Update README.md
Browse files
README.md
CHANGED
|
@@ -8,6 +8,11 @@ tags:
|
|
| 8 |
---
|
| 9 |
# METAGENE-1
|
| 10 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 11 |
## **Model Overview**
|
| 12 |
**METAGENE-1** is a 7B parameter metagenomic foundation model designed for pandemic monitoring, trained on over 1.5T base pairs of DNA and RNA sequenced from wastewater.
|
| 13 |
|
|
@@ -29,7 +34,7 @@ model = AutoModelForCausalLM.from_pretrained("metagene-ai/METAGENE-1", torch_dty
|
|
| 29 |
# Example input sequence
|
| 30 |
input_sequence = "TCACCGTTCTACAATCCCAAGCTGGAGTCAAGCTCAACAGGGTCTTC"
|
| 31 |
|
| 32 |
-
# Tokenize the input sequence
|
| 33 |
input_tokens = tokenizer.encode(input_sequence, return_tensors="pt", add_special_tokens=False)
|
| 34 |
|
| 35 |
# Generate output from the model
|
|
|
|
| 8 |
---
|
| 9 |
# METAGENE-1
|
| 10 |
|
| 11 |
+
馃搫 [paper](TODO)
|
| 12 |
+
|
| 13 |
+
馃寪 [website](https://metagene.ai/)
|
| 14 |
+
|
| 15 |
+
|
| 16 |
## **Model Overview**
|
| 17 |
**METAGENE-1** is a 7B parameter metagenomic foundation model designed for pandemic monitoring, trained on over 1.5T base pairs of DNA and RNA sequenced from wastewater.
|
| 18 |
|
|
|
|
| 34 |
# Example input sequence
|
| 35 |
input_sequence = "TCACCGTTCTACAATCCCAAGCTGGAGTCAAGCTCAACAGGGTCTTC"
|
| 36 |
|
| 37 |
+
# Tokenize the input sequence and remove the [EOS] token for generation
|
| 38 |
input_tokens = tokenizer.encode(input_sequence, return_tensors="pt", add_special_tokens=False)
|
| 39 |
|
| 40 |
# Generate output from the model
|