Datasets:

VikramJi

/

patent-classification

like 0

the message storage queue for relay transmission by a transmitter 250 receiver 260 receives programming instructions from a ground control station for example for dynamic reprioritization these instructions may be in the form of active messages carrying computer code to be executed in a dynamic reprioritization controller 290 of smart node 110 dynamic reprioritization controller 290 inspects the messages for relay that are stored in message storage queue 280 and specifies the order of transmission to a queue controller 270 by way of example dynamic reprioritization for the militarily relevant use of sensor fusion is considered in accordance with fig3 a plurality of s ground based optical sensors 300 1 300 2 300 s measure the direction cosines of targets as they appear in an area of sky above them the sensors are arranged in a circle and for this example s 8 each sensor is able to tie its specific observation to a particular target and send this observation in message to a smart node for reprioritization in this example the smart node might be located at a geostationary satellite that relays the observation messages to a weapons control processing center in this example the target locations are estimated and a directed energy de weapon is issued against them the probability that the de weapon will be effective on any particular firing is a strong function of the merit of the individual target location estimate the greater the volume of uncertainty within which the target is to be found the greater the number of weapon commitments or equivalently de firings.

well optical qualities one of the processability measures is the natural draw ratio determined at 280 u00b0 f 138 u00b0 c another measure is the area under the yield stress curve lower area values and higher natural draw ratios indicate greater processibility optical properties were determined on samples stretched to an average thickness of 0 6 mils 15 u03bcm optical properties include haze transmittance and gloss haze and luminous transmittance were determined in accordance with astm d1003 in general lower haze films will have higher transmittance specular gloss was measured generally in accordance with astm d2457 astm d2457 refers to measurements at 20 45 and 65 degrees in addition specular gloss was measured at an angle of 85 degrees the invention is illustrated but not limited by the following examples a mini random polypropylene designated sunoco 2 1mf and available from sunoco chemicals was tested with and without a nucleation system this polypropylene was selected for its high isotacticity and 0 5 ethylene content typical of mini random polypropylene it has a melt flow index of 3 2 which is typical for mini random polypropylenes used in film production the nucleation system consisted of a blend of aliphatic dicarboxylic and monocarboxylic acids primarily adipic and stearic acids the ratio of stearic acid to adipic acid in this nucleation system was in accordance with the ratios of u s pat nos 5 300.

placed upon it application_number US 42823203 A description fig1 3 refer to the preferred embodiment of the invention they show a support apparatus 110 for supporting and arranging for example evaporative cooling devices 1 along the outer wall 2 see fig4 of a home the apparatus 110 comprises a main support frame 120 for bridging each gap 3 caused by cutting through at least one or two 2 u00d7 4s 4 of a frame of a home 7 see fig4 in order to accommodate a vent 16 see fig2 of the cooling device 1 these cut 2 u00d7 4s 4 each have a top severed end 5 and a bottom severed end 6 the main support frame 120 has a substantially rectangular configuration 121 see fig2 and a middle rung 128 traversing widthwise across the rectangular configuration 121 the apparatus 120 also has a base 130 extending horizontally from the middle rung 128 of the main support frame 120 similarly the base 130 has a substantially rectangular configuration 131 and a middle rung 138 traversing widthwise across the rectangular configuration 131 the apparatus 110 also has at least two support rungs 140 extending downwardly at an angle from the rectangular configuration 131 of the base 130 into contact with the rectangular configuration 121 of the main support frame 120 for stabilizing and supporting the.

the invention involves providing a tower of uniform cross section positioning wind turbines and their supporting structures sequentially at the base of the tower raising them and mounting them on the tower sequentially and thereafter providing a plurality of outriggers and their foundations and attaching them to the tower application_number US 46098509 A description referring in particular to fig1 and 2 a tower for mounting wind turbines and their supporting structures is indicated generally at 10 with the tower proper at 12 supporting structures at 14 14 and turbines at 16 16 the illustrative tower 12 shown has a height a of approximately two hundred 200 feet as best illustrated in fig3 the tower 12 includes a plurality of narrow elongated vertically extending main longitudinal members 18 18 preferably tubular and a plurality of shorter narrow interconnecting cross members 20 20 the cross members 20 20 may be tubular or triangular in cross section in a truss structure the members 20 20 extend between the members 18 18 and cooperate therewith to form a massive monolithic structure having a vertical dimension of at least fifty 50 feet 200 feet as shown and mentioned above the cross sectional configuration and other structural characteristics of the tower may vary but in all cases the cross sectional dimensions and configuration of the tower from its base to the.

body the dry bearings each comprise plastics sleeves 105 supported by and secured to a metal cylinder which can be press fit into the bore 102 the plastics sleeve 105 generally of ptfe i e the polymer polytetrafluoroethylene acts to form a bearing between the metal surfaces of the body and the member and additionally acts to prevent improper travel of air such as by leakage along the surface of the valve member the parts 103 and 104 each include a flange 108 for axially locating the parts when firmly connected together by a bolt not shown which passes through a bore 109 in the part 104 and engages a screw threaded bore 110 in the part 103 so as to draw a shoulder 111 of the part 103 against the end of the part 104 by slackening and retighting the bolt the relative angular positions of the parts 103 and 104 can be adjusted as explained in more detail hereinafter the part 103 includes a stub shaft 112 for connection to a drive wheel 113 shown in fig1 connected to the main drive motor 20 of the machine via a variable gear box not shown in this way the valve member 103 104 can be rotated in synchronism with machine speed and at a preselectable rate relative thereto the valve body 101 includes a first pair of ports 114 115 fig1 and 9 which are connected to a source of high pressure air shown schematically at 30 via intervening valves not shown for controlling the air pressure at the ports 114 115 each of the ports 114 115 is connected via a short bore to.

methods a second mouse monoclonal antibody directed against a different epitope on rabbit igg should be conjugated with fad again using previously described methods the desired detection complex is somewhat like a sandwich with the bead capture antibody here the bead antibody is a first anti rabbit igg antibody forming the first layer the antigen here rabbit igg is used as the antigen forming the middle layer and the fad conjugated anti antigen antibody here a second anti rabbit igg antibody that binds to a different epitope on rabbit igg forming the top layer this structure is built up in stages and the beads are washed in between each stage first the middle layer is added to the first layer and then the top layer is added to the middle layer and lower layer purified rabbit igg should be suspended 0 1m phosphate buffered saline ph 7 0 at a concentration of 0 1 mg ml and incubated with a 1 solution of the mouse anti rabbit igg conjugated microbeads for 1 hour washed 3 u00d7 in the same buffer by repeated microcentrifugation and then resuspended to the original 1 concentration to add the top layer to the sandwich the fad conjugated monoclonal mouse anti rabbit igg should then be added to these washed microbeads to a final concentration of 0 2 mg ml of antibody and allowed to bind for 1 hour the beads should be washed 3 u00d7 in phosphate buffer and resuspended in the 1 5m trehalose buffer at a 1 suspension the net result is to create a sandwich structure of the type in which the fad conjugated anti rabbit igg monoclonal antibody binds to the rabbit igg which in turn binds to the anti rabbit igg coupled to the beads these beads should.

of the solvents may contain from 2 to 8 acyclic carbon atoms typical mixtures which may be used to provide the solvent system especially with methyl ethyl ketone peroxide include various mixtures of c2 to c6 glycols and c3 to c6 trialkyl phosphates for example mixtures of numbers of the following materials ______________________________________ boiling point u00b0 c flast point u00b0 f ethylene glycol 197 2 240 8diethylene glycol 245 0 290dipropylene glycol 233 330hexylene glycol 198 230triethyl phosphate 216 240______________________________________ crude ethylene glycol usually containing quantities of diethylene glycol and triethylene glycol may be used in the solvent system fed by line 16 glycol derivatives such as ethylene glycol acetate may be used in the solvent system the relative proportions of the solvents their number and the difference between their individual boiling points in the solvent system may vary widely and are a matter of choice provided that the overall composition and the individual components conform to the above described parameters the quantity of solvent fed by line 16 should be at least sufficient to maintain a homogeneous reaction mixture throughout the addition of hydrogen peroxide the reaction is carried out at as low a temperature as possible compatible with speed of reaction higher temperatures favour decomposition of the product whereas low temperatures below 10 u00b0 c result in long reaction times the process is carried out at a temperature below about 35 u00b0 c.

for example blending into a particular environment or provided with supports to carry additional barrier devices that are commonly seen around compounds facilities and homes such as barbed wire razor wire electric fence signs a continuous or pseudo continuous board above the top portion and substantially parallel to the uppermost interconnecting member or the like 0038 fig5 illustrates a side view of an exemplary embodiment of the plate 100 in an overturned position after for example contact by a vehicle thus in operation as a vehicle approaches from direction u201c a u201d as illustrated in fig1 and comes into contact with the barrier 1 the barrier 1 overturns with foot 30 acting as a fulcrum forcing foot 20 into the undercarriage of the vehicle with the top portion 10 engaging the ground surface 3 to facilitate stopping of the vehicle given the symmetric nature of the plate 100 regardless of the direction of impact the barrier 1 is capable providing the same type of stopping and undercarriage damaging characteristics in addition to foot 20 causing undercarriage damage to the vehicle the foot 20 is also capable of lifting the vehicle that struck the barrier 1 off the ground to further facilitate stopping 0039 fig6 illustrates a perspective view of an exemplary configuration of.

section and is provided adjacent to the distal end thereof with a magnetic metallic insert 53 the distal end of the drive lever 50 defines a bearing tip 54 which is disposed for camming engagement with the camming surface 44 of the drive cam 40 as is best illustrated in fig3 and 4 a generally c shaped permanent magnet 55 is fixedly secured in a support bracket 56 on the mounting plate 31 as by a fastener 57 the permanent magnet 55 has legs 58 which project a predetermined distance beyond the support bracket 56 for engagement with the magnetic insert 53 on the drive lever 50 the propulsion apparatus 30 also includes an actuating assembly generally designated by the numeral 60 with includes a hollow handle sheath 61 mounted on the raised end wall 23 of the game 20 above the aperture 27 therein an elongated lever 62 extends through the apertures 27 and 28 and is mounted intermediate its ends for pivotal movement about the axis of a pivot pin 63 supported between a pair of brackets 64 carried by the handle sheath 61 the lever 62 has an enlarged trigger portion 65 disposed within the handle sheath 61 and projecting forwardly therefrom beyond a curved recess 66 in the.

phase noise and lock speed considerations a relatively high value of u03c9 n is required so that the frequency has been set as in fig1 the 90 khz oscillator 6 injects the test signal into the summing amplifier 5 voltage vd appears at the input to the summing amplifier and voltage v 1 at the output of a 1 a attenuator 7 following the summing amplifier at these points the voltages are very low on the order of 10 mv which is equivalent to a frequency modulation index of 0 05 in the millimeter wave oscillator this value is sufficiently low so as not to cause disturbance in most cases of operation with angle modulation in those cases where disturbance does still exist the frequency of the injected signal f m can be changed so that it is not in the transmitted information range in order to eliminate the disturbance each of these signals passes through a very narrow band pass filter 9 10 which filters the signal out of the large amount of noise these filters are implemented as active filters with very high q the filtered signals are supplied to sophisticated peak detectors 11 12 which convert them to dc voltages proportional to the signal levels the dc voltages are supplied to a differential amplifier 16 whose output voltage is proportional to vd v 1 that is in the desired condition when vd v 1 the voltage becomes zero from equation a and the parameter definitions it can be seen that when vd gt v 1 that is the output voltage from the differential amplifier is positive u03b6 u03c9 n and so the open loop gain are too high and it follows that.

two housing parts 31 33 of the electronic angle sensor 17 form an interior space 37 of the angle sensor 17 in which the sensor unit 39 and the analysis unit 41 are located both the sensor unit 39 and the analysis unit 41 are configured as integrated switching circuits 43 the sensor unit 39 is located in the lower housing part 33 of the angle sensor 17 the lower housing part 33 being opened on its side pointing in the direction of the indicator 7 such that the sensor unit 39 pointing in the direction of the indicator 7 closes the interior space 37 of the angle sensor 17 the sensor unit 39 is thus visible and accessible from outside of the angle sensor 17 there is a measuring distance 45 between the sensor unit 39 pointing in the direction of the indicator 7 and the indicator 7 of the indicator instrument 1 fig4 show a capacitive electronic angle sensor 17 this comprises the upper housing part 31 the lower housing part 33 which is shown as semitransparent in fig4 the output interface 25 which is configured in the form of two data lines 21 the sensor unit 39 as well as the cover glass 13 which has the black print 19 a sealing element 47 between the upper housing part 31 and the cover glass 13 is provided at the connection point 35 which is located in the not visible opening of the cover glass 13 the sealing element 47 is advantageous to reduce or even to prevent a penetration of dust and fluids behind the cover glass 13 further individual measuring sectors 49 of the.

in dialysis the impact on the patient 39 s calcium levels should be addressed and methods to address this issue are presented herein in one embodiment the increased citrate that would enter the patient 39 s blood as a consequence of using the high citrate dialysate is offset by including additional ionized calcium and magnesium in the dialysate and optionally reducing the levels of sodium chloride and sodium bicarbonate in the dialysate thus both the calcium and magnesium concentrations in the high citrate dialysate may be higher than the concentrations found in standard dialysate the calcium ion concentration in a high citrate dialysate of the present invention may be as high as about 5 meq l while the magnesium ion concentration in a high citrate dialysate of the present invention may be as high as about 2 meq l in an alternative embodiment the dialysate entering the dialyzer and contacting the patient 39 s blood contains a high level of citrate but not a high level of either calcium or magnesium when the calcium and or magnesium ion concentration in dialysate is not increased to compensate for the calcium arid magnesium binding action of citrate then the calcium ion concentration in the citrate may be as low as about 2 5 meq l while the magnesium ion concentration may be as low as about 1 0 meq l if the high citrate dialysate does not contain compensatory levels calcium and or magnesium ions then the blood leaving the dialyzer will have a high concentration of citrate and in fact may have a higher concentration of citrate than is clinically desirable due to the tendency of the citrate to bind calcium within the patient to address this consequence in one method.

the door 10 through a first side 26 and a second side 30 of the door 10 an edge bore axis 34 extends through a center point of the edge bore 14 and a cross bore axis 38 extends through a center point of the cross bore 22 the edge bore axis 34 is substantially normal to and coplanar with the cross bore axis 38 the edge bore 14 intersects the cross boor 22 inside the door 10 when properly positioned the plane containing the edge bore axis 34 and the cross bore axis 38 will be substantially perpendicular to the latch edge 18 the edge bore 14 is centered along a width 42 of the latch edge 18 typical doors 10 have a latch edge width 42 between 1 u215c inches and 1 u00be inches a backset 46 i e the distance from the latch edge 18 to the center point of the cross bore 22 is typically 2 u215c inches or 2 u00be inches depending on the door hardware the edge bore 14 and the cross bore 22 must also be properly positioned vertically on the door 10 for example for a door 10 having a height of 80 inches it may be desirable to position the centers of the edge bore 14 and cross bore 22 at a.

transmit power of the circuit switched connection to the maximum transmit power for the mobile station 33 dbm the transmit power of the packet switched connection is correspondingly reduced to 27 2 dbm in order to maintain the average transmit power of the mobile station at 315 mw a method of power control according to embodiments of the present invention is illustrated in fig7 in step s 700 the mobile station receives a codec command from the base station in step s 702 the mobile station checks whether it is transmitting both a circuit switched and a packet switched connection if not the mobile station proceeds to step s 708 and implements the codec contained in the codec command if yes the method proceeds to step s 704 in which the mobile station checks whether the codec is one of the n lowest codec modes if not the method proceeds to step s 708 and implements the codec contained in the codec command if yes the mobile station prioritises the transmit power of the circuit switched connection increasing it to the maximum transmit power for the mobile station and reducing the transmit power of the packet switched connection so as to maintain the average transmit power.

dirt etc to be completely removed from between the two surfaces to avoid circuit degradation in the drawings the holder 1 is shown mounted on a panel 50 by means of openings 51 in its upper flange as shown in fig3 and fig8 in the example shown the lower flange may be supported by an l shaped bracket 52 which may be secured to a panel 50 however it will be understood that the fuse holder 1 may be mounted on panel 50 in any desired or conventional manner further an embodiment having both upper and lower flanges with two openings on each flange provides another alternative style for such embodiment the l shaped bracket 52 may require appropriate modification known to those skilled in the art the fuse box 10 of the fuse holder 1 may be inserted in an opening not shown in the panel 50 on top of an l bracket 52 as shown in fig8 the lower flange 9 may rest on the l bracket 52 the lower ends 30c 31c and 32c of the leads 30 31 and 32 extend into or are in contact with the electrical contacts 61 62 and 63 in the circuit board 60 the fuses 2 may be inserted within the fuse cavities 11 since the cavities 11 are horizontally oriented with respect to each other and perpendicular to the copper clad board 40 and the circuit board 60 any number of such fuse cavities 11 may be positioned alongside each other depending on the.

large classification a read processing system a an operating system b a control processing system c and a printing process system d the read processing system a comprises a reader 3 having an image sensor a contraction processor 4 performing a contraction process a pseudo half tone processor 5 converting data into pseudo half tone data a simple binarization processor 6 converting data into simple binarization data and an enlarging processor 7 performing an enlarging process in this arrangement the reader 3 reads documents by the image sensor and after necessary processes such as a d converting the image data is output the image data are fed to the control processing system c through the contraction processor 4 the pseudo half tone processor 5 or the simple binarization processor 6 and the enlarging processor 7 in the foregoing when the equal multiplying factors are selected by a multiplying factor selection key 10 which is described later then the image data passes through the contraction processor 4 and the enlarging processor 7 as it is on the other hand when an enlarging factor for multiplying by an integer number is selected then the image data pass through the contraction processor 4 as it is and are enlarged and processed by the enlarging processor 7 when an enlarging factor of multiplying by a non integer number is.

will see that because the invention is made of plasticized materials it is inexpensive to manufacture can be installed quickly and easily by one person does not effect the structural integrity of existing curb inlets because no drilling screwing welding or hammering is involved for installation in addition the invention is a low maintenance solution to the problem of water contamination of natural lakes rivers and stream beds the low maintenance costs for periodic removal of debris collected on the screen is a small price to pay for generations of clean water for everyone furthermore the invention has additional advantages in that it is the most inexpensive device for intercepting debris or sediment runoff before entering the storm sewer trunkline it provides a debris and sediment filtering system which will not interfere or impede with the operations of street cleaning equipment asphalt paving machines snow plows or the like it provides a screen and filtration insert for curb inlets that can be produced with various sized hydraulic openings to serve as a temporary or permanent storm water erosion pollution prevention measure it provides a debris and sediment screen with a relieving means which will release from a fixed position without human assistance and return to the original fixed position without human assistance although the description above contains many specificity 39 s these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this.

an organo magnesium compound for the avoidance of doubt a compound of formula i is prepared by reacting a compound of formula ii with a grignard compound of formula iii a preferred embodiment of this general reaction comprises the production of delmopinol formula iiia by reacting a compound of formula ii with the preferred grignard compound of formula iiia the formation of the grignard compound ill and its subsequent reaction with the oxazolidine ii is carried out in a suitable solvent such as ethers c 4 c 12 and mixtures of said ethers with c 1 c 8 aliphatic or c 6 c 8 aromatic hydrocarbons preferably the solvent is selected from the group consisting of diethylether tetrahydrofuran methyltetrahydrofuran dibutylether and the following mixtures tetrahydrofuran toluene tetrahydrofuran xylene methyltetrahydrofuran toluene methyltetrahydrofuran xylene dibutylether xylene dibutylether toluene a compound of formula i for example delmopinol obtained by the process of the present invention may be converted into a pharmaceutically acceptable salt preferably into the hydrochloride salt and delmopinol salts may be converted into delmopinol by known methods described in the art by a way of example delmopinol hydrochloride can be prepared from delmopinol by reaction with hydrochloric acid in any suitable solvent examples of suitable solvents are for instance toluene xylene methylisobutylketone dibutylether methyl tert butylether ethyl acetate and mixtures thereof the compound of formula ii can be obtained by the process summarised in scheme i which can be carried out in two steps or as a one pot reaction as used herein the term u201c one pot reaction u201d is to be given its normal meaning in the art i e the compound of formula ii is produced in a single reaction.

u03b3 blocks of intra mb 250 are generated from the dc coefficients of u03b3 blocks in a prior intra mb similarly the reconstructed dc coefficient of cb 256 is generated from a prior cb block and the reconstructed dc coefficient of cr 257 is generated from a prior cr block for one embodiment the reconstructed dc coefficients of a first intra mb are stored in accumulator 211 subsequently using the reconstructed dc coefficients stored in accumulator 211 vld 220 performs an arithmetic computation on the dc coefficient of the next intra mb to generate the reconstructed dc coefficients of the next intra mb the arithmetic operation performed by vld 220 and the use of accumulator 211 is further described below in conjunction with fig3 for another embodiment the dc coefficients of intra mb 250 are inverse quantized dc coefficients in particular vld 220 performs an inverse quantization on the reconstructed dc coefficients thus generating inverse quantized dc coefficients in intra mb 250 to perform the inverse quantization vld 220 multiplies a reconstructed dc coefficient by an intra_dc_multiplier value for one embodiment the intra_dc_multiplier value has a value of 8 4 2 or 1 based on an intra 13 dc 13 precision value specified in a header transmitted in conjunction with the picture subsequently.

load position with the lever 19 in a generally vertical position and a cutting position as shown in fig1 in which it overlaps the feed wheel 16 and the lever 19 extends generally horizontally located at the top portion of the lever 19 is a release button 21 which when depressed allows the user to remove the cutting mechanism 18 to facilitate the cleaning of the can opener 11 also attached to the lever 19 and coordinated with the cutting mechanism 18 is a metal plate 22 which supports a magnetic assembly 23 the magnet assembly 23 is used to retain the lid of a can after it has been separated from the sides of the can the housing 12 of the can opener of the present invention is made up of two basic parts one being a box like portion 25 and the other a front plate 26 the front plate 26 may be designated the support plate since it carries all the mechanism of the can opener including the motor 13 the feed wheel shaft 15 the cutting mechanism 18 and also a bag opener casing 27 the front plate 26 and the box like portion 25 cooperate to form an enclosure 28 within which the motor and reduction gearing are received the box like portion 25 which is best shown in fig2 is made of an inexpensive styrene plastic material since it performs little function except to enclose the mechanism carried by the front plate 26 the portion 25 is also formed with a forwardly projecting base 29 which provides the necessary support for the can opener preventing it from tipping forwardly when a can is received between the cutter 20 and the feed wheel 16 and force.

only the outside of the portable enclosure 10 zipped up only allows view of the bag 22 with front strap 76 and rear strap 78 in fig2 the zipper is totally undone and along with the cutaway portion you are able to see the internal portions of the bag 22 including the internal frame 14 and the reservoir 18 with its rack baffle bottom 20 the bag 22 has six main sides or facets the front facet 24 left facet 26 right facet 28 top facet 30 bottom facet 32 and the rear facet 36 the front facet 24 and the zipper flap 146 connect together via the zipper assembly 148 the zipper assembly 148 is made up of the zipper chain 150 with the left zipper pull 152 and the right zipper pull 154 the front pocket 36 is connected to the zipper assembly 148 at the zipper chain 150 the front pocket 36 is also made up of the front mesh 46 and the rear mesh 48 with a cover 50 over the front mesh 46 the hook velcro 52 attaches to the front mesh 46 facing in the loop velcro 54 attaches to the rear mesh 48 facing out the left pocket 38 part of the left facet 26 is made up of the front mesh 56 and the rear mesh 58 with a cover 60 over the front mesh 56 the.

hz 21 h 3 0 521 3h s 18 h 3 0 060 0 046 0 029 and 0 006 each 3h each s 4 u00d7 s 1 u2014 ch 3 ms ei m z 628 3 m 613 1 m u2212 me 571 3 m u2212 t bu 496 63 m u2212 t bume 2 sioh 383 4 m u2212 t bume 2 sioh u2014 c 8 h 17 366 21 234 20 129 41 75 100 exact mass calculated for c 39 h 72 o 2 si 2 628 5071 found 628 5068 protected vitamin 8 10 mg 16 u03bcmol was dissolved in anhydrous thf 3 ml and a solution of tetrabutylammonium fluoride 1 m in thf 160 u03bcl 160 u03bcmol was added followed by freshly activated molecular sieves 4a 300mg the mixture was stirred under argon at room temperature for 2 h then diluted with 2 ml of hexane ethyl acetate 6 4 and applied on a waters silica sep pak cartridge 2 g elution with the same solvent system gave the crude product i that was further purified by hplc 10 u00d7 250 mm zorbax silica column 4 ml min using hexane 2 propanol 9 1 solvent system analytically pure 2 methylene 19 norvitamin i 3 3 mg 52 yield was collected at r v 32 ml as a colorless oil uv in etoh u03bb max 261 5 251 5 243 5 nm 1 h nmr 500 mhz cdcl 3 tms u03b46 36 and 5 88 1h and 1h each d j 14 3 hz 6 and 7 h 5 11 and 5 09 each 1h each s ch 2 4 47 2h m 1 u03b2 and 30 h 2 85 1h dd j 13 4 4 6 hz 100 h 2 81.

in table 1 table 1______________________________________spectral data for salinamide a______________________________________source cnb091 a streptomyces sp from a surface swab of a cassiopeiaxamachana culture maintained at scripps institute of oceanography university of california at san diego u03b1 d sup 26 u00b0 c 0 97 cdcl sub 3 mp 221 225 u00b0 c decomposesmolecular formula c sub 51 h sub 69 n sub 7 o sub 15hrfabms m h sup m z 1020 492 obs 1020 493 calc u03b4 1 0ppmir cdcl sub 3 3436 3379 1745 1735 1682 1657 1636 cm sup 1uv meoh 281 267 224 208 nm______________________________________ the nmr data for salinamide a is set forth in table 2 the carbon numbers in table 2 correspond to the numbered carbons in the above formula for salinamide a table 2__________________________________________________________________________nmr data for salinamide ac x cosy sup c u03b4 sup 13 c sup a u03b4 sup 1 h sup b tocsy sup d hmbc sup d roesy sup d__________________________________________________________________________1 169 7 c 2 40 8 ch2 3 66 d 19 1 3 1 4 19 3 4 90 4 90 dd 19 1 19 7 3 4 3 3 66 3 6 23 d 9 0 2 5 2 54 165 3 c 5 120 1 ch 5 64.

diagramming tool 110 of the present system on the right the user can select the appropriate scenario component and drag it or place it on the design screen also by clicking with a mouse or any other pointing device on a scenario component the user can populate edit with a keyboard or any other similar inputting device or select the fields associated thereto for instance the user can name a state described an event in an event box enter the fields to be evaluated by a condition box etc in that sense the diagramming tool 110 typically comprises tool bars drop down menus configuration windows etc as in known cad interface allowing the user to properly select place and edit the components of the scenarios on the screen for instance in fig5 the user has selected a u201c buys u201d event and a drop down menu has appeared allowing the user to select the appropriate type of event in fig6 and 7 the user has selected a u201c buys u201d event and a configuration window has appeared allowing the user to modify the parameters of the u201c buys u201d event in fig6 the user has selected the u201c attributes u201d tab such as to be able to edit the attributed of the u201c buys u201d event while in fig7 the user has selected the u201c rules u201d tab such as to be able to edit the rules associated with the u201c buys u201d event fig8 shows a screenshot of a configuration window for a rule the window allows.

ribbon tape material 30 the carbon fiber strands 10 are interconnected to the interior carbon fiber grid 6 positioned substantially adjacent to the interior surface of the insulative core and with the exterior carbon fiber grid 8 positioned substantially adjacent the exterior surface of the insulative core 4 one example of a carbon fiber grid ribbon 30 which may be used in the present invention is the u201c mec grid u2122 u201d carbon fiber material which is manufactured by hexcel clark schwebel the interior and exterior carbon grid tape is comprised generally of looped or crossed weft and warped strands that run substantially perpendicular to each other and are machine placed on several main tape u201c stabilizing strands u201d that run parallel to the running rolling direction of the tape the carbon fiber tape is then used in a totally separate process by casting it transversely through the insulating core 4 to produce an insulated structural core panel that links together compositively the interior concrete layer 14 and exterior concrete layer 16 of the composite wall panel 2 with regard to the concrete utilized in various embodiments of the present application the interior wall may be comprised of a low density concrete such as cret o lite u2122 which is manufactured by advanced materials company of hamburg n y this is an air dried cellular concrete which is nailable drillable screwable sawable and very fire resistant in a preferred embodiment the exterior concrete layer 16 is comprised of a dense concrete material to resist moisture penetration and in one embodiment is created using visco crete u2122 or equal product which is a chemical that enables the high slumped short pot life liquification of concrete to enable the concrete to be placed in narrow wall.

to obtain cavities 520 620 and 420 surmounting the diffused source region 52 drain region 62 and gate region 42 it is noted here that the dimension of the cavities is greater than the aperture of the orifice this selective removal may be carried out by any known means for example by means of an oxidizing chemical agent such as a solution comprising 40 ml of 70 hno 3 20 ml of h 2 o 2 5 ml of 0 5 hf or by isotropic plasma etching next one or more electrically conducting materials are deposited by known methods allowing the previously obtained cavities to be simultaneously filled fig1 in order to obtain the source region 52 the drain region 62 and the gate region 42 these regions being surmounted by electrically conducting zones for example metallizations 53 63 and 43 and connection vias 91 which are also electrically conducting between these metallizations and the surface of the integrated circuit since the aperture of the cavities is greater than that of the orifices the areas of the metallizations 43 53 63 are greater than the vias aperture this permits a decrease in the contact resistance without increasing the lateral dimensions of the vias which permits one to maintain the integration density of the interconnections in this regard the cavities 420 520 620 and the etching orifices 90 may be filled with tungsten w for example by chemical vapor deposition cvd known per se for example within the 500 u00b0 c to 600 u00b0 c temperature range or else by ald atomic layer deposition also known per se for example within the 200 u00b0 c to 300 u00b0 c temperature range it is also possible to use copper cu cobalt.

the number of revolutions completed to determine the relative position of the associated latch truck 67 the rotary sensor can for example produce counted pulse signals each representing a relative position of the latch truck 67 alternatively or in addition a sensor can be provided on each latch truck 67 to monitor its movement along the guide rail 65 a rotary sensor such as a hall effect sensor or an optical sensor could monitor rotation of one of the wheels 77 79 of the latch truck 67 in the present embodiment the cover 41 has an auto detect strip 81 provided at the leading edge 55 of the cover 41 the auto detect strip 81 extends along the leading edge 55 of the cover 41 the auto detect strip 81 comprises one or more sensors not shown for sensing any obstacle inside the vehicle 1 disposed on the path of the cover 41 such as the back of the rear seats 17 or an item disposed in the load space the auto detect strip 81 is provided for determining when the leading edge 55 of the cover 41 encounters an obstacle or obstruction such as the back of the rear seats 17 the auto detect strip 81 can comprise one or more of the following sensors a mechanical switch an electrical contact or a capacitive sensor in the present embodiment a capacitive strip is provided on the leading edge 55 of the cover 41 the capacitive strip can be used in conjunction with the position monitoring unit described herein alternatively or in addition the current voltage drawn by the motor 69 could.

and l211a similar to those in the previously described dmlt norton eb lawson lb freytag lc clements jd clin vaccine immunol 2011 april 18 4 546 51 seq id no 5 in m51559 in addition to the two mutations in m51405 there are mutations in the region 189 to 197 in dmcta the sequence is nap g ssmsn seq id no 8 whereas in mmcta the sequence is dss g titgd seq id no 9 the underlined residue in each sequence is the r192g mutation present in both molecules the reinsertion of the mutant ctxa genes was done by gene replacement using the above described suicide plasmid pmt suicide sacb a native ctxa gene together with a fragment of the upstream zot gene was pcr amplified from chromosomal dna isolated as described previously from strain phil6973 an o1 el for clinical isolate of v cholerae using the primers zot f 5 u2032 gggggtctctctagaatgctgcgggagcaaggcggctg 3 u2032 seq id no 10 and cta r 5 u2032 ggggggaagcttataattcatccttaattctattatgtgtatcaatatcagattg 3 u2032 seq id no 11 see table 1 the resulting fragment was digested with eco31i and hindiii and inserted into a p15a based expression vector digested with xbai and hindiii in order to generate the double mutant cta with amino acid changes r192g and l211a a dna fragment was synthesized the allowed the entire 3 u2032 end of.

ends of the inner and outer rows 50 and 52 of the wire spoke basket b as shown particularly in fig5 alternate ones of the spokes 50 and 52 will be disposed on the inner and outer sides of such support rings 60 and 62 a peripheral support ring 64 is affixed to the radially outer ends of the inner and outer rows 50 and 52 of the spokes referring to fig2 and 6 a plurality such as three of generally u shaped synthetic plastic anti rattle pads 70 of like construction are snapped about the outwardly and inwardly facing sides of support ring 64 to engage the wheel body b adjacent the radially outer end of attachment flange 84 at its junction with tire rim 28 referring now to fig8 it should be noted that a plurality such as three similar anti rattle pads 74 are snapped about the inwardly facing surfaces of some of the inner spokes 50 to abut the outwardly facing surface of wall 44 of hub cup h preferably pads 70 and 74 are equidistantly spaced about the circumference of wire basket w cap c is generally cup shaped having truncated frusto conical side walls 80 which are integral with an end wall 82 the center portion of end wall 82 is formed with an inwardly extending collar 84 which is coaxially bored to receive an attachment bolt.

using reducing agents such as sncl 2 and conc hcl or h 2 pd catalyst the process of the present invention is described herein with reference to examples which are illustrative only and should not be construed to limit the scope of the present invention in any manner the palladacycles formula 7 are synthesized for the first time in our laboratory and successfully used for the suzuki type biaryl formation reaction two necked 25 ml rb flask was charged with pdcl 2 0 177 g 1 mmol licl 0 100 g 2 4 mmol and meoh 2 ml the resulting reaction mixture was stirred under argon atmosphere at 25 u00b0 c for 2 5 h then to the same reaction was added naoac 0 123 g 1 5 mmol and a solution of the corresponding sulfilimine formula 6 0 293 g 1 mmol in meoh 2 ml sulfilimine was prepared by following published procedure sharpless et al j org chem 2001 66 594 599 the resulting reaction mixture was stirred at 25 u00b0 c for 72 h then distilled water 6 ml was added to it and the solid was filtered on sintered funnel washed with water and dried under reduced pressure 5 mm for 3 h to afford palladacycle formula 7 where in r h and r1 me as brown colored solid yield 66 mp 135 141 u00b0 c decomp preparation of palladacycle where in r h and r1 ch ch 3 two.

per minute or per data amount basis that the wlan 20 expects to charge the user and hence the rate of reimbursement expected from billing agent 26 upon finding the contract terms acceptable the billing agent 26 sends back a signed contract or such other acknowledgement during step 104 the contract can be signed digitally by machine rather than by a human being next the wlan 20 requests from the billing agent 26 its digital certificate during step 106 whereupon the billing agent delivers the certificate to the wlan 20 during step 108 the billing agent 39 s digital certificate constitutes a data file that includes the public key of the billing agent which a receiving entity i e the user can use to encrypt information for decryption by the billing agent thus allowing for information exchange in a secure manner the wlan 20 forwards the billing agent 39 s certificate to the user during step 110 thereafter the wlan 20 sends to the user the proposed wsr after receiving the billing agent 39 s certificate and the wsr the user then decides whether to accept the access charges demanded by the wlan 20 if the user accepts then during step 114 the user does the following 1 verifies the certificate 2 inputs a pin and 3 encrypts the pin in accordance with the billing agent 39 s certificate the user verifies the certificate using a trusted party 39 s public key to make sure that 1 the certificate is indeed issued by the trusted party and 2 the certificate hasn 39 t been altered by anybody else encryption of the pin in accordance with the billing agent 39 s certificate entails encrypting the pin.

sources 14 and 15 with this structure the energy at the output of each terminal stage can be controlled and therefore a symmetrical adjustment of the field can be achieved the above described method and the rotary magnetic field generator offered as an exemplary embodiment for the implementation of this method make the creation of a high frequency rotating magnetic field possible by providing output signals at the two terminal stages which are accurately phase shifted by 90 u00b0 across a wide frequency range by means of the control of the terminal stages by steep edge switching pulses instead of high frequency currents all requirements for the provision of a high frequency rotating magnetic field can be achieved without difficulty in particular in respect of the adjustability across a broad frequency range and in the balancing of the separate magnetic fields which combine to cause the rotating magnetic field of circular character the digital control of the terminal stages makes it possible not only to control the terminal stages in an improved manner but also considerably facilitates the requirements in view of the variability of the frequency in case of a rigid 90 u00b0 phase difference of the sinusoidal signals at both outputs of the terminal stages due to the resonant circuits required for reasons of energization of the crossed coils 6 and 7 they only sift.

gas filtering system can be positioned around rf applicator 14 within or outside the bore hole to permit gas recovery through inner passage 42 without water the gas filtering system blocks liquid water and allows only the gas to pass through it other embodiments are within the scope of the claims for example although rf applicator 14 includes dipole antenna 40 other antenna configurations are equally applicable for use with the rf applicator for example referring to fig3 rf applicator 14 can include an antenna 70 which is in the form of an extension of coaxial transmission line 20 the applicators described in conjunction with fig2 and 3 are designed to provide a predetermined impedance characteristic for example to provide a high level of coupling into the coal seam however in other embodiments changing the impedance characteristics of the rf applicator may be desirable for example dielectric characteristic of the subterranean formation may differ or change as the water is converted to steam in such embodiments the applicator may include a tuning mechanism referring to fig4 for example a shorting link antenna 80 is connected to the distal end of coaxial transmission line 20 in essence shorting link antenna 80 is a dipole antenna having a looped end 82 and shorting link 84 positioned across the end an insulated push rod 86 is connected to shorting link 84 such that in operation it can be used to move the shorting link and adjust the electrical length of the antenna a remotely controlled non conducting hydraulic actuator 90 is provided to move push rod 86 in the embodiment shown a center conductor transition 92 is provided between coaxial transmission line 20 and a center.

delivery of pertinent content u2014 particularly when the caller is on hold in further illustration fig1 pictorially shows a process for delivering targeted content to a caller during call processing of an inbound telephone call as shown in fig1 a caller 120 a can place a telephone call from a location 110 such as an industrial organization examples of industrial organizations include retail stores service businesses public transportation terminals and the like the telephone call can be received in a call processing center 140 from over a pstn 150 the call processing center 140 such as a public branch exchange pbx or a call center in general can include one or more telephone extensions 180 to which the telephone call can be routed to facilitate the routing of the telephone call the call processing center 140 can include an acd or ivr system not shown the caller phone number 160 of the location 110 can be determined by the call processing center 140 for instance by inspecting ani data for the telephone call or by requesting the services of caller id as it is well known in the art targeted content delivery system 100 can map the caller phone number 160 to a data store of content 190 a 190 b such as music 190 b or advertisements 190 b by way of a location content table 130 of note the location content table 130 can map phone numbers to content with specific reference to a particular phone number or by reference to a type of industrial organization common to different phone numbers so that once.

part for each of the groups of mice is shown in fig6 a 6c from the histological scores for the distal part of the colon as set out in fig6 a 6c it could be concluded that there is a clear decrease of inflammation upon inoculation of mice with l lactis cells producing trefoil peptides mice having received pt1mtff1 transformed l lactis cells show a significant reduction of the inflammation of more than 65 as can be seen from fig6 a 6c the inflammatory infiltration and the epithelial damage in the distal part of the colon are significantly decreased following inoculation with recombinant l lactis strains which secrete mtff1 polypeptide these results were confirmed in a separate experiment which was conducted equally including larger groups group size 10 and more control groups fig7 shows histological scores obtained as described above of healthy control mice control and of mice which received dss as described either left untreated dss or treated as described above with mg1363 mg1363 pt1trex1 or mg1363 pt1mtff1 as indicated the experiment shows a clear and significant decrease in the intestinal inflammation in the group of mice treated with mg1363 pt1mtff1 the latter experiment was also evaluated by determining the levels of interleukin 1 u03b2 il 1 u03b2 and interferon u03b3 ifn u03b3 both pro inflammatory cytokines well known to the skilled mice n 10 were inoculated with the strains indicated as described control healthy mice dss mice receiving 5 dss in.

to the upper 12 via a hinge member 20 on the right side of the shoe 10 the toe flap 16 includes a securing device 24 on the left side of the shoe 10 for securing the flap to the upper 12 and or sole 13 the sole includes a top surface 25 a bottom surface 26 a heel portion 27 and a toe portion 28 in fig1 the toe flap 16 is in a closed position with the securing device 24 releasably attaching the toe flap 16 to the shoe sole 13 turning to fig2 and 3 the pedicure shoe 10 is shown with the toe flap 16 in an open position the toe flap 16 opens from the left side of the shoe 10 pivoting about the hinge member 20 located on the right side of the shoe 10 the hinge member 20 may be any suitable device for allowing the toe flap to pivot for example a simple crease in the fabric of the toe flap may be a suitable hinge member it will be appreciated that the toe flap 16 is configured to open sufficiently wide so that the toe flap 16 does not interfere with the toes of a foot when a foot is inserted into the pedicure shoe 10 the toe flap 16 also functions to provide access to the toes of a foot without requiring removal of the pedicure shoe 10 the securing device 24 may be used for securing the toe flap 16 in a closed position the securing device 24 may be any suitable device for releasably attaching the.

to the outboard side of the pontoon the opposite front end of the pontoon is provided with an idler shaft assembly 170 comprising an idler shaft 172 with sprockets 174 176 178 secured thereto the shaft is supported at both ends by pillow blocks similar to those described above fig2 shows details of the tracks 180 that when looped around the pontoons are guided by the lower and upper channels 128 129 and the drive shaft and idler shaft sprockets each track assembly 180 comprises plural identical endless chains 182 and a plurality of transverse cleats 184 affixed to alternate links thereof each of the cleats may comprise a metal u section open outwardly as shown in fig2 which provides good traction in mud and mire we prefer however to use t shaped cleats 186 one of which is shown in detail in fig5 the generous fillets 188 between the legs of the t of at least an inch radius render the cleat self cleaning this design avoids the substantial accumulation of mud that can detract from buoyancy with other designs fig4 shows the cab assembly 10 reinstalled upon the amphibious buggy assembly note the original hydraulic motors 20 and lines 22 for transferring fluid to and from the cab 39 s hydraulic pump.

individual apertures of the mask therefore etchant which pentrates the holes from the inner side of mask 10 tends to flow back through the holes and contribute to the desired etching it is frequently desirable to grade the holes from the largest size at the center of the mask to a decreasing size with radial distance from the center this is easily accomplished by arranging spray heads in the manner indicated by the dots in fig3 arranging them in concentric circles spaced to achieve uniform coverage of the field of apertures grading control is easily exercised by changing the separation of the spray heads from the portion of the mask to which they are individually to direct etchant and it is also subject to control by varying the flow of etchant through the various spray heads as a practical matter it is convenient to feed the spray heads from a common manifold and exercise control by spacing the spray heads with respect to the plane of the mask alternatively a stick or a single line of spray heads 20 may be employed in the manner indicated in fig2 such an arrangement provides a ribbon pattern of etchant having a width that is small relative to the smallest dimension of the field of apertures and having a length which is at least equal to the largest dimension of that field the linear array of spray heads in this embodiment is rotatably mounted and is continuously driven to rotate the pattern of etchant about an axis that is normal to the central area of mask 10 rotation of the nozzle array causes the entire field of apertures to be sprayed as necessary to etch back or enlarge all of the apertures of the field a suitable speed of rotation is 30.

coil tubing 30 orientation assembly 200 is removed from coil tubing 30 and plug assembly 100 is lowered into coil tubing 30 in an orientation that prevents slips 42 from engaging seam 32 as shown for example in fig2 b as a result of the prior location of seam 32 through the use of orientation assembly 200 referring to fig8 and 9 in an alternative embodiment slip mechanism 40 is set through the application of hydraulically assisted downward mechanical force a hydraulically powered setting tool not shown is inserted into upper mandrel 26 the setting tool applies a downward force causing the downward motion of slip cage 44 with respect to mandrel 10 as slip cage 44 is forced downward the remaining components of slip mechanism 40 also move downwardly causing slips 42 to ramp on setting cone 16 slips 42 extend radially and into engagement with inner wall 34 of coil tubing 30 placing plug assembly 100 in the set position as slip mechanism 40 is forced further downward seal elements 14 are compressed and expand radially until reaching sealed engagement with inner wall 34 of coil tubing 30 referring now to fig1 a 9 in certain embodiments seal elements 14 comprise rubber with 50 durometer hardness or less the 50 durometer seal elements 14 are manufactured by parker seal the industry standard rubber durometer for the sealing or packing elements in downhole packer plug applications is in the range of 60 to 90 durometer which indicates the use of a much harder rubber compound in contrast the softer rubber compound utilized in certain embodiments of the current invention is crucial.

65 on the body 62 projecting into a cap bore 66 spring means as for example a torsion spring 67 is connected between the cap and body to urge the body in one rotary direction in addition finger actuated means including a remote key as at 68 is operable to oppose the spring via a tension strand and displace the body 62 in the opposite rotary direction such means may include a driven pulley 69 integral with the body by means such as eccentric screw 69a a drive pulley drive roller 70 proximate the key a cord or line 71 wound on the driven pulley and drive pulley so that the two rotate together and a suitable means such as friction or rack type connection or as shown a cord 72 between a stem 68a on the key and the drive pulley so that the latter is rotated when the key is depressed suitable stop pins 73 and 74 may project into grooves 75 and 76 in the pulley to limit its rotation at locations corresponding to the above described modes of operation of the valve body to connect or not to connect the tubing section with the crooks such an actuation system with all forces transmitted in tension between keys and valves has the dual advantages of low inertia and accommodation of extreme dispersion of valves from the source of control observation of the key assembly shown in fig4 comprised of elements 68 68a 72 drive pulley guide roller 70.

dmrs in two adjacent columns can be located in the middle of the r pdsch zone after being translated thus the dmrs in the middle of the r pdsch zone can ensure demodulation performance of the r pdsch when the rn moves at a low speed or is immobile the cdm t mode is adopted for a demodulation reference signal of an r pdsch there are three ofdm symbols occupied by an r pdcch and the second timeslot and the last ofdm symbols in the first timeslot in the sub frame are occupied by the r pdsch in the present embodiment and as illustrated in fig5 the result of configuring resource units for transmission of the demodulation reference signal of the r pdsch is the same as in the first embodiment and for a specific flow thereof reference can also be made to the first embodiment the cdm t mode is adopted for a demodulation reference signal of an r pdsch there are two ofdm symbols occupied by an r pdcch and the second timeslot and the last two ofdm symbols in the first timeslot in the sub frame are occupied by the r pdsch in the present embodiment the operation s 11 is to firstly search a resource zone occupied by the r pdsch for resource units in an lte system.

226 the second frame 260 is guided by the rails penetrating through guide holes 330 332 334 336 formed transversely through side wall blocks 203 of the housing 202 shown in fig1 and 13 the blocks 203 are fastened to the remaining portions of the housing 202 by fasteners 205 the blocks are removable to facilitate assembly disassembly of the cutting assembly 200 brackets 340 342 are fixedly connected to the rails 264 266 within the perimeter of the housing 202 by two clamping arrangements each effected by a fastener 359 shown in fig7 and 13 a pin 360 362 see fig1 extends from each bracket 340 342 into the cam slots 248 250 the pins include plastic rings 363 for reduced friction sliding shown in fig7 and 13 within the cam slots two dual acting cylinders 366 368 act on the rails 264 266 to drive the rails in horizontal reciprocation in this regard a piston not shown is connected to each of the rails within the dual acting cylinders and pneumatic or hydraulic pressure acting on opposite sides of the piston drives the rails into reciprocation the reciprocation of the rails causes the reciprocation of the horizontal longitudinally directed blade 302 and causes vertical reciprocation.

at one end rollers 10 cooperating with the pressing member 5 while the opposite ends from the rollers 10 act upon slides 11 mounted in the guide portion 8 each of the slides 11 has a bending roller 13 and a shaping roller 14 on a spindle 12 by means of the pivotable levers 9 the bending rollers 13 can be moved out of a position that defines a maximum working aperture for the tool into a position that defines a minimum working aperture for the tool specifically in a downward movement of the rotating shaping tool as indicated by the arrow 16 a depressor 15 first of all presses directly on a workpiece 17 namely an inhaler cartridge 36 as the downward movement continues the levers 9 are pivoted in the direction of the arrow 18 as a result of the activity of the conical region 6 of the pressing member 5 and the pivoting movement of the lever 9 is converted into a radial advancing movement of the slide 11 in the direction of the arrow 19 in order to move the bending roller 13 and the shaping roller 14 into their end position in which they describe the minimum working aperture for the tool when the shaping tool is moved axially upwards the levers 9 are pivoted by means of radially acting compression springs supported on an intermediate ring 20 so that the bending roller 13 and the shaping roller 14 are moved into a position in which they describe.

dioxide aerosil u2122 cab o sil u2122 cab o sil m 5p u2122 wacker hdk u2122 croscarmellose sodium ac di sol u2122 explocel u2122 nymcel zsx u2122 pharmacel xl u2122 primellose u2122 solutab u2122 vivasol u2122 crospovidone kollidon cl u2122 kollidon cl m u2122 polyplasdone xl u2122 polyplasdone xl io u2122 docusate sodium guar gum galactosol u2122 meprogat u2122 meyprodor u2122 meyprofin u2122 meyproguar u2122 low substituted hydroxypropyl cellulose magnesium aluminun silicate carrisorb u2122 gelsorb u2122 magnabite u2122 neusilin u2122 pharmsorb u2122 veegum u2122 methylcellulose benecel u2122 culminal mc u2122 methocel u2122 metolose u2122 microcrystalline cellulose avicel ph u2122 celex u2122 celphere u2122 ceolus kg u2122 emcoel u2122 ethispheres u2122 fibrocel u2122 pharmacel u2122 tabulose u2122 vivapur u2122 povidone kollidon u2122 plasdone u2122 sodium alginate kelcosol u2122 keltone u2122 protanal u2122 sodium starch glycolate explotab u2122 primojel u2122 vivastar p u2122 polacrilin potassium amberlite irp88 u2122 silicified microcrystalline cellulose prosolv u2122 starch aytex p u2122 fluftex w u2122 instant pure cote u2122 melojel u2122 meritena u2122 paygel 55 u2122 perfectamyl d6ph u2122 pure bind u2122 pure cote u2122 pure dent u2122 pure gel u2122 pure set u2122 purity 21 u2122 purity 826 u2122 tablet white u2122 or pre gelatinized starch instanstarch u2122 lycatab c u2122 lycatab pgs u2122 merigel u2122 national 78 1551 u2122 pharma gel u2122 prejel u2122 sepistab st 200 u2122 spress b820 u2122 starch 1500 g u2122 tablitz u2122 unipure ld u2122 and unipure wg220 u2122 or mixtures thereof preferred disintegrants are super disintegrants such as croscarmellose sodium crospovidone low substituted hydroxypropyl cellulose microcrystalline cellulose carboxymethylcellulose sodium carboxymethylcellulose calcium and sodium starch glycolate a particularly suitable disintegrant is croscarmellose sodium when the disintegrant is croscarmellose sodium the total weight.

or rearward in the associated shield tubes 44 46 and 48 thereby to pivotally move the mirror unit about the spherical projection 64a of the mirror holding portion 64 into a desired angular position the setting of the wire assemblies is made in the following manner first one end of each wire 24 26 or 28 is passed leftward as viewed in fig2 through the opening 64b of the mirror holder portion 64 and then through an opening 22b formed in the back frame 22 of the mirror unit with the enlarged stopper head 24a 26a or 28a inclined upon the stopper head projecting sufficiently into the interior of the mirror unit the wire is pulled rightward causing the associated stopper head to be raised up and brought into engagement with the inside surface of the back frame 22 of the mirror unit then one end of the associated shield tube 44 46 or 48 is fixed or screwed to the opening 64b of the mirror holder portion 64 then the other end of the wire 24 26 or 28 is passed through the opening of the body 36 of the control device 30 and connected to the universally pivoting member 34 of the same and the other end of.

execute however strain is placed on the fracturing pumps while performing this kind of rapid pump rate change in a preferred embodiment of this invention rather than rapidly increasing and or decreasing the pump rate of the fracturing pumps or in addition to changing the pump rate a portion of the fracturing fluid with or without proppant is diverted away from the wellhead changing the flow rate in order to provide a pressure pulse to the wellbore 10 fig4 shows a schematic representation of an embodiment of an overall system layout 30 of this invention for providing a pressure pulse to the wellbore 10 with or without changing the pump rate the system 30 of this embodiment preferably includes a fracturing tank 32 generally a water tank to store the water and or other fluid that will comprise a portion of the fracturing fluid the system 30 preferably also includes a pre blender 34 preferably a mixing truck that mixes the water or other fluid from the fracturing tank with other components of the fracturing fluid such as polymers and other chemicals to make the fracturing fluid at this point the fracturing fluid preferably does not include a proppant the system of this invention further includes a slurry blender 36 that mixes the fracturing fluid with the proppant and or other chemicals to create a.

produce audible speech that the driver can hear another embodiment of a road sign announcing arrangement 200 of the present invention is shown in fig3 arrangement 200 includes a camera 212 and a text recognition module 216 which may be substantially similar to camera 12 and text recognition module 16 of fig1 and thus are not described in detail herein the output of text recognition module 216 may be received by an electronic processor 226 which also receives vehicle location information from an in vehicle gps module 228 processor 226 is also in bi directional wireless communication with an external database 230 of sign messages stored in association with geographical locations processor 226 may forward the vehicle location information along with vehicle traveling direction information which may be derived from the changes in vehicle location to database 230 database 230 may interpret this information as a query as to what message is conveyed by a sign that may be visible to the driver database 230 may respond to the query by transmitting to processor 226 both the literal word for word message on the visible sign and a longer textual interpretation of the sign that is more easily understood in audio form than is the literal word for word message for example in the case of the sign of fig2 database 230 may transmit to processor 226 both u201c speed limit 25 u201d and u201c construction zone ahead speed is reduced to 25 miles per hour u201d processor 226 may compare the output of text recognition module 216 to the literal word for word message as provided by database 230 processor 226 may then based on the comparison produce a confidence score indicating the degree of confidence that the word for word message as.

the filter medium 82 the cleaned air then leaves the top of the electrostatic filter 70 and enters the exhaust passage 100 which directs air downwardly through the centre of the separating apparatus 6 to the exit port 96 which is located on the lower end of the separating apparatus 6 in the embodiment shown in fig6 a and 6 b the further cleaned dust laden air passes out of the vortex finders 66 and enters the plenum 98 the air passes through the plenum 98 and enters the top of the electrostatic filter 70 the air then travels past the corona discharge device formed from the corona discharge electrode 84 and the electrodes of low curvature 86 such that any dust particles remaining in the further cleaned dust laden air become charged the further cleaned dust laden air containing the charged dust then travels downwardly through the filter medium 82 a potential difference is generated across the filter medium 82 causing the charged dust particles to be attracted to respective positive and negative ends of the filter medium 82 thus trapping them within the filter medium 82 the cleaned air then leaves the lower end of the electrostatic filter 70 and exhausts the separating apparatus 6 via the exit port 96 located on the lower end of the separating apparatus 6 in the embodiment shown in fig7 the further cleaned dust laden air passes out of the vortex finders 66.

and products from the monoalkylation thereof with propylene oxide aqueous 1 5 naoh used as solvent and catalyst as follows a alpha cyclodextrin b mono s 2 39 hydroxypropyl alpha cyclodextrin c beta cyclodextrin d 2o s 2 39 hydroxypropyl beta cyclodextrin e 2 o r 2 39 hydroxypropyl beta cyclodextrin f gamma cyclodextrin g mono s 2 39 hydroxypropyl gamma cyclodextrin the experimental conditions employed were the same as those used for the results described in connection with fig2 above to document that a product monosubstituted in position 6 can be prepared analogously the reaction described in example 6 was performed u03b2 cyclodextrin was condensed with s propylene oxide using a high concentration of alkali the monosubstituted product in that case when toluene was used as a complexing agent coprecipitated with u03b2 cyclodextrin from mass spectrum of the reaction mixture and comparison of the thin layer chromatography properties of authentic 2 o substituted product fig4 it is obvious that the product is different from 2 o 2 hydroxipropyl u03b2 cyclodextrin on the basis of the data in the previous application the product has to be 6 o 2 hydroxypropyl u03b2 cyclodextrin fig4 shows a thin layer chromatogram of the reaction products of beta cyclodextrin with s propylene oxide catalyzed by 30 d d aqueous sodium hydroxide wherein this path is identified by number 34 3 34 2 o s 2 39 hydroxypropyl beta cyclodextrin path 34 2 34 beta cyclodextrin path 34 1.

18 in a stationary position relative to the adapter mount 16 if the fastener 38 is loosened the support arm 18 can move relative to the adapter mount 16 if the fastener 38 is tightened the first half 34 a and the second half 34 b of the adapter mount 16 tighten around the support arm 18 and the support arm 18 cannot move relative to the adapter mount 16 fig3 illustrates a perspective view of the sliding clamp 30 that attaches the series of ball jointed links 20 to the support arm 18 the sliding clamp 30 includes a substantially square opening 46 that matches the shape of the support arm 18 in this example the opening 46 includes rounded corners 47 and linear sides 49 the corresponding rectilinear shape of the opening 46 and the support arm 18 prevent the support arm 18 from rotating about its own longitudinal axis in this example the sliding clamp 30 includes a first half 40 a and a second half 40 b that each include an opening 42 a fastener 48 shown in fig1 is received in the openings 42 to secure the first half 40 a and the second half 40 b.

that link insofar as as shown in fig3 the link 42 has a socket 44 in which engages a centralising pin 46 the wall of the socket 44 has aligned apertures 48 50 in which pegs 52 and 54 engage these pegs being carried by pivotable jaws 56 and 58 the jaws 56 and 58 are connected to the clamping device 60 having swingable arms 62 and 64 on the ends of which are provided guide rollers 66 and 68 as the bladder 38 inflates the rollers 66 which are held inwardly by spring action are caused to pivot to the position shown in fig1 which has the effect of moving the jaws 56 and 58 apart to remove the pegs 52 and 54 from the apertures 48 and 50 and the positioning device 40 and the device 60 with the rollers and jaws can be detached from the bladder and the connecting tube 42 so that it can be pulled along the line 10 away from the inflated bladder a series of additional pressure pipes and corresponding bleed pipes 70 72 four in all extend to the outside of the bladder 38 and are removably attached to the positioning device 40 device 40 is moved to the other end of the main.

third lens l 3 and an image plane im of an imaging element it is noted that the cover glass 10 may be optionally omitted the first lens l 1 is formed in a shape so that both a curvature radius of a surface thereof on the object side and a curvature radius of a surface thereof on the image side are positive i e it is shaped to form a meniscus lens that directs a convex surface to the object side near an optical axis x the second lens l 2 has a shape such that a curvature radius of a surface thereof on the object side is negative and a curvature radius of a surface thereof on the image side is positive i e it is shaped to form a biconcave lens near the optical axis x the third lens l 3 is formed in a shape so that both a curvature radius of a surface thereof on the object side and a curvature radius of a surface thereof on the image side are positive i e it is shaped to form a meniscus lens that directs a convex surface to the object side near the optical axis x here according to the embodiment the third lens l 3 has an aspheric shape in which both surfaces on the object side and surface on the image side are convex on the object side near the optical axis x and has a concave shape on the object side at periphery thereof in the embodiment all of the lens surfaces of the first lens l 1 through the third lens l 3 are formed to be aspheric surfaces when the aspheric surface applied to the lens surfaces.

16 and stator coils 18 which have cores of laminar plates 20 or the like the rotary hub includes permanent magnet elements 22 of generally conventional design these may be poles of a single ring magnet having multiple poles the magnets or poles 22 are held in a magnet sleeve 24 the hub 12 includes a sleeve 26 inside the sleeve 26 is a shaft 28 which is journaled into the base 16 of the stator portion 14 the shaft 28 includes an axial load thrust plate 30 at one end thereof the thrust plate 30 is sealed off from the outside by an end cap 32 which creates what is known as a dead end design because of the physical seal formed by the cap 32 and the sleeve 26 referring to fig1 a which is an enlarged view of a portion of the motor of fig1 there is a radial gap 36 between the sleeve 26 and the shaft 28 as well as an axial gap 38 between the bottom of the thrust plate and the sleeve and a clearance 40 between the top of the thrust plate 30 and the end cap 32 finally there is a radial gap 42 between the sleeve 26 and the radially outer most end of the thrust plate 30 collectively the gaps 38 42 and 40 form a dead end cavity for the thrust plate 30 all of the gaps 40 42 38 and 36 are filled with a lubricating fluid or oil 44 which forms a fluid bearing and allows the hub 12 and the sleeve 26 to rotate with respect to the shaft 28 and the thrust plate 30 referring to fig7 the gap 36 extends.

0 0 0 0 0 2 2 0 0 4 2 0 2 dimethylcarbamoyl imino 5 methylthio 1 3 4 thiadiazolin 3 carboxylic acid ethylester 0 0 0 0 0 0 0 0 1 1 0 0 2 1 0 5 ethylthio 2 dimethyl carbamoylimino 1 3 4 thiadiazolin 3 carboxylic acid ethyles ter 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 compounds of the seed invention peanut potato pea corn wheat barley rice sorghum 2 dimethylcarbamoylimino 5 methylsulfonyl 1 3 4 thiadiazolin 3 carboxylic acid methylester 10 8 9 10 8 9 9 5 ethylsulfonyl 2 dimethyl carbamoylimino 1 3 4 thiadiazolin 3 carboxylic acid methylester 10 10 8 10 8 8 10 9 5 ethylsul fonyl 2 dimethyl carbamoylimino 1 3 4 thia diazolin 3 carboxylic acid ethylester 10 10 9 10 10 9 2 dimethylcarbamoylimino 5 methylsulfonyl 1 3 4 thia diazolin 3 carboxylic acid ethylester 10 9 9 10 9 9 10 9 2 dimethylcarbamoylimino 5 propylsulfonyl 1 3 4 thia diazolin 3 carboxylic acid isopropyl ester 10 10 8 cent chrysan echiono lamium compounds of the stellaria senecio matricharia aurea amaranthus themum impomoea polygonum a vena chloa setaria digitaria sorghum poa amplexi invention media vulargis chamomilla cyanus retroflexus segetum purpurea lapathifolium fatua crus galli italica sanguinalis halapense anua caule 2 dimethylcarbamoyli mino 5 methylsulfonyl 1 3 4 thiadiazolin 3 carboxylic acid methylester 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 5 ethylsulfony l 2 dimethylcarbamoyli mino 1 3 4 thiadia zolin 3 carboxylic acid methyl ester 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 ethylsulfonyl 2 dimethylcarbamoylimino.

differing from that of the above mentioned operation or at the same speed when the dryer is an integral part of the kiln the same applies to drying of the glazing in the following description reference is made to a process wherein drying of the tile body is performed previously and separately while drying of the glazing is carried out immediately prior to heating and at the same speed in this case it lasts a few minutes for example from 5 to 7 minutes at suitable temperatures for example up to 200 u00b0 c and under an adequate and intense gas circulation when drying of the glazing is completed and the actual heat treatment starts the temperature of the tiles according to the present invention is quickly raised up to the firing temperature the firing temperature measured near the tiles as are all the temperatures stated in this specification may vary quite substantially according to the compositions but it is generally around 1000 u00b0 c as for example between 800 u00b0 c and 1200 u00b0 c but more commonly between 1000 u00b0 c and 1100 u00b0 c for example around 1050 u00b0 c and 1060 u00b0 c the heating of the tiles is carried out as referred to above in an environment where heat transmission takes place by convection with gas flowing counter current to the direction of travel of the tiles and besides heating the tiles it heats also the walls of the heat treatment chamber which are normally made of refractory.

of fig1 in fig8 there is shown a dispenser where the hollow body has spiral bellow 44 the bellow is shown from the bottom to the top portion of the hollow body however the bellow may be a part of a smaller portion of the hollow body the remainder of this dispenser is as described for the dispenser of fig1 in fig9 there is shown a dispenser where the hollow body has a plurality of bellows 46 as shown this can be collapsed to a smaller size for storage there can be more or fewer bellows than as shown in fig9 the remainder of this dispenser is as described for the dispenser of fig1 in fig1 there is shown a top plan view of the hollow body and in particular an alternative embodiment of the dispensing closure of fig4 as in fig4 a plurality of apertures is formed by the fine mesh 17 made of woven or non woven material however in fig1 the protecting grid pieces are arranged differently the protecting large mesh grid has grid pieces 60 in a radial spoke formation for support with a central hub 62 at which one end of each grid piece attaches again as in fig4 the dimensions of the apertures of the large mesh protecting grid must prevent the contact between fabrics and the fine mesh section in either the woven non woven or other form the.

of the openings 58 and 67 positioned on the flange 60 of the plug removal shield 44 of fig4 taken along line 7 7 as mentioned above with respect to fig3 and 4 the openings 58 may be used to insert the mounts 52 shown in fig3 and 4 such as a metal plastic or fabric strap e g a rope a chain a wire a cable a metal tape a velcro strap a plastic tie a u clamp a bent rod or a square rod suitable for securing the plug removal shield 44 to the drain tube 36 the opening 67 may be used to drain fluid the mounts 52 may be circumferentially disposed about the drain tube 36 shown in fig3 and 4 inserted through the openings 58 and then secured to the flange 60 for example by using stop sleeves or crimps 62 in another embodiment such as the embodiment shown in fig8 the mounts 52 may be secured by using for example multiple rods 104 indeed fig8 illustrates a bottom view of an embodiment of the flange 60 having multiple rods 104 suitable for securing the mounts 52 in the illustrated embodiment the rods 104 may be fastened to the flange 60 for example by welding the rods 104 to the flange 60 the mounts 52 may be fastened to the rods 104 for example by tying the mounts 52 to the rods 104 tying the mounts 52 to the rods 104 may enable a secure and fast attachment of the plug removal shield 44 to the drain tube 36 shown in fig3 and 4 likewise untying the mounts 52 from the rods 104 may enable a simpler and faster method of detaching the plug removal shield.

valve seat 70 and an outlet or discharge passage 84 above the valve location the inlet passages 82 are connected individually to the conduits 18 26 and the discharge passages are connected to supply fluids to the interior of head 14 the valve seal structure of the present invention is a shear seal having contoured seats and a flat seal element this seal configuration results in a significant reduction of sticking friction and creates a snap type opening effect which has good sealing characteristics and requires low spring forces to effect good sealing thus when an operating button is pushed to operate the valve the valve operates easily and quickly and the valve return springs 73 may be very light springs still referring to the structure of fig5 a portion of small diameter stem 64 projects above retainer plate 80 and the valve operating buttons are mounted on this portion of each stem with a mild friction fit as seen in fig5 soda button 32 is mounted on the stem of the center valve and syrup buttons 38 and 42 are mounted on the valve stems on either side of the soda button 32 these operating buttons are retained in place by retainer 30 which defines a hollow interior operating space 92 an activating bridge 94 extends from each of the syrup buttons 38 and 42 below retainer plate 30 and each of these activating bridges overlaps an annular operating ring 96 on soda button 32 thus when operating force is applied to either syrup button 38 or syrup button 42 to move the button and valve downward to operate the syrup valve activating bridge 94 engages.

lip 42 for retention on the bead plates 16 18 the ring 28 of fig4 is formed by two stamped metal pieces 44 46 the piece 44 forming the contact surface is similar to the ring 28 of fig1 the second piece 46 is secured to the open trough of the first piece 44 to result in a more structurally stable ring 28 the ring 28 of fig5 is formed of conventional thermoplastic or thermoset materials of the type used to manufacture airspring pistons to obtain the necessary structural stability needed the ring 28 is formed as a series of accordion ribs 48 the outer surface of the ring 28 approximates the contact surface of the other exemplary rings 28 and enables the airsleeve 10 to move in the desired manner fig6 and 6a illustrate another variation of the stamped metal ring 28 the ring 28 has both a radially inner extending flange 40 and a radially outer extending flange 50 the outer extending flange 50 may be continuous about the outer circumference of the ring 28 or the width of the flange 50 may vary when the air spring 10 is to be mounted on a narrow surface such as a beam 52 the edges of the air spring 10 overhang the beam 52 to provide additional reinforcement the flange width is increased to a maximum width at two opposite locations that then contact the beam 52 when the air spring 10 is mounted variations in the present invention are possible in light of the description.

a portion of the electrode adjacent the exposed surface of the electrode first modified electrode material 270 is selected to have a tcr with little or no change with positive temperature change so that at programming temperatures of 600 u00b0 c or more the resistivity of first electrode material 270 does not decrease to a value lower than a resistivity at a reduced non programming temperature in one example electrode material 270 has a resistivity r 1 that is higher than a resistivity r 2 of electrode material 230 a at temperatures greater than 600 u00b0 c or at least has a thermal coefficient of resistivity that has a lower variation to positive temperature change modifying species 260 of oxygen carbon or nitrogen when introduced into polycrystalline silicon to form electrode material 270 has shown a reduced tcr compared to polycrystalline silicon with electrode material 270 having a greater resistivity r 1 at 600 u00b0 c to 650 u00b0 c than electrode material 230 a of polycrystalline silicon the amount depth of the first electrode material 270 generally depends on the amount of voltage that will be used to set or reset a volume of memory material using voltages in the range of about 3 3 volts v according to current technology a suitable depth for electrode material 270 of for example sic or sio 2 into a polycrystalline silicon electrode is approximately 600 angstroms u00e5 at lower voltages a shorter depth would be suitable in terms of amount of first electrode material 270 amounts of 0 1 to 20 atomic percent of modifying species 260 are suitable 0 5 to 10 percent are.

pipe ends 34 and 36 apparatus not shown can now be inserted through the passageway 32 in flange fitting 30 to cap off the ends 34 and 36 of pipe 10 and thereby close fluid flow after repair or maintenance has been done the mechanism for capping off the ends of the pipe are removed and it then becomes necessary to provide a permanent closure of the containment housing specifically to complete the job of temporarily terminating fluid flow through pipe 10 the passageway 32 in flange fitting 30 must be closed the invention herein provides a system of achieving permanent high temperature closure of passageway 32 by means of a completion plug assembly generally indicated by the numeral 38 before describing the details of completion plug assembly 38 and flange fitting 30 further reference to fig1 shows systems by which completion plug assembly 38 can be installed into flange fitting 30 secured to the top surface 40 of flange fitting 30 is a valve bottom flange 42 which is a lower portion of a valve generally indicated by the numeral 44 valve 44 has a top flange 46 which receives the bottom flange 48 of a hydraulic cylinder 50 valve 44 has a vertical passageway 52 therethrough that is of internal diameter equal to or greater than the passageway 32 in flange 30 opening 52 in valve 44.

member 30 is substantially spherical and truncated on opposite sides 32 34 also the first and second notches 36 38 extend axially away from one another at least one portion 46 of the housing preform 62 is disposed in at least one of the first and second notches 36 38 in alternative embodiments of the invention the radial discontinuities are formed as one or more dimples such as dimples 40 42 as result the tubular member 30 would be immovably associated with the finished housing 12 after the flow forming process in the exemplary embodiment of the invention the finished housing 12 is assembled to other components to form the inventive differential assembly 10 after the finished housing 12 has been formed from the housing preform 62 with the tubular member 30 disposed in situ a longitudinal aperture 70 is formed and finished the longitudinal aperture 70 receives one of the axle shafts not shown which defines splines thereby matingly engaging splines 72 defined by the gear 20 also a transverse aperture 74 is formed and finished the transverse aperture 74 passes through the finished housing 12 and the tubular member 30 the pin 14 is received in the transverse aperture 74 the lid 50 is fixedly associated with the finished housing 12 after the gears 16 18 20 22 have been assembled the lid 50 defines a second longitudinal aperture 76 which receives one of the axle shafts the other axle shaft not shown extends through defines splines which matingly engage splines 78 defined by the gear 22 while the invention has been described with reference to an exemplary embodiment it will be understood by those skilled in the art that various.

of the trunk fiber optic 45 may also be present the parabolic mirror 41 corrects for both of these slight errors by collecting the electromagnetic energy from the output end 55 of the front fiber optic 45 and subsequently focusing the electromagnetic energy into the input end 55 of the fiber tip 51 the parabolic mirror 41 may also comprise molypdium in a preferred embodiment the clamp assembly 91 operates to firmly grip and hold the trunk fiber optic 45 in the presently preferred embodiment the clamp assembly 91 is provided with at least one slit which extends from the distal end 93 of the clamp assembly 91 to a region 95 just distal of the set screw 97 as presently embodied the at least one slit extending from the distal end 93 to the region 95 just distal of the set screw 97 comprises two slits which are adapted to allow the clamp assembly 91 to be compressed by the chuck 23 onto the trunk fiber optic 45 the chuck 23 thus the at least one slit extending from the distal end 93 to the region 95 just distal of the set screw 97 comprises two slits which are adapted to allow the clamp assembly 91 to be compressed by the chuck 23 onto the trunk fiber optic 45 the chuck 23.

mg made up to volume with distilled water ph6 7 various amounts of diltiazem and bethanechol were added in the amounts shown in examples 4 and 6 to form various compositions for dose ranging studies composition white soft paraffin 50 g liquid paraffin 20 g cetomacrogol emulsifying wax 30 g cetosteryl alcohol 24 g and cetomacrogol 1000 6 g a base cream was formed by firstly separate mixing of the aqueous and non aqueous components of the cream weighed quantities of propylene glycol and a proportion of the preservative solution were placed in a beaker to which the weight quantity of carbomer powder was added using an impeller type mixer to form a colloidal suspension of the carbomer thereafter the weighed quantity of dmso was added and rapid stirring continued at room temperature until a translucent uniform gel had been formed in the meantime the weighed quantities of white soft paraffin and the cetamacrogol emulsifying ointment were placed in a separate beaker heated to melting point and gently stirred to give a uniform base the drug is then added to the remainder of the preservative solution which in turn was then added to the gel and whilst vigorously stirring the uniform base above was added to form a cream the carbomer acted as a dual neutralisation agent and primary emulsifier of the oil and aqueous phases to form the uniform cream base a bethanechol cream composition was made up as above but using 0 5 g of bethanechol 0 1 w w instead of diltiazem ten volunteers were used in a double blind study to determine the concentration of diltiazem cream of example 1 which most effectively lowers resting.

the mechanical separator includes a housing 170 defining an internal cavity 175 being the separation chamber a baffle arranged to rotate 185 includes a baffle plate 180 having a plurality of members 190 projecting therefrom the housing includes a plurality of elements 195 projecting from an internal surface so as to in this embodiment intermeshed with the members of the rotating baffle this embodiment further includes a mass transfer device 200 for aiding in the formation of bubbles in the liquid phase so as to facilitate heat and mass transfer by rotating the baffle as liquid is introduced through the liquid distributor 135 the liquid distributor 135 uniformly distributes the liquid as droplets again to aid in heat and mass transfer by increasing surface area the liquid phase is further disrupted by the interaction between the stationary elements 195 and moving members 190 the centrifugal force applied by the rotating baffle forces the liquid through the interlaced elements and members to a periphery of the chamber 175 whereby the liquid phase is eventually passed through a liquid outlet 165 the gas within the feed stream however is subject to a vortex arrangement and so biased into the central portion 207 of the rotating baffle whereupon it is vented through the gas outlet 160 fig5 shows a detailed view of the liquid phase path as it passes through the interlaced stationary elements 195 and moving members 190 of the rotating baffle the mass transfer device 200 further impedes the liquid phase flow 230 tending to collect liquid 235 and forming bubbles 240 as a result of the consequential turbulence in this way the mass transfer devices aid in the heat and mass transfer to further boil the.

s has occurred because the seal s is on face g of the box b the components of the lock l are formed from a suitable strength steel or other suitable material the lock l comprises a housing assembly 22 which is formed of a front housing 24 and a rear housing 26 which are mounted to the front half f and the rear half r of the meter box b respectively the front housing 24 is aligned with the rear housing 26 so that the front housing 24 registers with the rear housing 26 when the meter box b is closed however the front housing 24 completely separates from the rear housing 26 as the front half f is rotated to open the box b the housing assembly 22 is formed of square structural tubing in the preferred embodiment the square tubing enables the housing assembly 22 to be easily connected to a flat surface of the meter box b such as the side or bottom of the box b by tack welding or by other suitable connecting means a flange 30 fig2 is mounted at an outer end 28 of the housing 24 the flange 30 has a suitable number of openings 31 formed therein through which a wire or wires of the seal s may be passed for the purpose.

17 volume create an obstruction in the hot gas flow that the combustor shell contains the hot gas is therefore forced to follow the path of the corrugations as it would a row of stationary vanes as is common with other annular combustors a second shell liner 18 amp 19 encompasses the main combustor shell that envelops the combustion process this liner may have constant radii or variable radii in the longitudinal and or circumferential directions this liner creates an annular volume inside and outside the annular combustion region compressor discharge air is passed through these regions with the intent of removing heat from the combustor shell 14 amp 15 additionally the outer cooling region is open to the 1st stage turbine at the downstream end therefore the flow is pressure driven and exits at this end of the combustor in this outer annulus region the discharge air travels downstream and through the outside of the corrugations 21 removing heat from that material as well before entering the first stage turbine this outer liner 18 must attach to the outer combustor shell 14 by establishing a surface contact between 14 and 18 at the end of the combustor the surface contact will begin at the combustor exit and end slightly upstream establishing this type of mounting joining of the two liners 14 amp 18 creates an enclosed corrugation channel 21 on the cooling flow side this allows for the cooling flow to become more developed before entering the turbine inlet in this example the inner cooling region does not enter the 1st stage turbine instead dilution holes placed in.

pieces 32 and 34 further contain in the medial portion an insulator block region generally designated by numeral 39 insulator region 39 houses each connector pin so that the union between male connector pin 40 and female connector pin 42 is suitably insulated from any outside chemical or electrical agent in order to withstand the corrosive chemicals and enormous external pressure the outer surface of heater unit connector 30 must be incredibly strong the aforementioned elements of connector 30 are encased in a steel fitting assembly 50 u201c encasement means u201d each component of which is welded with continuous beads using the u201c teg u201d welding process to each adjoining component in the preferred embodiment the outer surface of connector 30 is comprised of stainless steel which is joined using the process of u201c teg u201d welding this welding process allows the seams of joined components to withstand the extreme conditions of the bore well finally each connector piece is secured to the other by fitting assembly 60 fitting assembly 60 and sealing fitting 62 are as would be apparent to anyone skilled in the art designed to engage one another so as to form a sealed junction in the preferred embodiment this union is a standard two inch union that is modified by u201c teg u201d welding that is the union is welded using the teg process so that it will withstand the extreme environmental conditions of the bore well the shielding of the electrical connections between surface wiring leads 24 and heater wiring leads.

90 turning now to fig6 there is shown a under counter mounted food preparation sink 110 according to a second example embodiment of the invention this is similar to the first embodiment except for using conventional under counter mounting hardware regardless of whether the installation follows the principles of fig1 or fig6 it should be appreciated that no further faucet or hand spray is required to be mounted on the counter top in the preferred embodiments this saves considerable space having described the primary features of the food preparation sink 10 its preferred operation can be explained as follows a user pushes on switch 93 this signals the electronic control module 94 to begin delivery of water from water line 91 through fitting 86 and into the inlet port 80 of the valve system 70 this can also signal the garbage disposal 90 to begin operation to dispose of the waste either immediately or with a slight time delay looking next at fig5 the water flows in direction i into the inlet port 80 and into the manifold 74 of the valve system 70 depending on the position of the valve member 82 the water takes different flow paths from the manifold 74 the diverter plate of the valve member 82 is movable back and forth in a first direction v1 and a second direction v2 to direct the water flow through the valve system 70 between a first path p 1 and a second path p 2 when the valve member 82 is in a first position at the end of movement in first direction v1 as shown in fig5 water generally flows along the second path p 2 between the inlet port 80 and the second port.

layers a and e and for the regions b c and d it will also be understood that while the term high relative permeability may be a relative term the same is understood by those of skill in the pertinent art to be accurately defined in the magnetoresistive memory context a further alternative is illustrated in two mutually orthogonal sections in fig2 a and 2b two magnetoresistive memory cells being illustrated between two layers f and h made of an electrically conductive or poorly insulating material having a high permeability the essential difference from the first alternative is however that the layers f and h make contact neither with the bit lines nor with the word lines rather they are isolated therefrom by an electrically insulating material having a relatively low relative permeability this makes it possible for example to use electrically conductive or poorly insulating materials having a high relative permeability since as a result of the electrically insulating material the bit and word lines and also the memory cells themselves are not short circuited or bridged the layers f and h may be composed of different or else identical electrically conductive or alternatively electrically non conductive materials having a high relative permeability electrically conductive layers having a high relative permeability are usually alloys of iron nickel and or cobalt the layer g can fill the entire space between the layers f and h and the memory cells together with word and bit lines the material of the layer g is an electrical insulator having a low relative permeability and is composed for example of silicon dioxide or silicon nitride in further embodiments it is also possible for only the regions b and or c and or d to be composed.

channel clearly as capacity requirements dictate embodiments having higher rate packet interfaces and additional us and ds channels are readily extrapolated from the first illustrative embodiment the mini cmts is compatible with and directly or indirectly supports analog and digital modulated tv signals docsis cable modem services voip based on packetcable or other standards compliance with opencable standards legacy telephony and set top boxes the downstream data received from a regional packet network or other wan via 100 mbps ethernet protocol is presented via the mini cmts 39 s mac to the downstream modulator formatted in 188 bytes mpeg frames which are in turn coded and modulated into a 44 mhz if signal the mpeg stream is compatible with and encapsulates docsis frames the analog return spectrum 5 42 mhz is digitized and selected upstream docsis channels are demodulated and the data extracted the packets are delivered by the docsis mac to the ethernet interface and then transferred optically to the head end or sh via the packet network similarly from the same digitized analog return spectrum 5 42 mhz legacy channels are selected converted and packetized into ethernet frames using either a layer 2 or layer 3 protocol these frames are forwarded to the cable head end by commercially available switches at the head end a master dac controller extracts the bit streams from the ethernet frames and recovers the analog channels fig4 a through 4e illustrate conceptually the process of digitizing a legacy upstream channel fig5 illustrates the layer 2 encapsulation of digitized return channel data fig6 illustrates the layer 3 encapsulation of digitized return channel data this selection of only desired return channels to be forwarded upstream yields a more efficient utilization of us bandwidth fig3 a is a top level.

in each printing stand i a volume difference indicator u03b4v yni is calculated which is equal to the difference between the products of the ink zone settings s yni and the ink strip lengths bi of the previous and subsequent jobs the volume difference indicator u03b4v yni calculated is thus inherently indicative of the actual volume change u03b4v ayni required in each ink zone a u03b4v yni greater than zero indicates that ink must be removed from the inking mechanism for a particular ink zone and a u03b4v yni less than zero indicates that ink must be added similarly a u03b4v yni of zero indicates that no ink volume change is necessary for a particular ink zone all ink zone volume difference indicators u03b4v yni are checked for greater than and less than zero conditions if all ink zone volume difference indicators are substantially zero then adjustment of the ink profile becomes unnecessary if at least one of the ink zone volume difference indicators is greater than zero indicating the required removal of ink from that ink zone then the ink strip length is set to the maximum value bmax of the printing stand if no ink zone volume difference indicators are greater than zero but at least one is less than zero indicating only the addition of ink in at least one ink zone then the ink strip length is set to a value biset derived as discussed below referring now to fig6 b for each ink zone yni appropriate parameters are determined depending upon whether there is to be an addition to a reduction from or no change in the ink volume if there is to be an ink volume reduction the appropriate transition ink zone setting si is determined using an empirically.

the infusion set the infusion set is now applied into the body by the spring force of the pretensioned levers the distance u201c d 2 u201d shown in fig9 a between hammer head and infusion set after release does not have to be defined depending on the curvature of the skin at the application site the infusion set is in contact or not in contact with the hammer after the puncturing procedure the insertion device can be removed from the application site and the application procedure is completed in a further variant not shown in the figures but which can be understood therefrom and from this description the infusion set is not secured on the housing in such a way as to be struck off it by the hammer head and instead the infusion set is attached to the hammer head itself this means that the upper end of the infusion set is brought into connection with the lower end of the hammer head this can be done for example by adhesive bonding frictional engagement or a form fit in some cases the infusion set can be plugged onto or into the hammer head in this case the hammer head can for example have an extension which engages into a corresponding recess in the infusion set for example with an exact fit to hold the infusion set by frictional engagement.

diameter of approximately 2 495 inches and hooks having an outside diameter of 2 672 inches and 2 705 inches for a flexible hose having a 2 5 inch inner diameter in another example the connection device can have the top flange and the bottom section of the middle tubular portion having an outside diameter of approximately 2 995 inches and hooks having an outside diameter of 3 172 inches and 3 205 inches for a flexible hose having a 3 0 inch inner diameter the reference numeral 10 a fig1 16 generally designates another embodiment of the present invention having a second embodiment for the connection device since connection device 10 a is similar to the previously described connection device 10 similar parts appearing in fig1 10 and fig1 16 respectively are represented by the same corresponding reference number except for the suffix u201c a u201d in the numerals of the latter the second embodiment of the connection device 10 a is substantially oval and is configured to be connected to a flexible hose having an oval cross section as well as one with a round cross section compressed to conform to the oval shape of the collar in the illustrated example the connection device 10 a is used to connect an oval flexible hose to the air box as viewed from above see fig1 the connection device 10 a includes two parallel straight sections 100 and a pair of end semi circular sections 102 connected to the straight sections 100 the connection device 10 a includes a bottom flange 18 a a tubular middle wall 20 a and a top flange 22 a the tubular middle wall 20 a is between and connected to the bottom flange 18 a.

controller 12 or portions of the program may be stored within the controller 12 and other portions of the program may be stored in other devices in the disc player 50 in any event when a user loads a disc 1 in the player 50 and pushes a reproduction button on the display manipulation section 13 the system controller 12 initializes the servo section 6 for controlling the focusing servomechanism the tracking servo mechanism the carriage servo mechanism the spindle servo circuit etc in addition the gain of the rf amplifier within the rf gain control section 8 is set to an initial value and a variable t is set to 0 operation s 1 then the system controller 12 instructs the first servo controller 6 a to control the carriage servomechanism and or the tracking servomechanism to move the pickup 3 to an initial position h 1 beneath the lead in area lia of the disc 1 as shown in fig4 operation s 2 subsequently the controller 12 instructs various devices to control the pickup 3 so that it irradiates a laser beam on the lead in area lia of the disc 1 moreover the controller 12 instructs the second servo controller 6 b to control the spindle motor 2 to rotate the disc 1 at a predetermined rotational speed operation s 3 based on the laser beam that reflects.

the first clamping unit being adapted to hold the sheet adjacent an upper edge thereof and the second clamping unit being adapted to hold the sheet adjacent a lower edge thereof the system is used in training exercises for emergency measures personnel who need to be able to break automotive glass to gain entrance to a vehicle application_number US 60471406 A description referring to the drawings there is shown in fig1 the clamping system 10 according to a preferred embodiment of the invention in use on a vehicle 1 the clamping system 10 comprises an upper clamping unit 12 adapted to engage the upper portion of the doorframe 2 of the vehicle 1 and a lower clamping unit 14 adapted to be secured to the outer surface of the door 3 of the vehicle 1 below the lower portion of the window opening the clamping system 10 serves to hold a sheet w of automotive window glass in place over where the original window is located in the vehicle door therefore the glass sheet w can easily be replaced multiple times during training exercises without damaging the original vehicle windows the upper or first clamping unit 12 as shown in fig2 comprises first inner and second outer clamping bars 12 a 12 b which cooperate in order to engage an upper portion w of the sheet w of automotive window glass the first clamping bar 12.

to send water to the drain after a predetermined amount of suds water has been removed from the storage receptacle application_number US 42317582 A description in fig1 a washing machine is generally shown at 10 as having an imperforate tub 12 with a perforate basket 14 and a vertical agitator 16 therein a water supply not shown an electrically driven motor 18 which is operably connected to a pump 20 and controls 22 including a presettable sequential control means for use in selectively operating the washing machine 10 through a programmed sequence of washing rinsing and drying steps there is also shown a wash tub 24 having a first liquid retaining receptacle or holding tank 26 and a second liquid retaining receptacle 28 connected to a drain and further having a suds return valve mechanism 30 secured to the tub 24 within the first liquid retaining receptacle 26 the suds return valve mechanism 30 is shown ih greater detail in fig2 7 the mechanism consists of an exterior housing 31 which is attached to a wall 32 of the wash tub 24 by means of a bracket 33 as seen in fig1 and 5 such that a portion of the housing 31 extends down into the retaining receptacle 26 within the housing 31.

different in diameter the coupling of the invention is manufactured to accommodate such difference and is susceptible to no such pinching the angle of bevel as illustrated in fig1 is advantageously 45 u00b0 but may be any other angle sufficient to prevent the above described pinching presently hubless cast iron soil pipe is used in size ranges of 11 2 34 15 34 in diameter and is produced in lengths of five feet and ten feet fittings are produced in an assortment of over 600 different patterns with fig1 illustrating a fitting 60 which is normally referred to as a 34 reducing 1 4 bend 34 having the required spigot beads 62 housing 40 would also be manufactured in sizes to accommodate these various nominal pipe diameters in the past efforts have been undertaken to develop a coupling for hubless pipes which holds or resists higher internal pressures generally by employing one type of mechanical clamping pressure around the pipe ends to provide the sealing pressure and the clamping force the instant invention is an improvement over prior art pipe couplings of this type and due to its adaptability to existing pipe couplings involves little added expense and provides adaptability to existing installations the two major requirements for sealing and coupling the hubless pipes when exposed to high internal pressures are that the sealing pressure is still.

shorting bars 44 may be deposited along with the heating conductors 36 and bus bars 40 the grid patterns of the present invention may be advantageously installed either in wire form or as deposited enamels or ceramics at several locations to be effective in heating the lower section 32 of the automobile glazing unit 12 and the parking position area of the windshield wiper blades the grid patterns may be placed at the interior surface 20 the exterior surface 26 or they may be preferably disposed within the automotive glazing at the first middle surface 22 the second middle surface 24 or installed directly into the intermediate layer 18 all that is required is that the grid pattern 34 be in thermal contact with an area of an automobile glazing unit it is recognized however that placement of the grid pattern at the interior surface 20 the first middle surface 22 the second middle surface 24 or the interior of the intermediate layer 18 avoids the harmful effects of direct weather conditions associated with mounting the grid pattern to the exterior surface 26 of the automobile glazing unit 12 in a preferred embodiment the heating conductors 36 of grid pattern 36 are shown in cross section in.

the respective openings with the aid of the tip of a pencil or the like the leads 42 and 43 extend from contact panel 37 through apertures in corner walls 23 aperture 28 in wall 27 and circuit board recess 54 and the battery coupler leads extends through an apertures in the battery well bottom wall aperture 28 and recess 54 the procedure for assembling the game is simple and apparent from the above instead of connecting the diode leads directly to terminals a4 and a5 the diode leads can be connected to the output leads of a conventional flasher or oscillating circuit interrupter having input leads connected to the terminals at a4 and a5 this will cause the diode d to flash on and off when a low resistance circuit is completed between a2 and a5 in the application and operation of the improved assembled game device described above a participant marks a selected area of plastic panel 36 in accordance with game plan 48 by means of pencil p and if the area of the applied mark registers with a bridge element 47 the bridge element 47 is depressed and the interface resistance between the bridge element 47 and the bridge connector arms 39 is sharply reduced to sufficiently short the conductor members 38 whereby to apply a signal to the base of transistor t to sharply decrease its output resistance and increase the current flow therethrough to energize and illuminate light emitting diode d to change the game panel 34 may be replaced by other panels carrying other game representations and to.

may be added to the process equipment at either an end or to one of the center stages of the equipment liquid liquid extractions are typically run by any of three routes mixer settler systems liquid liquid extraction tower systems or centrifugal contacters the particular equipment used in this process may be any of several types of mixer settlers any of several types of column configurations or any of several types of centrifugal contacters the separation of the two phases may be conventional gravity settling or by any of several enhanced separators such as enhanced gravity settlers or centrifugal separators in selecting the solvents to be used in any of these systems it is necessary for the solvent pair to have specific properties that allow the separation to be made for commercial interest it is necessary that several additional properties be obtained in the solvent pair thus while some general guidelines do exist for the selection of the solvents in a system involving crude pcnb containing hcb and other impurities these guidelines are at best difficult to apply because these particular compounds have very similar structural properties it is thus quite unexpected that this purification can be accomplished at all with a liquid liquid solvent extraction system in which one of the solvents is a polar solvent and the other is a nonpolar solvent the.

u2218 x u2218 x x x u2218 x xn u2218 x x x x x u2218 x xo d x u2218 u2218 u2218 x x u2218 u2218 u2218 3rd u2218 u2218 u2218 x x x u2218 u2218 u2218 2nd u2218 u2218 x x u2218 x u2218 u2218 u2218 1st u2218 u2218 x x x u2218 u2218 x x______________________________________ in an automatic transmission having the foregoing gear train and hydraulic control circuit the pilot pressure of the c2 duty control valve 11 becomes zero by turning off the duty solenoid valve s2 for c2 in a case where there is a power on downshift kick down from the 3rd range to the 2nd range i e a case where the c2 hydraulic pressure is released and the b1 hydraulic pressure is introduced by way of example as a result the c2 duty control valve 11 is closed and the hydraulic pressure delivered to the clutch c2 becomes zero thereby releasing the clutch c2 at this time the path which transmits the input torque to the output shaft is interrupted and the gear train enters the neutral state consequently unless the hydraulic pressure of brake b1 starts rising at a point where turbine rotation and engine rotation are in synchronism namely at point x in fig3 the engine will rev up and the driver will experience an unpleasant sensation for example if the rise in the b1 hydraulic pressure is delayed by time u03b4t in fig3 engine rev up u03b1 equivalent to an engine speed u03b4n e occurs in fig3 n e represents engine rotational speed and n t denotes turbine rotational speed the latter is expressed by the.

4 illustrate package 10 formed of top laminate 11 and bottom laminate 12 which cooperatively enclose therebetween a plurality of wieners or wiener shaped products 13 laminates 11 and 12 are combined preferably about product 13 to form a continuous edge seal 22 and peripheral flange 24 the laminates are also drawn inwardly about the product to conform to the contour thereof to provide package 10 with improved rigidity for efficient handling as best shown in fig3 bottom laminate 12 is formed out of outer lamina 15 of plasticized polyvinyl chloride which is combined in adhering relationship with middle lamina 16 of ethylene vinyl acetate which is in turn combined in adhering relationship with inner lamina 17 of saran copolymer polyvinylidene chloride top laminate 11 as shown in fig3 and 5 is similarly formed with outer plasticized polyvinyl chloride film 20 and middle saran copolymer lamina 19 and inner ethylene vinyl acetate lamina 18 the saran copolymer has generally crystalline structure with random crystal distribution throughout and provides suitable oxygen barrier properties typically a saran copolymer film having a composition of approximately 85 vinylidene chloride and 15 vinyl chloride provides suitable oxygen barrier properties in accordance with the preferred aspect of the present invention hermetic seal barrier 22 between saran copolymer lamina 17 and ethylene vinyl acetate lamina 18 can be readily separated by peeling back the.

26 the narrowed transition area 34 of the central body 12 allows the wiper springs 20 to deflect when plugs are inserted into the jacks without hitting the central body this also provides clearance for the follower springs 18 and wiper springs 20 to be biased toward the central body the plug can then move the follower springs 18 and wiper springs 20 away from the central body causing firm continuous contact with the wiper springs 20 the posts 16 are cast as one unit with the midsection 14 each post has a conical shape which decreases in diameter slightly from the midsection 14 to the end of each post 16 referring now to fig2 and 5 at the attachment point between the midsection 14 and the post 16 a small depression 36 is cast into the midsection 14 to ensure that the first spring 18 or spacer 52 mounted on the posts 16 will rest flush against the midsection 14 the small depression also relieves any stress that may concentrate at the interface of posts 16 and midsection 14 the posts 16 preferably have a nearly constant diameter over a majority of their length so that components at a higher elevation in the stack will have only slightly more misalignment with respect to the posts than do those closer to the central body 12 some misalignment in a plane parallel to the midsection is tolerable so long as it does not interfere with the functioning of the follower springs 18 and wiper springs 20 when a plug is inserted all wiper springs 20 must of course remain aligned sufficiently to establish a connection with a plug upon insertion in jacks 28 the tip 38.

antiviral activity in the mouse model of genital herpesvirus infection u201d antiviral chemistry amp chemotherapy 10 327 332 this micronized form of cap was incorporated into sponge like materials made from other cellulose derivatives hydroxypropylmethylcellulose u201c hpmc u201d and or methylcellulose u201c mc u201d by foam generating and freeze drying processes surprisingly it was found not only that micronized cap u201c aquateric u201d can be incorporated into solid foams sponges generated from hpmc and or mc but that such sponges were soft mechanically resilient and thus ideally suitable as bio erodible microbicidal vaginal devices even more surprisingly the cap u201c aquateric u201d not only endows the dried sponges with mechanical resilience but upon bioerosion initiated by exposure to water micronized cap u201c aquateric u201d in its original micronized form is released from the sponges and thus fully exerts its antiviral antimicrobial activities thus incorporation of micronized cap u201c aquateric u201d into the sponges provides not only virucidal and microbicidal properties to the sponges as described for micronized cap hereinbefore but most unexpectedly also provided the sponges with highly desirable mechanical properties without the need for any ingredients other than the aforementioned cellulose derivatives the composition of the foams can be altered by varying the concentrations of cap and of hpmc and mc and their respective viscosities in such a way that the final properties of the sponges are most desirable this also depends on the foaming equipment as well as freeze drying the optimal conditions can be easily determined by those of ordinary skill in the art to further scale up the production of the sponges equipment for foaming and freeze drying described in u s pat no 5 863 553 the entire contents of which are hereby incorporated by reference herein or any alternative equipment available.

gate 52 the other input to each of these and gates is from a ram store 54 56 and 58 respectively representing binary image information derived respectively from the vertical slit filter the horizontal slit filter and the reference filter more particularly these ram storage units 54 56 and 58 hold the most recent forty two lines of binary image for each of the three mini field filters involved the output from the comparator circuit 46 enables the appropriate and gate to pass on to the microprocessor the binary value for that pixel pxy from either 1 the image developed through the vertical average filter or 2 the image developed through the horizontal filter or 3 in the default situation where v h the image developed through the reference filter the image ram storage units 54 56 and 58 hold the binary values for each of the three images for the most recent forty two lines of image so as to have available the appropriate binary value for transmission through the or gate 60 to the microprocessor the output from the comparators 32 34 36 are the three video images indicated each image in turn being constituted by a series of binary value pixels the processing applied by the exclusive nor gates 38 40.

the drawing the memory cell for phines like cells has for example a bottom oxide with a thickness ranging from 2 nanometers to 10 nanometers a charge trapping layer with a thickness ranging from 2 nanometers to 10 nanometers and a top oxide with a thickness ranging from 2 nanometers to 15 nanometers in some embodiments the gate comprises a material having a work function greater than the intrinsic work function of n type silicon or greater than about 4 1 ev and preferably greater than about 4 25 ev including for example greater than about 5 ev representative gate materials include p type poly tin pt and other high work function metals and materials other materials having a relatively high work function suitable for embodiments of the technology include metals including but not limited to ru ir ni and co metal alloys including but not limited to ru u2014 ti and ni t metal nitrides and metal oxides including but not limited to ruo2 high work function gate materials result in higher injection barriers for electron tunneling than that of the typical n type polysilicon gate the injection barrier for n type polysilicon gates with silicon dioxide as the top dielectric is around 3 15 ev thus embodiments of the present technology use materials for the gate and for the top dielectric having an injection barrier higher than about 3 15 ev such as higher than about 3 4 ev and preferably higher than about 4 ev for p type polysilicon gates with silicon dioxide top dielectrics the injection barrier is about 4 25 ev and the resulting threshold of a converged cell is reduced about 2 volts relative to.

incorporate ambient absorbed photo luminescent materials the preferred self stick pressure sensitive adhesive layer 14 is applied to the tongue by utilizing a 3 m double stick adhesive tape to permanently adhere the latent adhesive layer 14 to the tongue along with the release strip 15 alternatively a hook or loop side of a hook and loop fastener may be attached along the length of the tongue the mating side of the hook and loop fastener would then be attached to the door edge to install the preferred embodiment of the new draft stopping seal 10 on a door see fig7 and 9 the protective strip 15 is removed as shown in fig6 and the elongate seal 10 is adhered by adhesive strip 14 along the entire horizontal top edge of the door fig9 with the sheath at the intersection of door edge and door face and along the entire vertical edge of the door with the sheath at the vertical side edge of the door and with the sheath easily bending into a 90 u00b0 turn b at the upper corner of the door the seal 10 is self biasing against the frame when the door is closed to bridge and to seal any gaps thereby eliminating drafts which otherwise occur of course if the draft is present only the top edge.

and base plate of the display device the substrate is formulated to be light weight insulative and with a high compressive strength for resisting atmospheric loads placed on the display screen by the reduced pressure in addition the substrate is formulated to be easily etched laser ablated or photochemically machined and assembled as a third member spacer structure application_number US 61892896 A description initially a substrate is formed of an aerogel xerogel or photosensitive material e g photosensitive glass photosensitive aerogel photosensitive xerogel a substrate comprising an aerogel or xerogel material can be formed as a sheet and then patterned and etched using dry etching or laser ablation processes this is shown in fig1 4 a substrate comprising a photosensitive material can be patterned and etched using a photochemical machining process this is shown in fig5 a 5d fig6 shows a substrate constructed in accordance with the invention assembled as used as a spacer in an assembled fed with reference to fig1 a substrate 10 is formed of a sheet of aerogel or xerogel material having a predetermined thickness of 34 t 34 by way of example the thickness 34 t 34 may be on the order of 10 u03bcm to 1000 u03bcm in addition the substrate 10 is formed with a polygonal peripheral configuration having predetermined length 34 l 34 and width 34 w 34.

of existing apparatus application_number US 201113246893 A description fig1 illustrates how the invention in a repeater system 1 or a repeater cascade 1 makes use of frequency transposing repeaters where isolation against echo between repeaters is made redundant by the use of three frequency bands f 1 f 2 f 2 for each information channel possibly each signal direction in use the figure shows in more detail how the invention makes use of a repeater cascade 1 with the help of frequency transposing repeaters 6 8 in combination with repeaters that amplifies within the same channel 7 9 by applying only two frequency bands f 1 and f 2 for on and the same information channel this is achieved in a symmetrical system by repeater 6 frequency shifting from frequency f 1 to f 2 the nest repeater 7 repeats the signal within the same frequency band f 2 the next repeater 8 repeats by frequency shifting to f 1 further on the sequence is repeated starting with the subsequent attenuation 5 and repeater 9 in this way echo for example into one repeater 6 from a different repeater 8 is avoided because the gain in each individual repeater 6 7 8 is substantially lower than the attenuation 3 4 between three.

a fiber the assumptions were as follows calculations were based on ambient conditions in air the load was the pressure drop acting directly towards the fiber the load was uniform over the fiber length there was no fiber overlapping the load was calculated from the applied pressure for example 70 gram force square millimeter 100 psi and the fiber surface area exposed to that pressure from the preceding equations one may derive an expression for calculating u201c stiffness u201d these equations may be applied to fibers of regular or irregular cross sectional shape an example of stiffness calculations for fibers having circular cross sections is given below the deflection is proportional to 1 stiffness and the w and i in eq 1 were kept constant for all the fibers and the stiffness was thus calculated table 1 presents u201c stiffness factors u201d defined as the ratio of the stiffness of a given fiber to the stiffness of a glass fiber gl used in experiments that will be described later in the examples section the glass fibers had a young 39 s modulus of 65 gpa a 20 micron diameter and were 12 mm long the nature of the polypropylene fm nylon nl and crosslinked polyvinyl alcohol r1 and r2 fibers will also be described later in more detail the calculation of the stiffness or stiffness factor for the.

to give the title compound cmr dmso d 6 u03b4 167 6 153 9 136 4 127 1 121 5 119 6 114 1 107 5 51 9 31 3 and 26 5 concentrated hydrochloric acid 425 ml is added to a slurry of 5r methylamino 5 6 dihydro 4h imidazo 4 5 1 ij quinolin 2 1h one maleate vii example 9 850 g in ethanol 7 65 liters the mixture is stirred at 20 25 u00b0 and concentrated while adding additional ethanol the product is isolated by filtration and the cake is washed with ethanol and dried to give the title compound u03b1 25 d u2212 35 u00b0 water uv 206 59400 227 7020 279 5540 282 5570 nmr 400 mhz d 2 o u03b4 7 05 7 09 6 95 6 99 4 73 4 09 4 13 3 96 4 01 3 88 3 93 2 94 3 25 and 2 76 cmr 100 mhz d 2 o u03b4 155 25 126 26 126 08 123 08 120 88 114 27 108 97 52 60 39 72 31 49 and 26 34 a solution of 5r 5 methylamino 5 6 dihydro 4h imidazo 4 5 1 ij quinoline 2 1h one hydrochloride viii example 10 11 0 kg and phosphorous pentasulfide 20 4 kg in pyridine is refluxed until the reaction is complete the reaction is quenched with aqueous potassium hydroxide the solution is vacuum distilled and diluted with water concentrated hydrochloric acid is added to lower the ph to 10 0 10 5 and the solution is extracted with a mixture of n butyl alcohol ethyl acetate 20.

rate of reactants and cofeeds at the operating temperature and pressure of the process are preferably from about 1 to about 250 seconds more preferably from about 1 to about 50 seconds the reaction product of the gas phase catalytic fluorination step will include in addition to the desired hydrofluoropropene unreacted hydrochlorofluoropropene and fluro and chlorofluor substituted propane such as 245cb and 244bb these byproducts can be separated from the desired hydrofluoropropene in a series of two or more separation columns with the by products being recycled to the gas phase catalytic fluorination reaction the tetrachloropropene feedstock of the present invention can be formed via variety of ways as would be know by a person skilled in the art the data presented in the examples was calculated based upon results obtained in comparable reactions with closely related materials uncatalyzed liquid phase fluorination of 1 1 2 3 tetrachloropropene hco 1230xa to 2 chloro 3 3 3 trifluoropropene hcfo 1233xf 0 28 moles of hco 1230xa can be loaded into a 300 ml hastelloy c autoclave equipped with gas inlet valve mechanical stirrer and an outlet cooling tower 3 5 moles of hf gas can be condensed in the autoclave the reaction mixture would be gradually heated up to 120 u00b0 c with continuous stirring for approximately 1 2 hour excessive gas pressure resulted.

is a perspective view of the present system illustrating a single coffer module with a flat ceiling surface panel with square and angled corners and both straight and angled beam wall boards and beam board moldings the result is a coffer shape that provides a 3d relief shape which has a substantially rectangular outline with a v shaped wedge extending from one side of the rectangular outline fig1 is a plan view of the present system illustrating a single coffer module with a flat ceiling surface panel with square and angled corners and both straight and angled beam wall boards and beam board moldings fig1 is a perspective view of the present system illustrating a single coffer module with a flat ceiling surface panel with all angled corners and both straight and angled beam wall boards and beam board moldings as they relate to one another fig1 is a plan view of the present system illustrating a single coffer module with a flat ceiling surface panel with all angled corners and both straight and angled beam wall boards and beam board moldings fig1 is a perspective view of the present system illustrating a single coffer module with a flat ceiling surface panel with both square and radius corners and straight and curved beam wall boards and beam board moldings fig1 is a plan view of the present system illustrating a single coffer module with a flat ceiling surface panel with both square and radius corners and straight and curved beam wall boards and beam board moldings fig1 is a perspective view of the present.

the standard body weight for shipment of 110 kg in 8 months without much difference from pigs fed conventional blended feeds as is clear from fig1 this can dearly be attributed to the effects of the koji mold treatment namely the growth promoting effect of the feed composition according to the present invention furthermore during this time none of the pigs were lost to disease the immune resistance improvement effect of the present feed composition was tested in mice twelve mice were divided into two groups of six the test group was given the fermented garbage feed composition of example 1 without restriction and the control group was given the mixed feed composition indicated below in the test the twelve mice in the test group and the control group were fed the respective feed compositions for 3 days given subcutaneous injections of the sarcoma180 virus then further raised for a period of 14 days and subjected to analysis as is clear from this table the weight of cancer is clearly reduced in the test group as compared with the control group while the weight of the liver does not increase thus confirming that the fermented garbage feed composition of the present invention is not toxic and promotes immune resistance next the results of taste tests of pork from the pigs in the test of example 1 shall be shown below the results of judgments of the odor prior to eating meat color fat color tenderness taste odor after eating and overall preference are shown respectively in.

outwardly to the perimeter thereof it is necessary to utilize a vehicle which is operable on water and maneuverable in sludge and clay therefore a lightweight amphibious vehicle 21 which is floatable upon water is utilized in fig6 the vehicle is shown as including rotary driven hollow pontoons 33 and 34 which support the frame of the vehicle in an elevated position with respect to the water appropriate power means are provided on the vehicle for rotating the drums which drums are provided with fluted surfaces for purposes of creating propulsion through water and clay one such type of vehicle is disclosed in applicants 39 copending application ser no 07 906 446 filed jun 30 1992 entitled amphibious land reclamation vehicle with particular reference to fig6 the lightweight amphibious vehicle 21 carries a high pressure centrifugal pump 26 to which is mounted a discharge line 36 the pump extends downwardly relative to the vehicle and through thin crusted surface areas so that it is located within the clay layer 11 of the settling pond the pump is inserted well within the clay layer to avoid pumping of water in order to allow pumping of the clay a mechanical agitator such as a rotatable blade 37 may be mounted adjacent to the pump which blade is used to mix the pudding consistency clay to a.

104 which gauges are firmly attached to the hinge strips 98 99 by adhesive as can be noted from fig9 the pressure plate 102 has a recess 105 which is arranged on one side of the line 96 and through which a rod 106 extends with clearance the rod 106 is firmly attached to a cylindrical core 107 which is surrounded with clearance by a wire winding 108 the latter terminates in two electrical connections not shown the rod 106 is received at one end with clearance in a bore hole 109 provided in the frame 95 the other end of the rod 106 is mounted with clearance in a bearing 110 which is firmly attached to the plate 93 a pressure plate 111 is also mounted on the rod 106 preferably by pressfitting and thus follows the movements of the rod 106 as can be noted from fig1 a plate 112 is arranged parallel to the plate 93 the two plates 93 and 112 being connected to each other via cylindrical spacers 113 by means of screws 114 as can be noted from the lower part of fig9 the plate 112 extends merely far enough so that the electromagnet 94 is positioned enclosed between the two plates 93 and 112 in accordance with fig1 the pressure plates 102 and 111 are circular each of them having a guide edge 115 which prevents any twisting of the pressure plates 102 and 111 the angularly bent parts 100 and 101 formed on the pressure plate 102 are dimensioned so that the pressure plate 102 can be shifted between the two plates.

olefin can itself act as a solvent for example 1 hexene in which case no other solvent is necessary the concentration of nbr in the reaction mixture is not critical but should be such that the reaction is not hampered if the mixture is too viscous to be stirred efficiently for example preferably the concentration of nbr is in the range of from 1 to 20 by weight more preferably in the range of from 6 to 15 by weight the process of the present invention usually is carried out at a temperature in the range of from 20 to 140 u00b0 c preferably in the range of from 60 to 120 u00b0 c the reaction time will depend upon a number of factors including cement concentration amount of catalyst used and the temperature at which the reaction is performed the metathesis usually is complete within the first two hours under typical conditions the progress of the metathesis reaction may be monitored by standard analytical techniques for example using gpc or solution viscosity whenever referenced throughout the specification the molecular weight distribution of the polymer was determined by gel permeation chromatography gpc using a waters 2690 separation module and a waters 410 differential refractometer running waters millennium software version 3 05 01 samples were dissolved in tetrahydrofuran thf stabilized with 0 025 bht the columns used for the determination were three sequential mixed b gel columns from polymer labs reference standards used were polystyrene standards from american polymer standards corp the mooney viscosity of the rubber was determined using astm test d1646 the nitrile rubber of the present invention is very well suited for the manufacture of a shaped article such.

flanges to one another connecting means 50 may be any means known in the art to connect flanges 54 and adjust the distance between them in fig2 the magnetic field 52 may also be seen it forms a y shape in the middle of conduit 51 and because of the bidirectional nature of the three magnets the generated magnetic fields form a pair of loops about the device this draws the emanated field closer to the device and prevents spreading of the magnetic field very far from the device itself this also serves to strengthen the field that is applied to conduit 51 although the field applied to the conduit is not expressed as a straight line but rather a v shaped field those skilled in the art will appreciate that this is essentially unidirectional those skilled in the art will also appreciate that this design ensures that all of the fluid and all of the regions of the conduit are exposed to a magnetic field of sufficient strength because the externally projecting energy of the magnets is drawn back into the device by exterior opposing poles this field is even stronger fig3 shows a diagrammatic front view of an alternative embodiment of the present invention in this particular embodiment magnets 68 are all aligned in the same direction such that the same poles on each of them face conduit 70 focusing strips are also shown focusing strips 62 are located on sidewalls 64 of casing 66 as can be seen.

exposed to connect to other circuitry fig2 indicates in phantom lines an external circuit board 52 which has signal processing circuitry which may include an amplifier modulator demodulator etc to process electrical currents received from the contact 46 and or to generate electrical currents to deliver to the contact 46 to energize the transducer 40 the particular optoelectric connector is shown as having four optoelectric assemblies 61 64 although one or any number can be used the mating optical fiber connector 14 includes a ferrule 70 in which the cable optical fiber 24 is mounted with the tip 72 of its fiber being even or flush with the tip of the ferrule it would be possible to construct the optoelectric connector 12 so it received the ferrule 70 with the tip 72 of the optical fiber positioned close to the optic face 42 of the transducer 40 however the transducer 40 has a face of much larger width than the width of the optical fiber 24 as a result light from the fiber 24 would not be distributed over a substantial area of the transducer 40 so that only a very weak current would be produced by the transducer for moderate amplitude light in the optical fiber 24 also where the transducer 40 is designed to generate light that is to travel through the fiber 24 very little light generated by the transducer 40 would find its way into the fiber 24 in accordance with the present invention applicant provides an optical fiber stub 80 with an outer stub end 82 that is.