staff:mostly senior doctors:performing AGMPs. It also criticised a state-commissioned 'rapid review' document published by the Antimicrobial Resistance and Healthcare Associated Infection (ARHAI) (source B2, Table 1 ), on which the IPC guidance was based. The ARHAI review was labelled 'Version 11.0'; it concluded (as the previous 10 versions had done) that the predominant mode of transmission was large droplets at short range and that there was " no clear evidence" (page 9) for airborne spread outside AGMPs; a version 12 published a few weeks later contains the same claims. An independent evidence assessment commissioned by the Royal College of Nursing (source B4, Table 1 ) described the ARHAI rapid review as flawed and outdated. Front-line nurses gave media interviews describing their concerns about working with minimal protection when patients were unwell and coughing, backed up by aerosol scientists who agreed that coughing would generate virus-laden aerosols for which standard masks were inadequate protection. In one such interview, the presenter reminded the audience that Health Protection Scotland's latest advice is that there is no evidence to support a change in recommendations and that the Health Secretary had said they would be ''guided by the experts' (a reference to infectious diseases doctors). She is quoted: We take that really seriously and have adapted the PPE that we provide. But we also have a situation where individual members of staff in NHS or in care are able to exercise their own professional judgement about the circumstance that they face and whether or not they believe that they need additional PPE to that that is currently clinically recommended (Scottish Health Secretary, quoted on Good Morning Scotland, 2 nd March 2021 - source B5, Table 1) We consider this deflection to 'own professional judgement' further in our analysis section. Also noteworthy in this case is the publication on 5 th March 2021 of new Public Health England guidance on ventilation of indoor spaces (source B6, Table 1 ). In an exact mirror of the WHO:and citing the WHO's new roadmap on ventilation, published a few days earlier (source A17, Table 1 ):this new policy document appeared to base its recommendations on an assumed airborne route of transmission but was not accompanied by substantial changes to its other policy documents. A key player in this case study is the instigator and lead author of the letter to the Prime Minister, the Professional Lead of the Infection Prevention and Control Network at the Royal College of Nursing (RCN) (source A22, Table 1). She is a registered nurse, with many years' clinical experience along with a two-year secondment managing professional standards at the RCN. The Professional Lead role requires her to engage with front-line nurses and ensure the highest standards of infection control in their clinical work. She is the person within the nurses' professional body to whom registered nurses would direct their concerns about unsafe practices. As the letter she drafted (source B3, Table 1 ) illustrates, she appears to feel a strong sense of moral responsibility to prevent further deaths of frontline healthcare workers. Canada. In this case study, we focus on guidance relating to schools in one Canadian province, British Columbia, and a legal challenge by healthcare workers in another province, Quebec. From the very beginning of the pandemic, British Columbia based its prevention measures on an explicit contact, droplet, and fomite theory of transmission. A tweet posted by from British Columbia's Centre for Disease Control (source C1, Table 1) on 11 th February 2020, for example, linked to a video by a physician epidemiologist and stated: "The new #coronavirus is spread by droplets that come from the mouth or nose. The droplets don't stay floating in the air. This is not an airborne virus." Many interventions, such as the state-wide policy of closing children's playgrounds and disabling traffic light push buttons, revealed a prevailing fear of droplet and fomite transmission. But as evidence on airborne transmission accumulated during the late spring and summer of 2020, pressure from workers' unions, supported by aerosol scientist researchers, mounted for the province to adopt measures to reduce airborne spread. However, the province authorities long resisted the idea of airborne transmission. British Columbia's Provincial Health Officer described the open letter from 238 international aerosol scientists as " a little bit of a tempest in a teapot [...]" and reiterated her confidence in the existing advice focused on large droplets and surface transmission (source C3, Table 1 ). It was not until early January 2021 that the British Columbia Center for Disease Control (BCCDC) edited its guidelines to include the risk posed by "smaller droplets" (which may be a euphemism for aerosols): " Smaller droplets come out of the mouth and nose at the same time as larger droplets. These smaller droplets are light, and they can float in the air for a longer time. Because of this, smaller droplets may collect in enclosed spaces unless they are diluted with clean air from the outdoors or from a ventilation system. If many people are sharing a space without enough clean air, it can lead to COVID-19 infections." (source C6, Table 1 ) Despite stopping short of the use of words such as 'aerosols' or 'airborne', the new guideline was welcomed by front-line workers. But it still provided ambiguous messages on masks and omitted any directives to improve ventilation in schools. Extraordinarily, school officials in one locality ordered classroom windows to be screwed shut after teachers had opened them to increase ventilation (source C11, Table 1 ). The Provincial Health Officer for British Columbia is a highly-respected medical doctor. She had initial specialist training in infectious diseases and a distinguished career in military medicine, as well as working for the WHO internationally, and subsequently trained in public health. She was the public health lead in Toronto for the 2003 SARS outbreak, and in 2018 was the first woman to be named as chief medical officer for British Columbia. Her regional role during the Covid-19 pandemic, including regular media briefings to explain aspects of the science to the public, made her a household name in the state and conferred legitimacy and authority on her statements (source C12, Table 1). She appears at least partly driven by the urge to quell panic and maintain calm:which may explain her 'storm in a teacup' comment and, more generally, her reluctance to embrace theories about the dominance of aerosol transmission. In Quebec, a dispute about airborne transmission of the virus ended up in the courts. In April 2020, during the first wave of the pandemic, Quebec's Nurses Union (FIQ) asked the province's National Institute of Public Health (INSPQ) that they mandate the use of N95 masks (a kind of respirator providing high-grade protection against aerosols) in long term care facilities where most of the COVID-19 cases were occurring (source C13, Table 1). However, INPSQ's advice was based on a theory of large droplet and fomite transmission (source C16, Table 1) and this view shaped the institutional response. It was illustrated, for example, by a report from around the same time in which one regional hospital network publicly blamed employees' sloppy handwashing to explain a COVID-19 outbreak (source C14, Table 1). The first wave of the Covid19 pandemic took a very hard toll on Quebec's long-term care residents and workers. Between March 2020 and February 2021, 13% of the 40,000 people institutionalized in a long-term care institution in Quebec died from Covid-19 (source C22, Table 1). In some institutions, virtually all residents became infected and so few workers remained that at one point the Canadian military was called in to take over (source C15, Table 1). Notably, the army provided N95 masks for all their troops undertaking this work (source C15, Table 1). Nevertheless, aligning with the orthodox view, Quebec's Director of Public Health published an ordonnance on 8 th June 2020 forbidding the use of N95 masks for health professionals save for a few designated procedures (source C17, Table 1). On 10 th July 2020, after losing hope of finding a negotiated settlement on their request for N95 masks, the FIQ brought the matter to a labour tribunal (source C18, Table 1). The Nurses Union claimed there was no shortage of N95 masks and that denying nurses this higher-grade protection was going to cost lives (source C19, Table 1). The availability of sufficient N95 masks was later confirmed by the minister of health (source C20, Table 1). By that time, more than 17,000 health care workers had been infected (source C20, Table 1). The legal action ended with a scathing legal ruling in March 2021. The employer had argued, through an expert witness from the Public Health Institute of Quebec (INSPQ), that there was no evidence of significant airborne transmission of SARS-CoV-2 and that standard medical masks were adequate protection. In upholding the nurses' case, the judge decried INSPQ's expert for using 'false arguments' and 'fallacies ', and another expert for being unaware of key scientific developments in his field when testifying . The ruling also noted that, "despite [an] emerging scientific consensus, the INSPQ maintains, in court, the position that there is no air transmission" (source C22, Table 1 paragraph 143). Interestingly, shortly afterward, a group of 109 health professionals, most of them doctors and nurses from infectious diseases backgrounds, wrote a public letter contesting the scientific soundness of the ruling (source C23, Table 1). The letter states, for example: "Given the lack of scientific evidence regarding the benefits of wearing a respirator over a procedural mask when in contact with 'medium-risk' patients, we suspect that your recommendations are likely heavily influenced by the 'precautionary principle'. However, the precautionary principle must be based on science and not obscure it. In addition, this precautionary principle could prove to be deleterious for all workers in Quebec if the risks associated with your recommendations are greater than the expected benefits. We therefore ask that the CNESST [Commission des Normes, de l'Equite, de la Sante et de la Securite du Travail (French: Committee on Standards, Equity, Health and Safety at Work; Canada)] carry out as soon as possible and publish a risk-benefit analysis of its recommendations. This analysis should include a forecast of the expected benefits including a quantification of the cases of infection prevented through these recommendations, as well as the number of RPAs that should be used to prevent infection in a worker (known as "Number needed to treat"). In addition, this analysis must include an estimate of the occupational injuries that will occur as a result of these recommendations. Prolonged wearing of the respirator is indeed associated with risks for workers (skin lesions, headaches, fatigue and increased risk of becoming infected, etc.)." (source C23, Table 1) The phrasing of the letter strongly emphasises the potential harms of the N95 mask (including, allegedly, a worker becoming so fatigued that they become inadvertently infected) rather than its potential benefits (preventing infection and death). The extract also illustrates the authors' appeal to the tools of evidence-based medicine (such as the Number Needed to Treat metric ) and their irritation in the face of what they appear to perceive as a challenge to their legitimate scientific authority in the sub-field of infectious diseases. Japan. In Japan, cases and deaths from Covid-19 were very low compared to the West but high compared to neighbouring countries like Taiwan . The first documented case of Covid-19 in Japan was on 15 th January 2020. By mid-February, there was an active national containment strategy in place which included assiduous contact-tracing with the goal of identifying, investigating, and quashing new clusters promptly . Contact-tracing was both prospective (to identify onward transmission) and - unusually - retrospective (to identify which past activities may have led to the person becoming infected). Japan's approach also included lengthy quarantine periods (30 days), strict border controls, voluntary restriction of activities (for example, reducing travel and eating out, and working from home if possible), masking in the workplace, and economic support for businesses. In contrast with the confident announcements from WHO and Western governments that the virus was not airborne, the Japanese government did not make any firm statements about the mode of transmission in these early documents. Notably, however, on 9 th March 2020, the Government of Japan (source D1, Table 1 ), with the personal backing of the Prime Minister, reported a careful analysis of several clusters across the country made possible through meticulous analysis of retrospective contact-tracing data. It introduced the '3Cs' message (avoid closed spaces, crowded places, and close proximity), explicitly invoking the precautionary principle on the grounds that the virus could be airborne: 6. What we ask of you The locations where mass infections were confirmed so far are places where the following three conditions were met simultaneously: (1) closed space with poor ventilation, (2) crowded with many people and (3) conversations and vocalization in close proximity (within arm's reach of one another). It is believed that more people were infected in such places. Therefore, we ask that you predict locations and settings where these three conditions could occur simultaneously and avoid them. We do not have enough scientific evidence yet on how significantly such actions can reduce the risk of spreading infection. However, since places with poor ventilation and crowded places are increasing infections, we ask that you take precautions even before scientific evidence for clear standards is found." (source D1, Table 1 , page 2) Central to Japan's novel and successful strategy of retrospective contact tracing was a large cohort of highly-trained public health officers based in (or rapidly redeployed to) local public health centres - an approach sometimes referred to as field epidemiology. Importantly, these officers had ongoing experience of dealing with other airborne infectious diseases in the community, notably tuberculosis (TB), for which aggressive retrospective contact tracing with a view to identifying and controlling clusters was already in place . Japan's 3Cs message, which was designed to inform both national policy and public behaviour, was adopted into public-facing WHO advice on 13 th October 2020 (source A13, Table 1 ), though the mismatch between this advice and continuing statements elsewhere there was "no firm evidence" for airborne spread was not addressed. Retrospective contact tracing had been attempted in some Western settings (e.g., British Columbia) in the first wave of the pandemic but was not sustained or showcased in the same way as Japan, nor did analysis of case clusters persuade local public health officials of the airborne nature of the disease. The striking difference in how aerosol theory was received in Japan compared to our other case studies may be explained in part by an analysis of individual-level factors. For example, the personality and trajectory of the virologist who is credited with introducing Japan's '3Cs' approach to the pandemic back in March 2020 (source D6, Table 1 ) - which structured his own habitus - likely played a role. He is a medical doctor by training and spent many years working as a senior adviser for the WHO on communicable diseases. He led WHO South East Asia's response to SARS in 2003, where he became known for promoting transparency and information-sharing. But this doctor took a novel approach to the COVID-19 pandemic. He worked with a professor of mathematics to analyse early clusters of cases both within Japan and on the Diamond Princess cruise ship. The discovery that:unlike with influenza:a tiny proportion of primary cases gave rise to around 80% of secondary cases led them to hypothesise that the airborne route of transmission was dominant and that the key to controlling the pandemic was controlling clusters . A press article from November 2020 describes him thus: "X---, an unassuming and bespectacled 61-year-old, is at times hardly distinguishable from the average salaryman. A field epidemiologist by training, X--- cut his teeth working for Japan's development agency in Zambia, and has spent most of his career as an academic, currently affiliated with Tohoku University. He's far less well-known in his native country than other top infectious disease officials like Anthony Fauci in the U.S., and unlike Sweden's Anders Tegnell, no one is tattooing his image on their bodies. But those who worked with X--- say his early sense of urgency, constantly badgering government officials to do more, was crucial to Japan's response." (source D6 ) In contrast to many key public health actors in the West, then, this leading medical adviser in Japan kept a low public profile, decided that randomised controlled trial evidence and the assumptions of evidence-based medicine had little to contribute to the pressing questions around transmission, worked quickly and collaboratively with non-medical experts to produce a novel mathematically-informed hypothesis, embraced the precautionary principle (that action should be taken before scientific evidence is definitive), ignored advice from the WHO, developed a simple and catchy '3Cs' message, and operated quietly but effectively behind the scenes to bring political actors up to and including the Prime Minister on board. This contrasts with his contemporaries in the West, whose vested interests in their own game and their decision to reject the contribution of heterodox scientists tied them firmly to contingent paths. The Japanese adviser was able to enjoy interdisciplinary collaboration in a country which seems fairly open to interfield alignment and solidarity in relation to public health.

bourdieu, sars-cov-2, aerosol transmission, evidence-based medicine, illusio, infection prevention and control, orthodoxy, symbolic violence

PMC8189795_01

Female

A 49-year-old female presented to the emergency room with lumbar pain, transitory dark urine, asthenia, anorexia, weight loss, and leg and periorbital edema (Table 1). She referred chronic use of a proton pump inhibitor and had been consuming a nonsteroidal anti-inflammatory drug (NSAID) for the previous month. Laboratory evaluation showed elevation of the erythrocyte sedimentation rate (ESR) 140 mm/first hour and C-reactive protein (CRP) 7.75 mg/dL, normocytic and normochromic anemia (Hb 10.1 g/dL), and increased serum creatinine (3.96 mg/dL) and urea (103 mg/dL). Urinalysis showed hematuria and proteinuria (1044 mg/24 h) without cellular casts. Additional investigations were unremarkable. She underwent a kidney biopsy for declining kidney function despite intravenous hydration and discontinuation of nephrotoxins that showed, on light microscopy, normal glomeruli and diffuse mononuclear cell interstitial infiltrates, consistent with acute TIN, which was initially deemed pharmacologic. She started systemic corticosteroids (oral prednisolone 1 mg/kg/day) with clinical improvement and full renal function recovery in 6 months. However, at 8 months after the initial presentation, while on the final phase of steroid tapering (prednisolone 2.5 mg every other day), she presented with ciliar hyperaemia and pain in the right eye (Table 1) and unilateral anterior nongranulomatous uveitis was detected (Figure 1). Based on the presence of uveitis and TIN, the diagnosis of TINU syndrome was confirmed. Further clinical investigation was made to rule out the main infection and inflammatory diseases considered for differential diagnosis, including hepatitis B and C, Toxoplasma gondii, Mycobacterium tuberculosis, Epstein-Barr, syphilis, cytomegalovirus, and brucellosis infections, sarcoidosis, and Behcet's disease. Examination for human leukocyte antigen (HLA) alleles showed HLADQ B1*02*06 HLADR B1*02*06 positivity. Systemic corticosteroids were optimized to 0.5 mg/kg/day, and azathioprine 2 mg/kg/day was associated, beyond topical corticosteroids, with achieved uveitis control (Table 1). Six years after being diagnosed, the patient is clinically stable under immunosuppressive therapy with prednisolone 5 mg/day and azathioprine 1 mg/kg/day.

PMC10368906_01

Female

Our patient is a 68-year-old woman who had undergone a splenectomy for Felty's syndrome and who presented with one month of worsening lower back pain and fever. Her back pain was chronic and previously managed with intra-articular steroid injections over the course of several years but had recently worsened significantly. Spinal CT imaging revealed a stable compression deformity at the L1-L2 level and new L1-L2 discitis (Fig. 1). MRI showed L1-L2 discitis, vertebral body enhancement, and a contrast-enhancing anterior paraspinal soft tissue prominence (Fig. 2). An aerobic bacterial culture of the affected disc obtained via CT-guided aspiration was sterile, and she was treated empirically with intravenous (IV) vancomycin and ceftriaxone. Fever and back pain persisted while on antibacterial therapy, and repeat CT 4 weeks into treatment showed progression of the L1-L2 compression fracture without significant change in discitis. She was transferred to our tertiary hospital and underwent an anterior L1 and L2 corpectomy with anterior T12 through L3 interbody fusion. The empiric antibiotics were held for three days preoperatively to improve the diagnostic yield of specimens obtained during surgery. Erythrocyte sedimentation rate (ESR) and C-reactive peptide (CRP) were elevated at > 120 mm/hr (normal range 0-40 mm/hr) and 99.6 mg/L (normal range 0-4.9 mg/L), respectively. Surgical pathology revealed acute and chronic osteomyelitis and osteonecrosis with necrotizing granulomas. Acid-fast bacilli (AFB) smear showed 10-99 AFB per field ("1+" designation), and aerobic and anaerobic bacterial tissue, bone, and blood cultures were negative for growth. Risk factors for exposure to MTB were absent. Induced sputum for AFB was smear and culture negative, and the patient had no respiratory symptoms. M. tuberculosis (MTB) interferon-gamma release assay (Quantiferon-TB ) was indeterminate due to low mitogen reactivity. The patient was diagnosed with non-tuberculous mycobacterial (NTM) osteomyelitis/discitis and started on rifampin, ethambutol, moxifloxacin, and clarithromycin to cover broadly for the most common causes of NTM infection. The isolate was sent to the Maryland State Department of Health laboratory, where probes for MTB, M. avium/intracellulare complex (MAC), M. kansasii and M. gordonae were negative. It was then sent to a commercial laboratory for definitive identification and susceptibility testing. At approximately four weeks, growth was seen on the mycobacterial growth indicator tube (MGIT), presumptively identified as M.fortuitum/chelonae complex, though this species is a rapid grower, typically growing in 7-10 days. The regimen was switched to clarithromycin, moxifloxacin, and IV imipenem and amikacin. Subsequently 16 S sequencing was performed, and M. xenopi was identified. The isolate was reported as susceptible to amikacin, ciprofloxacin, clarithromycin, linezolid, moxifloxacin, and trimethoprim/sulfamethoxazole, and resistant to ethambutol, rifampin, and streptomycin (Table 1). Her regimen was changed to clarithromycin, moxifloxacin and linezolid based on susceptibility results, but severe nausea necessitated a switch from clarithromycin to azithromycin. The patient's back pain eventually subsided, and at a follow-up visit one month after beginning M. xenopi treatment, she was free of fever and other symptoms of infection. Objective data revealed a down-trending ESR and CRP with values of 52 mm/hr and 10.4 mg/L two months into treatment. Overall, she received approximately 4 months of appropriate treatment for M. xenopi, before dying of non-infectious causes related to her underlying illness.

discitis, immunocompromised, mycobacteria, mycobacterium xenopi, non-tuberculous mycobacteria, osteomyelitis

PMC7592679_01

Female

In a research letter, Dong et al. reported a possible case of vertical transmission in a 29 year old women with radiographic evidence of pneumonia and a positive NP swab for COVID-19. The mother received antibiotics, oxygen, corticosteroids, and antiviral drugs prior to delivery. The mother wore an N95 mask and did not hold the infant following the delivery. The infant was asymptomatic at birth, had Apgar scores of 9 and 10 and was immediately quarantined. Of note, the infant demonstrated elevated SARS-CoV-2 IgM and IgG levels at two hours of life, but serial NP swabs for SARS-CoV-2 were negative. At time of discharge, immunoglobin levels were still elevated. The presence of IgG levels at two hours of life could be explained by elevated maternal levels, however IgM antibodies do not freely cross the placenta. It is difficult to determine whether the elevated IgM was due to fetal infection, delivery, or an unrelated process. Without testing amniotic fluid or placenta specimens, no definitive conclusions can be drawn. Increased availability of IgG and IgM testing has improved the quality of surveillance and detection of SARS-CoV-2. Zeng et al. reported immunoglobulin levels from six infants born to COVID-19 positive mothers between February 16th and March 6th. All mothers underwent caesarian section and the infants were immediately isolated following delivery. Neonatal viral throat and serum swabs were all negative for SARS-CoV-2, but IgG and IgM were elevated in five and two respectively, out of the six infants. While the sample size is small and no evaluation of the placenta or amniotic fluid occurred, the report raises concern of placental involvement and fetal exposure to the virus. In the series published by Zhu et al., the clinical status of 10 neonates were reported. None of the infants born to COVID-19 positive mothers demonstrated a positive throat swab PCR. One infant, born at 34 weeks' gestation, developed hemorrhagic shock, secondary to profound gastrointestinal bleeding and ultimately died secondary to multi end organ failure. A second infant, born at 34 week's gestation, developed fever and gastrointestinal (GI) bleeding, but responded to supportive therapies. With negative testing, and without evaluation of placental tissue or amniotic fluid, it is difficult to draw any conclusions regarding the biologic nature of the GI symptoms or any putative relationship to COVID-19 exposure. Clinical symptoms in neonates are non-specific and appear similar to the classic presentation of respiratory distress syndrome. Additionally, radiologic imaging may demonstrate pneumonia, which is difficult to distinguish from premature lung disease. It is important to have a high degree of suspicion when managing neonates born to positive mothers, while recognizing more information is needed to truly develop a consistent neonatal phenotype. There is currently no specific treatment for COVID-19 infection, nor access to an available vaccine. The American Academy of Pediatrics (AAP) and the Centers for Disease Control (CDC) have developed guidelines to aid in the care of infants born to COVID-19 positive mothers (Table 4). Recent guidelines prioritize universal maternal testing and recommend a shared decision-making process related to whether the infant should stay with the mother or be isolated. Treatment of patients with active SARS-CoV-2 illness has focused on the provision of supportive care according to illness severity. This may range from oxygen therapy and/or prone positioning to intubation, ICU support in patients with shock or adult respiratory distress syndrome (ARDS). Table 3 provides an overview of current strategies that have been implemented or are under investigation to either mitigate the risk of transmission or modulate the disease course. Prevention has been used as a primary means to control the growth of COVID-19. As virus spread primarily relates to"person to person" interaction and has demonstrated familial clustering, limitation strategies that minimize human interaction, or social distancing, may help diminish transmission. It has been difficult to accurately determine the basic reproduction number (RO) of SARS-CoV-2, which is used to determine how quickly the virus can spread throughout a population, across various countries and cities with differing population densities. Currently studies indicate the virus has a RO of 2.2, meaning each infected individuals has the potential to spread the virus to 2.2 other individuals. Until the RO drops to less than 1 the outbreak is likely to continue with aggressive spread. Mitigation measures such as social distancing, school closures, quarantine of exposed individuals have been determined through simulation and observational studies to have the potential to reduce transmission of previous pandemics, although there is no published evidence of the efficacy of this strategy in the setting of the current pandemic. Vaccination research has started, with several academic centers and pharmaceutical companies having taken on the challenge, however the timeline needed to ensure patient safety remains considerable. Modulation of the spread within the health care system is of vital importance. Wu et al. reported that 3.8% of their positive COVID-19 population in China were infected health care personnel. The impact to health care workers in Italy is even greater; in some situations, hospitals have closed because of the magnitude of transmission among health care workers. Protection of healthcare workers has been made especially challenging due to an insufficient global supply of personal protective equipment and disruptions within the supply chain. To help combat this shortage, given that pregnant mothers may be either be asymptomatic carriers or undiagnosed due to limited testing, the vague or mild nature of symptoms, andthe potential for comorbid disease states, it is incumbent on healthcare systems to ensure that neonatal teams have efficient processes to protect vulnerable front-line workers and mitigate both COVID-19 spread and access to healthcare delivery for other neonatal ICU patients. An array of medications are in current use to treat patients with COVID-19. Anti-viral agents such as oseltamivir, ganciclovir, lopinavir/ritonavir and remdesivir have been used for critically ill patients. Remdesivir is a nucleotide analogue that interferes with viral replication. A clinical trial is currently in progress at multiple centers in Wuhan province. Additionally, the anti-malarial agent chloroquine phosphate has been used to treat pneumonia symptoms, as it possesses anti-viral and anti-inflammatory properties and has demonstrated positive clinical effect in the treatment of COVID-19. Clinical trials of the efficacy of chloroquine are also being conducted in China. Finally, lopinavir has demonstrated inhibition of protease activity in coronavirus species and is currently under investigation. There are no reports of use of these agents in pregnant mothers or their infants. Use of convalescent plasma, as a means of generating passive immunity, has been the subject of recent investigation. This therapeutic strategy was previously investigated during the SARS and MERS outbreaks; specifically, a metanalysis demonstrated a significant reduction in mortality compared to placebo. In addition, clinical experience from five COVID-19 positive individuals in China with ARDS demonstrated clinical improvement following the receipt of convalescent plasma. While this was not a randomized controlled study, the report is compelling and suggests biological and therapeutic plausibility. While many of the current treatments under investigation hold promise, due diligence and scientific rigor are essential to minimize the potential of unintended or unanticipated patient harm. There is currently no scientific evidence to justify any approach to treatment in pregnant mothers or in neonates. Centers should develop institutional guidelines based on best available evidence and resources available to them.

sars-cov-2, angiotensin-converting enzyme 2 (ace2), pandemic, pneumonia

PMC9871838_01

Male

A 7-year-old boy presenting with a leukocyte count 800 x 109/L and peripheral lymphadenopathy was diagnosed with precursor T-ALL with extensive involvement of the bone marrow (BM) and peripheral blood. Multiparameter flow cytometry showed an immature T-lymphoblast population (95%) of cortical phenotype (EGIL III; CD45dim/CD7+/cytCD3+/Tdt+//CD4/CD8dim+/CD10-/CD1ahetero/CD56/16-/CD99++/CD5dim+/ CD2+/CD48+/CD38+//TCRa/b-/TCRg/d-/HLA-DR- {Bene, 1995 #41}). The blasts were negative for myeloid markers (cytMPO and CD33) and for B-cell markers (CD19 and cytCD79a). According to the standard of care (SoC) genomic characterization, the patient had a normal karyotype and none of the targeted fluorescence in situ hybridization (FISH) analysis was positive, i.e., no KMT2A- or BCR::ABL rearrangements and no ABL-class rearrangement were detected. A biallelic CDKN2A/B deletion was the only clonal aberration detected. The patient responded poorly to standard four-drug induction (dexamethasone, pegylated-asparaginase, daunorubicin, and vincristine) and was switched to consolidation at day 19 (6-mercaptopurine, cytarabine, and cyclophosphamide). Two weeks later, he still had 80% blasts in the bone marrow and was considered refractory and treatment with nelarabine initiated. Following two rounds of nelarabine and one additional high-risk chemotherapy block, remission was achieved, and he subsequently underwent hematopoietic stem cell transplantation (HSCT) from his haploidentical mother. The conditioning regimen consisted of ATG (grafalon), fludarabine, and thiotepa together with total body irradiation (TBI) (12 Gy in four fractions) and rituximab after which he received an alpha/beta T-cell-depleted peripheral stem cell graft. Initially, mycophenolate mofetil was switched to cyclosporin together with prednisolone after 45 days due to acute gut and skin graft versus host disease (GVHD). He is currently 8 months post HSCT, with no sign of disease but still on a low dose prednisolone. At the time of initial failure, the genetic laboratory was engaged to screen for potential targets for experimental therapy. DNA isolated from the bone marrow sample taken at diagnosis was sequenced using a PCR-free, paired-end WGS protocol with a 30x coverage on an Illumina HiSeq X platform at Clinical Genomics (SciLifeLab, Stockholm) and annotated to the Human GRCh37 (hg19) build. Variants were identified using the MIP validated for routine diagnostics and visualized in the SCOUT interface. MIP performs structural variant (SV) detection using Delly, TIDDIT V2.0, as well as Manta and single nucleotide variant (SNV) detection using GATK HaplotypeCaller. Subsequently, filtering was performed using the list of targetable genes described in the INFORM study. This analysis resulted in 260 SNVs and 18 SVs. Further filtering of the SNVs based on gnomAD or local observations as well as annotations in ClinVar narrowed the list to 11 SNVs that were manually inspected and dismissed, as no targetable SNV was identified. Similarly, the 11 SVs were manually curated based on recurrency in the local database and inspection in Integrated Genomic Viewer (IGV) leaving only three SVs that interestingly affected regions recurrently involved in ALL. Two of these SVs affected the JAK2 locus on 9p24.1 and inspection in IGV revealed a shared breakpoint suggesting that both SVs had occurred in the same genomic rearrangement (Supplementary Figure 1). The first SV consisted in a 122 kb-long intrachromosomal inversion with breakpoints that mapped to intron 15 (NM_001322194.2) and telomeric to the JAK2 locus. The second SV consisted in an interchromosomal event and shared the breakpoint in intron 15 of JAK2, while the second breakpoint was located at 14q32.11 and mapped to intron 25 in the CCDC88C locus (NM_001080414). Both events are visualized in the Circos plot in Figure 1A. The rearrangement of JAK2 could be verified with metaphase FISH that confirmed that the 5' signal at the JAK2 locus was translocated to chromosome 14 while the 3' signal was retained on derivative chromosome 9 (Figure 1B). As the rearrangement involves the most distal regions of chromosomal arms 9p and 14q, it is beyond the resolution of chromosome banding analysis and cannot be detected by karyotype analysis. In addition, SV analysis also detected a deletion on 9p21.3 encompassing 39 kb and supported by 95% of reads that resulted in a biallelic loss of CDKN2A/B that had been previously found in SoC testing. Taken together the data indicated a reciprocal translocation t(9;14)(p24.1;q32.11) with a concomitant inversion of a 122-kb-long fragment from 9p that resulted in the creation of a fusion gene joining intron 25 of CCDC88C to intron 15 of JAK2 on derivative chromosome 9. As a result of the inversion from the 9p fragment, the genes are arranged in opposite orientations and thus no reciprocal fusion is created at derivative 14 (Figure 2). According to the WGS findings, the rearrangement juxtaposes exons 1 to 25 of CCDC88C to exons 16 through 25 of JAK2, creating a novel fusion gene (Figure 2). The expression of the fusion transcript joining exon 25 of CCDC88C (3' partner) to exon 16 in JAK2 gene (5' partner) was confirmed with RT-PCR followed by Sanger sequencing. The fusion gene will thus result in an in-frame hybrid protein with the kinase domain of JAK2 at the carboxy-terminal.

jak2 fusions, pediatric t-all, precision medicine, targeted therapy, whole genome sequencing

PMC7294958_01

Male

A 15-day-old male infant was referred to our hospital with a history of recurrent apnea, suspected sepsis, neonatal hyperbilirubinemia, and thrombocytopenia. The infant was ventilated at the referring hospital for recurrent apnea and was treated with intravenous antibiotics and other supportive measures. General examination at admission revealed marked hyperpigmentation of the face (Figure 1) and genital region (Figure 2). Systemic examination was unremarkable. The possibility of neonatal chikungunya was considered due to classical hyperpigmentation, clinical presentation, and thrombocytopenia. The patient's mother reported having suffered a fever during the week preceding his delivery. The diagnosis in the neonate was confirmed by positive IgM antibodies to chikungunya. The child was treated symptomatically, recovered gradually, and was extubated on the third day of admission. Platelet count also normalized and the infant was discharged on the tenth day of admission. Transmission of chikungunya from mother to fetus is most likely when the mother is viremic at delivery. Though neurological, ocular, renal, and hematological manifestations have been described, the striking pigmentation of the nose, described as the "chik sign," is the most recognizable feature in the diagnosis of neonatal chikungunya . Differential diagnoses include congenital lupus, drug rash (due to imipenem, for instance), and bacterial infections (Listeria monocytogenes, Staphylococcus epidermidis), fungi (Candida), and viruses (human herpesvirus 6, enteroviruses). Knowledge of the "chik sign" as a cutaneous feature of chikungunya could be useful in resource-poor settings to detect unrecognized outbreaks of this arboviral fever, especially when the facilities for serological confirmation are not available.

PMC7368129_01

Female

A 79-year-old Japanese non-drinker woman with a history of dementia and primary aldosteronism was admitted to our hospital presenting with fever and a productive cough persisting for the past three days and respiratory distress. Despite the advanced age, the score of performance status was 2 (ambulatory and capable of all self-care but unable to carry out any work activities; up and about more than 50% of waking hours). She had never been a resident in a nursing home or an extended-care ward. She also did not receive antimicrobial agents and was not hospitalized in the preceding 90 days, and had no history of overseas travel. All these factors were indicative of her infection being community acquired. Upon admission (day 1), her general condition was severe, and vital signs indicated sepsis; blood pressure was 89/60 mmHg; heart rate, 130 beats/min; body temperature, 38.5 C; respiratory rate, 25 breaths/min; and oxygen saturation, 92% in room air. A physical examination revealed crackles on both lateral lung fields upon auscultation. Blood tests showed elevated white blood cell count (16,400 cells/muL; neutrophil 88%) and C-reactive protein (42.81 mg/dL). A chest X-ray revealed lobar pneumonia on both lung fields, and computed tomography (CT) revealed multiple consolidations with air-bronchogram, nodules, and ground-glass opacities, particularly in both lower lobes (Figure 1). Although, radiological findings indicated pneumonia due to S. pneumoniae, Gram staining of sputum samples revealed no predominant microorganism. A commercially available urine antigen test for detecting S. pneumoniae and Legionella pneumophila and the rapid influenza virus test were also negative. The case was diagnosed as severe CAP with septic shock, and fluid resuscitation for septic shock and administration of meropenem (MEPM) were started immediately. The following day, both sputum and two sets of blood cultures confirmed only Gram-negative coccus. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry revealed the isolate as K. pneumoniae. Colonies on sheep blood agar demonstrated hypermucoviscosity, and the string test:a semiquantitative phenotypic estimation that determines hypermucoviscosity by stretching a bacterial colony on an agar plate using an inoculation needle:was positive (the string reached over 5 mm in length, which is consistent with the characteristics of HV-KP). A biochemical test confirmed that the isolated organism was K. pneumoniae. Multiplex PCR (magA, iutA, allS, kfu, rmpA, entB, mrkD, and ybtS) and multilocus sequence typing (MLST) were performed according to previously described methods. Genetic analysis identified this strain as the K2 serotype harboring rmpA, iutA, entB, and mrkD (Figure 2). Therefore, we identified the isolated strain as hypervirulent. The isolate belonged to ST 86 (ST86) as determined by MLST. Additionally, urinalysis, urine culture, lumbar puncture, ultrasonography, and CT of the abdomen and head were performed to determine if the patient had complicating disseminated HV-KP infection, because treatment duration depends on the site and extent of infection. Metastatic infections, such as liver abscess, meningitis, brain abscess, or ocular infection, were all absent. The isolate was susceptible to all routinely tested antibiotics except ampicillin. MEPM was stopped and the patient was placed on ceftriaxone (CTRX) as a definitive therapy, because the usual dose of CTRX is given once a day, which could avoid intravascular over volume in the elderly. The patient received 2 weeks of intravenous antibiotics, recovered gradually, without recurrence, and was discharged on day 20.

streptococcus pneumoniae, community-acquired pneumonia, hypervirulent klebsiella pneumoniae, lobar pneumonia, sequence type 86, serotype k2

PMC3929145_01

Male

A 45 year-old Caucasian male presents with approximately 12 episodes of tongue swelling over the last year. Each episode occurs upon awakening in the morning, is preceded by tongue tingling, and is not associated with swelling in other locations of his body. He has no associated airway obstruction but does have difficulty talking and closing his mouth due to the degree of swelling. He has no history of urticaria and does not develop hives in conjunction with tongue swelling. He denies any other signs or symptoms of anaphylaxis. The patient has been evaluated in the emergency room for many of these episodes and treated with diphenhydramine, prednisone, and ranitidine with improvement in symptoms within an hour of receiving medication. He has also self-treated many episodes with diphenhydramine at home with quick resolution of symptoms. Other times, he has had symptoms of only tongue tingling and is able to abort an episode of swelling with quick treatment with diphenhydramine. He has no history of allergic rhinitis, allergic skin disorders, or food allergy. He has not noticed any specific seasonality, food ingestion, rhinitis, or ocular symptoms associated with episodes. On review of systems, patient complained of frequent indigestion and heartburn for the last year but denied halitosis, acidic taste in his mouth, or cough. He has no history of mouth sores or ulcers, dental caries, or gingivitis. Laboratory evaluation included normal complete blood count, chemistries, and liver function tests. Thyrotropin was 2.7 mIU/ml (0.27-4.2), C4 25.3 mg/dL (10-40), C1 esterase inhibitor quantity 12 mg/dL (11-26), and C1 esterase inhibitor function >100% (>68%). After initial evaluation, daily antihistamine therapy was initiated and patient had complete resolution of episodes of angioedema with the exception of one episode after missing two days of therapy. Helicobacter pylori IgG was also evaluated due to the patient's complaints of heartburn. With a positive history and an elevated H. pylori IgG at 1.36 u/mL (1-1.09), patient was treated with triple drug therapy including: amoxicillin, clarithromycin, and omeprazole. After therapy for H. pylori eradication, patient discontinued treatment of fexofenadine and within 1 day had an episode of angioedema of the tongue. He restarted daily fexofenadine and has remained free of episodes of angioedema.

PMC2823681_01

Male

A 60-year-old man visited his physician because of a skin discoloration suggestive of jaundice, dark urine and pale stools. The patient also reported vague epigastric pain, with onset about 6 months prior to the onset of icterus. He denied any fever or weight loss. His medical history also included hypertension, diabetes mellitus and tuberculosis. A complete blood cell count was taken, which revealed no abnormality, while the blood chemistry profile demonstrated direct hyperbilirubinemia (total bilirubin, TBIL:20 mg/dl, direct bilirubin, DBIL:16 mg/dl) and a remarkable elevation of the alkaline phosphatase (ALP) and gamma-glutamyl transpeptidase (GGT) (the levels of aspartate transaminase (AST) and alanine transaminase (ALT) were only mildly elevated). The patient was subjected to ultrasound examination of his abdomen which disclosed a cystic mass in the head of the pancreas and a dilatation of the common bile duct (1.7 cm) and intrahepatic bile ducts. The patient was further evaluated with T1-weighed and T2-weighed gadolinium ((Gd)-DTPA)-enhanced MRI images and MRCP, which revealed a cystic lesion in the pancreatic head with maximum transverse diameter of 5 cm. The pancreatic cyst was in communication with a clearly dilated main pancreatic duct. In parallel with the dilatation of the main pancreatic duct along its entire course, a significant dilatation of secondary ducts (side-branches) was also documented (Figure 1). The imaging findings were compatible with the diagnosis of a diffusely distributed intraductal papillary mucinous neoplasm (IPMN) of the mixed-type variety. Moreover, the ultrasonographic finding of the dilated intra- and extra-hepatic biliary tree was confirmed, with maximum diameter of the common bile duct at about 1,7 cm. Due to the level of icterus and the coexisting dilation of the common bile duct (CBD), the patient was subsequently subjected to ERCP with simultaneous insertion of a plastic stent into the CBD. During the upper gastrointestinal endoscopy, only a mild esophagitis of the lower third of the esophagus was diagnosed, with no indication of a gastric wall abnormality reported. After the aforementioned complete work-up of the patient, he was referred to our Surgical Department for surgical treatment. Because of the diffuse distribution of the cystic neoplasm, a total pancreatectomy, splenectomy and limited partial gastrectomy was performed. Incidentally a subserosal polypoid tumor was found at the greater curvature of the gastric antrum. Local excision of the gastric tumor was performed and it was also sent for histologic examination. On the 6th postoperative day, the patient presented a biliary leak which was managed conservatively. He was discharged on the 40th day, and 1 year after the operation has been disease and symptom free. Histologic examination of the orthotopic pancreas revealed a non-invasive intraductal papillary mucinous neoplasm involving the main pancreatic duct, with prominent intraductal papillary projections (Figure 2a). The papillae were well-developed with a fibrovascular core. The neoplastic epithelial cells showed intestinal differentiation. The neoplasm exhibited significant architectural and nuclear atypia. There was budding off of clusters of neoplastic cells into the lumen, as well as, significant nuclear pleomorphism with loss of polarity and prominent nucleoli (IPMN with high grade dysplasia; figure 2b). Additionally, a 2.5 x 2.2 x 0.9 cm measuring tissue specimen from the gastric wall was received. Macroscopic evaluation revealed a 1.5 cm white nodule with cystic spaces. Histological examination demonstrated heterotopic pancreatic tissue consisting of well-formed lobules of pancreatic acini and cystically dilated ducts containing intraluminal papillae (Figure 3a, b). The papillary structures were lined by mucinous epithelium with focal intestinal metaplasia and mild to moderate nuclear atypia (Figure 3b, c).

PMC9759974_01

Male

We present a case of a 37-year-old male who came to Yanet internal medicine speciality centre, Hawassa, Sidama,Ethiopia. He presented with intermittent crampy abdominal pain of 3 months duration. He complained of occasional abdominal distension and intermittent vomiting of ingested matter occasionally with bilious content. He had constipation but had no failure to pass faeces or flatus. In addition, he had easy fatigability, loss of appetite and unquantified significant weight loss. The patient reported that he had the above symptoms for the last 3 years but the symptoms have worsened in the last 3 months prior to his current presentation. He had no diarrhea or cough. His past medical history is unremarkable. On physical examination, he looked acutely sick. On V/S (Vital Sign) PR (Pulse rate)-104 bpm RR (Respiratory rate)-20 bpm T (Temperature)-ATT (Afebrile to touch) BP (Blood pressure)-100/70 mmHg. On HEENT- he had slightly pale conjunctiva. On abdominal examination- the abdomen looked soft, which moved with respiration; there was no visible peristalsis, no area of tenderness, and DRE (Digital rectal examination)-normal. On investigation. Hemoglobin (Hgb)=8.4 g/dl Hematocrit (HCT)-27.9. Platelet (Plt)= 295x103/uL Complete blood count (CBC)- White blood cell count (WBC)=6.5x103/uL Granulocyte=73% Lymphocyte=15%. Blood group and Rh= o+. FBS (Fasting blood sugar), BUN (Blood urea nitrogen), Creatinine, ALP, AST, ALT are all normal. Serum Na, K+, Cl- were in the normal limits. On imaging. CXR (Chest x ray) was normal. Abdominal Ultrasound - There was a short segment of small bowel mass like asymmetric wall thickening measuring 4.5cm by 2.2 cm over the LUQ (Left upper quadrant) with a maximum wall thickness of 1.2cm. There were multiple adjacent mesenteric lymphadenopathies, the largest 1.1cm. The proximal small bowel was distended up to 5cm with collapsed distal bowel. The conclusion was, short segment small bowel wall thickening with luminal stenosis and features of partial SBO (Small bowel obstruction) and mesenteric lymphadenopathies, and small bowel carcinoma was considered as differential diagnosis, and Abdominal CT (Computed tomography) was recommended. On Abdominal CT there were multi-focal short and long segment symmetric wall thickening of small bowel loops, which was marked in the left lower quadrant narrowing the lumen with proximal bowel loops dilatation and shouldering. There were also multi-focal luminal narrowing (constrictions) of the involved small bowel loops with associated focal wall thickening. Small mesenteric lymph nodes were noted in the left lower quadrant small bowel mesentery with adjacent mesenteric fat stranding and internal hypoattenuation in keeping with central necrosis (see Figure 1). The patient was admitted with the consideration of Inflammatory bowel disease (IBD) and was given IV Ceftriaxone and Hydrocortisone and kept on maintenance fluid for 36hrs. After Small bowel Carcinoma was entertained, he was transferred to the surgical side. Because of a blood shortage, he was transfused with only 1 unit of X-matched blood and taken to OR (Operation room) for exploratory laparotomy. Under GA (General anesthesia) and ETT (Endotracheal tube) abdomen was cleaned and draped, then entered through a vertical midline incision, there was a distended small bowel about 200cms away from the ligamentum trietz, and the distended segment was about 100cm long, and there were three constrictions nearly obstructing the lumen which were a few centimeters apart. There were scant shooty mesenteric lymph nodes, there was no fat stranding, and the rest of the bowel looked normal. So we did segmental resection and end-to-end ileo-ileal anastomosis (See Figures 2 and 3). The site of anastomosis was about 100cm proximal to the ileocecal junction. After thorough lavage, the wound closed in layers, and the count was correct. The patient had a smooth postoperative course and was discharged on the third postoperative day. He returned to the outpatient clinic after 2 weeks with the pathology result. The microscopic description of the Pathology report stated: Sections from the intestinal lesions and mesenteric lymph nodes revealed nodular aggregates of epitheloid cells surrounded by mixed inflammatory cells and scattered Langhans type giant cells with areas of central caseous necrosis. That was histomorphologically consistent with Tuberculosis (See Figures 4-9). He was doing well and started on anti TB medication. He came to follow-up at two and seven months postoperatively and he was doing fine with all the symptoms resolved.

abdominal tb, gastrointestinal tb, granulomatous inflammation, intestinal tb

PMC7350134_01

Male

An 85-year-old male with a past medical history of hypertension, hyperlipidemia, sciatica, prostate cancer (status post radiation therapy, on leuprolide), and pulmonary fibrosis was admitted to the hospital by his PCP after developed bladder and bowel incontinence in the setting of weakness and unsteadiness. Ten days prior to his admission he reported a mechanical fall with head trauma during a racquetball match without loss of consciousness. Computed tomography (CT) of his head and magnetic resonance imaging (MRI) of his hips were negative for acute injuries. He subsequently developed a prodrome of sharp right leg pain and numbness, followed by a zosteriform, linear, vesiculopustular eruption initially distal to the knee and progressed to involve the medial and posterior region of his right lower extremity and groin area (Fig. 1). Additionally, he developed discrete lesions of the face, trunk, and remaining extremities. Polymerase chain reaction (PCR) test was positive for VZV, confirming herpes zoster. Valacyclovir at 1 g three times a day (TID) was started for treatment of disseminated shingles. Patient at that time was also noted to be up to date on immunizations, with the exception of live zoster vaccine. A few days later, he developed bladder and bowel incontinence in the setting of weakness and unsteadiness. Review of systems was otherwise negative. No history of immunosuppressive pharmaceutical drug use. He was seen by his PCP, who directly admitted him at the hospital. Physical exam was significant for a vesiculopustular rash on the patient's face, trunk, and extremities, worse on the right lower extremity. More than 20 lesions were appreciated beyond the initial dermatome. Neurologic exam was significant for diminished right hip flexion and abduction strength, decreased pinprick and proprioception sensation on the right lower leg medially, without saddle involvement; and diminished right patellar and Achilles reflexes. Initial labs were significant for a leukocytosis of 13,400/muL, with left shift. Imaging studies included a CT of the abdomen/pelvis that was significant for a dilated bladder and a MRI of the lumbar spine that was significant for diffuse abnormal enhancement of the cauda equina nerve root and right lumbosacral plexus. The patient was diagnosed with disseminated herpes zoster, predominantly along the L3-S2 dermatomes with lumbosacral plexopathy, manifesting as cauda equina syndrome. He was started on intravenous (IV) acyclovir 10 mg/kg TID for 14 days, followed by valacyclovir 1000 mg for 7 days as well as gabapentin for associated neuropathic pain. He continued to have bowel incontinence and was found to have a coinfection with Clostridioides difficile. Leukocytosis and frequency of bowel movement improved after initiation of metronidazole 500 mg TID. An indwelling Foley catheter was placed for overflow incontinence. After the lesions crusted over, the patient was discharged from the hospital. He continued to have bladder and bowel incontinence; however, he had marked improvement in motor function. He was followed closely by the Departments of Urology and Neurology. At a 10-week follow-up phone interview patient reported significant improvements in ambulating, resolution of neuropathic pain, and complete resolution of prior incontinence.

cauda equina syndrome, herpes zoster, herpes zoster vaccine, varicella zoster virus infection

PMC7522583_01

Male

We described unusual presentation of PMF with spontaneous bleeding after laparoscopic adrenalectomy. A 73 years old Caucasian man underwent laparoscopic right adrenalectomy for a rapidly increasing expansive mass (3.5 x 2.5 cm) of the right adrenal gland. It was an incidental finding on a computed tomography (CT) scan performed for dyspnoea. In the previous two years, the patient had a magnetic resonance (MR) and a positron emission tomography (PET) showing an increasing lesion with morphological features suggestive for adenoma, pheochromocytoma, tuberculosis (TB), and an enlarged spleen. Blood tests excluded secreting lesion or TB infection. The list of comorbidities included hypertension on treatment with beta-blockers, benign prostatic hypertrophy treated with silodosin, chronic obstructive pulmonary disease (COPD) treated with steroids inhalers, hypothyroidism, previous appendectomy, unspecified previous surgery for head trauma. An informed consent was obtained before surgery. According to standard procedure adopted in our Center for laparoscopic adrenalectomy, an open technique was used for laparoscopic access. Abdominal cavity exploration showed blood and clots on the surface of great omentum, in absence of any source of bleeding. After trocars placement, liver was retracted and posterior peritoneum was divided on the right side of the inferior vena cava to identify the adrenal gland (Fig. 1). After coagulation of adrenal vein, gland was dissected from its attachments and removed in a specimen retrieval bag. Haemostasis was accurately controlled, two drains were placed on the side of adrenal excision and on the perisplenic side, respectively, at the end of procedure. After surgery, the patient was admitted on post-operative intensive care unit for parameters monitoring, due to COPD. The night of intervention the patient developed hypotension not responsive to fluids administration, tachycardia, anaemia not responsive to blood transfusions. Haematic fluid was present in drains bag. The patient underwent urgent explorative laparotomy, that highlighted massive haemoperitoneum, clots in the abdomen, on the splenic side, on Morrison's space, and at the confluence between right renal vein and inferior vena cava. No bleeding source was found. A lavage was performed with hot fluids and haemostatics were placed on the side of previous surgery. Two drains were placed under the liver and on the right adrenalectomy site. First and second intervention were performed by the same surgeon (M.G.). In the post-operative period, we observed a progressively increase of white blood cells count (WBC), until 53.000/mm3 with basophilia, monocytosis and thrombocytosis, in the absence of any foci of infection; haemoglobin (Hb) was normal and blood transfusion was unnecessary. Clotting screening was normal. Spontaneous bleeding on abdominal wall started after the second surgery and required arteriography and embolization. Due to an increase of WBC in the absence of signs and symptoms of infection, the patient was referred to haematology.

case report, laparoscopic adrenalectomy, primary myelofibrosis

PMC7783446_01

Female

A 78-year-old woman was referred to our clinic with bilateral hearing loss with sound distortion, tinnitus and auditory hypersensitivity, recurrent vertigo/dizziness induced by loud noises (Tullio phenomenon), and a diagnosis of bilateral SSCD at the temporal bone HRCT performed in the emergency room (Figures 2a-c). Preoperative audiometry indicated severe mixed hearing loss in the right ear, with moderate conductive hearing impairment in the left ear (Figure 1). A pure tone sound of 110 dB at 500 and 1,000 Hz in the right ear, and pneumatically increasing external auditory canal pressure induced dizziness without detectable nystagmus on video-oculographic (or Frenzel goggles) examination. Her tympanogram was bilaterally normal. A stapedial reflex could not be performed due to patient intolerance (dizziness). Mastoid vibration elicited dizziness without detectable nystagmus on video-oculographic (or Frenzel goggles) examination. A temporal bone 1.5-T MRI with 3D reconstruction performed two months before did not show the bilateral dehiscence (Figures 2d-h). Air conduction cervical VEMPs (cVEMPs) demonstrated a threshold of 85 dB HL on the right side and 100 dB HL on the left side. The cVEMPs were recorded from both ears using 500 Hz short tone-bursts (STBs). A video head impulse test for horizontal and vertical canals, including both dehiscent SSC, showed normal vestibulo-ocular reflex gain bilaterally (Table 1). Possible surgical procedures (superior canal plugging or resurfacing either through a middle fossa approach or via a transmastoid route, or RW niche plugging) were discussed with the patient. Comorbid cardiopulmonary conditions represented major contraindications for general anesthesia, so the latter procedure was the only possible option to pursue. Since the patient did not show bilaterally any benefit from an air conduction hearing aid but rather had deteriorating auditory and vestibular symptoms on the right, we decided to perform the surgical procedure in the right ear as it had worse vestibular and auditory symptoms, a poorer hearing threshold, and greatly altered HRCT and VEMPs findings. With local-assisted anesthesia, we performed a transcanal approach with elevation of the tympanomeatal flap and preservation of the chorda tympani nerve with a minimally invasive retroauricular incision. Ossicular mobility and continuity were assessed, we excluded the stapedial fixation, and no cerebrospinal fluid (CSF) leak was observed during the surgical procedure. After identification and reshaping of the RW niche, a vibroplasty was performed paying particular attention to correctly plugging the round window and coupling it with the floating mass transducer (FMT) of the VSB (Figure 3). We opted to couple the FMT with the RW because concomitant RW plugging was performed and from previous studies it seemed to provide a more stable coupling over time than incus. No ossicular chain abnormalities or perilymphatic fistula were observed intraoperatively. The plugging of the round window was achieved using cartilage and perichondrium (tragus). This autologous tissue also helped to seal off the FMT in the round window niche. Furthermore, VSB hearing outcomes were monitored with electrocochleography using a cotton-wick recording electrode placed on the hypotympanum (Figure 4). The wire of the VSB was housed in a canal tunnel drilled up to the tympanic attic. Minimal drilling of the cortical temporal bone posterosuperior to the external auditory meatus was necessary to house the implant receiver and extra wire (Figure 4). The ear canal tunnel was covered with autologous cartilage and external auditory meatus packing was performed. This study received an exemption from the ethics committee of the University Hospital of Siena (Comitato Etico Regione Toscana, area vasta Sud Est-AOU Senese, Usl Toscana Sud Est) on 10/21/2019 for publication. Surgery was uncomplicated, the patient did not complain of any post-operative vestibular symptoms. Sutures and external meatus packing were removed on the 10th postoperative day. At the 1-month follow-up, the patient underwent VSB activation and hearing and vestibular examination. She reported a significant improvement in auditory hypersensitivity and reduced sound distortion although tinnitus remained unchanged. No disabling vestibular symptoms were reported. Neither dizziness nor nystagmus could be observed in response to loud sounds or increased external ear pressure on the right side. The postoperative pure tone audiogram revealed a mild increase at 500, 1,000, and 2,000 Hz and a mild decrease at 250 and 4,000 Hz for bone conduction thresholds (Figure 1). An improvement to moderate hearing loss in the VSB-aided hearing threshold was confirmed at 3 months (Figure 1). The maximum speech recognition score of bysillabic words at 65 dB HL improved from 10% preoperatively to 70% at the last follow-up. The improvement of hearing and vestibular symptoms was confirmed subjectively by the patient on the right side. Discomfort and mild dizziness associated with loud sounds on the left side remained unchanged. Using a visual analog scale (0-10), the patient reported an improvement in symptoms from 10 to 4 and from 9 to 2, respectively, for hearing and vestibular complaints (3-month follow-up). Left side mild symptoms related to dehiscence remained unchanged. No short-term surgical complications such as device extrusion or external or middle ear canal infection/inflammation were identified at the 3-month follow-up (Table 1). Control HRCT was not performed since correct positioning of the FMT and plugging of the RW were confirmed by improvements in symptoms and stability of VSB-aided hearing. Air conduction VEMPs were not performed for safety reasons due to the risk of mobilizing the plugging or FMT from the RW.

canal dehiscence syndrome, middle ear implant, round window plugging, round window reinforcement, superior semicircular canal dehiscence

PMC9387394_01

Male

A 68-year-old male patient complaining of epigastric pain, vomiting and postprandial regurgitation, dysphagia, and heartburn. Over the past three years, there has been progressive dysphagia and worsening of halitosis. The investigation started with an upper digestive endoscopy that showed a sizeable diverticular ostium, full of food waste, just above the gastroesophageal transition. For a better therapeutic plan, a contrasted esophagus-stomach-duodenal radiograph was requested, which corroborated the endoscopy's finding, presenting a sizeable diverticular formation (90.6 x 60.2 cm along the left and anterior lateral contour of the lower third of the esophagus, projecting into the posterior mediastinum. Finally, the postponement was given by a computed tomography scan of the chest, which demonstrated a sizeable diverticular formation in the lateral wall of the distal esophagus, with a large neck (20.4 cm), measuring 70.6 x 60.3 cm, in the axial plane, containing residues forming a level. A 5 mm trocar was placed next to the xiphoid appendix to open space near the liver. A 12 mm trocar was inserted in the upper right quadrant of the abdomen in the topography of the anterior axillary line. The robotic platform was allocated, allowing the start of docking and surgery. Diverticula of the thoracic esophagus measured approximately 7 cm long and 3 cm in diameter by endoscopy. For access to the thoracic cavity was required dissection of this hiatus hernia and lysis of adhesions of the robotic arm. The diverticula approach was made by using endoscopy to empty the content and make the dissection of the cavity easier. We proceeded with the partial opening of the esophageal pillar for better closure of the diverticulum ostium and the esophageal diverticulectomy stapling with three purple loads from the universal automatic stapler iDrive Ultra, associated with esophageal myotomy. (Figure 1) Histopathological examination revealed an esophageal end segment measuring 7 cm long and 3 cm in diameter with irregular muscle subepithelial layer and extensive hemorrhage. The patient's postoperative evaluation was standard, without any complication, and was discharge from the hospital on the fourth day post-surgery.

chest, diverticulum, esophagus, robotic, surgery

PMC7550954_01

Male

A 36-year-old man presented to our fever clinic on 13 February 2020 in Nanchong, Sichuan, China, with a dry cough, headache, asthenia and fever, which had started 10 days previously. He denied any recent travel, but reported a history of contact with a family member from Wuhan, China (who had not been diagnosed with SARS-CoV-2 infection), which was considered a high-risk area for COVID-19 infection by the Chinese health authorities at the time. The patient did not have any chronic medical problems and was a non-smoker. The physical examination revealed that body temperature of 38.2 C, respiratory rate of 20 breaths per minute, pulse of 105 beats per minute, blood pressure of 109/71 mmHg, and his oxygen saturation was 91% in room air. The thoracic CT image (Figure 1(a) and (b)) showed bilateral lesions, patchy, also confluent and ground glass with the mixed consolidation. Blood tests showed lymphocytopenia, thrombocytopenia and high levels of lactate dehydrogenase (LDH) and other inflammatory markers. A nasopharyngeal swab sample was collected and tested for SARS-CoV-2. The test result was positive. The patient was isolated and was provided with symptomatic support and antiviral treatment (recombinant human interferon, lopinavir/ritonavir oral solution, diammonium glycyrrhizinate injection and methylprednisolone). The ethics committee of North Sichuan Medical College approved this study. Informed consent was obtained before the LUS procedure. The LUS examinations were performed using a portable device (Mindray/UMT-500, China) with a 5-MHz convex probe. Settings were set to penetration mode with a low center frequency and a single focus zone at the level of pleura, and compound scan technology was used in the diagnosis of consolidation. In order to reduce the exposure risk, only one emergency department (ED) physician (Y.C.) entered the isolation room, observing all the standard preventive measures for respiratory, droplet and contact isolation provided by the National Health Commission of the People's Republic of China for the COVID-19 outbreak. The ultrasound probe was enclosed in a sterile, plastic probe cover. The patient was scanned in the supine position following the LUS examination method described in a previous study. Each hemithorax was divided into six regions using three longitudinal lines (parasternal, anterior and posterior axillary) and two axial lines (one above the diaphragm and the other 1 cm above the nipples). The ultrasound device was sterilized in a dedicated area and put enclosed in a new sterile plastic bag at the end of the procedure. During the hospitalization, the patient conducted a total of four ultrasound examinations, which were first, fifth, tenth, and fifteenth days of admission, respectively. The LUS was performed by the same ED physician using the same ultrasound device. The specific LUS findings for this patient were the interstitial-alveolar damage showing bilateral, diffuse pleural line abnormalities, subpleural consolidations, white lung areas and thick, irregular vertical artifacts (Figure 1(c)-(h)). When the patient recovered from the SARS-CoV-2 infection, LUS images showed a normal pleural line with A-lines regularly reverberating (Figure 1(i) and (j)). Detailed report of LUS findings at each examination are shown in Table 1.

coronavirus disease 2019 pneumonia, consolidation, lung ultrasound, severe acute respiratory syndrome coronavirus 2 infection, white lung

PMC5140866_01

Male

A 62-year-old man had been well until 2 weeks before he presented to our hospital with a high fever. Two years before this presentation, he had been diagnosed with myelodysplastic syndrome (MDS) and showed a chromosomal abnormality in 46XY,+1,der(1;7)(q10:p10). The patient had not previously received any immunosuppressive treatment and had not previously undergone bone marrow transplantation. Although a rapid influenza antigen test was negative, zanamivir and acetaminophen were prescribed due to an ongoing influenza epidemic. The patient revisited our hospital four days after his initial presentation due to a persistent fever. A chest X-ray showed consolidation in the right lower lung field and the patient was admitted to our hospital (Fig. 1A). His vital signs on admission were as follows: temperature, 40.1C; heart rate, 127/min; blood pressure, 198/119 mmHg; respiratory rate, 28/min; and oxygen saturation on room air, 97%. There were no remarkable physical or laboratory examination findings. No infectious agents were detected in the patient's blood or sputum cultures on admission. The patient was negative for serum autoantibodies, serum antigens against fungi, and urinary antigens against pneumococcus and legionella. Piperacillin-tazobactem, azithromycin, and voriconazole were initiated from the first day of admission and switched to meropenem, levofloxacin, and amphotericine B on day 4. Peramivir and sulfamethoxazole-trimetoprim were added on days 2 and 3, respectively. In spite of the treatment, the patient's respiratory status worsened. On day 4 of hospitalization, his PaO2 level was 56 mmHg with the administration of 15 L O2 by a non-rebreather mask and his blood pressure was 68/41 mmHg. He was transferred to the intensive care unit (ICU) with mechanical ventilation (Fig. 1B). After noradrenaline therapy proved ineffective against the patient's persistent hypotension, hydrocortisone [200 mg/day (50 mg/day of prednisolone equivalent)] was administered to maintain circulation. His blood pressure subsequently increased to the normal range and his respiratory status showed improvement. The corticosteroid dosage was increased to prednisolone (60 mg/day) on day 9 of hospitalization, and he was successfully weaned from mechanical ventilation on day 11 without additional immunosuppressive agents (Fig. 2). The first TBLB on day 15 of hospitalization revealed the cardinal features of AFOP, namely, abundant fibrin exudate, immature organization in the alveolar spaces, and lymphoplasmacytic infiltration in the alveolar septa (Fig. 3A). The consolidation in the right lower lobe persisted, despite prolonged corticosteroid treatment, possibly suggesting another complication such as a fungal infection. A second TBLB performed on day 42 revealed the replacement of these features by fibroblasts and evidence of organization, which are the histological features of OP (Fig. 3B). Neither TBLB revealed any typical fibrin balls, hyaline membranes, eosinophilic infiltration, bleeding, vasculitis or infection. The diagnosis of AFOP and OP was made based on the histological and clinical signs. The dosage of the prednisolone was tapered to 7 mg/day when the patient recovered and was discharged on day 52 of hospitalization (Fig. 4). In spite of four months of azacytidine treatment, which was initiated after hospital discharge, the patient's MDS progressed to leukemia. Thereafter, the patient refused to undergo any additional chemotherapies or hematopoietic stem cell allograft transplantation. The patient died five months after hospital discharge. During the course of the disease, his respiratory status remained good.

PMC4816904_01

Male

We describe a 48-year-old gentleman with a 30 pack-year smoking history who was admitted for refractory hypoglycemia secondary to a suspected insulinoma. Biochemical work up proved positive warranting imaging studies with computed tomography (CT) chest/abdomen/pelvis to look for an underlying insulin-secreting tumor. His complete blood count showed a white blood cell count of 9.9 x 103/muL, hemoglobin of 13.8 g/dL, platelet count of 442 K/muL with an absolute eosinophil count of 0.1 K/muL. Complete metabolic panel revealed a mildly low sodium level and a glucose level of 34 mg/dL but was otherwise unremarkable. His liver functional tests were normal. His insulin level was elevated at 133 mIU/mL, as well as pro-insulin of 46.5 pmol/L, random cortisol of 129.1 mcg/dL, and c-peptide of 9.3 ng/mL. His vitals signs were normal and he was afebrile. Imaging studies revealed multiple pulmonary nodules, the largest measuring 1.4 cm x 1.2 cm in left lung (Fig. 1). Further serologic work up was negative for fungal and mycobacterial causes of pulmonary nodules as antibodies for histoplasma, aspergillus, coccidioides, and blastomyces were negative by immuno-diffusion and complement fixation. Interferon-gamma release assay for tuberculosis was negative. A CT guided core needle biopsy of the largest lung mass was done to rule out neoplasm and revealed a necrotic granuloma on microscopy (Fig. 2). This is not pathognomonic for parasitic disease in this case so other infectious etiologies were considered. The specimen was sent for fungal and mycobacterium culture which were negative at 4 and 6 weeks respectively. No sputum cultures or smears were performed on this patient in the acute setting, this is one of the limitations of our workup. Further inquiry of patient's social history revealed that the patient has three dogs, one of which was ill with fatigue, weight loss, and hair loss. He could not recall whether he had his dogs were treated for heartworm. The patient denied any travel history to suggest tropical disease and granulomatous diseases such as granulomatosis with polyangiitis and sarcoidosis were ruled out based on the appearance of the biopsy and the absence of any systemic signs or symptoms consistent with inflammatory disease. There were no fevers throughout his hospitalization and lab testing for autoimmune disease was not performed during the workup. While there was not a confirmatory test or obvious parasite on biopsy, clinically the patient was diagnosed with an indolent infection secondary to D. immitis. The patient was still experiencing repetitive, symptomatic episodes of hypoglycemia while on maximum medical therapy and was transferred to a quaternary care center for management of his biochemical insulinoma. The patient was discharged from the other facility without evidence of insulinoma.

canine host, dirofilaria immitis, parasite, zoonosis

CT scan of the thorax showing multiple pulmonary nodules.

PMC4074971_01

Male

In May 2009, a 62-year-old male patient was admitted with complaints of severe pain and edema in gluteal region. He had a history of cholecystectomy and pulmonary tuberculosis 3 years before. Pelvic computed tomography (CT) revealed a huge mass (15*13 cm) infiltrating the coccyx and most of the sacrum without any regional lymphadenopathies. Chordoma of the sacrococcygeal area was diagnosed by Tru-Cut biopsy under radiological evaluation. In June 2010, the chordoma in the sacral region was excised with tumor-free margins. Afterwards, adjuvant radiotherapy was applied for about 30 days; pelvic box tumor total dose: 50 gray in 25 fractions and boost tumor total dose: 10 gray in 5 fractions. After completion of the treatment, the patient was followed up 10 Gy boost dose was applied after 50 Gy to the total dose of 60 Gy in 30 fractions. 2 Gy was applied per fraction every weekdays. A local tumor recurrence developed after about two years and required additional surgical procedures. The patient was reoperated for its tumor recurrence. Soon after the operation, during routine examination, liver function tests were found moderately high. Abdominal computerized tomography (CT) revealed multiple hypodense lesions in the liver: 17 cm mass in the right lobe, about 7 cm mass in the left lobe, and 3 cm mass in junction of the right and the left lobe of the liver (Figure 1). Therefore, we decided to proceed fine needle aspiration of the lesion under ultrasound guidance. A histological examination of the biopsy from the liver lesion showed a metastatic focus from the sacrococcygeal chordoma (Figures 2(a) and 2(b)). We then decided to treat our patient with imatinib mesylate. However, the patient died because of hepatic failure before starting the treatment.

PMC4532013_01

Female

A 21 years old female was admitted for the evaluation of mild dyspnea. She had had symptoms of airway obstruction, such as wheezing, hoarseness and mild dyspnea since a young infant. She was premature at delivery with body weight of less than 2 kg. There was no family history of congenital anomalies. On admission, blood pressure was 140/90 mmHg, pulse rate was 80/min, body temperature was 36.5 C and respiration rate was 16/min. On physical examination, she was alert, but had a slight dyspneic appearance. There were no cyanosis, chest deformities and cardiac murmurs. Laboratory findings on admission were within normal ranges. There were no abnormalities on EKG. FEV1 was 1.52L (66.2% of predicted value) and FVC was 1.90L (54.5% of predicted value) on pulmonary function test. On bronchoscopy, the trachea was too narrow from the initiation to pass through. Complete cartilaginous ring without posterior membranous portion was found on the entire trachea (Fig. 1). The plain chest X-ray showed a right mediastinal mass-like density and a long-segment tracheal narrowing (Fig. 2). The Chest CT revealed the anomalous left pulmonary artery originating from the right pulmonary artery and its posterior course between the trachea and the esophagus (Fig. 3). She did not have any other cardiovascular and gastrointestinal anomalies. She was discharged without specific treatment because of mild symptoms which are mainly caused by complete tracheal ring and not by tracheal compression due to vascular anomaly. The term "Vascular Ring" was introduced to describe the mediastinal vascular anomalies causing tracheobronchial compression by Dr. Robert Gross who reported the first successful operation of a vascular ring. The pulmonary sling is a kind of vascular ring and the term was first used by Contro et al. in 1958 to distinguish it from other vascular anomalies). Carl et al. reported that when vascular rings were classified into four groups, as follows, 1) complete vascular rings with double aortic arch or right aortic arch 2) pulmonary sling 3) innominate artery compression and 4) miscellaneous, pulmonary sling was about 4.5%). Embryologically, it has been suggested that it is caused by a maldevelpment of the left ventral pulmonary artery bud due to growth failure or reabsorption. The left lung may capture its arterial supply by connection of the left postbronchial plexus with the right sixth arch through capillaries caudal to the lung bud. Then, as the lung bud grows caudally, the course of the left pulmonary artery is behind the developing trachea-bronchial tree). About half have cardiac or tracheo-bronchial anomalies which determine the prognosis. According to Christoph Dohleman's review, the associated cardiac anomalies were 49% and among those, patent ductus arteriosus, ventricular septal defect and atrial septal defect were most common. Tracheo-bronchial anomalies were associated in 56%. Tracheal stenosis with complete tracheal rings was the most common anomaly, followed by stenosis of main stem bronchus, tracheal bronchus and tracheo-esophageal fistula). Wells et al. proposed a classification system assigning pulmonary sling without complete tracheal rings to type 1 and pulmonary sling with complete tracheal ring to type 2. corresponding to the ring-sling complex. Ring-sling complex can be classified into a lethal form and a form in which there is enough pars membranacea left to allow sufficient tracheal growth. The two forms can be distinguished only by their clinical course, i.e., either severe respiratory symptoms with progression or mild symptoms without progression). Pulmonary sling can be diagnosed by angiography, CT or MRI. Bronchoscopy and echocardiography should be performed to evaluate the combined cardiac or tracheo-bronchial anomalies. The plain radiographic features include unequal aeration due to compression of the right main bronchus by the anomalous vessel, low carina, horizontal equal-length right and left mainstem bronchi and long-segment tracheal stenosis. Pulsating mass compressing esophagus can be visualized on fluoroscopy with barium esophagography). Most common finding in an asymptomatic adult is a right mediastinal mass. Diagnostic considerations such as dilated azygous vein, lymphadenopathy, foregut cyst or esophageal neoplasm should be excluded). We found a right mediastinal mass in our case. Most cases can be diagnosed by CT or MRI, but misinterpretation can occur because of a bifurcation-like structure of the pulmonary artery. The left pulmonary artery can be missed because of its different level of crossing the carina or main bronchus. Slice thickness should be as little as 3 mm). Potts et al. was the first to propose the now most common corrective surgical procedure: division and reimplantation of the anomalous left pulmonary artery into the pulmonary trunk anterior to the trachea with division of the ligamentum arteriosum). Because of high operation mortality and loss of function of the left lung due to obstruction of the reconstructed vessel, a conservative approach with symptomatic management was recommended initially). But recent development of operation technique has resulted in low operation mortality and good patencty of the reconstructed vessel. So, in view of the seriousness of this condition and the fact that reports of surgical management have been encouraging, current policy is to offer an operation as soon as the diagnosis is made).

Chest CT findings Anomalous left pulmonary artery originating from the right pulmonary artery and crossing between the trachea and the esophagus toward the hilum of the left lung.

PMC6522162_01

Male

A 22-year-old emaciated male presented to the gastroenterology clinic of our department with complaints of diarrhea and weight loss since the last 3 months. His old record revealed him to be a diagnosed case of celiac disease, having been diagnosed 3 years prior to this admission, which was based upon his Tissue Transglutaminase serology (TTG serology) and duodenal biopsy report (Figure 1). He was later started on gluten free diet (GFD) and was initially compliant on it for a year. Later on, he became non-compliant and had been so ever since then. Currently his loose stools were watery in consistency, occurring 7-8 times per day. They were foul smelling, being difficult to flush, associated with tenesmus and with weight loss of around 5 kgs during this same time period. He did not complain of decrease in his appetite during this time nor had any history of fever, nausea, vomiting or of dysphagia. On examination, he appeared severely wasted with thin brittle hair along with dry skin and had prominent costal margins (Figure 2). His initial lab reports showed a low hemoglobin 10.2 g/dL along with a low platelet count 102,000 109fL. He was also found to have a severe electrolyte in-balance along with a low potassium (2.5 mEq/L), a low calcium (7.6 mg/dL), low albumin 1.8 g/dL, high phosphate 6.4 mg/dL and deranged LFTs with a TBR 0.48 U/L, ALP 303 U/L, SGPT 101 U/L, SGOT 65 U/L GGT 29 U/L. His iron profile, B12 and folate levels were sent along with lipid profile, which were all within normal limits. Ultrasound abdomen was later done and revealed diffuse fatty liver. His currently height was 132cm, while his weight was of 11.5kg along with a BMI 6.8 kg/m2. A nutritionist was immediately taken on board and he was started on blendized diet along with total parenteral nutrition and with replacement of his deranged electrolytes. His condition later improved within a week followed by weight gain of 3 kgs in one week. His oral intake gradually improved and his intravenous nutritional support was gradually tapered off. He regained 4 kg of weight and was later discussed and advised for regular follow-ups.

bmi, celiac disease, nash, gluten free diet

PMC6551541_01

Male

A 16-year-old male complained of inability to flex his left elbow since 1 year prior to admission. One and a half year before, he fell down and hit his elbow during football practice. He felt pain and there was swelling on his elbow. However, he didn't seek for medical treatment. He had his elbow massaged every week for 5 months but there was no improvement. His elbow became fixed in extended position. A month later, he went to an orthopaedic surgeon and underwent x-ray examination which revealed a fracture and dislocation on his left elbow. He was then referred to our institution for further treatment. From clinical examination, range of flexion-extension of the elbow was 300-00 with normal pronation-supination. There was no neurological deficit (Fig. 1). From radiological examination, there was a malunion of medial epicondyle with subluxation of left proximal ulna (Fig. 2). From 3D CT reconstruction, there was a deformity and malunion fracture in humeral capitellum with radial and ulnar postero-superior dislocation (Fig. 3). The patient was diagnosed with extension contracture of the left elbow due to malunion of left capitellum, neglected dislocation of the radiohumeral joint, and neglected dislocation of the ulnohumeral joint. The patient was scheduled to have a contracture release, open reduction and internal fixation, and ulnar interposition. Intraoperatively, we did a posterior approach to the elbow. The ulnar nerve was identified and preserved. The fibrotic tissues and heterotopic ossification were excised. We did a contracture release and open reduction and internal fixation using K-Wire. The flexion and extension of the elbow were evaluated and we managed to get 300 - 130 of flexion-extension ROM. Afterwards, ulnar interposition was performed to prevent ulnar impingement. The wound was closed and a single drain was placed. The elbow was immobilized with back-slab in 900 flexion position for two weeks. After 1 week, the patient went back to our hospital for follow-up examination. In the 1st evaluation, we tried to remove the back slab and moved the elbow passively. The movement is restricted due to pain and the patient went back home with the back slab on. In the 2nd week follow-up, we permanently remove the back slab and the stitches. At that time, the pain still persisted and the patient was planned to have physical rehabilitation. On the 4th week after surgery, the surgical wound was infected. We performed debridement, implant removal, and manipulation under general anesthesia. Two weeks later, patient came back to our hospital. We removed the stitches and started rehabilitation. Later on, he continued his rehabilitation in his previous hospital. After 6 months, he visited our outpatient clinic for medical checkup. From physical examination, the elbow flexion-extension ROM was 1100 - 300 (Fig. 4). The patient is able to do normal daily activities (Fig. 5).

contracture release, elbow stiffness, functional elbow range of motion, malunion capitellum fracture, neglected dislocation of radial head and ulnar

PMC8042286_01

Female

A 31-year-old woman was admitted to our hospital with complaints of 4 months of breathlessness. She has noticed the onset of breathlessness 4 months ago and was admitted to the local hospital. Routine blood examination revealed a moderate degree of anemia (Hemoglobin 75g/L). A massive right-sided PE was identified on chest computerized tomography (CT) scans. She underwent thoracentesis. 3,000 ml hemorrhagic fluids were drained and contained no malignant cells. Breathlessness was relieved. She was discharged with a diagnosis of hemorrhagic pleural effusion of unknown origin. The patient was transferred to our hospital because of recurrence of dyspnea 2 months ago. She was a non-smoker and had a 4-year history of infertility and bilateral ovarian chocolate cysts. Two times of laparoscopic ovarian cystectomy have been done in the past 4 years. She had regular periods every 28 days, lasting 7 days with severe dysmenorrhoea. The physical examination was consistent with massive right-sided PE. A repeated Chest CT scan revealed massive right PE (Figures 2A,B). Thoracentesis and chest tube drainage were performed. Pleural aspirates revealed a deep red-colored hemorrhagic appearance (Figure 2C). Blood laboratory findings revealed anemia: hemoglobin 75g/l, red blood cells 3.9 x 1012/L, hematocrit 31%. Analysis of the pleural fluids showed the following values: red blood cell 260,000/mm3, hematocrit 2%, white blood cell 190/mm3, mononuclear cells 84%, total protein 50 g/L, albumin 33g/l, lactate dehydrogenase 260 IU/l, adenosine deaminase 15.5 IU/l, glucose 5.2 mmol/L, T-SPOT.TB 0 spot forming cells/106 PBMCs, normal carcinoembryonic antigen, negative tuberculosis/non-tuberculous mycobacterium DNA amplification, negative acid-fast bacilli staining, and negative culture for bacteria, fungi, and mycobacteria. Cytological examination of liquid based cytology (ThinPrepTM) smears showed scattered clusters of endometrial glandular cells (Figure 3A). Immunohistochemical staining of sediment cell blocks for estrogen receptor and progesterone receptor showed nuclear positivity (Figures 3B,C). A diagnosis of endometriosis-related PE was made. The patient was prescribed leuprolide (3.6 mg intramuscularly every month). At 14-month follow-up, there was no recurrence of breathlessness. Chest radiography showed a little right-sided pleural effusion. The patient underwent HBSO because of severe dysmenorrhoea, menorrhagia, and infertility. Oral Tibolone Tablets were prescribed (1.25 mg every day). Spontaneuos right-sided hydropneumothorax occurred 3 months later. The patient discontinued Tibolone tablets and the symptoms of cough and dyspnea improved. She declined repeated chest CT, thoracentesis, and thoracic surgery.

clinical features, diagnosis, endometriosis-related pleural effusion, hemorrhagic pleural effusion, thoracic endometriosis syndrome, treatment

PMC8192213_01

Male

A 71-year-old immunocompetent Caucasian male patient presented to the emergency department via ambulance a few hours after a fall from a height of 3 meters. After a primary survey, a computed tomography (CT) imaging revealed clavicle fracture, serial rib fractures associated with pulmonary contusion and hemopneumothorax on the left side, and non-displaced serial rib fractures on the right side. He underwent surgery with surgical stabilization with plates of the clavicle and the ribs on the left side and was discharged home on the 19th postoperative day (POD). Three months later, he presented with a painful swelling on his right chest wall without a history of new trauma or surgery on that side. Physical examination showed a large solitary swelling over the seventh/eighth rib, 3 x 5 cm in dimension. The lesion was soft, tender, fluctuating with defined margins, and not attached to underlying structures. In order to determine the cause of the swelling, we performed an ultrasonography and a CT Scan that showed a capsulated fluid collection (Figure 1). A diagnostic thoracoscopy showed no abnormal intrathoracic findings (Figure 2), and therefore, an open incision of the collection was performed. Intraoperatively, we confirmed the presence of an encapsulated abscess with purulent secretion coming out from a hole in the 7th rib (Figure 3). After partial resection of the affected rib and tissue sampling for histological and microbiological examination, a negative pressure dressing was applied (Wound V.A.C. Therapy; KCI, San Antonio, Texas). Histopathologic examination revealed extensive granulocyte infiltrates. The presence of Candida albicans was detected in the resected tissue but not in blood cultures (in absence of specific treatment). Dressing changes were scheduled every 3 days until a clean granulating wound without any residual sign of infection was obtained. Two weeks after the initial debridement of the infected tissue, the defect measured approximately 10 x 6 cm and was about 4 cm deep. After confirming the presence and course of a sizeable perforator originating from the superior epigastric artery in the proximity of the wound by means of a CT angiography and handheld doppler, a perforator-based superior epigastric artery perforator (SEAP) propeller flap was planned (Figure 4). After its harvest, most of the flap (about 70% of its surface) was deepithelialized and buried to adequately fill the dead space, while the distal tip of the flap served as a monitor to check its perfusion postoperatively (Figures 5 and 6). The postoperative course was thereafter uneventful, and the patient could be discharged 7 days after the wound closure. On the day of discharge, the wound was healing without any swelling or tenderness of the affected area. At 21 days follow-up, all the wounds were healed, and the patient was allowed to return to all normal activities without any restrictions. Further surgery to remove the monitor skin island under local anesthesia was offered for cosmetic reasons, but the operation was postponed due to the COVID-19 outbreak. He was treated with fluconazole for 6 months. After a 9-month follow-up, we found no evidence of infection or abnormal wound healing (Figure 7).

PMC4052119_01

Male

A 75-year-old man, treated for arterial hypertension, was diagnosed with stage I colon cancer. He was submitted to colon resection and one week later developed an infectious peritonitis, that was controlled with systemic broad spectrum antibiotics. One month after surgery, he presents to his general practitioner (GP) with daily fever (>38 C), weight loss, and progressive asthenia. Physical examination was not remarkable. The GP suspected infection and prescribed oral antibiotics. Blood tests showed pancytopenia (Table 2) with negative serology for HIV, B and C hepatitis, EBV, CMV, Rickettsia conorii, Leptospira, Borrelia burgdorferi, and Salmonella typhi. Active tuberculosis infection was also excluded. The condition extended for 3 months, with no response to treatment and clinical deterioration with unremitting fever. The patient was admitted to hospital where he began broad spectrum antibiotics (piperacillin-tazobactam 4,5 g, t.i.d.) and prednisolone 40 mg/m2. Repeated serologies and bacteriologic cultures were inconclusive. A thoracoabdominal CT scan showed a soft spleen enlargement (14,5 cm x 6 cm). The main clinical suspicion was an occult infection. Blood tests showed persistent and worsening pancytopenia, with hepatic cytolysis and cholestasis, elevated ferritin, and triglycerides (Table 2). A bone marrow biopsy was performed presenting signs of phagocytosis of blood elements. The diagnosis of HPS was then made (Figure 1). Despite the diagnosis, his clinical status worsened and rapidly evolved to multiorgan failure (MOF) with hepatic, respiratory, and cardiac dysfunction. He died 10 days after admission.

PMC4052119_02

Female

A 62-year-old woman with a previous history of bone tuberculosis in childhood presented with lymph node tuberculosis reactivation. She initiated therapy (isoniazid, pyrazinamide, rifampicin, and ethambutol), but after ten months treatment was interrupted due to pancytopenia. Drug toxicity was suspected, but pancytopenia persisted after stopping the treatment. A first bone marrow biopsy was inconclusive. The patient's hematologic cell counts continue to drop (Table 2) and a new medullar evaluation was compatible with a myelodysplastic syndrome with complex karyotype (chromosomes 5 and 7 deletions). Treatment with azacitidine was started and soon interrupted due to the presence of fever with absent signs of infection. The patient was admitted to hospital. The fever was refractory to antibiotics (imipenem, vancomycin) and fluconazole. The bacteriologic studies of urine, respiratory secretions, and blood cultures were negative. A high ferritin value of 19000 mug/L made the suspicion of HPS. Further tests revealed elevated alpha-chain IL-2 soluble receptor and low fibrinogen levels (Table 2). A new bone marrow biopsy revealed signs of hemophagocytosis (Figure 1). At this point, the diagnosis of HPS was made. Even though the patient did not present neurologic symptoms, a lumbar puncture was performed revealing high protein levels, indicating probable central nervous system (CNS) involvement. The patient began treatment with etoposide and dexamethasone and intrathecal methotrexate according to protocol HLH-94 with clinical improvement, resolution of fever, and continuous recovery of blood count (Table 2). She completed 8 weeks of therapy. Despite an initial clinical improvement, she was readmitted to hospital and died with septic shock due to a severe respiratory infection 2 months after completion of initial therapy.

PMC3515935_01

Female

A 13-year-old girl born at 32 weeks gestation with congenital hydrocephalus and VP shunt presents with abdominal distension, pain and vomiting. Her shunt was inserted at 12 days of age. This was followed by a shunt infection that was treated by shunt externalization and antibiotic therapy. The shunt was later reinserted back into the peritoneum. At the age of four, the shunt was revised because of a distal malfunction. There were no other abdominal or shunt surgeries. On examination, the patient was awake and alert, afebrile and neurologically stable with no evidence of raised intracranial pressure. The abdomen was markedly distended with diffuse tenderness and decreased bowel sounds. Ultrasound revealed significant dilatation of the small bowel loops and echogenic peritoneal fluid. CT showed large loculated/multiseptated abdominal cysts pushing the bowels and liver superiorly [Figure 1]. The VP shunt was externalized. The CSF was clear and the APC partially drained 1.8 L of yellowish fluid, and her abdominal symptoms subsided. CSF gram stain did not reveal any organisms and all cultures were negative. The leukocyte and erythrocyte count was 1 and 0, respectively. CSF protein and glucose levels were normal [Table 1] The shunt was converted to a ventricular-pleural (VPl) system and the patient discharged home. Follow-up chest X-ray revealed an increasing right-sided pleural effusion with no evidence of a shunt malfunction. Thoracentesis was performed and cultures were negative for bacteria, including slow growing and rare organisms such as tuberculosis. The VPl shunt was converted to a ventricular atrial (VA) shunt, with no complications. The patient has remained well for over 3.5 years.

abdominal pseudocyst, hydrocephalus, pediatrics, shunt complication, ventriculoperitoneal shunt

PMC3514531_01

Male

A 46-year old gentleman was admitted to hospital after having been found unconscious in his home. Past medical history included malignant melanoma that had been radically excised 9 years previously and the patient, after several controls, was believed to be in remission. There was no record of excessive alcohol- or other drug abuse. On admission the patient presented with a Glasgow Coma Score (GCS) of 3, a dilated left pupil, bilaterally brisk reflexes, and positive Babinski sign. There were no signs of neck stiffness, fever, petechiae, or trauma. S-100B was not acquired on admission (Figure 1). A CT scan showed a left-sided chronic subdural hemorrhage (SDH), resulting in a midline shift of 15 mm (Figure 2). Evacuation of the subdural hematoma was performed. Intra-operatively, the pressure within the hematoma was noted to be low. The brain parenchyma failed to resume its natural position after the evacuation. The first S-100B sample was obtained post-operatively 4 h and 22 min after the paramedics were alerted. S-100B was elevated (1.9 mug/l; Figure 1). The patient did not respond as well as is expected after an SDH evacuation. A follow-up CT scan on day 2 revealed a persistent midline-shift, as well as new occipital infarcts, assumed to be secondary to cerebral herniation. The patient improved to a GCS of 9 (E1 + M6 + V2; E, Eye; M, Motor response; V, Voice) on day 2. On day 4, the patient deteriorated, GCS 6 (E1 + M4 + V1). A CT scan revealed an increased midline-shift, so a re-evacuation was performed later the same day and an intra-cranial pressure (ICP) monitor (Codman ) was inserted. The dura was thicker than normal and the subdural mass did not look like a conventional hematoma, so samples were acquired for further pathological examination. Post-operatively the patient demonstrated a refractory critically unstable ICP ranging 15-30 mmHg and an increasing midline-shift on CT scan. Therapeutic management included hyperosmotic fluid, deep sedation with Midazolam, Morphine and Propofol, and hypothermia therapy. To facilitate treatment an external ventricular drain (EVD) was inserted. The S-100B levels were followed twice a day and showed an unusual peak of 22 mug/l (normal range <0.11 mug/l) on day 5 (Figure 1). Other sources of the extreme S-100B levels, including encephalitis, new cerebral infarctions, and extra-cerebral sources such as malignant melanoma, were pursued. Further head CT scans, including CT-angiography, showed no new findings. An EEG did not show any epileptic activity, MRI confirmed multiple infarcts, more than previously detected (Figure 3) yet no other information regarding the dura. A CT scan of thorax and abdomen showed widespread lung and liver metastases (not shown). Later day 5, a decompressive left-sided hemicraniectomy was performed (Figure 1, point E). While the S-100B declined post-operatively, the patient's ICP was still refractory unstable and the midline-shift remained 15-16 mm (Figure 4). Despite optimized neurosurgical intensive care, the patient showed steadily increasing ICP so treatment was finally withdrawn. The patient passed away on day 8 of his hospital stay due to brain herniation. The pathologist reported that extensive granulomatous tissue was noted within the hematoma and dura during the re-evacuation. The histopathological examination showed cells positive for S-100, Melan A, and HMB45, making metastases of malignant melanoma most probable. An autopsy confirmed malignant melanoma metastasis within the lungs, pleura, and lymphatic system. Metastatic tumor growth was also found in the brain parenchyma, dura, gallbladder, and kidneys. The protein S-100B is an increasingly used biomarker within neurosurgery and neurointensive care. The calcium-binding protein, which is synthesized and released by cells mainly found in the CNS (Moore,), is primarily an astrocytic protein but is also located in other cells of the CNS, such as neurons, oligodendrocytes, and choroid plexus epithelium (Steiner et al.,). Both serum and CSF S-100B have been proposed to be valuable biomarkers of traumatic brain injury (TBI; Herrmann et al.,). In the early process, S-100B can help estimate the extent of the primary injury (Herrmann et al.,; Savola et al.,), monitor potential secondary insults (Raabe et al.,; Bellander et al.,) and be an asset in outcome prediction (Herrmann et al.,; Savola et al.,; Thelin et al., submitted). Increased S-100B levels have also been found in patients suffering from ischemic cerebrovascular insults (Jonsson et al.,; Foerch et al.,). Vasospasm and long-term outcome in subarachnoid hemorrhages have been shown to correlate to increased levels of S-100B (Oertel et al.,). CNS infections may alter S-100B levels such as viral and bacterial meningoencephalitis and neuroborreliosis (Lins et al.,) and herpes simplex encephalitis (Studahl et al.,). Clinically, S-100B is also the most widely used biomarker in malignant melanoma patients (Smit et al.,). The main use is monitoring of advance disease, staining of histopathological samples and to evaluate the efficacy of therapy (Martenson et al.,; Smit et al.,; Egberts et al.,). Serum samples of S-100B were obtained on admission to Karolinska University Hospital and approximately every 12 h (06:00 and 18:00). All serum samples were arterial and analyzed using an automatic electro-chemiluminescence immunoassay (Elecsys S-100B ; Roche Diagnostics, Penzberg, Germany) method. The serum levels of S-100B and NSE, and radiological findings, were acquired using the medical files from the hospital database system Take Care (CompuGroup Medical Sweden AB, Farsta, Sweden). The ICP was acquired using ICU-Pilot (Dipylon Medical, Solna, Sweden).

s-100b, biomarkers, human, malignant melanoma, neurosurgery

PMC8399307_01

Male

A 56-year-old Bangladeshi male, presented with high grade fever and nodular skin lesions for 3 months. The skin lesions first appeared in the thigh followed by involvement of the trunk. Some of the lesions grew larger and ulcerated over time, releasing pus. He received several courses of antibiotics on suspicion of bacterial abscess without any significant improvement. His co-morbidities include hypertension, ischemic heart disease and chronic kidney disease secondary to long standing hypertension. He has been suffering from inflammatory oligoarthritis involving both knee joints and back for the last 2 years, which was labeled as undifferentiated spondyloarthritis. He took a number of NSAIDs and oral corticosteroids (prednislolone 20 mg daily) irregularly for pain relief. Intra-articular steroid injection was given on one occasion six months back. He had lost about six kilograms over 3 months. There was no previous history of TB or contact with known TB patients. On examination, his face was puffy with central obesity and relatively thin limbs. Thinning of the skin was also noted. There was neither lymphadenopathy nor organomegaly. Warm, tender, nodular lesions of variable size and shape were found in the abdomen (Fig. 1), back and thigh. Some of them were ulcerated. The largest one was located on the back, measuring about 4 x 3 cm (Fig. 2). Both knee joints were swollen with Grade 2 tenderness and there was restricted movement in all directions with positive patellar tap. Muscle bulk and power were reduced symmetrically and proximally in both lower limbs. Muscle tone was unaltered with normal deep tendon reflexes and flexor plantar responses bilaterally. Investigations revealed normal blood counts with high ESR (40 mm in 1st hour) and raised CRP (85.83 mg/L). S. creatinine was raised (1.7 mg/dL) and eGFR was low (30 ml/min/1.73 m2). Urinalysis revealed no abnormality. Microscopy and culture of urine for acid fast bacilli (AFB) were negative. Aspiration of pus from skin lesion revealed numerous AFB on staining (Fig. 3). Skin biopsy revealed perivascular infiltration of chronic inflammatory cells with mild acanthosis and exocytosis of epidermis. MTB-PCR of skin biopsy detected MTB DNA which was susceptible to Rifampicin. Culture of pus in Mycobacteria growth indicator tube (MGIT) revealed growth of MTB (Fig. 4). Sputum smear for acid fast bacilli (AFB) and culture for Mycobacterium tuberculosis were negative. High-resolution computed tomography (HRCT) of the chest and colonoscopy were performed to look for the primary focus of TB, but both were found to be normal. CT scan of abdomen and pelvis were normal as well. Tuberculin skin test was negative. A repeat test was performed after 8 weeks which was negative as well. 24 h urinary free cortisol was well above the normal range, measuring 227.05 mcg/day (Normal range: 50-190 mcg/day). Rheumatoid factor, anti-citrullinated protein antibody (ACPA) and HLA-B27 were negative with normal findings in plain X-ray and MRI of both SI joints. Early osteoarthritic changes were noted in plain X-ray of both knee joints. He has been given anti-tubercular therapy comprising isoniazid, rifampicin and pyrazinamide in full dose and ethambutol with renal modification. After one month of taking the anti-tubercular drug, his skin lesions improved significantly.

cutaneous tuberculosis, metastasic tuberculous abscess, tuberculous gumma

PMC8280816_01

Female

A 29-year-old female with a past medical history of polysubstance abuse (methamphetamine/heroin), chronic hepatitis C, and seizures presented to the emergency room in September 2019, with a complaint of full body aches, fever, chills, diffuse chest pain, shortness of breath, and yellow to bloody sputum production for 3 days before admission. Three weeks prior to presentation, she had a cardiorespiratory arrest after a heroin overdose and required cardiopulmonary resuscitation with chest compressions. She was previously in drug use (naltrexone) remission which was discontinued due to elevated liver enzymes. The last time she used methamphetamine was 3 days prior to admission, without having withdrawal symptoms. She used sterile needles obtained from an exchange clinic, did not share or lick them but admitted sharing the water used to mix drugs. Her lactic acid levels were moderately elevated (2.17 mmol/L) but her other lab work-ups including the WBC count, were normal. A trans-esophageal echocardiogram was negative for vegetation. Chest X-ray and computerized tomography (CT) scan of the chest (Figure 1) confirmed multifocal pneumonia. The chest CT (Figure 1A) showed bilateral airspace opacities throughout the right upper, middle, and lower lobes, including the lingula. No cavitation or pleural effusions were seen to suggest septic emboli. Mediastinal and hilar structures demonstrated no filling defects within the pulmonary arteries to suggest pulmonary emboli. Patient vitals remained stable. Two sets of blood cultures were collected and incubated at 35 C in the BACTEC FX system (Becton Dickinson, Sparks Maryland) and the patient was started on vancomycin (1500 mg, intravenous (IV), every 12 hours) plus piperacillin/tazobactam (3.375 g, IV, every 8 h). Despite antimicrobial therapy, she continued complaining of diffuse chest pain and cough. The second blood culture became positive at 3 days of incubation. The blood culture was sub-cultured onto blood, potato flake, Sabouraud's, CHROMagar, and corn meal agar plates and incubated at 30 C. Azithromycin (500 mg, IV, every 24 hours) and micafungin (100 mg, IV, every 24 hours) were added to the therapeutic regimen. A wet preparation showed narrow-necked budding yeast-like fungus (Figure 2A) primarily consisting of round to oval cells, and the Gram stain revealed budding yeast-like cells (Figure 2B). Growth was observed after 24 to 48 hours of incubation on all agar mediums and characterized as smooth, pin-point small white colonies (Figure 2C and D). Appearance on CHROMagar did not identify any Candida species while morphological assessment on corn meal agar was suggestive of a yeast-like fungus predominately, round to oval in appearance. Matrix-assisted laser desorption/ionization:time of flight (MALDI-TOF) mass spectrometry analysis (Bruker Daltonic, Billierica, MA, USA using Bruker flexAnalysis and flexControl software version 3.4), performed 3 independent times, failed to identify the organism. Yeast within the genus Candida and, Cryptococcus due to the observation of narrow neck budding, were in the differential but was pending confirmation. Symptoms subsided after antifungal administration and a chest X-ray showed relative improvement. Additional tests (HIV, TB, and Legionella) were unremarkable. The sputum culture was predominately indigenous oral flora. The yeast-like colonies were sent for molecular testing (ARUP Laboratories, Salt Lake City, Utah). The rDNA sequencing, targeting the ITS1 (internal transcribed spacer 1) region, identified the organism as Sporopachydermia lactativora (NCBI #, AF202900.1 (%ID = 100%; hits (444/444)). Antifungal susceptibility testing (YeastOne, Sensititre, Thermo Fisher) was performed and MIC values were provided to the treating clinician with no interpretations for sensitivity or resistance, as there are no interpretive criteria for this species. The reported antifungal MIC values for this species were as follows: Micafungin (8 mug/mL), AmphotericinB (0.5 mug/mL), Itraconazole (0.06 mug/mL), Anidulafungin (2 mug/mL), Capsofungin (4 mug/mL), Fluconazole (<=0.12 mug/mL), Flucytosine (<=0.06 mug/mL), Posaconazole (0.06 mug/mL), and Voriconazole (<=0.008 mug/mL). The patient continued on intravenous micafungin (100 mg, IV, every 24 hours) for the duration of her hospital stay. Her clinical condition improved and she was discharged 13 days after admission, with micafungin (100 mg, IV, every 24 hours) as part of her continuing treatment. Micafungin was discontinued when she showed no further respiratory symptoms on her follow-up visit (11 days after her discharge). Her lungs were clear on auscultation.

fungus, sporopachydermia, infection, pathogenesis, pneumonia

PMC1087842_01

Male

A 47-year-old man was hospitalized in our intensive care unit (ICU) for generalized seizures and hypotension. Three days before admission, he suffered from fatigue, fever, vomiting, abdominal pain and lower GI hemorrhage. He was homeless and a chronic alcoholic. Physical examination showed general status impairment, with a temperature of 36.5 C and a Glasgow Coma Score of 10. No focal neurological deficit was noted. His blood pressure was 80/26 mmHg, his heart rate 106 /min and his respiratory rate 36 /min. His abdomen was tender with hepatomegaly. Usual blood tests showed a creatinine of 413 mumol/l (N <120), white blood cell count of 15.1 x 106 /l (N: 4 x 106-10 x 106) with 85% polymorphonuclear leukocytes, hemoglobin of 8.5 g/dl (N: 13-18) and platelets 178 x 106 /l (N: 150-400). He presented with severe lactic acidosis (arterial pH 7.21 (N: 7.34-7.45), PaCO2 3.7 kPa (N: 4.3-6.0), blood bicarbonate 11 mmol/l (N: 20-26), and plasma lactate 22 mmol/l (N: 1-2)). His prothrombin time was 9% (N>75%), fibrinogen 3.72 g/l (N: 2-4), factor V 25% (N >75%), and factors II + VII 5% (N >75%). Other tests showed an AST of 4,480 UI/l (N<50), an ALT of 2,340 UI/l (N<50), bilirubin 67 mumol/l (N<17), LDH 24,500 UI/l (N<275), lipase 11,820 UI/l (N<200), and creatine phosphokinase 3,330 UI/l (N<170). Abdominal ultrasonography showed an enlarged liver without ascites. The chest X-ray, electrocardiogram, cerebral CT scan were unremarkable. The patient was intubated. He received IV infusions of norepinephrine (6 mg/h), dobutamine (15 mug/kg/min), omeprazole (80 mg/day), N-acetylcysteine (300 mg/kg over 20 h), cefotaxime (3 g/day) and metronidazole (1.5 g/day). Continuous hemodiafiltration was started. Cultures of blood, urine, stools and tracheal aspiration were negative. Toxicological screening tests, including acetaminophen, ethanol, ethylene glycol, and methanol were negative. HIV-1 ELISA serology was positive, CD4+ lymphocytes count 160 x 106 /l (N >700), and HIV-1 RNA level was 5.8 x 105 copies/ml. Bronchoalveolar lavage (BAL) showed 2.5 x 108 cells/l with 58% lymphocytes. A diagnosis of Mycobacterium tuberculosis infection was rapidly assessed by an amplification assay (Amplified Mycobacterium Tuberculosis Direct Test, Gen Probe, California) and retrospectively confirmed by BAL cultures. Isoniazid, rifampicin, ethambutol, and pyrazinamide were started on day 3. Endoscopic examination showed grade II esophageal varices, moderate peptic esophagitis, erythematous gastritis with cardial superficial ulcerations without active bleeding, and normal duodenum and colon. CMV culture using MRC5 cells inoculation was positive in blood but not in BAL. CMV amplification assay was negative in the cerebrospinal fluid. Histopathologic analysis of a gastric biopsy showed edema, inflammatory infiltrate and typical intranuclear cytomegalic inclusion bodies in endothelial cells in mucosa. Immunohistochemistry with a specific anti-CMV antibody (E13, Argene, France) confirmed active CMV infection of the stomach (Fig. 1). Specific staining and culture were negative for Helicobacter pylori. As soon as these results were known (on day 10), ganciclovir was started. Concomitant abdominal CT scan disclosed large and heterogeneous peripancreatic hypodensities, mildly enhanced following contrast infusion (Fig. 2). However, their exact etiology remained undetermined. The patient developed hospital-acquired Pseudomonas aeruginosa pneumonia and his condition worsened. He died 30 days after admission. Postmortem examination showed a large, well-circumscribed gastric perforation with a diameter of 4 cm. The stomach was solidly adhered to the transverse colon and to the lower face of the liver. There was a thick necrotic and hemorrhagic inflammatory coating around the pancreas, which, in contrast, appeared macroscopically normal. The whole GI tract, except the stomach, was normal. CMV infection of the GI tract can cause severe damage. Isolated involvement of the stomach is possible, although rare. Symptoms are not specific, including unexplained fever, dysphagia, sharp or postural epigastric pain, vomiting, diarrhea, and GI bleeding. Characteristic upper endoscopic findings are edema, congestion, mucosal ulcerations, multiple punched-out gastric ulcers, erosions, and upper GI hemorrhage. However, findings may be mild showing congestion and thickening or be atypical, with hemorrhaged necrotic gastritis or pseudo-tumors. Multiple mucosal biopsies are needed to detect CMV. In HIV-infected patients, CMV is significantly associated with chronic active gastritis or gastroduodenal ulcers, in contrast with healthy adults, in whom symptomatic CMV gastric infection is exceptional. Thus, early recognition of CMV GI infection, including blood cultures and cautious GI endoscopic evaluation, may allow for adequate therapy, preventing complications, such as life-threatening bleeding or perforation. CMV infection activates endothelial cells and leukocytes, altering GI microcirculation and inducing extensive vasculitis, thrombotic vascular occlusion, necrosis, and ischemic perforation. The most common reported locations of intestinal perforation are the colon (53%), the distal ileum (40%), and the appendix (7%). CMV-associated perforation of the stomach is a rare presentation. To our knowledge, isolated CMV-induced gastric perforation has only been reported in non-HIV organ transplant recipients. In our patient, CMV-associated gastric perforation, as a presenting manifestation of HIV infection, was responsible for multiorgan failure. The diagnosis was difficult, in the absence of acute abdomen and pneumoperitonium. Consistently, initial endoscopic examination missed the gastric perforation, since the hole in the stomach was probably filled in by peritoneum. Moreover it is possible that a suboptimal endoscopic evaluation of the upper GI tract was due to the patient's initial unstable condition and the performance of the gastroscopy in such a critical situation. In contrast, concomitant abdominal CT scan showed large hypodense images surrounding the pancreas, attributed after postmortem examination, to the hemorrhagic and necrotic inflammatory materials that filled in the gastric perforation. Alternative causes of gastric ulcer, including Helicobacter pylori infection, should be discussed. Indeed, CMV is an opportunistic virus and may thus appear in previously damaged tissues. However, a recent study suggested that CMV, rather than Helicobacter pylori, may be the main causative pathogen of peptic ulcers in HIV-infected patients, in comparison to non HIV-infected ones. In our case, histopathologic findings and cultures were negative for Helicobacter pylori. Moreover, CMV inclusion bodies, which were observed on initial pathological findings, clearly indicated the existence of a CMV disease at the patient's admission. Usually, resolution of symptoms and endoscopic findings is obtained with IV ganciclovir or foscarnet. Combined antiretroviral therapies may also be effective, even without specific treatment of CMV. However, in the case of perforation, despite immediate surgical resection and antiviral therapy, mortality rate remains elevated (> 80%), due to elevated operative mortality and increased postoperative complications. In our case, ganciclovir therapy successfully reduced CMV viral load before the occurrence of death, which resulted from misdiagnosed gastric perforation.

PMC9759007_01

Male

A 10-week-old baby boy presented to Chawama First Level Hospital in Lusaka, with a history of i) coughing for 2 weeks prior to the visit, ii) sneezing, iii) refusing to breastfeed, iv) intermittent fevers, and v) general irritability and being difficult to console. His medical history revealed that he was HIV exposed (HEI) and had been on neonatal prophylaxis (Nevirapine 1.5 mL OD, Zidovudine/lamivudine 1.5 mL BD, Cotrimoxazole 2.5 mL OD) from birth and HIV DNA PCR testing done at 6 weeks was negative. The child was born at term via spontaneous vaginal delivery, had a birth weight of 3.8 kg, was exclusively breastfed, and received all age-appropriate vaccinations (BCG and OPV at births; OPV, PCV, Rota, and HepB, HiB, DPT at 6 weeks). There was no family history of sickle cell disease or positive tuberculosis contact.

infancy, invasive pneumococcal disease, malaria, newborn screening, severe anemia, sickle cell disease

PMC9639711_01

Unknown

In this study, the clinical characteristics and outcomes of 66 cancer patients with coronavirus disease-19 have been reported. The median age of participants was 61 years old and the main symptoms were fever, cough, and fatigue. Leukemia and lymphoma were the most prevalent cancer among patients followed by breast cancer. Our results showed that cancer patients had anemia, lymphopenia, and leukopenia. A quarter of our patients were admitted to the ICU and received HCQ and corticosteroids. About 71.4% of COVID-19-infected cancer patients received at least one antiviral drug, such as ganciclovir, lopinavir/ritonavir, arbidol, and ribavirin, while 32.1% were treated with two or more than two antiviral drugs. All patients with abnormal chest CT showed a GGO. The rate of mortality in cancer patients with COVID-19 was 23% and was not significantly different from among cancer COVID-19 patients with different stages. Cancer patients have several risk factors that put them at higher risk for COVID-19 infection, such as suppressed immune systems, older age, increased comorbidities (e.g., diabetes, chronic lung disease, and cardiovascular disease), and need for frequent hospitalizations and referring to the hospital for chemotherapy. According to a study conducted in the USA, increased rate of mortality in cancer patients with COVID-19 is significantly linked with older age, need for ICU support, multiple comorbidities, and elevated levels of lactate dehydrogenase, D-dimer, and lactate. Three of these items including elevated levels of D-dimer, lactate dehydrogenase, and higher incidence of comorbidities were found in COVID-19-infected cancer patients in our study as well. Fatality rate in their study was 28%, which is almost similar to our result (23%). The double-arm meta-analysis by ElGohary et al. showed that cancer patients had a higher risk of mortality, ICU admission, severe/critical disease, and mechanical ventilation than noncancer patients, but the rate of ICU admission was not significantly different between groups in a case-control study performed in Iran (P > 0.05). This study also reported significantly higher rate of dry cough (75.0% vs. 29.2%, P = 0.01) and fever (72.7% vs. 45.8%, P = 0.02) in COVID-19 cancer patients, but these differences were not significant in our study between these groups. In their study, gastrointestinal cancer was the most frequent type of cancer followed by breast cancer and hematologic. Nine (37.5%) of their cancer patients were at stage 4, while in our study, only 20% were diagnosed with metastatic cancer. The prevalence of breast cancer in both studies was similar, 18.18% in our study versus 20.8% in study by Taghizadeh-Hesary et al. In our study, 77.1% of COVID-19 cancer patients had anemia, which is higher compared to prevalence of anemia in general COVID-19 population (48.2%) reported by another study in Iran and 24.7% reported by Bellmann-Weiler in Austria. According to their results, the rate of death was almost twice in patients with anemia compared to the rest of COVID-19 population. It has been reported that the higher percentage of anemia in COVID-19 cancer patients may be the result of malnutrition and an immunosuppressive condition that leads to the increased susceptibility to respiratory pathogens. According to a cohort study in the USA, on admission, anemia was independently associated with increased risk of all-cause mortality in COVID-19 patients, but it was not significantly linked with severe outcomes during hospitalization. A recent study of 259 patients with COVID-19 by Bellmann-Weiler et al. also confirmed these results that anemia on admission but not iron deficiency is an independent predictor of COVID-19 related mortality. For both cancer and general COVID-19 patients in our study, GGO was the most occurred feature of chest CT imaging followed by patchy consolidation, which has higher prevalence in COVID-19 cancer patients as a bilateral lung involvement than regular patients. These findings are in line with the results of study by Zhang et al., Vuagnat et al., and Taghizadeh-Hesary et al., named the GGO as the most common imaging result. A nationwide analysis on cancer patients with coronavirus in China showed that patients undergoing chemotherapy or cancer-related surgery were more likely than general COVID-19 patients at the risk of severe clinical events. Our study showed an increased risk of mortality and serious clinical events due to the COVID-19 infection in cancer patients after surgery. However, the risk of side effects from cancer treatments does not appear to increase. The true effects of COVID-19 on cancer patients will be known in the near future. Evidence suggests that cancer is associated with worse clinical outcomes in patients with COVID-19. However, elderly patients with cancer may not be at risk of death if they develop COVID-19. These findings could potentially help physicians discuss with patients about their disease conditions to provide a prognosis and maybe, guide health policy. In the field of cancer, it is clear that the earlier the diagnosis of malignancy or cancer, the better the clinical outcome for the patient. Most health-care protocols have now follow safety guidelines and procedures, which have significantly reduced the risk of viral outbreaks when encountered in their health-care facilities. False negative results of COVID-19 test and incomplete information of some patients are the limitations of our study.

covid-19, coronavirus, neoplasms, retrospective case study, severe clinical events

PMC8127742_01

Male

Our case involved a 12-year-old male, who was diagnosed with relapsed AML 4 months after treatment. He was initially diagnosed with AML (French-American-British (FAB) classification: M0) 11 months prior to the relapse. Bone marrow aspiration (BMA) performed after the relapse revealed a blast frequency of 93.6% (FAB classification: M0). Peroxidase staining showed that the blasts did not contain any Auer bodies (Figure 1), and the blasts were positive for CD13 (29.8%), CD33 (99.8%), CD11b (98.4%), and CD34 (99.7%) and negative for cytoplasmic myeloperoxidase. Chromosomal analysis of the bone marrow revealed the following karyotype: 46, X, -Y, t(7; 12)(p15; p12), +10[4]/46, XY[7]. FLT3-ITD, a specific chimeric gene; chromosomal abnormalities (affecting chromosomes 5, 7, and 8); and central nervous system metastasis were not detected during the initial diagnosis or at relapse. After the initial diagnosis, the patient received five courses of chemotherapy (cytarabine, etoposide, and anthracycline) on the basis of his standard risk profile (the core-binding factor was not affected). After the diagnosis of relapse, the patient received a course of FLAG-IDA-GO (30 mg/m2 fludarabine, 5 days; 2 g/m2 cytarabine, 5 days; 10 mg/m2 idarubicin, 1 day; and 3 mg/m2 gemtuzumab ozogamicin, 1 day) and one intrathecal injection (IT) [7]. Since a BMA examination performed after bone marrow recovery, that is, at 1 month after the first course of FLAG-IDA-GO indicated a non-CR (50.4%), we added a week of azacytidine. Thereafter, BMA showed a blast frequency of 87.8%, and chromosomal analysis revealed a karyotype of 46, X, -Y, t(7; 12)(p15; p13), +10[6]/46, XY[5]. Since in vitro drug sensitivity tests suggested that antimetabolic agents, such as clofarabine, and alkylating agents, such as cyclophosphamide and etoposide, would be effective, we then attempted combination chemotherapy involving clofarabine, cyclophosphamide, and etoposide (40 mg/m2 clofarabine, 5 days; 440 mg/m2 cyclophosphamide, 5 days; and 100 mg/m2 etoposide, 5 days) and one IT. After approximately 1 month, BMA indicated that CR and normal chromosomal findings had been achieved. Then, a second course of the same regimen (cyclophosphamide was administered at half the previous dose) was administered. After two courses of clofarabine had been administered, no severe clofarabine-associated adverse events were noted, except for febrile neutropenia, which was controlled with antimicrobial drugs (common terminology criteria for adverse events (CTCAE) grade 3); hepatotoxicity (increased aspartate aminotransferase levels (CTCAE grade 2) and increased alanine aminotransferase levels (CTCAE grade 2)); and bone marrow suppression (anemia and decreased neutrophil, white blood cell, and platelet counts (CTCAE grade 4 for all events)). After the second course of clofarabine, cyclophosphamide, and etoposide, the patient underwent allogeneic BMT from his father (completely matched for the human leukocyte antigen DNA type), which involved a preparatory regimen comprising total body irradiation (TBI) (12 Gy) and cyclophosphamide (60 mg/kg, 2 days). The BMT was successful and did not result in severe complications, and neutrophil engraftment was confirmed on day 29. Grade 4 acute graft-versus-host-disease (GVHD), involving intestinal symptoms, was temporarily observed and controlled with cyclosporin and prednisolone. Gradual amelioration of the acute GVHD was achieved through immunotherapy. BMA revealed a normocellular bone marrow without blasts, and hematological CR was maintained for 12 months after the BMT. Also, complete chimerism was detected using short-tandem-repeat analysis, and chromosomal analysis revealed a karyotype of 46, XY[20/20].

clofarabine, pediatric, relapsed acute myeloid leukemia

PMC6546941_01

Male

A 71-year-old Japanese man was admitted with new onset jaundice, leg swelling, abdominal distention, pruritus, multiple ecchymotic lesions, and mild behavioral changes. He reportedly had history of easy bruising, epistaxis, and bright red blood per rectum, which worsened around 3 days prior. He reported recent intake of 1600 mg of ibuprofen and 4 g of acetaminophen, taken over a period of 3 days, about 8 days prior to presentation. In addition, patient reported a 20-year history of alcohol abuse. On examination, patient was icteric, with multiple ecchymotic lesions. Labs showed severe thrombocytopenia and moderate neutrophilic leukocytosis. He had elevated total bilirubin (9.7 mg/dL), Aspartate Transaminase (AST) of 645 U/L, Alanine Transaminase (ALT) of 175 U/L, and Alkaline Phosphatase (ALP) of 834 U/L. Prothrombin time (PT)/International Normalized Ratio (INR)/activated partial thromboplastin time (APTT) were 13.6/1.29/43 seconds, respectively. Toxicology screen was negative. Creatinine was 5.33 mg/dL, estimated glomerular filtration rate 11 mL/min, sodium 124 mmol/L, and blood urea nitrogen 42 mg/dL. Ammonia was <10 umol/L, ceruloplasmin level was normal at 39.9 mg/dL. Hepatitis panel, Quantiferon tuberculosis gold assay, and Human Immunodeficiency Virus antibodies were negative. Cytomegalovirus (CMV) IgG Ab was 2.5 U/mL, Epstein Barr Virus (EBV) capsid Ag IgG Ab was 225 U/mL, and EBV Nuclear Ag Ab titer was 224 U/mL. Autoimmune markers were within normal limits. Computed tomography (CT) scan of the abdomen showed hepatomegaly with mild diffuse hepatic fatty change and mild anasarca characterized by small volume ascites and small bilateral pleural effusions. Magnetic resonance (MR) imaging of the abdomen showed hepatomegaly without evidence of diffuse infiltrative process or hepatic mass, but there was nonspecific peri-portal edema, which was favored to be secondary to hepatitis. Computed tomography of the chest did not show any visible lymphadenopathy but showed small bilateral pleural effusions. Drug induced liver injury and alcoholic cirrhosis were initial considerations. Over the course of hospitalization, patient's condition deteriorated with worsening coagulopathy, neutropenia, and anemia requiring multiple transfusions of blood products including factor concentrates. Progressive renal failure required hemodialysis. A liver biopsy was performed and pathology revealed an atypical proliferation of small/medium-sized lymphoid cells involving the hepatic parenchyma (Figure 1). Immunohistochemical studies (IHC) showed a marked predominance of atypical CD20-positive B-cells consistent with B-cell lymphoma (Figure 2). The lesional cells were predominantly distributed within sinusoids with expansion and forming medium-sized atypical aggregates involving portal tracts, evidenced by intact bile ducts centered within the aggregates (Figure 3). There was no evidence of large nodules or sheets of large cells. Additional IHC studies showed aberrant co-expression of BCL6 and fluorescence in situ hybridization (FISH) studies positive for t(14; 18) most consistent with follicular lymphoma, grade 1 to 2. A bone marrow biopsy showed significant involvement by lymphoma. Epstein Barr Virus in situ hybridization studies were negative. The background liver showed features of obstructive cholestasis. There was no evidence of peripheralized lymphoma by flow cytometry. He received a total of 4 weeks course of rituximab and 2 weeks course of melfalan chemotherapy. Adriamycin was not started due to significant hyperbilirubinemia. During hospital stay, total bilirubin was elevated up to 48.9 mg/dL which slightly improved after commencement of chemo, in addition to reduction in transaminases. He remained coagulopathic with INR of 2.03, APTT of 126 seconds, and PT of 21.4 seconds. Lactic acid increased up to 16.3 mmol/L. He also developed increasing ascites and paracentesis showed elevated polymorph nuclear cell count of >250 cells/mm3. Because of this, appropriate treatment for spontaneous bacterial peritonitis was initiated. Our patient died 40 days after admission due to septic shock, atrial flutter, acute renal failure, and eventual hypoxic respiratory failure.

sub-acute liver failure, follicular lymphoma, primary hepatic lymphoma

PMC7276597_01

Male

A 24-year-old patient was admitted to our department due to a car accident with multiple injuries, including femur fractures of both sides which were treated with plate osteosynthesis in Belarus. No complication was apparent on the left side. However, a persistent wound secretion with subsequent osteomyelitis was present on the right side 3 years after initial surgery even after adequate surgical debridement and antibiotic regime. Biopsy revealed methicillin-resistant and borderline oxacillin-resistant S. aureus (BORSA). X-rays confirmed osteomyelitis with a sequestrum, a fistula, and significantly reduced bone stock. The patient presented with an Ilizarov ring fixator in situ in our department for the 1st time in 2012. The Ilizarov ring fixator was implanted in Belarus in 2011. The patient preferred an exceptional salvage procedure to preserve the limb since amputation was not an option (Fig. 1). Therefore, we suggested a two-step-surgery approach to treat the osteomyelitis before performing the definitive osteosynthesis. The Ilizarov ring fixator was removed and a vigorous debridement was performed by refreshing the pseudarthrosis, removing the sequestrum, and dead bone. Finally, an AO fixator external was implanted after several efficient debridements (Fig. 2a and b). An antibiotic therapy was established with vancomycin (20 mg/kg/d) for 4 weeks followed by clindamycin (1800 mg/d) and co-trimoxazole forte (sulfamethoxazole 2400 mg/d/trimethoprim 640 mg/d) for 6 weeks. Ciprofloxacin (1500 mg/d) was additional given for the first 2 weeks during the treatment with clindamycin. The AO fixator external was removed after 10 weeks of antibiotic treatment and surgery was performed after an additional antibiotic-free window of 5 weeks. We decided to perform a definitive treatment without intraoperative local antibiotic carrier application since the laboratory blood test revealed no elevated infection parameters. Moreover, no signs of persistent infection were found during the operation. The bone defect was stabilized by a long gamma trochanteric nail (Stryker, UK). A wide resection of the non-union tissue was performed which was crushed and placed beside the nail to bridge the defect zone (Fig. 2c and d). Surprisingly, biopsies of the proximal and distal non-union side revealed the same bacteria and resistogram when compared to the initial biopsies taken before the rigorous debridement procedures (Table 1). However, reimplantation of crushed bone tissue from the infected side did not result in a relapse of osteomyelitis. The most likely bacteria load was reduced and the local effect of antibiotics was improved by crushed bone even when used from non-union infected side. Antibiotic therapy was established with vancomycin (20 mg/kg/d) for 2 weeks followed by co-trimoxazole forte (sulfamethoxazole 2400 mg/d/trimethoprim 640 mg/d) for 10 weeks. Neoangiogenesis proceeds much faster in small autologous fragments as in large dimensioned bone stock. Therefore, the blood supply increased around the affected area along with the bioavailability of antibiotics. Frequent radiographic and clinical controls showed remodeling of the femur during a period of 3 years with partial weight-bearing and no signs of infection (Fig. 3). Due to the bone spanning with cancellous bone and the increase soft tissue tension by an infected, shortened, and for 3 years not loaded leg, we decided to restore the leg length of 4 cm in a further step. The long gamma trochanteric nail (Stryker, UK) was removed after 2 years of no signs of in-fection and limb lengthening procedure was carried out by implanting a fully implantable mo-torized lengthening nail (Fitbone , Wittenstein, Germany). In addition, a varus supracondylar femur osteotomy was performed to correct for biomechanical alignment (Fig. 4a and b). The fully implantable motorized lengthening nail (Fitbone ) was removed after successful limb lengthening and final bone biopsies revealed no infection (Fig. 4c and d). Due to the long period of rest and partial loading, the knee and hip joint was severely re-stricted in the range of motion (ROM) and the bone showed osteopenia in the radiological control. After intensive physiotherapeutic treatment, the patient achieved an unrestricted ROM with his indolent hip and knee joints.

osteomyelitis, antibiotic availability, crushed bone, femur shaft fracture, infected pseudarthrosis

PMC9726257_01

Male

A 46 year old man presented with a 7 month history of episodic pain and swelling of left knee joint, nocturnal fever, productive cough, loss of appetite, and on and off painful erythematous skin nodules on arms and legs. He was a known patient with type 2 diabetes mellitus who was not receiving proper treatment. He was a smoker and admitted to excessive alcohol consumption. He was not taking any long-term medication. On examination, he was averagely built with a swollen, warm, and tender left knee joint with restricted movements. There were tender subcutaneous nodules over the left arm and right thigh, compatible with a clinical diagnosis of erythema nodosum. He also had finger clubbing and bilateral cervical and axillary lymphadenopathy but no hepatosplenomegaly or organomegaly, and the rest of the examination was essentially normal. His initial investigations revealed a normochromic normocytic anaemia with haemoglobin of 84 g/L, moderate rouleaux formation, normal platelet, and white cell count with neutrophil predominance. The blood picture showed evidence of an infective or inflammatory process. His inflammatory markers were elevated, with a CRP of 42 mg/L and an erythrocyte sedimentation rate (ESR) of 138 mm/1st hour. Renal and liver profiles were normal apart from hypoalbuminaemia with reversed albumin globulin ratio. Lactate dehydrogenase level (LDH) was elevated (398.4 U/L). His chest radiograph revealed prominent bilateral hilar lymphadenopathy. Contrast-enhanced computed tomography (CECT) of the abdomen and chest revealed multiple discrete lymphadenopathy in the bilateral axillae, cervical, hilar, paratracheal, subcarinal, and para-aortic regions. Additionally, the high-resolution computed tomography chest revealed paraseptal emphysema, fibrosis, a thick-walled cavity in the right upper lobe apical segment with a ground glass appearance, and a patchy consolidation in the left lingual region. Findings were more suggestive of an infective pathology than sarcoidosis. Mantoux test was 13 mm and sputum was thrice negative for acid fast bacilli initially. At this point, the patient defaulted on follow-up for 3 months until he presented to the medical casualty with severe pain and swelling of the left knee joint and painful subcutaneous nodules on the legs and arms. The joint aspirate was blood stained and subsequently diagnosed as haemarthrosis. A skin biopsy was done for the skin nodules as well, for which he developed delayed bleeding from the biopsy site. A coagulation screen was performed, which revealed an isolated prolongation of activated partial thromboplastin time (APTT) of 139 seconds with normal prothrombin time, thrombin time, and fibrinogen levels. Further inquiry revealed no family history of bleeding tendency, but his episodic left knee joint swelling over the past few months was suggestive of recurrent haemarthrosis. A detailed coagulation work-up was done at this time. APTT mixing test with pooled normal plasma (PNP) revealed uncorrected APTT and that the FVIII and factor IX levels were markedly low at 0.3% and 0.006%, respectively. Factor XI was undetectable. The inhibitor assay showed a very high titre of FVIII inhibitor of >1000 Bethesda units (BU). A diagnosis of AHA was made, and a possible aetiology was sought. An autoimmune screen revealed weakly positive antinuclear antibodies, but double-stranded DNA and rheumatoid factor were negative. With a strong suspicion of active tuberculosis, the CECT chest and abdomen were repeated which revealed a cavity with a tree in bud appearance in the right upper lobe with a progressive right hilar lymphadenopathy suggestive of active pulmonary tuberculosis with bronchogenic spread. His fourth and fifth sputum samples were positive for acid-fast bacilli which confirmed pulmonary tuberculosis. An APL antibody screen was done which revealed weakly positive DRVVT, moderately positive antibeta 2 glycoprotein IgM (53.8 U/L), and a weakly positive anticardiolipin IgM levels. Repeat testing after 3-months confirmed the persistence of APL antibodies with a moderately positive DRVVT. A final diagnosis of AHA due to a possible underlying autoimmune disease in the background of active pulmonary tuberculosis was made. It was not clear whether pulmonary tuberculosis contributed to autoimmunity. However, the coexistence of secondary APS was still considered due to the persistence of APL antibodies. Patient had several bleeding episodes involving the left knee joint and the right elbow joint. He also developed a gluteal muscle haematoma and all bleeding manifestations were successfully managed with recombinant factor VIIa (r FVIIa) infusions and tranexamic acid. Following a multidisciplinary meeting, antituberculous drugs (ATD) for pulmonary tuberculosis were started. Concurrent immunosuppression therapy commenced with high dose steroids including initial intravenous methyl prednisolone followed by oral prednisolone. After a period of 10 weeks, oral cyclophosphamide 100 mg daily was added while tapering off oral steroids as the APTT was persistently prolonged with poor response. With cyclophosphamide, APTT was reduced to 50 s and the inhibitor titre came down to 700 BU. He responded well to ATD, with clinical improvement, a declining ESR, and clearance of the initial findings on his repeat CECTs. Unfortunately, the patient developed transaminitis during this time of high-dose cyclophosphamide therapy and ATD therapy requiring drug withdrawal. Interruption of cyclophosphamide therapy resulted in several episodes of bleeding (haemarthrosis and epistaxis) which required aggressive factor replacement therapy. As he had almost completed 11 months of therapy, ATD was also discontinued at the same time. At this point, a combined-aggressive immunosuppression therapy was started with rituximab, high-dose oral prednisolone and low-dose cyclophosphamide, with close monitoring of liver functions aimed at disease remission. He showed a dramatic response just after the third dose of rituximab with normalization of APTT with both lupus sensitive and insensitive reagents and normalization of ESR after completion of rituximab 4 doses. He was given low-dose (50 mg daily) therapy with cyclophosphamide which was continued for another 6 months, and prednisolone was tailed off slowly with monthly monitoring of APTT, ESR, and liver functions. Subsequent regular assessments showed persistently normal APTT with both lupus-sensitive and insensitive reagents and normalized ESR with a normal FVIII level (70%) and factor IX (90%). But we could not perform the Factor XI levels due to resource constraints at that time. A repeat APL screen with DRVVT was still positive which confirmed the persistence of APL antibodies. We considered this could more likely to be due to secondary APS with an underlying, undetermined autoimmune disorder than tuberculosis which had been completely treated by that time.

PMC3789579_01

Male

This case report describes the history of a 13-year-old soccer player, born with a congenital heart malformation complex without cyanosis (Fallot Tetralogy of Fallot-Pink). This congenital heart disease was surgically corrected at the age of 10 months by the classic repair in Tetralogy of Fallot - an outflow patch of pericardium was used to relieve subpulmonic obstruction, and the VSD was closed with a pericardial or Dacron patch. The cardiac surgery led to an excellent result. After the radical heart surgery, the child had normal development, showing a natural inclination to physical activity. Since birth, he was followed by our pediatric cardiology unit,, where he performed a regular clinical and instrumental follow-up, from which it is documented that he never showed any kind of cardiac complication. He always practiced in recreational sports activity, but at some point he asked to engage in competitive soccer. Indeed, the aspiring young footballer has come into our medical center to undergo pre-participation screening and showed a better cardiorespiratory fitness than many of his peers with indices of optimal recovery. During the cardiorespiratory exercise testing, the athlete has achieved a maximum heart rate of 195 bpm at the height of the effort to a VO2 max >50 ml/min/kg and a ventilatory anaerobic threshold corresponding to 82% of VO2 max (Figure 1). Resting ECG showed sinus rhythm, normal AV and intraventricular conduction (QRS <100 ms), with normal repolarization. ECG during exercise testing did not detect arrhythmias (Figure 2). Subsequent transthoracic bidimensional echocardiography (Figure 3) showed excellent repair of the VSD and normal size and normal morphology of the left ventricle, with preserved systolic and diastolic function. Mild right ventricular enlargement and mild tricuspid regurgitation were present; no abnormalities of the RV outflow tract were found other than a trivial pulmonary regurgitation. The aortic root was normal size, without aortic valve regurgitation. Cardiac MRI was also performed, showing a slight dilatation and mild hypertrophy of the right ventricle, with normal biventricular contractile function and normal size of the aortic root and the pulmonary arteries, and without significant alterations of diameter at the level of the pulmonary valve (trivial regurgitation <5%) (Figure 4). In light of this evidence, in agreement with the pediatric cardiologist referent, he has been qualified as a competitive player, overcoming the restrictions of Italian Protocol COCIS 2009.

cardiorespiratory fitness, congenital heart disease, sports/pre-participation screening, teenager, tetralogy of fallot

PMC10020642_01

Male

A 72-year-old man presented with complaints of pain on the anteromedial infrapatellar side of the right knee with sensory disturbance that began 2 years earlier. The patient previously underwent right knee arthroscopy at another hospital for a meniscus injury in May 2020, which gave him relief from knee pain, but pain and discomfort near the incision of the medial portal persisted. Given this situation, various physical treatments, such as ice compress, were administered postoperatively. However, the symptom was only partially relieved before discharge. Subsequently, the patient visited two other hospitals and began taking oral pregabalin and duloxetine for treatment of the pain based on a diagnosis of right common peroneal nerve injury. Pain in the same dermatomal distribution was slightly relieved, but a withdrawal reaction was observed. The patient still felt migratory pain at the inner foretibia. The patient had high blood pressure for 5 years and had no other history of chronic disease or surgery. The patient's parents were deceased, cause of death unknown; he had one brother in good health. The patient denied (1) any similar disease in the family; (2) tuberculosis, hepatitis, or other infectious diseases in the family; and (3) hereditary or familial diseases, such as diabetes or hemophilia, in the family. Physical examination of the right knee detected atrophy of the quadriceps femoris muscle, decreased muscle strength (M4), obvious tenderness in the medial side, radiating pain along the anterior tibia, sensory disturbance (S3+), and positive Tinel's sign. The results of a drawer test, McMurray test, pivot shift test, and lateral stress test were negative. Color ultrasound and magnetic resonance imaging (MRI) examination of the patient's right knee were performed. Color ultrasound showed a hypoechoic area suggesting inflammatory changes in the right medial quadriceps femoris tendon. MRI showed level II injury in the posterior horn of the medial meniscus of the right knee joint and edema of the infrapatellar fat pad. The final diagnosis was injury to the infrapatellar branch of the saphenous nerve. The patient underwent neurolysis for the infrapatellar branch of the saphenous nerve under epidural anesthesia in July 2022. An enlarged incision was made along the original medial approach. Scar hyperplasia was observed after careful separation of the subcutaneous tissue. During neurolysis, branches were found wrapped in the scar; their continuity and integrity were confirmed after relief. We translocated the nerve and embedded it under the fat (Figure 1). After surgery, the patient took 0.5 mg mecobalamin orally three times per day for 4 weeks. The patient's pain was clearly relieved, and numbness disappeared on the first postoperative day. One month after surgery, the pain had disappeared completely and the patient was satisfied with the outcome.

knee arthroscopy, medial approach, numbness, pain, saphenous nerve

PMC6230409_01

Female

A 46-year-old female presented with complaints of fever, breathlessness on minimal exertion, vomiting, abdominal pain, and reduced appetite since 10 days. She also complained of weight loss of 10 kilograms in the last 6 months. She was diagnosed with HIV-1 infection, 1 month prior, and was prescribed tenofovir, lamivudine, and efavirenz fixed-dose combination single-pill regimen. Her baseline CD4 count was 68 cells/mm3, and plasma HIV-1 viral load was 867,000 copies/ml. She had no comorbidities or prior significant medical history. On examination, she was febrile (temperature: 100 degrees Fahrenheit) with pulse (100/min), blood pressure (110/60 mm Hg), and respiratory rate (24/min). Respiratory examination revealed crepitations in bilateral inframammary, infraaxillary, and infrascapular areas. There was diffuse abdominal tenderness but no organomegaly. Rest of the examination including fundoscopy was unremarkable. Hemoglobin was 8.3 g/dl while rest of the biochemical investigations was normal. CD4 count and plasma HIV-1 viral load after 1 month of ART was 190 cells/mm3 and 9,500 copies/ml, respectively, suggesting satisfactory immune reconstitution. The arterial blood gas (ABG) was suggestive of hypoxia (pO2-63 mm Hg) on room air. Chest X-ray was suggestive of bilateral, extensive, and patchy consolidation suggestive of infective etiology (Figure 1). Sonography of abdomen showed multiple mesenteric nodes with the largest size of 21 mm by 17 mm, grade 2 fatty liver, and dilated portal vein. The CT scan of chest revealed bilateral ground glass haziness suggestive of pneumocystis carinii pneumonia (PCP). CT abdomen showed biliary dilatation due to distal CBD stricture, mesenteric lymphadenopathy and mild diffuse thickening of the caecum, and ascending and transverse colon. 2D echocardiography of the heart was normal. Blood culture was sterile, and serum procalcitonin was normal. Keeping a provisional diagnosis of IRIS to Pneumocystis jirovecii or Mycobacterium tuberculosis in mind, she was started on high-dose trimethoprim-sulphamethoxazole (TMP-SMX), oral steroids, and empirical antitubercular therapy (ATT) in addition to ART. She had diarrhea on admission, which subsided in 2 days after taking loperamide. Stool routine and modified Ziehl-Neelsen (ZN) examination was unremarkable. Due to a suspicion of CMV enterocolitis, she was also started on empirical oral valgancyclovir. Bronchoscopy with BAL was attempted but had to be aborted in view of worsening hypoxia during procedure. For establishing diagnosis, upper GI endoscopy and colonoscopy were attempted. Upper GI endoscopy revealed diffuse gastroduodenitis. Colonoscopy showed patchy colitis. Duodenal biopsy revealed focal blunting, ulceration, and neutrophilic exudates (Figure 2). The surface epithelium showed several eggs, larvae, and adult forms of S. stercoralis (Figure 3). Lamina propria showed moderate mononuclear inflammatory infiltrate with lymphoid follicle formation and many admixed eosinophils (Figures 2 and 3). There was no evidence of tuberculosis or malignancy. Induced sputum also demonstrated larvae of S. stercoralis. As a result, diagnosis of SHS as a manifestation of IRIS was made, and she was started on an oral combination of albendazole (400 mg twice a day) and ivermectin (200 microg/kg). Inspite of antihelminthic treatment, her dyspnea worsened. Her repeat ABG showed hypoxia (PO2 -47 mm Hg, Spo2 89%) and respiratory alkalosis. She developed hypotension (blood pressure 80/60 mm Hg) and altered sensorium in the form of increasing drowsiness (Glasgow Coma Scale 12/15). She was shifted to the Intensive Care Unit (ICU) for the same. MRI brain and CSF examination were normal while serum sodium level had dropped to 125 mEq/L. Noradrenaline infusion and noninvasive BIPAP ventilation were started. She was initiated on intravenous (i.v.) meropenem, i.v. teicoplanin, and i.v. fluconazole in addition to antihelminthic agents, steroids (in tapering doses), and ART. ATT and valganciclovir were withdrawn while TMP-SMX was reduced to prophylactic dose. She gradually started improving over the next 7 days with improvement in sensorium and reduction in breathlessness. She was shifted out of the ICU by day 21 of admission. Her CXR showed complete resolution of pneumonic consolidation. She was discharged on oral antihelminthic treatment which she continued for another 8 weeks. Follow-up endoscopy studies showed complete clearance of S. stercoralis.

PMC4996549_01

Female

A 37-year-old female was found to have an incidental bladder lesion in 2007 at age 30 during ultrasonography investigation for subfertility. A transurethral resection of bladder tumor was performed, during which the lesion was found to extend into the proximal right ureter. Ureteroscopy was performed and the tumor was resected from the bladder and distal ureter. Histopathology showed a fibroepithelial polyp with no evidence of urothelial dysplasia or malignancy. Her medical history included two previous cesarean sections, lifelong nonsmoker, and no prior exposure to carcinogenic chemicals. She subsequently developed recurrence of bladder tumors in 2010 and 2012 with the histopathology showing as papillary ureteritis with evidence of mitotic activity. She was commenced on a course of intravesical bacillus Calmette-Guerin (BCG) for the recurrence of her bladder tumors and the mitotic activity. Following completion of her BCG course, she remained tumor free at 3 and 6 months check with cystoscopies. Eight months following BCG, she developed right-sided flank pain and although the bladder was clear of recurrence, a retrograde pyelogram was performed because of her previous distal right ureteral lesion. Although the distal ureter was clear, there was a new development of a large proximal ureter obstructing the polypoid lesion. A CT intravenous pyelogram showed that the lesion was 4.2 x 0.1 x 1.8 cm (Fig. 2). It is hypothesized that the previous resection at the right distal ureter had allowed reflux of the BCG proximally, stimulating the growth of this proximal ureteral granuloma. Given the patient's age and history of recurrent bladder and ureteral tumors, a right nephroureterectomy and autotransplantation were carried out. A laparoscopic nephroureterectomy was performed that identified the right kidney with two renal arteries and a long renal vein with multiple segmental veins. The ureter was dissected away and the bladder stapled and the renal arteries and veins were ligated, with a warm ischemia time of 5 minutes. Following cold perfusion, back table exploration of the kidney was performed with flexible ExURS, which identified the proximal ureteral lesion (Fig. 3). ExURS confirmed the intraluminal lesion margins, allowing for resection of the lesion and distal ureter with adequate proximal length for reimplantation. Intraoperative frozen section of the proximal ureteral lesion shows inflamed granulation tissue with chronic histiocytic reaction, suggestive of a poorly formed granuloma. Reimplantation of the kidney into the right pelvis was performed by a vascular surgeon, with anastomosis of the renal vein to the external iliac vein and the renal artery to the external iliac artery. The ureter was then reimplanted into the bladder by the urology team with 4-0 polydioxanone and a Double-J stent. Postoperatively, the patient made an uncomplicated recovery with adequate urine output through an indwelling catheter. Her renal function on discharge was excellent with a serum creatinine of 58 muM and an estimated glomerular filtration rate of 91. She underwent an effective trial of void 2 weeks postoperatively and her stent was removed 3 weeks postoperatively. Formal histopathology of the ureteral tumor showed mucosal ulceration with moderate active chronic inflammation and granulomatous inflammatory reaction. Stains for acid-fast bacilli were negative and Mycobacterium tuberculosis complex polymerase chain reaction was also negative.

PMC4054826_01

Male

An 18-year-old male was referred to our hospital for asymptomatic cardiomegaly (Fig. 1A). There was no history of trauma, thoracic surgery or neoplasm. Clinical examination was unremarkable except for distant heart sounds. Electrocardiography showed low voltage complexes. Echocardiography revealed massive pericardial effusion without tamponade (Fig. 1B). Pericardiocentesis yielded 1.25 L of tea-colored fluid (Fig. 1C). Aspirated pericardial fluid had lymphocytic predominance with numerous RBCs; fluid protein was 7 gm/dL, sugar 116 gm/dL and ADA 21U /L; there were no malignant cells, bacterial growth on culture or trophozoite or bacilli on gram stain. Mantoux test and antinuclear antibody were negative. Laboratory tests demonstrated normal blood counts, serum electrolytes, serum lipid profile, liver function, serum urea, creatinine, calcium and phosphate. Pericardial aspirate also showed triglyceride level of 1723 mg/dL and cholesterol of 1021 mg/dL with a cholesterol to triglyceride ratio of <1, characteristic of chylous fluid. High resolution computed tomography did not show any mediastinal mass. Lymphoscintigraphy using 99Tc demonstrated lymphatic leak around the heart region (Fig. 2A). Fusion of MRI images with lymphoscintigraphy was taken with a view of localizing the leak site; it demonstrated enhancement in the pericardial space (Fig. 2B). Patient was kept on low fat medium-chain triglyceride diet. Since there was no reduction in the daily aspirate, surgery was done via right lateral thoracotomy. Thoracic duct was ligated above diaphragm and pericardial window created by anterior pericardiectomy. The patient had an uneventful recovery and was well after 6 months of follow up. Pericardial biopsy showed cystic lymphangioma of pericardium (Fig. 2C). Chylopericardium, first described by Hasebrock in 1886, is a rare entity. It may be a consequence of thoracic and cardiac surgery or as a result of chest trauma, mediastinal tuberculosis, mediastinal neoplasm, mediastinal radiotherapy or thrombosis of subclavian vein. The term primary isolated chylopericardium was first reported by Groves and Effler in 1954. Abnormalities of the lymphatic system and mediastinal lymphangiectasia causing chylopericardial effusions are referred to as idiopathic chylopericardium. Age at diagnosis ranges from 18 to 68 years. Clinical presentation may vary from incidental detection of cardiomegaly (as in our case) to those presenting with dyspnea, fatigue, or cardiac tamponade. Characteristics of chylous fluid include a milky yellowish appearance, triglyceride level >500 mg/dL, cholesterol-triglyceride ratio of <1 and lymphocyte predominant fluid with negative cultures. In our patient, the fluid was tea-colored, probably owing to mixing of red blood cells (RBC). Diagnosis of chylopericardium can be made noninvasively by precordial imaging using 99Tc-labeled RBC or oral administration of 131I-triolein. Lymphangiography may be helpful in identifying fistulous communications as well as anatomy of thoracic duct which is well known for its variations. In our case we used 99Tc-sulfur colloid for lymphoscintigraphy which showed uptake of the radiopharmaceutical around the heart region suggesting chylopericardium. MRI fusion lymphoscintigraphy confirmed the leakage of chyle into pericardial cavity. Our case is the first case where fusion imaging was used for localization of chylous fluid leakage into pericardial space.

cystic lymphangioma, isolated chylopericardium, lymphoscintigraphy

PMC10193338_01

Female

The study found that the People's Daily WeChat and Sina Weibo accounts primarily used the human interest frame and action frame in their news coverage of the Novel Coronavirus outbreak involving medical personnel. The responsibility frame, morality frame, and conflict frame were less commonly applied. The human interest frame mainly covered the family relationships and emotions of medical personnel, such as the Sina Weibo post on February 3, "White nurse and firefighter's wedding," and another on April 19, "Forward your blessings! A nurse and her police boyfriend got married." The WeChat article on February 25 entitled "When mom stayed on the front line of the fight against the pandemic, the 6-year-old brother was so strong that he was able to console his brother missing his mother," also falls under this frame. In addition, the human interest frame also reflected the hard work and dedication of medical staff through depictions of their body parts, such as the WeChat article post on February 1 entitled "Heartache! This is the hand of a 22-year-old nurse," and another on March 8 entitled "Beauty can't hide! Comparison pictures of female nurses before and after anti-pandemic fight." The Sina Weibo post "Traces of a mask on the face of Li Lanjuan" on February 20 also falls under this frame. Li Lanjuan is a female academician of the Chinese Academy of Engineering, an expert in infectious diseases, and a member of the high-level expert group of the National Health Commission whose words and deeds gained widespread media attention during the outbreak of the Novel Coronavirus. The action frame primarily focused on pandemic diagnosis, protection knowledge popularization, patient treatment, and other practical actions to combat the pandemic, such as the June 29 Sina Weibo post "Wu Zunyou said between 10 and 20 million infected persons will be diagnosed worldwide in a much shorter period of time," the June 20 Sina Weibo post "Experts: Beijing pandemic prevention cannot copy the traditional Chinese medicine prescription used in Wuhan," and the February 3 Sina Weibo post "Zhong Nanshan's team laboratory isolated live virus in patient's feces," and the March 2 WeChat article entitled "The lung is not existent anymore, the first case of Novel Coronavirus autopsy report released", etc. Wu Zunyou and Zhong Nanshan were both male medical experts who received widespread media and public attention during the COVID-19 outbreak. Wu Zunyou is the chief epidemiologist of the Chinese Center for Disease Control and Prevention (CDC), who often participated in official press conferences during the Novel Coronavirus outbreak. Zhong Nanshan is an academician of the Chinese Academy of Engineering and the head of the Senior Expert Group of the National Health Planning Commission, and he made important contributions to the SARS outbreak in 2003 and the Novel Coronavirus outbreak in 2019. On April 8, 2020, after 76 days of closure, Wuhan lifted its control measures on outbound traffic and resumed external traffic in an orderly manner. Taking April 8 as the boundary, reports on medical staff fighting the pandemic in People's Daily's WeChat and Sina Weibo were divided into two stages. The first stage was from January 1, 2020, to April 8, 2020, and the second stage was from April 9, 2020, to December 31, 2020. It was found that there were significant differences in the choice and use of frames between the two stages of news reporting (see Tables 2 and 3). Compared to the previous period, the proportion of reports mainly involving male medical personnel with action frames in the latter period decreased significantly (WeChat: from 64.7% to 44.2%; Weibo: from 74.4% to 70.5%; Weibo and WeChat total: from 71.1% to 62.1%), while the proportion of reports mainly involving female medical personnel with action frames increased significantly (WeChat: from 16.1% to 22.2%; Weibo: from 18.9% to 41.2%; Weibo and WeChat total: from 17.6% to 31.4%). The proportion of reports mainly involving female medical personnel with human interest frames also decreased significantly (WeChat: from 80.6% to 77.7%; Weibo: from 67.5% to 41.2%; WeChat and Weibo total: from 73.5% to 60.0%). The human interest frames of reports mainly involving male medical personnel did not change significantly (WeChat: from 35.2% to 48.0%; Weibo: from 16.3% to 12.5%; WeChat and Weibo total: from 22.8% to 23.7%). Therefore, the news frames used by People's Daily when reporting on medical staff against the pandemic are not invariable, but changes with the reporting stage and the pandemic prevention and control situation. The selection and application of media frames exerted a "framing effect" on society and audiences. Experimental studies have shown that frames draw attention to particular aspects of the reality described, which logically means that they simultaneously direct attention away from other aspects (Entman,). As shown in Table 4, the chi2 test found a significant difference in media frames by gender (). Moreover, the proportion of human interest frames used in reporting on female medical personnel (59.2% and 79.6%) was much higher than that used in reporting on male medical personnel (14.2% and 41.7%), while the proportion of action frames used in reporting on female medical personnel (25.9% and 18.3%) was much lower than that used in reporting on male medical personnel (72.3% and 54.3%) in People's Daily's Sina Weibo posts and WeChat articles. The human interest frame was mainly related to two aspects: the role of women in the private sphere such as family and marriage, and the portrayal of women's body parts. There is a significant amount of content in WeChat articles and Weibo posts that highlight the roles of female medical personnel as wives, lovers, and mothers. For example, on February 3, there was a Weibo post "The wedding in a long distance for a nurse in white clothes and a fireman", and on April 29, there was a WeChat article entitled "The nurse in Hubei who once called out her daughter to do her homework was seriously suffering from cancer. Netizens wish her to be better!". In contrast, there are very few reports highlighting the role of male medical personnel in family and marriage. In all the reports analyzed, "husband," "father," "son," and other identities representing family relationships rarely appear. Whereas cropped hair, indentations on the face, and burned hands may seem to praise women's dedication, they actually imply a deeper connotation of morally judging the body as an esthetic subject. This influences the reader's interpretation of the message, with selfless devotion replacing professional skills as the major criterion for measuring female medical personnel fighting the pandemic, and selfless moral models replacing skilled professionals as their primary image. The Feb. 12 Sina Weibo post "Super valiant! Female medical personnel shaved off the hairs at the back of their heads," to which netizen @fanziyang commented: "For the sake of convenience in work, they have become our female knight-errant instead!" The term "knight-errant" is more of an ethical evaluation of female medical personnel. Furthermore, the reinforcement of the human interest frame and the weakening of the action frame have obscured the professional competencies of female health workers and downplayed their actual and professional actions in the fight against the pandemic. These media frames are influenced by established gender perceptions and further reinforce these stereotypes of both genders. The study found that Chinese official media displayed gender bias in reporting on female medical personnel. By using different media frames, the news media presents the image of female medical personnel differently from that of men, and the inherent gender cognition of society permeates into the news reports of the media. Given this background, is it possible for women to transcend the gender bias of the media? Beauvoir (: p. 813) pointed out, "It is through work that woman has been able, to a large extent, to close the gap separating her from the male." However, this study shows that the majority of female medical personnel did not really bridge the gap with their male counterparts. In the media reports, they still appeared in a different image from men. Nonetheless, this study also found that the gender media frame did not target all female medical personnel, and the media adopted media frames similar to that of male medical personnel when reporting on some female medical personnel and presented a similar image to their male counterparts. Taking Li Lanjuan as an example. Li Lanjuan's name appeared in the title of 4 Wechat articles, among which 3 articles used action frame (75%) and 1 article used human interest frame (25%). When reporting on Li Lanjuan, the WeChat official account of People's Daily used the action frame more frequently than the average male medical staff (54.3%), and used the human interest frame less frequently than the average male medical personnel (41.7%). Li Lanjuan appeared 8 times in Weibo posts mainly involving female medical personnel, among which 5 posts used the action frame (62.5%) and 3 posts used the human interest frame (37.5%). Although the frequency of action frame involving Li Lanjuan was lower than the average of male medical personnel (72.3%), it was much higher than the average of female medical personnel (25.9%). The probability of using the human interest frame when reporting on Li Lanjuan by Weibo was higher than the average of male medical personnel (14.2%), but much lower than the average of female medical personnel (59.2%). Let's compare Li Lanjuan's reporting frame with Zhong Nanshan's. Zhong's name appeared in the title of 27 WeChat articles, of which 20 used the action frame (74%) and 5 used the human interest frame (18.5 %). In other words, the probability of using the action frame when reporting Li Lanjuan by People's Daily WeChat was equal to that of Zhong Nanshan's, while the probability of using the human interest frame was slightly higher than Zhong Nanshan's. The above content mainly emphasizes the actual actions that Li Lanjuan took to fight the pandemic, such as the Sina Weibo posts "Li Lanjuan claims that it is not correct that the Corona Virus exists for 20 years in minus 20 C," "Li Lanjuan leaving Wuhan while warning of two great dangers," and the WeChat articles entitled "When can Wuhan be unsealed? Academician Li Lanjuan said like this," "Li Lanjuan: after 'zero increase' in Wuhan's pandemic, two issues still need to be highly emphasized." Chen Wei is an academician of the Chinese Academy of Engineering and has made contributions to the research and development of COVID-19 vaccines in China. When people's Daily reported on Chen Wei on WeChat and Sina Weibo, they all paid attention to the progress and achievements of her vaccine experiments. In our view, the action frame is more conducive to demonstrating the professional identity of medical personnel and their contribution to the fight against the pandemic, while the human interest frame highlights the personal side of medical personnel. In media reports, Li Lanjuan and Chen Wei are fighting the pandemic with their sublime expertize, researching and developing COVID-19 vaccines and expressing their opinions, predictions, and warnings on the pandemic. They demonstrate their image as female scientists with conspicuous professionalism and great contributions to the fight against the pandemic, which is in line with their male counterparts like Wu Zunyou and Zhong Nanshan. Therefore, the gender media frame is not inevitable in news reports, and it is possible for women to be liberated from the gender media frame.

cultural and media studies, health humanities, medical humanities

PMC7250292_01

Female

A 43-year-old female never-smoker presented with prolonged paroxysmal cough and was diagnosed with stage IVa (T2bN2M1b) lung adenocarcinoma in Jun 2017. She underwent an endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) and immunohistochemistry showed that the nucleoli had obvious heterotypic cells arranged like adenoid and CK (+), TTF-1 (+), NapsinA (+), P63 (+). Enhanced computed tomography (CT) revealed an upper left lung lesion (3.6x2.9 cm) with mediastinal lymph node metastasis (2.1x1.0 cm) and hepatic S4 segment metastasis (1.0x0.9 cm). She received two courses of docetaxel combined with cisplatin chemotherapy as the first-line treatment, and CT revealed no change in the lesion (Figure 1). To explore potential targeted treatment, next-generation sequencing (NGS) analysis was performed on the patient's peripheral blood using a 21 gene panel. The patient was found to carry the classical EML4-ALK fusion. Therefore, crizotinib was commenced at 250 mg bid on September 5th 2017. A follow-up CT conducted on January 17th, 2018 revealed a 61% regression in her primary lung lesion (1.4x1.2 cm), indicating that the patient had achieved partial response (PR). In May 2018, eight months after the onset of crizotinib treatment, the patient was discovered to have tumor progression (PD) due to brain metastases (1.9x1.6 cm) by head MRI and acquired resistance to crizotinib was suspected. A second blood-based NGS showed the presence of the p.G1202R ALK mutation was observed. The patient was started on brigatinib (180 mg daily with a seven-day lead-in at 90 mg) on May 18th, 2018. Brigatinib is a next-generation oral ALK inhibitor used in the second-line after progression on crizotinib. However, a CT scan conducted after 53 days of brigatinib treatment revealed a new mediastinal lymph node (1.6x1.2 cm), and the appearance of new pericardial metastases. A third NGS testing was therefore performed, and a new type of NTRK arrangement (LIPI-NTRK1, Figure 2) was identified in addition to the two previous alternations. The patient's shortness of breath significantly increased due to the hydrothorax on the left side of the chest. After a pleural puncture, the symptoms were slightly relieved. Given her physical conditions, the patient refused to switch to another regimen, including NTRK inhibitors. She was able to benefit from ALK TKI therapy for 8 months and died on September 24th, 2018, with overall survival of 16 months from the time of diagnosis.

alk, nsclc, ntrk1, brigatinib, primary resistance

PMC7745642_01

Female

A 43-year-old woman presented with impaired vision in her left eye for the previous 2 weeks. She had a non-traumatic unilateral red eye, chemosis, and untreated hypertension. At the initial visit, the respective right and left corrected visual acuities were 20/16 and 20/2000, and the bilateral intraocular pressure was 20 mm Hg. The chemosis was accompanied by serous discharge, keratic precipitates, partial synechia of the iris and cells (2+) in the anterior chamber (Figure 1 (Fig. 1), Figure 2 (Fig. 2)), and vitreous of the left eye. A fundus examination of the left eye showed optic disc swelling, a focal retinitis lesion at the temporal margin of the optic disc, macular exudates in a star pattern, a flame-like retinal haemorrhage, and a serous macular detachment (Figure 3 (Fig. 3), Figure 4 (Fig. 4)). Fluorescein angiography showed leakage from the optic disc of the left eye (Figure 5 (Fig. 5)). No signs of inflammation were apparent in the right eye. The patient reported that her pet cat had scratched her forehead 3 weeks before she presented for examination. She did not have a fever, any detectable skin lesions, or lymphadenopathy. An infectious disease specialist performed a systemic examination and found no evidence of systemic CSD or any other infectious disease. Since conjunctivitis and iridocyclitis were present in addition to the aforementioned fundus findings, extensive investigations for uveitis were conducted that included measurement of the total blood count and erythrocyte sedimentation rate (ESR) as well as tests for autoantibodies, syphilis, viruses, and toxoplasma antibody. Except for a slightly elevated ESR rate (26 mm/hour), the results were unremarkable. Angiotensin-converting enzyme, soluble interleukin-2 receptor, and chest x-ray parameters were all within the normal limits. A blood sample was sent to a pathology laboratory for serology testing for B. henselae antibody. Since optic disc edema is associated with a macular star, it is important to exclude other causes such as malignant hypertension, sarcoidosis, toxoplasmosis, tuberculosis, and spirochetal disease. The systemic blood pressure was 160/91 mm Hg, and all blood test results were within the normal limits, with the exception of the slightly elevated ESR. QuantiFERON TB (Qiagen, Germantown, MD, USA) was negative. Serology testing for B. henselae antibodies was the only positive test result (IgM titre 1:16, IgG titre 1:256). Serology tests for cytomegalovirus, toxoplasma, and human immunodeficiency virus were negative. Given the clinical ocular findings and the reported cat scratch, CSD was suspected even without systemic illness. Oral doxycycline 200 mg/day and prednisolone 20 mg/day with tapering were prescribed. Topical corticosteroid and mydriatic treatments were administered for the anterior chamber inflammation. After the initiation of treatment, the optic disc edema, focal retinal infiltrates, retinal haemorrhage, serous retinal detachment, and macular exudates gradually decreased (Figure 6 (Fig. 6)). The cells in the anterior chamber and vitreous resolved over the treatment course. However, it is noteworthy that the focal retinitis persisted and doxycycline was prescribed for 3 months. Six months after the start of treatment, macular atrophy developed and the visual acuity remained 20/40.

anterior uveitis, cat scratch disease, serous macular detachment

PMC4743272_01

Female

An 88-year-old female with a history of anemia and hypertension presented to the emergency room with the acute onset of the worst headache of her life after walking into a supermarket. On neurological examination, she had no focal deficits; her only complaint was a severe global headache and neck pain. A computed tomography (CT) scan of the head and cervical spine revealed diffuse acute SAH within the basal cisterns that extended inferiorly down to through the cervical-medullary junction, attended by mild acute hydrocephalus [Figures 1 and 2]. Preliminary imaging with a CT angiogram of the head and neck were unremarkable for vascular pathology. She subsequently underwent formal angiography, which revealed an incidental bilobed, left cavernous carotid aneurysm measuring 3 by 5 mm. As the authors could not attribute the diffuse SAH to this cerebral aneurysm, they ordered a magnetic resonance (MR) imaging scan of the brain and cervical spine [Figures 3 and 4]. The cranial MR showed no other abnormalities, but the cervical MR revealed degenerative cervical disease at the C5-C6 level including a large disc osteophyte complex contributing to flattening of the ventral cord. At the C5-C6 level of maximal cord compression, there was a small pseudoaneurysm arising from the anterior spinal artery [Figures 5 and 6]. The patient remained in the neurosurgery Intensive Care Unit until postbleed day 9. She was then transferred to the floor and subsequently discharged to a subacute rehabilitation facility. She was seen in clinic 3 months later, remaining neurologically intact. After completing a course of rehabilitation, she is now living at home 4 months later with assistance.

aneurysm, cervical, spine, subarachnoid hemorrhage, trauma

PMC3336250_01

Female

A 28-year-old female gravid- 2 Para- 1 with an uneventful antenatal period delivered a full-term female child weighing 2.5 Kg by normal vaginal delivery. She developed intermittent high-grade fever associated with chills one week after delivery. There were no other complaints. There was no significant past history of illness or contact with a case of tuberculosis. General physical examination revealed pallor. There were no enlarged lymph nodes or palpable liver and spleen. The lungs were clinically normal. Initial laboratory investigations were as follows: haemoglobin-8.3 gm/dL, MCV-96.5 fl, MCH-28.2 pg, and MCHC-29.2 g/dL, total leucocyte count was 7,500/cumm with 57% polymorphs and 30% lymphocytes. Erythrocyte sedimentation rate (Westergreen) was 45 mm fall first hour. Liver and renal function tests were within normal limits. Widal test for enteric fever, strip test for malarial parasite, and urine and blood culture were not contributory. Serology for HIV, HBV, and HCV was negative. Chest radiography and ultrasound abdomen done during second week of fever were essentially normal. Patient was initially treated as a case of viral fever and then empirically for enteric fever. She, however, continued to have low-grade fever with night sweats. Three weeks later follow-up ultrasound abdomen revealed mild hepatosplenomegaly. Repeat chest radiograph done at this stage was normal. Mantoux test and mycobacteriology serology panel for Anti-A60 Mycobacterium IgG, IgA, and IgM were negative. Patient was now put empirically on antimalarials but she continued to be symptomatic. Chest radiograph repeated four weeks later suggested the presence of bilateral miliary mottling (Figure 1). The diagnosis of miliary tuberculosis was confirmed by high resolution CT scan (Figure 2). The patient was started on 4-drug regimen ATT (isoniazid, rifampicin, ethambutol, and pyrazinamide) for first three months, followed by isoniazid and rifampicin for next six months. In a few days there was significant improvement in general condition of the patient. She became afebrile after 10 days of ATT. Followup imaging study after 9 month of treatment revealed no residual activity. Newborn was vaccinated with BCG at birth. She was breast fed and put on INH prophylaxis for 3 months. She had a normal chest skiagram and negative Mantoux test before and after INH therapy. Both mother and child are doing fine after one year of follow-up.

PMC8317259_01

Male

A 21-year-old male complained of asthenia and intermittent fever for 10 days was referred to our department for surgery from the department of hematology, as an ultrasound showed an undefined lesion on his liver. He has a history of severe aplastic anemia. Hepatitis B virus infection history or exposure in the infected area was denied. We learned that the patient took long-term exogenous testosterone for stimulating hematopoiesis. Upon examination he showed facial acne and facial hair. He was weak with a body-mass index of 20.5 kg/m2. On deep palpation he had increased mild tenderness of the right upper abdominal quadrant. His admission test was significant for declined leukocytes level (1.45 x 109/L; lower limit of normal [LLN], 4.0 x 109/L), declined erythrocytes level (1.17 x 1012/L; LLN, 4.0 x 1012/L) and declined platelets level (3 x 109/L; LLN, 100 x 109/L). Alpha fetoprotein (AFP) and carbohydrate antigen 19-9 were normal. His abdominal magnetic resonance imaging showed the lesion was markedly hyperintense at T2 with a range of 65.0 x 45.0 mm, and normal liver contour with no signs of liver cirrhosis. The mass was enhanced in the arterial phase and persisted in the portal venous and hepatobiliary phases (Figure 1A). Despite the patient having asthenia and intermittent fever syndrome, the liver tuberculoma was a likely diagnosis. A test result for tuberculosis was negative. A liver biopsy was assigned, because the patient was scheduled for hematopoietic stem cell transplantation (HSCT) and immune inhibitor therapy. In this patient, liver biopsy revealed that the focal area of the liver plate was thickened with more pseudo-adenoid structures, slightly alien cells. Nevertheless, there was still divarication over the diagnosis of either benign or malignant as immunohistochemical stains for hepPar-1, glutamine synthetase, and heat shock protein 70 were positive, which are hepatocellular carcinoma markers. But cells were negative for glypican-3, and there was a lack of significant evidence for frank malignant behavior, Immunohistochemical staining showed that beta-catenin was positive on the membranes, with < 10% positive for Ki67, consistent with a hepatic adenoma (Figures 1B,C). In the meantime, we excluded the extramedullary hematopoietic foci as no characteristic signs were found via microscopy. Extramedullary hematopoiesis, which commonly presents as granulocytes, erythrocytes, and giant cells are all visible, and erythroid hyperplasia is obvious. The key to the correct diagnosis is recognizing that the presence of a liver mass in the background of normal liver parenchyma is unlikely to represent hepatocellular carcinoma, especially at a normal AFP level. Considering the patient's past medical history, negative blood tests, and the pathology of liver biopsy, the final diagnosis was identified as androgen-related hepatic adenoma. Then we withdrew the androgen for observation. Surprisingly, the lesion shrank significantly after 38 days. The patient was transferred to the department of hematology and completed hematopoietic stem cell transplantation. The lesion diminished gradually over a two-year follow-up (Figure 1D).

a teachable moment, androgen-related hepatic adenoma, clinical challenges, extramedullary hematopoiesis, less is more

PMC2872560_01

Female

A single subject was recruited for this case study. The subject provided informed written consent to participate in this research study, which was approved by the University of California, Irvine, Institutional Review Board (Protocol #95-563). The subject was a 31-year-old female with a suspicious mass in the right breast at the 3 o'clock position 1 to 3 cm from the nipple. Standard clinical ultrasound indicated that the lesion was well circumscribed and homogeneous, measuring 3.7 by 1.8 by 2.0 cm. LBS measurements were performed on the subject over an 8-week cycle (Table 1). The initial LBS measurement was taken 4 days prior to a standard core biopsy. Pathology indicated that the sampled lesion was a benign fibroadenoma. Subsequent LBS measurements were performed weekly thereafter to monitor breast optical properties throughout the wound-healing process, as outlined in Table 1; a total of eight postbiopsy LBS measurements were performed. Because the subject was premenopausal, we also related LBS measurement dates to patient menstrual cycle phases. In order to approximate the subject's phase in menstrual cycle, menses onset dates were recorded. The menstrual cycle length was calculated as the first day of the menses to the last day before next menses. The assumption that the luteal phase is approximately 14 days prior to the onset of menses was used to postulate when the ovulatory phase occurred. Care was taken to perform LBS measurements with the patient in a consistent position. The subject laid supine with her arm up above her head on a recliner at about 30 deg from horizontal for all LBS measurements. An ultrasound was then performed to visualize the breast lesion position at the time of the baseline LBS measurement. A steady-state broadband-only scan was done to quickly visualize the areas of greatest optical attenuation over the lesion localized by ultrasound. The point of highest attenuation was assumed to be the best representation of the lesion and was chosen as the center of the LBS scan area (Fig. 1(a)). A 10-mm-spaced point grid measuring 50 by 100 mm was marked on the breast using a nonpermanent surgical skin marker. Within our coordinate system, the nipple was taken to be the origin, with the LBS scan area centered on the (30 mm, 0 mm) location. The large scan area was chosen to cover regions of the breast both with and without the lesion. The top leftmost point of the grid (0 mm, 50 mm) was measured with respect to the nipple and recorded to remark the LBS scan area on the subject during subsequent LBS measurements. On the contralateral normal breast, a partial grid covering the same area as the lesion was also marked and measured as a control. LBS measurements were performed at each spatial grid location by moving the handheld probe to each marked location. The instrument probe was placed with light gravitational pressure without compression on the skin surface. The average penetration depth of the light was calculated to be approximately 15 mm below the surface of the skin. Maps of breast tissue physiological properties were generated by calculating the DOS-measured parameters at each grid location. No tomographic reconstructions were used, and the tissue within the field of view was assumed to be homogeneous in accordance with the standard diffusion approximation. Map points were interpolated using 2-D nearest-neighbor cubic splines to round out the discrete shapes. All image thresholds were performed using the maximum and minimum values of the image. A four-stage color bar was used with RGB values of (0,0,0), (0,0,255), (0,255,255), and (255,255,255) to display all functional maps. The lesion center was defined as the spatial location of the TOI maximum in accordance with our previous studies. The spatial extent of the lesion was then defined as the full width at half maximum (FWHM) of the TOI image, as we have done for a single axis in previous nonimaging studies. The TOI FWHM image then formed a mask for the images of other optical properties. Because of the limited spatial sampling of the lesion (i.e., only a few points are typically found inside the uninterpolated lesion masks), we have reported the maximum value within the FWHM as a value representative of the lesion Feature-based stratification was preferred to a strict spatial segmentation of lesion area to guard against possible movement of the lesion and/or optically scanned area. Normal tissue values were taken to be the average of DOS-measured parameters from the same spatial location on the contralateral normal breast. The calculated standard deviations, typically from the background and other normal tissue regions, represents the variation in the measured parameter across the image area. Images were rethresholded by TOI FWHM for each measurement date. An ultrasound of the lesion was performed in order to determine the position, orientation depth, and size (Fig. 2). Ultrasound showed a well-circumscribed, solid mass at the 3 o'clock position of the right breast, 1 to 3 cm from the nipple. The ultrasound was taken in two views: transverse and longitudinal. The lesion dimensions in the transverse and longitudinal orientations were measured to be approximately 26.8x21.3 mm and 20.6x20.8 mm, respectively. A needle core biopsy was administered by a general surgeon 4 days after a baseline DOS measurement session. An incision was made at the surface of the breast at a site away from the lesion [Fig. 1(a)]. Figure 1(b) depicts the orientation of the biopsy needle in relationship to the lesion location and the DOS scan in a medial-lateral view. The needle was inserted through the incision site and tracked through the lesion in the breast (dotted line). The LBS scan area was performed in the direction indicated in the figure. The position of the incision site was noted at each DOS measurement. On day 9, the incision scar was red and about the same size as the tip of the surgical marker used to mark the breast. The patient claimed the area was tender, but there was no irritation or bruising visible. By day 23, the redness at the site of incision had completely dissipated. On day 44, the patient reported that her breasts felt swollen. Her menses began on day 46.

PMC7475736_01

Male

Written informed consent for the off-label use of drugs and publication of this report was obtained from the patient and his family. The patient was an 82-year-old man who was a passenger on the Diamond Princess cruise ship, which experienced an outbreak of novel coronavirus (SARS-CoV-2). Prior to the off-label use of the antiviral drugs (lopinavir/ritonavir, chloroquine, and favipiravir) and use of remdesivir, which is an unapproved drug in Japan, all the drugs were reviewed and approved by the ethics committee of our hospital. Remdesivir was obtained from the drug manufacturer (Gilead Science, Inc., Foster City, CA, USA) through a Compassionate Use Program. The patient tested positive for SARS-CoV-2 by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay while on board the ship. Two days later, he was transferred to the infectious disease ward at our hospital. He had a history of bronchial asthma, hypertension, and dyslipidemia and showed no respiratory symptoms including cough, sputum, and dyspnea at the time of admission. His vital signs, except blood pressure (165/94 mmHg), were within their normal ranges at admission. Computed tomography (CT) scan and chest radiographs showed bilateral, subpleural ground-glass opacities in both lungs (Figure 1). Blood tests showed almost normal results on admission (Table S1). Both urinary pneumococcal antigen and urinary legionella antigen were negative. Simple inspection kit results were negative for both influenza virus types A and B. Oral administration of lopinavir/ritonavir, an anti-human immunodeficiency virus (HIV) drug, and ceftriaxone were commenced. Figure 2 illustrates the course of use of therapeutic drugs and medical devices. On day 2, he had no noticeable symptoms other than dry cough. On day 3, however, he developed appetite loss and a fever of 38 C. SpO2 decreased to 90% on room air. Oxygen administration via a nasal cannula was started that night. However, his respiratory condition further deteriorated on day 4, and he was unable to maintain an SpO2 of 90% even with administration of 2 L/min oxygen. CT scan clearly showed exacerbation of the pulmonary pathology compared to the previous scan, with infiltration and reticular shadows appearing in wide areas of both lung fields (Figure 1). He was transferred to the intensive care unit (ICU), where a blood test showed worsening of inflammatory findings (Table S1). Poor oxygenation continued after ICU admission, with an SpO2 of 90-95% even with oxygen administration of 10 L/min using a reservoir mask. Tracheal intubation was performed due to further worsening of oxygenation at midnight on day 5. We initiated mechanical ventilation in the pressure-controlled mode. Sedation with propofol and fentanyl and administration of dopamine and noradrenaline were commenced after intubation. The antibiotic was changed to meropenem, and oral administration of lopinavir/ritonavir was discontinued. In the afternoon of day 6, we decided to introduce veno-venous extracorporeal membrane oxygenation (VV-ECMO) because his oxygenation could not be maintained with the assistance of mechanical ventilation alone. On day 7, administration of chloroquine, which has been reported to have an inhibitory effect on coronavirus, was commenced and was continued for two days until favipiravir became available. On day 9, the administration of favipiravir, which was developed for treating RNA viruses including influenza virus, was started. On the first day, 1600 mg was administered twice, and thereafter, 600 mg was administered through a gastric tube twice per day for 5 days, as instructed in the package insert. However, even after five days of favipiravir treatment in this case, PCR assay using sputum collected from the lower respiratory tract continued to show a positive result (Figure 2, Table S2). Administration of remdesivir was started on day 14, with an initial IV loading dose of 200 mg, followed by 100 mg IV once daily for 9 days. ECMO was terminated on day 24 with improvement in his symptoms. The administration of chloroquine was also resumed on day 24. On day 32, tracheostomy was performed. Through this period, we repeatedly performed sputum testing using PCR assay, which was established broadly in Japan. Briefly, RNA was extracted using the QIAamp Viral RNA Mini kit (QIAGEN, Valencia, VA) and the primer set that targeted the specific gene of SARS-CoV-2 coding N protein (N2). The results were validated by comparing the results to the synthesized RNA of an internal control, following which cycle threshold (Ct) values were determined. Details of the sets are shown in the supplemental methods. Ultimately, we confirmed a negative PCR result 41 and 43 days after the first positive result (Figure 2; Table S2) and weaned the patient off mechanical ventilation. Currently, although he has recovered from the life-threatening condition, he requires continued treatment for several complications, namely, bacterial infection and liver dysfunction, which is suspected as being induced by one of the therapeutic drugs.

PMC2836132_01

Male

A 21-year-old male footballer has presented, for a few months after trauma a local discomfort in particular in the left popliteal fossa during palpation and usual daily activities. Physical examination was negative for the presence of a soft mass in the upper part of the popliteal left fossa without local signs of inflammation. Instead was positive for the pain in the front part of the left knee during palpation. There was no evidence of clinical signs of peripheral arterial angiopathy. Chest and abdomen examination, arterial blood pressure, chest X-ray, oxygen saturation, and electrocardiogram were normal. Duplex scanning, Computed Tomography scanning, and Magnetic Resonance imaging (MRI) are considered to be important non-invasive diagnostic methods for the diagnosis of PVA. Magnetic Resonance imaging (MRI) without contrast media demonstrated a 4 x 2 cm oval formation with dishomogeneous hyperintensity on T1-and T2-weighted sequence in the left popliteal fossa adjacent to the vessels suspected for a blood lesion (Figure 1). Then the color-Doppler ultrasonography (US-CD) was performed to identify the true origins of this lesion. This examination demonstrated only a mixed echogenicity mass in the left popliteal fossa with no evidence of arterial or venous nature. Subsequently this mass was evaluated with Angio-Computed Tomography (ACT) using a computed tomography scanner (Highspeed Advantage, GE Medical System Milwaukee, WI, USA). Images were acquired without and with contrast media intravenously (a single bolus of 120 cc with a flow rate of 3.5 ml/s of nonionic contrast medium via an antecubital venous access) and a scan was obtained with three phases from the injection of contrast media. Every data acquired were transferred to an Advantage Windows workstation (GE Advantage) and reconstrued using maximal intensity projection (MIP) and volume rendering (VR) technique. The ACT acquisition confirmed a 36 mm x 17 mm oval mass in the left popliteal fossa continuous with the popliteal veins. This lesion had presented contrast enhancement only in delayed acquisition (180 sec) and so appeared to be a true venous aneurysm(Figures 2 and 3). The PVA was repaired surgically via a posterior approach to the popliteal fossa. A 4 x 2 cm aneurysm was identified. In the same time open tangential aneurysmectomy and lateral vein reconstruction were realised (Figure 4). A histopathologic examination revealed an aneurysm venous wall with none evidence of inflammatory or degenerative signs. The patient was given warfarin for anticoagulation and was discharged on the 3th postoperative day. Two months postoperatively, the patient's symptoms were improved; the repetition of venous duplex scanning showed patency of the repaired popliteal vein without venous thrombosis. Elastic stockings were suggested for support, and daily aspirin was recommended for prophylaxis against thrombosis. The patient was able to resume normal activities.

PMC7371580_01

Female

A 59-year-old female presented to our institution with a four-week history of malaise, myalgia, chills, and unintentional weight loss. She also endorsed rhinorrhea and a non-productive cough over this time. She had no medical history or prescription medications, although she took daily supplements including Vitamin C, Vitamin D, zinc, garlic, and a multivitamin. She used marijuana intermittently but did not smoke tobacco or use any other substances. Upon presentation, she was afebrile with an oxygen saturation of 96% on room air and otherwise stable vital signs. Her respiratory, cardiac, and abdominal examinations were unremarkable. Initial investigations were notable for a peripheral lymphocyte count of 52.2 x 109/L and flow cytometry showing 70% involvement of an immunophenotypically abnormal monoclonal plasma cell population. A bone marrow biopsy performed on Day 4 of her hospital admission confirmed a diagnosis of plasma cell leukemia. Of note, CT chest performed upon admission to hospital did not demonstrate any airspace disease. On Day 8, she began therapy with bortezomib 1.3 mg/m2 weekly, dexamethasone 40 mg weekly, and lenalidomide daily. She was afebrile and her oxygen saturation was 95% on room air. The next day, her cough worsened significantly from earlier in the admission, and the sputum contained small volumes of dark blood. The hemoptysis and severe cough persisted on Day 10; she remained afebrile with an oxygen saturation of 96% on room air. A CT scan of the chest demonstrated bilateral patchy ground glass opacities with regions of crazy paving and new small bilateral pleural effusions (Fig. 1). Bronchoscopy was performed on Day 11. Sequential bronchoalveolar lavage demonstrated increasingly hemorrhagic returns. Microbiologic testing for bacterial and fungal cultures, COVID-19, influenza, RSV, TB, PJP, and galactomannan was negative, and cytology did not demonstrate any malignant cells. A workup for alveolar hemorrhage was initiated. Anti-nuclear antibodies, rheumatoid factor, anti-cyclic citrullinated peptide (anti-CCP), extractable nuclear antigen (ENA) panel, anti-nuclear cytoplasmic antibodies (ANCA), anti-glomerular basement membrane antibodies (anti-GBM), complements C3 and C4, cryoglobulin, anti-cardiolipin antibodies, and lupus anticoagulant testing were all within normal limits. CRP was 82.1 mg/L (2.9 mg/L on admission). The patient remained clinically stable on room air, with no further hemoptysis after Day 12 of her admission and with gradual improvement in her cough. Therefore, she was not immediately initiated on corticosteroids, aside from the 40 mg of weekly dexamethasone in her chemotherapeutic regimen. However, she became febrile on Day 13 and on Day 14, out of concern that the fevers may be a delayed manifestation of a bortezomib-related reaction, she was started on prednisone 70 mg daily. A septic workup was negative, and the fevers subsided. A repeat CT scan of the chest on Day 17 of her admission showed near complete resolution of the ground glass opacities, with some residual mosaicism in the upper lung zones, and a decrease in the size of the effusions. She was discharged home shortly afterward and continued therapy with lenalidomide and a tapering dose of steroids; our service advised that she not be rechallenged with bortezomib. She has not had any recurrence of her respiratory symptoms.

bortezomib, diffuse alveolar hemorrhage, drug-induced lung injury, plasma cell leukemia, pulmonary hemorrhage

PMC6431363_01

Male

A 66-year-old man had been diagnosed with infectious cervical tuberculosis on C1 and undergone posterior C1-2 screw-plate fixation at a hospital in India one year prior to his visit to our hospital. Although the surgery was successful and his neck pain had improved, his swallowing function had gradually worsened over the nine-month period after the initial surgery, along with loss of reduction. Due to progressive dysphagia and severe weight loss, he was referred to our hospital. His medical history included hypertension and mild diabetes mellitus (HbA1c 6.2% NGSP). He had been given antitubercular treatment since he was diagnosed with infectious cervical tuberculosis at the local hospital. The patient's height was 165 cm, his weight was 52 kg (BMI 19), and he exhibited normal cognitive function. He had lost 25 kg over 7 months because of difficulty in swallowing, and a nasogastric (NG) tube was placed for tube feeding. Neurological examination of the patient revealed left dominant proximal arm muscle weakness with atrophy, dysesthesia in distal fingers, hyperreflexia throughout with bilateral extensor plantar reflex. Oral examination was remarkable for left tongue atrophy as well as left tongue deviation, which was consistent with unilateral HNP. Routine blood work showed slightly elevated level of C reactive protein (CRP), but the findings were otherwise normal. Chest X-ray results showed no specific abnormality. Lateral cervical X-ray showed O-C2 angle of 17-degree kyphosis (Figure 1). Computed tomography (CT) showed an erosive lesion at dens and anterior arch of the atlas (Figure 2). Magnetic resonance imaging showed a space-occupying lesion in the retropharyngeal space, which presented with heterogeneous signals on both T1- and T2-weighted images (Figure 3). Further sequential review of previous imaging studies revealed that, contrary to the progression of O-C kyphosis, the lesion had been gradually decreasing in size. In sum, the patient had two main problems: severe dysphagia and subsequent malnutrition and neck pain. Initially, we assumed that the dysphagia was primarily caused by oropharyngeal stenosis resulting from O-C kyphosis. However, since no findings of the intracranial pathology were observed and the patient exhibited a persistent unilateral HNP and severe swallowing dysfunction, we eventually hypothesized that the dysphagia would have been deteriorated even worse due to the limited tongue movement. In other words, both O-C kyphosis and HNP were related to dysphagia, and it was not possible to draw a clear line by which these two factors were divided regarding the etiology. No conservative treatments had improved these symptoms, and we therefore decided to perform a corrective surgery to restore the swallowing function and to relieve the neck pain. Posterior O-C3 fusion surgery with iliac bone graft was performed without complications. The O-C kyphosis was corrected to 6-degree lordosis on O-C2 (Figure 4). Findings of the tissue biopsy from the retropharyngeal mass were negative for infectious etiology. The postoperative course was uneventful. His swallowing function concomitantly with his tongue movement improved in two weeks after the surgery. At the final follow-up visit at five months, bone union was observed, and swallowing function was confirmed without further deterioration.

PMC7124461_01

Male

While under treatment for TB, a proportion of individuals die from the disease. In India, 6% of 676 patients age 14 to 87 years old died in a directly observed therapy program. Death rates were independently associated with weight <35 kg and history of previous treatment. A study in Mexico found that the risk of death from pulmonary TB was associated with delays in treatment after the onset of disease and to poor adherence by patients to the treatment regimen. In Ghana, patients who died were likely to be human immunodeficiency virus (HIV)-positive, to be older, live in a rural area, have sputum smear-negative disease, and prolonged duration of symptoms before diagnosis. A United Kingdom study indicated that delay in diagnosis was the main contributing factor leading to death from TB. Delayed diagnosis of active pulmonary TB among hospitalized patients (which leads to greater morbidity, mortality, and transmission of infection) in Canada was associated with atypical clinical and demographic characteristics. An investigation conducted among inner city residents in a large United States city identified predictors of death to be underlying illnesses such as diabetes mellitus, renal failure, chronic obstructive pulmonary disease, and HIV infection. Cases of TB can go undetected until discovered after death. Among 3,102 TB cases in San Francisco, California, 4% were identified at death. Factors associated with these cases were age >=43 years, male sex, white race, birth in the United States, and injecting drug use. Death from TB may sometimes have a rapid onset and progression. TB-related sudden death has been related to bronchopneumonia in 64 percent (n = 30) of reported patients, of which 30% had hemoptysis (n = 14). In New York State, exclusive of New York City, deaths from TB appear to be relatively rare events. In 2001, of the 415 TB cases reported, 9 were identified at death. There are a number of reasons why TB cases are "missed" and are identified and reported at death. Individuals may have had a concurrent condition masking TB disease; they may have been treated for TB disease or infection in the past and suffered an unidentified reactivation; or they may have encountered economic or sociocultural barriers to accessing health care. A TB-related sudden death, where TB disease was not suspected or detected until autopsy, led to a large contact investigation and prompted the New York State Department of Health to look into other TB deaths in an effort to identify patterns where TB disease may have gone undetected and to identify opportunities for intervention to prevent transmission of infection and subsequent development of disease. Some of the results of this investigation were previously reported as an abstract. At a large resort hotel (550 employees providing service to 600 guest rooms and a food service capacity of 1,000 guests/sitting), the security officer was on routine patrol when she was notified by radio of an individual lying on the hallway floor of one of the buildings where resort employees reside. On arrival, the officer found a man lying on his back, not breathing and without a pulse. One officer observed blood on the walls and floor of the hallway. There were no obvious signs of violence. The local rescue unit and the state police were summoned. The officer started cardiopulmonary resuscitation (CPR), and the others cordoned off the area. The patient was transported by ambulance to the hospital, and the officers secured the area as a crime scene until notified by the hospital, 3 hours later, that the man had died from natural causes. The officers cleaned the area with bleach and a biohazard clean-up kit, and the man's room was padlocked. Because the death was unattended, the hospital conducted an autopsy. The cause of death was determined to be cardiorespiratory failure caused by or as a consequence of TB, and the County Health Department was immediately notified. The case had never received medical attention for TB and was unknown to the county staff. The postmortem examination of lung tissue identified Mycobacterium tbcomplex, which was susceptible to all first-line drugs, e.g., rifampin, isoniazid, pyrazinamide, ethambutol, and streptomycin. A contact investigation was launched immediately. County staff contacted the manager of the resort to report a TB death in one of the resort staff and explained both the need to conduct, and the logistics of, a contact investigation. The resort management worked closely with the county nurses to be sure that complete and accurate information was available for the investigation. The resort is located in a sparsely populated area north of New York City. Service worker staff for resorts of this type frequently have ties to New York City and travel to area resorts for seasonal jobs. These employees often live in housing available right on the resort grounds and include a high proportion of foreign-born individuals who often are not fluent in English. Foreign-born staff in this investigation came from 17 countries outside the United States, many of which were Central or South America; however, other countries of origin included China, former Soviet Union, and Indonesia. Language barriers were addressed through existing staff at the local health unit and the use of commercially available telephone-based translating services. Management of the resort recognized the importance of the contact investigation and provided all necessary work schedules and assignments to facilitate identification of staff who may have been exposed to the patient. Transportation to the county clinic proved to be a barrier to attendance despite the provision of shuttles by the resort, so additional clinic sessions were held on the grounds of the resort at a location not accessible to the guests.

PMC3420526_01

Male

This 36-year-old man presented with a 2-month history of generalized epileptic activity and altered perception. Upon examination by a neurologist he was begun on antiepileptic treatment, which consisted of carbamazepine 400 mg daily. His medical history was unyielding. Neurological examination was remarkable for bilateral Babinski's sign. Cranial magnetic resonance imaging (MRI) revealed multiple dural-based enhancing lesions with cerebral edema (Figure 1). Chest X-rays appeared normal, and the CSF was clear. The patient underwent a right frontal stereotaxic awake craniotomy for histopathological diagnosis. At craniotomy the outer layer of the dura was firm and thickened and avascular pinkish, firmly involved the inner layer, fibrous masses resembling meningioma. Histological examination revealed multiple confluent necrotizing and nonnecrotizing granulomas with giant cells (multinucleated and Langhans' type) (Figure 2). Microbiological studies did not reveal acid-fast bacilli. The patient was placed on a regimen of anti-TB medication for 18 months, which consisted of rifampicin (600 mg/daily), ethambutol (1500 mg/daily), and isoniazid (300 mg/daily). The patient's seizures were controlled with phenytoin 300 mg/day, and follow-up MRI at the end of the second postoperative year showed regression of the lesions (Figure 3).

PMC9829017_01

Male

A hypertense 72-year-old man was evaluated in the Infectious Disease Unit after orthopaedic evaluation for loss of strength in his lower limbs. The CT scan revealed an inflammatory lesion on lumbar vertebrae L2-L3 and a paravertebral abscess (Fig. 1). The patient lives in a rural setting, has contact with goats, and had a 1-year history of pain measuring 4/10 on the numerical scale with an inflammatory pattern. There were no relevant clinical or physical findings. The patient was admitted, microbiological samples collected, and a CT-guided biopsy of the lesion performed. Empirical therapy with ceftriaxone and vancomycin was started, but on the 11th day the patient presented generalized macular exanthema on the neck, thorax, abdomen and thighs, which disappeared on digital pressure, fever and cytolysis that resolved with the suspension of antibiotic therapy. Biopsy results were insufficient for diagnosis (only musculoskeletal and fat tissue). Levofloxacin was started and suspended due to vasculitis, so meropenem was instituted empirically while microbiological studies were still negative or pending. Serological testing revealed C. burnetii antibody titres of 1/512 IgG phase I and 1/128 IgG phase II, and were IgM negative. Blood cultures were negative and the patient remained asymptomatic. Echocardiography ruled out endocarditis. Additional studies were negative (Mycobacterium tuberculosis, Brucella and HIV). Serological testing after 8 weeks showed 1/2048 IgG phase I and phase II titres, confirming the Q fever hypothesis. Treatment was adjusted to doxycycline and hydroxychloroquine. MRI imaging revealed advanced L2-L3 spondylodiscitis and empyema with a left psoas major ipsilateral abscess, so CT-guided drainage was performed. Culture of the drainage fluid was negative. There was minor clinical improvement given the presence of vertebral destruction and empyema, so neurosurgical evaluation recommended surgical fixation of the vertebrae and drainage of the intracanal empyema, which was successful (Fig. 2). Culture of pyogenic material was negative. The patient is currently undergoing physical rehabilitation in a convalescence unit and has another 12 months of antimicrobial therapy (for a total of at least 18 months). A multimodal strategy is in place to treat non-oncological chronic pain and medical follow-up is being maintained.

coxiella burnetii, q fever, spondylodiscitis

PMC7154946_01

Unknown

Male, 23 years old, was referred to the emergency department because of fire-related burn injury. The patient suffered from superficial to deep dermal burn injuries that covered 22% of the total body surface area (TBSA). The patient was admitted to the burn unit department. On the 5th day of admission, the patient underwent the wound debridement and installation of NPWT. Burn wounds were cleaned every five days, followed by re-installation of NPWT. On the 15th day of admission, the wound was managed with open wound treatment using Vaseline without installation of NPWT. The patient was discharged on the 19th day of treatment in a good condition (Fig. 1).

burn dressing, burn treatment, burns, npwt, negative pressure wound therapy

PMC7154946_02

Unknown

Male, 56 years old, was referred to the emergency department because of fire-related burn injury. The patient suffered from superficial to deep dermal burn injuries that covered 53% TBSA. On the 10th day of admission, the patient underwent the wound debridement and installation of NPWT. Burn wound was cleaned every five days, followed by re-installation of NPWT. On the 31st day of admission, the burn wound surfaces were decreased by 48% TBSA. The patient should be discharged that day, but due to social factors, the patient still being treated at the hospital with open wound care using Vaseline until the 51st day of admission before being discharged in a good condition (Fig. 2).

burn dressing, burn treatment, burns, npwt, negative pressure wound therapy

PMC7154946_03

Unknown

Male, 19 years old, was admitted to the emergency department because of electrical-related burn injury. The patient suffered from superficial to mid dermal injuries that cover 21% TBSA. On the 5th day of admission, the patient underwent the wound debridement and installation of NPWT. On the 19th day of admission, the burn wound surface reduced about 20% TBSA. The patient was discharged on the 21st day of treatment in a good condition (Fig. 3). Clean the burn wound using normal saline. Cover the burn wound with three layers of sterile gauzes until wrapping all of the wound surfaces. Put the connector cup at the center of the wound. Cover the gauzes with an occlusive transparent film dressing. Connect the connector cup with the hose which was already connected to the NPWT device with a pressure setting of -125 mmHg. Evaluate the wound every 5 days. NPWT Procedure:

burn dressing, burn treatment, burns, npwt, negative pressure wound therapy

PMC8276656_01

Male

A 48-year-old male patient with a long-term smoking history and no other significant disorders was admitted to the clinic in May 2016. His major symptoms included a 2-year history of damage to the skin and nail of the hallux of the right foot, often complicated by secondary bacterial superinfection. He complained of chronic rest pain in the big toe and swelling of the right foot but denied the typical intermittent claudication. There was no direct injury to the right foot preceding the symptoms. However, in the past the patient used to play football. Physical examination revealed trophic changes involving the right foot, particularly advanced in the big toe and less severe in the second and third toe. The skin there was thickened with hyperkeratosis and peeling. There was also partial necrosis of the big toe. His right hallux, foot, and calf appeared swollen, with local tenderness of the great toe. The hallux nail plate was deformed, thickened, and brittle with hyperkeratosis and yellow discoloration (Figures 1 and 2). There were easily palpable symmetric pulses in both lower and upper extremities. The only laboratory test finding was mildly elevated CRP (21 mg/l). Kidney, liver, and lipid parameters and electrolytes were all normal. Antibody tests (ANA, cANCA, pANCA, anti-CCP, RF, LA, anti-cardiolipin, and anti-beta 2 glycoprotein I antibodies) were negative. Viral tests for HBV, HCV, and HIV were negative. An oral glucose tolerance test and glycated hemoglobin assay (HbA1c 4.9%) excluded glucose metabolism disorders. Standard imaging tests (chest X-ray, ECG, abdominal ultrasound) were normal. X-ray of the right foot did not show any signs of destruction or inflammation involving the bones. There was no calcification in the projection of the vessels. The ankle-brachial index was normal (1.11 on the right side, 1.15 on the left). Doppler ultrasonography of the lower extremity arteries showed normal symmetrical high resistance flows. The walls of the vessels were normal. Aneurysms, which could be a potential source of peripheral embolism, were excluded. However, a slight dilatation of the right posterior tibial artery was detected. CT angiography revealed a rare vascular anomaly in the right lower extremity: hypoplasia of the distal segment of the anterior tibial artery, a slightly dilatated and tortuous posterior tibial artery, that fed the arteriovenous malformation (AVM) in the big toe with increased venous flow in the lower limb (Figures 3, 4, 5). There were no changes typical of Buerger's disease. The decision was taken to amputate the distal phalanx of the right hallux, because of the location of the lesion, the lack of remedial possibilities, and the significantly intensified symptoms. Histopathological examination of the removed tissues excluded neoplasm, but confirmed the features of vascular anomaly. Additionally, thickened stratum corneum with chronic inflammatory infiltration and dilated stromal vessels were described. After the amputation, the wound healed normally, the right lower limb edema resolved, and CRP decreased in laboratory test results. At 3-year follow-up, no recurrence of skin lesions in the lower extremities was observed.

abnormal nails, arteriovenous malformation, hallux, lower extremity, skin diseases

PMC4861867_01

Male

A 57-year-old male presented to the Emergency Department with right elbow swelling and discomfort. The patient reported falling on the elbow and skidding on the grass with the elbow flexed forward while playing football, four days before presentation. While in the Emergency Department, the patient was seen by Orthopedics, had elbow radiographs performed (Fig. 1), and had approximately 5 cc of fluid (described as "venous blood") aspirated from the area of swelling. The patient presented for a followup appointment at the Orthopedic Clinic two days later complaining of pain and increased swelling at the medial aspect of the elbow. The pain woke him from sleep and was only minimally relieved with pain medication. Additionally, there were two palpable cords in the region of elbow swelling. The patient was clinically diagnosed with traumatic bursitis, and a compressive bandage was applied. Over the next week, the patient's swelling worsened, and he had an ultrasound examination of the area of pain and palpable mass (Fig. 2). On ultrasound, the mass showed lobules of increased echogenicity, interspersed with areas of slightly complex lower echogenicity. Unenhanced MRI, performed the following week, demonstrated an irregularly shaped, 4.2 x 3.7 x 1.4-cm (longitudinal x AP x transverse) lentiform unilocular T2 hyperintense collection that contained numerous fat globules overlying the deep fascia of the elbow and draping over the medial epicondyle (Figure 3, Figure 4). The imaging findings were consistent with an acute MLL. The patient continued to follow up with Orthopedics over the course of the next few months, opting for conservative management, including physical therapy and pain medication. The collection resolved approximately 6 months after the traumatic event.

PMC8592922_01

Male

Patient: The patient was a 45-year-old man with a body mass index of 19.8 kg/m2. Past history: Dilated cardiomyopathy and placement of a cardiac resynchronization therapy-defibrillator (CRTD). Oral medication history: Antihypertensive drug, diuretic. During the previous several months, the patient had experienced epigastric discomfort. He had an episode of presyncope after a meal and was transported to our hospital by ambulance. On presentation, the patient's blood pressure was 82/64 mmHg, heart rate 140/min, SpO2 98% (room air), and consciousness level GCS E4V5M6. Ejection fraction (EF) was determined on an echocardiogram and found to be 20%. Although tachycardia and decreased blood pressure were seen, hemodynamics stabilized rapidly with a transfusion of <1,000 mL fluid that was administered on an emergency basis. A blood sample showed mild anemia (Hb, 11.5 g/dL) but no other significant findings. Although contrast computed tomography (CT) showed an irregularity in part of the wall of the descending portion of the duodenum, no perforation or extravasation was seen. There were no other significant findings in the head or chest. The patient was admitted to thoroughly investigate the presyncope episode, and the planned endoscopy was scheduled the following day. Although the patient's vital signs were stable after admission, blood collected on the day after admission showed worsening anemia (Hb, 7.6 g/dL). Duodenal hemorrhage was suspected based on the patient's clinical course, and upper gastrointestinal endoscopy was scheduled the following day due to gastric fullness (Supplementary Figure 1). However, the patient had an episode of presyncope before the endoscopic examination was performed, and an emergency call was placed in the general ward. When examined by the physician, the patient was found to be in shock, and emergency transfusion was started immediately. However, the patient went into cardiac arrest. Although a spontaneous heartbeat was restored with cardiopulmonary resuscitation, the patient's hemodynamics were unstable. Because a large volume of bloody drainage was seen from the nasogastric tube that had been inserted, the cause of the cardiac arrest was concluded to be upper gastrointestinal hemorrhage, and a decision was made to perform emergency hemostasis. However, the emergency blood transfusion administered by pumping barely produced pulse pressure. Consequently, there was not sufficient time to proceed to a CT examination. Placement of a REBOA device was therefore planned to temporarily stabilize the patient's hemodynamics. The patient was moved to a fluoroscopy room as resuscitation was continued. A REBOA device (Rescue Balloon ER , Tokai Medical Products, Kasugai, Japan) was then inserted via the left femoral artery and placed in zone I (region between the left subclavian artery and the celiac artery). Blood pressure increased transiently due to inflation of the REBOA balloon. Vascular embolization was planned as the hemostasis procedure, and it was determined that it would be performed in the fluoroscopy room. A 4-Fr sheath was placed contralaterally via the right femoral artery. Imaging was performed via the celiac and superior mesenteric arteries, and extravasation was seen from the gastroduodenal artery to within the duodenum (Figure 1A). Isolation of the hemorrhage site by coil embolization was then planned. The gastroduodenal artery was embolized using 11 ionization coils (Target Detachable Coil , Stryker, Tokyo, Japan). During the embolization procedure, the transfusion rate was adjusted to manage hemodynamics as appropriate, while ischemia distal to the REBOA device was prevented by deflating the REBOA balloon. Angiography performed after embolization showed that the extravasation had nearly disappeared (Figure 1B). Moreover, no marked decrease in blood pressure was seen when the REBOA balloon was completely deflated. After completion of the embolization procedure, imaging is performed via the superior mesenteric artery with the REBOA balloon deflated. The ischemic area associated with embolization was confirmed to be small (Figure 1C), and there were no significant complications. The procedure was therefore completed, and the patient was returned to the intensive care unit (ICU). The transfusion required to maintain circulation from resuscitation to the end of the embolization procedure used 26 units of RBCs and 16 units of fresh frozen plasma (FFP). After the patient returned to the ICU, there were no findings suggestive of recurrent bleeding, and hemodynamics were stable. Although the patient had a past history of dilated cardiomyopathy and was therefore weaned from mechanical ventilation carefully, mechanical ventilation was withdrawn without incident on day 8 of his illness. Upper gastrointestinal endoscopy performed on day 11 of hospitalization showed an ulcer in the anterior wall of the duodenal bulb and coil extrusion but no bleeding (Figure 2). Oral food intake was subsequently started, and the patient was able to walk without assistance at discharge and had no neurological sequelae.

cardiopulmonary arrest, cardiopulmonary resuscitation, interventional, radiology, shock

PMC7369452_01

Male

Patient information: A 35-year-old male patient, left hand dominant, presented to orthopaedic outpatient clinic with complaints of paraesthesia and weakness in his right hand for the past 6 weeks along with an inability to make a fist fully and difficulty in writing with the same hand. Clinical Findings: A detailed examination was carried out. General physical examination was unremarkable. Local examination revealed a 2 cm transverse surgical scar mark (from the venous cut down procedure) present at the medial aspect of right arm just proximal to the elbow crease (Fig. 1). He had appreciable wasting of thenar eminence of that hand as compared to the other side. There was decreased sensation over the lateral aspect of palm and palmar aspect of radial 31/2 digits as compared to the other side. He was unable to do the "OK sign", which suggested weakness of the flexor pollicis longus (FPL) and flexor digitorum profundus (FDP) of index finger (Fig. 2). "Pointing finger sign" was positive due to the inability to flex PIP and DIP joints of index finger (Fig. 3). Hence, a clinical diagnosis of median nerve injury secondary to peripheral venous cut down was made. Timeline: He reported that his symptoms started developing 6 weeks ago when he was admitted in emergency room and had a peripheral venous cut down procedure done to gain emergency vascular access as he had presented with intestinal perforation secondary to intestinal tuberculosis. Diagnostic Assessment: Clinical suspicion of median nerve injury warranted the need to do electrodiagnostic studies, EMG (electromyography) and NCV (nerve conduction velocity), to further aid in diagnosis. EMG revealed wasted right abductor pollicis brevis with decreased recruitment and interference pattern. Sensory NCV revealed lack of stimulation of fibres across right median nerve at the level of elbow. Hence, the diagnosis of median nerve injury was confirmed. Therapeutic intervention: Patient was explained the nature of the problem and a detailed discussion was held with him discussing the various treatment options, operative versus non-operative. Patient was counselled about the risks and benefits of the surgery and signed an informed consent form. Upon exploration, it was noted that the median nerve was tightly tied circumferentially with a non absorbable suture, (most likely being an ethilon suture, which is same as used to close the skin) forming a constriction band (Fig. 4). The constriction band was released and external neurolysis done (Fig. 5). Follow up & Outcomes: Post-operatively, patient underwent transcutaneous nerve stimulation daily for three weeks along with physiotherapy exercises. Around two weeks post operatively, it was noted that patient was able to flex PIP joint of index finger (Fig. 6). During follow-up visit, at around 4 months, he showed complete recovery in the function of the muscles of the hand innervated by median nerve i.e. flexor digitorum superficialis, lateral half of the flexor digitorum profundus and flexor pollicis longus and was able to make a full fist (Fig. 7). He was able to write normally, had no complaints of paraesthesia and could go back to work. He has been followed up for a period of 12 months and there have been no concerns.

case report, iatrogenic injury, median nerve, venous cut down

PMC3000144_01

Female

On October 28, 2001, a local hospital reported a suspected case of inhalational anthrax to DOH. The case-patient was a 61-year-old female with a 3-day history of progressive weakness, chest heaviness, myalgia, cough, and shortness of breath. She was admitted to intensive care with respiratory failure, emergently intubated before being interviewed, and treated with multiple antibiotics and diuretics for a presumptive diagnosis of community-acquired pneumonia, congestive heart failure, or inhalational anthrax. On October 29, nonmotile, gram-positive rods in long chains were isolated from routine blood cultures, and her antibiotic therapy was adjusted to provide for enhanced coverage of inhalational anthrax. That evening, Bacillus anthracis was preliminarily identified from her blood culture isolate and from pleural, fluid, and bronchial washings by polymerase chain reaction (PCR) at the DOH Public Health Laboratory and CDC. The following day, pleural and blood isolates were confirmed as B. anthracis by gamma phage lysis and direct fluorescent antibody testing. The case-patient died on October 31. B. anthracis isolates were subtyped at CDC by multiple-locus variable-number tandem repeat analysis (MLVA) and sequencing of the pagA gene. All isolates were MLVA genotype 62 and pagA genotype I, the same genotype as all other isolates from the 2001 anthrax outbreak in Florida, New Jersey, Washington, D.C., and Connecticut. We report the results of the epidemiologic and environmental investigation by DOH, CDC, and local and federal law enforcement agencies in response to this isolated case of inhalational anthrax. The objectives of our investigation were to determine the time, location, and route of exposure; to identify any additional cases of cutaneous or inhalational anthrax; to determine whether this case was an isolated case or sentinel case of a larger outbreak; and to guide our public health response. Immediately after confirming the case-patient's diagnosis, epidemiologists from DOH and CDC and a detective and special agents from the Joint Terrorism Task Force formed joint investigative teams to ensure the rapid and efficient sharing of relevant information between the epidemiologic and criminal investigations. To identify the time and location where the case-patient might have been exposed to anthrax during the 60 days before illness onset, detectives from the NYC Police Department and FBI along with local and federal epidemiologists performed joint interviews of the patient's social, work, and neighborhood contacts. We chose a 60-day period on the basis of the range of the inhalational anthrax incubation period during the Sverdlovsk anthrax outbreak in 1979. We conducted regular interagency meetings to analyze new information collaboratively and strategize about the next steps of the investigations. We collected information about the case-patient's habits and activities through interviews with co-workers, neighbors, acquaintances, and a mail carrier to uncover any potentially relevant personal details, including places she frequented, and her social contacts. Investigators searched the case-patient's apartment, examined personal effects, reviewed telephone and financial records, and visited four post offices that she was known or thought to have used. To locate persons who might have information regarding activities during the incubation period, we displayed the case-patient's photograph in churches that she reportedly attended and in Chinatown, which she frequented. Employees from 15 businesses near the case-patient's apartment complex and work were interviewed. Members of the NYC Anthrax Investigation Team also met with investigators of the other unexplained inhalational case in Connecticut. Using the identification number from a subway transit card issued to the case-patient by the New York City Metropolitan Transportation Authority (MTA), we obtained data about her transit activity from October 22 to October 26, indicating which buses and subway stations she entered in the week before onset of illness. The MTA also identified a previous transit card number with boarding times that matched the pattern of subway use linked to her card. Using this information, we were able to approximate her bus and subway travel during the previous month (September 21-October 20). Our investigation included active case finding and surveillance for additional anthrax cases at the case-patient's workplace and in her apartment complex. We asked all co-workers, patients, and visitors who had spent >1 hour at her workplace during the preceding 2 weeks to report for an interview; at the interview, they were offered antibiotic prophylaxis. We also used the following information to identify additional suspect cases: 1) the hospital's employee health department list of all employees who had been evaluated for fever during the previous 2 weeks; 2) the human resources department list of employees who had missed >1 day of work during this period; 3) interviews regarding symptoms in occupants from 27 of 28 of the neighboring apartments in her complex; and 4) a community meeting in the case-patient's Bronx neighborhood in which the case was discussed and neighbors were encouraged to report illnesses or skin lesions suggestive of anthrax. In addition, active surveillance for suspect cases was established with the U.S. Postal Service and MTA in NYC because of concern regarding potential exposures in post offices, from mail, or in the subway system. Any ill employee was contacted by DOH staff by telephone and asked about symptoms. Any suspect cases were referred for immediate evaluation and follow-up. The case-patient was a resident of an apartment in a predominately Hispanic section of the Bronx; she lived alone. She had no known family members in NYC and a limited number of close acquaintances. A refugee from Vietnam, she had lived in the United States for 26 years. Her acquaintances at work and in her neighborhood reported her daily routine and usual activities to be habitual, with a regular work schedule, visits to Chinatown in Manhattan to shop, and trips to post offices and department stores near her workplace and home. Although reportedly friendly and generous, she lived a solitary life. Her apartment was clean and tidy. We collected no information suggesting that she had traveled outside NYC during the 60-day period before onset of illness. Neighbors did not recall any recent visitors to her home. From information received from MTA, we ascertained that she rode the No. 6 Lexington Avenue subway almost daily, traveling from her home in the Bronx to her workplace in Manhattan (Figure). She had worked full time in an East Side Manhattan hospital for 12 years, delivering supplies from basement stockrooms to clinics and wards within the hospital. She had not missed any work in the several weeks before onset of illness. She did not directly work with or sort mail. The hospital's mail was sorted in a section of one of these stockrooms, where it was placed into wooden mail slots. The mailroom and stockroom staff reported no suspicious packages or letters. We constructed a timeline of her activities in the several weeks preceding her illness. Although her subway transit card, work records, financial records, and sales receipts allowed us to account for some of her activities, approximately 40% of the nonwork-related hours before her death remained unaccounted for. The criminal investigation found no suspicious letters or activity to connect the case-patient to any of the known anthrax-laden postmarked letters, and no evidence existed that she had visited any of the media sites in NYC affected by this outbreak. Shared information with the investigators in Connecticut indicated that she and the case-patient in that state had little in common. A total of 232 coworkers, occupants from 27 of 28 neighboring apartment units, 35 acquaintances, and 1,675 hospital patients and visitors were screened for symptoms of cutaneous or inhalational anthrax in connection with this single case. A total of 69 persons with respiratory symptoms and 21 with suspicious skin lesions were followed up by medical evaluation or telephone call. None of these persons were diagnosed with inhalational or cutaneous anthrax. We contacted all hospital employees listed as ill on absentee (n=60) and employee health (n=88) lists and found them to have recovered from minor illnesses or injuries. Enhanced surveillance in NYC hospitals, the U.S. Postal Service, and emergency departments in NYC have continued since 2001 to 2003. No further cases of anthrax have been identified in NYC.

PMC7383343_01

Female

A 24-year-old woman from Lima, Peru, presented with a nine-month history of persistent right hemicraneal headache preceded by photopsia, associated to nausea and photophobia. Her medical history was relevant for migraine; she worked as a teacher at an orphanage and had travelled within the previous year to Morocco and Spain. Seven months prior to presentation, she had been evaluated for this complaint; a head computed tomography (CT) angiography was performed which showed a hypodense, right occipital lesion with ill-defined borders and peripheral contrast enhancement (Figure 1); the study was followed by a brain magnetic resonance imaging (MRI), which confirmed the presence of a solid cortical formation of about 0.7 centimeters in the right occipital lobe, with an irregular border, associated with vasogenic edema. A biopsy of the lesion was performed, and it demonstrated a necrotizing granuloma, with no identification of acid-fast bacilli, a negative Mycobacterium tuberculosis tissue polymerase chain reaction (PCR), and no evidence of malignancy. The patient was then referred to the Infectious Diseases Department in order to rule out infectious causes of granulomatous brain lesions. Further workup demonstrated negative results for Histoplasma antibodies, Listeria monocytogenes (IgG), Leptospira (IgG-IgM), Hydatidosis (IgG), Borrelia burgdorferi (IgG-IgM), Coxsackie B Ab, E. histolytica Ab, Bartonella henselae (IgG-IgM), QuantiFERON TB, antinuclear antibodies, ANCA C-P, SS-A antibodies, SS-B antibodies, Rose Bengal, tube agglutination, 2-mercaptoethanol test, prozone phenomenon, and blocking antibodies. After four months without a definitive diagnosis, she was readmitted after an episode of generalized tonic-clonic seizures. Serum and cerebrospinal fluid (CSF) tests were negative for histoplasmosis, paracoccidioidomycosis, vasculitis, and tuberculosis. Empiric treatment for cerebral tuberculosis (isoniazid 300 mg, rifampicin 600 mg, pyrazinamide 150 mg, and ethambutol 1200 mg/daily plus dexamethasone 6 mg/daily) therapy was started given the high prevalence of tuberculosis in Peru and the finding of a necrotizing granuloma in the brain biopsy, but the headache and photopsia persisted. Evaluation by Ophthalmology, which included fluorescein angiography, found bilateral optic papillitis without signs of uveitis. Further studies for granulomatosis demonstrated a switch in the Brucella panel tests, with positive plate agglutinations, positive Rose Bengal test, and positive (1/100) tube agglutination test; these tests were performed in three different laboratories, and all of them reported consistent results. Specific brucellosis treatment was started with doxycycline 100 mg twice a day, trimethoprim-sulfamethoxazole 160/800 mg twice a day, and intravenous amikacin 1 g daily; she received amikacin only for the first 10 days and the other two antibiotics for twelve weeks. Corticosteroids doses were tapered gradually until total discontinuation at the end of the first month of specific therapy. Clinical, laboratory, and radiological improvement was seen during the ambulatory 12-month follow-up visit; she did not have any other headache crisis, neither seizures nor visual disturbances.

PMC9816882_01

Male

Patient information: the patient is 22 years old male with no medical history, non-smoking, obese with a BMI of 31 kg/m2 with no history of a tuberculosis contamination. Clinical findings: he consults for a right axillary suppuration evolving for two years with repeated episodes of abscessing, fistulization, and purulent flow. The initial lesion seemed to be an inflammatory induration of 2.5 cm, evolving by a push towards an extension on the surface and adherence to the deep plane. The evolution of the case was marked by periods of clinical improvement with the sagging of the renitent masses but then reappearing a few months later. This disabling situation altered the patient's quality of life and led him to many consultations during the last few years with protocols combining local care, antibiotics, and even repeated drainage of the collections. The examination at the admission finds an endure cupboard at the level of the right axillary region. It is 5cm in diameter with many fistulas and umbilicated papules adhering to the deep plane with ipsilateral lymphadenopathy (Figure 1). The rest of the skin examination spotlights lesions of predominant folliculitis at the back, the trunk, and acne on the face (Figure 2). Besides, the patient does not display any general infectious signs (no fever or chills, or night sweats). Therapeutic interventions: we have opted for surgical exploration for diagnostic and therapeutic purposes. A wide surgical excision was performed in one piece, carrying the entire fistulized skin flap to the surface with its deep extensions and adhering lymphadenopathy to the magma of the inflammatory tissue (Figure 3). We maintained post-surgery drain care for 48 hours, a probabilistic antibiotic therapy approach, and local care until healing. The specimen has been oriented and sent for pathological examination. Diagnostic assessment: histological analysis reveals the following: inflammatory lymphadenitis with caseous necrosis. Absence of signs of malignancy (Figure 4). The patient received treatment based on anti-tuberculosis therapy. Follow-up and outcome of interventions: the postoperative evolution was good, with complete healing after a week and no recurrence (Figure 5). Patient perspective: the patient was satisfied with the treatment and the postoperative results. Informed consent: the patient provided full consent after an oral explanation of our intention of publishing her case.

axillary hidradenitis, axillary swelling, case report, lymph node tuberculosis

PMC9490049_01

Male

A previously healthy 10-year-old boy presented to our department with a 5-day history of intermittent, left-sided chest pain exacerbated by deep breathing. He denied any current fever, cough, hemoptysis, nausea, vomiting, diarrhea, palpitations, night sweats, or weight loss. Additionally, he also denied previous surgery, trauma, sick contacts, dental work, aspiration episodes, and exposure to hazardous and/or infectious materials. He had no remarkable medical history and had received all scheduled vaccines, including BCG, without any serious adverse events. There was no family history of asthma, diabetes, immunodeficiency, malignancy, and tuberculosis. On day 3 of chest pain, he sought treatment at a local hospital. Chest radiography demonstrated left lobe pneumonia (Figure 1A), while blood examination revealed a white blood cell count (WBC) of 10.4x 109/L with 58.5% neutrophils and C-reactive protein levels < 0.50 mg/L. Thus, he was initially treated for community-acquired pneumonia with ceftriaxone and azithromycin for 2 days without relief. A subsequent plane computed tomography (CT) scan of the chest disclosed a round soft tissue mass and a small amount of pleural effusion in the left lung (Figures 1B,C). Then, the patient was transferred to our hospital for further evaluation and treatment at the request of his parents. His vital signs upon arriving to us were as follows: body temperature, 37.1 C; pulse rate, 92/min; respiratory rate, 28/min; and blood pressure, 113/67 mmHg. Physical examination showed no abnormalities. Blood routine and biochemical tests were all within normal ranges. Empiric antibiotics with azithromycin and amoxicillin/clavulanate were given. The HIV test, viral hepatitis serologies, antinuclear antibody, serum parasite IgG, serum galactomannan, serum 1, 3-beta-D-glucan, serum Cryptococcus antigen test, T-spot test, oncological biomarkers, Legionella antigen, Mycoplasma pneumoniae antigen, and respiratory virus antigen were all negative. Due to concern of endocarditis and other occult sources of infection, echocardiogram and abdominal ultrasonography (US) were also ordered and were unremarkable. The patient underwent conventional flexible bronchoscopy and bronchoalveolar lavage (BAL). The utility of bronchoscopy revealed no unsuspected endobronchial lesions. BAL fluid (BALF) yielded only benign bronchial epithelial cells and macrophages, with no bacterial, viral, or fungal inclusions. The initial blood, sputum, and BALF specimens were all negative on both Gram stain and culture. These results yield no clear etiology for the formation of the nodule. However, his symptoms persisted. On hospital day 5, a chest X-ray revealed a left lung nodule measuring 2 cm in diameter (Figure 1D), which was similar to the previous. The thoracic US showed a hypoechoic lesion, 2.2 cm x 1.9 cm x 1.6 cm. This was confirmed by a contrast-enhanced CT scan revealing a rim-enhancing lesion in the left lower lobe lung (Figures 1E,F). The pulmonary abscess was highly suspected based on these findings. He was then sent for a US-guided lung biopsy on hospital day 7. Metagenomic next-generation sequencing (mNGS) showed 416 sequence reads of S. intermedius in lung biopsy tissue. Consistently, 5 days later, the culture of the specimen yielded pure growth of S. intermedius, with the pathological evaluation of the mass demonstrating fibroblast proliferation, no evidence of malignancy, lymphoma, or soft tissue tumor. The microorganism isolated from the lesion was susceptible to penicillin G, ceftriaxone, vancomycin, linezolid, levofloxacin, and chloramphenicol. Antibiotics were then narrowed to amoxicillin/clavulanate. However, following the biopsy, he had an intermittent slight fever since hospital day 7. A repeated chest X-ray showed partial resolution of the mass (Figure 2A) on hospital day 8, but an ultrasound revealed pleural effusion on hospital day 11. Considering the unsatisfactory effectiveness of amoxicillin/clavulanate, his antibiotic regimen was switched to linezolid on day 11. A thoracentesis was performed evacuating 190 ml of reddish-brown purulent pleural fluid (Figure 2B). Pleural fluid glucose was 6.07 mmol/L, protein 54.4 g/L, lactic dehydrogenase (LDH) 240 U/L, triglyceride 0.42 mmol/L, adenosine deaminase (ADA) 16.2 U/L, and white blood cell count 6,836.0 x106/L (64.0% polymorphonuclear cells and 36.0% mononuclear cells). Accordingly, pleural fluid analysis with mNGS reported 110 sequence reads of S. intermedius. The pleural fluid culture was negative. Clinically, his fever subsided on hospital day 13, and the patient was also much improved. A repeat chest scan confirmed the obvious resolution of the lung nodule and disappearance of the pleural effusion on hospital day 20 (Figures 2C,D). The patient was then discharged home with the plan to finish a 4-week course of linezolid and continued to be asymptomatic. Follow-up CT after 3 months showed nodule resolution without any residual lesion (Figures 2E,F).

streptococcus intermedius, case report, infection, metagenomics next-generation sequencing, pulmonary nodule, ultrasonography-guided lung biopsy

PMC3812098_01

Male

In April 2011, a 68-year-old man presented himself at our research clinic in rural Tanzania with a three-month persistent productive cough, chest pain, night sweats, and recurrent nonmassive haemoptysis. He denied fever, night sweats, weight loss, and any recent contact with a known tuberculosis case. A prior treatment with a broad-spectrum antibiotic had not been successful. The patient reported having been treated for tuberculosis, diagnosed by sputum smear ten years ago. On examination he was afebrile, in a reduced general condition with a body mass index of 17.1 kg/m2. Other findings were bilateral reduced breath sounds and mild clubbing. Testing for HIV with two rapid tests (SD Bioline HIV 1/2 3.0 and Determine HIV-1/2) was negative. Posteroanterior chest radiography in an erect position showed a cavity of 60 mmx73 mm diameter in the right upper lobe containing an intracavitary focal mass of 47 mmx31 mm diameter with adjacent moon-shaped radiolucency (Figure 1). A second radiography in a supine position showed a changed position of this focal mass (Figure 2). A chest x-ray of the previous TB episode was not available for comparison. Smear microscopy of early morning and spot sputum after Ziehl-Neelsen stain was negative for acid-fast bacilli. A nucleic acid amplification test (Xpert MTB/RIF) did not detect Mycobacterium tuberculosis. Both the early morning and spot sputum samples were subsequently cultured on solid (Lowenstein Jensen) and in liquid (MGIT) media, neither of which showed mycobacterial growth after eight and six weeks, respectively. In order to isolate Aspergillus, a sabouraud dextrose agar was inoculated directly with sputum, but only Enterobacter cloacae could be found. Due to lack of facilities, neither an ELISA for IgG antibodies to Aspergillus nor an Aspergillus precipitin test could be performed. There is no epidemiological data on pulmonary aspergilloma in Tanzania and sub-Saharan Africa. However, the high burden of tuberculosis in these countries suggests a considerable number of unreported cases. The case described here should not illustrate a new treatment approach but emphasize the limitations and challenges in diagnosis and treatment due to resource limitations, the tuberculosis epidemic, and lack of consensus on therapeutic approach. The means used in this case surpassed the resources of an average rural setting, where we would have encountered even more limitations. Our initial diagnosis was purely based on the typical radiological findings illustrated in Figure 1 and Figure 2. Recurrent nonmassive haemoptysis and other clinical symptoms at the first consultation were consistent with pulmonary aspergilloma and other pulmonary conditions, including tuberculosis. Unfortunately, we could not compare radiographies with the tuberculosis episode that the patient had ten years before and distinguish between new and old radiological manifestations. Consequently, our case fulfilled all criteria for a sputum smear-negative case according to national standards and the international standards for tuberculosis care in high epidemic countries, and the NTLP decided to start treatment despite of the unavailability of mycobacterial cultures at this point. If we had attributed the symptoms purely to pulmonary aspergilloma, surgical resection would have been the best treatment choice. Missing options of surgical treatment due to lack of resources and epidemiological concerns led to the decision to treat pharmacologically, first for tuberculosis and subsequently for pulmonary aspergilloma. With total treatment duration of at least 12 months, it was difficult to guarantee proper adherence to both treatments. In our case, insufficient drug supply, as well as logistical difficulties in making the antifungal drugs available for the patient, led us to extend the antifungal therapy for another six months. It remains unclear if the treatment with tuberculostatica, antifungal medication, or the natural history of pulmonary aspergilloma caused the clinical improvement of the patient, whose symptoms disappeared except residual chest pain. Retrospectively, although it was initially not possible to exclude a smear-negative tuberculosis case, treatment of pulmonary aspergilloma should have been given priority while TB treatment should have been started only in the case of positive cultures. The challenges in differential diagnosis and therapy of pulmonary aspergilloma demonstrated in this case underline the necessity for incorporating management of this frequently neglected TB-associated disease into national TB treatment guidelines in endemic countries.

PMC5772952_02

Female

A 31-year-old female from a non-consanguineous family presented to PUMCH in April 2015 due to an abnormal appearance on a chest X-ray observed during a medical examination 1 year prior. The patient did not present with any respiratory symptoms such as dyspnea on exertion or a cough. Physical examination revealed decreased pulmonary sounds in the lower zones and P2>A2 was heard during heart auscultation. The HRCT revealed diffuse, scattered, hyperdense micronodules throughout the whole lungs, accompanied by interlobular septal and bilateral pleural calcific thickening, subpleural cysts between the ribs and calcified parenchyma, referred to as the 'black pleura' sign (Fig. 2A and B). The BAFL examination (performed as above) revealed that the classification of inflammatory cells was normal and the ratio of cluster of differentiation (CD)4+/CD8+ T cells was 0.9 (reference range, 0.9-2.0), but a calcified body was detected (Fig. 2C). ABG measured pH 7.378, PaCO2 37.0 mmHg, PaO2 88.1 mmHg, SO2 96.4% and HCO3 22 mmol/l of room air (data not shown). Lung tissue pathology and SLC34A2 gene testing were lacking as a positive diagnosis of PMA had been reached based on the tests performed making invasive surgery unnecessary Gene testing was not performed on this patient due to economic constraints. A 99mTc-MDP bone scan revealed a diffusely increased intake of radiation in the lungs. An echocardiograph revealed mild enlargement of the right ventricle (anteroposterior diameter, 32 mm), with mild pulmonary hypertension (pulmonary systolic pressure, 37 mmHg) (data not shown). PFT and routine blood biochemistry were normal (data not shown). In the patient's local hospital they were misdiagnosed with pulmonary tuberculosis (TB) due to the appearance of miliary nodules on HRCT imaging. Following a positive diagnosis for PAM no medication was prescribed. At the 3 year follow-up the clinical course of the patient's disease remained stable.

clinical manifestations, diagnostic imaging, pulmonary alveolar microlithiasis, solute carrier family 34 member 2

Diagnostic imaging and pathological features of case 2. (A) HRCT imaging of a lung window exhibiting hyperdense micronodular interlobular septal thickening and the black pleura sign in the lungs.

PMC5772952_02

Female

A 31-year-old female from a non-consanguineous family presented to PUMCH in April 2015 due to an abnormal appearance on a chest X-ray observed during a medical examination 1 year prior. The patient did not present with any respiratory symptoms such as dyspnea on exertion or a cough. Physical examination revealed decreased pulmonary sounds in the lower zones and P2>A2 was heard during heart auscultation. The HRCT revealed diffuse, scattered, hyperdense micronodules throughout the whole lungs, accompanied by interlobular septal and bilateral pleural calcific thickening, subpleural cysts between the ribs and calcified parenchyma, referred to as the 'black pleura' sign (Fig. 2A and B). The BAFL examination (performed as above) revealed that the classification of inflammatory cells was normal and the ratio of cluster of differentiation (CD)4+/CD8+ T cells was 0.9 (reference range, 0.9-2.0), but a calcified body was detected (Fig. 2C). ABG measured pH 7.378, PaCO2 37.0 mmHg, PaO2 88.1 mmHg, SO2 96.4% and HCO3 22 mmol/l of room air (data not shown). Lung tissue pathology and SLC34A2 gene testing were lacking as a positive diagnosis of PMA had been reached based on the tests performed making invasive surgery unnecessary Gene testing was not performed on this patient due to economic constraints. A 99mTc-MDP bone scan revealed a diffusely increased intake of radiation in the lungs. An echocardiograph revealed mild enlargement of the right ventricle (anteroposterior diameter, 32 mm), with mild pulmonary hypertension (pulmonary systolic pressure, 37 mmHg) (data not shown). PFT and routine blood biochemistry were normal (data not shown). In the patient's local hospital they were misdiagnosed with pulmonary tuberculosis (TB) due to the appearance of miliary nodules on HRCT imaging. Following a positive diagnosis for PAM no medication was prescribed. At the 3 year follow-up the clinical course of the patient's disease remained stable.

clinical manifestations, diagnostic imaging, pulmonary alveolar microlithiasis, solute carrier family 34 member 2

Diagnostic imaging and pathological features of case 2. (B) HRCT imaging of a mediastinal window demonstrating subpleural intense linear calcification during a bronchoalveolar lavage fluid examination.

PMC5772952_02

Female

A 31-year-old female from a non-consanguineous family presented to PUMCH in April 2015 due to an abnormal appearance on a chest X-ray observed during a medical examination 1 year prior. The patient did not present with any respiratory symptoms such as dyspnea on exertion or a cough. Physical examination revealed decreased pulmonary sounds in the lower zones and P2>A2 was heard during heart auscultation. The HRCT revealed diffuse, scattered, hyperdense micronodules throughout the whole lungs, accompanied by interlobular septal and bilateral pleural calcific thickening, subpleural cysts between the ribs and calcified parenchyma, referred to as the 'black pleura' sign (Fig. 2A and B). The BAFL examination (performed as above) revealed that the classification of inflammatory cells was normal and the ratio of cluster of differentiation (CD)4+/CD8+ T cells was 0.9 (reference range, 0.9-2.0), but a calcified body was detected (Fig. 2C). ABG measured pH 7.378, PaCO2 37.0 mmHg, PaO2 88.1 mmHg, SO2 96.4% and HCO3 22 mmol/l of room air (data not shown). Lung tissue pathology and SLC34A2 gene testing were lacking as a positive diagnosis of PMA had been reached based on the tests performed making invasive surgery unnecessary Gene testing was not performed on this patient due to economic constraints. A 99mTc-MDP bone scan revealed a diffusely increased intake of radiation in the lungs. An echocardiograph revealed mild enlargement of the right ventricle (anteroposterior diameter, 32 mm), with mild pulmonary hypertension (pulmonary systolic pressure, 37 mmHg) (data not shown). PFT and routine blood biochemistry were normal (data not shown). In the patient's local hospital they were misdiagnosed with pulmonary tuberculosis (TB) due to the appearance of miliary nodules on HRCT imaging. Following a positive diagnosis for PAM no medication was prescribed. At the 3 year follow-up the clinical course of the patient's disease remained stable.

clinical manifestations, diagnostic imaging, pulmonary alveolar microlithiasis, solute carrier family 34 member 2

Diagnostic imaging and pathological features of case 2. (C) Hematoxylin and eosin staining of bronchoalveolar lavage fluid demonstrating a lamellar calcified body (magnification, x400). HRCT, high resolution computed tomography.

PMC8288200_03

Male

Non-contrast CCT of a 56-year-old asymptomatic male patient who had been routinely followed up due to the diagnosis of laryngeal cancer for one year demonstrated a newly emerging hypodense solid mass on the left side of anterior thoracic wall at the level of second costae. The mass measured 25x35x37 mm in size caused destruction in the adjacent costa and invaded the pectoralis muscle (Figure 5a and 5b). There was also an extension of the mass to the intrathoracic area with pleural thickening and reticulations in the adjacent lung parenchyma, suggesting invasion (Figure 5c). Several lymph nodes, the largest of which was 8x7mm in size, were observed in the left internal mammary chain (Figure 5d). In 18F-FDG PET/CT performed for further evaluation, increased F-18 FDG uptake (SUVmax: 12.0) was noted in the lesion (Figure 5e). In the differential diagnosis of the lesion, laryngeal cancer metastasis, haematological malignancies, tuberculosis, soft tissue sarcoma and malignant pleural mass were considered. After an excisional biopsy, the diagnosis of the lesion was reported as IgG4-RRD.

computed tomography, igg4, lung

PMC4705617_01

Male

On January 5th, 2014, a 2-year-old boy with JMML was presented to the pediatric hematology and oncology department for abnormal hemogram lasting for two months. Then, he was admitted to the hospital and discharged 8 days later after completing the Human Leukocyte Antigens (HLA) matching (Fig. 1a). Subsequently, he continued with chemotherapy and outpatient medications, including mercaptopurine, prednisone, and 13-cis-retinoid acid (isotretinoin). On June 5th, 2014, the patient returned to the hospital for preparation before HSCT. His vital signs were normal, and physical examination was unremarkable except some discrete old rashes on skin (Fig. 2). The result of hospital laboratory examinations was also normal. Since June 10th, patient started to receive a myeloablative conditioning regimen [busulfan (BU) 1.2 mg/kg iv. q6h for 4 days, cyclophosphamide (CTX) 50 mg/kg iv. qd for 4 days and anti-thymocyte globulin (ATG) 3.3 mg/kg iv. qd for 3 days]. However, the patient suffered from fever (up to 39.8 C) with mild cough and running nose since June 15th, indicating respiratory infection. Subsequently, clinical examinations were performed to analyze the possible cause. The blood/marrow culture were negative. The number of his peripheral white blood cells and neutrophils was 7500 and 2450 per cubic millimeter, respectively. The C-reactive protein (CRP) was above 200 mg per liter (normal range, 0 to 5 mg per liter). The procalcitonin (PCT) was 0.15 ng per milliliter (normal range, 0 to 0.1 ng per milliliter). The G test which was target for broad spectrum dectection of fungal infection was 20.6 pg per milliliter (normal range, 0 to 20 pg per milliliter). All these results from assays of serum liver-enzyme, usea nitrogen, creatinine, electrolyte and pathogen specific antigen were within range of normal value. However, the result of chest X-ray showed increased lung-markings. Consequently, the patient was treated with meropenenm (MEM) targeted for gram-negative and other refractory bacteria, and vancomycin (VANC) targeted for gram-positive cocci. Meanwhile, antifungal agent caspofungin acetate (CAS) and antiviral agent acyclovir (ACV) were also administered as prophylaxis (Fig. 1b). The patient underwent the cord blood transplantation and HSCT (the donor was his mother) on June 20th and 21th, respectively. From June 15th to June 24th, patient's body temperature dropped to 38.5 C from 40.5 C, then rose to 40.3 C again (Fig. 1c). Meanwhile, CRP dropped to 8.5 mg per liter (normal range, 0 to 5 mg per liter). Although treatments had been performed regularly, his symptoms of fever, chills and cough still didn't lighten. Physical examination showed some previous discrete rashes and coarse lung sounds. CRP was 119.2 mg per liter (normal range, 0 to 5 mg per liter). MEM and VANC almost had no effect on the clinical symptoms. Then, his primary care physician decided to switch drugs to linezolid (LZD) against gram-positive cocci, tobramycin (TOB) against gram-negative bacteria for a week, and voriconazole for fungal prophylaxis (Fig. 1b). During this period, patient also experienced anemia and thrombocytopenia occasionally. After transfusion of washed red blood cells and platelets for skin bleeding, the number of his hemoglobin and platelets returned to normal. During the next two weeks, he still presented with fever, mild expectoration and some discrete old rashes, suggesting the possibility of tuberculosis bacillus infection. Considering the medication safety, the doctor stopped using TOB and LZD, and changed to use the rifampicin (RFP) and fusidic acid against gram-positive bacteria and tazocin against drug-resistance gram-negative bacteria (Fig. 1b). On July 13th, lumber puncture was performed to collect cerebrospinal fluid (CSF) for tubercle bacillus detection, but no positive results were obtained by culture and PCR based methods. After a week, the computed tomography (CT) of chest showed pneumonia in the posterior basal segment of the lower lobe of right lung (Fig. 3c/d), and CRP became 0.2 mg per liter (normal range, 0 to 5 mg per liter), but his body temperature still fluctuated between 37.7 C and 39 C. Finally, we got the informed consent of patient's mother on behalf of the patient for detecting potential pathogens based on NGS technology (Fig. 1a). Within 43 h after collecting patient's blood, we finished the detection of pathogens, identifying 22,123 (out of 2,602,891) sequence reads (0.8499 %) uniquely corresponding to Propionibacterium acnes (P. acnes, G +) genome. P. acnes accounted for a very high proportion in detectable microorganisms and possessed a high coverage of genome, which was also significantly higher than control (Fig. 5). This result was re-confirmed by the NGS detection and species specific real-time PCR (RT-PCR). Based on the result, the primary care physician turned to adopt specific drugs for treatment of P. acnes infection immediately, including VANC, ciprofloxacin (CPFX) and amikacin (AMK) against gram-positive bacteria, CAS and ACV for prophylaxis of fungal and virus infections. Over the next 5 days, the patient gradually recovered with his body temperature returning to normal range and his old rash fading (Fig. 2c/d). However, other complications still persisted, such as the graft versus host disease (GVHD).

PMC9977209_01

Male

A 36-year-old male patient presented with complaints of dry cough and shortness of breath on exertion for two months. His cough was worse at night. He also complained of low-grade intermittent fever for two months. His appetite was normal and he denied any history of weight loss, joint pain, night sweats, chills, rash, rhinorrhea, epistaxis, hemoptysis, hematuria or burning sensation in hands and feet. There was no history of smoking or any kind of drug intake. His past medical history was unremarkable. He was a resident of a village in the eastern part of India and worked as a manager on a poultry farm. Two weeks before presenting to our medical care facility, he was diagnosed with a lower respiratory tract infection by a private practitioner and was prescribed a short course of oral antibiotics. But he continued to have fever, cough, and breathlessness. On presentation to our facility, his physical examination was notable for rhonchi throughout both lung fields. His vital signs were normal. The results of initial laboratory investigations were as follows: hemoglobin 12.8 gm/dL (reference range: 13-17 gm/dL), total leukocyte count 50,230/microL (reference range: 4,000-11,000/microL), absolute eosinophil count 37,510/microL (reference range: 40-440/microL), platelet count 151,000/microL (reference range: 150,000-400,000/microL), and random blood sugar 93 mg/dL (reference range: 70-100 mg/dL). Peripheral blood smear showed leukocytosis with marked eosinophilia without any left shift. Liver function tests and kidney function tests were within normal range. The chest radiograph showed the presence of reticulonodular opacities involving all zones of both lung fields (Figure 1). High-resolution computed tomography (HRCT) scan of the thorax revealed the presence of mosaic attenuation in the bilateral lung parenchyma. There were multiple centrilobular nodules along with smooth interlobular septal thickening involving all the lobes bilaterally (Figure 2). Cytological analysis of bronchoalveolar lavage fluid (BAL) showed marked eosinophilia. Smear examination and cultures of BAL fluid revealed no pathogenic microorganism and GeneXpert MTB/RIF did not detect Mycobacterium tuberculosis. Spirometry was suggestive of combined obstructive and restrictive changes. The Mantoux test was negative. The stool examination did not show any parasites. Urine examination did not reveal any protein, red blood cells, or sediment. Serum immunoglobulin (Ig) E level was 9915 U/L (reference range: less than 150 U/L). Serum Aspergillus fumigatus-specific IgE level was 0.08 kU/L (reference range: less than 0.35 kU/L), while serum A. fumigatus-specific IgG level was 13 mg/L (reference range: less than 27 mg/L). Antineutrophil cytoplasmic antibodies were negative. Anti-filarial antibody was positive by the immunochromatographic method. The patient was started on DEC therapy at a dose of 100 mg thrice daily. Cough improved within three days of treatment initiation and the fever subsided after five days. Subsequent serial blood counts showed a decrease in eosinophil count (Table 1). Diethylcarbamazine was administered for three weeks. The patient became completely asymptomatic. After four weeks of completion of the DEC course, the chest radiograph and spirometry were repeated. Chest X-ray showed the persistence of reticular opacities bilaterally (Figure 3). Also, follow-up spirometry showed partial improvement in lung function with the persistence of restrictive abnormality (Table 2).

centrilobular nodules, diethylcarbamazine, filariasis, peripheral eosinophilia, tropical pulmonary eosinophilia

PMC3326965_01

Female

We report a case of M. chelonae-associated parotitis in a 35-year-old woman. She presented with complaints of painful swelling and redness of the angle of her left jaw that started 1 month prior to admission. She reported that it started as a small 1-cm swelling in the middle aspect of her left jaw that gradually progressed to the angle. She was started on oral clindamycin and levaquin. There was no clinical improvement after a week of therapy. She started experiencing a pulsating pain that was aggravated by eating. A week prior to admission, she noticed progression of the redness and swelling to the left earlobe. She denied having any fever, chills, fatigue, weight loss or hearing impairment. She had a past medical history of neonatal portal vein thrombosis, splenectomy in 1992; and esophagogastric varices diagnosed by endoscopy two years ago. She was originally from Spain and had immigrated to the United States 15 years ago. She gave no personal or family history of tuberculosis. Her father had thyroid cancer. She did not have any history of recent travel. Physical examination [Figure 1] revealed a mobile and tender mass measuring approximately 3 cm and occupying the superficial lobe of the left parotid gland. There were overlying erythematous skin changes suggestive of parotitis. Facial nerve function was normal. Other physical findings were also normal, and there was no palpable cervical lymphadenopathy. The complete blood count, erythrocyte sedimentation rate, results of other biochemical/ autoimmune investigations and chest X-ray were normal. The result of the Human Immunodeficiency Virus (HIV) antibody test was negative. She had a tuberculin test done, which was measured at 4 mm (negative). CT scan [Figure 2] showed diffuse enhancement of the left parotid gland with an enlarged soft tissue mass lesion, measuring 3 x 4 cm in size, with a cystic component. A CT-guided fine-needle aspiration was performed, and the smear came back positive for acid-fast bacilli (AFB) [Figure 3]. The working diagnosis at that time was M. tuberculosis-related parotitis, and our patient was empirically treated with oral antitubercular meds (rifampin 300 mg, isoniazid 150 mg, ethambutol 400 mg and pyrazinamide 1000 mg once a day). Ten days later, the cultures grew AFB; and utilizing the genotype TB system (Hain, Nehren), the AFB was identified as Mycobacterium chelonae. Drug susceptibility report showed the organism to be resistant to imipenem, amikacin, ciprofloxacin, cefoxitin and linezolid; and sensitive to clarithromycin. The antitubercular regimen was discontinued, and she was started on oral clarithromycin 500 mg twice a day, with some evident resolution of symptoms, size and inflammation after 3 months of therapy. The management plan wasto continue this antibiotic regimen for at least six months and to regularly follow up with her during the duration of therapy.

immunocompetent, mycobacterium chelonae, parotitis

PMC2661005_02

Female

At the last examination six months later, the patient, still amaurotic, was given a poor prognosis for further recovery of the visual defects. Fundus examination revealed severe optic disc atrophy in both eyes (Figure 1). The clinical examination and the MRI confirmed the diagnosis of isolated bilateral optic neuropathy. We searched for a genetic etiology. The patient's parents were dead; she had no brothers or sisters; but she had a 28-year-old son who had no ophthalmic problems. Blood samples were taken from the patient after obtaining informed consent. Genomic DNA was extracted from blood samples using the BioRobot EZ1 and the EZ1 DNA Blood kit (Qiagen, Courtaboeuf, France). Next, 30 primer pairs (Appendix 1) were used to amplify the 30 OPA1 coding exons, including exon-intron junctions. PCR amplifications of the DNA were conducted under standard protocols. The purified PCR products were sequenced using a Ceq2000 DNA sequencer (CEQ DTCS-Quick Start kit; Beckman Coulter, Fullerton, CA). The OPA1 mutation is described according to the OPA1 transcript variant 1 (RefSeq: NM_015560). To exclude the presence of any rare mitochondrial DNA mutation, we sequenced entirely the mitochondrial genome. The mtDNA was PCR amplified in eight fragments using the protocol 96 C for 10 min, followed by 30 cycles of 96 C for 45 s, 58 C for 30 s, 72 C for 3 min, and a last extension at 72 C for 10 min (Appendix 2). PCR products were purified and sequenced as described in the previous section. The research followed the tenets of the Declaration of Helsinki. Fibroblast cells were obtained from skin biopsies taken after obtaining written consent from the patient, as described elsewhere. Fibroblasts, obtained by explants from skin punch biopsy, were maintained in DMEM (Invitrogen, Carlsbad, CA) with 10% bovine calf serum at 37 C in a humidified atmosphere with 5% CO2. All fibroblast cultures were mycoplasma-free, as shown by the DAPI/Hoechst in situ coloration and by PCR (Venor Gem, BioValley, Marne-la-Vallee, France). All experiments were performed on cells with similar passage numbers, ranging from 5 to 15, so as to avoid artifacts due to senescence, known to occur at passage numbers greater than 30. The rate of mitochondrial ATP synthesis and the ATP/O ratio were determined in cells permeabilized by exposure to digitonin, as described below. Cells were resuspended in the respiratory buffer, which contained 10 mM KH2PO4, 300 mM mannitol, 10 mM KCl, and 5 mM MgCl2, pH 7.4. This buffer was supplemented with 2 mM iodoacetate and 2 mM EDTA so as to prevent glycolytic ATP synthesis and ATP hydrolysis by cellular ATPases. The respiratory rates (O2/min/mg of proteins) of 3-5x106 cells were recorded at 37 C in 2 ml glass chambers using a two-channel, high-resolution Oxygraph respirometer (Oroboros, Innsbruck, Austria). ATP synthesis was started by addition of 5 mM malate, 5 mM pyruvate, and 10 mM succinate, followed by addition of 1.5 mM ADP. Five aliquots were sampled each minute during mitochondrial ATP synthesis, quenched with an equal volume of 1%(W/V) TCA solution and neutralized by adding a 25 mM HEPES, 2 mM EDTA, pH 7.75 buffer. Three aliquots were also sampled after addition of 8 microg/ml oligomycine (an ATP synthase inhibitor) to check for residual nonmitochondrial ATP synthesis. The ATP synthesized in situ was measured using the Enliten ATP assay (Promega, Madison, WI). Luminescence was measured on a multidetection reader for microplates Xenius XML (SAFAS, Monaco, Monaco) using a 10-s integration period. Standardization was performed with known quantities of ATP measured under the same conditions. Coupling efficiency (ATP/oxygen [ATP/O]) was measured by polarography as the number of nanomoles of ATP produced from ADP+Pi per nanomole of oxygen consumed by permeabilized cells. The efficiency of the respiratory chain was tested using malate, pyruvate, and succinate as substrates. A Beckman DU 640 spectrophotometer (Beckman Coulter, Fullerton, CA) was used to measure the activity of the mitochondrial respiratory chain complexes on cell homogenates at 37 C in a cell buffer that contained 250 mM saccharose, 20 mM tris[hydroxymethyl]aminomethane, 2 mM EGTA, and 1 mg/ml BSA, pH 7.2. Complex IV (cytochrome c oxidase, COX), complex V (F1-ATPase), and citrate synthase activities were recorded following Rustin et al.. Complex IV activity was measured in a 50 mM KH2PO4 buffer, using 15 microM reduced cytochrome c on 105 cells permeabilized by 2.5 mM beta-D-dodecylmaltoside. To measure the activity of complex V, we first disrupted cells by freezing in liquid nitrogen, followed by rapid thawing at 37 C. The cells were then centrifuged for 2 min at 800x g, resuspended in cell buffer (250 microl/106 cells). This was followed by a sonication step (6x5 s with an MSE sonicator). Complex V activity was immediately assayed on this cell lysate (0.5x106 cells) in a Tris/KCl buffer, composed of 50 mM Tris and 10 mM KCl, and containing 2 mM Phosphoenolpyruvate (PEP), 0.5 mM ATP, 5 mM MgCl2, 1.5 microM FCCP, 2.5 microg/microl antimycin A, 0.1 U lactate dehydrogenase, and 0.1 U pyruvate kinase (Roche Diagnostics, Meylan, France), 5 mg/ml BSA, pH 8. After incubation for 3 min, the reaction was started by adding 0.1 mM NADH and the rate of disappearance of NADH was monitored at 340 nm. In addition, 10 microM oligomycin was added to determine the background rate (nonspecific for complex V activity). Citrate synthase was assayed by standard procedures, using 0.15 mM 5-5-dithiobis(2-nitrobenzoic acid) (DTNB), 0.5 mM oxaloacetate, 0.3 mM acetyl-CoA, and 0.1% (V/V) Triton X-100. Specific enzymatic activities were expressed in mIU (e.g., nanomoles of cytochrome c, NADH or DTNB/min/mg protein, respectively). Enzymatic activities of complexes IV, V and citrate synthase are listed in Table 1. Cells cultured in a two-well chamber slide (Labtek, Nunc International, Naperville, IL) were incubated with 100 nM Mitotracker to label the mitochondrial network (Molecular Probes, Carlsbad, CA) according to manufacturer's instructions. Z-Stack fluorescent images were acquired with a Leica (DMI6000B; Microsystems GmbH, Wetzlar, Germany) and a Roper CoolSnap HQ2 camera. MetaMorph software (Molecular Devices, Sunnyvale, CA) was used to analyze images. Mitochondrial length and number were determined using integrated morphometric analysis of the regions created around mitochondria after deconvolution (Metamorph , Molecular Devices), as described above by Cassereau et al.. Around 50 deconvolved images were used to quantify the mitochondrial length. Measurements of mitochondria length distribution were divided into four groups: <1 microm, 1 to 5 microm, 5 to 10 microm, and >10 microm. Pellets of 5x106 fibroblasts from the patient and controls were stored at -80 C until used for western blot analysis. Next, 40 microg protein were solubilized in Laemmli buffer and heated for 5 min at 50 C. Proteins were separated on an 8% SDS-polyacrylamide gel and electroblotted to a PVDF membrane (Amersham Biosciences, Buckinghamshire, UK). Membranes were saturated overnight at 4 C with 5% nonfat milk dissolved in TBS-Tween-0.1%, pH 7.4, which contained 137 mM NaCl, 2.7 mM KCl, 23 mM Tris, and 0.1% Tween-20. Membranes were then incubated 2 h at room temperature with monoclonal mouse anti-OPA1 antibody (BD Bioscience PharMingen, Milan, Italy) and mouse monoclonal anti-Hsp60 antibody (Stressgene, Victoria, Canada). Membranes were then washed three times in TBS-Tween-0.1% and incubated with 1:10,000 horseradish peroxidase-conjugated rabbit anti-mouse secondary antibody for 1 h at room temperature. The immunoreactive proteins were visualized with enhanced chemiluminescence (ECL Plus Western Blotting Detection Reagents; Amersham Biosciences). Band intensities were quantified with Quantity One software (Bio-Rad, Hercules, CA).

PMC4533407_01

Male

A healthy 23-year-old man suffered a helmet-to-helmet collision with an opponent during a game of American football. He immediately experienced transient blurred vision for a few minutes and mild nausea and dizziness, without amnesia. The symptoms improved within 15 min and the team director allowed him to return to play the next day. Three days later, he was again hit on the head while playing American football. He subsequently experienced continuous vomiting and dizziness. He visited our hospital 18 h after sustaining the second injury. On admission, he showed mild dizziness without cerebellar sign. Magnetic resonance imaging (MRI) revealed acute infarction in the right cerebellar hemisphere (Fig. 1A-D), and magnetic resonance angiography (MRA) revealed stenosis of the right superior cerebellar artery (SCA) without vertebral artery (VA) dissection (Fig. 2A). Although vasculitis, autoimmune diseases, encephalitis, and cardiogenic cerebral embolism were considered, laboratory and cardiac investigations yielded normal results. We therefore diagnosed cerebellar infarction due to traumatic arterial spasm or dissection of the SCA and started conservative treatment. Dizziness gradually improved, and MRA 3 days after the second injury revealed improved stenosis of the right SCA (Fig. 2B). Vertebral angiography 7 days after the second injury demonstrated no abnormalities (Fig. 3A-C). The patient was discharged home, after 2 weeks, without neurological deficits. Follow-up MRI and MRA 3 months after the second injury revealed old infarction in the right cerebellar hemisphere without vascular abnormality (Fig. 2C).

PMC10392214_01

Female

This is a 25-year-old primigravida mother whose gestational age from a reliable last normal menstrual period was 29 weeks and 6 days. She came for an antenatal care follow-up after she was referred from a private clinic with the diagnosis of second trimester pregnancy and coexisting molar pregnancy at 26 weeks of pregnancy, which was her first visit. She had no aneuploidy screening or genetic testing. She had symptoms of excessive vomiting and nausea in the first trimester and early in the second trimester; otherwise, she had no history of vaginal bleeding, headache, abnormal body movement, or raised blood pressure, and she had no self-history or family history of diagnosed chronic medical or surgical illness. On her second visit, she was evaluated and diagnosed with the same assessment as the private clinic at 27 weeks and 5 days, and she was appointed to have regular follow-ups both at our hospital and the private clinic every 2 weeks. On her current presentation, she was diagnosed with hyperthyroidism in addition to the above diagnosis, for which she was admitted to the hospital after she presented for her routine follow-up. Except for palpitation, she had no symptoms or danger signs of pregnancy in her current presentation. Upon arrival, the physical examination revealed a blood pressure of 120/70, a pulse rate of 108, a respiratory rate of 18, and temperature = 36.5 C The thyroid gland size was normal, with no nodules, and on obstetric abdominal palpations, the fundal height was 32 weeks, with a longitudinally lie, cephalic presentation, and a fetal heartbeat of 144. And also, no uterine contraction was detected, and on genitourinary examination, there was no vaginal bleeding, and the cervix was closed, posterior, and firm. On ultrasound evaluation, the findings were as follows: twin intrauterine pregnancy, one normal and the other molar. The normal twin was cephalic, with a positive fetal heartbeat and no gross anomaly, an average gestational age of 29 weeks and 4 days, and an estimated fetal weight of 1200 g. The placenta was fundal and posterior. The biophysical profile findings were adequate amniotic fluid volume with intact acute variables, and the Doppler study was normal. There was a 13 x 7 cm echo complex mass anteriorly with a diffusely cystic and snowstorm appearance (Figures 1 and 2). The twin peak (lambda sign) and a thick inter-twin membrane are also seen. Laboratory investigation results were as follows: on complete blood count (white blood cells = 6500 cells/muL, hematocrit = 35.8%, and platelet = 236,000/muL), thyroid function tests (thyroid-stimulating hormone (TSH) = 0.19 mIU/L, free T3 = 8.21 nmol/L, free T4 = 275 nmol/L), liver function test (serum glutamic-oxaloacetic transaminase = 24 IU/L, serum glutamic-pyruvic transaminase = 19 IU/L), renal function test (creatinine = 0.8 mg/dL), serum electrolytes are in a normal range, blood group and Rh is O positive, hepatitis B surface antigen = negative, venereal disease research laboratory = negative, hepatitis C antibody = negative, urinalysis = unremarkable, and serum beta-hCG was 88,387.21 mIU/mL. She was diagnosed with an early preterm twin pregnancy in which normal fetus coexists with molar + hyperthyroidism based on the clinical presentations, ultrasound findings, and laboratory results. Following a thorough explanation of the risks of developing complications related to a molar pregnancy, she was admitted to the obstetric ward with the aforementioned diagnosis for inpatient management. She received two courses of dexamethasone 6 mg intramuscularly twice a day (BID) for 2 days for lung maturity, as well as propylthiouracil 100 mg per os (PO) BID, propranolol 10 mg PO BID, and was followed with antepartum fetal surveillance with maternal kick count, a biweekly biophysical profile, and a fetal Doppler study. The Doppler study of the normal fetus was done, and all the results were normal throughout the follow-up period. Serum beta-hCG done after 2 weeks of admission, and it was 94,387 mIU/mL. A thyroid function test was also done every 2 weeks (once antepartum after the initial presentation and twice postpartum), and it was in the normal target range, which is TSH suppressed and free T4 in the upper range of normal during antepartum and in the normal target range postpartum after 7 days and 2 weeks. She had improved from hyperthyroidism clinically as well as by biochemical tests, and the antithyroid drug was continued at the same dose. On the 22nd post-admission day, at 33 weeks of gestation, she started having labor. Then, she underwent a cesarean section (C-section) for an indication of twin pregnancy molar coexisting with an alive fetus in labor, resulting in the delivery of a 1700-g female neonate who was alive and had APGAR scores of 8 and 9 at the first and fifth minutes, respectively. The fetus' cord and placenta were healthy. The other finding was an excessive vesicular mass, which is distinct from a normal placenta and membrane (Figure 3). The woman had a smooth postoperative period; except the neonate was admitted to the neonatal ICU with the diagnosis of preterm + low birthweight + respiratory distress syndrome, and after being treated for the above diagnosis and worked up for congenital hypothyroidism (thyroid function tests were in the normal range in the first week and 2 weeks after the discharge), both the mother and neonate were improved and discharged on the fifth postoperative day. After the operation, the sample was sent for histopathology, and the results showed hydrophilic villi with a circumferential proliferation of trophoblasts (Figure 4). The index was a complete mole, whereas the second placenta showed a normal placenta. The chest X-ray done postpartum was normal, and following 3 months, post-molar surveillance demonstrated a normal pattern of serum beta-hCG decrease, which was then negative until 6 months of monthly monitoring.

ethiopia, twin pregnancy, wolaita, case report, complete mole