diff --git "a/cluster/838.jsonl" "b/cluster/838.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/838.jsonl"
@@ -0,0 +1,39 @@
+{"text": "Gene expression in chloroplasts is controlled primarily through the regulation of translation. This regulation allows coordinate expression between the plastid and nuclear genomes, and is responsive to environmental conditions. Despite common ancestry with bacterial translation, chloroplast translation is more complex and involves positive regulatory mRNA elements and a host of requisite protein translation factors that do not have counterparts in bacteria. Previous proteomic analyses of the chloroplast ribosome identified a significant number of chloroplast-unique ribosomal proteins that expand upon a basic bacterial 70S-like composition. In this study, cryo-electron microscopy and single-particle reconstruction were used to calculate the structure of the chloroplast ribosome to a resolution of 15.5 \u00c5. Chloroplast-unique proteins are visualized as novel structural additions to a basic bacterial ribosome core. These structures are located at optimal positions on the chloroplast ribosome for interaction with mRNAs during translation initiation. Visualization of these chloroplast-unique structures on the ribosome, combined with mRNA cross-linking, allows us to propose a model for translation initiation in chloroplasts in which chloroplast-unique ribosomal proteins interact with plastid-specific translation factors and RNA elements to facilitate regulated translation of chloroplast mRNAs. Translation of mRNA into protein is the main step for the regulation of gene expression in the chloroplast, the photosynthetic organelle of plant cells. Translation is conducted by the ribosome, a large macromolecular machine composed of RNA and protein. Studies have shown that the composition of the chloroplast ribosome is similar to that of bacterial ribosomes, but also that chloroplast ribosomes contain a number of unique proteins. We present the three-dimensional structure of the chloroplast ribosome, as calculated using cryo-electron microscopy and single-particle reconstruction. Chloroplast-unique structures are clearly visible on our ribosome map, and expand upon a basic bacterial ribosome-like core. The role of these chloroplast-unique ribosomal proteins in regulating translation of chloroplast mRNAs, including light-regulated translation, is suggested by the location of these structures on the ribosome. Biochemical data confirm a predicted function in chloroplast translation for some of the unique proteins. Our model for translation in the chloroplast incorporates decades of biochemical and genetic studies with the structure presented here, and should help guide future studies to understand the molecular mechanisms of translation regulation in the chloroplast. Cryo-electron microscopy and single-particle reconstruction were used to calculate the structure of the chloroplast ribosome. Chloroplast-unique proteins are visualized as novel structural additions to a basic bacterial ribosome core. The chloroplast of plants and algae is believed to have originated from the endosymbiosis of an ancient photosynthetic bacteria into a eukaryotic host. Remnants of that ancient bacteria remain in the modern chloroplast, as it maintains a circular genome and transcription and translation machinery similar to that of prokaryotes ,2. ChlorpsbA and atpA), these alone are insufficient to account for the pause sites.Due to the bacterial ancestry of the organelle, translation in the chloroplast has been considered bacterial-type translation, and many of the requisite bacterial-type translation factors can be identified in chloroplasts, although not all of these are exact homologs of the bacterial proteins . TranslaRNA elements identified as regulatory components in the translation of chloroplast messages are primarily located in the 5\u2032 UTR. These elements include Shine-Dalgarno (S-D) sequences, stem-loop structures, and A/U rich elements ,18\u201320. NChlamydomonas reinhardtii, four of which are located on the small subunit of the ribosome. Three other ribosomal proteins, S2, S3, and S5, have large chloroplast-unique domains on otherwise homologous bacterial ribosomal proteins 31]) in thttp://www.rna.ccbb.utexas.edu; C. reinhardtii chloroplast ribosome, nor were genes encoding these proteins identified in the completed C. reinhardtii nuclear genome sequence (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html). There is no known function for either of these proteins on the ribosome -uridine 5\u2032-triphosphate. The entire 91-nt psbA 5\u2032 UTR in its unprocessed form was used in this experiment. UV cross-linking reactions were carried out in the presence of 150 mM Tris-HCl (pH 7.0), 250 mM KCl, 25 mM MgCl2, 25 mM DTT. Reactions were exposed to 2 \u00d7 600 mJ of UV radiation, after which the RNA was digested prior to separation of ribosomal proteins via denaturing SDS-PAGE. Gels were stained with Coomassie Brilliant Blue to visualize protein bands and then exposed to phosphorescent screens to visualize radiolabeled bands.Gel slices were cut from SDS-PAGE gels, and trypsinized peptides were prepared from the gel slices according to . Mass spFigure S1(A) A representative field of view taken using cryoEM shows that a good distribution of particle orientations was obtained on continuous carbon grids. Image was taken at 50,000 \u00d7 magnification; scale bar is as indicated.(B) After an initial round of projection matching, class averages (top image of each column) indicated that particle data were heterogeneous. Reference-free classification and hierarchical clustering were used to identify self-consistent subclasses in particles matching each projection (middle three images in each column). Only subclasses containing particles corresponding to whole, assembled chloroplast ribosomes were allowed to proceed in refinement (center image in each column). Numbers indicate percentage of particles from each shown class that were clustered to each subclass.E. coli 70S ribosome in similar orientations (bottom row). Areas that appear to have additional density on the chloroplast ribosome compared to the bacterial ribosome are circled in black.(C) Images obtained by averaging chloroplast ribosome particles found in identical orientations (top row) are shown for comparison with two-dimensional projection images of an (1.2 MB AI).Click here for additional data file.Figure S2A 0.5 Fourier Shell Correlation cutoff was applied to both the unliganded chloroplast ribosome map (solid line) and the PSRP-7 antibody-bound chloroplast ribosome map (dashed line). The resolutions presented for the structures are 15.5 \u00c5 for the unliganded map, and 19.4 \u00c5 for the antibody-bound map.(239 KB AI).Click here for additional data file.Figure S3E. coli 16S sequence and secondary structure prediction. Secondary structure diagram has been adapted from the Comparative RNA Web Site (http://www.rna.ccbb.utexas.edu).Blue numbering indicates total position along the 16S rRNA. Helices colored in gray are lacking compared to (480 KB AI).Click here for additional data file.Figure S4C. reinhardtii chloroplast . Blue numbering indicates total position along the 23S rRNA. Helices colored in gray are lacking compared to E. coli 23S sequence and secondary structure prediction. Helix in checked box is extended in chloroplast compared to E. coli. Secondary structure diagram has been adapted from the Comparative RNA Web Site (http://www.rna.ccbb.utexas.edu).Green labels mark the individual pieces of the large subunit rRNA in (924 KB AI).Click here for additional data file.Figure S5E. coli ribosome are shown.This shift results in a slight lift of the beak. Head and central protuberance areas of the (A) chloroplast ribosome and (B) (1.7 MB AI).Click here for additional data file.Table S1Bold type indicates proteins with substantial size difference between bacteria and chloroplast; these proteins are discussed further in the text. Grey type indicates proteins that were not identified via proteomics as being a part of the chloroplast ribosome.(20 KB XLS)Click here for additional data file.Table S2See (22 KB XLS)Click here for additional data file.Video S1The large subunit of the ribosome is colored lighter green, and the small subunit is darker green. Chloroplast-unique structures are found on the small subunit of the ribosome. The largest chloroplast-unique structure emerges from the head and neck region, and extends along and above the platform of the small subunit; another makes connections between the beak, head, and shoulder of the small subunit of the ribosome. See text for detailed discussion of structure, and reconstruction and refinement particulars.(5.3 MB MOV)Click here for additional data file.http://www.rcsb.org/pdb/home/home.do) accession numbers for E. coli ribosome proteins discussed in this paper are 1VS7, 1VS8, and 2AVY.The RCSB Protein Data Bank ("}
+{"text": "Over the past decade, we have seen a large explosion of anatomical and functional neuroimaging techniques, allowing exciting investigation of new aspects of the human brain functions with respect tocognition, learning, and memory. These developments have occurred with respectto the machinery (diverse methods of acquisition), themethods for analysis, and the extent of clinical applications. This issue givesrepresentative examples of these three avenues of development.Recent advances in magnetic resonance imaging acquisition techniques have not only focused onfunctional sequences but also on anatomical ones. One important contribution tothis field has been the recent development of diffusion weighted imagingmagnetic resonance (MR) sequences in order to study the quality of white matterconnectivity and importantly perform tractography in order to study for thefirst time anatomical connectivity in the human brain in vivo. Indeed, five articles in the present issue focus onsuch methods. Leh et al. use diffusion tensor imaging (DTI) tractography tostudy cortical and subcortical connectivity of the pulvinar in the living humanbrain. Their results are in accordance with those previously observed inmonkeys and provide further support for an important role of the pulvinar inhuman visual information processing and spatial attention. One difficulty oftenencountered in performing analyses of effective connectivity  of fMRI data isthat one usually has to provide an initial network model to be validated. Thismodel should ideally be based on known anatomical connections between brainregions. However, such information in humans is still incomplete. In theirarticle, Fonteijn et al. present a study that revisits existing functional networks using DTI. The obtainedresults are of great interest for all researchers in the field. Information isprovided about the likelihood of region connections via tractography. For anumber of connections the authors find anatomical connectivity that correspondsto the proposed functional paths. They provide compelling examplesshowing that the use of DTI tractography is a valuable tool to define theanatomical networks required to perform good analysis of effectiveconnectivity. From a more methodological viewpoint, Jbabdi et al. propose a model for thestructure of the brain which considers anatomical connections between variouscerebral regions as being geodesic with respect to a metric given by the inverseof the diffusion tensor. Using this geodesic method, they are able to construct a path connecting every pairof brain regions. However, the brain is obviously not fully connected, andconsequently, they needed to determine whether a given geodesic reallyrepresents a white matter fiber tract or not. This is why they also propose anindex for the probability of being a fiber, which combines a term thatrepresents the data fit and another term that represents the data confidence. Theirnew algorithm is tested on simulated data and proves to be computationally fastas well as robust to local perturbation induced by fiber crossing. They alsouse it on real data to show its feasibility.A new approach in studying diffusivity in the human brain has been the use of high angularresolution diffusion imaging (HARDI) as an alternative to DTI to overcome thelatter method's limitation in complex fiber regions with crossing. Two articlespropose novel methods to make the best use of such acquisition sequences. Probabilisticalgorithms have been preferred to standard streamline techniques because theyare robust to noise in the orientation distribution functions (ODFs) maps and because they can go throughbundle crossings that are likely to happen given the effective resolution ofthe voxels. Perrin et al. develop a new probabilistic algorithm based on the fiber ODF using a Monte Carlo randomwalk algorithm. Monte Carlo particles move inside the continuous field of q-ball diffusion ODF and aresubject to a trajectory regularization scheme. Their new algorithm is tested on simulateddata. Segmentation of white matter and subcortical structures from diffusion weighted magnetic resonance imaging,either DTI or HARDI, is fairly recent. Wassermann et al. use a region-based statistical active contourtechnique on these images of ODFs to find coherent white matter fiber bundlesand a nonlinear spectral-clustering algorithm is presented in order to segmentdifferent fiber bundles.The use of transcranial magnetic stimulation (TMS) has greatly increased during the last five years.While not being an imaging method per se, it does allow to perform \u201cbrainmapping\u201d by studying change in behavior and performance when stimulating aspecific cortical region. In combination with other brain imaging methods suchas Positron emisson tomography or functional MRI, it also allows for the studyof functional connectivity. Finally, it is also being explored as a therapeutictool for patients with neurological and psychiatric disorders. In theirmanuscript, Ko et al. applied rTMS to right dorsolateral prefrontal cortex(DLPFC) and the vertex during different temporal phases of the Wisconsin cardsorting task (WCST), an extensively used neuropsychological task to assessexecutive processes. Performance on the WCST specifically deteriorated whenapplying rTMS to the DLPFC (and not the vertex) when it was applied during thefeedback period (when the participant plans the next response) but not when itwas applied during the matching period (when the response is executed).\u00a0 This selective impairment of the DLPFC is consistent with its proposed role in monitoring events in working memory. Rektorova et al., for their part, investigated whether rTMS can induce beneficial effectson L-Dopa induced dyskinesias in Parkinson\u2019s disease. Their preliminary resultsindicate that rTMS of the DLPFC in these patients does have an improving effecton dyskinesias possibly by inducing a depression of motor cortex excitability,while stimulating the motor cortex directly does not provide the same effect.One issue of great debate regarding blood oxygenated level dependant (BOLD) functional MRI is its relationship to cerebral blood flow and metabolism under different conditions. Previousstudies have suggested that during selective activation of a subset of thezones comprising a columnar system in the visual cortex, perfusion increasesuniformly in all columns in the system, while an increase in oxidativemetabolism occurs predominantly in the activated column. If this were true, onewould expect a disproportionally large BOLD increase compared with blood flow,for a highly localized response in the cortex as opposed to a more diffuse one.To address this issue, Gauthier and Hoge used arterial spin labeling in a groupof young adults while performing a monocular and a binocular task. Theirresults show that the ratio of BOLD to cerebral blood flow effects do notdiffer significantly between the two stimulation conditions, indicatingcomparable coupling between flow and oxidative metabolism in V1, regardless of thecolumnar fraction that was activated.The investigation of the patterns of connectivity in largescale extended brainnetworks in the context of BOLD fMRI is a complex task that has also been thesource of much attention during the last few years. In their article, Perlbarg andMarrelec review the methods used so far, discuss some of the issues that haveto be faced, and propose some avenues for more efficient exploration of suchnetworks. They describe the early correlation approaches that have been used,socalled functional connectivity studies, but point out that the explorationof a whole network would require the successive computations of many functionalconnectivity maps, each map being used for the selection of the seed voxel, whichdoes not prove very realistic. They also advocate that most methods developedso far for effective connectivity have been of restricted use for studyingextended large-scale networks, as their intrinsic complexity prevents them frommodeling systems with that many degrees of freedom. They propose thatmathematical methods coming from graph and/or network theory may be well suitedto deal with such problems, and stress the importance of comparing resultscoming from other imaging modalities to validate and better understand thelarge-scale network approach in fMRI.Multiple methods have been developed recently to perform meta-analysis of functionalneuroimaging data. Many of them have been task dependent. Peiffer et al.propose to extend to BOLD fMRI, a method that has been proposed in the mid-60\u2019sto assess the relationship between response times in young and older adultsacross a variety of tasks called the Brinley plots. In the proposed method, alinear regression is performed over the average BOLD activity map taken overdifferent scanning sessions (while performing different tasks) taken from eachgroup to be compared . This provides arelatively easy method to perform a meta-analysis to evaluate two differentgroups that take into account between-task differences.Finally, on the clinical side, Bernad and Doyon review the role of noninvasive neuroimagingtechniques such as fMRI and TMS in understanding how the neural connections arealtered as a consequence to cerebrovascular injury, the neural mechanisms thatunderlie neurorehabilitation in stroke, as well as motor memory consolidationin healthy adults. They argue that these methods have the potential to be usedas clinical tools to promote and optimize individualized motor recovery instroke patients.Altogether, these papers constitute a representative sample of the state of the art inneuroimaging methodology and we hope they will be of great interest to a largenumber of scientists and clinicians in the field."}
+{"text": "Reconstruction, Analysis and Visualization of Metabolic Networks) Toolbox: a software suite that allows for semi-automated reconstruction of genome-scale models. It makes use of published models and/or the KEGG database, coupled with extensive gap-filling and quality control features. The software suite also contains methods for visualizing simulation results and omics data, as well as a range of methods for performing simulations and analyzing the results. The software is a useful tool for system-wide data analysis in a metabolic context and for streamlined reconstruction of metabolic networks based on protein homology. The RAVEN Toolbox workflow was applied in order to reconstruct a genome-scale metabolic model for the important microbial cell factory Penicillium chrysogenum Wisconsin54-1255. The model was validated in a bibliomic study of in total 440 references, and it comprises 1471 unique biochemical reactions and 1006 ORFs. It was then used to study the roles of ATP and NADPH in the biosynthesis of penicillin, and to identify potential metabolic engineering targets for maximization of penicillin production.We present the RAVEN  are large stoichiometric models of cell metabolism, where the goal is to incorporate every metabolic transformation that an organism can perform. Such models have been extensively used for the study of bacterial metabolism, in particular for metabolic engineering purposes. More recently, the use of GEMs for eukaryotic organisms has become increasingly widespread. Since these models typically involve thousands of metabolic reactions, the reconstruction and validation of them can be a very complex task. We have developed a software suite, RAVEN Toolbox, which aims at automating parts of the reconstruction process in order to allow for faster reconstruction of high-quality GEMs. The software is particularly well suited for reconstruction of models for eukaryotic organisms, due to how it deals with sub-cellular localization of reactions. We used the software for reconstructing a model of the filamentous fungi  Genome sequencing projects have in recent years contributed enormously to our understanding of the metabolic capabilities of cellular systems. Functional annotation of the gene products allow for reconstruction of genome-scale metabolic models (GEMs) that summarize these metabolic capabilities in a consistent and compact way The foundation of a GEM is the functional annotation of the genes. The first GEMs were primarily for model organisms for which direct evidence exists in the literature for a large proportion of the genomically encoded functions Several approaches which also aim at generating GEMs from either a template model or from a general database have been published Saccharomyces cerevisiae, and the resulting GEM was compared with a manually reconstructed model. Thereafter the RAVEN toolbox was used for the reconstruction of a GEM of the industrially important mold Penicillium chrysogenum. The Penicillium genus encompasses species of great economical, medical, and environmental importance Penicillium genus serve important roles in the food industry, both as some of the main spoilers of fresh vegetables and as essential actors in the production of blue cheeses. Most importantly though, they are sources of major antibiotics, particularly penicillin and griseofulvin.The RAVEN Toolbox was evaluated for its ability to reconstruct a GEM for the well studied yeast P. chrysogenum strains have been subjected to 50 years of directed evolution to increase the yields and titers of penicillin, with great cost reduction and productivity gain, but the yields are still far from the theoretical maximum P. chrysogenum could aid in identification of metabolic bottlenecks as well as in elucidating the underlying reason for the significantly better performance of industrial strains compared to low producing strains.The industrial production of \u03b2-lactam antibiotics, such as penicillins and cephalosporins, is one of the success stories of biotechnology. Today the \u03b2-lactams represent one of the largest biotechnological products in terms of value, with sales of about USD 15 billion Reconstruction, Analysis, and Visualization of Metabolic Networks) was developed. The toolbox is a complete environment for reconstruction, analysis, simulation, and visualization of GEMs and runs within MATLAB. The software imports and exports models in two formats: the widely used Systems Biology Markup Language (SBML) format http://www.sysbio.se/BioMet). A software suite named the RAVEN Toolbox (The software has three main foci: 1) automatic reconstruction of GEMs based on protein homology, 2) network analysis, modeling and interpretation of simulation results, 3) visualization of GEMs using pre-drawn metabolic network maps.Previously published GEMs represent a solid basis for metabolic reconstruction of models for new organisms, in particular if the organisms are closely related and therefore share many metabolic capabilities. The main advantage of using existing models compared to reaction databases, such as KEGG or BRENDA The first approach lets the user supply a number of existing GEMs and FASTA files with protein sequences for the template models and for the organism of interest. The software then generates a draft model based on protein orthology. The default implementation uses bi-directional BLASTp http://www.sysbio.se/BioMet). These HMMs are based on the last open version of KEGG. More advanced users can set parameters that affect how genes are mapped to KOs and how general, unbalanced, or otherwise problematic reactions from KEGG should be dealt with.The second approach is also based on protein homology but requires no template models. Instead it relies on the information on protein sequences and on the assigned metabolic reactions that is available in the KEGG database. The method makes use of the KEGG Orthology (KO) IDs, which are manually annotated sets of genes that encode some specified metabolic function. Each KO is associated with a number of metabolic reactions. The aim of the present method is to assign genes to these KOs based on the consensus protein sequence. The tool first downloads all relevant parts of the KEGG database to a local directory and parses these files to generate a GEM representing a metabolic network across all of the species annotated in KEGG, i.e. this would lead to a network comprising 7029 metabolites, 8398 reactions and 843369 genes, when using the most current version of the KEGG database. A GEM for the organism of interest is then constructed by choosing a subset of this larger model and linking the reactions with the corresponding genes. The protein sequences for each KO are retrieved and aligned using MUSCLE The approach proposed above will facilitate and accelerate the generation of a draft metabolic network reconstruction. The automated reconstruction can lead to some loss of control compared to a stricter manual, bottom-up approach. It is therefore important to identify and fill gaps in the model to ensure that the network is functioning as required. In a high quality model all reactions should be able to have a flux if all uptake and excretion reactions are allowed and net synthesis of most metabolites should be possible . The second criterion is important, since the large degree of freedom in GEMs allow for internal loops where reactions can carry flux but where no net consumption or synthesis of metabolites occurs. The RAVEN Toolbox contains a number of methods to support the gap filling process. The following section describes the suggested workflow for gap identification and filling when starting from a draft network.makeSomething and consumeSomething functions identifies such reactions by solving the mixed integer linear programming (MILP) problem of finding the smallest set of reactions which results in the net synthesis or consumption of any metabolite. The solutions can then be cross-referenced to balancing information from getElementalBalance in order to identify reactions which are both active and have wrong/lacking composition. This process can also be done automatically using removeBadRxns.Gap filling traditionally centers on adding reactions in order to enable production of all precursors needed for biomass production. However, it is equally important to ensure that the model cannot produce anything when there is no uptake of metabolites. The reactions which enable this type of behavior are typically those which involve polymers, metabolite pools, or other abstract metabolites but they can also simply be erroneous reactions. A brute force solution would be to exclude all reactions which are not elementally balanced, but this could result in a large fraction of the network being deleted, as many metabolites typically lack information about elemental composition. The canProduce/canConsume can be used to generate a list of the metabolites that can have net synthesis or consumption. Early on in the reconstruction process it is likely that not all biomass precursors can be synthesized. The function checkProduction can be very useful in this situation. It calculates the smallest set of metabolites which must have net synthesis in order to enable net synthesis of all other metabolites. This gives the user information such as \u201cin order to synthesize biomass, you must enable synthesis of valine and coenzyme A\u201d or \u201cif synthesis of choline is enabled, the following set of metabolites could also be synthesized\u201d. The function also allows the user to set rules about merging compartments, since it can be easier to first make sure that the model is functional with merged compartments and deal with transport and sub-cellular localization afterwards.After the user has added relevant exchange reactions haveFlux can be used to identify reactions which cannot carry flux, and also to distinguish between reactions which cannot carry flux because some substrate cannot be synthesized and those which cannot carry flux because some product cannot be further consumed. However, because of the many internal loops in GEMs it is common that reactions can carry flux and appear well-connected even if they are not connected to the rest of the metabolic network. getAllSubGraphs can be used to identify such subnetworks using Tarjan's algorithm Ideally all reactions should be able to carry flux if all relevant exchange reactions are available. The function fillGaps can be used to retrieve reactions from a set of template models or from KEGG in order to generate a functional network. The user can set constraints on their model, such as that it should be able to produce biomass from minimal media, and fillGaps will then solve the MILP problem of including the minimal set of reactions from a set of template models in order to satisfy the constraints. The same function can be used to enable net synthesis of all metabolites or to enable flux through all reactions. This approach is similar to that taken in Model SEED, and enables fully automatic model reconstruction. However, we suggest that GEM reconstruction should be done iteratively and with manual input and that the results from these algorithms are to be viewed as suggestions to point the user in the right direction.The function In eukaryotes the enzymatic reactions are distributed between different organelles. To determine which reactions occur where is a difficult task, and one of the more time-consuming steps in the reconstruction process. The RAVEN Toolbox takes a first step towards speeding up this step by including a method for assigning subcellular localization to enzymatic reactions in an automated fashion. The algorithm aims at assigning localization in a manner that is consistent with signal peptide composition and physiochemical protein properties, while at the same time maintaining a well-connected and functional network. The default predictor is WoLF PSORT, which is distributed with the RAVEN Toolbox The RAVEN Toolbox also contains a number of methods for performing simulations using GEMs. In this aspect it is similar to the COBRA Toolbox Saccharomyces cerevisiae, a model organism for which several GEMs have been constructed. To compare the quality of the automatically generated model to a manually curated one, some kind of reference was needed. As all models contain errors it would not be very relevant to simply compare the similarity between the RAVEN Toolbox generated model and a previously published model. Saccharomyces Genome Database (SGD) was therefore used as a reference with respect to the enzymes present in S. cerevisiae and their subcellular localization. A model was generated from KEGG in a fully automatic manner and then compared to the iIN800 model, a model which has been shown to have excellent simulation capabilities The RAVEN Toolbox pipeline was validated by constructing a model for getKEGGModelForOrganism with the settings to only use eukaryotic genes when training the HMMs, a cutoff of 1e-30 when matching genes to the HMMs, and to exclude reactions labeled as general or incomplete in KEGG. S. cerevisiae genes were excluded in the training of the HMMs to simulate reconstruction of an organism for which there is little previous gene annotation. Not all unbalanced or erroneous reactions were labeled as such, and this resulted in that the KEGG model could produce some metabolites without any uptakes. removeBadRxns identified 79 reactions which enabled such production .The model was generated using tion see . Out of Based on experimental minimal media the model was allowed uptake of glucose, phosphate, sulfate, NH3, oxygen and the essential nutrients 4-aminobenzoate, riboflavin, thiamine, biotin, folate, and nicotinate The resulting model contained 1126 reactions, 1144 metabolites and 713 genes . 521 (73%) of those genes were shared with iIN800. 192 genes were unique to the automatically reconstructed model and 91 genes were unique to the iIN800 model . Given the inputs the model could have net-synthesis of 476 (42%) of the 1144 metabolites .These results show both strengths and weaknesses of using a fully automatic approach to reconstruction. A model capable of producing all the needed building blocks for synthesis of protein, RNA, DNA, and the cell wall was generated solely from a FASTA file and with almost no manual input. The automated gap filling identified 17 new reactions, out of which 8 were not present in the published P. chrysogenum map (see following section for details).Stoichiometric metabolic models have been proven to generate remarkably good predictions when it comes to the central carbon metabolism in microorganisms. However, the lack of kinetic and regulatory information is a rather large simplification and it is possible to get simulation results that have little biological meaning . It is therefore imperative to understand the underlying reasons for a change in predicted phenotype after a perturbation such as a gene deletion. Due to the large dimensionality of GEMs interpretation of flux distributions is a rather daunting task. Visualization of fluxes can aid with interpretation, as well as provide an instant overview of how the system functions. Software that aims at network visualization based purely on connectivity, such as Cytoscape P. chrysogenum genome, sequence alignment analysis was performed. Three fungi from the Aspergillus genus  were selected for sequence comparison based on being closely related fungi outside of the Penicillium genus and on having previously reconstructed GEMs . This result suggests that metabolism of A. oryzae is probably closer related to P. chrysogenum than A. nidulans and A. niger which have less sequence homologues of 576 and 563, respectively. Upon completion of the similarity searching, the results suggest that 1143 genes in P. chrysogenum could be assigned as orthologous metabolic genes from the three Aspergillus species used for comparison. The large number of metabolic orthologues indicates that the existing GEMs for closely related species could be a sound foundation upon which to reconstruct the new model.In order to assign metabolic functions to the genes present in the GEMs see . Table 2P. chrysogenum metabolic network was reconstructed. The metabolic network comprises 1471 unique metabolic reactions in four sub-cellular compartments; extracellular, cytosolic, mitochondrial, and peroxisomal . There are 30 reactions in the model which cannot carry flux if all uptakes are allowed, i.e. dead-end reactions . In general, the reactions that were inferred from A. oryzae but not from A. niger are predominantly involved in co-factor synthesis and in sugar polymer metabolism. The reactions inferred from A. niger iMA871 but not from A. oryzae iWV1314 are mainly involved in lipid metabolism. The key statistics of the reconstructed P. chrysogenum network compared to those of other fungal networks is available in To evaluate the similarity between the reconstructed network and the template networks, the networks were compared with respect to identical reactions and involved metabolites. Only diagrams . The uniATP, and for growth associated maintenance, KxATP, i.e. ATP costs not directly associated with biomass synthesis but associated with cell growth . These parameters were determined by linear regression to glucose-limited chemostat experiments in the presence of phenoxyacetic acid (POA) ATP and 104 mmol ATP/g DW for KxATP. The growth-associated ATP cost is significantly higher than for the template organisms (64 mmol ATP/g DW/h in A. niger iMA871). This could possibly be an effect of the presence of phenoxyacetic acid, which is added to the fermentation medium under industrial penicillin producing conditions. It is believed that phenoxyacetic acid, being a lipophilic weak acid, acts as a proton un-coupler which would manifest itself as a high ATP maintenance cost 0F1-ATPase. This is a small simplification since the number of protons pumped across the mitochondrial membrane might also differ between organisms. This parameter was estimated to 3.75 (3.88 in A. niger iMA871). Growth is described as production of biomass, which in turn is regarded as drain of the macromolecules and building blocks that constitute the cellular components. The demand of each component is estimated based on published data on the biomass composition. The main components and their content within the biomass are listed in P. chrysogenum model. The first case is a study of penicillin yields and in particular the relative importance of ATP and NADPH provision during penicillin production. In the second study we show how the model can be used to integrate fermentation data with transcriptome data using a recently published sampling algorithm to aid in the interpretation of high-throughput data A genome-scale metabolic model is a powerful tool that can be used for exploring the metabolic capabilities of the cell, as well as being used as a scaffold for integrative data analysis. Here we present two case studies to illustrate the use of the reconstructed Penicillin production is associated with an increased requirement of energy in the form of ATP; in the condensation of the three precursor amino acids to form the tripeptide ACV; in the reduction of sulfate; and when a side chain (the precursor molecule which is supplied to the media and which differs depending on the type of penicillin produced) is activated by ligation to coenzyme A. Penicillin production is also associated with a large requirement of NADPH; primarily needed for the reduction of sulfate but also in the biosynthesis of valine and homoserine from \u03b1-ketobutyrate. Elucidating the impact increased ATP requirements have compared to the NADPH requirements is useful when choosing among possible metabolic engineering strategies.Different types of penicillin can be produced by changing the side chain that is supplied to the medium (e.g. supplementation of phenylacetic acid result in penicillin G and supplementation of phenoxyacetic acid result in penicillin V). However, this has no impact on the yield and it is therefore not necessary to specify the type of penicillin being produced for theoretical evaluations. The maximum theoretical yield of penicillin on glucose with sulfate as the sulfur source was calculated to be 0.42 mol penicillin/mol glucose using the reconstructed genome-scale metabolic model. This is in agreement with what has previously been published NADPH and NADH are similar when it comes to energy content, but have different roles in the metabolism, where NADPH serves primarily anabolic roles and NADH primarily catabolic roles. NADPH is mainly produced in the pentose phosphate pathway, which makes NADPH somewhat more energetically expensive to regenerate compared to NADH. In order to investigate the relative importance of NADH and NADPH an artificial reaction was included that allowed for production of NADPH from NADH to simulate a potential increase of the NADPH availability. Simulations were then carried out maximizing first for growth and then for penicillin production. The resulting flux through the artificial reaction was 8.5 times larger when maximizing for penicillin than when maximizing for growth. This demonstrates that the cells will have a much higher NADPH demand at high penicillin yields compared to normal growth conditions. Redirecting a higher flux through the pentose phosphate pathway and/or introducing NADH-dependent versions of NADPH-consuming enzymes could therefore be potential metabolic engineering strategies for achieving higher penicillin yields.For the direct identification of possible metabolic engineering targets a gene deletion analysis was performed by searching for sets of gene deletions that result in an increased yield of penicillin, and which would stoichiometrically couple penicillin production to growth. This was performed using FBA, and combinations of up to three gene deletions were evaluated . The only targets which could be identified were the deletion of any of the genes responsible for breakdown of phenylacetic acid . Deletion of any of these genes resulted in a 21% increase in penicillin production when maximizing for growth.The metabolism of cells is redundant in the sense that different sets of metabolic reactions can be used to generate the same net phenotype. A recently developed method aims at finding potential metabolic engineering targets by identifying genes that are differentially expressed between different cultivation conditions and where the corresponding reactions exhibit significantly changed fluxes for the same conditions A total of 58 fluxes were found to be significantly changed between the high and low production strains (p<0.05) and 612 genes were differentially expressed (p<0.005). Out of those, 36 reactions were identified as having significantly higher flux and up-regulated genes see , i.e. thAs can be seen in P. chrysogenumWe also found that the pathway from \u03b1-ketobutyrate to succinate is identified to have both increased flux and increased gene expression. \u03b1-ketobutyrate is a by-product of cysteine production via the transsulfuration pathway, and it is used for isoleucine biosynthesis. Under normal growth conditions the demand for cysteine is less than that for isoleucine, meaning that all \u03b1-ketobutyrate is converted into isoleucine. However, during high-level penicillin production the cysteine production far exceeds the need for isoleucine, requiring an alternative route for \u03b1-ketobutyrate consumption. This route involves the decarboxylation of \u03b1-ketobutyrate to yield propionyl-CoA, which then goes into the methylcitrate pathway, eventually resulting in succinate S. cerevisiae. The reconstructed model compares well with a manually reconstructed model. This demonstrates that the RAVEN Toolbox is useful for reconstruction of novel models, in particular eukaryotic models, due to its feature for automatic assignment of sub-cellular localization. We used the RAVEN Toolbox to reconstruct a GEM for P. chrysogenum by using three models for closely related fungal species. Extensive manual validation of the model was performed; both to validate the reconstruction method and to ensure a high-quality model. The resulting P. chrysogenum model consists of 1471 reactions, 1235 metabolites and 1006 genes. 440 cited articles provide experimental evidence for the majority of the reactions. Considerable efforts were spent on standardizing and annotating the template models in order to adhere to MIRIAM standards. The standardized template models and the reconstructed P. chrysogenum model are available through the BioMet Toolbox. This collection of fungal models, together with the complementary method of generating metabolic networks based on the KEGG database, constitutes an excellent platform for the reconstruction of metabolic networks for other eukaryotic organisms.The RAVEN Toolbox, a software suite for semi-automated reconstruction and simulation of genome-scale metabolic models was developed. The RAVEN Toolbox is the first software that contains methods both for model reconstruction and for a wide variety of simulation approaches. A visualization feature for simulation results and a feature that allows the user to manipulate metabolic models and set simulation parameters via Microsoft Excel are provided in order to make the software easy to use. The RAVEN Toolbox was evaluated for its ability to reconstruct GEMs by generating a model for P. chrysogenum metabolic network was reconstructed based on a combination of automated reconstruction approaches, manual curation, and an extensive bibliomic survey. The A. nidulans iHD666 A. niger iMA871A. oryzae iWV1314P. chrysogenum model. Efforts were taken in order to standardize the template models to facilitate the automatic reconstruction. This standardization primarily involved metabolite naming, but also how to represent more complex aspects of metabolism such as polymers and lipids. As part of the standardization effort a large majority of the metabolites were assigned database identifiers and chemical structure information. This annotation step allowed for verification that all reactions were elementally balanced, which in turn led to a number of inconsistencies in the template models being corrected. The revised models for the three Aspergillus species are available as up-dates in the BioMet Toolbox (http://www.sysbio.se/BioMet) Three GEMs for other filamentous fungi, P. chrysogenum was then constructed based on bidirectional best hits of BLASTp between the template model proteins and their orthologues in P. chrysogenum using the RAVEN Toolbox. Proteins were regarded as orthologues if E-value <1e-30, identity >40%, sequence coverage (>50%) and alignment length (>200 amino acids).A draft GEM for P. chrysogenum Wisconsin 54-1255  were obtained from the EMBL database (http://www.ebi.ac.uk/embl/). The protein sequences of A. nidulans FGSC A4  were taken from the Broad Institute database (http://www.broadinstitute.org/annotation/genome/aspergillus_group). The protein sequences of A. oryzae RIB40  were taken from the DOGAN database (http://www.bio.nite.go.jp/dogan/project/view/AO). The protein sequences of A. niger ATCC1015  were taken from the JGI database (http://genome.jgi-psf.org/Aspni5/Aspni5.home.html).The protein sequences of P. chrysogenum . Two way ANOVA were employed to evaluate the differentially expressed genes with respect to the strain (DS17690 and Wis 54-1255) with multiple correction following A random sampling algorithm was applied in order to identify transcriptionally regulated metabolic bottlenecks Dataset S1P. chrysogenum in SBML and Excel formats, together with a metabolic map for visualization and a task list for model validation.The iAL1006 genome-scale model of (ZIP)Click here for additional data file.Figure S1Fungi. ALR : >0.50, identity: >0.40. The red shades refer to protein homology that can found within a genome . The green shades refer to protein homology that can found between two genomes (ortholog).Proteome comparison of genomes in (PDF)Click here for additional data file.Figure S2Agreement of model simulations with experimental fermentation data. Data from glucose-limited chemostat with defined medium containing glucose, inorganic salts and phenoxyacetate.(PDF)Click here for additional data file.Table S1removeBadRxns. 72 reactions were unbalanced, general or polymer reactions and were therefore correctly removed. 7 reactions were correct in KEGG, but were removed because they lacked metabolite composition .Reactions which were excluded from the general KEGG model after running (PDF)Click here for additional data file.Table S2S. cerevisiae to a published model of the same organism (iIN800) in terms of included genes. The table shows the genes that are unique to either the automatically reconstructed or the manually reconstructed model, and a classification of the genes into groups that reflect how well suited they are for being included in a GEM. Genes labeled as \u201cenzymatic\u201d should be included, while all other groups should probably be excluded. For iIN800 some enzymatic genes are further classified as \u201cpolymer\u201d, \u201clipid\u201d or \u201cmembrane\u201d. These are parts of metabolism where an automatically generated model from KEGG would have particular drawbacks compared to a manually reconstructed model. \u201cPolymer\u201d corresponds mainly to genes involved in sugar polymer metabolism, which is an area that contains many unbalanced reactions in KEGG. Such reactions were excluded in the validation, so the corresponding genes could not be included. The same is true for \u201clipid\u201d, where the reactions contain many general metabolites, which also results in excluded reactions. \u201cMembrane\u201d corresponds to reactions which depend on any one metabolite in different compartments. This compartmentalization information is absent in KEGG so such a reaction would read, for example, A+B\u200a=\u200a>A+C. \u201cA\u201d here might mean \u201cA(cytosolic)\u201d and \u201cA\u201d, but since that information is missing, the equation becomes incorrect and it is therefore excluded. \u201cSignaling\u201d corresponds to proteins which are primarily involved in signaling, even though they might have an enzymatic capability.Comparison of an automatically reconstructed model for (PDF)Click here for additional data file.Table S3S. cerevisiae model from minimal media . Uptake of the carriers carnitine and acyl-carrier protein was allowed for modeling purposes (many compounds are bound to them and therefore net synthesis of these compounds is not possible without them).Metabolites which could be synthesized in the automatically reconstructed (PDF)Click here for additional data file.Table S4S. cerevisiae model from minimal media after gap-filling. These metabolites were all present in the model before the addition of new reactions.New metabolites which could be synthesized in the automatically reconstructed (PDF)Click here for additional data file.Table S5S. cerevisiae model by fillGaps. Out of the 45 added reactions 17 has evidence to support that they should be included in the model, 9 has inconclusive of missing evidence, and 19 should not have been included in the model.Reactions which were added to the automatically reconstructed (PDF)Click here for additional data file.Table S6predictLocalization (transport cost\u200a=\u200a0.1). The color indicates whether the gene product is mitochondrial in SGD, where green means that it does, yellow that it is unclear, and red that it does not.Genes where their corresponding reactions were localized to the mitochondria after running (PDF)Click here for additional data file.Table S7Reactions which cannot carry flux even when all uptake reactions are unconstrained.(PDF)Click here for additional data file.Table S8Comparison of metabolic models.(PDF)Click here for additional data file.Table S9P. chrysogenum.Biomass composition calculations for (PDF)Click here for additional data file.Table S10Reactions with significantly higher flux in DS17690 compared to Wis 54-1255 where the corresponding genes are also up-regulated. Ranked by significance (p<0.05).(PDF)Click here for additional data file.Table S11Reporter metabolites when comparing the DS17690 and Wis 54-1255 strains. Ranked by significance. Top 40 best scoring metabolites are shown.(PDF)Click here for additional data file."}
+{"text": "A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.Antibodies to both infectious forms of vaccinia virus, the mature virion (MV) and the enveloped virion (EV), as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the  Smallpox was officially declared eradicated by the World Health Organization in 1980, and routine vaccination against smallpox no longer recommended except for select groups  . Thus, tDespite their efficacy as prophylactic vaccines against smallpox, traditional smallpox vaccines, which are strains of live, replicating vaccinia virus, have been associated with some rare but serious adverse reactions in some vaccinees . SomewhaThe safety profile of candidate new smallpox vaccines can be established in the clinic, but in the absence of clinical smallpox, evaluation of efficacy of new-generation smallpox vaccines poses a challenge. Efficacy evaluation will rely heavily on data obtained from appropriate animal models, as well as bridging of preclinical immunogenicity and efficacy data to immunogenicity data obtained in clinical studies . ComplicA33R and B5R genes of vaccinia virus encode the EV A33 and B5 proteins, respectively. Antibodies to each protein inhibit virus spread in cell culture and B5 antibody neutralizes EV infectivity. Further, immune responses to A33 [A33R and B5R genes on vaccine induced immunity and protection, using a virulent vaccinia virus challenge in a mouse model.The s to A33 ,17 and Bs to A33  also elis to A33 . In addis to A33 ,20. TakeMale BALB/cByJ mice (4\u20135 weeks old) were obtained from the Jackson Laboratory, Bar Arbor, Maine. Mice were housed at an animal facility provided by the Center for Biologics Evaluation and Research (CBER). Care and handling of animals were performed according to guidelines provided by the Animal Research Advisory Committee, National Institutes of Health. Mice were fed with sterile feed and drinking water, and were routinely cared for by the Division of Veterinary Services, CBER. The animal study protocol was approved by the CBER Animal Use and Care Committee.BSC-1 cells (ATCC CCL-26), RK-13 cells (ATCC CCL-37), and BSC-40 cells (ATCC CRL-2761) (a derivative of BSC-1) were grown and maintained in Dulbecco\u2019s modified Eagles\u2019s medium (DMEM) containing 10% fetal bovine serum (FBS), and 50 \u00b5g/ml gentamicin. BSC-40 cells were obtained from Dr. Bernard Moss, National Institutes of Health (NIH), and were routinely used to determine vaccinia virus titer.A clonal isolate of vaccinia virus, DV-3, was isolated by plaque purification from the Dryvax virus seed stock described previously . DV-3 wa\u00b0C, an overlay of 2 ml growth medium containing 0.5% carboxymethyl cellulose (CMC) was added to each well, and plates were re-incubated for 2 to 7 days . For crystal violet staining, the CMC overlay was aspirated and a solution of 0.5% crystal violet containing 25% formalin (fixative) was added to each well. After 30 minutes of staining, plates were rinsed with water to reveal plaques.Confluent monolayers of BSC-40 cells in 6-well tissue culture plates were infected with diluted virus suspensions. Control wells were mock-infected with DMEM medium. After 2 hours of incubation at 37 For detection of plaques by immunostaining, cells were rinsed with PBS after the removal of the CMC overlay, and fixed with a cold solution of acetone/methanol (1:1) for 10 minutes. A blocking solution (3% FBS in PBS) was added to wells, and rocked for 1 hour at room temperature. The primary antibody, a rabbit anti-vaccinia antibody  diluted to 1:500 in blocking solution was added, and plates were rocked for additional 1 hour at room temperature. Cells were washed 3 times with PBS, and a secondary antibody, an Alkaline phosphatase-conjugated goat anti-rabbit antibody was added at 1:7,500 dilution. After 1 hour incubation, the plates were washed 3 times with PBS, and the Western blue stabilized substrate for alkaline phosphatase  was added. After 5\u201310 minutes of rocking at room temperature, excess substrate was rinsed off with water. The number of plaques or immunostained foci were counted and virus titer was calculated. Images of crystal violet-stained and immunostained plaque were scanned with HP Scanjet 5590 scanner .B5R (B5Rko), A33R (A33Rko), or both A33R and B5R (A33R/B5Rko) were constructed by homologous recombination, using a gene knockout strategy as previously described [A33R or B5R by PCR were designed based on the published sequence of vaccinia virus strain WR (GenBank accession number NC_006998), and DNA isolated from a plaque-purified clonal isolate of Dryvax, DV-3, was used as the template.Recombinant vaccinia viruses deleted of the escribed . A 788bpescribed . PrimersB5R flanking sequences to amplify an approximately 1.8 kb DNA fragment by PCR. This fragment was cloned into the plasmid pCR2.1  to generate pTRIKOB5. The plasmid was transfected into BSC-1 cells infected with DV-3 using FuGENE  and virus plaques expressing GFP were isolated, and plaque-purified.In constructing B5Rko, the left flanking sequence was generated with coordinates 167859\u2013167886 and the reverse complement of coordinates 168342\u2013168373 as primers, with the latter containing the reverse complement of coordinates 924\u2013944 of pLW44. The right flanking sequence was generated with coordinates 169334\u2013169363 containing coordinates 1690\u20131710 of pLW44 and the reverse complement of coordinates 169843\u2013169869 as primers. The left and right fragments were combined with the GFP fragment amplified from pLW44, and using the outermost primers of the A33R was amplified with coordinates 142420\u2013142444 and the reverse complement of coordinates 143299\u2013143328 as primers, with the latter containing the reverse complement of coordinates 924\u2013944 of pLW44. The right flank was generated using coordinates 145886 - 143910 containing coordinates 1690\u20131710 of pLW44 on the 5 end and the reverse complement of coordinates 144473\u2013144505, as primers. The left and right fragments were combined with the GFP fragment amplified from pLW44, and using the outermost primers of the A33R flanking sequences to amplify a 2.6kb DNA fragment by PCR. This was cloned into the plasmid pCR2.1 to generate pTRIKOA33. Recombinant virus plaque expressing GFP (A33Rko) was generated as described above, and plaque-purified.Recombinant A33Rko was constructed by a similar method as above. The left flanking sequence of NdeI site and the reverse complement of nucleotides 952 to 979 of pT3794 containing a NotI site. The DsRED PCR fragment was cloned into pCR2.1 to obtain pREDleft, a plasmid where the side of the DNA fragment containing the NdeI restriction site was closest to the XbaI restriction site in pCR2.1. A pair of complementary sequences of nucleotide sequences corresponding to the vaccinia virus promoter in pLW44 (nucleotides 942 to 967), and containing NdeI and XbaI overhangs and an AscI site were annealed and ligated with pREDleft that has been linearized with NdeI and XbaI to produce pVVDsRED. This plasmid contains the dsRED monomer under the control of the vaccinia virus promoter used in pLW44. The left flanking sequence of A33R was amplified using the reverse complement of coordinates 144473\u2013144505 containing an XbaI site, and coordinates 143886\u2013143910 containing an AscI site. The PCR product was cloned into pCR2.1 to generate pTAA33Rleft, and sub-cloned as a 620 bp AscI to XbaI fragment into pVVDsRED to generate PVVDsREDA33left. The right flanking sequence of A33R was amplified with a pair of primers corresponding to coordinates 142420\u2013142444 and the reverse complement of coordinates 143299\u2013143328, containing a HindIII and a KpnI site, respectively. The PCR product was cloned into pCR2.1 to generate pTAA33Rright. A 910 bp fragment containing the right flanking sequence of A33R was excised from pTAA33Rleft as a HindIII and KpnI fragment and inserted into PVVDsREDA33left to produce PTRIA33DsRED. The plasmid PTRIA33DsRED was transfected into BSC-1 cells infected with B5Rko using FuGENE, and recombinant virus plaques expressing both DsRED and GFP (A33R/B5Rko) were isolated and plaque purified.The double recombinant virus vA33RB5Rko was constructed by modification of B5Rko. A 690 base pair coding sequences for the DsRED monomer was amplified from pDsRED Monomer (pT3794-5)  by PCR, using nucleotides 289 to 309 of pT3794 (Clonetch Laboratories) containing a The structure of the three recombinant viruses was confirmed by PCR assay using oligonucleotide primers that produced DNA fragments that could distinguish among wild type DV-3, A33Rko, B5Rko, and A33RB5Rko. Titers for A33Rko and B5Rko recombinants were determined by plaque assay on BSC-1 cells using crystal violet staining after 48 hours. The vA33RB5Rko double knockout was titered by plaque assay and plaques were detected by immunostaining.CP77 gene of cowpox virus. The CP77 gene is a host range gene that is fragmented or absent in vaccinia virus strains [CP77 gene locus by PCR were designed based on the published sequence of vaccinia virus strain WR (GenBank accession number NC_006998), and DNA isolated from a VV\u2013WR was used as the template. The left flanking sequence of the fragmented CP77 gene equivalent in VV\u2013WR was generated by PCR using coordinates 11527\u201311562 and the reverse complement of coordinates 12547\u201312573 as primers, with the latter containing nucleotides 235\u2013262 of pCR2.1. Similarly, the right flanking sequence of the CP77 locus was generated using the reverse complement of coordinates13483 -13515 and coordinates12673 -12607 as primers, with the latter containing nucleotides 313 to 341 of pCR2.1. The products from the three PCR were purified and combined as template for the amplification of a fragment that contains sequences of the left flank, luciferase, and the right flank, using a pair of primers from the outermost sequences of the right and left flanking sequences. This fragment contains one contiguous DNA fragment containing regions corresponding to the vaccinia CP77 host range gene interrupted by the luciferase gene under control of the vaccinia early/late promoter. This fragment was recombined with IHD-J-GFP, a vaccinia virus IHD-J strain containing the GFP gene inserted into the site corresponding to the CP77 gene to obtain IHDJ-luc. Similarly, the fragment was recombined with WR-GFP, a vaccinia virus WR strain containing the GFP gene inserted into the site corresponding to the CP77 gene to obtain WR-luc. Virus clones not expressing GFP were isolated, purified, and screened for luciferase expression. IHDJ-luc was further verified by determining the nucleotide sequence of the viral A34R gene to confirm the presence of Glu151 and by observing plaque phenotype under liquid media after infection of BSC-1 cells in monolayers. The virulence of WR-luc and IHDJ-luc was shown to be similar to wild type WR and wild type IHD-J, respectively, by determining their 50% lethal dose (LD50) in mice, using the Reed and Muench method [Recombinant vaccinia viruses strain WR and strain IHD-J expressing the firefly luciferase  were constructed by insertion of the luciferase gene at the locus of the equivalent of the  strains ,27. The  strains , was amph method .3, 104, or 105 pfu) in 2 \u00b5l volume was applied to the inoculation site.Vaccination of mice with vaccinia virus DV-3, recombinant viruses A33Rko, B5Rko, and A33/B5Rko, was performed by tail scarification as previously described . Briefly50) of the challenge virus was suspended in endotoxin-free PBS, and 10 \u00b5l was applied into each nostril . Mice were observed and weighed daily for 10 to 12 days, and those that lost 25% of their original body weight were euthanized in accordance with the animal study protocol. In experiments where mice were challenged with recombinant WR-luc or IHDJ-luc, mice were weighed and in vivo imaging detection of luciferase expression was performed using the IVIS-50 system  as previously described [Vaccinia virus challenge of mice with the Western Reserve (WR) strain and the International Health Department J (IHD-J) strain, or recombinant WR-luc and IHDJ-luc, was performed by intranasal inoculation as previously described . Mice weescribed . Images The detection of vaccinia-specific immunoglobulin G (IgG) against the MV form of vaccinia virus by enzyme-linked immunosorbent assay (ELISA) was performed using inactivated Dryvax as coating antigen for antibody capture. ELISA detection of anti-vaccinia EV A33 and B5 IgG using affinity-purified recombinant vaccinia A33 and B5 proteins ,30. The 5 pfu/ml (~ 300 pfu) of purified vaccinia virus WR was added to 300 \u00b5l of each serum dilution. As a virus control, 3 \u00b5l of 105 pfu/ml virus suspension was added to 300 \u00b5l of medium. The serum/virus mixtures and the virus control were incubated at 37\u00b0C for 1.5 hours, and used to infect confluent monolayers of BSC-40 cells. Cells were infected with 100 \u00b5l per well in duplicate wells per serum dilution, and also with the virus control. A pair of wells (cell control) received un-supplemented DMEM medium. After 2 hours of infection, infection medium was aspirated from all wells, and 1 ml of DMEM medium supplemented with 5% fetal bovine serum, 50 \u00b5g/ml gentamicin, and 0.5% CMC, was added to each well. The cells were incubated for an additional 24 hours, after which they were fixed/stained with crystal violet solution containing formalin. After washing off excess crystal violet stain with water, the number of plaques in each well was counted and the average numbers of plaques were determined. The percent virus neutralization in each dilution of the test serum sample was calculated using the mean plaque count in the virus control as the denominator. The 50% neutralizing titer (NT50) for each test serum sample was computed using the GraphPad Prism 5 software .Serum samples obtained from mice were pooled by treatment group in each experiment and tested for virus neutralization by traditional plaque reduction neutralization test (PRNT) as previously described , with mo8 pfu/mL) was used in the EV neutralization assay in the presence or absence of 1% baby rabbit complement. In a final reaction volume of 300 \u00b5l, each test serum sample was diluted 1:50 in medium, and the 10F5 anti-L1 monoclonal antibody  and rabbit anti-A27 polyclonal antibody  were added to final dilutions of 1:100 and 1:50, respectively. As a virus control, 3 \u00b5l of 105 pfu/ml EV suspension was added to 300 \u00b5l of medium containing the anti-L1 and anti-A27 antibodies. For a second set of EV neutralization in the presence of complement, baby rabbit complement  was added to a final concentration of 1%. Fresh EV was diluted to 105 pfu/ml in DMEM medium, and 3 \u00b5l was added to each reaction. Following incubation at 37 \u00b0C for 1.5 hours, virus/antibody mixtures were used to infect confluent monolayers of BSC-40 cells. Cells were infected with 100 \u00b5l per well in replicate per each serum dilution, and also with the virus control. Control wells received only DMEM medium. Assay plates were incubated for 24 hours, then fixed/stained with crystal violet as described above. The number of plaques in each well was counted, and the percent EV neutralization for each test sample was calculated using the mean plaque count in the virus control as the denominator.Vaccinia virus EV neutralization antibody was quantified as previously described  with modFor analysis of antibody titers in the various treatment groups of mouse immunization experiments, significant differences were analyzed using either an unpaired, two-tailed Student\u2019s t test or a one-way analysis of variance (ANOVA). Fisher\u2019s exact test was used to compare differences in the number of surviving animals in various treatment groups following challenge. In all cases, significant differences between groups were defined as P < 0.05 .A33R, B5R, or both A33R and B5R open reading frames were deleted. Although A33R and B5R single gene knockout vaccinia viruses have been reported previously, we chose to delete these genes in a vaccine-derived strain of vaccinia virus in order to evaluate the contribution of these proteins in an animal model of vaccination. At the time when these studies were initiated, the only available licensed smallpox vaccine in the United States was Dryvax, a non-clonal virus prepared by growth on the skin of calves. To facilitate the generation of gene knockout recombinants, a platform virus was developed by clonal selection after plaquing Dryvax vaccine virus on BSC-1 cells. Individual plaque isolates of Dryvax were characterized in vitro by viral genome analysis and replication in tissue culture, and in vivo for their ability to elicit a protective immune response in mice (A33R); B5Rko (lacking B5R); and A33R/B5Rko (a double knockout lacking both A33R and B5R).To investigate the role and importance of the extracellular envelope proteins A33 and B5 in eliciting protective immunity following vaccination, we used a gene knockout approach to generate vaccinia virus recombinants in which the  in mice . One of B5R gene locus. The recombinants were plaque-purified and stock viruses were prepared from infected BSC-1 cells, and purified on 36% sucrose cushion. In order to verify the deletion of A33R and B5R or both genes from A33Rko, B5Rko and A33R/B5Rko, respectively, we extracted DNA from the recombinant viruses and DV-3, and used internal primers for the A33R and B5R genes in a PCR assay to amplify co-ordinates 12 to 348 (337 base pairs) and co-ordinates 130 to 664 (535 base pairs) of A33R and B5R, respectively. As a control, the entire sequence of the 792 base pairs of the C3L open reading frame was amplified from the three recombinants, and DV-3. The results showed that whereas C3L was amplified from all recombinant viruses and DV-3, and that the A33R and B5R sequences could be amplified from DV-3, the deleted genes could not be amplified from their respective knockout, confirming the absence of A33R from A33Rko, B5R from B5Rko, and the absence of both genes (A33R and B5R) from A33R/B5Rko (data not shown).A33Rko and B5Rko were constructed by homologous recombination of plasmid vectors containing the sequence of the green fluorescent protein (GFP) and flanking sequences of the either target gene with DV-3. The A33R/B5Rko double knockout was constructed by using the A33Rko virus for the insertion of the DsRed gene at the The recombinants were characterized for growth in cell culture. Confluent monolayers of BSC-40 cells were infected with A33Rko, B5Rko, A33/B5Rko or DV-3, and cells were stained with crystal violet after 7 days of incubation in order to detect virus plaques (10) was about 1.5, 1.2, and 2.1 log10 higher than the peak titers for A33Rko, B5Rko, and A33R/B5Rko, respectively.To determine the growth characteristics of the recombinant virus constructs, BSC-40 cell monolayers were infected with DV-3 or with the individual recombinant knockout viruses at a multiplicity of infection of 0.01. Infected cells were harvested after 3, 6, 24, 48, 72, and 96 hours post-infection, lysed, and the virus titer in each lysate was determined by plaque assay with crystal violet staining  or by immunostaining (A33R/B5Rko)  of A33Rko, B5Rko, A33R/B5Rko, or DV-3, or were mock-immunized with diluent (PBS) via tail scarification. Three weeks post immunization, mouse sera were collected and tested for the presence of vaccinia virus-specific IgG by ELISA using inactivated Dryvax as capture antigen. Except for the PBS-treated group that had no detectable vaccinia-specific IgG, antisera from mice immunized with A33Rko, B5Rko, A33R/B5Rko, or DV-3, had measurable levels of IgG , the NT50 were not significantly above those in control sera, likely reflecting the limits of assay sensitivity.Vaccinia MV-neutralizing antibody in the antisera of the different treatment groups was determined by standard plaque-reduction neutralization test (PRNT). Somewhat surprisingly, the levels of neutralizing antibody , both viruses were sufficiently pathogenic in the intranasal challenge model to allow a range of challenge doses to be evaluated. Additional characterization of the 2 challenge viruses revealed that the IHD-J strain exhibited more extensive comet formation in tissue culture using liquid overlay and had a higher relative proportion of released EV to MV virus than WR (data not shown).The effect of deletion of vaccinia virus genes encoding the EV proteins A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus strains WR or IHD-J. Although the neuro-adapted WR strain is commonly used as a challenge virus in mouse models of orthopoxvirus vaccination, the IHD-J strain was of interest because of its ability to produce relatively higher amounts of released EV form of vaccinia virus than the WR strain. Although the LD5 pfu of either DV-3 or any of the EV knockout virus recombinants A33Rko, B5Rko or A33R/B5Rko were protected from a subsequent challenge with 25 LD50 of WR, whereas no mice in the control PBS-immunized group survived this challenge . 3 to 105 pfu and subsequently challenged intranasally with 25 or 100 LD50s of vaccinia virus WR  and 8/10 (DV-3) survived 25 LD50 of WR. At the 100 LD50 challenge dose, 1/5 of mice vaccinated with 104 pfu of A33R/B5Rko and three-fifths of those vaccinated with the same dose of DV-3 survived a 100 LD50 challenge with WR , and thus were pathogenic in mice with the added advantage that virus dissemination could be monitored in vivo in real time. Similar to the IHD-J and WR parent viruses, IHDJ-luc exhibited more extensive comet formation in tissue culture using liquid overlay and had a higher relative proportion of released EV to MV virus than WR-luc. In experiments designed to compare in vivo spread of the 2 luciferase-expressing viruses, IHDJ-luc appeared to disseminate faster than WR-luc following intranasal inoculation (data not shown). Naive mice were inoculated with either 10 LD50 or 100 LD50 of either WR-luc or IHDJ-luc and virus dissemination was recorded by in vivo imaging on days 3 through 7 . Taken together, the results from multiple experiments measuring mortality, morbidity, and virus dissemination indicated that deletion of the A33R and B5R genes appeared to have little effect on the ability of a vaccinia virus vaccine to provide protection against a lethal intranasal challenge in a mouse model.To test the effect of A33R and B5R genes from a vaccinia vaccine virus, and particularly whether the immune response to A33 and/or B5 is required sine qua non for protection against disease.A number of virus antigens and epitopes have been identified as targets for the cellular and humoral immune response against vaccinia virus smallpox vaccine ,37. HoweB5R deletion reduced virulence, were constructed on virus backbones such as WR and IHD-J that are relatively lethal in mice. Since our goal was to evaluate the role of specific EV antigens in vaccine-induced immunity and protection in a mouse challenge model, we chose to make EV gene knockouts in a virus strain more relevant to licensed smallpox vaccines. Toward that end, we isolated cloned viruses from the licensed smallpox vaccine Dryvax and characterized them for growth properties, immunogenicity, and protective capacity, in order to obtain a platform virus that was similar to Dryvax in certain key attributes. A somewhat similar approach was used to derive the second-generation smallpox vaccine ACAM2000 that is currently licensed for production in cell culture [Our approach to evaluating the effect of A33 and B5 on vaccine effectiveness was to construct knockout vaccinia viruses missing either or both of these EV protein-encoding genes. Knockout viruses lacking A33  and B5 ,49 have  culture . Althoug culture , and in A33R and B5R genes, respectively, as well as a third recombinant, A33R/B5Rko, lacking both A33R and B5R. Although we did not directly evaluate the virulence of these EV knockout viruses in animals, it is not likely that the deletions would make them more virulent, especially as they exhibited an attenuated growth in cell culture, as reflected in their smaller plaque phenotypes (A33Rko and B5Rko) or inability to form visible plaques (A33R/B5Rko). These knockout viruses are the focus of the immunization and protection studies described in this report. However, we also generated A34R and A56R knockout viruses in DV-3 (data not shown). We observed that recombinant vaccinia viruses deleted of the A33R or B5R genes displayed relatively small plaque sizes compared to the parent virus, as did the A34Rko but not the A56Rko (data not shown), consistent with previous reports [A33R or B5R resulted in reduction in virus replication, the deletion of both A33R and B5R genes results in an even more dramatic decrease in total virus yield in cell culture.A panel of DV-3 knockout viruses with deletions in individual EV genes were constructed for evaluating the contributions of EV proteins to the protective response elicited by vaccination. Viruses included A33Rko and B5Rko, which lacked the  reports -49,51. O5 pfu of virus. Analysis of serum samples obtained three weeks after mice had been vaccinated with 105 pfu of either DV-3 or the EV knockout viruses revealed that all animals sero-converted and contained high levels of vaccinia-specific IgG as measured by ELISA using whole vaccinia virus as antigen, although the mean IgG titer in mice that were vaccinated with the parent virus DV-3 was significantly higher than those of the A33Rko or A33R/B5Rko groups . Thus, subsequent protection and challenge experiments focused on an extensive comparison of the A33R/B5Rko double knockout with DV-3, using a range of immunization doses and challenge doses of 25 to 100 LDProtection in this animal model was conferred by A33R/B5Rko in spite of impaired replication, as evidenced by reduced virus titers in cell culture but also in the reduced total vaccinia antibody response following vaccination, and the absence of an EV neutralizing antibody response in vivo. Regardless, it is still not clear whether these results can be extrapolated to conclude that an EV antibody response is not needed for an effective smallpox vaccine. As noted above, our experiments do not distinguish between an EV antibody response and a cell-mediated response to EV antigens. Further, there is likely a redundancy in the protective immune response, including both humoral and cellular immune responses, that could preclude the requirement for any individual vaccine antigens. Finally, there also remains the very real possibility that limitations inherent in the animal models used for preclinical vaccine evaluation do not faithfully predict the efficacy of candidate vaccines against smallpox in humans. Evaluation of the protective effect of the recombinant vaccine viruses generated in this study in other animal models of orthopoxvirus challenge may be informative. Nevertheless, in the absence of smallpox, and with good smallpox animal models not available nor practical, major challenges remain for the efficacy evaluation of new-generation smallpox vaccines that cannot be bridged to previous vaccines used successfully against smallpox.Figure S1Characterization of Dryvax plaque isolates.6 pfu of Dryvax and Dryvax clones 3, 4, and 5, subcutaneously. Serum samples were obtained at 3 weeks after inoculation and total vaccinia-specific IgG determined by ELISA.Individual plaque clones of Dryvax were isolated, characterized, and compared to non-clonal Dryvax vaccine virus. (A) Viral DNA was isolated from BSC-1 cells infected with Dryvax and each of\u00a06 Dryvax clones, digested with\u00a0HindIII and analyzed by agarose gel electrophoresis. (B) BSC-1 cells were infected with Dryvax and Dryvax clones 3, 4, and 5 at a multiplicity of 0.01. Virus yield at 6, 24, and 48 hours was determined by plaque assay. (C) Groups of 5 mice were infected with 10(TIF)Click here for additional data file."}
+{"text": "The present study sought to explain why bilingual speakers are disadvantaged relative to monolingual speakers when it comes to speech understanding in noise. Exemplar models of the mental lexicon hold that each encounter with a word leaves a memory trace in long-term memory. Words that we encounter frequently will be associated with richer phonetic representations in memory and therefore recognized faster and more accurately than less frequently encountered words. Because bilinguals are exposed to each of their languages less often than monolinguals by virtue of speaking two languages, they encounter all words less frequently and may therefore have poorer phonetic representations of all words compared to monolinguals. In the present study, vocabulary size was taken as an estimate for language exposure and the prediction was made that both vocabulary size and word frequency would be associated with recognition accuracy for words presented in noise. Forty-eight early Spanish\u2013English bilingual and 53 monolingual English young adults were tested on speech understanding in noise (SUN) ability, English oral verbal ability, verbal working memory (WM), and auditory attention. Results showed that, as a group, monolinguals recognized significantly more words than bilinguals. However, this effect was attenuated by language proficiency; higher proficiency was associated with higher accuracy on the SUN test in both groups. This suggests that greater language exposure is associated with better SUN. Word frequency modulated recognition accuracy and the difference between groups was largest for low frequency words, suggesting that the bilinguals\u2019 insufficient exposure to these words hampered recognition. The effect of WM was not significant, likely because of its large shared variance with language proficiency. The effect of auditory attention was small but significant. These results are discussed within the Ease of Language Understanding model , which p Spoken language comprehension is a complex process that entails encoding an acoustic signal, matching it to the right phonological representation stored in long-term memory (LTM) out of thousands of such representations, and finally retrieving the semantic information associated with the phonological information and integrate it with the preceding information. Yet understanding spoken language under optimal listening conditions is usually a seemingly effortless process. Only when it comes to listening to speech under suboptimal conditions do we become conscious of this process and individual differences in people\u2019s ability to understand speech become obvious. This is especially true in a second language, as many second language speakers can attest to and has also been shown in many studies (for a review see The ease of language understanding (ELU) model  providesThe degree of similarity between the acoustic signal and an internal phonological representation determines the amount of processing that is needed for lexical access to be successful. When the match is optimal, processing is automatic and effortless. The greater the mismatch, the greater is the need for explicit processing of the signal. This explicit processing loop is dependent on WM resources. Thus, according to the model, individual differences in SUN can be attributable to two sources, individual differences in WM capacity and individual differences in the quality of speaker-internal phonological representations of words in LTM.buk and puk) sound less similar, presumably because variability directs infants\u2019 attention to the relevant dimension that distinguishes the minimal pairs  than others. These assumptions are similar to the lexical quality hypothesis developed by While occurrence counts in large corpora of language can give us an idea of the relative quality of representations of words in memory (the less frequent a word the less precise its representation), it is more difficult to estimate the overall language experience of individuals. Different means of data collection are possible such as asking participants to keep a diary of daily interactions for a week or similar techniques. However, these measures are based on self-report and do not capture language experience over longer periods of time. In this paper, the assumption is made that vocabulary knowledge, and more precisely productive vocabulary knowledge, closely resembles language experience and thus the quality of phonological representations. Individuals who are able to recall infrequent words must have been exposed to these words more often than someone who is not able to recall low frequency words. Someone with a weaker phonological representation of a word may be able to recall the first sound or a similar sounding word but lexical retrieval may not be successful. This phenomenon is usually referred to as a tip-of-the-tongue state in the literature . A seconAs mentioned before, in the ELU there are two sources for speaker-internal individual differences in SUN. One source is the quality of internal phonological representations, as described above. The other source is differences in WM capacity. When mismatches between the acoustic signal and phonological representations occur, speech processing relies more on explicit processes, which presumably are more susceptible to individual differences in processing resources than implicit processes. Examples of such explicit processes include \u201cinference making, semantic integration, switching of attention, storing of information, and inhibiting irrelevant information\u201d , p. 3. ISeveral studies have established a correlation between tests of verbal WM, typically assessed through the reading-span test see , and perOther executive functions next to WM may be recruited during SUN. When individuals follow a conversation in background noise, they have to selectively attend to one speaker and ignore other sounds or speakers e.g., . In addiThe purpose of the present study was to find individual differences that would predict SUN. Based on the ELU model, it was hypothesized that language experience, measured through vocabulary knowledge, verbal WM, and auditory attention would predict SUN. It was further hypothesized that differences between monolingual and bilingual participants would mostly be attributable to differences in language experience. To test this hypothesis, word frequency of to be recognized words was manipulated.1. In addition, participants had to be between 18 and 35 years old. Six additional monolinguals and five additional bilinguals were tested but they were not included in the final sample because they did not meet the definition of monolingual (5), early bilingual (4), or were too old (1) or too young (1) to be included in the study. Detailed participant information can be seen in Table 1. The study was approved by the local Institutional Review Board and all subjects gave their written informed consent to participate.The study included 53 monolingual and 48 bilingual participants. The inclusion criteria for monolinguals were that they did not learn a second language before the age of 10. Some monolinguals had learned a second language in foreign language classes in school but they were not fluent in their second language and had not spent more than a short vacation in a non-English speaking country. Bilinguals had to have learned Spanish from birth and English before the age of 8Participants\u2019 background information was collected with a questionnaire created for this study, administered by the experimenter. The instrument was loosely based on coast could be preceded by Ms. Brown might consider the coast (low predictability) or by The boat sailed along the coast (high predictability). The original SPIN recordings were obtained on CD from the Department of Speech and Hearing Science from the University of Illinois Urbana-Champaign. The sound file was edited so that each sentence was saved in a separate file. For the background babble, a short sequence from the original babble track  was chosen and mixed with each sentence in Praat  and the mean frequency per million was 15.92 (SD = 16.46). Information about phonotactic probability came from r = 0.16 and the correlation between log-frequency and neighborhood density was r = 0.16.In the present study, 128 sentences from the test were chosen and divided into four lists of 32 wordsEach participant heard the first half at 3 dB SNR and the second half at -2 dB. Within each SNR, half of all words were played in a predictive context and the other half in an unpredictive context in a randomized order. Across all participants, each word was administered in all four conditions in a Latin-square design. After each sentence, the participant was prompted to type the last word of the sentence. The next trial started when a participant pressed ENTER. Before the actual experiment, 10 sentences were administered at a SNR of 8 dB to ensure that participants had understood the task. Participants were also told to check the word they typed on the screen for any spelling errors before going to the next trial. This test was administered in Eprime 2.0 .3. The NIH toolbox is a collection of different tests in the areas of cognition, emotion, motor function, and sensation. All tests are available freely and are administered online. In the WM test, participants see pictures and their labels and hear their names. The set-size differs from two to seven pictures. Pictures are either animals or food items. After each set of pictures, participants are asked to repeat what they just saw in size order from smallest to biggest. For example, if they saw a bear, a duck, and an elephant, they would say duck, bear, and elephant. To establish the size order, participants have to pay attention to the size of the object on the screen but in most cases, the relative proportions on the screen corresponded to real life. The test has two parts. In the first part, sets consist only of animals or only of food items. In the second part, sets consist of animals and food and participants are asked to repeat the food first from smallest to biggest and then the animals from smallest to biggest. Both parts start with two practice sets to ensure that participants understood the directions. If they make a mistake in either practice set, the instructions are repeated and the set is administered again. After the practice items, the test starts with a set size of two. If a participant correctly repeats all pictures, the set size of the next trial increases by one. If the participant makes an error, another set of the same size but different items is administered. Testing stops when a participant cannot correctly repeat two sets in a row or when the last set is administered. Responses were recorded on a paper sheet and a score for each participant was calculated by counting the total number of items of all correctly repeated sets. Thus the total score for each part is 27 (2+3+4+5+6+7) and the total possible score is 54. This test was only administered in English.The WM test used for this study comes from the US National Health Institute\u2019s (NIH) so called Toolboxr = 0.57) and tests of executive function (r = 0.43 -0.58). The correlation with a test of receptive vocabulary, on the other hand, was low (r = 0.24).Recently, the reliability of the test was established . The tesW-scores are not corrected for participant age at testing.Verbal ability was assessed with the Woodcock-Mu\u00f1oz Language Survey \u2013 Revised WMLS-R; , which iIn is to out as down is to \u2026? Scores from both tests can be combined into a single score with the provided software, which the test developers call Oral Language Ability . This score correlates highly with the cluster score that is based on all tests of the WMLS-R (r = 0.9). The standard error of the mean for all tests is between 5.55 and 5.93 and the internal consistency reliability coefficients were around r11 = 0.9 , wrong letter when the correct letter was adjacent to it on the keyboard and the resulting word was not a word in English , when a letter was missing and the resulting word was not a word in English, or when the answer was a homophone of the target word, regardless of whether the typed word was a real English word . In total, 286 (2.2%) instances were corrected in this way, which is comparable to 2.5% in lme4 package  were recognized with higher accuracy than words in high noise , and words in a predictive context  better than words in an unpredictive context . The difference between a low and a highly predictive context was 28.2% when noise was high and 20.5% when noise was low and this interaction was significant . Monolinguals recognized words more accurately  than bilinguals . When noise was low, the difference between monolinguals and bilinguals was smaller [M\u0394 = 7.1 percentage points (pp)] than when noise was high (M\u0394 = 10.9 pp) but this interaction did not reach significance . The effect of predictability was only slightly larger for monolinguals (M\u0394 = 24.8 pp) than bilinguals (M\u0394 = 23.8 pp). Nevertheless, the interaction between predictability and language group was significant . As can be seen in Figure 1, this interaction was likely caused by the fact that monolinguals benefitted more from a predictive context compared to bilinguals when noise was high. In the high noise condition, the benefit for monolinguals was M\u0394 = 31.06 pp and M\u0394 = 24.87 pp for bilinguals. The main effect of frequency was significant , showing that high frequency words were recognized with greater accuracy than low frequency words. The interaction between frequency and language group was also significant . Figure 2 suggests that this interaction was driven by the steeper slope of the frequency effect in the bilingual group compared to the monolingual group.First a model was run with four predictor variables to analyze group-level effects, language group , predictability (low/high), noise level (low/high), and word frequency . The results showed that words in low noise  = 0.527, p < 0.001] and WM and processing speed were moderately correlated . Processing speed and verbal ability were not correlated .The following variables were added to the analysis to investigate the effect of individual differences: verbal ability, WM, and processing speed. All continuous variables were centered around the mean. The mean values for each variable can be seen in A model was built with the same variables as above, that is, language group, word frequency, noise level, and predictability, plus the individual difference variables. Besides the main effects, only the significant interactions are reported here. The full model can be seen in the Supplementary Materials.2 > 10, ps < 0.001). Furthermore, main effects of verbal ability  and processing speed  were significant, showing that higher verbal ability and faster processing speed (lower RTs) were associated with higher accuracy on the SUN test. This can be seen in Figures 3 and 4 respectively. The interaction between verbal ability and predictability was significant . As Figure 3 shows, participants with higher verbal ability benefitted more from a predictive context compared to those with lower verbal ability. The interaction between word frequency and verbal ability was also significant . This interaction can best be interpreted using Figure 5. The difference in accuracy between listeners with high and low verbal ability was most pronounced for low frequency words. WM was not a significant predictor of SUN accuracy , likely because of its high correlation with verbal ability . These analyses show that verbal ability was a powerful predictor of SUN accuracy. Expressed as a odds-ratio, compared to someone with average verbal ability, someone with verbal ability 1 SD above the mean was 2.14 times more likely to recognize a target word. Compared to verbal ability, the effect of processing speed was much smaller. Compared to someone with mean processing speed, someone 1 SD below the mean was 1.09 times more likely to recognize a target word.The main effects of language group, noise level, and predictability were highly significant as before  but the interaction with frequency was no longer significant (both \u03c72 < 1). The main effect of frequency was significant in the bilingual group  but not in the monolingual group . Furthermore, the effect of processing speed did not reach significance in either group . This may have been due to insufficient power in these smaller samples.To check whether the effect of verbal ability was true for both groups or was simply driven by group differences, follow-up analyses were run for each group separately. The main effect of verbal ability and the interaction with predictability were highly significant in both groups . A t-test confirmed that the difference in vocabulary scores between these subgroups was not significantly different . The mean group difference in SUN accuracy in this subsample was M\u0394 = 5.1 pp, which is smaller than in the total sample (M\u0394 = 9.0 pp). Yet this difference was still statistically significant . The interaction between word frequency and language group was not significant  but Figure 6 suggests that it was especially the low frequency words that were more difficult for bilinguals. Also the language group by predictability interaction was still significant in this subsample , suggesting that differences in language proficiency alone cannot explain this interaction.The analyses so far suggest that verbal ability had an effect on SUN in both the monolingual and the bilingual group. Yet, even when verbal ability was controlled for, language group was still a significant predictor. To investigate further what the added difficulty for bilinguals might be, two subgroups were formed from each group, respectively, that were closely matched on their vocabulary scoreThe results confirmed previous studies by showing that noise had a disruptive effect on speech understanding whereas a predictive context was facilitative. The effect of a predictive context was stronger when noise was high compared to when it was low and monolinguals benefitted more from a predictive context than bilinguals. Word frequency had an effect on recognition accuracy, high frequency words were recognized with greater accuracy than low frequency words. However, in follow-up analyses, this effect was only marginally significant in the monolingual group, while it remained significant in the bilingual group. Next, an analysis of the effect of individual differences in verbal ability, WM, and attention was conducted. The effect of verbal ability was highly significant in both groups, as was the interaction between verbal ability and predictive context, showing that individuals with higher verbal ability recognized more words in general and also benefitted more from a predictive context. The effect of WM was not significant, likely because of its shared variance with verbal ability. The effect of processing speed was significant when both groups were analyzed together but did not reach significance when each group was analyzed separately. Finally, two subsamples from each group that were matched on their vocabulary scores were compared. This analysis showed that group differences were reduced when subjects were matched on verbal ability but the differences were still statistically significant, suggesting that differences in verbal ability cannot completely explain the bilingual disadvantage in SUN.As in previous studies e.g., , the bilbilingual disadvantage and which factors contribute to it but also to find possible explanations for this disadvantage. In this respect, an improvement to previous research was that monolingual and bilingual participants were tested with the same standardized language test. A standardized test is not only important to make results comparable across studies but also to be able to compare the samples of monolinguals and bilinguals within a study. This is important to note because the present study found that verbal ability was associated with SUN in both groups. Since bilinguals often have a smaller vocabulary in each of their languages compared to monolinguals , although the interaction between group and frequency did not reach significance. In this respect it is interesting that the size of the frequency effect changed as a function of proficiency. The effect was most pronounced for participants at the lower end of the proficiency range. In the matched subsamples, however, the proficiency range was smaller and this may be why the interaction was no longer significant.Both explanations for individual differences in SUN, verbal ability and word frequency, are related because both depend on language experience. Someone who is exposed to language in many different contexts is more likely to learn the meaning of more words compared to someone with more limited exposure and, at the same time, they will encounter words of lower frequency more often. How, then, can we explain that the two subsamples that were matched on verbal ability still performed significantly different on the SUN test? It may be that for the bilinguals, vocabulary knowledge overestimated their actual exposure to English. Even though they knew the meaning of a less common word, they may not have encountered that word as often as a monolingual speaker. Also, assuming that a bilingual speaker hears English in school and Spanish outside of school, they will hear each language not only less often but also from a more limited number of speakers. These may be factors that determine the quality of phonological representations  and thusWhile the present hypothesis for the bilingual disadvantage was based on exemplar models, the data do not necessarily contradict the predictions of models that assume an abstract level of representation of words. For example, TRACE  assumes mouse, pig, and banana that all participants were likely very familiar with. It was therefore surprising that the test correlated highly with the language test (r = 0.5). Exemplar-based models can explain this finding because they assume that not only one representation is activated at the time of encoding but all exemplars of a word. If a word is represented by many exemplars then it is more likely that a memory trace is still active in LTM at the time of retrieval. Related to this explanation is also the finding that items stored in WM are not independent from LTM representations  but also in the age of acquisition (AoA) of the tested language and socio-economic status . In the present study, additional tests showed that neither variable was a significant predictor of SUN once language proficiency was accounted for but these results may be different in a sample where AoA and SES are not correlated with verbal ability.The purpose of the present study was to find factors that would explain individual differences in SUN between listeners, especially between monolingual and bilingual listeners. Previous research had established that bilinguals often performed below monolinguals on SUN tests, even when the bilinguals had learned the second language early in life. The present study confirmed these results but the general conclusion was that differences between groups could largely be explained by frequency effects, which suggests that differences between groups are less categorical than might be assumed based on previous research. Based on the ELU model , it was The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Receptor activator of nuclear factor-kappa B ligand (RANKL) appears to bean osteoclast-activating factor, bearing an important role in the pathogenesis of multiplemyeloma. Some studies demonstrated that U-266 myeloma cell line and primary myelomacells expressed RANK and RANKL. It had been reported that the expression of myeloidand monocytoid markers was increased by co-culturing myeloma cells with hematopoieticstem cells (HSCs). This study also attempted to show the molecular mechanism of RANKand RANKL on differentiation capability of human cord blood HSC to osteoclast, as wellas expression of calcitonin receptor (CTR) on cord blood HSC surface.+ hematopoietic stem cells wereisolated from umbilical cord blood and cultured in the presence of macrophage colony-stimulating factor (M-CSF) and RANKL. Osteoclast differentiation was characterized by usingtartrate-resistant acid phosphatase (TRAP) staining, giemsa staining, immunophenotyping,and reverse transcription-polymerase chain reaction (RT-PCR) assay for specific genes. In this experimental study, CD133CTR mRNA showed TRAP reaction was positive in some differentiated cells, including osteoclast cells. Hematopoietic stem cells expressed RANK before and after differentiation intoosteoclast. Compared to control group, flow cytometric results showed an increasedexpression of RANK after differentiation. Expression of Presence of RANKL and M-CSF in bone marrow could induce HSCsdifferentiation into osteoclast. Remodelling procedure of bone is composedof resorption and formation of this organ .MesenchCTSK), tartrate-resistant acid phosphatase (TRAP) and calcitonin receptor (CTR) genes are regulated during osteoclastogenesis -also known as osteoclastogenesis inhibitory factor (OCIF)or tumor necrosis factor receptor superfamily member 11B (TNFRSF11B), RANKL, and RANK systems was suggested as an another mechanism for activation of osteoclasts and finally bone destruction . OPG is ogenesis . Evidences show that large amount of TRAP is presented in osteoclasts. Thus, activity of this protein is considered as an established marker for identification of osteoclasts . RANK and RANKL mRNA. In co-culture myeloma cells with HSCs, it was also determined that expression of myeloid and monocytoid markers were increased  and centrifuged in 400g for 30 minutes at 22\u02daC. To remove the platelets, the cell pellet was centrifuged at 200 g for 10 minutes at 22\u02daC. Then, the pellet was resuspended in 500 \u03bcL of phosphate buffered saline . 50 \u03bcL of FcR blocking reagent  was added, mixed well and incubated at 2-8\u02daC for 10 minutes. Afterwards, 50 \u03bcL of CD133 microbeads  were added to the cells and incubated for 30 minutes at 4\u02daC. The Cells were centrifuged at 300 g for 5 minutes. The supernatant was aspirated and the cells were re-suspended in 500 \u03bcL of PBS. The cell suspension was added to a positive selection column. Column was washed with PBS. The column was removed from the magnetic separator and placed on a suitable collection tube. Enough amount of buffer was pipetted onto the column. After that, the magnetically labeled cells were flush outed by tightly pushing the plunger into the column. In this experimental study, CD133+ cells were plated at a density of 7\u00d7104cells/well in 24-well plates. They were seeded in triplicateinto four groups: control compared to treated groupsby M-CSF, RANKL and M-CSF plus RANKL. Thecells were cultured in 1mL of Iscove\u2019s Modified Dulbecco\u2019s Medium  containing 2 mML-glutamine , 100 U/mL penicillin, 100 \u00b5g/mL streptomycin  and 5% heat-inactivatedfetal bovine serum . The cellsin each well were separately treated by 30 ng/mL ofM-CSF , 50 ng/mL ofsoluble human RANKL  and both of them. Also, culturedCD133+ cells in medium containing 5% FBS wereused as control group. The cultures were incubated at37\u02daC in a humidified atmosphere of 5% CO2 for 21days. The medium was exchanged every 48 hours by demi-depletion.The immunophenotyping was performed todetect the expression of CD133 and RANKwithin different days.CD133For cell surface markers detection, phycoerythrin (PE)-conjugated anti-CD133  and PE-conjugated anti-RANK  were used. The procedure of staining was done according to the manufacturer\u2019s instructions. PE-conjugated mouse IgG1 isotype control antibody  was used for each sample -as a negative controlto block nonspecific binding sites. After labelling, all samples were analyzed by a flow cytometer  in Royan Institute . The results were analyzed by using flowjo7.6.1 software . + cells before (day 0)and after differentiation (day 21) were done by acid phosphatase kit  according to the manufacturer\u2019s instruction. During differentiation, CD133+ cells became fusiform adherent cells from day 3. These cells were detached by incubation with trypsin  at 37\u02daC for 15 minutes. Cytospins of slides were prepared and stained by TRAP and Giemsa staining. For TRAP staining, after fixation in leucognost fixing mixture, the cells were stained by freshly prepared TRAP staining solution . TRAP staining of CD133For Giemsa staining, cytospins of slides were immersed by putting a few drops of methanol on them and fixed in the liquid for 10 minutes. Afterwards, the slide was immersed in a freshly prepared Giemsa staining solution for 45 minutes, then rinsed with distilled water and was left to dry. Staining slides were subjected to take photo under microscope  attached with a digital camera (SONY DSC-w7). + cells before and after differentiation in control and treated groups using RNeasy Mini Kit  based on the manufacturer\u2019s guideline. Single strand complementary DNAs (cDNAs) were synthesized with reverse transcription . Primers which were used by reverse transcriptase polymerase chain reaction (RT-PCR) technique for detection of human RANK, human CTR and hypoxanthine-guanine phosphoribosyl transferase (HPRT1) as internal control, were shown in the Table 1. The cDNAs were amplified using a mastercycler gradient eppendorf PCR system  in a mastercycler gradient eppendorf PCR system for 33 cycles. Total RNA was isolated from CD133PCR was accomplished with the following program: 5 minutes of initial denaturation at 95\u02daC, 1 minute of denaturation at 94\u02daC, followed by the cycles comprised of annealing for 1 minute at 57\u02daC, extension for 2 minutes at 72\u02daC, terminated by a final extension incubation at 72\u02daC for 10 minutes. Data were represented as the mean \u00b1 SD. Data analysis was performed using Kruskal-Wallis test. A P<0.005 was considered statistically significant. All statistical analysis was implemented with SPSS software, version 11.0 . After the completion of consent form by the pregnant women, three samples of full term human umbilical cord blood were kindly provided by permission from the Iranian Blood Transfusion Organization. 3CD133+ cell/mLwas plated in 24-well plates on the third day anddivided into four groups. Within differentiation ofCD133+ cells, these cells were counted and viabilitywas simultaneously evaluated on days 0, 7, 14 and21 by using methylene blue staining  on day 14 of the culture . + and RANK+,respectively.After14daysofdif-ferentiation, RANK+cellsincontrolaswellasM-CSF, RANKL and M-CSF plus sRANKL treated groups were 10.63, 19.68, 18.16 and 38.80%, respectively (At the first day of cell isolation (before differentiation), flow cytometric results demonstrated that 93.37 and 2.74% of the cells were CD133ectively . RANK gene in CD133+ HSCswas examined by RNA extraction and RT-PCR.Before differentiation, RANK mRNA expressionwas detected in CD133+ HSCs. Results showedthat cultured CD133+ cells on days 7 and 21 of thedifferentiation expressed RANK at mRNA level incontrol and each of RANKL, M-CSF and RANKLplus M-CSF treated groups (Expression of d groups . + cells on the first day of isolation (before differentiation) do not express CTR gene at mRNA level, however it was detected after 21 days of differentiation in control and treated groups by RANKL, M-CSF and RANKL plus M-CSF  showed that 5.4% of the mouse BM cellsare RANK+.We also found that CD133+ cells, on day 0,and TRAP-positive cells after differentiation onday 21. It is suggested that variation of cytoplasmic TRAP staining in the control and the treatedgroups by RANKL or M-CSF could highlight different stages of cell maturity. TRAP is known to bean inducible enzyme, whose expression is relatedto cell growth and differentiation (Staining results indicated TRAP-negative cellsbefore differentiation of CD133ntiation .+cells (+ cells werenot determined when these cells were only treatedby M-CSF (Miyamato and colleagues determined whenosteoclast precursor cells derived from mouseBM were cultured in the presence of M-CSFplus RANKL or M-CSF, they generated TRAP+cells . On the by M-CSF .+ cells in the treated groups, we determined the respective cells in the control group. Faustand colleagues showed that cultured human PBMCin aMEM+10% FBS without the addition of stromalcells, growth factors or cytokines led to TRAP+ cellswith low levels of TRAP expression (As previously indicated, in addition to the presence of TRAPpression .Presence of RANKL and M-CSF in bone marrow could induce osteoclast differentiation from HSCs. Our findings indicated that RANK and RANKL lead to the deregulation of bone remodelling, increment of osteoclast activity and bone destruction in myeloma patients with bone disease. in vitro instead of using invasive technique to obtain BM. Therefore, we propose to determine the boneresorbing capacity of the differentiated cells by pit formation assay for monitoring novel drugs. If these cells are capable to create bone resorption cavity, we can use cord blood sample to generate osteoclasts"}
+{"text": "In ADPKD patients total kidney volume (TKV) measurement using MRI is performed to predict rate of disease progression. Historically T1 weighted images (T1) were used, but the methodology of T2 weighted imaging (T2) has evolved. We compared the performance of both sequences.40 ADPKD patients underwent an abdominal MRI at baseline and follow-up. TKV was measured by manual tracing with Analyze Direct 11.0 software. Three readers established intra- and interreader coefficients of variation (CV). T1 and T2 measured kidney volumes and growth rates were compared with ICC and Bland\u2013Altman analyses.2. CVs were low and comparable for T2 and T1 . TKV was clinically similar, but statistically significantly different between T2 and T1: 1867 [1172\u20132721] vs. 1932 [1180\u20132551]\u00a0mL, respectively (P\u00a0=\u00a00.006), with a bias of only 0.8% and high agreement (ICC 0.997). Percentage kidney growth during 2.2\u00a0\u00b1\u00a00.3\u00a0years was similar for T2 and T1 , with a bias of 1.5% and high agreement (ICC 0.843). T2 was more often of sufficient quality for volume measurement .Participants were 49.7\u00a0\u00b1\u00a07.0\u00a0years of age, 55.0% female, with estimated GFR of 50.1\u00a0\u00b1\u00a011.5\u00a0mL/min/1.73\u00a0mIn patients with ADPKD, measurement of kidney volume and growth rate performs similarly when using T2 compared to T1 weighted images, although T2 performs better on secondary outcome parameters; they are more often of sufficient quality for volume measurement and result in slightly lower intra- and interreader variability.The online version of this article (doi:10.1007/s00261-017-1285-2) contains supplementary material, which is available to authorized users. Autosomal Dominant Polycystic Kidney Disease (ADPKD) is the most common hereditary renal disease, with a prevalence of 3\u20134 per 10,000 in the general population . The disMonitoring glomerular filtration rate to assess disease severity and progression in ADPKD has limitations, because GFR can remain within the normal range for prolonged periods of time, despite nephron loss, due to hyperfiltration of residual nephrons . MeasureHistorically, gadolinium enhanced T1 weighted images were used for the measurement of TKV because of the short scanning time, low variations in image quality and high contrast of the renal structures against the surrounding tissues . In patiWe compared the performance of using T2 and T1 weighted MR images for the measurement of kidney volume and growth in patients with ADPKD, and tested the hypothesis that the use of T2 might be preferred over T1 weighted images.2 were included between 2012 and 2015 at the University Medical Centers of Groningen (UMCG), Leiden (LUMC), Nijmegen (Radboud UMC) and Rotterdam (Erasmus MC), all in the Netherlands. Details of the study protocol have been published elsewhere  in case of non-normal distribution.In a test set of 12 patients kidney volumes were measured twice by three readers. This test set was used to assess the intra- and interreader reliability. Three MR images per MRI scanner were selected. Kidney volumes ranged from approximately 670 to 4000\u00a0mL. The intra- and interreader reliability for the left, right, and total kidney volume were assessed using the intraclass correlation coefficient (ICC). Reproducibility was evaluated by assessing intra- and interreader coefficient of variability (CV). Intrareader CV was calculated per MR image for each of the readers as the standard deviation of the two TKV values divided by the mean TKV multiplied by 100%. Interreader CV was calculated for each of the 12 MR images as the standard deviation of TKV values assessed by all three readers divided by the mean TKV of that image multiplied by 100%. As subgroup analysis intra- and interreader CVs were calculated for the different MRI scanners separately and for quartiles of T1 breath-hold trigger time.To investigate whether the TKV results obtained with T1 and T2 weighted images correlate, orthogonal regression analysis was performed, and the ICC was calculated using all MR images of our cohort. Agreement between T1 and T2 measurements was evaluated by Bland\u2013Altman analyses, where bias and precision are defined as mean difference and SD of the mean difference. Subsequently, serial MR images of 40 patients were used to determine whether both methods can accurately detect changes in TKV. Correlation between changes in TKV measured using T1 and T2 weighted images was assessed similarly using orthogonal regression analysis, calculation of ICC, and Bland\u2013Altman analyses. Follow-up scans were preferably performed on the same MRI scanner as at baseline, and TKV was measured using the same series of images as at baseline. As sensitivity analyses we tested whether differences in kidney volumes  and growth rate  between T1 and T2 were dependent on the type of MRI scanner, T1 breath-hold trigger time, or on height-adjusted total liver volume, according to the polycystic liver disease (PLD) classification .\u03b1 of 0.05). Third, we analyzed the percentage of MR images that was deemed sufficient for TKV measurement. Fourth, we compared the duration of TKV measurement using T2 and T1 weighted images.To assess the consequences of using T2 instead of T1 weighted images, four analyses were performed. First, the effect on classification according to Mayo height-adjusted TKV\u00a0(htTKV) risk class , and secT test. A one sample T test was used when analyzing percentage difference of volumes measured on T2 compared to T1 weighted images, taking the volumes on T1 weighted images as 100%. For testing between more than two groups, a Kruskal\u2013Wallis test was used for non-parametric data and an ANOVA for parametric data with Bonferroni correction. A \u03c72 test was used for differences between proportions. All analyses were performed with SPSS, version 22.0 (SPSS Inc). P\u00a0<\u00a00.05 was considered to be statistically significant.Differences in paired non-parametric data were tested with a Wilcoxon signed-rank test and in paired parametric data with a paired 2. The mean systolic and diastolic blood pressure values were 135\u00a0\u00b1\u00a013 and 83\u00a0\u00b1\u00a09\u00a0mmHg, respectively. Of all patients 97.5% used antihypertensive medication of which 87.5% used a RAAS blocker. Patients had a follow-up of 2.2\u00a0\u00b1\u00a00.3\u00a0years.Of the 40 included patients, 55.0% was female and the average age was 49.7\u00a0\u00b1\u00a07.0\u00a0years. Estimated GFR was 50.1\u00a0\u00b1\u00a011.5\u00a0mL/min/1.73\u00a0mP\u00a0=\u00a00.1 and P\u00a0=\u00a00.5, respectively) nor for T2  weighted images. No significant differences in intra- or interreader CVs were observed between the different MRI scanners or according to T1 breath-hold trigger time for the left, right, or total kidney volume (Supplementary Tables\u00a01 and 6).The intra- and interreader reliability for both the T1 and T2 weighted images were high, with ICCs ranging from 0.997 to 1.000. Although the intra- and interreader CVs of both T1 and T2 weighted images were comparable for TKV, the intra- and interreader CVs for the separate kidneys were significantly lower for T2 , without systematic under- or overestimation, with a bias and precision of \u22121.5 and 5.6% , the percentage of T1 and of T2 weighted images that was deemed suitable for TKV measurement was 71.1% and 86.7%, respectively (P\u00a0<\u00a00.001). The remaining MR images were not suitable for volume measurement, because the quality of the images was insufficient. Sensitivity analysis showed that the results were not different across the various MRI scanners (Supplementary Table\u00a05). The time needed to assess TKV was on average 41.6\u00a0\u00b1\u00a013.0\u00a0min for a T1 weighted scan and 44.8\u00a0\u00b1\u00a016.4\u00a0min for a T2 weighted scan (P\u00a0=\u00a00.09).Of all baseline MR images of the DIPAK-1 study participants  and compartments filled with water  appear hypointense, whereas the opposite is true for T2 weighted images. As a consequence T2 weighted images have a higher soft-tissue contrast and hyperintense renal cysts that help to delineate the kidney boundaries against background tissue more easily . Of noteWe found however, that T1 weighted images resulted in statistically significant smaller kidney volumes. Nonetheless, volumes were clinically similar with a mean difference between volumes of less than one percent, which is less than the interreader CV and therefore of low clinical relevance. This assumption was confirmed when assessing the consequences for risk classification using the Mayo htTKV classification; only 15% of patients was reclassified using the kidney volumes observed on T1 vs. T2 measurements. In addition, no systemic over- or under-classification was observed. When looking in detail at the differences in TKV assessed on T1 vs. T2 weighted images, we found that the smaller T1 TKV was driven by the right kidney volume. This led us to hypothesize that the liver might have caused difficulties in distinguishing kidney from liver tissue. To corroborate our hypothesis, we therefore performed a sensitivity analysis according to the PLD classification . HoweverThe performance of T1 and T2 weighted images in assessing percentage kidney growth was similar. However, when calculating the number of patients needed for clinical trials that test novel renoprotective agents and change in TKV as endpoint, fewer patients were needed when using T2 instead of T1 weighted images. Moreover, when analyzing the percentage of T1 and T2 weighted MR images that were deemed suitable for volume measurement, we found that T1 weighted images were more often rejected because the quality of the images was insufficient to reliably delineate the kidney borders for volume measurement. In clinical practice this would result in making an extra MRI, with an increase in costs and patient burden as a result. This could form a rationale to only scan T2 weighted images for the assessment of kidney volume, which would save scanning time. Lastly, although TKV growth rates were similar when using T1 or T2 weighted images, one should consider using the same sequence for follow-up within one patient, to reduce measurement variations introduced using two different sequences in one patient.Our study has the limitation that it was performed in a relatively small number of patients. However, this number of patients has previously shown to be sufficient to detect differences in total kidney volume measurement techniques in ADPKD . Second,Strengths of our study are that we had follow-up data available, enabling us to compare change in TKV, which is one of the most important parameters for disease progression in patients with ADPKD. In addition, we had three readers measuring TKV to assess intra- and interreader variability, and multiple parameters were available to assess feasibility of the two techniques, such as duration of assessment and approval rates of T1 and T2 weighted images.In conclusion, we found that kidney volumes and kidney volume growth rates assessed on T2 and T1 weighted images were comparable. These findings show that T2 weighted images can be used, but are not superior to T1 weighted images for kidney volume measurement in patients with ADPKD. Differences between T2 and T1 were small, and likely not clinically relevant although on secondary outcome parameters T2 had minor advantages over T1 weighted images.Supplementary material 1 (PDF 22 kb)Supplementary material 2 (PDF 90 kb)Supplementary material 3 (PDF 72 kb)Supplementary material 4 (PDF 26 kb)Supplementary material 5 (PDF 12 kb)Supplementary material 6 (PDF 93 kb)Supplementary material 7 (PDF 161 kb)Below is the link to the electronic supplementary material."}
+{"text": "It was just a few short years ago that we celebrated the Centennial of my Dad\u2019s birth. That was in 2013 and it is now a little over 50 years since my Dad died at his desk just before being sworn in as a Member of Congress for his 14th term. A lot has happened since then.My father was born on March 23, 1913, the third of six children. He grew up in a town called Harmony in the northern part of Rhode Island. He had planned to enroll at the College of the Holy Cross, but the Great Depression changed that. Rather, he joined his older brother and father in bricklaying, a profession that prepared him very well for the arduous work that awaited him in the U.S. House of Representatives. He went from being the president of the local Bricklayer\u2019s Union, No. 1 in 1939 to being elected to represent the Second District of Rhode Island in 1940.\u201c\u2026 just like Paul of Tarsus was suddenly transformed on the road to Damascus, John Fogarty was transformed on the road to Bethesda\u2026John believed that one ounce of prevention was worth a pound of cure; in other words 1 billion for medical research might save 16 billion in medical care.\u201dIn 1947 he was appointed to the House Appropriations Committee to serve on the Subcommittee on Labor, Health, Education and Welfare, where he would become the Committee\u2019s youngest chairman in 1949. R.I. State Historian Laureate Patrick Conley said:\u201cAs we limit the span of uncertainty in the cause of death and illness and extend and enrich the span of life, we act in the highest ideal of government in the service of the governed, and in the best tradition of public, private, and individual enterprise.\u201dAnd, my Dad never looked back. He truly believed that \u201cno man is an island\u201d and that collaborating with colleagues at home and abroad brought the best minds together to attack the pestilence, war, famine, and death that still plague millions of people around the world today. He said, \u201cAs long as people are sick, something has to be done to make them better. The government has to give most of the help because there\u2019s no one else to give it.\u201d He was called a \u201chealth zealot\u201d by some and took that as a compliment. As a result of his untiring dedication to better health he would become known as Mr. Public Health:I think it is safe to say that we all know someone who has benefited from the work that my father and his Congressional colleagues did to further medical research and to build the premier national biomedical research facility\u2014the National Institutes of Health (NIH). During his 26 years in Congress he expanded funding for the NIH from $28.5 million in 1949 to $1.1 billion at the time of his death in 1967 at the age of 53. It is very important to note that my father did not do this alone. My Dad had the good fortune to have his dear friend Mel Laird from Wisconsin as his Ranking Minority Member. Together, they shaped public health policy and routinely increased funding for medical research, often beyond what their Presidents and fellow lawmakers thought was sufficient. According to my Dad, \u201cThere are no politics in this committee because these departments affect every human being in our country.\u201d And on the Senate side they had Lister Hill of Alabama, who along with my Dad sponsored the Hill-Fogarty \u201cHealth for Peace\u201d bill, opening up further opportunities for the support of research and training on an international basis.\u201cI have always recognized\u2026that just as disease knows no national boundaries so also the benefits of medical research and indeed research itself can know no boundaries. Time and time again, it has been demonstrated that the goal of better health has the capacity to demolish geographic and political boundaries and to enter the hearts and minds of men, women, and children in the four corners of the earth.\u201dMy Dad argued that increasing federal support for medical research reduced human suffering and was an \u201ceconomical investment in life\u2026Research is the only means we have for reducing the growing federal burden of medical care costs.\u201d In the midst of the Korean War and the intensifying Cold War he knew this research would benefit our country\u2019s defense by increasing the number of healthy people who could serve in our military. He also stressed the importance of being able to combat bacteriological warfare and address treatment in the field from injuries caused by new weaponry, all of which would contribute directly to our national security. Increased medical research had similar benefits for our economy: healthier workers and reduced disabilities. These outcomes would in turn contribute to peace in the world. We would also benefit economically if people of other nations were healthier because U.S. trade would increase and we would not have to send so much money in aid to other countries. He saw early on the need to work with all nations to curb the transmission of disease, a point that was painfully brought home by the Ebola outbreaks of recent memory. He truly knew the importance of global health, stating:It was difficult to believe that in 1962 my Dad was talking about a world that had shriveled in size, with the most distant places only hours apart. My father, indeed, had a prescient vision of how important global health was and would be. As far as global health is concerned, the genie is out of the bottle; the world is smaller today and continues to shrink. Global health has never been more vital than it is today and its importance will only increase. The NIH, the preeminent medical research facility in the world, must have a substantial organization dedicated to global health. This is the Fogarty International Center, which supports basic, clinical, and applied research and training for U.S. and foreign investigators working in the developing world. The Center serves as a bridge between the NIH and the greater global health community. Since its establishment in 1968 through legislation introduced by Melvin Laird right after my Dad\u2019s death, nearly 6,000 scientists worldwide have received significant research training through Fogarty programs that benefit people here at home and around the world.\u201cI think that this matter of expanding research is one \u2013 perhaps the one \u2013 truly global effort in which all nations can and will join as real partners.\u201dMy Dad was a delegate to World Health Organization meetings for many years and firmly believed that major investments in health around the world could and would lead to peace. I agree, as he stated:I recently had the good fortune to meet with Representative Tom Cole , the Chairman of my father\u2019s subcommittee, and found him to have the same philosophy and concern for global health as my father. Chairman Cole would rather \u201cfight Ebola in West Africa than in West Dallas\u201d \u2013 so would my Dad."}
+{"text": "Somatostatin (SOM) is an active substance which most commonly occurs in endocrine cells, as well as in the central and peripheral nervous system. One of the parts of the nervous system where the presence of SOM has been confirmed is the enteric nervous system (ENS), located in the wall of the gastrointestinal (GI) tract. It regulates most of the functions of the stomach and intestine and it is characterized by complex organization and a high degree of independence from the central nervous system. SOM has been described in the ENS of numerous mammal species and its main functions in the GI tract are connected with the inhibition of the intestinal motility and secretory activity. Moreover, SOM participates in sensory and pain stimuli conduction, modulation of the release of other neuronal factors, and regulation of blood flow in the intestinal vessels. This peptide is also involved in the pathological processes in the GI tract and is known as an anti-inflammatory agent. This paper, which focuses primarily on the distribution of SOM in the ENS and extrinsic intestinal innervation in various mammalian species, is a review of studies concerning this issue published from 1973 to the present. Somatostatin (SOM) was isolated for the first time from the ovine hypothalamus in 1973 as a factor which inhibits growth hormone release . SOM is The ENS is a part of the autonomic innervation of internal organs. It is localized in the wall of the GI tract from the oesophagus to the rectum. Since the ENS is characterized by complex organization, a high number of nervous structures and a high level of independence from the central nervous system, it is often called \u201cthe second brain\u201d or \u201cthe intestinal brain\u201d ,8,9. TheThe enteric neurons are grouped in the intramural ganglia, which are connected to each other by a dense network of nerve fibres. The number and exact localization of these ganglia clearly depend on the mammalian species and the segment of the GI tract . In smalIn large mammals , the ENS in the oesophagus and stomach is similar to rodents and consists of the myenteric plexus and separate submucous ganglia ,12. The Instead, in the small and large intestine of large mammals, apart from the myenteric plexus located (like in rodents) between longitudinal and circular muscle layers, two types of submucous plexuses C can be The enteric neurons are very different in terms of morphological properties, functions and electrophysiological characteristics, but the greatest differentiation of them concerns the neurochemical characterization, i.e., the abilities of particular neuronal cells to synthesize various active substances. Previous studies have described that enteric neurons may synthesize several dozen active factors, which act as neuromediators and/or neuromodulators, intracellular transporters and enzymes. The most important of them (apart from acetylcholine\u2013the main neuromediator within the ENS) include, among others, vasoactive intestinal polypeptide (VIP), galanin (GAL), nitric oxide, substance P (SP), calcitonin gene-related peptide (CGRP) and serotonin ,9,10,15.To date, the presence of SOM has been described in the ENS in various mammal species, including humans ,17,18,19Soon after the first description of SOM in the hypothalamus, it was also observed in the nervous structures of the ENS. One of the first publications concerning this issue described the presence of SOM within the MP of the GI tract of guinea pig, which is the best known species in terms of the distribution and functions of SOM in the ENS . In thisPrevious studies have also shown that SOM may occur in various types of guinea pig enteric neurons . Studies of various authors often differ regarding the exact distribution of SOM in the enteric neurons in the guinea pig small intestine. According to Hu et al., SOM has been observed in neurons belonging to group II of the Dogiel classification and is characterized by large, elongated or round perikaryon with a single long and thick axon projected in the aboral direction . In turnOther studies have shown that SOM-positive neurons in the guinea pig small intestine are relatively numerous in the submucous plexus and amounted to about 30% of all neuronal cells . Such neSOM has also been detected in the enteric nervous structures of other parts of the guinea pig digestive tract but, contrary to the small intestine, knowledge concerning this issue is more fragmentary. For the large intestine, it is known that the number of SOM-positive neuronal cells in the colonic enteric plexuses is generally similar to that observed in the small intestine . NeverthKnowledge of the distribution of SOM-positive neuronal cells and nerves in the wall of the guinea pig stomach is more fragmentary. SOM has been observed in about 6% of all neuronal cells located in the myenteric plexus . The samIn recent years, the domestic pig has increasingly been used as an animal model during studies concerning the influence of various pathological states on the GI tract and the ENS. This is because considerable similarities in the organization, neurochemistry and electrophysiology between human and porcine ENS have been described ,43. TherGenerally, SOM in the porcine ENS is present in the same types of the enteric neurons as in the guinea pig. Namely, the main two classes of the porcine enteric neurons, in which SOM is observed are 1) type-V neurons located in myenteric and outer submucous plexus (not in the inner submucous plexus) playing the role of the descending interneurons and 2) type-IV neurons observed in all types of intramural plexuses and playing the role of secretomotor neurons ,44,45. IIn previous studies, clear differences in the localization of SOM-positive nervous structures have been observed between the particular segments of the porcine GI tract. The most is known about the distribution of SOM-positive enteric nervous structures in the small and large intestine. The number of enteric neuronal cells in these GI tract segments is rather low. The exact number depends on the fragment of the intestine and are different in various studies. According to Gonkowski and Calka, in the porcine descending colon, the number of SOM\u2014immunoreactive neuronal cells in the MP, and OSP amounts to about 2% of all neurons and in the ISP, it oscillates about 4% . In turnTo date, SOM has been detected in the enteric nervous structures in various segments of the human digestive tract ,55,56,57Knowledge of the distribution of SOM-positive neuronal cells and nerves in the human stomach and oesophagus is scarce. It is known that SOM is present in both the neuronal cells and nerve fibres localized in the gastric antrum . NeuronsThe presence of SOM has been also observed in the innervation of the GI tract in other mammal species. In the rat and mouse, the distribution of SOM in the ENS is generally similar to the guinea pig. This peptide has been noted in a small number of myenteric and submucous neurons  and nerve fibres located in the muscular and mucosal layers, as well as inside the enteric plexuses ,66,67,68In 1984, Lolova et al. described for the first time the presence of SOM in the ENS located within the pyloric sphincter, ileum, ileocecal sphincter and proximal colon of the cat . The greThe presence of SOM in the neuronal structures has been also studied in the canine digestive tract ,76,77. COf course, the above-mentioned species are not the only species, in which SOM has been observed in the enteric nervous structures. Some studies of this issue concern very exotic mammalian species. For example, SOM has been noted in rare nerves located in the cardiac, funding and pyloric regions of the stomach of the African elephant  and in tAs mentioned above, SOM acts by means of five types of receptors (from SSTR1 to SSTR5) ,80. The In the rat, SSTR2 receptor was described within distinct populations of the enteric neurons localized in the intestinal myenteric and submucous plexuses, as well as in the gastric myenteric plexus . Such tyDistribution of SOM receptors was also studied in the murine small intestine . AccordiIn the majority of fibres, SSTR1 co-localizes with CGRP. Contrary to the rat, SSTR1 was not observed in intramural neuronal cells of the murine ileum . In turnThe term \u201cplasticity\u201d of the nervous system concerns adaptive changes within neuronal cells arising under the influence of modification of the environmental conditions and is intended to maintain homeostasis ,87. SuchBacteroides fragilis infection, the decrease in the number of SOM\u2013immunoreactive cells\u2013was accompanied by an increase in the density of SOM-positive intraganglionic nerves [Previous studies have shown that the number of SOM-positive enteric nervous structures is also subject to change in response to various stimuli. The character and intensity of these changes clearly depend on the acting stimulus, segment of the digestive tract, part of the ENS and mammalian species studied. The first publication concerning a decrease of SOM concentration in the wall of the guinea pig ileum after extrinsic innervation was published in 1977, shortly after the discovery of this peptide . In subsc nerves .Various changes in the number of SOM-positive enteric neurons and nerves, clearly dependent on the part of the ENS and acting stimulus, were described in the porcine descending colon . It has Interestingly, the previous studies reported more than once that strong pathological stimuli, which are known to influence the neurochemical characterization of the enteric neurons, have no effect on the number of SOM-immunoreactive nervous structures in the GI tract. Such a situation has been noted, among others, in the human colon during Hirschsprung disease , within Apart from the ENS, the functions of the GI tract are regulated by extrinsic innervation, in which three main parts can be distinguished: afferent sensory, sympathetic, and parasympathetic neuronal cells  96,97,9,99. Sensory neurons conduct sensory and pain stimuli from the GI tract to the central nervous system. It has been shown that the perikarya of these neurons are located in the dorsal root ganglia (DRG) and in the sensory ganglia of the vagal nerve, such as jugular and nodose ganglia ,100,101.The next part of the extrinsic innervation of the GI tract is parasympathetic innervation. Cell bodies of parasympathetic neurons supplying the GI tract are located in dorsal motor nucleus and nucleus ambiguous of the vagal nerve , as well as in parasympathetic nuclei of the sacral spinal cord  ,103,104.It should be pointed out that knowledge concerning the occurrence of SOM in the extrinsic innervation of the GI tract is rather scarce. The greatest number of studies apply to the distribution of SOM in the intestinal sympathetic innervation. The presence of SOM in a relatively large number of neuronal cells  located in the coeliaco-superior mesenteric ganglion complex of the guinea pig was first described in the 1970s . The firNevertheless, the most thorough investigations concerning the distribution of SOM in the extrinsic gastrointestinal innervation have been conducted on the domestic pig, which may be the best animal model of human gastrointestinal innervation . In the The functions of SOM within the ENS have been the objective of studies from the 1970s, but until now, all aspects connected with SOM activity in the enteric neurons have not been fully elucidated.The first papers concerning the functions of SOM in the ENS, published in the 1970s and 1980s, showed that SOM inhibits the release of acetylcholine from neurons located in the myenteric plexus, and, therefore, it may contribute to the inhibition of the intestinal muscle contraction ,115. SimStudies on the influence of SOM on acetylcholine release by the myenteric neurons isolated from the guinea pig intestine were continued by Yau et al. . They obApart from the involvement of SOM in the inhibition of gastrointestinal motility and secretory activity, SOM in the ENS may also play various other functions. As mentioned above, previous studies have reported the presence of SOM both in the intrinsic primary afferent neurons located in the wall of the intestine ,58 and iOther studies have reported that SOM may participate in the regulation of the intestinal blood flow . In turnThe above-mentioned anti-inflammatory properties of SOM have led to this peptide and its analogues  becoming the subject of studies aimed at the eventual application of these substances during the treatment of intestinal inflammatory processes. Previous studies have shown that octreotide inhibits the feeling of pain during inflammatory processes in the intestine . It alsoPrevious studies have indicated that SOM is an important neuronal factor participating in the regulation of GI tract functions. The presence of this peptide has been noted in numerous mammalian species, both in the enteric nervous system of various segments of the digestive tract, as well as in the extrinsic innervation of the stomach and intestine. The exact number of SOM-positive neuronal structures in the ENS clearly depends on the mammalian species and segment of the GI tract. SOM located in the ENS may play multidirectional functions. Among others, it inhibits intestinal motility and secretory activity of the mucosal layer, participates in the sensory and pain stimuli conduction, and regulates blood flow in the wall of the GI tract. The major functions of SOM are connected with pathological changes within the intestine and the anti-inflammatory properties of this peptide have led to interest in SOM analogues being used in the treatment of various intestinal diseases. Nevertheless, the elucidation of all aspects of the role of SOM in the ENS, as well as the suitability of SOM analogues in the treatment of particular intestinal diseases, requires further studies."}
+{"text": "Sebum content, skin hydration and acidic skin pH are major factors in maintaining skin health. Various nutrients are reported to influence skin health, but the effect of dietary patterns (DPs) on skin health is unclear. In this study, we considered the DPs associated with these three skin health parameters in 84 healthy adults aged 19\u201337 years. Dietary intake was assessed using a food frequency questionnaire (FFQ) and skin health parameters were determined on the forehead of each subject. Among the four DPs extracted from the FFQ, DP2, characterized by a high intake of cereals, potatoes and starch, saccharides and fish and shellfish, was negatively associated with skin hydration. DP3, characterized by a high intake of potatoes and starch, seeds and nuts, fruits and eggs, was positively associated with acidic skin pH only before adjusting for potential confounders. On the other hand, DP4, characterized by a low intake of beans, and a high intake of meats, dairy products and beverages and alcohol, was negatively associated with acidic skin pH and positively associated with sebum content. The data stratified by sex revealed a negative association between skin hydration and DP2 in males and a negative association between sebum content and DP3 and a positive association between sebum content and DP4 in females. In conclusion, we demonstrated that specific DPs were associated with sebum content, skin hydration and pH in healthy Korean adults and that those associations were affected by sex. Human skin is primarily responsible for protecting the body from a loss of water and various threats from the external environment. Therefore, it is important to appropriately maintain the skin permeability barrier function, which can be affected by several parameters, including sebum content, skin hydration and skin pH . Sebum, The function of the skin permeability barrier is also influenced by various internal and external factors, one of which is nutrition. It is well known that keratinocyte proliferation and differentiation in the epidermis is regulated by various nutrients, such as vitamin C ,7, calcin = 44) and female (n = 40) subjects aged 19 to 37 years participated in this study and provided their informed consent after receiving an explanation of the study. The exclusion criteria in the subject recruitment were having a chronic disease or skin disorder such as psoriasis or atopic dermatitis and taking nutritional supplements or medication for the skin, such as retinoids or steroids. All questionnaires and measurements were completed in December 2016. The general characteristics and dietary data for the subjects were collected by questionnaire. Anthropometric data and skin health parameters were measured using non-invasive methods, as described below.This cross-sectional observation study was approved by the Institutional Review Board of Kyung-Hee University (KHSIRB-18-016) and performed in accordance with the principles of the Declaration of Helsinki. Eighty-four healthy male (2).Demographic and general health characteristics of the subjects  were collected by questionnaire. Smoking and drinking behavior was divided into two categories based on current status: current smokers/drinkers and current non-smokers/drinkers. Physical activity was also classified into two categories: regular exercisers (those who reported regularly exercising at least once per week) and non-exercisers. Height (cm) and weight (kg) were measured using standard methods with the participants wearing light clothing and no shoes. Body mass index (BMI) was calculated as weight (kg) divided by the square of height (mDietary intake was assessed using a simple semi-quantitative food frequency questionnaire (FFQ) that listed 63 food items regularly ingested by Koreans . The sub2. Skin hydration and skin pH were also determined on the forehead using a corneometer , which measures the electrical capacity of the skin surface, and a skin-pH-meter  equipped with a planar glass electrode and based on potentiometric determination, respectively. The skin hydration results were given in arbitrary units. All measurements were repeated in triplicate.The subjects were not allowed to use any cosmetics on the measurement region on the test day. The measurements of skin health parameters were made after the subjects had remained in a resting position for 30 min in a room with a temperature of 22 \u00b1 2 \u00b0C and a humidity of 40%\u201360%. All skin health parameters were assessed using non-invasive and well-established measuring methods  ,18,19. SFactor analysis (principle component) with varimax rotation was used to extract dietary patterns from the 16 food groups. As a minimum of five subjects per variable is recommended for conducting a factor analysis , we usedWe performed a one-way analysis of variance for continuous variables and the chi-square test for categorical variables to compare the general characteristics across the quartiles of dietary pattern scores. A general linear model was used to determine linear trends in skin health parameter values across the quartiles of dietary pattern scores after adjusting for potential confounders. The first model was adjusted only for energy intake, and the second model was further adjusted for sex, age, BMI, smoking and physical activity. The adjusted means for skin health parameters and the 95% confidential intervals were also calculated. To check for sex effects on the relationship between skin health parameters and dietary pattern scores, we stratified the subjects into male and female and then analyzed the general linear model using data separated by sex after adjusting for age, BMI, smoking and physical activity. To understand the nutritional characteristics of the dietary patterns, we analyzed partial correlations of dietary pattern scores with the intake of the major nutrients, specific vitamins ,22,23, ohttp://www.r-project.org/) were used for the statistical analyses in this study. Statistical significance was set at p = 0.05. IBM SPSS version 23.0  and R statistical software version 3.4.3  [2 for sebum content  [The overall study population contained 44 males (52.4%) and 40 females (47.6%), and the average age was 24.8 \u00b1 4.1 years (means \u00b1 SD). The average BMI was 23.2 \u00b1 2.6 kg/mMI < 25) . The ave100\u2013220) , 64.1 \u00b1 100\u2013220) , and 5.2100\u2013220) . All valp for trend = 0.017) and Model 2 (p for trend = 0.028). High scores for DP3 tended to have a low skin pH (a positive association with acidic skin pH) only in Model 1 (p for trend = 0.045), whereas high scores for DP4 tended to have a high skin pH (a negative association with acidic skin pH) in both Model 1 (p for trend = 0.045) and Model 2 (p for trend = 0.039). Furthermore, high scores for DP4 tended to have a high sebum content in both Model 1 (p for trend = 0.008) and Model 2 (p for trend = 0.018).To evaluate the association of skin health parameters with the four dietary patterns, we analyzed alterations in sebum content, skin hydration and skin pH across the quartiles of dietary pattern scores after adjusting for potential confounders . Model 1p for trend = 0.003), and the positive association between DP4 and sebum content remained significant only in females (p for trend = 0.026). The associations between DP3 and DP4 and skin pH did not remain statistically significant in either males or females. Furthermore, we additionally found that females with high scores for DP3 tended to have a low sebum content (p for trend = 0.009). These results indicate that the effects of diet on skin health parameters might differ between males and females.As there were differences in the proportion of males and females across the quartiles in most dietary patterns , we checp < 0.001) and a negative association with most of the other nutrients: protein , fat , fiber , vitamin A , vitamin C , vitamin D , LA , \u03b3-linolenic acid  , isoleucine , leucine  and valine . On the other hand, DP3 showed a negative association with leucine intake  and a positive association with most other nutrients: fiber , vitamin A , vitamin C , vitamin E , vitamin D , LA , GLA  and dihomo-\u03b3-linolenic acid  . DP4 showed a negative association with the intake of carbohydrates , fiber , LA , and GLA  and a positive association with the intake of vitamin C , vitamin D , isoleucine , leucine , tryptophan , and valine .To understand the nutritional characteristics of the dietary patterns that showed statistically significant associations with the skin health parameters , we analyzed the partial correlations of those scores with the intake of nutrients known to be related to skin health parameters , but it showed a decreasing tendency across the intake quartiles of saccharides (p for trend = 0.040), indicating that the negative association between DP2 and skin hydration might result from the high intake of saccharides, not fish and shellfish. In addition, although energy intake tended to increase across the quartiles of DP2 scores  is an important factor in maintaining skin health and preventing skin disease ; many st\u20136 is an To the best of our knowledge, this is the first study to discover associations between dietary patterns and skin health parameters. To summarize our findings: DP2 was associated with decreased skin hydration . DP3 was associated with decreased sebum content  and skin pH , while DP4 was associated with increased sebum content  and skin pH . However, because the association between DP3 and skin pH was not significant after adjustment for potential confounders, further studies are required to clarify its association. In addition, the interpretation of our findings requires some care. First, because we considered only a relatively small number of subjects, our results have limited generalizability. Second, the causal relationship between dietary patterns and skin health parameters cannot be inferred from our results due to the cross-sectional nature of this study. Third, interpretations about the effects of a specific individual food or nutrient on skin health parameters requires attention because dietary patterns represent combinations of various food intakes. Particularly for nutrients that occur in small amounts, such as GLA and DGLA, the meaning of the associations we found requires careful interpretation. Finally, we measured skin health parameters on the forehead because it secretes more sebum than other sites. However, the face is highly influenced by various life habits, such as the use of cosmetics and other topical products and cleansers.This study revealed that specific dietary patterns are related to the skin health parameters of sebum content, skin hydration and skin pH on the foreheads of healthy Korean adults. In addition, we found that those associations could differ by sex. These findings could be useful basic data for promoting skin health and preventing skin disease. However, further prospective large-scale studies and randomized controlled trials are needed to support these findings and address the limitations of this study."}
+{"text": "Monoubiquitination of histone H2B (H2B-Ub) plays a role in transcription and DNA replication, and is required for normal localization of the histone chaperone, FACT. In yeast, H2B-Ub is deubiquitinated by Ubp8, a subunit of SAGA, and Ubp10. Although they target the same substrate, loss of Ubp8 and Ubp10 cause different phenotypes and alter the transcription of different genes. We show that Ubp10 has poor activity on yeast nucleosomes, but that the addition of FACT stimulates Ubp10 activity on nucleosomes and not on other substrates. Consistent with a role for FACT in deubiquitinating H2B in vivo, a FACT mutant strain shows elevated levels of H2B-Ub. Combination of FACT mutants with deletion of Ubp10, but not Ubp8, confers increased sensitivity to hydroxyurea and activates a cryptic transcription reporter, suggesting that FACT and Ubp10 may coordinate nucleosome assembly during DNA replication and transcription. Our findings reveal unexpected interplay between H2B deubiquitination and nucleosome dynamics. Eukaryotic chromatin is decorated with a wide range of reversible histone post-translational modifications (PTMs) that regulate all processes that require access to DNA, including transcription, DNA replication and DNA repair . ActivelSaccharomyces cerevisiae, histone H2B-K123 is monoubiquitinated by the E2/E3 pair, Rad6/Bre1 , whereas a ubp10 deletion strain shows broader enrichment of H2B-Ub in mid-coding regions of longer transcription units. The ChIP results suggest that Ubp8 and Ubp10 are required during transcription, but at different times and in different genic locations. However, it remains unclear how each of these factors produces these distinct profiles and what roles each enzyme plays during these processes.Despite their shared substrate specificity, Ubp8 and Ubp10 appear to play distinct roles in vivo. Several studies have shown that SAGA/Ubp8 primarily acts on H2B-Ub near promoters and transcription start sites to promote transcription initiation by RNA polymerase II . Ubp10 wome-wide , indicated genes , althougdeletion . The difdeletion  and Ubp1deletion , suggest strains  which shUbiquitination of histone H2B has been reported to assist recruitment of the histone chaperone, FACT (Facilitates Chromatin Transcription) to active chromatin . The yeaWe report here a novel role for the histone chaperone, FACT, in stimulating the H2B deubiquitination activity of Ubp10 on nucleosomes. We show that the rate of deubiquitination of yeast H2B-Ub is slower when incorporated into nucleosomes as compared to free H2A/H2B-Ub heterodimers, but that the addition of FACT reverses this block. This behavior is in marked contrast to the Ubp8/DUB module, which has robust activity on both heterodimers and intact nucleosomes and is not affected by FACT . We showDuring transcription, nucleosomes are at least partially disassembled in order to enable RNA polymerase to access the DNA template and are then reassembled in the wake of the transcribing polymerase. It is not known when during this process ubiquitin is conjugated to histone H2B and when it is removed by either Ubp8/SAGA or Ubp10. Since histone H2A/H2B heterodimers can be ejected and re-inserted during the dynamic nucleosome disassembly and reassembly that accompanies passage of RNA polymerase, it is formally possible that H2B is deubiquitinated when it is in an intact nucleosome, after ejection to the free H2A/H2B-Ub dimer form, or when the nucleosome is in an intermediate state of disassembly or assembly. We previously reported that the Ubp8/SAGA DUB module deubiquitinates H2B in the context of both the nucleosome and the free H2A/H2B-Ub heterodimers, with a modest preference for nucleosomes . Those rSince Ubp10 has been reported to associate with RNA polymerase II  and to dIn cells, core histones that are not incorporated into nucleosomes are usually bound by histone chaperones, which bind to H2A/H2B heterodimers or H3/H4 heterodimers or heterotetramers . The hisA possible explanation for the observed stimulatory effect of FACT is that it alters nucleosomal structure, making it a better substrate for Ubp10. Previous studies have shown that FACT binding can destabilize canonical nucleosomes, disrupting the octamer/DNA contacts, which could result in displacement of H2A/H2B heterodimers , therebyThe finding that FACT stimulates Ubp10 to deubiquitinate nucleosomes stands in stark contrast to the Ubp8/SAGA DUB module. We previously found  that theUbp10 contains an unstructured region rich in Asp/Glu that is N-terminal to the catalytic USP domain (residues 362\u2013733)  Figure . The N-tTo determine whether Ubp10 domains that are required for nucleosome binding are also required for DUB activity as well as for stimulation by FACT, we tested the DUB activity of the Ubp10 N-terminal truncations. All three N-terminal truncation mutants were active on H2A/H2B-Ub heterodimers, although the \u0394200 and \u0394250 truncations had slightly lower activity than intact Ubp10 . Similarpob3-L78R mutation, which destabilizes the Pob3 subunit of FACT and reduces its level by about 10-fold under permissive growth conditions (pob3-L78R strain had an elevated level of H2B-Ub (1.9-fold increased) that is comparable to that in a ubp10 deletion strain (1.4-fold increased) when normalized for total H2B. This increase in H2B-Ub in a FACT mutant is consistent with a role for FACT in deubiquinating H2B-Ub in vivo. A strain lacking Ubp10 and also carrying the FACT defect had roughly the same increased ratio of H2B-Ub as the pob3-L78R mutant  showed a decrease in FLAG-H2B-Ub levels when shifted to a restrictive temperature. In that experiment, cells initially experienced normal levels of FACT, followed by an acute reduction of the essential FACT complex to a level that does not support viability  but is viable at 25\u00b0C   or loss of Ubp8  , which rsertion) . Wild tyLO8 gene   results in increased levels of H2B-Ub that are comparable to those caused by loss of Ubp10 . The amplified product containing an N-terminal His6-tag and TEV (tobacco etch virus) cleavage site was inserted into a vector that contains thioredoxin protein, pET32a, using IN-fusion cloning kit (Clontech). Ubp10 N-terminal deletions containing residues 157\u2013792 (pMN3), 200\u2013792 (pMN4), and 250\u2013792 (pMN5), were similarly amplified from the original Ubp10-WT expression plasmid, pMN2, and inserted into pET32a. Ubp10-containing plasmids were expressed in Rosetta (DE3) cells. Briefly, a starter culture was grown to an OD of 0.6, then transferred to 1 L M9ZB medium and allowed to grow at 37\u00b0C. When the OD reached\u00a0~1.5\u20132, the medium was supplemented with 1 mM isopropyl-\u03b2-D-thiogalactoside (ITPG) and the temperature was shifted to 20\u00b0C for an overnight induction. Pelleted cells were lysed in lysis buffer, 25 mM HEPES pH 7.5, 20 mM imidazole pH 7.5, 600 mM NaCl, 10 mM 2-mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride (PMSF). The lysate was recovered by centrifugation and the supernatant was loaded onto 5 ml HisTrap HP column  using buffer A . Bound protein was eluted with buffer B . To cleave the purification tags, 1 mg of TEV protease (per mg of protein) was added to the combined fractions and dialyzed overnight against buffer A. The dialyzed sample was then reloaded onto a HisTrap column to remove the cleaved purification tag. The protein was then diluted with ion exchange binding buffer , and eluted with elution buffer . Final purification was carried out using preparative grade HiLoad Superdex 200 26/600  with a buffer containing 25 mM HEPES pH 7.5, 250 mM NaCl, and 10 mM 2-mercaptoethanol. All Ubp10 constructs were purified using this protocol. Small aliquots were flash frozen using liquid nitrogen. Although the enzyme is very robust, we avoided freeze thawing for re-use.To make the full-length wild-type Ubp10 expression plasmid (pMN2), the protein coding sequences were amplified from Saccharomyces cerevisiae histones H2A, H2B, H3, and H4 were expressed in E.coli and purified by standard methods ( methods  with mod methods . All wilXenopus H2B-DCA-Ub (DUB-resistant monoubiquitinated yH2B containing a dichloroacetone linkage between ubiquitin and H2B-K123 (yH2B-DCA-Ub) was prepared using the approach previously described for B-DCA-Ub .Saccharomyces cerevisiae FACT subunits, Nhp6 and the heterodimer of Spt16 and Pob3 were purified from yeast as previously described  cells. A 10 ml starter culture was prepared from a freshly transformed plate, grown to an OD of 0.4, transferred and inoculated to an OD of 0.6\u20130.8 in 500 ml 2xYT medium, then induced overnight at 25\u00b0C by addition of 1 mM IPTG. Cells were pelleted by centrifugation, resuspended in 50 mM Tris-HCl pH 7.5, 200 mM NaCl, 1 mM EDTA, 0.1 mM PMSF, protease inhibitor tablet , and 0.25 mM TCEP, and lysed with a Microfluidizer (Microfluidics). To prevent degradation, the lysate was immediately spun down, the supernatant was applied on to pre-equilibrated chitin resin, and incubated at room temperature for 2\u20134 hr. The bound protein was washed with lysis buffer, followed by wash buffer 1 , and wash buffer 2 . MES derivatization was performed for 18 hr at 4\u00b0C in a buffer containing 50 mM Tris-HCl pH 7.4, 200 mM NaCl, 1 mM EDTA, 0.1 mM PMSF, 250 mM MESNa and 0.25 mM TCEP. Cleavage was terminated by adding 20 mM NaOAc pH 5.2, 7 M urea, 1 M NaCl, 1 mM EDTA, 0.1 mM PMSF and 0.25 mM TCEP. The protein was then purified by ion-exchange on an SP column  with binding buffer  and eluted with a 0 to 1 M NaCl gradient. Following thorough dialysis against water, the protein was lyophilized and then resuspended in unfolding buffer . The protein was then purified by HPLC on a C4 column  equilibrated with 0.1% TFA and eluted with a 0% to 90% acetonitrile gradient elution. The final sample was then checked for derivatization by MALDI-TOF and immediately lyophilized to prevent hydrolysis.2 and [Pd(Allyl)Cl]2 Cl]2 . The ligHistone octamers and a 146 bp DNA fragment containing the Widom 601 nucleosome positioning sequence were purified and reconstituted into nucleosomes using standard methods . NucleosE.Coli using a polycistronic expression vector containing all four yeast histones (a generous gift from Alwin K\u00f6hler) and a purification tag on H2B as previously described . Once the reaction was completed, the samples were immediately loaded on to a pre-run 6% Novex TBE gels (Life Technologies) and electrophoresed for 75\u2013100 min using 0.25x TBE running buffer at 4\u00b0C. Gels were stained with SYBR gold (Life Technologies) for 20 min and imaged using Chemidoc Touch (Bio-Rad). Apparent dissociation constants were estimated from half-maximal Ubp10-nucleosome complexes on native gel.Ubiquitinated or wild-type nucleosomes (100 nM) and Ubp10 concentrations ranging from 0 to 1600 nM were incubated on ice for 1 hr in the presence of 20 mM HEPES pH 7.6, 50 mM NaCl, 5% sucrose, 1 mM DTT, and 2.5 mM MgClDeubiquitination activity assays were performed according to a previously described protocol . BrieflyYeast strains with the genotypes shown in Western blots were performed as in  In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Geeta Narlikar as Reviewing Editor and Jessica Tyler as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Vasily M Studitsky (Reviewer #2).Thank you for submitting your article \"FACT and Ubp10 collaborate to modulate H2B deubiquitination and nucleosome dynamics\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. As you will see the reviewers agree that your work contains new experimental findings that are important for understanding the role of H2B-Ub and histone chaperone FACT in chromatin dynamics during transcription and replication. However they also have some comments that they would like you to address experimentally to strengthen your core conclusions.Summary:Histone H2B ubiquitination is a highly conserved PTM coupled to active transcription. Although the enzymes that are involved in the ubiquitination and deubiquitination processes are largely known through genetics, the highly dynamic nature of this PTM has made mechanistic understanding of its function very difficult.ubp10-\u0394 and FACT mutants show synthetic effects in HU sensitivity and activation of a cryptic transcription reporter gene, suggesting that they function together in replication and transcription. Since Ubp10 was previously thought to function at subtelomere regions, these results revealed a possible new function of Ubp10 in transcriptionally active coding regions and provide a missing piece of H2Bub dynamics.This manuscript reports the surprising finding that histone chaperone FACT is a key regulator of H2B deubiquitinase Ubp10 in yeast. In vitro, FACT strongly stimulates Ubp10 to deubiquitinate nucleosomes, although the underlying mechanism is not entirely clear. In vivo, Overall the data are of high quality and presented with transparency. The results will be of interest to a broad audience in the transcription/chromatin field. However some key experimental tests are required to strengthen the conclusions as described below. Some textual clarifications are also required.Essential revisions:1) In Figure 2B: 2 \u03bcM Spt16/Pob3-WT and 2 \u03bcM Nhp6 was used. Is the nucleosome reorganized under these conditions? According to past studies from Formosa lab, typically reorganization requires at least 6-fold molar excess of Nhp6. More importantly does the stimulatory effect of FACT on Ubp10 action require both Spt16/Pob3 and Nhp6 in vitro? Or does FACT facilitate the deubiquitination in the absence of Nhp6 (and thus in the absence of nucleosome reorganization)? This is a critical experiment to further validate the model proposed in Figure 7.2) The very detailed proposed model suggests that nucleosome reorganization is necessary for the deubiquitination; however, this remains to be rigorously established (see comment 1). Furthermore, nucleosome reorganization requires the presence of Nhp6 and accordingly the model explicitly implicates Nhp6 in nucleosome reorganization. However, the cycles of ubiquitination/deubiquitination are presumably coupled to ongoing transcription/replication and Nhp6 is generally not present on transcribed genes. Therefore overall, the model should be further clarified and better connected to transcription and replication.ubp10-\u0394 leads to nonspecific spread of the SIR complex, which causes the observed genetic defects. Since the N-terminal regions of Ubp10 is required for its function at subtelomeres, and appears to be dispensable for FACT-dependent activity in vitro, the authors should rescue the synthetic genetic effects with Ubp10 N-terminal truncation mutants.3) Because Ubp10 has known to function in silencing, there is a formal possibility that 4) The result in Figure 4 is surprising. Previously it was reported that inactivating FACT  eliminates H2Bub . It's possible that this difference is due to allele-specific effects. However, higher levels H2Bub have been shown to associate with better nucleosome assembly . Figure 6 instead suggests that nucleosome assembly is defective. This contradiction needs to be addressed with more direct evidence (see point 5 below).5) Since westerns are notoriously difficult in discerning small differences, a more direct approach would be ChIP analysis of H2B and H2Bub levels across, for example, a long gene previously shown affected by Ubp10. This type of analysis would provide more mechanistic insights as to the effect on nucleosome integrity and relative H2Bub levels . It will also separate the effects of ubp10delta at subtelomere vs actively transcribed regions.6) The authors propose that FACT can stimulate Ubp10 action on H2B ubiquitylated nucleosomes by either partially unfolding the nucleosome or by dissociating the H2A/H2B dimer. A straightforward way to test for either possibility would be to run the deubiquitylated products on a native gel. If the products run analogous to unmodified nucleosomes this will suggest that FACT transiently unravels the nucleosome but that the nucleosome refolds after deubiquitylation. Instead if the products run analogous to tetrasomes or hexasomes, this will suggest that Ubp10 acts on a free H2A/H2B dimer that is released by FACT action.7) While the synthetic interaction is consistent with such a possibility, there is no direct evidence that FACT and Ubp10 function together in vivo. So we suggest that the authors make a statement in the Discussion such as: \"While there is no direct evidence that FACT and Ubp10 work together in vivo, the synthetic genetic interaction and the biochemical cooperation that we observe is consistent with such a possibility\". Essential revisions:1) In Figure 2B: 2 \u03bcM Spt16/Pob3-WT and 2 \u03bcM Nhp6 was used. Is the nucleosome reorganized under these conditions? According to past studies from Formosa lab, typically reorganization requires at least 6-fold molar excess of Nhp6. More importantly does the stimulatory effect of FACT on Ubp10 action require both Spt16/Pob3 and Nhp6 in vitro? Or does FACT facilitate the deubiquitination in the absence of Nhp6 (and thus in the absence of nucleosome reorganization)? This is a critical experiment to further validate the model proposed in Figure 7.We thank the reviewers for suggesting this experiment. Since yeast Spt16-Pob3 does not bind stably to nucleosomes and is unable to induce nuclease sensitivity without added Nhp6, we had assumed its effects on Ubp10 activity would also have this feature. As shown in the new Figure 2\u2014figure supplement 2 and 4, this assumption was incorrect, as Spt16-Pob3 was able to stimulate Ubp10 activity on nucleosomal H2B-Ub nearly as efficiently without Nhp6 as with it. This has implications for the model regarding how FACT affects Ubp10 activity, and we have made corresponding changes to Figure 7 as a result.Perhaps more importantly, this result provides more insight into how FACT affects nucleosomal structure, increasing the impact of the results. Human FACT and yeast Spt16-Pob3 do not stably alter nucleosome structure, but each is able to do so with added Nhp6. However, Nhp6 is not essential for viability in yeast, whereas Spt16 and Pob3 are, and human FACT affects RNA Pol II passage under conditions where it does not produce full reorganization. It is therefore clear that Nhp6 is not required for FACT activity, but supports it in vivo and in vitro. Several labs have shown that FACT has multiple domains that interact with histone surfaces, supporting a model in which FACT binds to nucleosomes in several modes. It seems unlikely that producing the fully reorganized form detected by EMSA or restriction endonuclease digestion is the only relevant function of FACT, and we previously proposed a transient \"assembly checkpoint\" form of FACT:nucleosome complexes to explain some genetic and biochemical results . We now propose that one of these modes of binding along the pathway to (or returning from) full reorganization is the form that is relevant for enhancing Ubp10 activity, thus explaining the lack of a requirement for Nhp6 to produce the stably reorganized form. This is significant because it reveals a function for a partially disrupted form of nucleosomes, and because it diminishes the possibility that the stimulation of Ubp10 activity is a simple consequence of H2A-H2B dimer eviction, which does not occur in the absence of Nhp6.2) The very detailed proposed model suggests that nucleosome reorganization is necessary for the deubiquitination; however, this remains to be rigorously established (see comment 1). Furthermore, nucleosome reorganization requires the presence of Nhp6 and accordingly the model explicitly implicates Nhp6 in nucleosome reorganization. However, the cycles of ubiquitination/deubiquitination are presumably coupled to ongoing transcription/replication and Nhp6 is generally not present on transcribed genes. Therefore overall, the model should be further clarified and better connected to transcription and replication.The lack of an absolute requirement for Nhp6 in the stimulation of Ubp10 activity on nucleosomal substrates changes our model and our discussion of it as discussed above under point 1. We have also modified the model figure accordingly.3) Because Ubp10 has known to function in silencing, there is a formal possibility that ubp10-\u0394 leads to nonspecific spread of the SIR complex, which causes the observed genetic defects. Since the N-terminal regions of Ubp10 is required for its function at subtelomeres, and appears to be dispensable for FACT-dependent activity in vitro, the authors should rescue the synthetic genetic effects with Ubp10 N-terminal truncation mutants.ubp10-\u2206(109-133) allele exhibited a silencing defect comparable to ubp10\u2206 . We deleted these residues from the native UBP10 locus using a markerless conversion method , combined the ubp10-\u2206(109-133) allele with FACT mutations, and repeated our genetic analysis. The mutation lacking the SIR-interaction domain did not affect the properties of FACT mutants in the manner observed for the full deletion of UBP10, ruling out the possibility that the phenotypes we observe are caused by the function of Ubp10 in silencing. We show the results for the pob3-L78R allele in Figure 6\u2014figure supplement 1.Richard Gardner's lab identified Ubp10 residues 109-133 as the region necessary for interaction with the SIR complex and showed that the 4) The result in Figure 4 is surprising. Previously it was reported that inactivating FACT  eliminates H2Bub . It's possible that this difference is due to allele-specific effects. However, higher levels H2Bub have been shown to associate with better nucleosome assembly . Figure 6 instead suggests that nucleosome assembly is defective. This contradiction needs to be addressed with more direct evidence (see point 5 below).spt16-G132D allele used by Fleming et al. have normal levels of Pob3 but reduced Spt16 under permissive conditions, whereas pob3-L78R strains have about a 10-fold reduction in Pob3 but nearly normal levels of Spt16 . Both alleles therefore examine cells with reduced FACT levels; however, one goes from normal to very low FACT  while the other has chronically low FACT throughout the experiment. Further, the balance of Spt16 to Pob3 is expected to be different in the two strains. Since complete withdrawal of FACT is ultimately lethal, we think the use of chronic reduction under viable conditions is preferable to complete inactivation of Spt16 at a non-permissive temperature. Overall, we do not know why Fleming et al. observed decreased FLAG-H2B-ub levels under conditions of lethal withdrawal of FACT using the spt16-G132D allele, but we are confident that H2B-Ub increases under chronic Pob3 depletion with pob3-L78R. Moreover, we claim that pob3L78R affects Ubp10 activity in vivo, not that all FACT defects do. We have added these ideas to the manuscript .We have found that strains with the ubp8D deletion is consistent with a role for H2B-Ub in stabilizing nucleosomes (the effects of ubp10D were not examined). However, the simple model that high global levels of H2BUb correlate with higher nucleosome occupancy is contradicted by their observation that highly transcribed genes have normal levels of nucleosome occupancy in a ubp8\u2206 mutant, even though these genes have markedly lower nucleosome occupancy in rad6\u2206 and H2B-K123A mutants . The relationship between global H2B-Ub levels and nucleosome occupancy is thus clearly complex. Our model that both ubiquitination and deubiquitination are important for maintaining chromatin structure and that Ubp10 and FACT function together in this process is consistent the general consensus that cycles of H2B ubiquitination and deubiquitination are critical to maintaining chromatin organization. We have added a paragraph to the Discussion (third paragraph) that summarizes these points.The data from Batta et al., 2011, show a more complex picture than a simple association of higher H2B-Ub with greater nucleosome occupancy. While that study shows a global decrease in nucleosome occupancy for an H2B-K123A mutation, that mutant cannot undergo cycles of H2B ubiquitination/deubiquitination and is presumably defective in FACT recruitment, all of which are thought to be important for maintaining chromatin organization . The decrease in global nucleosome occupancy observed in deletions of the H2B E2 ubiquitin conjugating enzyme (Rad6) and associated factor , and increase in global nucleosome occupancy observed in a 5) Since westerns are notoriously difficult in discerning small differences, a more direct approach would be ChIP analysis of H2B and H2Bub levels across, for example, a long gene previously shown affected by Ubp10. This type of analysis would provide more mechanistic insights as to the effect on nucleosome integrity and relative H2Bub levels . It will also separate the effects of ubp10delta at subtelomere vs actively transcribed regions.SPT16 covered with an spt16-G132D plasmid; our published work shows that each of these manipulations can lead to misregulation of at least some genes, so we instead used modifications of native loci in our experiments  We are therefore much more confident that this allele of FACT leads to elevated H2B-Ub than we are confident that spt16-G132D grown at the non-permissive temperature leads to its loss.We believe that the western blot data we are presenting meet a much higher standard of stringency than those presented in the Fleming paper (see response to point 4 above). We agree that quantitation of western blots with histones can be difficult, but we note that we used stringent methods including a dilution series on every blot to establish linearity of all responses (with an example shown in our figure), and we report quantitative results from at least 13 independent replicates. This is in contrast to the result reported by Fleming et al. who based their conclusion on visual inspection of a single lane from a single western without quantitation or normalization. Further, their strain carried a deletion of the two H2B genes covered with a plasmid expressing FLAG-tagged H2B (H2B-FLAG). It also had a deletion of We think that western blots provide the appropriate global information we need to ask a question about the effects of Ubp10, which we propose acts genome-wide for producing global chromatin architecture, whereas Ubp8 acts locally in the context of transcription. Western blots measure the global level of H2B-Ub whereas ChIP measures local levels, which are known to vary at different sites relative to the transcription start site, as discussed in several places in this manuscript. Using ChIP to answer this question assumes that we know which loci should be affected and which should not, but this in turn assumes a model in which ubiquitination exclusively supports nucleosome stability and that loss of Ubp10 will have predictable effects localized to the same genes whose transcription is altered by this mutation. As discussed below, these assumptions may not be valid, and testing them is beyond the scope of this manuscript. Our claim is that a FACT defect can cause global loss of deubiquitination of H2B by Ubp10; we do not know or claim to know where this failure occurs.ubp10\u2206 strain, but we did not see a uniform pattern of effects. H2B-Ub levels were unaffected by any mutation in PMA1, they were elevated in the promoter and 5' end of the HO gene in a pob3-L78R strain but not in a ubp10\u2206 strain, and they increased at the 3' end of HO in both mutants. Selected regions therefore support the model that FACT collaborates with Ubp10, but the story is clearly more complex. The initial rationale for attempting this approach was that it is difficult to use western blots to detect small changes in H2B-Ub, but ChIP introduces variation from both the antibody capture of material and using exponential PCR to detect small changes. We used 4 biological replicates of each strain and 4 technical replicates of each IP in our tests and observed more variation among the results than we did with western blots, not less. We therefore conclude that our western blot data meet the highest standard of stringency for this method, answer the question we are asking, and are more reliable for this purpose than ChIP.To address the reviewers\u2019 suggestion, we used anti-H2B-Ub ChIP to test several genes  of different sizes whose transcript levels change in different ways in a The ChIP-qPCR approach is also less suitable for our needs than westerns because there is no suitable commercially available anti-H2B antibody available for ChIP, so we cannot normalize the H2B-Ub levels to the H2B levels without resorting to using an epitope tag that disrupts the phenomenon we are measuring. Our tests show that supplying FLAG-tagged H2B affects the phenotypes of FACT mutants, making this an unacceptable alternative. Overall, the only way to pursue the interesting effects we have observed is to do a ChIP-seq experiment and compare the outcomes to nucleosome occupancy and positioning by MNase-seq. We are considering initiating these studies, but they are clearly beyond the scope of this revision.6) The authors propose that FACT can stimulate Ubp10 action on H2B ubiquitylated nucleosomes by either partially unfolding the nucleosome or by dissociating the H2A/H2B dimer. A straightforward way to test for either possibility would be to run the deubiquitylated products on a native gel. If the products run analogous to unmodified nucleosomes this will suggest that FACT transiently unravels the nucleosome but that the nucleosome refolds after deubiquitylation. Instead if the products run analogous to tetrasomes or hexasomes, this will suggest that Ubp10 acts on a free H2A/H2B dimer that is released by FACT action.We have performed the suggested experiment, which is shown in Figure 2\u2014figure supplement 4. The results show that the presence of FACT during the deubiquitination assay has no effect on the mobility of the three nucleosome species , indicating that the nucleosomes remain intact. This result suggests that FACT's effects on the nucleosomes that stimulate the activity of Ubp10 are transient and reversible.7) While the synthetic interaction is consistent with such a possibility, there is no direct evidence that FACT and Ubp10 function together in vivo. So we suggest that the authors make a statement in the Discussion such as: \"While there is no direct evidence that FACT and Ubp10 work together in vivo, the synthetic genetic interaction and the biochemical cooperation that we observe is consistent with such a possibility\".This statement has been added to the Discussion."}
+{"text": "Accessing support services for depression has been historically difficult given the societal stigma that exists regarding the condition. Recent advances in digital technologies continue to be postulated as a potential panacea yet the results from research trials have been mixed with a range of effect sizes.n\u00a0=\u00a08) taken from a feasibility RCT of a group based video-conferencing service for depressed adults. The co-researcher panel were introduced to a new method of participatory data analysis known as Participatory Theme Elicitation (PTE). This method involves using network analysis techniques to create groupings and visual diagrams in order to support the generation of themes and minimise scientific researcher input/influence.This article offers a different perspective by presenting a panel of end users (co-researchers) with qualitative interview data  or increases anxiety.The findings presented here appear to support existing (researcher and academic-led) literature in the field as well as suggest new areas for investigation. By presenting data generated solely by co-researchers, this article also adds to the evidence surrounding participatory analysis methods - particularly the growing need for robust approaches that are accessible and less time-consuming than those currently available.Clinicaltrials.gov) 20th Sept 2017 https://clinicaltrials.gov/ct2/show/NCT03288506NCT03288506 ( Video-conferencing technology, such as Skype may be a useful substitute for those who find it difficult to attend face-to-face services for mental health issues. The interview data presented here is gathered from individuals who took part in an 8-week online support group intervention for depression using video-conferencing (VC) technology. A unique aspect of this study is that the interview data was analysed by members of the public (co-researchers) who had previously accessed face-to-face support for depression. This was achieved using a new method of participatory analysis known as Participatory Theme Elicitation (PTE). The co-researchers generated themes that were both consistent with previous literature as well as revealing new insights by drawing on their unique experiences and perspectives. Key findings suggest that VC technology is accessible and relatively low cost with some data showing how the service improved mental health. Nonetheless, co-researchers suggested attention should be paid to the increased sense of self-awareness one may feel within an online group setting and whether this discourages participation and increases anxiety.The World Health Organisation (WHO) has reported that \u2018depression is now the leading cause of ill health and disability worldwide\u2019 . DepressThe Priory Group  estimateOne of the more promising forms of online support is through the use of Video Conferencing VC technology \u201311 with This article presents user-led qualitative data analyses from the Developing E-health Services (DES study) - an online group-based intervention for depression using video-conferencing (VC) technology. A unique aspect of this work is that the analysis presented here has been generated entirely by end users through an innovative network approach called Participatory Theme Elicitation (PTE), which is designed to make user involvement in data analysis more accessible for both users and researchers. The network analysis combines individually generated sets of themes into a combined set of themes and presents the results visually to support further discussion.Stevenson and Taylor  highlighWhile there is evidence to suggest that participatory data analysis can be beneficial, the complexities and practicalities involved have meant that it is often under-utilised within research. Participatory approaches are often viewed as time-consuming , 30\u201332 aTo present the user-led analysis of qualitative process evaluation data from an online (group-based) intervention for depression using video-conferencing technology.To explore participants\u2019 and facilitators\u2019 experiences of using and delivering an online group based support service for depressionTo identify the key benefits, challenges and areas for improvement for the online serviceClinicalTrials.gov Trial Number: NCT03288506).The DES Study (The DES project was informed by the MRC framework for intervention development  and usedn\u00a0=\u00a08). Further details on recruitment, retention and outcomes for the DES study are published elsewhere  and \u201cI think, when it started, there were one or two just technical things that \u2026 weren\u2019t a big deal but, in some way, kind of did interrupt the flow of the conversation \u2026 so, that was quite distracting\u201d [ID01].This theme had three important sub-themes \u2013 (a) technical issues of physically using the service (b) barriers to communication (in-group) and; (c) increased sense of self-awareness see Fig.\u00a0. This fi\u201cso, I think it\u2019s less easy on a videoconferencing call to actually pick up any non-verbal\u2019s of the other people who are not talking\u201d [ID08]. It is worth noting that both sub-themes were derived largely from the same excerpts - perhaps revealing differing views within the group or that co-researchers felt that some excerpts contained multiple meanings. In any case, this sub-theme is broadly similar to other literature in relation to online communication and ones sense of \u2018presence\u2019 .Originally discussed as relating to \u2018group composition\u2019, co-researchers developed (and recoded) this sub-theme by reflecting upon their own experiences. They surmised that participation in online groups might actually accentuate one\u2019s sense of self-awareness as users had to observe each other closely in order to \u2018pick up\u2019 on important non-verbal clues. One participant stated that, \u201cI really found that extremely difficult \u2026 in terms of syncing the voice when we were talking \u2026 trying to be sensitive, pick up on tones and moods \u2026 and even looking at the people and their body language\u201d [ID21]. This feeling of being closely \u2018watched\u2019 may have heightened one\u2019s sense of self within the group. While additional data is needed to support this finding, this is an interesting example of co-researchers moving from semantic to more latent level thematic analysis . Group facilitators also noted that,\u201cThere may be people who may feel more comfortable with the teleconferencing \u2026 the fact that they\u2019re in their own home, rather than having the anxiety and \u2026 sometimes the discomfort that you can find when you have to take yourself out of that safe space and you have to go in to another space\u201d [ID16]Communicating online was also felt to be easier \u2013 \u201cI think my part in the group was more conversational than it might be in a face-to-face group, where I probably would have said far less, largely because the face-to-face groups tend to be bigger\u201d [ID06]. Another participant stated, \u201cI felt like I could open up a lot more than I would do in a room full of people. It felt a lot more comfortable for me\u201d [ID26]. This disinhibition effect has been noted in other studies of online behaviour . It was also felt that the system was user friendly - \u201cI think it\u2019s good that we see each other, and people who have been on the calls, not all of them have been used to Skype and yet it\u2019s been a system that people have got used to very quickly\u201d [ID04]. Access to services is often viewed as a key determinant of health status . The facilitator emerged as a key factor \u2013 \u201cI think, (facilitator) is great \u2026 She actually comes in and she says, well, I can relate, and this is what happened to me\u201d. I think she\u2019s amazing\u201d [ID28]. The combination of group-based therapeutic approaches and relatable facilitation appeared to produce positive outcomes. For example, one participant spoke about gaining the courage to leave an abusive relationship \u2013\u201cOne of the benefits was, just being able to open up to somebody, with my problems, that would listen to me and gave me some great advice... it\u2019s actually got me out of an abusive relationship, for a start \u2026 so that\u2019s a very, very positive thing that came out of it\u201d [ID41].It was also suggested that the online group was a potential gateway into face-to-face services as one group facilitator remarked, \u201can interviewee [group user] had mentioned that \u2026. she is now looking at joining the other services offered by us\u201d [ID44]. Co-researchers grouped these together under the one theme, however they acknowledged that these could be developed further if more excerpts were available.Data revealed a strong sense that therapeutic relationships had, and could be, developed online. One participant noted, \u201c\u201cmaybe a little bit of training around Skype might be useful, just to be fully familiar with it, and then just to explore, small things that might make the service a little bit better or might ensure that things are smoother\u201d [ID12]. Participants also felt that additional measures should be in place to support older users of the service, particularly in regard to a general awareness of technology and its various uses -\u201cBut I do feel though that you need to be aware of the technology, how it works - and there\u2019s a lot of elderly men and women, they\u2019re horrified at the prospect of having to learn something new or to maybe manage something technically\u201d [ID37].In addition, they felt that ID43, which was located in Group 5, could also be used to support this theme \u2013\u201cI thought more people would have actually jumped at the chance to get into it. Unless putting a testimonial \u2026 about somebody being afraid of using Skype but then found it so beneficial or so easy to use in the end \u2026 because I think that might be what the stumbling block is\u201d [ID43].The final core theme identified by co-researchers was \u2018service improvements\u2019. Four of the six excerpts in this group appeared particularly relevant here. For example, Data analysis suggests that participants who took part in the DES project found the online groups largely beneficial. This was due, in part, to ease of access, quality of facilitation and a reduced sense of anxiety from being able to connect with others from a familiar environment (often one\u2019s home). Qualitative data also revealed that it was easier to \u2018open up\u2019 online and therefore promoted further disclosure of problems. Advances in mobile technology also meant that accessing online groups was affordable as webcam and computer purchases were not necessary. There was a clear sense of the potential for a therapeutic alliance to develop online. This was evidenced through positive comments regarding the group facilitator as well as participants revealing improvements in their mental state. There was also evidence that online groups had given some participants the confidence to think about attending face-to-face groups whereas others had made significant life changes (leaving an abusive relationship).Interestingly, co-researcher PTE analysis of interview data suggested that while a therapeutic process was evident, the ability of one to fully integrate into a group was unclear. Drawing upon their own experiences they felt that qualitative data revealed how a participant\u2019s sense of self-awareness may have increased within an online group setting. This may be due to a lack of physical proximity to others or the reduced non-verbal information available. Co-researchers discussed whether an online group increased one\u2019s sense that they were under the \u2018spotlight more\u2019 and therefore, in the case of ID34, participants would seek out others with similar profiles  in order to feel more comfortable. While previous evidence in this area is sparse, one interesting study by Greene and colleagues  did noteThe group based intervention was a convenient and valued option for participantsUsing VC technology meant that the service was accessible and relatively low cost (particularly given the developments in mobile technology)Online communication through a VC platform may facilitate increased disclosure of problemsTherapeutic alliances and processes are possible using VC technology with some participants clearly stating how the service improved their mental healthAdditional training and support should be offered (pre-intervention) to improve participants early experiences of using the technologyAdditional exploration is needed regarding the level of self-awareness one feels in a group based VC environment and whether this facilitates disclosure (through disinhibition) or increases anxiety.There were a number of challenges to delivering online support groups mentioned by participants. Disruptions to internet connections at times interrupted the flow of conversations and some early difficulties getting logged on were reported. Nonetheless, interview data suggests these were relatively minor. The data suggested that improvements to the service should include some training in video-conferencing technology prior to beginning the group as well as online testimonials for previous or current users to promote engagement/recruitment. It was also considered that by only interviewing those who had completed all 8-weeks of the intervention the views of those who dropped out would have been an important addition. Overall, these findings support previous literature in the field as well as offer some interesting insights and areas for future exploration. This suggests that PTE does support user developed theme generation using qualitative data. Key learning from the qualitative data presented here is summarised as \u2013The themes and sub-themes produced by co-researchers are largely reflective of the wider literature in the field . This isAs an approach to user-led qualitative analysis the authors found the time commitments fairly low and are confident all PTE Steps could be completed within as little as two days. The importance of capacity building and data sorting prior to analysis and interpretation cannot be overstated. Little moderation of group discussion was needed during Step 5 with discussion taking place organically and without prompting given the familiarity co-researchers had established with the data. The network diagram and network groupings appeared to be useful starting points and there was no evidence of one or two co-researchers monopolising the discussion or significant disagreement among co-researchers.Involving those with lived experience of depression is a clear strength of this study. However, involvement alone is tokenistic and it is important that co-researchers are given the opportunity to develop skills and expand their knowledge in order to increase the quality of analysis. PTE provided the structure in which to do this and the identified themes appear both logical and insightful. Important limitations to note are that the number of quotes were from a sub-sample of qualitative data and this may have unintentionally narrowed and influenced theme generation. Moreover, the data presented was collected from those who had completed all 8-weeks of the intervention and may have been more likely to give positive feedback. There were also three members of the co-researcher panel who could not attend the data analysis and interpretation session. While the strength of this approach is the independence of the network analysis results from researcher input, the results may be influenced by these limitations and one could also consider running the process in tandem with more formal academic researcher analysis to compare findings.The network analysis used to produce diagrams and groupings may require a certain level of specialist knowledge which may be off putting for some. In order to address this, the authors have developed a freely available, web based application [In conclusion, participants were largely positive regarding their experiences of using the online VC group. The ability to \u2018log in\u2019 from the comfort of one\u2019s home combined with ease of access and moderation by experienced group facilitators appeared to be key factors. As the intervention progressed, participants found it easier to share their thoughts and feelings with others and this appeared to facilitate disclosure and ultimately aid the recovery process. The involvement of end users in data analysis provided an insider perspective and revealed interesting insights which could be followed up in subsequent research \u2013 particularly in relation to online presence and intervention recruitment and retention. However, given the limited number of quotes available, the conclusions drawn must be treated with caution and future work using the PTE method may wish to increase the number of quotes available to co-researchers while at the same time acknowledging practical issues, such as fatigue, recall and concentration."}
+{"text": "Ixodes ricinus complex are vectors for some of the most frequently occurring human tick-borne diseases, particularly Lyme borreliosis and tick-borne encephalitis virus (TBEV). The search for vaccines against these diseases is ongoing. Efforts during the last few decades have primarily focused on understanding the biology of the transmitted viruses, bacteria and protozoans, with the goal of identifying targets for intervention. Successful vaccines have been developed against TBEV and Lyme borreliosis, although the latter is no longer available for humans. More recently, the focus of intervention has shifted back to where it was initially being studied which is the vector. State of the art technologies are being used for the identification of potential vaccine candidates for anti-tick vaccines that could be used either in humans or animals. The study of the interrelationship between ticks and the pathogens they transmit, including mechanisms of acquisition, persistence and transmission have come to the fore, as this knowledge may lead to the identification of critical elements of the pathogens\u2019 life-cycle that could be targeted by vaccines. Here, we review the status of our current knowledge on the triangular relationships between ticks, the pathogens they carry and the mammalian hosts, as well as methods that are being used to identify anti-tick vaccine candidates that can prevent the transmission of tick-borne pathogens.Hematophagous arthropods are responsible for the transmission of a variety of pathogens that cause disease in humans and animals. Ticks of the  Borrelia miyamotoi, Neoehrlichia mikurensis, Crimean Congo hemorrhagic fever virus, Powassan virus, Bourbon virus, Rickettsia species, Babesia species as well as Anaplasma phagocytophilum are starting to be slowly recognized as (re)emerging tick-borne diseases 80]). DesI. ricinus (associated with the European TBEV subtype) and I. persulcatus (associated with the Siberian and Far-Eastern TBEV subtypes) ticks. Several mechanisms of virus transmission in nature are described. Vertical transmission of the virus in the form of transovarial transmission of the virions via the eggs, as well as transstadial transmission has been documented. Transstadial transmission seems to be ineffective and its importance to the maintenance of the virus in nature is considered to be rather low  were downregulated in the tick midgut. The proteins identified in this study might be involved in cell invasion and the host\u2019s stress response [D. variabilis when infected by R. montanensis or R. amblyommii, it was found that rickettsial exposure downregulated the expression of S-transferase 1 (dvgst1) and Kunitz protease inhibitor (dvkpi) in the midgut. This suggests that rickettsial infection of the midgut might involve the downregulation of the tick\u2019s immune molecules [Crossing of the midgut barrier and colonization of tick salivary glands are imperative processes for pathogen transmission k saliva . A studyresponse . Interesolecules . The ticolecules , 152.Rickettsia species were shown to elicit a different response in their tick host [R. helvetica and R. monacensis with I. ricinus ticks. Rickettsia helvetica has been associated with disease, but the extent of its pathogenicity is still being studied and under debate [R. monacensis appears to be similar to that of other pathogenic SFG rickettsiae [R. helvetica showed disrupted or truncated amino acid sequences in genes encoding proteins involved in cell invasion in SFG Rickettsia and confocal laser scanning microscopy revealed the bacteria spread by cell breakdown rather than cell to cell spread [R. helvetica colonization and transmission by the tick host. In light of the apparent similarities between R. helvetica and non-pathogenic Rickettsia species, its high prevalence in tick populations and effective vertical transmission [Coxiella, Francisella and Rickettsia, and have been shown to affect tick fertility, overall fitness and possibly even vectorial capacity [I. ricinus ticks and R. helvetica, interference of the underlying processes involved could be exploited in order to affect I. ricinus fitness and/or pathogen transmission. These findings further highlight the importance of the examination of the specific mechanisms involved in R. monacensis-I. ricinus and R. helvetica-I. ricinus interactions.Despite the well-described abundance of data on proteins involved in the mediation of rickettsial infection in ticks and their subsequent transmission, it is difficult to predict which proteins are most suitable as targets for transmission-blocking vaccines and experimental evidence using immunized hosts is lacking. Moreover, different ick host , 143 andr debate , 154. Cekettsiae , 155. Insmission , its effsmission , 158. Mucapacity , 159. IfBabesia species, the causative agents of babesiosis, are apicomplexan malaria-like parasites of the red blood cells transmitted by Ixodes ticks. They are referred to as piroplasms, together with Theileria and Cytauxzoon species, because of their pear-shaped intra-erythrocytic stage. Babesia species infect a wide spectrum of mammalian hosts as well as several avian species and are, after trypanosomes, the most common group of blood parasites [Babesia bovis and Babesia bigemina are transmitted by Rhipicephalus spp. ticks. In Europe, the disease is mainly caused by Babesia divergens and transmitted by I. ricinus . Equineiewed in , 168).Babesia-infected blood show less severe symptoms than naturally-infected animals and develop a protective immunity upon recovery  [Babesia exoantigens, proteins released in the medium during parasite cultivation, have immunological capacities to reduce severity of the infection, as shown for the current commercialized vaccine against canine babesiosis [The current protection against bovine babesiosis is based mostly on the vaccination of young cattle with live attenuated parasites. The animals inoculated with iewed in ). Recentiewed in . Moreovethe host . The Baben (AMA) \u2013176, thren (AMA) , 178 rhoen (AMA) , 179\u2013181en (AMA) \u2013167, P0 en (AMA) , subtilien (AMA) , and GPIen (AMA)  are potebesiosis .Babesia  [Humans are not natural, but accidental hosts for iewed in ). Nevertiewed in , 187). I to date . Cases o to date , 187). C to date , 179). A to date , 180, in to date , 183 or  to date \u2013191. Inti (s.l.) , 193.I. ricinus [B. divergens and have recently also been identified as the primary vector of B. venatorum  [I. ricinus has been identified as a competent vector of B. capreoli [B. microti [In Europe, the transmission of species of medical relevance is caused by  ricinus . These tsp. EU1) \u2013199. In capreoli  and B. m microti .Babesia parasites multiply asexually in the erythrocytes of the vertebrate host where the first sexual stages, gametocytes, occur [via the tick bite [s, occur , 203. Thick bite , 205.Babesia parasites negatively affects tick development [Babesia infection to tolerable levels [T. equi in in vitro cultures, reduced the parasitaemia in mice infected with B. microti and was shown to play a role in regulating the vectorial capacity of the tick for Babesia [T. equi in vitro and silencing of this gene in ticks by RNAi increased infection of the tick organs [Babesia infection and the recombinant protein affected the growth of B. bovis in in vitro cultures [B. gibsoni [Babesia transmission from the tick to the host have been identified or investigated, let alone investigated as candidates for anti-tick vaccines interfering with Babesia transmission.An infection with elopment , so the e levels . Longici Babesia , 209. Sik organs . Cystaticultures . Silenci gibsoni . Althoug gibsoni \u2013216, up  gibsoni , and SUB gibsoni  by RNAi,Borrelia and TBEV, multiple relevant studies have been conducted. Indeed, multiple tick proteins assist Borrelia with survival in the tick, transmission from the tick and subsequent successful infection of the vertebrate host. This is either through direct binding to the spirochete or by interacting with host factors to create favorable conditions for Borrelia survival. For TBEV, direct interactions of the virus with tick proteins has not been shown. However, there is experimental evidence that the tick protein sialostatin L2 increases TBEV survival by interacting with host factors (dendritic cells). In addition, immune responses to other tick proteins affect TBEV transmission from the tick to the host. Tick-host-pathogen interactions for other TBPs are less well described. For the obligate intracellular bacteria A. phagocytophilum and SFG-Rickettsia the mechanisms for cell-invasion and cell-to-cell spread are being investigated, and several bacterial proteins involved in these processes have been described. Whether these bacteria apply the same mechanisms and interact with similar host proteins in tick and host cells, remains to be elucidated. Experimental work has also shown that the presence of TBPs can be beneficial for the tick. For example, A. phagocytophilum induces ticks to express an antifreeze glycoprotein gene that enhances their survival in the cold [Babesia. Studies focusing on the transcriptome or proteome of both the tick and the TBP during acquisition and transmission might help us to determine the key proteins involved in the pathogen-tick interactions.This review aims at highlighting the efforts in pursuing tick proteins that are responsible for pathogen transmission and hence could serve as candidates for anti-tick vaccines. For the cold . ConversBorrelia [Borrelia and possibly also the vectorial capacity for other TBPs. Interestingly, it has recently been shown that I. scapularis secretes a protein, PIXR, that modulates the tick gut microbiome and milieu [Borrelia has been shown to induce antimicrobial responses in the tick [We have reviewed several tick proteins that have proven to affect transmission of various pathogens from the tick to the host. Unfortunately, their use as potential transmission-blocking vaccines has met limited success when tested as single vaccine formulations. One explanation could be the enormous evolutionary pressure on these proteins (and the encoding genes) as they are readily exposed to the immune system of multiple hosts and to a wide range of pathogens. Indeed, Van Zee et al.  have shoBorrelia . This afd milieu . One migthe tick . This shthe tick , 221.I. ricinus the haploid genome size is about 2.65 Gb  [Fortunately, tick researchers have more efficient tools available than ever before. The rise of advanced sequencing tools and bioinformatics has increased the power and sensitivity of antigen discovery. The tick genome is amazingly large: for  3.2\u00a0Gb) . This la 3.2\u00a0Gb) . Another 3.2\u00a0Gb) , 57, 224In vitro feeding techniques have been established and described for I. ricinus and it has been shown for larvae of other tick species that the volume of feeding medium used can go down to less than 1 ml, increasing the suitability of in vitro feeding to study tick-pathogen interactions [in vitro or in vivo. This could help to narrow the number of candidates that can be further pursued in preclinical relevant settings. The powerful techniques described above give tick researchers the highly needed tools to peel off the complex layers of tick-host-pathogen interactions and to find ways to tip the balance in favor of the host.The design of transcriptomic or proteomic studies for conserved tick proteins involved in TBP transmission is complicated by the variation in transmission times for different TBPs during the tick feeding process. In addition, although genomic studies have been carried out on the salivary/midgut genes of uninfected ticks or tick cell lines, the use of TBP-infected ticks for transcriptomic analyses is still scarce , most liractions , 230. Anractions . RNAi exerythema migrans), but far more challenging and costly for diseases such as HGA, SFG-rickettsiosis and human babesiosis. Interestingly, a recent cost-effectiveness assessment of a potential anti-tick vaccine protecting against LB and TBEV showed that such a vaccine would be cost-effective in a country where both diseases are endemic, and highlighted which pharmacoeconomic criteria need to be monitored [The future development and application of anti-tick vaccines do not only depend on the biological hurdles or technical (im)possibilities. Pharmaceutical companies need to be interested in producing and bringing safe and effective anti-tick vaccines into the market. Clinical phase I/II trials to investigate the safety and immunogenicity in healthy adults, are the first step. Yet, phase III trials assessing the effectiveness of a new vaccine are relatively easy for TBE and LB , tick vectors and animal or human hosts, the search for the \u2018magic bullet\u2019 is not an easy task. But, how far is the goal post exactly? The best way to bite back against tick-borne diseases is to obtain more knowledge on the many aspects of the interaction between ticks, pathogens and mammals and development of tools to study these. As we have described in this review, new powerful tools have enabled substantial progress in the understanding of tick-host-pathogen interactions and the discovery of potential vaccine targets in recent years. Increasing efforts to peel of the complex layers of tick-host-pathogen interactions will provide a higher chance of discovering new and more potent targets for anti-tick vaccines. Therefore, this might be the dawn of a new era where an anti-tick vaccine protecting against the most common TBPs will come to fruition."}
+{"text": "Rhipicephalus sanguineus, which is a vector of numerous pathogens causing diseases in animals and humans, is imported most frequently to many European countries from endemic areas in the Mediterranean region or from other parts of the world. Additionally, alien tick species with high epizootic and epidemiological importance can be imported while attached to dog skin to Europe from other continents. Companion animals play an even greater role in the spread of autochthonous tick species and transmission of pathogens to other animals and humans. Before travelling to endemic areas of tick-borne diseases, tourists should be acquainted with prophylaxis methods to protect themselves and their companion animals against tick attacks.The risk of transmission of pathogen-infected ticks by dogs and cats transported by humans has increased substantially in recent decades due to the rise in tourist and economic migration rates. Therefore, we highlight the role of companion animals, mainly dogs, travelling with their owners or importation of these animals in the transmission of ticks and tick-borne diseases to non-endemic areas. The brown dog tick Rhipicephalus sanguineus tick, which is a vector of numerous pathogens causing diseases in animals and humans, is imported most frequently from endemic areas to many European countries. Additionally, alien tick species with high epizootic and epidemiological importance can be imported on dogs from other continents. Companion animals play an even greater role in the spread of autochthonous tick species and transmission of tick pathogens to other animals and humans. Although the veterinary and medical effects of the parasitism of ticks carried by companion animals travelling with owners or imported animals are poorly assessed, these animals seem to play a role in the rapid spread of tick-borne diseases. Development of strategies for protection of the health of companion animals in different geographic regions should take into account the potential emergence of unknown animal tick-borne diseases that can be transmitted by imported ticks.Increased human mobility elevates the risk of exposure of companion animals travelling with their owners or imported from other regions to tick attacks. In this study, we highlight the potential role of dogs and cats taken for tourist trips or imported animals in the spread of ticks and tick-borne pathogens. The  Canis lupus familiaris) and cats (Felis catus), can be hosts for various tick species from the family Ixodidae ).The most important role in rapid transmission of ticks and associated pathogens over long distances is ascribed to seasonally migrating birds e.g., ,209,210),210209,2Before travelling to endemic areas of tick-borne diseases, tourists should be acquainted with prophylaxis methods to protect themselves and their companion animals against tick attacks. Information about tick species that infest dogs and cats most frequently, periods of the highest tick questing activity, and threats of zoonotic tick-borne diseases posed to animal health is indispensable for owners of companion animals."}
+{"text": "Passiflora edulis) seeds from Madeira Island and a commercial passion fruit oil was used as reference. The commercial oil and the extracts that were obtained by traditional Soxhlet method with ethanol and acetone did not reveal the presence of the two stilbenes, piceatannol and resveratrol. However, the extracts that were obtained by the ultrasound method showed significant amounts of piceatannol and resveratrol when compared with the commercial oil. The presence of these compounds indicates that this oil could have potential application in cosmetic and pharmaceutical industries, due to their proven antioxidant and anti-aging properties.Recently, studies on the by-products from the food industry, such as passion fruit seeds, have significantly increased, as these can have an added value, due to their properties, such as potential antioxidant activity. This study was conducted to determine the presence of piceatannol and resveratrol in various extracts of passion fruit ( Passiflora edulis) is one of the species used in the production of juices by the food industry. Only the passion fruit pulp is used in the production of the juice, and the discarded seeds generate thousands of tons of waste every year [Madeira Island is a Portuguese territory that is located in the Atlantic Ocean, which has a temperate tropical climate, which allows for the cultivation of various species of passion fruit. The purple passion fruit , in Using the RP-HPLC method, piceatannol and resveratrol peaks were detected with retention times of 35.66 and 36.40 min., respectively. 2 = 0.999 and R2 = 0.996, respectively.Two calibration curves, one for piceatannol and the other for resveratrol, were obtained with RThere was no evidence of the presence of piceatannol and resveratrol in both extracts that were obtained by the Soxhlet method. The chromatograms showed unknown peaks, although some of the peaks obtained the same retention time, they did not absorb at the same UV wavelength as piceatannol and resveratrol. Because piceatannol and resveratrol are sensitive to high temperatures, these compounds may have been degraded during the eight-hour extraction of the Soxhlet method. Although the Soxhlet is a method with excellent extraction performance, in the case of polyphenols, due to the solvent heating at boiling temperatures for several hours, the degradation of phenolic compounds might occur .Similar results have recently been described by Vigan\u00f3 and collaborators . The stuThe HPLC-DAD method allowed for separating piceatannol and resveratrol in a single run, as can be seen in the There are no significant differences regarding the amounts of piceatannol in the samples obtained with ethanol and acetone, according to Ultrasound extraction is a widely used method, since it is low cost, simple, and generally presents better results than conventional extraction methods . This imA general overview of the results that were obtained by other authors allows for concluding that the ultrasound method is faster, more efficient, and more selective for polyphenols than the Soxhlet method .Passiflora subpeltata pulp from India by UPHLC-MS analysis. Significant amounts of epicatechin, ferulic acid, and protocatechuic acid were detected [A recent study investigated and quantified the polyphenol content in detected . Rimandodetected .In In a previous study, the same commercial oil presented lower antioxidant activity in relation to the extracts that were obtained by ultrasound using acetone and ethanol as solvents. This activity was determined while using DPPH  and ABTS  methods . DespitePassion fruit seeds were obtained from the food industry of Madeira Island. These seeds were then dried in a stove and, after that, the extracts were prepared. These extracts were prepared according to Krambeck and collaborators . The extPiceatannol and resveratrol standards, as well as ethanol and formic acid, were obtained from Sigma Aldrich . Acetone was purchased from Fisher Chemical . Methanol was purchased from VWR Chemicals .The stock solutions containing 1mg/mL of piceatannol and the same concentration for resveratrol in ethanol were prepared. All of the solutions were stored at \u22124 \u00b0C. Subsequently, for the calibration curve, standard solutions with concentrations ranging from 1.25\u201320 \u00b5g/mL for piceatannol and 0.625\u201335 \u00b5g/mL for resveratrol were prepared.The flow diagram for the extraction of the two stilbenes, piceatannol and resveratrol, can be seen in For the extracts that were obtained by Soxhlet, each selected solvent was heated to its boiling point, and the reflux was maintained for eight hours. For the extracts that were obtained by ultrasound, an ultrasound bath (35 kHz/80 W)  was used. The extraction time was 60 min at room temperature. At the end of all tests, the solvents were removed while using a rotary vacuum evaporator R-300 .RP-HPLC was carried out with some modifications, according to Lai and collaborators , for theThe results were statistically evaluated by one-way analysis of variance (ANOVA), in which significant differences at the 5% level were analyzed by the Tukey\u2019s test. SPSS Software  was used for the statistical analysis in this study.Passiflora edulis that were obtained by the Soxhlet method or in the commercial oil.In this study, resveratrol and piceatannol were not detected either in the extracts of by-products of Extracts obtained by the ultrasound method using ethanol or acetone showed significant amounts of stilbenes such as piceatannol and resveratrol. Passion fruit by-products can be used in cosmetic and pharmaceutical industries having an added value, in addition to reducing the environmental pollution, avoiding the burning or landfill of waste.Passiflora edulis seeds oil with green solvents and the potential interest of this product to industries, as it represents a low-cost ingredient.The obtained results also suggest the possibility of production of"}
+{"text": "The objective of this study was to identify conditional relationships between multiple metal biomarkers that predict systolic and diastolic blood pressure in the non-institutionalized United States adult population below the age of 60.We used inorganic exposure biomarker data and blood pressure data from three cycles (1999\u20132004) of the National Health and Nutrition Examination Survey (NHANES) to construct regression trees for blood pressure among adults ages 20\u201360  to identify predictors of systolic (SBP) and diastolic blood pressure (DBP). We also considered relationships among non-Hispanic black, Mexican-American, and white adults separately.The following metal exposure biomarkers were conditionally predictive of SBP and/or DBP in the full sample: antimony (Sb), barium (Ba), cadmium (Cd), cesium (Cs), lead (Pb), tungsten (W) and molybdenum (Mo). The highest average SBP (>\u2009120\u2009mmHg) was observed among those with low Sb (\u2264 0.21\u2009\u03bcg/dL) high Cd (>\u20090.22\u2009\u03bcg/g creatinine) and high Pb (>\u20092.55\u2009\u03bcg/dL) biomarkers. Those with the highest average DBP had high urinary W levels (>\u20090.10\u2009\u03bcg/g creatinine) in combination with either urinary Sb\u2009>\u20090.17\u2009\u03bcg/g creatinine or those with urinary Sb\u2009\u2264\u20090.17\u2009\u03bcg/g creatinine, but with high blood Pb levels (>\u20091.35\u2009\u03bcg/dL). Predictors differed by ethnicity, with Cd as the main predictor of SBP among non-Hispanic black adults, and Pb not selected by the algorithm as a predictor of SBP among non-Hispanic white adults.Combinations of metal biomarkers have different apparent relationships with blood pressure. Additional research in toxicological experimental models and in epidemiological studies is warranted to evaluate the suggested possible toxicological interactions between Sb, Cd, and Pb; and between W, Sb, and Pb; for cardiovascular  health. We also think future epidemiological research on inorganic exposure sets in relation to health outcomes like blood pressure might benefit from stratification by race and ethnicity.The online version contains supplementary material available at 10.1186/s12940-021-00695-1. Elevated blood pressure (BP) contributes greatly to cardiovascular disease morbidity and mortality . In the The literature examining joint associations between multiple metals and markers of cardiovascular health is limited, particularly in the context of large population-representative samples. There are studies that have considered possible joint effects of metals and metalloids on blood pressure outcomes in the National Health and Nutrition Examination Survey (NHANES), for example zinc-and-copper  or mercuAnother study  analyzinThe objective of this study was to investigate whether combinations of metals could predict SBP or DBP in NHANES, which collects rich data on biomarkers of environmental exposures in the US population, using regression trees\u2014a popular data-driven method to identify the conditional effects of multiple exposures. Until recently, regression trees have been inappropriate for analysis of complex population-relevant surveys such as NHANES since traditional regression tree methods do not account for the clustering, stratification and weighting of complex survey designs. This study advances the methodology of population-scale environmental epidemiology by using survey-consistent regression trees to characterize conditional effects of multiple inorganic exposures on blood pressure in NHANES. We recognize that there may be systematic differences in exposure both to metals and to potential effect modifiers by race and ethnicity in the United States, and so in secondary analyses we fitted survey-consistent regression trees within race-ethnicity strata.n\u2009=\u200933) were excluded. One primary sampling unit (SDMVPSU\u2009=\u20093) had very few study participants (n\u2009=\u200932) and thus, these participants were pooled with another sampling unit (SDMVPSU\u2009=\u20091) to stabilize model estimation. After pooling data across survey cycles and applying exclusions, our final analytic dataset consisted of 2413 individuals with complete data on metallic concentrations, SBP, DBP, age, sex, race, body mass index (BMI) and smoking status  on a continuous basis with data-released in two-year\u2009cycles. For this analysis, we pooled data from the 1999\u20132000, 2001\u20132002, and 2003\u20132004 survey cycles and restricted our sample to include participants \u226520\u2009years and\u2009<\u200960\u2009years of age who participated at mobile examination centers (MEC), had SBP or DBP measurements taken, and in whom barium (Ba), Cd, Co, Cs, molybdenum (Mo), Sb, thallium (Tl), and tungsten (W) had been measured in urine, and Pb had been measured in blood. We restricted to adults under age 60 because in that decade of age diastolic blood pressure stops increasing and instead begins to decrease , and so SBP and DBP were measured via standardized protocols , 15. BriBlood and urine samples were collected from individuals that participated in the physical exams at MEC; samples were frozen until laboratory analyses could be performed. Urine creatinine was measured using an automatic colorimetric determination based on a modified Jaffe reaction while metals concentrations in urine and blood were measured using inductively coupled plasma-mass spectrometry (ICP-MS) with a dynamic reaction cell to reduce interferences. Urinary cadmium concentrations were adjusted for molybdenum oxide interference . Only th2 were included in the model while the associations with BMI were approximately linear. Race/ethnicity was also considered as a potential effect modifier, and therefore regression trees were also estimated separately within race/ethnicity strata. Tobacco smoke can be a source of exposure for many of these toxic metals [The potential influences of race and ethnicity, sex, age, body mass index (BMI), and smoking status were controlled for within the survey linear models. We considered that age and BMI might not exhibit linear relationships with SBP or DBP and used loess curves to examine the nature of those associations. The association between both SBP or DBP with age was best approximated by a quadratic function; thus, age and agec metals  and can c metals . TherefoTo account for the pooling of three different survey cycles, we calculated a 6-year survey weight per the CDC\u2019s recommendation, multiplying the four-year heavy metal subsample weight (WTSHM4YR) by two thirds for participants sampled during 1999\u20132000 and 2001\u20132002, while multiplying the two-year subsample weight (WTSA2YR) by one third for participants sampled during 2003\u20132004. These weights were not further re-calibrated to the subset of complete cases used in our analysis.2, race, sex, BMI, and smoking status, using survey linear regression methods from the survey package [Statistical analyses were conducted in R version 3.4.4. We first examined the independent relationship of each individual creatinine-corrected metal, natural log-transformed, with SBP or DBP, while adjusting for age, age package  and comprpms) method [wi(yi\u2009\u2212\u2009\u03bc) within clusters and the estimated cluster effect among clusters, thus accounting for the complex survey design on the expected distribution of Y under the null, where Y is independent of the groups defined by the binary split. For each variable, this test is performed many times, each at the optimal cut-point to account for the fact that the data was observed before selecting splits. Among the variables that are below the designated p-value , the variables and the cut-point that leads to the partition with the largest test-statistic is selected to split the data.To explore non-linear relationships and potential high-order interactions between metals, we modeled sample-weighted and survey-design corrected regression trees via the recursive partitioning for modelling survey data  method , 23. Thirpms algorithm also estimates the parameters of a survey regression model specified by (SBP or DBP\u2009~\u2009age\u2009+\u2009age2\u2009+\u2009BMI\u2009+\u2009sex + race\u00a0+ smoking status), while accounting for the survey design , producing survey-design consistent regression models for each node conditional on the binary splits. Predicted means of Y (SBP or DBP in our case) and standard errors are estimated within each node. The recursive partitioning uses the residualized SBP and DBP values within the child nodes until none of the partitioning tests yield permutation p-values <\u20090.05, or when a node reaches a specified size limit. We implemented rpms with 2500 permutations and restricted the minimum terminal node size to 10% of our sample size, meaning that the regression tree would not produce end nodes containing fewer than 10% of the unweighted sample. In additional models, we stratified by self-reported non-Hispanic white adults, Mexican American adults, and non-Hispanic black adults to estimate demographically specific regression trees. For each of these demographically specific trees, predicted SBP or DBP were adjusted for age, age2, BMI, sex, and smoking status.Within each node of the tree, the Combining three NHANES survey cycles 1999\u20132004), we examined how multiple metals were jointly associated with SBP or DBP among the 2413 individuals aged 20\u201359\u2009years with complete data on SBP, DBP, biomarkers of internal dose of Ba, Cd, Co, Cs, Mo, Pb, Sb, W, and Tl concentrations in urine had been measured (Pb was measured in blood), as well as age, sex, race, BMI, and smoking status. The metals Ba, Cd, Co, Cs, Mo, and Tl were detectable in >\u200980% of urine samples and Pb was detectable in >\u200980% of blood samples, per the LODs from the 2003\u20132004\u2009cycle ; metals 999\u20132004,p-value <2E-16), while barium (Ba) and cobalt (Co), and antimony (Sb) and tungsten (W) were moderately correlated . We then examined the individual associations between metals with SBP or DBP by regressing BP (mm Hg) on the log-transformed metal concentration while adjusting for age, age2, sex, race, BMI and smoking status. We observed numerous associations via this individual screening. Higher concentrations of Ba, Sb, W, and Pb were associated with higher SBP, and similarly, though with smaller magnitudes of effect, for DBP; additionally, increasing concentrations of Cs and Mo were associated with lower DBP  and Sb  were associated with elevated SBP, while Mo  was associated lower SBP. Additionally, while adjusting for all other metals, W  was associated with elevated DBP and Mo  was associated with lower DBP.We first examined the correlation structure of the 9 metals. While most metals only exhibited modest, weak, or no correlations, there were a few notable moderate and strong pairwise correlations: cesium (Cs) and thallium (Tl) were strongly correlated  using the primary regression trees that were trained on the 1999\u20132004\u2009cycles, then compared predicted versus reported blood pressure with Spearman\u2019s correlations. We found that that predicted SBP and DBP were moderately positively correlated with reported SBP and DBP  in these independent data.Finally, we tested whether the regression trees for SBP and DBP that were trained on three NHANES cycles , could be informative about SBP and/or\u00a0DBP in an independent NHANES dataset (the 2005\u20132006\u2009cycle). For this analyses, we predicted SBP and DBP for each participant in the 2005\u20132006\u2009cycle with complete biomarker, blood pressure, and covariate data while applying the same exclusion criteria  were associated with SBP and DBP. When we applied the regression tree approach that accommodates complex joint effects of multiple metal exposures, many of the metals predictive of SBP or DBP in this analysis had substantial overlap with the set identified in the more traditional regression approach. Those with higher concentrations of Sb, Cd, W, and Pb tended to have higher predicted SBP, while those with higher Cs and Mo tended to have lower SBP and DBP.rpms algorithm as the metal on which to partition the root node for the SBP tree, suggesting that Sb is an important overall predictor of SBP at the population level. However, the regression tree approach provided additional insights regarding the joint relationships between metals and blood pressure. For instance, at the population-level, it appears as though Sb, Cd, Pb, and their potential interactions may be particularly important for elevated systolic blood pressure. We found that the only sub-groups with average SBP estimated to be greater than 120\u2009mmHg, were those with either Sb\u2009>\u20090.21\u2009\u03bcg/g creatinine, or those with Sb\u2009\u2264\u20090.21\u2009\u03bcg/g creatinine but in combination with Cd\u2009>\u20090.22\u2009\u03bcg/g creatinine and with blood Pb\u2009>\u20092.55\u2009\u03bcg/dL. Additionally, the highest estimated DBP was among those with a metal biomarker profile of W\u2009>\u20090.10\u2009\u03bcg/g creatinine, Sb\u2009\u2264\u20090.17\u2009\u03bcg/g creatinine, and blood Pb\u2009>\u20091.35\u2009\u03bcg/dL. Although, Cd and Pb have previously been characterized as risk factors for higher blood pressure, there is less evidence regarding the potential impacts of W and Sb [The metal that was most strongly associated with SBP (Sb) in linear models was also selected by the W and Sb , and nonOur analysis also suggested that the metallic determinants of SBP and DBP differ across demographic subgroups of the US population, though there are also some similarities. For instance, blood Pb levels were identified as a predictor of elevated SBP in both non-Hispanic black adults and Mexican American adults, and of elevated DBP among both non-Hispanic white adults and non-Hispanic black adults. However, the conditional relationships between Pb and other metals for their impacts on BP differed within each of these sub-groups. Similarly, W was included in all SBP and DBP trees, except for the DBP tree for non-Hispanic black adults, and was often selected included within the same branch of the tree as Pb. Antimony (Sb), which was the root node for the population-level SBP tree, appears to primarily affect SBP among non-Hispanic white adults, while Cd appears to be a particularly important predictor of elevated SBP among non-Hispanic black adults. The unique metallic risk factors and conditional relationships within these racial and ethnic subgroups could be due to different sources of exposure. For example: a major source of cadmium exposure is smoking , and nonOur study provides significant and novel insights into how environmental exposure to metals relate to blood pressure in the United States population. The most notable results from our study were the identification of thresholds and joint relationships between W, Sb, Cd, and Pb as determinants of elevated SBP and DBP. Exposure to Pb and Cd in the US population has declined since the 1980s, and a recent study found that the declining rates of cardiovascular diseases are likely related, in part, to these reductions in exposure to Pb and Cd . HoweverOur results suggest that higher Sb concentrations were associated with higher SBP, and that co-exposure to Cd and Pb, among those with lower Sb concentration, may have elevated SBP. We also found that higher W concentrations were associated with higher DBP, and our observed associations with Sb and Pb on DBP were conditional on W concentrations. Although numerous epidemiologic studies have observed relationships between Cd and Pb with elevated blood pressure , fewer sOur findings also suggest that higher concentrations of Cs and Mo were associated with lower BP . Previous studies examining the impacts of Cs and Mo on BP have been limited in number. Our current results support findings from a previous analysis of NHANES survey cycle data from 1999 to 2012, which found that Cs was associated with lower SBP and DBP , and resThis paper illustrates a novel data analysis approach that can be applied to other studies of how multiple exposures may associate with health outcomes, while leveraging the rich exposure data in large surveys. Though our analysis focused on a panel metals, this approach can complement the growing interest in environment-wide and exposure-mixture studies  to inclurpms to data from adults age 20\u201360 in the United States, we identified numerous relationships between metal exposure biomarkers and SBP or DBP, with the most notable combinations being the potential interactions between W, Sb, Cd and Pb. These findings add to the current body of evidence that Cd and Pb exposures are risk factors for elevated blood pressure, while providing additional evidence for an association between Sb and W with elevated BP, which may also modify the cardiovascular impacts of Pb and Cd. We also found that racial and ethnic sub-groups of the US population may have different metallic determinants of SBP and DBP, with high Sb being particularly relevant among non-Hispanic white adults and Cd being especially pertinent for BP among non-Hispanic black adults. The rpms framework can be used to model additional sets of exposures in future studies, advancing understanding of how the environment in gestalt contributes to health and disease in specific  human populations.In summary, in this application of Additional file 1: Supplemental Fig.\u00a01. Among non-Hispanic black adults: regression tree for estimated SBP as a product of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status. Urine metal biomarkers are corrected for grams of creatinine. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 2: Supplemental Fig.\u00a02. Among Mexican-American adults: regression tree for estimated SBP as a product of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status. Urine metal biomarkers are corrected for grams of creatinine. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 3: Supplemental Fig.\u00a03 Among non-Hispanic white adults: regression trees for estimated SBP as a function of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 4: Supplemental Fig.\u00a04. Among non-Hispanic black adults: regression tree for estimated DBP as a function of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 5: Supplemental Fig.\u00a05. Among Mexican-American adults: regression tree for estimated DBP as a function of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status within strata of Mexican American adults. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 6: Supplemental Fig.\u00a06. Among non-Hispanic white adults: regression tree for estimated DBP as a function of metals biomarkers in urine and blood while adjusting age, age2, sex, BMI and smoking status. Concentrations of metal biomarkers are either \u03bcg/dL blood (Pb only) or \u03bcg/g creatinine .Additional file 7: Supplemental Table 1. Proportions of metals concentrations with reported values that were above the limits of detection from the 2003-2004 cycle (n=852).Additional file 8: Analysis Scripts and Data."}
+{"text": "Magnetohydrodynamic (MHD) flow with Hall current has numerous applications in industrial areas such as Hall current accelerators, MHD power generators, planetary dynamics, Hall current sensors, etc. In this paper, the analysis of an unsteady MHD Casson fluid with chemical reaction over a rotating cone is presented. The impacts of Hall current, joule heating, thermal radiation, and viscous dissipation are analyzed. Entropy optimization is also considered in the present analysis. The system of coupled equations is tackled with homotopy analysis method (HAM). The convergence of HAM is also shown through figures. Deviations in the flow due to dimensionless parameters are shown graphically. Similarly, the variation in skin friction, Nusselt number, and Sherwood number are deliberated through tables. A justification of the current consequences is presented. The fluid flows through a cone have inspired attention due to recent improvements of innovative technologies. Fluid flows have excellent applications in many engineering and industrial fields like aeronautical engineering, solar collectors, rotating heat exchangers, homeotherapy treatment, endoscopy scanning, electronic chips, etc. Keeping in mind the significance of rotating flows, Kumari et al.  first prThe analysis of MHD flow with Hall currents has numerous applications in industrial areas such as Hall currents accelerators, MHD power generators, planetary dynamics, Hall current sensors, etc. Initially, Sato  investigDifferent fluids, such as viscoelastic fluid, Williamson fluid, Jeffrey fluid, micropolar fluid, power-law fluid, Casson fluid, etc., are named as non-Newtonian fluids. A model of the Casson fluid  is preseIt is well known that entropy, as a thermodynamic function, reflects a system\u2019s operating status. At the same time, it is necessary to minimize the entropy generation of a system to improve its working effectiveness. Entropy generation minimization techniques can be employed for the optimization of technical systems including heat exchangers, elements of nuclear and thermal power plants, ventilation and air conditioning systems, and so on. Thermodynamic second laws are utilized to examine the entropy optimization in term of the entropy age rate. Entropy augmentation is exploited to elucidate the performance of dissimilar contexts in modern and structure applications. Entropy is imitative from Greek word entropia, which implies that \u201ca moving in the direction of\u201d or \u201cchange\u201d. Entropy calculation is essential as it classifies the parameters for energy loss. Alternatively, thermodynamics second law was employed to minimalize the entropy optimization in engineering systems by Bejan ,31. UsinThis work presents the analysis of MHD Casson fluid flow with chemical reaction over a rotating cone. Joule heating, radiation, viscous impact, and Hall current are deliberated in this work. Furthermore, the features of entropy generation with first-order chemical reaction are examined. The system of coupled equations is tackled with HAM. The convergence of HAM is also shown in the following figures. Deviation in the flow distributions due to dimensionless factors are published through figures. The validation of the present results is presented through tables. Unsteady and incompressible Casson fluid flow with chemical reaction by a rotating cone is considered here. The cone rotates with angular velocity The general Ohm\u2019s law with Hall current is defined asHere, in this analysis, the electric field is ignored. Therefore, Equation (1) reduced asFurthermore, the basic model of the Casson fluid is demarcated asIn view of the mentioned assumptions, the leading equations of the Casson fluid and the general Ohm\u2019s law, including Hall current effect, are specified asHere ConsideringThe transformed equations areThe velocity  is conceded by HAM. It is supposed that Withorder problemsLet When By Taylor\u2019s series expansionThe auxiliary constraints are nominated such that the series (52\u201355) converge at HAM certifies the series solution\u2019s convergence of the demonstrated problem. The assisting factor .The coupled differential equations are treated analytically by means of HAM. Comparisons of the present analysis with the previous analysis mentioned in the literature by Chamka et al.  are presThe deviations in entropy and Bejan number due to the dimensionless embedded parameters are displayed in The arithmetical values of skin friction, Nusselt, and Sherwood numbers are illustrated in An analysis of unsteady MHD Casson fluid flow with chemical reaction over a rotating cone is presented in this article. Joule heating, thermal radiation, Hall current, and viscous dissipation are considered in this work. Furthermore, the features of entropy generation with first order chemical reaction are examined. The nonlinear system of equations is tackled with HAM. The key points are enumerated underneath.Primary velocity distribution reduces with heightens in Casson, velocity slip, and magnetic factors, whereas the reverse trend is observed against Hall, mixed convection, and buoyancy ratio parameters.Secondary velocity distribution moderates with escalation in Casson, magnetic, mixed convection, velocity slip, and buoyancy ratio parameters, whereas the escalating impact is observed with increasing Hall parameter.Temperature distribution decreases with increasing Hall parameter, whereas the rising impact is observed with escalation in Casson parameter, magnetic parameter, Brinkman number, and thermal radiation.Concentration distribution decreases with increasing Schmidt number and chemical reaction parameter. Entropy generation decreases with increasing Casson parameter and Hall parameter, while it increases with Brinkman number, diffusion parameter, and magnetic parameter. Bejan number decreases with increasing Brinkman number and Hall parameter, whereas the increasing impact is detected with Casson parameter, diffusion parameter, and magnetic parameter."}
+{"text": "A quadratic multiple regression analysis for these physical quantities has also\u00a0been carried out to improve the present model\u2019s effectiveness in various industrial and engineering areas. Furthermore, an\u00a0appropriate agreement is obtained on comparing the present results with previously published results.The present article provides a detailed analysis of entropy generation on\u00a0the unsteady three-dimensional incompressible and electrically conducting magnetohydrodynamic flow of a\u00a0Casson nanofluid under the influence of mixed convection, radiation, viscous dissipation, Brownian motion, Ohmic heating, thermophoresis and heat generation. At first, similarity transformation is used to transform the governing nonlinear coupled partial differential equations into nonlinear coupled ordinary differential equations, and then the resulting highly nonlinear coupled ordinary differential equations are numerically solved by the utilization of spectral quasi-linearization method. Moreover, the effects of pertinent flow parameters on velocity distribution, temperature distribution, concentration distribution, entropy generation and Bejan number are depicted prominently through various graphs and tables. It can be analyzed from the graphs that the\u00a0Casson parameter acts as an assisting parameter towards the temperature distribution in the absence of viscous and Joule dissipations, while it has an adverse effect on temperature under the impacts of viscous and Joule dissipations. On the contrary, entropy generation increases\u00a0significantly for larger Brinkman number, diffusive variable and concentration ratio parameter, whereas the reverse effects of these parameters on Bejan number are examined. Apart from this, the numerical values of some physical quantities such as skin friction coefficients in  Eastman et al.2 established a nanofluid containing copper nanometer-sized particles dispersed in ethylene glycol, and the nanofluid\u2019s thermal conductivity was larger than any other pure ethylene glycol. Khan and Pop3 suggested an innovative mathematical model on the steady flow and thermal behaviour of nanofluid flowing over a linearly stretching sheet. Seth et al.4 executed a comprehensive study on an attractive mathematical model containing the MHD mixed convection stagnation point flow of micropolar nanofluid.Nanofluids are generated by colloidal suspensions of nanosized particles in the base fluid. The nanoparticles are usually made of metals, oxides, carbides, or carbon nanotubes. For example, the base fluids are taken as water, ethylene, glycol, oil and many others. It is observed to have various important useful properties of nanofluid such as the increment of the heat transfer and the stretching rate of nanofluid. The increment in the effectiveness and performance of coolant is required in various areas such as electronics, power production, vehicle, engineering and industrial system etc. Generally, the nanofluid coolant is used to increase the quality of aerodynamics designs. Recently, nanofluid is applied in various cases, such as aerodynamics power engineering, heat exchanger, cooling of transformer, chemical separation devices, solar water heating, micropamps and drug recovery system. For huge requirements, the researchers are motivated to investigate the coolant, which has a high performance. So the researchers want to enhance the thermal conductivity of traditional fluids like ethyline glycol, water, oil etc. The thermal conductivity of ordinary base fluids is very low, and it is necessary to enhance the thermal conductivity of base fluids. The Suspension of nanoparticles in the base fluid improves the thermal conductivity and convective heat transfer. Initially, Choi5 executed an investigation on the solution of boundary layer equation of Newtonian fluid over a stretching plate. Generally, Crane\u2019s suggested model of the linearly stretching plate is not used in many industrial sectors. So Researchers find an interest for investigating the various aspects of the stretching rate. Remembering the vast applications of the stretching rate, Fang et al.6 investigated boundary layer flow over a stretching sheet with a power law velocity assuming the variable thickness of the sheet. The influences of different controlling parameters and different solution branches on the velocity and shear stress distributions were prominently illustrated. Rana and Bhargava7 analyzed flow and heat transfer of a nanofluid over a nonlinearly stretching sheet. Here the combined effects of Brownian motion and thermophoresis were prominently discussed. Kameswaran et al.8 examined Hydromagnetic nanofluid flow due to a stretching or shrinking sheet by taking viscous dissipation and chemical radiation effects into account. Here the external magnetic field significantly affects the nanofluid flow over a stretching sheet and controls the boundary layer of nanofluid. The impacts of magnetic field and viscous dissipation on the wall heat and mass transfer rates were highlighted significantly. Some other relevant and innovative investigations under different conditions are discussed by several authors12.The study on flow over a stretching sheet is significantly important for using its application in many engineering and industrial sectors. Its fascinated applications are utilized in the production of plastic and rubber sheets, metalworking process such as hot rolling, aerodynamic extrusion of plastic sheets, melt spinning as a metal forming technique, elastic polymer substance and production of emollient, paints, production of glass-fibre etc. Crane13 was the first to develope an interesting model regarding the incompressible magnetohydrodynamic flow of a viscous fluid past a stretching surface. Sheikholeslami et al.14 displayed a keen interest to address the numerical simulation of MHD nanofluid flow and heat transfer between two parallel plates in a rotating system by taking the effect of viscous dissipation into account. They discussed various important results including the nature of the magnitude of the skin friction coefficient and Nusselt number against the disparate values of pertinent parameters. They showed that magnetic parameter and rotation parameter had favourable effects on the magnitude of the skin friction coefficient, but the adverse effects of both of these parameters on Nusselt number were visualized. Khan and Makinde15 studied MHD laminar boundary layer flow of an electrically conducting water-based nanofluid containing gyrotatic microorganisms along a convectively heated stretching sheet. They incorporated the convective boundary layer condition. Hsiao16 initiated the model regarding micropolar nanofluid flow towards a stretching sheet with the multimedia feature in the presence of MHD and viscous dissipation effects by taking Brownian motion and thermophoretic effect into account. Contributions on the topic of MHD flow of the electrically conducting fluid under different conditions are depicted in the articles19.The flow of an electrically conducting fluid in the presence of magnetic field is utilized in many engineering devices, such as MHD propulsion system, plasma confinement, liquid-metal cooling of nuclear reactors, electromagnetic pumps, MHD generators etc. The strong magnetic field generates a resistive Lorentz force, which controls the flow. In heat transfer processes, for getting the remarkable outcomes of the product, the rate of cooling can be controlled. Under the influence of the externally applied magnetic field, the cooling rate of liquid is controlled. The researchers emphasize the study on magnetohydrodynamic fluid flow due to its immense potentials for using in various engineering and industrial problems. For the requirements of the new aspects of the investigation, the researchers move towards analyzing the magnetohydrodynamic fluid flow. Recalling the remarkable applications of this work, Pavlov20 studied the effects of variable properties along with the effects of suction/injection and Hall current on a steady MHD convective flow generated by an infinite rotating porous disk. They inferred that Hall parameter m had an amazing effect on the radial and axial velocity profiles. They noticed that increasing the values of 21 tried to derive the exact analytical solutions for the MHD flows of an Oldroyd-B fluid through a porous space in the presence of the effect of Hall current. Some of the recent research works about this phenomena are executed by several authors26.It is an established fact that the flow of an electrically conducting fluid under the impact of a magnetic field produces a transverse flow because of the effect of Hall current, which rises due to the strong intensity of the magnetic field. The Hall effect has the potential to deal with many real life problems, and has a great importance to signify different flow features within the flow field. As this context, for its remarkable applications in various cases, the researchers find a keen interest to analyze theoretically and graphically about the impact of Hall current on the MHD flow of the viscous, incompressible and electrically conducting fluid. Maleque and Sattar27 tried to execute the unsteady-state problem. The pioneering attempt to find a fluid film on an accelerating stretching surface was done by Wang. He introduced a similarity transformation to turn the Navier\u2013Stokes equations into the nonlinear ordinary differential equations. Attia28 presented an interesting model for analyzing the impact of the external uniform magnetic field on the unsteady flow of an incompressible, viscous and electrically conducting fluid over an infinite rotating porous disk. Freidoonimehr et al.29 initiated a fascinating model to investigate the effect of the unsteady MHD laminar free convective flow of nanofluid over a porous vertical surface. They analyzed the effect of various parameters like magnetic parameter, unsteadiness parameter, buoyancy parameter etc. on velocity and temperature distribution. They examined that unsteadiness parameter was highly responsible for decreasing skin friction coefficient, whereas the reverse effect of it on the rate of mass transfer was observed evidently. Some of the relevant and effective research works are done by several authors32.For the improvement of the realistic fluid flow problems, it is necessary for the researchers to move towards analyzing the time dependent models. Firstly, Wang33 made a first attempt to investigate the heat transfer of steady MHD non-Newtonian Casson fluid flow between two co-axial cylinders. Many years had passed to improve the investigation of this work. Nadeem et al.34 discussed the influence of the externally applied magnetic field on the Casson fluid flow in two lateral directions past a porous and linear stretching sheet. They presented the interesting results against the variation of Casson flow parameter as well as other fluid flow parameters. Recalling huge requirements of Casson fluid in real life, Prashu and Nandkeolyar35 introduced a mathematical model to get the interesting results about the influence of unsteady three dimensional incompressible and electrically conducting magnetohydrodynamic flow of Casson fluid over the stretching sheet under the combined effects of radiative heat transfer and Hall current. Various relevant and useful investigations are presented by several authors39.The investigation of non-Newtonian fluid attracts the researchers very much due to its huge applications in industrial and engineering areas. In 1995, Casson established a fluid flow model along with the flow of non-Newtonian liquids. Casson fluid is one type of nanofluid, and it has a great significance in various cases. Recently, the Casson fluid flow model becomes meaningful for its fascinated application in human life. The examples of Casson fluid are honey, Chilly sauce, jelly, blood etc. The Casson fluid flow model has a remarkable requirement in modern science. Casson fluid displays the properties of yield stress. However, when yield stress becomes large, Casson fluid turns into a Newtonian fluid. If yield stress is less than shear stress, Casson fluid starts move. Taking care of it Eldabe and Salwa40 established an amazing mathematical model regarding heat and mass transfer of an unsteady MHD flow of a rotating fluid past over a vertical porous flat plate with taking radiative heat transfer and natural convection into account. They estimated that increasing the values of the Prandtl number and the radiative parameter diminished the temperature of fluid within the boundary layer. Ansari et al.41 investigated the flow of non-Newtonian viscoelastic nanofluid over a linearly stretching sheet under the impact of the uniform magnetic field and radiative nonlinear heat transfer. The remarkable and innovative studies about this present phenomena are illustrated in the articles45.Heat transfer system is significantly performed by thermal radiation. The effect of thermal radiation finds the potential for using in many industrial and engineering applications, such as electrical power generation, nuclear energy plants, astrophysical flows, space vehicles, solar systems, gas production etc. In the present investigation, our motive is to develope various models which depict the impact of radiative heat transfer on the magnetohydrodynamic fluid flow under different conditions. Mbeledogu and Ogulu46 tried to investigate the entropy generation in a convective heat transfer process. Shit et al.47 scrutinized a mathematical model to analyze entropy generation on unsteady two-dimensional magnetohydrodynamic flow of nanofluid over an exponentially stretching surface in a porous medium under the influence of thermal radiation. This research work was extended by Shit and Mandal48. They treated Buongiorno\u2019s model to investigate entropy generation on unsteady magnetohydrodynamic flow of Casson nanofluid over a stretching vertical plate under the influence of thermal radiation. Their investigation suggests that Casson parameter increases entropy generation sharply, while thermal radiation increases it closer to the plate. In this context, some of the relevant and remarkable investigations are described in the articles55.In a thermodynamic system, the entropy generation is the amount of entropy which is created generally during irreversible processes by means of heat flow through a thermal resistance, fluid flow through a flow resistance, diffusion, Joule heating, friction between solid surfaces, fluid viscosity within a system etc. According to the second law of thermodynamics, the total entropy of the system remains unchanged during a reversible process. On the other hand,over a surface, when nanofluid flows are passing through several irreversible processes, such as diffusion, friction between the layers of fluid due to viscosity, thermal resistance, flow resistance, Joule heating etc., then the increment in the total entropy of the system can be observed. It is well known that entropy generation has a crucial role to diminish the required sources of energy of the system. In order to get better efficiency and performance in most engineering and industrial applications, the key concern of the researchers is to lessen the entropy generation. Taking care of this, initially, Bejan56 explored the quantized quasi-two-dimensional Bose\u2013Einstein condensates with spatially modulated nonlinearity in the harmonic potential. Liang et al.57 initiated a family of exact solutions of the one-dimensional nonlinear Schr\u00f6dinger equation for analyzing the dynamics of a bright soliton in Bose\u2013Einstein condensates with the time-dependent interatomic interaction in an expulsive parabolic potential. Wen et al.58 displayed the matter rogue wave in Bose\u2013Einstein condensates with attractive interatomic interaction analytically and numerically. Chen et al.59 combined the cellular dynamical mean-field theory with the continuous time quantum Monte Carlo method for getting the rich phase diagrams in the Hubbard model on the triangular kagome lattice as a function of interaction, temperature, and asymmetry. Moreover, in the field of quantum mechanics, Abliz et al.60 analyzed the entanglement control in an anisotropic two-qubit Heisenberg XYZ model in the presence of the external magnetic fields. Hu et al.61 described a brief explanation on the basis of the necessary and sufficient conditions for local creation of quantum correlation. Qi et al.62 represented a real physical system containing the non-Abelian Josephson impact between two 63 proposed an optical system describing the photonic Josephson effects in two weakly linked microcavities with ultracold two-level atoms. Furthermore, Ji et al.64 introduced an optical system to let a direct experimental observation of the quantum magnetic correlated dynamics of the polarized light.In quantum statistical mechanics, the idea of entropy was promoted by John von Neumann. Consequently, the entropy called as \u201cvon Neumann entropy\u201d is actually an extension of the classical Gibbs entropy concepts to the field of quantum mechanics, and is generally defined as follows So far as the researchers are investigating the impact of unsteady three-dimensional magnetohydrodynamic flow of Casson nanofluid over a stretching sheet for its remarkable requirement in engineering and industrial applications. No one has discussed about the unsteady three-dimensional magnetohydrodynamic flow of Casson nanofluid over the stretching surface in the presence of radiative heat transfer and mixed convection with taking viscous dissipation, Brownian motion, Ohmic heating, thermophoretic effect, heat generation and Hall current into account. In this present article,the main objective of the authors is to represent a mathematical model containing the unsteady three-dimensional incompressible and electrically conducting magnetohydrodynamic flow of Casson nanofluid over a stretching sheet in a vertical direction under the influence of radiative heat transfer, Hall current, Mixed Convection, Viscous and Joule dissipations. Similarity transformations are utilized to turn the nonlinear partial differential equations into nonlinear ordinary differential equations. The obtained nonlinear coupled ordinary differential equations are numerically solved by using spectral quasi-linearization method x-axis is along the sheet in the vertically upward direction, and y-axis is normal to the sheet. It is assumed that the\u00a0nanofluid is occupies the region x-direction is assumed to be B(t) is applied in the positive y-direction, which is normal to the surface of the sheet. The geometry of the problem is presented in Fig.\u00a0We consider the unsteady three-dimensional flow of an incompressible, homogeneous, electrically conducting Casson nanofluid past a vertical stretching sheet in the presence of an external magnetic field. We assume that mentclass2pt{minimThe rheological equation of the Casson fluid is given as follows:Using the above assumptions, the governing boundary layer equations i.e. continuity, momentum, energy and concentration equations can be expressed, respectively, as a and u, v and w are the components of velocity in x, y and z directions, respectively. t is time variable, m is Hall current parameter, T is the temperature of fluid within the boundary layer, C denotes nanoparticle concentration within boundary layer region, The suitable boundary conditions are defined as 65, the radiative heat flux is simplified asHere optically thick fluid is taken, and the radiative heat flux vector is defined with the help of the Rosseland approximation as follows67 are generated asFor simplifying the present mathematical model, the similarity transformationsx and z directions For engineering interest, the significant physical quantities, such as skin friction coefficients in The present physical quantities in non-dimensional form are defined as The obtained ordinary differential Eqs. \u201312) alo alo12) akth Chebyshev polynomial kth Chebyshev polynomial is defined as For solving the linearized and decoupled equations \u201321) num num21) nHere The solution error method is used to justify the convergence of the solutions for validating our results. In this method, the norm of the difference of the solutions at two consecutive iterations is calculated. If this norm approaches to very small value, then the method converges, and it validates the results obtained by using spectral quasi-linearization method (SQLM). The errors in the solutions of The errors in the solutions are represented through the Fig. 3 is executed after neglecting certain parameters. Table\u00a0Nt at x-direction against the significant parameters 34 is fulfilled through Table\u00a0In order to validate the present results, a comparison of the present results with the results obtained by Khan and PopThe term The term The term The terms The non dimensional form of entropy generation can be expressed as follows:The study on the entropy generation of any system is prominent to explain the irreversibility of thermal energy in the system. The main objective of the present model is to minimize entropy generation for obtaining better outcomes by controlling several physical parameters. The entropy generation rate per unit volume of the present model can be constructed mathematically as follows:Utilizing the similarity transformation, the nondimensional entropy generation can be reduced to the following formThe numerical study of the present mathematical model is analyzed by taking the effects of Hall current, radiation, mixed convection, heat generation, viscous and Joule dissipations, Brownian motion and thermophoresis into account under some boundary conditions. The present model of the physical problem is characterized by a set of time and space dependent nonlinear partial differential equations containing momentum equation, energy equation and concentration equation. Similarity transformations are applied to obtain a set of nonlinear ordinary differential equations, and SQLM is used to solve these ordinary differential equations subject to the relevant boundary conditions. From the physical point of view, the impact of several values of specified parameters on the flow field, such as mixed convection parameter, Prandtl number, magnetic number, Eckert number, Brownian motion parameter, thermophoretic parameter, Schmidt number, Hall current parameter, Radiation parameter and heat generation parameter are explored and plotted graphically. In the current section, for the numerical computation, the default values of pertinent parameters are taken as M on the profiles of velocity components in x and z-directions is depicted graphically in Fig. M leads to reduce the velocity x-direction within the boundary layer region. When the Casson parameter x-direction gets decreased with increasing the values of magnetic parameter M. On the contrary, the dual nature of transverse velocity  applied on the flow of an electrically conducting nanofluid produces Hall current and the impact of this current on the profiles of nanofluid velocity is demonstrated graphically in the Fig.\u00a0x-direction. However, the small increment in m can be visualized. The nanofluid velocity z direction enhances considerably on increasing the Hall current parameter m. Physically, lessening the conductivity m, which generates a magnetic damping force caused to speed up the velocity components of the nanofluid. The impact of unsteadiness parameter A on the velocity profiles can be observed in Fig.\u00a0x and z directions. It is also evident that the increment in Ec increases the boundarylayer thickness. It is observed from Fig.\u00a0Figures\u00a0tr and Prandtl number Pr on the fluid temperature is portrayed in Fig.\u00a0tr. The temperature ratio parameter tr indicates the ratio of the fluid temperature at the surface to the fluid temperature outside the boundary layer region. From Fig.\u00a0Figures\u00a0Nt. It is ascertained that Nt acts as an assisting parameter in case of concentration distribution inside the boundary layer region. From the physical point of view, this observation occurs due to the increment of the thermophoretic phenomena. Moreover, Fig.\u00a0Sc is responsible for decreasing the concentration within the boundary layer, which results in thinning the thickness of nanoparticle concentration boundary layer. The larger Schimdt number means the lesser mass diffusivity, which indicates to decrease the nanoparticle concentration throughout the boundary layer.Figure\u00a0M on entropy generation Be. It is noticed from Fig.\u00a0m on entropy generation profile. The increment in Hall current parameter enhances the entropy generation near the sheet, but at a certain distance from the sheet, the entropy generation diminishes significantly. In case of Bejan number, the same phenomenon is observed through the Fig.\u00a0m away from the sheet. As a result, Bejan number decreases. Figures\u00a0L on Be, respectively. Figure\u00a0L. Figure\u00a0L decreases Be. For the large L, the mass diffusivity of nanoparticle increases, which causes to rise the entropy generation. From the physical point of view, since the total entropy generation rate enhances, Bejan number decays. Figures\u00a0Be against the distinct values of temperature ratio parameter Be is elaborated through the Figs.\u00a0Nr has a tendency to enhance the entropy generation and Bejan number rapidly. For the higher estimation of Nr, the temperature increases, which results in an increment in entropy generation and Bejan number. Here the thermal irreversibility dominates over the total entropy generation.Figures\u00a0mentclasspt{minimax direction is a decreasing function of unsteadiness parameter A, Hall current parameter m, z direction has a decreasing effect on Casson parameter Pr. Moreover, the favourable behaviour of the parameters x direction can be noticed. The parameters z direction. The parameters For the engineering interest, the effect of disparate values of pertinent parameters on the numerical values of some physical quantities such as skin friction coefficients (mentclass2pt{minimmentclass2pt{minimx-direction, the values of z-direction, the numerical values of In the present section, the skin friction coefficients A are negative, while the values of the coefficient of m are positive. Consequently, it can be concluded from the Eq. (x-direction is noticed, on the contrary, the reverse trend of Hall Current parameter towards it takes place. Moreover, it can be noted that on increasing the Schmidt number, the values of the coefficient of the unsteadiness parameter are greater than the values of the coefficient of the Hall current parameter in magnitude, which signifies that a small change in the unsteadiness parameter leads to a large perturbation in z-direction, whereas the assisting behaviour of the unsteadiness parameter on it can be noted. Table\u00a0z-direction is much better than that of the quadratic regression estimates for the skin friction coefficient in x-direction, the reduced Nusselt number and the reduced Sherwood number.From Table\u00a0 the Eq.  that the the Eq.  it can bx- direction, which results in decreasing the momentum boundary layer thickness. But in case of transverse velocity, the dual nature of these parameters is observed prominently. On increasing the magnetic parameter and Casson parameter, the transverse velocity is decreasing drastically away from the sheet, but the reverse phenomena is noticed in the region closer to the stretching sheet. On the contrary, the magnetic parameter has a tendency to increase temperature profile.Magnetic parameter and Casson parameter lead to retard the Casson nanofluid motion in x- direction slowly, whereas it boosts to increase the transverse velocity highly.On the other hand, Hall current parameter declines temperature, which leads to decay the thermal boundary layer thickness. Moreover, Eckert number and mixed convection parameter increase the momentum of Casson nanofluid strictly. As a result of which, the increment of momentum boundary layer thickness is witnessed. However, the increasing trend of mixed convection parameter towards the temperature distribution is noticed significantly.The Unsteadiness parameter has no considerable effect on the velocity distribution of Casson nanofluid. Hall current parameter leads to enhance velocity in In the absence of viscous and Joule dissipations (Brownian motion is responsible to diminish the species concentration throughout the boundary layer, whereas thermophoretic diffusion has an opposing trend towards the species concentration.x-direction gets decreased due to increasing the parameters z-direction is an increasing function of parameters The magnitude of skin friction coefficient in The entropy generation is inferred to rise for increasing the diffusive variable, concentration ratio parameter and Brinkman number, whereas these parameters have an opposing effect on Bejan number. The Magnetic parameter diminishes entropy generation closer to the sheet and enhances the entropy generation drastically away from the sheet. The similar phenomena can be noticed in case of Bejan number. Moreover, the opposite observation can be visualized in case of entropy generation and Bejan number against the Hall current parameter. Casson parameter decreases the entropy generation, while its adverse trend is observed to the Bejan number.The increment in the strength of thermal radiation is highly responsible for the larger entropy generation and Bejan number.Our main objective of carrying out the present research work is to analyze the features of entropy generation on unsteady three dimensional magnetohydrodynamic flow of Casson nanofluid over the stretching sheet under the influence of radiative heat transfer, mixed convection, Hall current, thermophoresis, Brownian motion, Ohmic heating and heat generation. The governing boundary layer equations consisting of nonlinear coupled partial differential equations are transformed into ordinary differential equations by using Similarity transformation variables. The resulting highly nonlinear coupled ordinary differential equations are solved numerically by utilizing the spectral quasi-linearization method and Chebyshev spectral collocation method. The physical impact of several flow parameters are exhibited through various graphs and tables. The key observations of the present investigation are summarized as follows:"}
+{"text": "Human cardiac troponin C (cTnC) is the Ca2+-sensing component of the thin filament. It contains structural sites (III/IV) that bind both Ca2+ and Mg2+ and a regulatory site (II) that has been thought to bind only Ca2+. Binding of Ca2+ at this site initiates a series of conformational changes that culminate in force production. However, the mechanisms that underpin the regulation of binding at site II remain unclear. Here, we have quantified the interaction between site II and Ca2+/Mg2+ through isothermal titration calorimetry and thermodynamic integration simulations. Direct and competitive binding titrations with WT N-terminal cTnC and full-length cTnC indicate that physiologically relevant concentrations of both Ca2+/Mg2+ interacted with the same locus. Moreover, the D67A/D73A N-terminal cTnC construct in which two coordinating residues within site II were removed was found to have significantly reduced affinity for both cations. In addition, 1\u00a0mM Mg2+ caused a 1.4-fold lower affinity for Ca2+. These experiments strongly suggest that cytosolic-free Mg2+ occupies a significant population of the available site II. Interaction of Mg2+ with site II of cTnC likely has important functional consequences for the heart both at baseline as well as in diseased states that decrease or increase the availability of Mg2+, such as secondary hyperparathyroidism or ischemia, respectively.Cardiac muscle thin filaments are composed of actin, tropomyosin, and troponin that change conformation in response to Ca Ca2+ biin heads , 4, 5.2+-binding motifs (2+ binding (Human cTnC is a 161-amino acid protein composed of nine helices (N and A\u2013H), which form four EF-hand or helix\u2013loop\u2013helix binding motifs (sites I\u2013IV). Within these domains, residues in positions 1 (+x), 3 (+y), 5 (+z), 7 (\u2212y), 9 (\u2212x), and 12 (\u2212z) contain oxygen atoms arranged in a pentagonal bipyramid allowing for coordination of metal cations  and S2 . Skeletag motifs . cTnC ha binding , 12.2+ binding to sites III and IV in the C domain of cTnC occurs with high affinity (\u223c107 M\u22121) (\u223c10\u00d7 higher than the N domain) and a slow exchange rate (\u223c100\u00d7 slower than binding to the N domain) (2+]in at resting concentrations of free Ca2+ (\u223c100\u00a0nM)   , 14, 15.\u223c100\u00a0nM) . At restith Ca2+ . Mg2+ all\u201d sites , 18. Thef the TF , 20.2+ binds the low-affinity (\u223c10\u22125 M) site II such that this site is only partially occupied at diastolic-free Ca2+ concentrations (\u223c0.1\u00a0\u03bcM) with very few sites being bound (2+ concentrations (\u223c0.5\u20131.2\u00a0\u03bcM), which follow Ca2+-induced Ca2+ release , the majority is bound to cellular components such as ATP with only \u223c0.5 to 1.0\u00a0mM being freely available in the cytosol  for Ca2+ and Mg2+ was measured to be on the order of 106 and 102 M\u22121, respectively , in contrast to changes resulting from site I/II binding, which are small by comparison. Detection of heat changes associated with the interactions of metal ions and proteins is both challenging and a highly technique-dependent method, such that small changes may be deemed negligible  have been shown to modify Ca2+-binding properties  is a measure of the functional moles of protein and was approximately 1.00 in all the N-cTnC titrations . Given t2+ or Mg2+ was found to be associated with a positive \u0394H, so the interaction is driven by entropy  was found to be significantly greater (p\u00a0= 0.001) and 42.9-fold different than for Mg2+ (Kd\u00a0= 652.8\u00a0\u00b1 28.4\u00a0\u03bcM) (The affinity of N-cTnC for Ca28.4\u00a0\u03bcM) .Figure\u00a022+\u2013N-cTnC interaction  was significantly greater (p\u00a0< 0.0001) than that with Mg2+ , indicating a greater enthalpic cost of binding for the Ca2+ titration. Moreover, the entropic contribution for the Ca2+ titrations  was more favorable (p\u00a0< 0.0001) than the Mg2+ titrations  (The \u0394H of the Ca\u2217 mol\u22121) .2+ binding to apo-state N-cTnC (Kd\u00a0= 15.2\u00a0\u00b1 0.5\u00a0\u03bcM) was found to be greater than Mg2+ binding at this site, or when compared with the preincubation experiments , then titrated with 20\u00a0mM Mg2+  reduced the \u0394H associated with binding from 3.82\u00a0\u00b1 0.04\u00a0kcal \u2217 mol\u22121 in the apotitration to 1.73\u00a0\u00b1 0.05\u00a0kcal \u2217 mol\u22121 in the 3\u00a0Mm Mg2+ preincubated construct. The binding affinity changed from 15.2\u00a0\u00b1 0.5\u00a0\u03bcM in the apo-state to 48.9\u00a0\u00b1 2.8\u00a0\u03bcM in the 3\u00a0mM Mg2+-preincubated condition. The Ca2+ affinity was lower when comparing the apo-N-cTnC binding condition with higher concentrations of preincubated Mg2+  is thought to result from a weak binding interaction and indicates a less reliable fit under the experimental conditions  compared with Mg2+ binding (1148.6\u00a0\u00b1 95.0\u00a0\u03bcM) ; it also altered Mg2+ binding 1.8-fold (p\u00a0= 0.04); this change in Kd supports the binding of Mg2+ to the EF-hand of site II.Point mutations (D67A and D73A) were made , affecti95.0\u00a0\u03bcM) . The dou2+ to WT N-cTnC, Ca2+ to D67A/D73A N-cTnC, Mg2+ to WT N-cTnC, and Mg2+ to D67A/D73A N-cTnC . In addition, between the Mg2+-binding affinities, the binding affinity was consistently weaker for the D67A/D73A mutation. The \u0394\u0394G values comparing \u0394G between WT and D67A/D73A systems were similar for ITC and TI .Thermodynamic integration (TI) was performed to calculate absolute binding affinities (with change in Gibbs free energy reported) for the ions in the following systems: CaA N-cTnC . The ave2+/Mg2+ to site II is characterized by an endothermic interaction as indicated by our titrations on the N-terminal domain in this and previous publications  with a positive change in entropy . In the same full-length construct, the Kd associated with binding of Ca2+ to site II was 22.7\u00a0\u00b1 0.5\u00a0\u03bcM. This interaction had a positive \u0394H  and was entropically driven  (The binding of Ca\u2217 mol\u22121) .Figure\u00a072+ binding to site II (Kd\u00a0= 406.1\u00a0\u00b1 7.9\u00a0\u03bcM) and sites III/IV (Kd\u00a0= 16.7\u00a0\u00b1 0.7\u00a0\u03bcM) was characterized by a positive \u0394H  and negative \u0394H , respectively  than that seen for Ca2+. The interaction of Mg2+ with site II and sites III/IV was both entropically favorable  and resulted in spontaneous interactions .Mgectively . The dif2+ occupied a greater proportion of binding sites and limited binding Ca2+ to cTnC at all sites , moreover \u0394H was lowered (p\u00a0< 0.0001 for both). Binding of Ca2+ to sites III/IV in the presence of 1\u00a0mM Mg2+ resulted in a Kd (0.14\u00a0\u00b1 0.01\u00a0\u03bcM) that was not significantly different (p\u00a0< 0.05) than seen for the 3\u00a0mM Mg2+ preincubation (Kd\u00a0= 0.08\u00a0\u00b1 0.01\u00a0\u03bcM)  .2+ preincubation, the interaction proceeded with favorable enthalpy  and entropy . For the 3\u00a0mM Mg2+ condition, the reaction was again exothermic  with a positive change in T \u2217 \u0394S .At sites III/IV, for the 1\u00a0mM Mg2+ in control of the cTnC\u2013Ca2+ switch. Cellular-free Mg2+ is known to change in pathological conditions in the heart  , 652+ to\u2217 mol\u22121) . It is a binding .2+ binding to cTnC is often achieved indirectly by monitoring the fluorescence change and correlating this to the conformational change that results from the interaction. Fluorescent molecules such as 2-[4'-(iodoacetamido)anilino]naphthalene-6-sulfonic acid anilino]naphthalene-6-sulfonic acid-labeled C35S cTnC had a Kd of \u223c7\u00a0\u03bcM  (2+ is larger than Ca2+ (4.3 versus 4.1\u00a0\u00c5) , metals with similar ionic radii are able to substitute for this cation  ; converss 4.1\u00a0\u00c5) . In othes cation , 79. Mg2 in cTnC , 81.2+  at a distance that can vary greatly (2.3\u20132.7\u00a0\u00c5) compared with a much smaller variance for Mg2+ coordination (2.0\u20132.2\u00a0\u00c5)  .2+ and Mg2+ are most often coordinated by oxygen atoms, and this is usually accomplished by a hydroxyl group for Mg2+ and a carboxyl group for Ca2+  (Cafor Ca2+ . Ca2+ isparagine . EF-handsitions) , 87, 88.sitions) .2+ binds exclusively at sites III and IV of TnC . The KA associated with sites III and IV was measured to be 1.2 \u2217 106 M\u22121 for Ca2+ and 1.1 \u2217 102 M\u22121 for Mg2+ in canine ventricular skinned myocytes (Mge fibers . In rabbmyocytes .2+ was found to interact with site II with an apparent binding constant of 5.2 \u2217 102 M\u22121. This was only slightly lower than the constant associated with Mg2+ binding to sites III/IV (\u223c103 M\u22121), Ca2+ binding to sites III/IV (\u223c106 M\u22121), and Ca2+ binding to site II (\u223c104 M\u22121)  .2+ affinity of site II at 15 \u00b0C (\u223c1.2\u20131.9\u00a0mM)  . In the to 24\u00a0\u03bcM . Moreove\u00a0mM Mg2+ . Given t\u00a0mM Mg2+  hypothes2+-binding affinity of site II in lobster TnC isoforms, which are similar in sequence to human variants, was explored. Mg2+ affinity of site II was a single order of magnitude lower than that of Ca2+, such that the cations would compete for binding under physiological conditions  was used as the starting parameter and restrained throughout the simulation. ITC measures the thermodynamically quantifiable closed-to-open transition of the N-cTnC molecule. TI does not allow for such a transition, rather, it quantifies only the binding interaction. In the future, the closed structure of N-cTnC (PDB: 1SPY) can be simulated to quantify the presumably lower affinity it has for each of Ca2+ and Mg2+. The difference between these sets of simulations could then be used to better corroborate the ITC data.In order to further validate the ITC data, we also performed TI to calculate absolute binding affinities computationally. We performed these calculations for both Ca2+ binding, our TI results agreed very well with the binding affinities from ITC. For Mg2+ binding, the calculated absolute binding affinities were consistently underestimated by about 4\u00a0kcal \u2217 mol\u22121 but showed the same relative trends. Mg2+ was calculated to bind more weakly than Ca2+ in the WT and D67A/D73A mutant, in agreement with the ITC results. The Mg2+ absolute binding affinities were likely underestimated for multiple reasons. First, the crystal structure of WT N-cTnC (1AP4) was bound by Ca2+, and no structure of Mg2+-bound WT N-cTnC is available. We attempted to correct for this issue by minimizing the structure with Mg2+ bound WT N-cTnC. Because of the lack of an exact starting structure and restraints chosen, there is still likely some error. In addition, while we did try to choose the most accurate Mg2+ parameters for binding affinity calculations, there are well-documented difficulties in free energy calculations for Mg2+, most notably that the free energy of solvation (\u0394Gsolvation) is consistently underestimated  and high-affinity sites (\u223c107 M\u22121)  . That thI and IV . In addis in TnC .2+ to site II is not expected to induce significant structural changes in N-cTnC based on previous molecular dynamics simulation data  strengthens the interaction with cTnI and the rest of the cTn complex and the orders of magnitude differ between binding affinity at varying levels of filament complexity (2+ (11.9-fold) and Mg2+ (1.8-fold) to site II of N-cTnC; however, the impact on binding might be expected to be greater. It is possible that the effect of this double mutant is to reduce the binding of these cations, especially Mg2+ through allosteric interactions. In CaM, mutation of Ca2+ coordinating residues within the EF-hand can have structural consequences leading to altered binding kinetics  despite relatively high total cytosolic concentrations (2.1\u20132.6\u00a0mM)  . Mg2+ isactility .2+ and Mg2+ with cTnC is characterized by differences consistent with dissimilar ionic radius, number of required coordinating residues, as well as the energic cost of exposing hydrophobic amino acids to an aqueous environment. In the cell, these differences are functionally necessitated by dissimilar free cytosolic concentrations of each cation. Cellular Mg2+ is not necessarily prevalent enough to directly regulate contraction and is not thought to cause a conformational change upon binding to cTnC. However, given the affinities we have observed, its occupation of the binding site may restrict Ca2+ binding, disable key interactions with components of the cTn complex, such as cTnI, and prevent the subsequent conformational changes necessary for rigor-state formation. This competition for binding likely favors Ca2+ and is well tolerated; however, elevation of free Mg2+, which may accompany states of ATP depletion, for example, during ischemic stress, could have relatively significant functional consequence for cardiac force production.Our study provides insights regarding the thermodynamics of metal cation binding to cTnC. The interaction of CaTNNC1 gene (Uniprot ID: P63316) had previously been cloned into pET21a(+) vector and had a stop codon inserted at residue 90 to create the human N-cTnC construct using the Phusion site-directed mutagenesis protocol (Thermo Scientific). This construct was transformed into the BL21(DE3) Escherichia coli expression strain. The double-mutant D76A/D73A construct was made using site-directed mutagenesis carried out by GenScript. Expression and purification of all constructs were carried out as described previously  Q-Sepharose column . The FF Q-Sepharose column was connected with an AKTA FPLC system  and pre-equilibrated with buffer A with the addition of 1\u00a0mM DTT. After applying the clear supernatant onto the column, the solution was run at 5\u00a0ml/min with a gradual gradient mixing with buffer A and buffer B (buffer A with 0.5\u00a0M NaCl), starting from 0% buffer B up to 100% buffer B by the end of the run. Following analysis by 12% SDS-PAGE, the fractions containing purified N-cTnC were pooled and concentrated using Amicon ultracentrifugal filter device (Millipore) with a 3-kDa molecular weight cutoff.The cell pellet was thawed and suspended in buffer A (50\u00a0mM Tris\u2013HCl at pH 8.0 and 5\u00a0mM EDTA) and sonicated on ice at 50% amplitude with 30\u00a0s on and 30\u00a0s off for 5\u00a0min, or until there was no visible viscosity of the lysate solution. After sonication, the lysate was centrifuged at 30,000g for 30\u00a0min at 4 \u00b0C. The supernatant was obtained and dialyzed overnight against 4\u00a0l of buffer C (50\u00a0mM Tris\u2013HCl at pH 8.0 and 100\u00a0mM NaCl).The full-length TnC was purified using the same protocol described previously, with the addition of 30% ammonium sulphate precipitation following the sonication step. After the addition of 30% ammonium sulphate, the solution was stirred on ice for 30\u00a0min and subsequently centrifuged at 28,900After purification using the FF Q-Sepharose column, the fractions containing partially pure cTnC were concentrated to 3\u00a0ml using an Amicon ultracentrifugal filter device (Millipore) with a 10-kDa molecular weight cutoff. The concentrated protein sample was further purified by a HiPrep 26/60 Sephacryl S-100 column size-exclusion chromatography , which was equilibrated with buffer C. After confirming the purity of the protein on a 12% SDS-PAGE gel, all fractions containing the purified cTnC were combined, aliquoted, and stored at\u00a0\u221280 \u00b0C prior to pre-ITC dialysis.\u22121 cm\u22121 and a molecular weight of 10.1 and 18.4\u00a0kDa was used to determine protein concentration for the N-cTnC and full-length cTnC constructs, respectively, by 280\u00a0nm UV\u2013visible spectroscopy using a NanoDrop 2000 spectrophotometer (Thermo Scientific). The final dialysis buffer was used to dilute the protein samples to a final concentration of 200\u00a0\u03bcM for the N-terminal construct and 100\u00a0\u03bcM for full-length cTnC as described previously  were serially diluted in the final dialysis buffer to produce 6\u00a0mM Ca2+ and 40\u00a0mM Mg2+, respectively. The same standards were used to produce 4\u00a0mM Ca2+ and 20\u00a0mM Mg2+ titrants for the N-cTnC experiments. Given the key role of protein concentration in determination of affinity, we aimed to ensure consistency and did so through dilution of the protein from stock solutions with care taken to minimize human and pipetting error to fall at the minimum possible using recently calibrated instrumentation.Standard 1.0\u00a0M CaCl2+ was titrated into 200\u00a0\u03bcl of 200\u00a0\u03bcM apo-state N-cTnC as the baseline condition. For the full-length cTnC, 6\u00a0mM Ca2+ was titrated into 200\u00a0\u03bcl of 100\u00a0\u03bcM apo-state full-length cTnC with a dummy injection of 0.5\u00a0\u03bcl and 38 injections of 1\u00a0\u03bcl. The time interval between injections was 120\u00a0s, and stirring speed was set at 1000\u00a0rpm throughout each experiment.The ITC experiments were carried out in a MicroCal ITC200 instrument . Repeat titrations were used to ensure reproducibility. The sample cell was set at 25 \u00b0C, 200\u00a0\u03bcl of the protein was loaded, and the experiment was carried out at the same temperature. For the N-cTnC, 19 injections of the titrant were used with the first being a dummy injection of 0.8\u00a0\u03bcl and the subsequent 18 injections, 2\u00a0\u03bcl each. For these experiments, 4\u00a0mM Ca2+ and Mg2+ to the apo-state N-cTnC as well as in the presence of 1\u00a0mM of the counter ion (2+ into apo-state N-cTnC condition), the N (number of binding sites) associated with each interaction was necessarily constrained to equal 1.00 to facilitate curve fitting without altering protein concentration. The baseline condition was repeated daily, and the consistency of the thermodynamic parameters in these sets of titrations indicates protein quality and function throughout the set of experiments. If multiple ligands were simultaneously present in the reaction mixture, an \u201capparent affinity\u201d was determined for the injected titrant.Titration data were analyzed using MicroCal2000 for ITC through Origin 8.0 (OriginLab). Raw heats were integrated and fit by a least-squares algorithm using a \u201csingle-binding site\u201d model for the N-cTnC titrations and a \u201ctwo sets-of-binding sites\u201d model for the full-length cTnC titrations to calculate the thermodynamic parameters. As a point of comparison, the \u201ccompetition\u201d model on Origin was also used to study the binding of Canter ion  122). F. F2+ andp\u00a0< 0.05 considered the threshold for statistical significance.JMP 14.0 software package was used for statistical analysis. ANOVA was used to identify differences in each studied thermodynamic parameter from the N-cTnC and full-length cTnC titrations: in the apo-state and competition experiments, including both the WT and double-mutant proteins (N-cTnC only). Tukey's post hoc test was subsequently used to explore where the differences lie with 2+ ion bound, the system was solvated with a 12\u00a0\u00c5-padded transferable intermolecular potential 3P water box and neutralized with Na+ in Amber16  ranging from 0.0 to 1.0 in increments of 0.1. For each simulation, the system was minimized (2000 cycles) and heated (0.5\u00a0ns) before the 5\u00a0ns production run at 300\u00a0K using the ff14SB force field . Following the minimization, TI simulations were run similarly as for Ca2+. However, because of previously documented errors in the default Mg2+ parameters, the \u0394Gsolvation-optimized Mg2+ parameters from Li et\u00a0al. were used  was calculated for each step in the thermodynamic cycle by integrating the potential energy with respect to the coupling parameter, \u03bb . Two coret\u00a0al. ), which   to reviAll data presented in this article are contained within the article.This article contains The authors declare that they have no conflicts of interest with the contents of this article."}
+{"text": "Although only recently introduced in the ILD community, the concept of progressive fibrosing interstitial lung disease (PF-ILD) has rapidly acquired an important place in the management of non-idiopathic pulmonary fibrosis fibrosing ILD (nonIPF fILD) patients. It confirms a clinical gut feeling that an important subgroup of nonIPF fILD portends a dismal prognosis despite therapeutically addressing the alleged triggering event. Due to several recently published landmark papers showing a treatment benefit with currently available antifibrotic drugs in PF-ILD patients, endorsing a PF-ILD phenotype has vital therapeutic consequences. Importantly, defining progressiveness is based on former progression, which has proven to be a rather moderate predictor of future progression. As fibrosis extent >20% and the presence of honeycombing have superior predictive properties regarding future progression, we advocate immediate initiation of antifibrotic treatment in the presence of these risk factors. In this perspective, we describe the historical context wherein PF-ILD has emerged, determine the currently employed PF-ILD criteria and their inherent limitations and propose new directions to mature its definition. Finally, while ascertaining progression in a nonIPF fILD patient clearly demonstrates the need for  therapy, in the future, therapeutic decisions should be taken after assessing which pathway is ultimately driving the progression. Although not readily available, pathophysiological insight and diagnostic means are emergent to go full steam ahead in this novel direction. The conceptualization of the existence of a common progressive fibrosing (PF) phenotype, irrespective of the underlying diagnostic entity, has dramatically changed the landscape of interstitial lung disease (ILD) . In thisThe origins of the paradigm shift in pulmonary fibrosis are situated in the early years of this millennium, in which it became clear that IPF was not initiated by an exaggerated immune response that could serve as a treatable target, but should be regarded as a process of self-sustaining fibrosis , withoutBased on these seminal findings, a dichotomy in fibrotic ILD found entrance: IPF was regarded as an intrinsically fibrotic disease, whereas, in nonIPF fibrotic ILDs (fILD), one should focus on the initial trigger  in CTD-associated ILD (CTD-ILD), an inciting agent in fibrotic hypersensitivity pneumonitis (fHP) and a presumed immunological reaction in idiopathic nonspecific interstitial pneumonia (NSIP)) and treat accordingly, which\u2014in daily clinical practice\u2014was translated almost invariably to the initiation of immunosuppressive therapies. Given the lower mortality levels and known triggers, these nonIPF fILD entities were regarded as more benign, largely treatable and oftentimes reversible.Throughout the following years, a growing body of evidence strengthened an emerging clinical gut feeling that some subgroups within the spectrum of nonIPF fILD showed a progressive fibrosis that did not seem to resolve or stabilize by therapeutically addressing the alleged initial trigger ,9,10,11.Unfortunately, the relatively low prevalence of separate nonIPF fILD entities complicated the options for testing the efficacy of the antifibrotics in clinical trials. Given the plethora of therapeutic targets of both antifibrotics, the idea grew that while the exact contribution of specific molecular mechanisms in the progression of fibrosis might differ from one nonIPF fILD to another, these drugs could attenuate the progression of all nonIPF fILD patients . This hyImportantly, the benefits of clinically defining progressive fibrosis reach far wider than evaluating potential antifibrotic responsiveness. We envisage a role in referral for lung transplantation and/or the initiation of advanced care planning and initiation of palliative care. Moreover, as 50% of IPF patients die from cardiovascular comorbidities, cardiovascular prevention measures could be useful if the comorbidome of PF-ILD would prove to be similar to that of IPF. Furthermore, from a research perspective, defining patients with progressive fibrosis could be very useful as a patient group of specific interest.In order to selectively include nonIPF fILD patients with progressive fibrosis, the clinical trials assessing the efficacy of antifibrotic treatment in nonIPF PF-ILD selected patients with proven former disease progression throughout the months before study inclusion.Progression was defined slightly differently in each study. The RELIEF study , initiatAlthough these criteria certainly are not without merit, we believe that defining progression based on these criteria might have certain limitations.Firstly, by definition, the patient and clinician should wait until deterioration has been formally determined before the progressive fibrotic phenotype can be endorsed. Hence, precious time is lost, and the disease has objectively worsened in the meantime. Until we have treatment options that can significantly reverse fibrosis, this is a significant problem. In IPF, it takes approximately 2 years from symptom onset to diagnosis, and a survey study recently reported similar estimated delays in nonIPF fILD . One migSecondly, we believe the criteria might be far too strict for encompassing all progressive fibrosing nonIPF ILD patients in an acceptable time interval. Although IPF is invariably regarded as a relentlessly progressive disease, the placebo groups of the phase III trials evaluating the efficacy of the antifibrotics showed that only a minority of cases over the study period had such magnitude of a decline in pulmonary function, symptomatology or HRCT-derived fibrosis severity used for diagnosing the PF phenotype in the nonIPF PF-ILD trials. In the CAPACITY trial evaluating Pirfenidone versus placebo , only 32Thirdly, FVC might not be a good predictor in all fibrotic ILD patients. Many nonIPF fILD cases may present with a combination of emphysema and fibrosis (CPFE). In systemic sclerosis-associated ILD (Ssc-ILD), 7.8% of cases have been shown to present with CPFE , while aFinally, and most importantly, former progression proved to be a rather moderate predictor of future progression. Although all patients included in the INBUILD trial were progressive at inclusion (as this was needed for inclusion), only 40% and 60% of the placebo cases had a >10% and 5\u201310% FVC decline, respectively, throughout the first 52 weeks of the trial . Hence, Based on the limitations mentioned above, unraveling clinical parameters that can predict long-term disease progression will prove to be crucial. In the last 10 years, multiple cohort studies have been published in various nonIPF ILD entities, which can aid in this respect. In short, most studies reveal both baseline pulmonary function, HRCT parameters and multilevel composite scoring systems to be predictors of disease progression.FVC has been associated with survival in UILD ,10, fHP The PF-ILD has been conceptualized as an important subgroup of nonIPF fILD patients portend dismal outcomes similar to IPF, despite therapeutically addressing the alleged triggering event.Clinical studies have shown antifibrotics to be effective in nonIPF fILD patients with former disease progression. However, former progression has proven to be a rather moderate predictor of future progression; moreover, loss of time and pulmonary function is inherent before the PF-ILD phenotype can be endorsed.Clinical variables  might perform better as predictor of progression and can be assessed at time of diagnosis.In the future, predicting progression will ultimately inform the need for  treatment, while assessing the progression-driving disease mechanisms will guide treatment choices.Key messages:The extent of fibrosis, traction bronchiectasis and honeycombing have been shown to be associated with survival in UILD , fHP 8,,8,31, CTIn 2003, Wells and colleagues constructed the composite physiological index (CPI), an estimator of fibrosis extent on CT based on FVC, DLCO and forced expiratory volume in 1 s (FEV1), which proved to be associated with mortality . CPI proEven more important than these reported hazards and odds ratios, absolute survival and disease progression rates are often reported and almost invariably show similarities with IPF.Remarkably, based on the data provided in the Ryerson paper addressing outcome predictors in UILD , one canThis holds true for many other nonIPF fILD subgroups. Salisbury showed that HP with honeycombing conferred a similar outcome  to that of IPF with honeycombing and had a worse survival and FVC decline compared to IPF cases without honeycombing. Jacob showed that RA-ILD cases with honeycombing, irrespective of the distribution, showed similar outcomes  compared to an IPF cohort . It is by no means justifiable that in such a patient subgroup, accounting for 25\u201350% of nonIPF fILD cases ,11,32,34The very same case can be made for fibrosis extent. Ryerson showed a 3-year survival of nearly 50% in UILD cases with fibrosis extent >20% of the lung parenchyma  . Jacob eIn conclusion, whereas both pulmonary function variables and CT variables and multilevel composite scoring systems are all associated with mortality, the presence of honeycombing and a CT-derived fibrosis extent >20% are clearly associated with disease progression and IPF-compatible outcomes. Hence, we believe that enough evidence exists to justify the immediate initiation of antifibrotic treatment.Whereas predicting clinical behavior will clarify whether additional therapeutic action is needed, unraveling the underlying molecular mechanisms that drive disease progression will inform which therapy might be useful.Given the broad range of mechanisms that are therapeutically targeted with the currently available antifibrotic drugs and given the absence of other drugs that work crucially differently, the question of which drug should be initiated in a specific patient is\u2014at present\u2014without much meaning. However, as insight into the pathogenesis of both IPF and nonIPF fILD is rapidly accrued, rather soon than late, clinicians will need to make a well-informed choice about which mechanism he or she believes is driving the disease progression preponderantly, and thus which treatment option\u2014yet to be discovered\u2014to initiate primarily.While fibrogenesis is often abusively confined to extra-cellular matrix deposition, abundances of other mechanisms have been revealed to be pathogenetically substantial and are presumably not responsive to the currently available antifibrotic drugs. In IPF, epithelial senescence is a widely accepted early phenomenon ,41, inclWhile these pathways do not reach the full attention of the ILD clinician, as no targeting treatment is available, trials are underway to investigate the potential impact on the progression of fibrosis: thyroid hormone has been suggested for mitigating mitochondrial dysfunction , DasatinAs the clinical behavior of PF-ILD patients has proven to have so many aspects of IPF in common, it would be very surprising if these novel IPF-driving mechanisms did not have a role in nonIPF fILD disease progression. The first results in this regard have been published within the past few years ,16,41,63We believe that\u2014in the future\u2014disease progression will be ascertained by assessing aberrant activation of pathophysiological mechanisms. Biomarkers will be needed for this purpose, and the technology for development is about to be mature ,64,65,66Throughout the last decennium, the paradigm shift in the IPF pathophysiological narrative and the development of effective antifibrotic drugs has proven to be an important impetus for studying disease progression in nonIPF fILD, resulting in seminal phase III trials showing that antifibrotics are as effective in PF-ILD as they are in IPF. Former progression was used as inclusion criteria for these trials, but important limitations hamper their clinical use in practice: their ability to predict future progression was rather moderate, and the fact that disease progression should be awaited before treatment can be initiated might be unjustifiable in some patient subgroups: the presence of disease extent >20% or honeycombing was shown to predict future progression at least as well as former progression. Hence, treatment should be initiated as soon as possible, and disease progressions should not be awaited. Finally, as a more diverse collection of pathophysiological mechanisms are demonstrated to drive fibrosis, the future might bear more personalized medicine, in which disease progression will be predicted by biomarkers that ascertain aberrant activation of specific pathways and steer therapeutic choices alike."}
+{"text": "These results allow us to better outline the applicability limits of the stochastic separation theorems in applications.Stochastic separation theorems play important roles in high-dimensional data analysis and machine learning. It turns out that in high dimensional space, any point of a random set of points can be separated from other points by a hyperplane with high probability, even if the number of points is exponential in terms of dimensions. This and similar facts can be used for constructing correctors for artificial intelligent systems, for determining the intrinsic dimensionality of data and for explaining various natural intelligence phenomena. In this paper, we refine the estimations for the number of points and for the probability in stochastic separation theorems, thereby strengthening some results obtained earlier. We propose the boundaries for linear and Fisher separability, when the points are drawn randomly, independently and uniformly from a  However, some of the implications of the advent of the big data era remain poorly understood. In his \u201cmillennium lecture\u201d, D. L. Donoho  describethe data . ClassicOne of the \u201cpost-classical\u201d phenomena is stochastic separability ,4,5. If Recently, stochastic separation theorems have been widely used in machine learning for constructing correctors and ensembles of correctors of artificial intelligence systems ,7, for dn-element set in In its usual form a stochastic separation theorem is formulated as follows. A random dered in ,12,13,14dered in . Roughlydered in . GeneralWe note that there are many algorithms for constructing a functional separating a point from all other points in a data set . Among all these methods the computationally cheapest is Fisher discriminant analysis . Other ad and n are sufficient in order to use only Fisher separability and so that there is no need to search a more sophisticated linear discriminant.The papers ,6,7,12 dd-dimensional spherical layer and from the unit cube. These results give more accurate estimates than the bounds obtained in [In ,14, therained in ,12 for Fn points is ID, then we expect that the separability properties of the resulting set of points are similar to the properties of uniformly distributed n points in dimension d. In particular, we can use the theoretical estimates for the separation probability to estimate ID ..n pointsHere we give even more precise estimations for the number of points in the spherical layer to guarantee their linear separability. We also consider the case of linear separability of random points inside a cube in more detail than it was done in . In partX from M; i.e., there exists A point A point  all Y\u2208M ,7.i, j, such that A set of points eparable  or 1-coneparable  if any pthat i\u2260j ,7.M is linearly separable is not less than the probability that M is Fisher separable.Fisher separability implies linear separability but not vice versa . Thus, if d-dimensional unit ball centered at the origin  requ requ5) rA reviewer of the original version of the article drew our attention that for ained in ,15. Specd for fixed r, The both estimates (1) and (5) are exponentially dependent on r, where For all r, For all r, where For all r, d, ifFor all The following results concerning the linear separability of random points in the spherical layer were obtained in :For all r. We remove this drawback in this paper, giving more accurate estimates (see Theorems 1 and 3 and Corollaries 1 and 2).We note that the bounds \u201311) do  do 11) dn, where In , a produ\u2026,d). In , it is sIf all random variables n satisfies  estimates for the Fisher separability in the unit cube are derived in . The papn-element set The theorem below gives the probability of the linear separability of a random point from a random wed from ,16.The regularized incomplete beta function is defined as ely (see ).Theorem\u00a01.Let (1)\u00a0for (2)\u00a0for Proof.\u00a0Y is linearly separable from Y belongs to the convex hull of A random point First, estimate the numerator of this fraction. We denote by eter see . ThencoH of a ball of radius Now find is known  thatCapConsider two cases: \u2264r<1 see Case 1 If h of the ball If If Thus,HenceCase 2 If h of the ball If Henced and r and decreasing in n, which corresponds to the behavior of the probability r (see The estimates  and 15)15) for Pself see . On the self see  for the in r see .Note that the estimates , 15) ob ob15) obn guaranteeing the linear separability of a random point from a random n-element set The following corollary gives an estimate for the number of points Corollary\u00a01.Let (1)\u00a0or(2)\u00a0then The theorem below establishes asymptotic estimates.Theorem\u00a02.(1)\u00a0If (2)\u00a0If (3)\u00a0If Proof.\u00a0The paper  gives thSince b fixed and Since We have If If If If \u25a1n-element set The theorem below gives the probability of the linear separability of a random Theorem\u00a03.Let (1)\u00a0for (2)\u00a0for Proof.\u00a0Denote by Therefore, using the inequalityn = 10,000 points are shown in The graphs of the estimates , 17) an an17) and, the \"threshold values\" for such a big d differ greatly. In other words, the blessing of dimensionality when using linear discriminants comes noticeably earlier than if we only use Fisher discriminants. This is achieved at the cost of constructing the usual linear discriminant in comparison with the Fisher one.Another important conclusion from the experiment is as follows. Despite the fact that the estimates for both probabilities n guaranteeing the linear separability of a random n-element set The following corollary gives an estimate for the number of points Corollary\u00a02.Let (1)\u00a0or(2)\u00a0then The theorem below establishes asymptotic estimates for the number of points guaranteeing the linear separability with probability greater than Theorem\u00a04.(1)\u00a0If (2)\u00a0If (3)\u00a0If Let us show that the new estimates  and 17)17) for lStatement\u00a01.Let For r and n fixed(1)\u00a0if (2)\u00a0if (3)\u00a0if Proof.\u00a0If If If Now let us compare the estimates for the number of points that guarantee the linear and Fisher separabilities of random points in the spherical layer obtained in Corollary 2 and in , respectStatement\u00a02.Let (1)\u00a0if (2)\u00a0if (3)\u00a0if Proof.\u00a0If If If x, y inside the ball are not Fisher separable. Let x is not Fisher separable from a given point y. In [A reviewer of the original version of the article drew our attention to the fact that for the uniform distribution inside the ball , there esis see .d-dimensional unit cube Consider a set of points Theorem\u00a05.Let Proof.\u00a0Y is linearly separable from Y belongs to the convex hull of A random point k points placed in In  it is prCorollary\u00a03.Let Then Theorem\u00a06.Let Proof.\u00a0Denote by HenceCorollary\u00a04. Let 0<\u03d1<Then We note that the estimate  for the n points are Fisher separable with probability greater than However better  estimates for the Fisher separability in the unit cube are derived in . CorollaTheorem 6 and Corollary 4 in our paper state the same results with However, ,15 were The bounds  and 20)20) for tIn a recent paper , explicid-dimensional spherical layer or from the unit cube. These results refine some results obtained in [In this paper we refined the estimates for the number of points and for the probability in stochastic separation theorems. We gave new bounds for linear separability, when the points are drawn randomly, independently and uniformly from a ained in ,12,13,14n i.i.d. random points inside the spherical layer The strongest progress was in the estimation for the number of random points in a d) than if we only use Fisher discriminants. This is achieved at the cost of constructing the usual linear discriminant in comparison with the Fisher one. One of the main results of the experiment comparing linear and Fisher separabilities is as follows. The blessing of dimensionality when using linear discriminants can come noticeably earlier (for smaller values of"}
+{"text": "We included 15 healthy subjects aged 53\u201386\u00a0years for 70\u00a0min dynamic PET protocol of peripheral organs. We performed kinetic modelling of the adrenal gland, pancreas, myocardium, renal cortex, spleen, colon, and muscle using an image-derived input function from the aorta. A metabolite correction model was generated from venous blood samples. Three non-linear compartment models were tested. Additional time-activity curves from 6 to 70\u00a0min post injection were generated for prostate, thyroid, submandibular-, parotid-, and lacrimal glands.The autonomic nervous system is frequently affected in some neurodegenerative diseases, including Parkinson\u2019s disease and Dementia with Lewy bodies. In vivo imaging methods to visualize and quantify the peripheral cholinergic nervous system are lacking. By using [A one-tissue compartment model generated the most robust fits to the data. Total volume-of-distribution rank order was: adrenal gland\u2009>\u2009pancreas\u2009>\u2009myocardium\u2009>\u2009spleen\u2009>\u2009renal cortex\u2009>\u2009muscle\u2009>\u2009colon. We found significant linear correlations between total volumes-of-distribution and standard uptake values in most organs.18F]FEOBV PET signal was found in structures with known cholinergic activity. We conclude that [18F]FEOBV PET is a valid tool for estimating VAChT density in human peripheral organs. Simple static images may replace kinetic modeling in some organs and significantly shorten scan duration.High [Clinical Trial Registration Trial registration: NCT, NCT03554551. Registered 31 May 2018. https://clinicaltrials.gov/ct2/show/NCT03554551?term=NCT03554551&draw=2&rank=1.The online version contains supplementary material available at 10.1186/s13550-022-00889-9. In vivo imaging of the noradrenergic sympathetic nervous system is widely used in research, and constitutes a supportive diagnostic criterion in some neurodegenerative diseases, e.g., Parkinson\u2019s disease and dementia with Lewy bodies (DLB) , 2. Less11C]-methoxy-donepezil ([11C]donepezil), to measure acetylcholinesterase (AChE) density in visceral organs [11C]donepezil signal correlates well with known cholinergic innervation, but is not optimal for quantification of cholinergic neurons. First, [11C]donepezil binds to sigma-1 receptors with high affinity doaffinity . Second,affinity . FinallyCdoaffiniThe vesicular acetylcholine transporter (VAChT) is a glycoprotein closely associated with other cholinergic markers, i.e., choline acetyltransferase (ChAT), acetylcholine, and AChE . It is l18F]fluoroethoxybenzovesamicol ([18F]FEOBV) has been thoroughly validated for PET studies of the brain in rodents, monkeys, and humans [18F]FEOBV is a specific marker for VAChT, reflects the known cholinergic innervation in the brain, displays low interference with sigma- and dopamine receptors (unlike other vesamicol derivatives), can be displaced by \u201ccold\u201d FEOBV, and shows only modest defluorination [18F]FEOBV to visualize the peripheral cholinergic system in humans FEFFE18F]flrination , 23. To n humans . That st18F]FEOBV PET/CT protocol.In the present study we evaluated human in vivo VAChT distribution in 13 peripheral organs using a 70\u00a0min dynamic FEOBV tracer preparation is described in Additional file Siemens Healthcare, Erlangen, Germany). Participants were placed in supine position with hands above their head. After a topogram and a CT scan for attenuation correction, approximately 200\u00a0MBq [18F]FEOBV was administered into a cubital vein. Simultaneously, the PET acquisition was initiated. First, 6\u00a0min dynamic PET was acquired with the 26\u00a0cm field-of-view covering the top of the heart and the upper part of the abdomen. Then, from 6 to 70\u00a0min, dynamic whole-body PET data were acquired using continuous bed motion divided into 7\u2009\u00d7\u20092\u00a0min passes followed by 9\u2009\u00d7\u20095\u00a0min passes. The total scan time adds up to 70\u00a0min due to inter-pass bed motion. Each frame length was adjusted to each individual based on height, i.e., tall subjects required faster bed motion and vice versa . After PET acquisition, an ultra-low-dose whole-body CT scan was performed, and subsequently an additional low-dose CT scan of the thorax and abdomen after intravenously administered CT-contrast enhancement. All PET images were reconstructed using TrueX\u2009+\u2009TOF, 4 iterations, 5 subsets, 440 matrix, 2-mm Gaussian filtering, relative scatter correction, attenuation correction and were decay-corrected back to injection time. The PET image voxel size was 1.65\u2009\u00d7\u20091.65\u2009\u00d7\u20093.0 mm3.8FFEOBV tTime-activity curves were extracted from the dynamic PET images using different volume-of-interest (VOI) approaches. The whole-blood time-activity curve was acquired with a circular region-of-interest (ROI) with a diameter of 10\u00a0mm, placed in the center of the descending aorta on fused PET/CT images on 20 adjacent axial slices above the diaphragm. The colonic signal was assessed through three steps: (1) a section of the transverse/descending colon was outlined on the CT image; (2) this VOI was used as template for outlining the colonic PET-signal (great care was taken not to include spill-in from surrounding organs); (3) the PET VOI was normalized to the CT-derived anatomical colonic volume. This volume was corrected for air content by subtracting an isocontour VOI of -300 Hounsfield Units. The left adrenal, the submandibular and parotid glands were acquired by outlining the PET signal with subsequent normalization to the anatomical volume measured on the CT image. The liver and spleen VOIs were 8\u00a0mm wide and paralleled the organ border. Renal cortex, left ventricular myocardium, and pancreas were also sampled in this way with the VOIs placed on six adjacent slices. The pancreas VOI was placed in the hottest area in the center of the body and tail. Due to bile secretion, meaningful data could not be obtained from the head of pancreas. Circular muscle ROIs of 10\u00a0mm were placed bilaterally in the back muscles on 20 adjacent slices, approximately 30\u00a0mm lateral to the spinous process at the level of the diaphragm. Small circular ROIs were placed on six adjacent slices in prostate (diameter 15\u00a0mm) and in each thyroid lobule (diameter 6\u00a0mm). We abstained from uterus analysis because the signal was highly influenced by spillover of bladder and small intestinal signal. Finally, a circular ROI (diameter 6\u00a0mm) was centered in the hottest area of the lacrimal gland on two adjacent slices.3. VOIs sampling submandibular, parotid, and lacrimal glands and the thyroid were placed on the PET fused to the ultra-low-dose whole-body CT scan with a subsequent voxel size of 1.5\u2009\u00d7\u20091.5\u2009\u00d7\u20095mm3. To reduce the influence of movement artefacts, all VOIs were adjusted to the PET signal separately on each time frame. All analyses were performed using PMOD 4.0 . Examples of ROI-definitions for each organ are shown in Additional file VOIs sampling aortic lumen, myocardium, skeletal muscle, pancreas, colon, adrenal gland, spleen, liver, renal cortex, and prostate were defined on the PET image fused to the low-dose contrast-enhanced CT scan of the abdomen and thorax, with a voxel size of 1\u2009\u00d7\u20091\u2009\u00d7\u20092 mm18F]tracer ([18F]FDG) with a close correlation between image-derived and arterial blood sample activity .We did not measure arterial blood activity as an input function for the present study. Several steps were performed to yield the optimal image-derived input function. First, an image-derived arterial time-activity curve (TAC) was extracted from the PET/CT image using the aorta lumen VOI (see above). A similar approach has been validated for another 8Ftracer Venous blood samples used for tracer metabolite correction were drawn during PET acquisition at approximately 5, 15, 30, 45, and 60\u00a0min post injection. In two subjects, it was not possible to draw cubital vein blood, when the arm was placed above the head inside the camera. This position, however, promotes higher quality images of the abdominal organs. 15 data points were excluded as they yielded parent fractions\u2009>\u2009100% or increasing parent fraction over time\u2014both situations are implausible. Also, very low counting numbers were observed during metabolite analysis procedure, which generated high statistical variation in the data. As a result, we chose to generate a population metabolite-correction curve derived for all 15 subjects  with K1, k2, k3, and k4 as derived parameters; and an irreversible 2TCM with K1, k2, and k3 as derived parameters (k4 constrained to 0). The blood volume fraction (V0) and time delay were derived in all fits. Vascular parameters were derived using uncorrected whole-blood TACs. The 1TCM performed best (see below), and the derived total volume-of-distribution (Vt) was defined as K1/k2 [ml/ccm]. We also estimated Vt using Logan plots with estimated equilibrium times, a maximal error set to 10%, and with inclusion of a minimum of 6 data points . Here, the image-derived metabolite-corrected plasma TAC was used as the input function.Kinetic analyses of the dynamic PET data could only be performed for organs with full time-activity curves (0\u201370\u00a0min), i.e., myocardium, pancreas, renal cortex, spleen, adrenal gland, muscle, and colon. We used three different non-linear approaches with the image-derived metabolite-corrected plasma TAC as input function: a 1-tissue compartment model (1TCM) with KNormality was assessed with QQ-plots and histograms. The strength of the linear relationship between kinetic modeling parameters and standard uptake values (SUV) was interrogated with Pearson product-moment correlation coefficients. All statistical analyses were performed with GraphPad Prism 7.0 and Stata 13.1.18F]FEOBV administration was well tolerated without adverse events. The image-derived input function from the aorta lumen peaked at 18F]FEOBV was 54% of total activity in venous blood at 30\u00a0min, and 30% at 60\u00a0min post injection. The average [18F]FEOBV fraction in plasma was 0.69, i.e., 31% of tracer was bound to red blood cells (or white blood cells).8FFEOBV a18F]FEOBV with varying rates and degrees of washout , and was visible in the small intestine after Most visceral organs showed initial high uptake of FEOBV kinetic modeling of peripheral organs. Kinetic parameters from the 1TCM and Vt estimations from Logan plots are presented in Table 0 values were low in adrenal gland, pancreas, and muscle. Therefore, based on blood- and organ volume computations FEOBV in 13 peripheral organs of healthy human subjects. We tested three non-linear kinetic models of the pancreas, renal cortex, spleen, myocardium, muscle, adrenal gland, and colon. The 1TCM generally performed best, with robust fits of Vt. Although Vt does not represent specific binding of [18F]FEOBV, it reflects the degree of tracer being concentrated in tissue, which is interpretated as an indirect measure of VAChT density in the present study. The fitted V0 was lower than expected in adrenal gland, pancreas, and muscle. Therefore, we reanalyzed these data with constrained V0 which increased Vt by 7% in muscle, 23% in pancreas, and 37% in adrenal gland. Hence, the original fits may have underestimated the true Vt in these organs. Colon V0 was low, but the colon VOI unavoidably contains feces without blood supply or [18F]FEOBV binding. Determination of an intestinal-wall-only VOI is practically impossible. Thus, if the actual colon wall occupies 10% of the colon VOI, it would then translate into a V0 of 0 in other organs seemed reliable.In the present study we describe the distribution of [fraction . V0 in o18F]FEOBV in plasma due to high centrifugal filter retainment. This occurred even when [18F]FEOBV was dissolved in a buffer solution. To our knowledge, no other studies have investigated the free fraction of [18F]FEOBV. Therefore, the free fraction was conservatively set to 1, which underestimates Vt by an unknown magnitude.We could not determine free fraction of [18F]FEOBV to red blood cells was measured. We found that 69% of [18F]FEOBV was located in plasma , which was used to correct the input function in all subjects. Differences between individual subjects could have affected model parameters. Also, hematocrit differences between arterial blood and venous blood could have influenced this fraction (as hematocrit was measured in venous blood). However, one study showed that hematocrit is only 3% higher in venous blood compared to arterial blood [18F]FDG study comparing imaged-derived input from aorta to arterial blood sampling . The two approaches generated comparable estimates of Vt, except for a slightly lower Logan Vt in the adrenal gland and myocardium, and a slightly higher Vt in the colon  may have caused and overestimation in 1TCM. Thus, it is unclear whether 1TCM or Logan plot predicts the most reliable estimate of the Vt.As the input function was extracted from whole blood PET data in the aorta lumen, binding of FEOBV signal in each organ has different origins and reflects different cholinergic functions. Microvasculature (but not macrovasculature) in visceral organs, except kidney, liver, and spleen, receive VAChT positive parasympathetic neurons [The [ neurons .The pancreas exhibited high [18F]FEOBV accumulation with a relatively slow washout, suggestive of high VAChT density. Indeed, pancreatic VAChT containing neurons are abundant; vagal preganglionic parasympathetic neurons project to postganglionic parasympathetic neurons that are often clustered in intrapancreatic interlobular ganglia [18F]FEOBV signal contribution from alpha-cell uptake in the islets is impossible to estimate. Islets show intense staining in immunohistochemistry studies, but occupy less than 5% of total pancreatic volume, and alpha-cells only account for 11C]-donepezil PET estimated an almost eight times higher Vt in pancreas than in our study [11C]donepezil binding to exocrine acinar cells, which show very low VAChT staining in rat immunohistochemistry studies FEOBV binding similar to that of the pancreas. VAChT-immunoreactive neurons are discernable in ventricles, but higher density is observed in atria [18F]FEOBV PET of myocardium could be relevant in cardiac diseases with low cholinergic activity, e.g., chronic heart failure. One PET study has shown that [18F]FEOBV is suitable for measuring cardiac cholinergic activity in humans FEOBV uptake, and could account for some of the between-study discrepancy. Interestingly, the trend was driven by a statistically significant negative correlation between age and k2, and not K1. This indicates that it is not the extraction of [18F]FEOBV from blood to tissue that is altered with age\u2014which could be influenced by perfusion. Rather, it is the rate of [18F]FEOBV being transported from the myocardium back to blood, indicative of higher specific binding. We previously found a similar age effect for acetylcholinesterase in an [11C]donepezil PET study FEOBV signal of all investigated organs in the present study. The adrenal gland is innervated by preganglionic sympathetic neurons from the intermediolateral cell column in the thoracic spine FEOBV signal compared to other organs, but also a slow washout. As mentioned above, the colon PET signal is normalized to a CT-derived colon volume that include feces (but exclude air). This circumstance underestimates the true colonic [18F]FEOBV signal\u2014probably by at least an order of magnitude. In the human colon, more than 50% of enteric neurons in the myenteric and submucosal plexi stain for ChAT [18F]FEOBV binding is enteric cholinergic neurons, with a lower contribution from vagal parasympathetic projections. In support, bilateral vagotomy in rats elicit decreased VAChT staining density in the upper GI tract but not in the colon (N Van Den Berge\u2014unpublished data).for ChAT . ChAT cofor ChAT . Pregangfor ChAT . Anterogfor ChAT . It is lSpleen and renal cortex displayed similar [18F]FEOBV kinetics with an initial peak followed by rapid washout, although a bit slower in the spleen resulting in a higher Vt (9.72 vs. 6.06\u00a0ml/ccm)  Fig.\u00a0. This surenchyma .Resting muscle showed low [18F]FEOBV uptake, but barely any washout. The neuromuscular endplate from somatic motor neurons shows intense VAChT immunoreactivity [18F]FEOBV signal probably constitute both somatic- and parasympathetic efferent nerve fiber binding. One subject had significantly higher signal than average . In addition, no VAChT neurons are visible in rat liver FEOBV signal, with relatively slow washout. The glands contain postganglionic parasympathetic neurons from the otic, submandibular, and pterygopalatine ganglia . They can be macroscopically visualized with VAChT immunostaining in the vicinity of exocrine acini, ducts, myoepithelium, and microvasculature [18F]FEOBV signal in salivary- and lacrimal gland tissue may be of neuronal origin only. It is unknown whether the tracer is secreted into the saliva and lacrimal gland fluids.culature , 28. ThuThe thyroid showed initial intense [18F]FEOBV signal, followed by a rapid washout, suggestive of low VAChT density. Two human studies showed AChE containing neurons in the thyroid FEOBV uptake with relatively slow washout. VAChT containing neurons are abundant in all parts of prostatic tissue [18F]FEOBV retainment is probably primarily of preganglionic and postganglionic parasympathetic origin.c tissue , 57. ThuBone tissue, probably mainly restricted to the bone marrow, also showed relatively high [18F]FEOBV uptake ; l: Adrenal gland (PET/CT); m: Colon (CT); n: Colon (PET/CT); o: Parotid gland (CT); p: Parotid gland (PET/CT); q: Submandibular gland (CT); r: Submandibular gland (PET/CT). CT and PET/CT images are shown for the same slice . CT-derived VOIs are also displayed on the PET/CT image to show the slightly larger PET volume than anatomical CT-derived volume. PET signal is scaled to the level used in analyses of each organ, i.e., PET signal scale differs between images.Additional file 3. Figure S2: Arterial blood 18F-FDG time-activity curves (TACs) obtained from arterial blood samples (black) and auto-generated aorta-VOI (red). The curves are practically identical.Additional file 4. Table S1A:\u00a0Kinetic parameter estimates from the 2-tissue compartment model.\u00a0Values are presented as median (interquartile range) or mean (standard deviation). V0 = blood volume fraction [ml/ccm]; K1 = uptake rate constant [ml/ccm/min]; k2 = washout rate constant [1/min]; k3 = rate of tracer association to VAChT [1/min]; k4 = rate of tracer dissociation to VAChT [1/min]; CoV = Coefficient of variation for Vt estimates (mean/standard deviation); AIC = Akaike information criterion. *One fit failed.Additional file 5. Table S1B:\u00a0Supplementary Table 1B. Kinetic parameter estimates from the irreversible 2-tissue compartment model.\u00a0Values are presented as median (interquartile range) or mean (standard deviation). V0 = blood volume fraction [ml/ccm]; K1 = uptake rate constant [ml/ccm/min]; k2 = washout rate constant [1/min]; k3 = rate of tracer association to VAChT [1/min]. CoV = Coefficient of variation for k3 estimates (mean/standard deviation); AIC = Akaike information criterion. *Five k3 values approximated 0.Additional file 6. Table S2:\u00a0Best-fit-models in different organs. Comparison of 1-tissue-, 2-tissue- and irreversible 2-tissue compartment models."}
+{"text": "The structures of the synthesized compounds were defined by nuclear magnetic resonance (NMR), Fourier-transform infrared spectroscopy (FT-IR), elemental analysis, and LC-MSMS (for complexes) techniques. Stability of the silver complexes was confirmed by 1H NMR spectroscopy. Catalytic activities of Ag(I) compounds were tested for three-component coupling reaction of some aldehydes, amines, and phenylacetylene. Three new dibenzimidazolium salts bridged by 2-methylenepropane-1,3-diyl group were synthesized. Their dinuclear N-heterocyclic carbene Ag(I) complexes were prepared by the reactions of these salts with Ag N-heterocyclic carbenes (NHCs) and their transition metal complexes have been very popular in organometallic chemistry for many years. NHC metal complexes with powerful metal-carbon bonds have been typically employed as efficient catalysts in various transformations. NHC-Ag(I) complexes are of capital importance among these complexes. Using of these complexes as carbene transfer reactives for the synthesis of transition metal complexes is one of the most used methods [1\u20137]. There have been numerous reports related to biological and medicinal applications [8\u201313]. Also, NHC silver complexes may have luminescence properties [14\u201317], and these are of significance in material science. NHC-Ag(I) complexes exhibit catalytic efficiencies in cycloaddition of CO2(NHC)2]X2 (X = PF6 or BF4) formulation . Dibenzimidazolium salts are featured compounds since NHC procured from these salts can generate easily numerous NHC metal complexes with structural variety. There are many studies related bidentate bis(NHC) ligands in which a linking group acts as a bridge between two NHC units. Silver complexes of these type ligands with particularly antibacterial and antitumor activities are prepared by the reaction of the salts with silver oxide in general [37\u201339]. Silver complexes containing bis(NHC) and halide ligands  form monomeric, oligomeric and polymeric neutral complexes in the solid state [40\u201342]. Cationic silver bis(NHC) complexes have dinuclear . Multicomponent reactions (MCRs) allow the attainment of complex molecules starting from more than two simple building blocks in one step. So, they have importance in various aspects in organic synthesis. A3-coupling reactions are presented.In this study, synthesis of three novel 2-methylenepropane-1,3-diyl group bridged dibenzimidazolium salts and dinuclear NHC-Ag(I) complexes are reported. As far as is known, the studies about alkenyl bridged bis(NHC) are relatively less than those of alkyl bridged groups. To synthesize stable metal complexes containing chelating carbene ligands, we have prepared these dinuclear silver complexes. We hope that the metal NHC complexes formed by transmetallation by using these silver NHC complexes can be employed as effective catalysts. Besides, findings regarding catalytic tests of the complexes in A1H (400 MHz) and 13C (100 MHz) NMR spectra, a Varian VNMRJ spectrometer was employed. Elemental and mass analyses were executed by a LECO-932 CHNS device and a SHIMADZU LC-MSMS-8040 mass spectrometer, respectively. Thermogravimetric analysis was accomplished using EXSTAR TG-DTA 7300 instrument. IR spectra were obtained with Perkin-Elmer FT-IR spectrophotometer in the range of 400\u20134000 cm\u20131 using KBr. All experimental operations were performed in air. The chemicals commercially available were used without any purification. For recording  1(1 mmol) and 3,5-dimethylbenzyl bromide (2 mmol) was stirred in DMF (3 mL) at 80 \u00b0C for 24 h. After cooling to the room temperature and addition of Et2O (15 mL), the suspension was filtered. The solid was washed by EtOH (2\u00d75 mL) and Et2O (2x5 mL) and dried in air. Yield: 91%. IR n(NCN): 1558 cm\u20131.1H NMR (CD3OD): d = 9.78 , 7.93\u20137.85 , 7.71\u20137.63 , 7.13 , 7.05 , 5.65 , 5.45 , 5.31 , 2.29  ppm. 13C NMR (CD3OD): d = 139.07, 135.75, 132.61, 131.62, 131.47, 130.49, 127.22, 127.16, 125.90, 118.65, 113.81, 113.35, 50.83, 49.00, 19.83 ppm. LC-MSMS: [M-Br]+ atm/z607.20. Anal. Calc. for C36H38N4Br2: C, 62.97; H, 5.59; N, 8.16. Found: C, 63.07; H, 5.42; N, 7.77%. The mixture of2bwas obtained by the reaction of1with 3,5-dimethoxybenzyl bromide with the same procedure for2a except that drying in vacuum. Yield: 77%. IR: n(NCN): 1554 cm-1.1H NMR (dmso-d6): d = 10.11 , 8.03-7.95 , 7.67-7.59 , 6.73 , 6.47 , 5.68 , 5.42 , 5.27 , 3.70  ppm. 13C NMR (dmso-d6): d = 161.29, 143.49, 136.50, 136.27, 131.66, 131.48, 127.29, 127.19, 119.26, 114.48, 114.43, 107.22, 100.42, 55.84, 50.47, 49.22 ppm. LC-MSMS: [M-Br-H]+ atm/z669.20. Anal. Calc. for C36H38N4O4Br2: C, 57.60; H, 5.11; N 7.47. Found: C, 56.85; H, 4.74; N, 7.38%. Compound2cwas obtained by the reaction of1with 3,5-di-tert-butylbenzyl bromide with the same procedure for2a except that washing process. The solid was washed by Et2O (4x5 mL) and dried in air. Yield: 97%. IR n(NCN): 1562 cm-1.1H NMR (dmso-d6): d = 10.17 , 8.11 , 7.99\u20137.91 , 7.71\u20137.56 ,7.41 , 7.35 , 5.75 , 5.45 , 5.09 , 1.22  ppm. 13C NMR (dmso-d6): d = 151.56, 143.30, 137.14, 133.55, 131.56, 131.51, 127.27, 127.22, 123.29, 122.64, 114.54, 114.38, 51.01, 49.08, 35.06, 31.58 ppm. LC-MSMS: [M-Br]+ atm/z775.40. Anal. Calc. for C48H62N4Br2\u22c51.5H2O: C, 65.36; H, 7.44; N, 6.35. Found: C, 65.63; H, 7.43; N, 7.32%. Compound2O (2 mmol) was stirred in MeOH (20 mL) at room temperature for 24 h in dark. After filtration through celite, NH4PF6 (2.5 mmol) in MeOH (10 mL) was added to the filtrate and it was stirred at 25 \u00b0C for 2 h in dark. Filtration, washing with MeOH (2 \u00d7 5 mL) and Et2O (2 \u00d7 5 mL), and finally recrystallization from MeCN/Et2O (1/3) gave the pure product.The mixture of the salt (1 mmol) and Ag(NCN): 1400 cm-1.1H NMR (dmso-d6): d = 7.62 , 7.34 , 6.76 , 5.55 , 5.36 , 4.96 , 2.00  ppm. 13C NMR (dmso-d6): d = 140.40, 138.31, 136.30, 133.79, 133.68, 129.88, 125.14, 124.90, 124.71, 112.92, 52.23, 52.02, 21.12 ppm. LC-MSMS: [M-PF6]+ atm/z1409.35. Anal. Calc. for C72H72N8Ag2P2F12: C, 55.60; H, 4.68; N 7.21. Found: C, 56.53; H, 4.67 ; N, 7.24%.Yield: 77%. IR n(NCN): 1400 cm\u20131.1H NMR (dmso-d6): d = 7.68\u20137.59 , 7.35 , 6.27 , 5.56 , 5.38 , 4.91 , 3.52  ppm. 13C NMR (dmso-d6): d = 162.16, 140.46, 138.53, 133.78, 133.71, 124.90, 124.76, 112.85, 105.65, 99.16, 55.42, 52.15, 51.97 ppm. LC-MSMS: [M-PF6]+ atm/z1537.40. Anal. Calc. for C72H72N8O8Ag2P2F12: C, 51.37; H, 4.32; N, 6.66. Found: C, 52.14; H, 4.16; N, 6.71%.Yield: 76%,. IR n(NCN): 1400 cm-1.1H NMR (dmso-d6): d = 7.86 , 7.50-7.40 , 7.36 , 7.22 , 7.16 , 5.69 , 5.34 , 4.74 , 1.01  ppm. 13C NMR (dmso-d6): d = 151.19, 135.72, 133.95, 133.50, 125.06, 124.93, 122.19, 121.92, 113.28, 112.72, 52.75, 34.78, 31.36 ppm. LC-MSMS: [M-PF6]+ atm/z1746.60. Anal. Calc. for C96H120N8Ag2P2F12: C, 60.94; H, 6.41; N, 5.92. Found: C, 61.30; H, 6.41; N, 5.69%.Yield: 70%. IR n2O and MgSO4 were added to the mixture. Filtration was done and Et2O was removed from the filtrate. Related propargylamine was obtained in pure form by column chromatography. NHC silver complex (3 mol%), aldehyde (1 mmol), amine (1.2 mmol) and phenylacetylene  were placed in a test tube with screw cap. The mixture was stirred at 80 \u00b0C for 18 h in dark medium. After cooling to room temperature, Et1was prepared by the reaction of two equivalents of benzimidazole and one equivalent of 1,1-bis(chloromethyl)ethylene by using NaH base in THF [15]. Quaternization of1with two equivalents of substituted benzyl bromides afforded the dibenzimidazolium dibromide salts2a-2c. Transition metal complexes of N-benzylic benzimidazol-2-ylidene are of importance in organometallic chemistry, and there have been various studies on these compounds . Dinuclear cationic NHC silver hexafluorophosphate complexes3a-3cwere procured by the reactions of2a-2cwith two equivalents of Ag2O and then salt metathesis reactions of bromide complexes with NH4PF6 in methanol medium. Synthesis methods of dibenzimidazolium salts and dinuclear NHC-Ag(I) complexes are in Figure 1. Dibenzimidazole compound2a-2cappear at 9.78-10.17 ppm in the 1H NMR spectra, these signals resonating in a low field do not exist in those of the Ag(I) complexes. This observation points out formation of a NHC metal complex as previously reported [52]. The absence of carbene carbon signals in the 13C NMR spectra of the silver complexes may be attributed to the fluxional behaviour of the NHC silver complexes . IR peaks concerning the stretching vibrations of -C=N- groups for the salts are present at 1554\u20131562 cm\u20131. Whereas, these values decrease to 1400 cm\u20131 for the metal complexes. These data are compatible with the literature [54]. The stretching frequencies related to P-F bond for the complexes appear in the range of 834\u2013840 cm\u20131. The sharp band observed in 3390 cm-1 for 2c is assigned to the n(O-H) of hydrated water. TGA/DTA analysis supports that this compound is a hydrate molecule. Unfortunately, single crystals required for XRD analysis were not obtained despite all efforts. The molecular weights of2a-2cand3a-3cwere proved by LC-MSMS spectroscopic analysis. [M-Br]+ and [M-2Br]+ peaks are observed for2a-2c. There are [M-PF6]+ signals at 1409.35, 1537.40, and 1746.60, respectively in the mass spectra of3a-3c. Mass data affirm dinuclear [Ag2(L)2](PF6)2 formulation. It is believed that the cationic silver complexes3a-3cisolated as hexafluorophosphate salts do not form polymers. The results of elemental analysis confirm the expected formulations. While the signals of the acidic C2 protons of1H NMR spectroscopy for a period of ten days. 1H NMR spectra were recorded on the day their dmso-d6 solutions were prepared and after one, four, seven, and ten days. The spectra for stability testing are shown in Figures S7-S9 in supporting information. The results evidently point out that the complexes are stable in solution even after ten days. Stabilities of the silver complexes in solution were studied by 3-coupling reactions have been catalyzed by many transition metal ions, the number of studies on using NHC silver complexes is limited. In this work, catalytic activities of Ag(I) compounds were studied for three-component coupling reaction of some aldehydes, amines and phenylacetylene. The reaction of p-formaldehyde, diethylamine, and phenylacetylene was carried out using different solvents and different amount of catalyst3a . The results showed that solvent free medium and increased amount of catalyst raised the activity. N,N-diethyl-3-phenylprop-2-yn-1-amine was obtained in 78% yield with 3 mol% catalyst . When the same reaction was performed by using piperidine instead of diethylamine, 51%\u201352% yields were obtained . These data are comparable with the literature . It was understood that each of the three complexes exhibited similar activities in both reactions examined. In our previous work, 59% yield was obtained for this reaction with a similar complex containing 3-methoxybenzyl group on NHC ligand [15]. The presence of a larger number of alkyl groups on the benzyl substituent causes a decrease in the catalytic activity. 3,5-dimethylbenzyl, 3,5-dimethoxybenzyl and 3,5-di-tert-butylbenzyl substituents on NHC ligands did not affect the catalytic behaviours of the catalysts. This consequence is consistent with the literature . In the case of using aliphatic aldehydes and the amines, such as diethylamine and piperidine, the propargylamine compounds were gained in moderate yields . Using morpholine caused low yields . When the results are compared, it is seen that the prepared complexes show less activity than monomeric NHC silver complexes possibly because of steric hindrance. This result is consistent with the literature [31].While ABased on the literature [56\u201358], a mechanism can be proposed . Firstly, C-H activation of phenylacetylene forms a silver-acetylide complex and acidic proton. The formation of this complex may proceed through a p-complex. Then, in situ formed silver acetylide reacts with iminium cation to give propargylamine and the catalyst.3-coupling reactions of some aldehydes, amines and phenylacetylene were performed. The results deduced that3a-3cexhibited similar activities, and the substituents on NHC ligands in the catalysts did not change the yields. Preparation of different transition metal complexes obtained from these compounds and their catalytic experiments have proceeded.A new series of dibenzimidazolium salts bridged by 2-methylenepropane-1,3-diyl group and their dinuclear NHC-Ag(I) complexes were synthesized and characterized. Preliminary catalytic tests for A"}
+{"text": "ADP/ATP translocase 1 (ANT1) is involved in the exchange of cytosolic ADP and mitochondrial ATP, and its defection plays an important role in mitochondrial pathogenesis. To reveal an etiological implication of ANT1 for Parkinson\u2019s disease (PD), a neurodegenerative disorder, a mouse model treated with 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine and neuroblastoma cell model induced by 1-methyl-4-pehny1-pyridine were utilized in this study.+. Protein interaction assay, coupled with the analysis of LC-MS/MS, silver-stained SDS-PAGE and Western blot against anti-ANT1 antibody respectively, illustrated the interaction of ANT1 with \u03b1-synuclein using the expressed \u03b1-synuclein as a bite. Additionally, a significant increasing ROSs was detected in the MPP+-treated cells.The tissue-specific abundance in ANT1 in mouse brains was accessed using the analysis of Western blot and immunohistochemistry. Down-regulated soluble ANT1 was found to be correlated with PD, and ANT1 was associated with PD pathogenesis via forming protein aggregates with \u03b1-synuclein. This finding was confirmed at cellular level using neuroblastoma cell models. ANT1 supplement in neuronal cells revealed the protective roles of ANT1 against cytotoxicity caused by MPPThis study indicated that ANT1 was a potentially causative factor of PD, and led to neuropathogenic injury via promoting the formation of protein aggregates with \u03b1-synuclein. This investigation potentially promotes an innovative understanding of ANT1 on the etiology of PD and provides valuable information on developing potential drug targets in PD treatment or reliable biomarkers in PD prognostication. Parkinson\u2019s disease (PD) is characterized as a slowly progressive neurodegenerative disorder that results from a combination of multiple genetic and environmental risk factors \u20133. This The patients with PD decrease their life span, reduce their life quality and suffer a lot from the disease. The parkinsonian symptoms clinically include motor features, such as rest tremor, muscular rigidity and bradykinesia, and non-motor symptoms containing autonomic dysfunction, cognitive impairment, sleep disorders, psychiatric symptoms, dementia, etc. Since non-motor symptom appears at onset, the patients with PD may develop into classical motor features after long-term disease duration as the disease progresses , 5, 7, 8substantia nigra pars compacta (SNpc) which contributes to the motor impairment of PD. However, the recent growing evidences illustrates that pathologic area of PD is distributed outside the nigrostriatal pathway and tends to appear prior to the onset of overt motor symptoms. Meanwhile, as aggregates of abnormally folded proteins has been identified to be a common pathogenesis of neurodegeneration, the accumulation of intracellular protein inclusions which composes primarily of \u03b1-synuclein is found to be an important biological hallmark of PD. Till now, \u03b1-synuclein is recognized as a major component to form a variety of different aggregates with thin thread-like or small dot-like structures in the brain with neurodegenerative disease  followed by clearance at 14,000\u00a0rpm for 30\u00a0min twice. For cells, the cultured SH-SY5Y cells in a 10\u00a0cm dish were digested with trypsin, and collected by centrifugation at 1000\u00a0rpm for 5\u00a0min. Then, the SH-SY5Y cells were broken by ultrasonication  followed by removal of insoluble fragments through centrifugation at 14,000\u00a0rpm for 30\u00a0min twice. Subsequently, the protein concentrations of the supernatants were determined using a BCA kit . Thus, the protein lysates were obtained and frozen at \u2212\u00a080\u00a0\u00b0C for a further investigation.2PO4; 5\u00a0mmol/L of KCl; 1.5\u00a0mmol/L of MgCl2; and 80.1\u00a0mmol/L of NaCl; pH 7.4) for 30\u00a0min respectively. On the one hand, the different specialized structures including striatum, midbrain, cerebellum, cortex, hippocampus, brain stem were dissected carefully, post-fixed in the above fixative, and stored at 4\u00a0\u00b0C for IHC examination. On the other hand, the whole mouse brains were saturated in 15% picric acid in PBS followed by storage in 20% sucrose in PBS at 4\u00a0\u00b0C for immunofluorescence staining.On the 7th day after the last MPTP injection, the mice were anesthetized by inhalation of diethyl ether, and mechanically fixed to expose the heart completely via opening the chest. The mice were intracardially perfused with 0.9% physiological saline and 4% paraformaldehyde in phosphate-buffered saline  and 5-hydroxytryptamine (5-HT) in SH-SY5Y cells and striatum of mouse brains were measured by performing RP-HPLC respectively. The samples were injected into HPLC analysis, and eluted through a C18 column . The mobile phase was a mixture of acetic acid buffer : methanol \u2009=\u2009 86:14; the flow rate was constant at 0.5\u00a0ml/min over the course of HPLC separation, and the eluted compounds were detected by monitoring the absorbance at the wavelength of 280\u00a0nm.Eighty microgram of soluble proteins for each different specialized structures and neuroblastoma SH-SY5Y cells was separated by running a 15% SDS-acrylamide gel electrophoresis (SDS-PAGE) in a vertical electrophoresis apparatus and transferred to a PVDF membrane in blotting buffer  to make protein accessible to monoclonal antibody detection using anti-\u03b2-actin antibody (Abcam), anti-ADP/ATP translocase 1 antibody  and anti-GAPDH antibody (Abcam). The protein bands were visualized by an enhanced chemiluminescent (ECL) system .The different fixed specialized structures were routinely processed for embedding in a paraffin block followed by dehydration using a gradient concentration of alcohol . Then, the samples were diaphanized by immersion in xylol, and embedded in paraffin. The paraffin-embedded sections were sliced to 10\u00a0\u03bcm thickness and mounted on glass slides for IHC analysis using the primary antibody of anti-ANT1 and anti-TH . Diaminobenzidine was used for visualization of immunolabeling.+ for another 24\u00a0h, SH-SY5Y cells were incubated with DCFH-DA (10\u00a0\u03bcmol/L) for 30\u00a0min. After washing with PBS twice, the fluorescence intensity was determined using a fluorescence microplate reader (Beckman) with an excitation wavelength of 485\u00a0nm and an emission wavelength of 535\u00a0nm.Measurement of the intracellular ROSs was performed using the fluorescent probe 2\u2032,7\u2032-dichlorofluorescin diacetate , which can be oxidized to the highly fluorescent dichlorofluorscein (DCF). Cells were seeded and cultured onto black 96-well plates with a clear bottom. After exposure to MPPAfter the whole mouse brain was frozen in Milli-Q water in freezing microtome/cryostat (\u2212\u00a040\u00a0\u00b0C), six micron-thick sections were cut and mounted on glass slides for immunofluorescence analyses using the monoclonal antibodies including anti-ANT1 and anti-\u03b1-synuclein as the probes. SH-SY5Y cells were seeded on poly-L-lysine-coated coverslips in six-wells plates for 12\u00a0h. Then, the cells were fixed with 4% paraformaldehyde followed by permeabilization with 0.5% Triton X-100. After blocked with 1% normal serum in PBS for 30\u00a0min at room temperature, the SH-SY5Y cells were incubated with monoclonal antibodies, including anti-ANT1 and anti-\u03b1-synuclein respectively at 4\u00a0\u00b0C overnight. The secondary antibodies conjugated to rhodamine/FITC were used in this study. All samples were counterstained with 4\u2032,6-diamidino-2-phenylindole (DAPI) . The images were acquired with an Olympus inverted fluorescence microscope .hsa-ANT1 gene (GenBank: BC022032.2) was amplified from cDNA of homo sapient using the forward primer of 5\u2032 ATAAGCTTCGAGCTGTCACCATGGGTGATC 3\u2032 (underlined sequence was HindIII site) and the reverse primer of 5\u2032 TCCTCGAGTTAGACATATTTTTTGATCTCATC 3\u2032 (underlined sequence was XhoI site). The purified hsa-ANT1 fragment was cloned into the pJET-T to generate pJET-hsa-ANT1. Then the sequence-confirmed hsa-ANT1 from the plasmid of pJET-hsa-ANT1 was cloned into pcDNA3.1 to yield pcDNA3.1-hsa-ANT1 for transfecting neuroblastoma SH-SY5Y Cells.The +. Then, the MPP+-treated cells were cultured for transfection until they reached a confluence of 70\u201390%. And the transfection was conducted using lipofectamine 2000 . Prior to transfection, the plasmid of pcDNA3.1-hsa-ANT1 was mixed directly with lipofectamine 2000 (m:v \u2009=\u2009 1:2\u20133) in DMEM. Then, the mixture was added to the cells. Transfection efficiency, cell apoptosis and parkinsonian parameters were monitored at 48\u00a0h post-transfection.Neuroblastoma SH-SY5Y Cells were seeded in flat-bottomed 6-well plates and exposed to 1.2\u00a0mM MPPCell apoptosis was analyzed using flow cytometry and Annexin V-FITC Apoptosis Detection Kit . SH-SY5Y cells were stained with dual staining Annexin V-fluorescein isothiocyante (FITC)-propidium iodide (PI) at room temperature in the dark for 15\u00a0min. Then, the stained cells were measured by flow cytometry . The data were analyzed by FlowJo , and the apoptotic cells were counted and presented as a percentage of the total cell counts. The results were conducted in triplicate.synuclein gene was chemically synthesized and sequenced followed by ligation with pCold II to yield the expression vector of pCold II-\u03b1-synuclein in Takara company. The pCold II-\u03b1-synuclein was transformed into E. coli BL21 (DE3) cells for over-expression of the \u03b1-synuclein fusion protein. A single colony of E. coli BL21 (DE3) carrying pCold II-\u03b1-synuclein was grown in 5\u00a0ml of LB medium overnight, and the resulting culture was used to inoculate 200\u00a0ml of LB medium. When the optical density of the culture was 0.5 at 600\u00a0nm, 0.6\u00a0mmol/L isopropyl-D-thiogalactopyranoside (IPTG) was added to induce \u03b1-synuclein expression for another 20\u00a0h at 16\u00a0\u00b0C. The cells harboring pCold II-\u03b1-synuclein were lysed by sonication  in pre-chilled lysis buffer . The cytoplasmic fractions were applied to a pre-equilibrated Ni\u2013NTA column  of 1.0\u00a0mL column volume after they were clarified by centrifugation at 27,000g at 4\u00a0\u00b0C for 40\u00a0min. The purification was performed according to the manufacturer\u2019s instruction. The column was washed with 20\u00a0ml wash buffer  to remove unbound protein, and eluted with 10\u00a0ml elute buffer . The eluted fractions were collected, and their protein concentration was determined using a BCA kit. \u03b1-synuclein in the eluted fractions was verified by running a 15% SDS-PAGE followed by Western blot analysis. The probing of the membrane with antibody of (anti)-polyhistidine monoclonal HIS-1  was conducted manually, and the colorimetric detection of protein bands was developed by ECL solution [\u03b1-6-tagged \u03b1-synuclein  was allowed to bind to the Ni-NTA magnetic agarose bead suspension (40\u00a0\u03bcl) in 500\u00a0\u03bcl pull-down reactions under gentle rotation at 4\u00a0\u00b0C for 2\u00a0h. Then, the supernatants were removed using a magnetic MagRack6\u2122  whereas the magnetic beads bound with \u03b1-synuclein protein were remained in a microcentrifuge tube. Five hundred microliters of whole-cell lysate of mouse brains with protease inhibitor cocktail  (prey) was added to the \u03b1-synuclein-bound Ni-NTA beads and incubated at 4\u00a0\u00b0C for 2\u00a0h with gentle rotation. After incubation, unbound proteins were removed by washing using wash buffer . The beads were then suspended in 50\u00a0\u03bcl elute buffer , and the eluted fractions were collected. The bound proteins were run on a 15% SDS-PAGE gel stained with a silver staining kit , and analyzed by Western blot analysis coupled with a 15% SDS-PAGE separation. The probing of the membrane with (anti)-ANT1 monoclonal antibody was conducted manually, and the colorimetric detection of protein bands was developed by ECL solution.Pull-down assay for \u03b1-synuclein interaction partners was performed using Ni\u2013NTA magnetic agarose beads . The purified His2S2O3: 300\u00a0mm K3Fe(CN)6 (1:1). The reduction of the decolorized gel was performed in 100\u00a0mmol/L NH4HCO3 solution, and the digestion of the gel was conducted in 50\u00a0mmol/L NH4HCO3 solution containing 12.5\u00a0ng/\u03bcl of sequencing-grade trypsin for 20\u00a0h at 37\u00a0\u00b0C according to a modified in-gel trypsin digestion procedure. Then, the trypsin-digested peptide fragments were desalted using C18 StageTip column followed by lyophilization. The lyophilized peptide fragments were dissolved in 0.1% formic acid for subsequent liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis.Silver-stained gel lane was excised into small pieces followed by decolorization in 400\u00a0\u03bcl mixed solution containing 100\u00a0mmol/L NaThe LC-MS/MS analysis was performed using shotgun separation of peptide mixtures on a reversed phase C18 column  by EasynLC1200 chromatographic system . Optimum separation was achieved with a binary mobile phase at a flow rate of 300\u00a0nl/min. Solvent A: 0.1% formic acid aqueous solution; solvent B: 0.1% formic acid, 95% acetonitrile and water. The gradient elution program was: 0\u20133\u00a0min, ramping to 7% from 2% of solution B; 3\u201348\u00a0min, ramping to 35% from 7% of solution B; 48\u201353\u00a0min, ramping to 90% from 35% of solution B; 53\u201360\u00a0min, 90% of solution B. The MS analysis was conducted by Q-Exactive Plus mass spectrometer in 60\u00a0min. The Q-Exactive Plus MS analysis was set to data-dependent acquisition, and the MS instrument was operated in the positive mode. Working conditions of MS were as follows: mass range 300\u20131800\u00a0m/z at 70,000 at m/z200 resolution for triggering MS/MS events; automated gain control (AGC) at 1e6; maximum IT at 50\u00a0ms. The data of tandem MS was acquired under the following conditions: 20 ions with the highest intensity triggered by each full-scan of MS; the resolution of the tandem mass spectrum: 17,500 at m/z200; AGC: 1e5; maximum IT: 50\u00a0ms; MS2 Activation Type: HCD; Isolation window: 2.0Th, Normalized collision energy: 27. The MS data retrieval was performed by MaxQuant1.6.1.0 software against Uniprot Mus musculus Database.Quantification of the protein bands was conducted using Image J (version 1.42). The color images were converted to gray-level intensity for quantification. Slight variations in background staining were corrected by subtracting background density. Digital analysis on the immunohistochemistry images was performed using Image-Pro Plus software (version 6.0).t test. WB and IHC data were analyzed in triplicate. A threshold of P values \u2009<\u2009 0.05 was considered statistically significant.Statistical analyses were conducted using GraphPad Prism 6 and SPSS (version 19). The statistical difference between the MPTP-treated group and the control group was evaluated using a two-tailed equal variance Student\u2019s MPTP, which can reproduce the similar essential parkinsonian symptoms in mice to the ones in patients with PD, was utilized for preparing animal model of PD in this study. A successful mouse model was supported by detecting the reduction in the representative biochemical markers of PD including dopamine (DA), 5-hydroxytryptamine (5-HT) and tyrosine hydroxylase (TH), and examining motor dysfunction via the vertical grid test which assesses the fore-paw strength and horizontal grid test which evaluates the fore-paw faults.Typical parkinsonian symptoms are motor dysfunction. Thereby, in order to assess whether the MPTP administrated mice had motor impairment, a locomotor activity was evaluated between the healthy and MPTP-treated group. Figure\u00a0SNpc evaluated by immunohistochemistry was conducted. The MPTP-treated mice displayed a significant reduction in striatal DA , striatum , hippocampus , cerebellum  and brain stem  in the MPTP-induced group, with the exception of cortex. No significance in soluble ANT1 abundance was found in cortex  between the MPTP-induced group and their controls. This suggests that soluble ANT1 was down-regulated in PD conditions. Thus, the down-regulated soluble ANT1 is found to be associated with PD.To characterize the relationship between ANT1 and PD, we analyzed the abundance of soluble ANT1 in the different specialized structures of the mouse brains including hippocampus, cortex, striatum, cerebellum, midbrain and brain stem. Figure\u00a0To further investigate whether ANT1 was associated with PD, a tissue-based IHC was performed using the monoclonal anti-ANT1 antibody as the probe. The dark brown spot was recognized as positive. Figure\u00a0The aggregation of abnormally folded proteins has been characterized as a common cause of PD, and \u03b1-synuclein has been characterized as a major component in protein aggregates. Since the important roles of \u03b1-synuclein in PD pathogenesis, an association of ANT1 with \u03b1-synuclein aggregation was investigated in the mouse brains using dual immunofluorescence to further reveal the pathogenesis associated with ANT1. We analyzed the co-expression of \u03b1-synuclein and ANT1 in the different structures of mouse brains as shown in Fig.\u00a0As noted above, although ANT1 was down-regulated in the MPTP-treated group, the protein aggregates formed by ANT1 and \u03b1-synuclein was found only in the mouse brains of MPTP-treated group. Thus, co-aggregation of ANT1 with \u03b1-synuclein is highly suspected to be associated with PD pathogenesis.+ was used as a PD-like cell model in this study.In this study, ANT1 was demonstrated to be involved in the pathogenesis of PD via forming protein aggregates with \u03b1-synuclein. To further confirm the association of ANT1 with \u03b1-synuclein, we aimed to detect this finding at a cellular level. Thereby, neuroblastoma SH-SY5Y cells treated with MPP+ on SH-SY5Y cells was evaluated by observing the cellular morphology  was as high as 19.27% (P \u2009=\u2009 0.027). Thus, ROSs level was significantly increased in MPP+-treated neuroblastoma cells. Based on this finding, we highly suspected that down-regulated ANT1 resulted in the dysfunctional transport of ATP and ADP across the mitochondrial membrane, and led to the abnormal production and accumulation of ROSs, then participated in the pathogenesis of PD. In addition, oxidative stress is thought to promote the accumulation of \u03b1-synuclein, a hallmarker of PD, further to promote the formation of Lewy bodies in brain [In this study, ANT1 was found to be associated with PD. As reported, the impairment of ANT1 is proposed to contribute to the pathogenesis of mitochondrial myopathy and hypertrophic cardiomyopathy . A defic+-induced cytotoxicity and rescuing cells from the PD-like injury.Although ANT1 has been shown to be cytotoxic in several cell types and induce cell death in cardiomyocytes and Hela cells , 18, the+-treated models compared to their controls.In this study, we illustrated that dysfunction of ANT1 led to the formation of the \u03b1-synuclein-containing protein aggregates. Based on the evidences obtained in this study, we proposed a hypothesis that the down-regulated ANT1 was the source of the increased ROSs, and the dysfunctional ANT1 initiated the formation of the protein accumulation which was associated with \u03b1-synuclein. The increased ROSs may attack \u03b1-synuclein to promote the co-aggregation of \u03b1-synuclein with ANT1 resulting in cell death of neurons as shown in Fig.\u00a0+-treated models. Then, ANT1 impairment possibly results in mPTP open. Theoretically, mPTP open allows an increase in the permeability of molecules with less than 1500 Daltons in mass across the inner membranes of the mitochondria, thus results in mitochondrial swelling [In addition, the importance of ANT1 also lies in its involvement in the formation of pro-apoptotic mPTP  as a major component, which is located in the inner membrane of mitochondria. ANT1 interacts with several proteins containing cytosolic benzodiazepine receptor, porin/voltage-dependent anion channel, Bax and matrix cyclophilin-D to form mPTP. In this study, we found a dramatic decrease in ANT1 in MPTP/MPPswelling . mPTP opBased on the obtained evidences in this study, an implication of ANT1 for PD pathogenesis is proposed. As a key functional component in the inner membrane of mitochondria, ANT1 is involved in the exchange of cytosolic ADP and mitochondrial ATP, and plays a crucial role in maintaining the mitochondrial function, whereas mitochondrial dysfunction plays a critical role in the aged disease such as PD. In this study, we detected a down-regulated DA and ANT1, and up-regulated \u03b1-synuclein aggregation, co-aggregation of ANT1 with \u03b1-synuclein, and motor impairment in the MPTP-treated group Fig.\u00a0. The pro+-induced cytotoxicity in SH-SY5Y cell models. Despite the limitations of this study, this is the first report to reveal ANT1 as potential etiology of PD. This investigation provides key information necessary for designing prospective studies to evaluate ANT1 in the etiology of PD, thus may potentially provide valuable information on developing potential drug targets in PD treatment or reliable biomarkers in PD prognostication.As noted, we reported that the down-regulated ANT1 and suspicious ANT1 accumulation were associated with PD pathogenesis via forming the co-aggregation with \u03b1-synuclein, and ANT1 supplement attenuated MPP"}
+{"text": "Neurofibromatosis type 1 (NF1), neurofibromatosis type 2 (NF2) and schwannomatosis (SWN) are rare conditions with pronounced variability of clinical expression. We aimed to reach consensus on the most important manifestations meriting the development of drug trials. The five-staged modified Delphi procedure consisted of two questionnaires and a consensus meeting for 40 NF experts, a survey for 63 patient representatives, and a final workshop. In the questionnaires, manifestations were scored on multiple items on a 4-point Likert scale. The highest average scores for NF experts deciding the \u2018need for new treatment\u2019 were for malignant peripheral nerve sheath tumour (MPNST)  and high grade glioma (HGG)  for NF1; meningioma  for NF2 and pain  for SWN. The patient representatives assigned high scores to all manifestations, with plexiform neurofibroma being highest in NF1 , vestibular schwannoma in NF2 , and pain in SWN . Twelve experts participated in the consensus meeting and prioritised manifestations. MPNST was ranked the highest for NF1, followed by benign peripheral nerve sheath tumours. Tumour manifestations received highest ranking in NF2, and pain was the most prominent problem for SWN. Patient representative ratings for NF1 were similar to the experts\u2019 opinions, except that they ranked HGG as the most important manifestation. For NF2 and SWN, the patient representatives agreed with the experts. We conclude that NF experts and patient representatives consent to prioritise development of drug trials for MPNST, benign peripheral nerve sheath tumours, cutaneous manifestations and HGG for NF1; tumours for NF2; and pain for SWN. Neurofibromatosis type 1 (NF1), neurofibromatosis type 2 (NF2) and schwannomatosis (SWN) are genetic disorders that predispose to the development of nerve sheath tumours , 4.Rare hereditary conditions like the neurofibromatoses (NF) require large, multicentre trials and multiple patient populations for successful evaluation of new treatments. EU-PEARL  is an international project, and the aim is to create a framework for the future conduct of Integrated Research Platforms (IRPs) . InsteadThe wide range of manifestations of NF  presents a challenge when trying to create a framework for future IRPs. Since it would be impossible to include all disease manifestations, it is critical to prioritise clinical manifestations for evaluation. Given the patient-centric design of EU-PEARL and the general importance of including patients\u2019 opinion in clinical trial design, patient input on this prioritisation is vital. The aim of this study was to reach consensus on the most important manifestations of NF to select for clinical drug trials, based on the opinions of both NF experts and patient representatives.We used a five-staged modified Delphi procedure, consisting of two questionnaires and a consensus meeting for NF experts, a survey and consensus meeting for patient representatives, and a final workshop for the selection of manifestations Fig.\u00a0.Fig. 1A Initially, we prepared the list of clinical manifestations that would be presented to the NF experts in the first questionnaire. Based on a literature search in Medline , 7 and tn\u2009=\u200912) were asked to participate in the NF expert consensus meeting.Potential Delphi participants were included from our contacts through (a) the European Neurofibromatosis Group (ENFG), (b) NF experts within ERN GENTURIS, (c) clinicians from the Children\u2019s Tumour Foundation (CTF) clinical care advisory board and (d) international NF experts who participated in the development of the new diagnostic criteria . We did At the start of each questionnaire participants received an announcement email, followed by a second email with a hyperlink to the questionnaire. The deadline for completing the questionnaires was set at 2, 5 weeks after sending the hyperlink. Non-responders were sent a general reminder after two weeks, and a personalised reminder email on the day of the deadline. The questionnaires were built and distributed using Google Forms.The first questionnaire aimed to reduce the number of manifestations. Participants were asked to score each manifestation on a 4-point Likert scale (1\u2009=\u2009\u2018No priority\u2019 to 4\u2009=\u2009\u2018High priority\u2019) for priority of inclusion into a platform trial  the need for a new drug treatment in addition to existing treatments, (ii) the availability of existing drug treatments and (iii) the available evidence for these treatments. Need for new treatments and availability of drug therapies were scored on a 4-point Likert scale, and evidence for effectiveness of existing drug therapies on a 5-point Likert scale. For items (ii) availability and (iii) evidence, a \u2018Do not know\u2019 option was provided. Answers from experts who chose this option were excluded from the analysis for that item.The consensus meeting was hosted virtually due to the COVID-19 pandemic and planned two weeks after the deadline of the second Delphi questionnaire. The consensus meeting had two goals: (i) to arrange the various NF manifestations into manifestation groups that could be studied in a combined platform trial, and (ii) to reach consensus about a priority ranking for these groups. First, manifestations were excluded in a group discussion, based on the results from the second questionnaire and clinical expertise of participants. Next, the remaining manifestations were aggregated into groups, based on pathophysiology, targets for treatments, organ system, etc. Participants were asked to rank these manifestation groups according to priority for inclusion into platform trials. Given the larger number of manifestations for NF1, this condition required a third questionnaire. It consisted of a question on feasibility of performing a platform trial for this group (easy or difficult) and the ranking of the manifestation groups.To include input from patients in our final selection of manifestations, a survey and consensus meeting was performed for patient representatives. Separate surveys were developed for NF1, NF2 and SWN patient representatives in close coordination with two NF patient organisations (Neurofibromatosis Patients United (NFPU) and CTF) , 12. TogThe outcomes of the NF expert consensus meeting and the patient representatives\u2019 survey and consensus meeting were used by the WP7 group to decide on a final selection of manifestations groups in a final virtual workshop.Results from the second Delphi questionnaire for NF experts and the patient representatives\u2019 survey were analysed by calculating the average score on the Likert scale for each item. Additionally, all items were analysed for floor and ceiling effects . For the NF expert consensus meeting and patient representatives\u2019 survey, average rankings were calculated. The ranking could range between 1 and 8 for NF1 (since eight manifestation groups could be ranked); between 1 and 2 for NF2, and between 1 and 3 for SWN. A lower ranking implies a higher priority for inclusion into future clinical trials.We identified a total of 66 manifestations; 52 for NF1, 9 for NF2 and 5 for SWN.There were 43 positive responses to the Delphi invitation and 9 individuals did not respond. Thirty-eight participants completed the first questionnaire in the given timeframe Fig.\u00a0. The queDue to the COVID-19 outbreak the original deadline of 2, 5 weeks after launch was extended by 1 week. Thirty-six participants completed the questionnaire 84%) Fig.\u00a0. Seven m% Fig.\u00a0. Seven external NF experts and five WP7 clinicians participated in the consensus meeting. In the NF1 consensus discussion, a number of manifestations were excluded based on the availability of existing effective treatments , which was reflected in their average scores for availability and evidence for treatment ANNEX\u00a0. Two manFor NF2, three manifestations were excluded during the consensus meeting, either because effective  treatments are already available (cataract), or because the manifestations are rare and/or rarely cause significant symptoms  ANNEX\u00a0. OrbitalFor SWN, unilateral vestibular schwannoma and meningioma were excluded because of their rarity and due to the availability of reasonably effective surgical treatment options. Pain was identified as the most important manifestation, given its\u2019 severity and best feasibility for performing platform trials. Loss of function and numbness and/or tingling due to a schwannoma were also considered, but received a lower ranking than pain due to low feasibility for performing platform trials and lack of clear outcome measures.The invitation to participate in the survey was sent to 91 patient representatives ANNEX\u00a0. We obtaFor NF2, the highest average NT score was appointed to vestibular schwannoma , but all manifestations within the tumour group received high average scores with relatively small variability in appointed scores ANNEX\u00a0. VestibuIn SWN, pain had highest average scores ANNEX\u00a0 and alsoThe average rankings of the manifestation groups by the patient representatives were discussed with members from NFPU and CTF during the virtual consensus meeting. The rankings were agreed upon without any changes.Based on the results from the NF expert consensus meeting and results from the patient representatives\u2019 survey and consensus meeting, we achieved consensus that for NF1 the following groups will be included into future platform trials: (1) MPNST, (2) benign peripheral nerve sheath tumours, (3) cutaneous manifestations and (4) high grade gliomas. The focus for NF2 will be the tumour group. For SWN, pain will be the top priority.We performed a five-staged modified Delphi procedure, and were able to reach a consensus on the most important challenges in neurofibromatosis, as seen by experts and patient representatives. We identified four manifestation groups for NF1 that are recommended for future platform trials: MPNST, benign peripheral nerve sheath tumours, cutaneous manifestations and high grade gliomas. For NF2, priority was assigned to the group tumour manifestations . For SWN, pain has been selected as the top priority for future platform trials.https://clinicaltrials.gov/ct2/show/NCT04374305). This grouping of manifestations, however, is susceptible to change according to new insights, e.g. the discovery of a new common drug target, or if the pathophysiology of a manifestation can be linked to the pathophysiology of another manifestation (group).Since platform trials can include multiple conditions in the same trial, either because of similar treatment and/or similar pathophysiology, manifestations could be aggregated into main groups. This allowed for a more extensive selection of manifestations that could be included. A similar strategy can be seen in a newly launched platform trial for NF2 in the USA, where different tumour types are encompassed in the same trial  did not report significant difficulties with completing the survey in a foreign language in their feedback on the survey. We also did not collect information on level of education, socio-economic status and ethnicity. The impact of socio-economic status may vary strongly amongst countries, and possibly interacts with the psychosocial burden of NF. We did not observe any regional differences between patient representatives from the USA versus European countries, but our small sample size might have influenced this result. There is also no stratification of results for age and patient vs. parent/caregiver respondents of the survey, which could have skewed the results since the NF are progressive conditions. However, results from the patient representatives\u2019 survey were homogenous, suggesting a certain level of data saturation of the results.Multiple patient representatives reported difficulty in estimating burden and need for treatment for manifestations that they themselves had not experienced. This may have favoured manifestations that had the highest prevalence in our patient representatives\u2019 survey, such as plexiform neurofibroma 68%) and subcutaneous neurofibroma (62%) in NF1  and shoGiven the high prevalence of neurocognitive manifestations  andIn conclusion NF experts and patient representatives consent to prioritise the development of future clinical trials for new drug treatments for MPNST, benign peripheral nerve sheath tumours, cutaneous manifestations and high grade gliomas for NF1; tumour manifestations for NF2; and pain for SWN. The findings of this study are mostly important and relevant to EU-PEARL, to aid the creation of the framework on which the future platform trials can be conducted. This study may serve as a guideline on which manifestation may have highest priority for future research.The authors are member of the EU Patient-centric clinical trial platform (EU-PEARL). EU-PEARL has received funding from the Innovative Medicines Initiative 2 Joint Undertaking under grant agreement no. 853966. This Joint Undertaking receives support from the European Union\u2019s Horizon 2020 research and innovation programme and EFPIA and CTF, Global Alliance for TB Drug Development non-profit organisation, Springworks Therapeutics Inc. This publication reflects the authors\u2019 views. Neither IMI nor the European Union, EFPIA, or any Associated Partners are responsible for any use that may be made of the information contained herein.Supplementary materials: Annex 1, 2, 6, 8, 9 and 10.Annex 3Annex 4Annex 5Annex 7"}
+{"text": "Previously, we have demonstrated that lipid and lipoprotein profiles in breast cancer patients are altered compared to a control showing a new link between triglycerides enriched particles and breast cancer, hence suggesting an active role of lipids and their metabolism in this pathology. In this study, we have demonstrated the importance of tumor microenvironment crosstalk as well as the crucial role of lipid transfer between adipose tissue and cancerous cells. Moreover, we have demonstrated that each breast cancer subtype has their specific lipid signature. Interestingly, drug resistant luminal A cell lines switch this metabolic profile to the triple negative lipid signature. Knowledge of these signatures might help us to understand how these specific lipids are related with drug resistance and how it may clarify new treatments in these cancer patients.R and MCF-7 TAXR). We have observed that different lines metabolize the palmitic acid in a different way and use their carbons in the synthesis of different new lipid families. Furthermore, we have observed that the lipid synthesis pattern varied according to the cell line. Surprisingly, the metabolic pattern of the resistant cells was more related to the TNBC cell line compared to their sensitive cell line MCF-7. These results allow us to determine a specific lipid pattern in different cell lines that later might be used in breast cancer diagnosis and to find a better treatment according to the cancer molecular type.Obesity and adipose tissue have been closely related to a poor cancer prognosis, especially in prostate and breast cancer patients. The ability of transferring lipids from the adipose tissue to the tumor cells is actively linked to tumor progression. However, different types of breast tumor seem to use these lipids in different ways and metabolize them in different pathways. In this study we have tracked by mass spectrometry how palmitic acid from the adipocytes is released to media being later incorporated in different breast cancer cell lines (MDA-MB-231, SKBR3, BT474, MCF-7 and its resistant MCF-7 EPI Breast cancer is the most common cancer in women and the second one overall . DespiteThe communication between tumor cells and the adipocytes is bidirectional, and it has been described that tumor cells are able to modify the transcriptomes and metabolism of adjacent cells for their own benefit. In fact, adipocytes located within the tumor microenvironment are also subjected to dedifferentiation and a reprogramming of their metabolic behavior, transforming into cancer associated adipocytes (CAAs) . CAAs reMoreover, lipids are a high heterogenous variety of molecules. Depending on their structure and composition, lipids can play a plethora of roles in cell biology, such as membrane biosynthesis, energy storage, and cell signal transmission ,15.According to the Lipid Maps Alliance, lipids can be divided into eight different groups: fatty acids (FAs), glycerolipids (GL), glycerophospholipids (GP), sphingolipids (SP), sterol lipids (ST), prenol lipids (PR), saccharolipids (SL), and polyketides (PK) . It is wThese tumor lipid metabolic modifications also provide the possibilities for novel diagnostic strategies in cancer. As lipids can be found in urine, blood and other different accessible tissues, a lipid molecular screening by lipidomic technology can aide cancer diagnosis as well as in the understanding of the metabolic changes which cancer cells are subjected to within their microenvironment .Some studies have found modifications in several lipid families in BC patients compared to the control population and correlated these alterations with a higher frequency of cancer occurrence . FurtherR and MCF-7 EpiR cells in close contact with mature adipocytes. Our main objective was to understand how the adipose tissue within the tumor microenvironment transfer lipids to adjacent cancer cells and how the tumor lipid metabolism is modified as a result, using lipidomics techniques and analysis.In order to understand the metabolic switch that tumor cells undergo within their microenvironment, we performed in-depth lipid profiling of four different BCC lines, MDA-MB-231, BT474, SKBR3, and MCF-7 as well as the MCF-7 derived drug resistant MCF-7 TAXPrevious studies have detected a different lipidic and lipoprotein profile in breast cancer patients compared to healthy women . KnowledR and MCF-7 EpiR were described previously and originally obtained from the American Type Culture Collection (ATCC). Cell lines were cultured Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) supplemented with 10% foetal bovine serum (FBS), 1% penicillin streptomycin and 1% non-essential amino acids  at 37 \u00b0C with 5% CO2.Human MDA-MB-231, BT474, SKBR3, MCF-7 and its resistant MCF-7 TAXFibroblast cell line 3T3-L1 was obtained from the American Type Culture Collection (ATCC) and it was cultured until confluence. Then, they were cultured for 10 days with differentiation media, consisting in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin, 1% Non-essential Amino Acid Solution, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 \u00b5M dexamethasone and 10 \u00b5g/mL insulin from bovine pancreas .After differentiation, mature adipocytes were serum starved for 24 h. Then, they were cultured with the necessary conditions for each experiment.R and MCF-7 EpiR were cultured until they reached 80% of confluence. Then cells were serum starved. After 24 h of incubation with 0.1% FBS, different BCC lines CM were obtained for further assays. Moreover, mature adipocytes were cultured for 3 days with the different BCC lines CM. As a control condition, mature adipocytes were serum starved for 3 days.To obtain conditioned media (CM), MDA-MB-231, BT474, SKBR3, MCF-7 and its resistant MCF-7 TAXOil Red O is a dye which strongly stains neutral lipids. To determinate the adipocyte lipid content, mature adipocytes were cultured with different BCC lines CM. For 3 days of incubation, treated and non-treated mature adipocytes were stained with Oil Red dye following the protocol described (#K580-24) and pictures were taken with an inverted microscope (Olympus IX71). Then, three washes with isopropanol 60% were performed and for dye extraction, cells were incubated with isopropanol 100% for 5 min. Afterwards absorbance at 490 nm was measured using SINERGY HT .RNA extraction was performed according to the PureLink RNA Mini Kit  protocol and it was quantified using Synergy HT . Total RNA (1 \u03bcg) was reverse-transcribed using the PrimeScript RT Reagent Kit . Levels of mRNA were assessed using LightCycler96 device (Roche) with the Taqman probes for respective genes acquired from Life technologies CD36 (Mm00432403_m1), FABP4 (Mm00445878_m1), FABP5 (Mm00783731_s1), TBP (Mm01277042_m1). Then, transcript results were normalized with the gene TBP and the fold change was obtained.R and MCF-7 EpiR, fibroblasts were differentiated for 10 days as previously described. During the differentiation process labeled palmitic-acid BODIPY (Sigma) every other day. In order to test the intake of labeled palmitic acid during the differentiation process, different images were taken using an inverted microscopy (Olympus IX71) and fluorescent intensity measure by ImageJ.To observe the lipid transfer from mature adipocytes to BCC lines MDA-MB-231, BT474, SKBR3, MCF-7 and its resistant MCF-7 TAXAlternatively, after maturation, the labeled adipocytes were serum-deprived for 3 days, and the medium was collected. Then, the BCC lines to be examined were seeded into 24 well plates until they reached 80% confluence and they were serum-starved with DMEM high glucose 0.1% FBS for 24 h. Next, the medium derived from labeled adipocytes were added to the BCC lines. After 72 h of treatment, cells were washed with PBS 1X, and images were taken using an inverted microscopy (Optimus IX71).In order to determine the protein levels from adipocytes CM, ELISA assay was performed to detect the levels of FABP4 and CD36. The media from the adipocytes and the CAAs were obtained as explained above. The samples were analyzed performing ELISA assay following the company protocols (Antibodies Online).Different BCC lines were seeded in 12 well plates. After serum-starvation, cells were incubated with adipocyte CM and they were stained after 24 h with the lipophilic fluorescent dye Nile Red (100 ng/mL)  diluted in PBS 1\u00d7 for 5 min at room temperature to visualize the lipid droplets. Cell images were captured using an Olympus IX71 microscope and analyzed using the Image J software obtaining the intensity of each image.13 was added. For PA formulation, C13PA (200 \u00b5M) was mixed with free fatty acid BSA (33.32 \u00b5M) (Sigma). As a control condition, a parallel differentiation with non-isotope PA was performed. To assess the lipid transfer from mature adipocytes to the different BCC lines, a coculture system was performed. Firstly, 3T3-L1 fibroblasts were seeded and cultured in the upper chamber of a 12-well plate until they reached confluence. Then, they were differentiated as described above. Every other differentiation day, an isotope of palmitic acid (PA) with CIn a 12 well plate, different BCC lines were seeded and cultured until they reached 80% of confluence. Then, the upper chamber with mature labeled and non-labeled adipocytes were put on above these BCCs. After 2 days of coculture, cells were harvested and collected until their analysis.Cells and culture media lipids were extracted using a biphasic extraction method. Cells were extracted in 220 \u00b5L methanol. After sample fragmentation by vortexing, immersion in liquid N2, and ultrasonication, 440 \u00b5L of dichloromethane (DCM) and 140 \u00b5L of water were added sequentially. A total of 200 \u00b5L of media was extracted via the same procedure as the cells without the immersion in liquid N2 and using methyl tert-butyl ether (MTBE) instead of DCM. Samples were incubated at 4 \u00b0C for 30 min and centrifuged . 330 \u00b5L of the organic phase (lipidic) was collected for drying under a stream of nitrogen. Lipid pellets were resuspended in 150 \u00b5L of methanol/toluene (9:1) for liquid chromatography\u2013mass spectrometry (LC\u2013MS) analysis. Quality control (QC) samples consisting of pooled samples from each condition were injected at the beginning and periodically through the workflow.\u20131; nebulizer, 30 psig; fragmentor, 120 V; and skimmer, 65 V. The instrument was set to work over the m/z range from 50 to 1200 with an acquisition rate of 3 spectra/sec. For compound identification, MS/MS analyses were performed in targeted mode with an acquisition rate of 3 spectra/sec, applying three collision energies:10, 20, 30, and 40 V. Lipid structures were identified by matching tandem MS spectra against reference standards in LIPID MAPS [Untargeted LC\u2013MS analyses were performed using a UHPLC system  coupled with a 6550 ESI-QTOF MS (Agilent Technologies) operating in positive electrospray ionization (ESI+) mode. A total of 2 \u00b5L of cells extract and 3 \u00b5L of media extract were injected, and lipids were separated by reverse-phase chromatography with an Acquity UPLC C18-RP . Mobile phase A was acetonitrile/water (60:40) (10 mM ammonium formate), and mobile phase B was isopropanol/acetonitrile (90:10) (10 mM ammonium formate). Solvent modifiers were used to enhance ionization and to improve the LC resolution in positive ionization mode. Separation was conducted under the following gradient: 0\u20132 min, 15\u201330% B; 2\u20132.5 min, 48% B; 2.5\u201311 min, 82% B; 11\u201311.5 min, 99% B; 11.5\u201312 min, 99% B; 12\u201312.1 min, 15% B; 12.1\u201315 min, 15% B. The ESI conditions were as follows: capillary voltage, 4000; gas temperature, 150 \u00b0C; drying gas, 12 L minPID MAPS  and/or LPID MAPS  and/or MPID MAPS .13C enriched lipid metabolites. This analysis provided a matrix containing the retention time, ion m/z value, number of 13C enriched and the integrated the peak area of each feature for each sample. Features were then putatively associated to lipid identities found in above mentioned databases. Only those annotated features were statistically tested for significant changes across experimental groups using a one-way ANOVA, correcting for multiple comparisons using Tukey\u2019s honest significant differences and false discovery rate (FDR) method.LC\u2013MS data were processed using the XCMS R package  for peakp-value < 0.05 was considered to be statistically significant.All analyses were performed with the Statistical Package for Social Sciences (SPSS) software 27.0.1.0 . Data were expressed as mean \u00b1 SEM. Statistical analysis was determined by one-way ANOVA and the differences between groups was analyzed using the Tukey post-hoc test. A R and MCF-7 TAXR) and the amount of lipids accumulated in the mature adipocytes was then examined using Oil Red staining.To assess if tumor cells can influence the amount of lipids liberated by the adipocytes, mature adipocytes were cultured with conditioned media from different BCC lines .Interestingly, we observed that incubation with CMs from BCC lines caused the intracellular lipid droplet levels to decrease drastically when compared to the adipocytes incubated with the control CM . Accordip < 0.05) one-way ANOVA)  in the mature adipocytes upon culture with BCC CMs by RT-qPCR. The results showed that the mRNA levels of FABP4 and CD36 were significantly increased in the adipocytes when culture with BCC CMs (* y ANOVA) A.p < 0.05) one-way ANOVA.In addition, once we analyzed two of the most representative BCC lines (MDA-MB-231 and MCF-7) effects on adipocyte CM composition, we observed that there was an increase of all three fatty acid transporters within the media B. BCC liR and MCF-7-TAXR with the control or adipocyte CM and studied their lipid uptake by staining their intracellular accumulated lipid droplets using Nile Red. The results showed that there was a significant increase in the amount of lipid droplets in all the BCC lines following incubation with adipocyte CM when compared with control CM   .Palmitic acid is a fatty acid closely linked to cancer progression . We sougThen, we assessed if the lipids accumulated in the mature adipocytes, are released by the adipocytes and uptaken to the different BCC lines. We analyzed the levels of intracellular BODIPY fluorescence in the BCCs after cultured them with PA-labeled adipocyte CM and found a substantial increase in labeled palmitic acid in the cytoplasm of BCCs, suggesting that the accumulation of lipids in the BCCs when co-cultured with adipocytes as a result of their uptake of lipids released by the adipocytes B.13C labeled palmitic acid was added to differentiating adipocyte, which were then co-cultured with different BCCs, respectively. Further mass spectrometry analysis revealed that the 13C labeled PA had transformed into different lipid species in the BCCs. The results showed that there were new lipid species, such as DAG, TG, ceramides, phosphatidylcholines, phosphoethanolamines and sphingomyelins, whose carbons were derived from the mature adipocytes derived 13C-labeled PA. Once we analyzed the different BCC lines one by one, we observed that some BCCs had a similar but specific lipid pattern that were distinct from other BCCs. For example, we uncovered that SKBR3 and BT474 cells had a similar lipid signature. Through principal component analysis, we found that both SKBR3 and BT474 cells were closely related in terms of their lipid metabolism, particularly the way they convert the labeled fatty acids into DAGs and SMs. Moreover, we also detected that their lipid species, including diacylglycerols (DAGs), sphingomyelins (SMs), triglycerides (TGs) and phosphatidylcholines (PCs), are notably different from the other BCC lines studied. When we compared the luminal A MCF-7 cell line with its resistant derivatives, MCF-7 EPIR and MCF-7 TAXR, through principal component analysis, we observed that they were remarkably different in their lipid metabolic pathways by which the labeled fatty acids were transformed into intracellular lipids. Amongst the lipids which differed substantially between the parental and drug-resistant MCF-7 cells were ceramides (CMs), sphingomyelins (SMs), phosphatidylethanolamines (PEs) and phosphatidylcholines (PCs).Next, we sought to identify the specific changes in lipid compositions in the breast cancer cells in response to co-culture with adipocytes. R and MCF-7 EPIR cells harbored a lipid signature more similar to the triple negative breast cancer (TNBC) cell line MDA-MB-231. , such as PC(O-33:3), PC(38:1) and PC(20:0/18:1) were increased in the drug-resistant MCF-7 and TNBC cells compared to the other drug-sensitive cell lines. Among the lipids, the phosphatidylethanolamines, including PE(P-34:2)///PE(P-16:1/18:1), PE(P-36:2)///PE(P-18:1/18:1), PE(O-34:2)///PE(O-15:1/19:1), PE(P-38:7)///PE(P-16:1/22:6), the ceramides (CMs), such as LacCer(18:1/16:0) and LacCer(18:1/24:0) and the sphingomyelins (SMs), such as SM(36:1) and SM(42:1), were also altered in both the drug resistant MCF-7 cells and MDA-MB-231 cells when compared with the rest of the drug-sensitive cell lines .R and MCF-7 TAXR and the MDA-MB-231 cell lines when compared with the other relatively more drug-sensitive cell lines. Moreover, as MDA-MB-231 cells have previously been shown to be a more taxol and epirubicin resistant cell line compared to MCF-7 and some of the other breast cancer cell lines studied, our results also suggest that the more drug-resistant and malignant breast cancer cells have modified their lipid profiles and metabolism to enhance their drug-resistance and malignant progression.In summary, these alterations demonstrate a switch in lipid components and metabolism in the drug resistant MCF-7 EpiThe interactions between different components of the tumor microenvironment and the cancer cells play a key role in cancer initiation and malignant progression . In consR and MCF-7 TAXR. The results have expanded our understanding of the effects of many types of breast cancer cells, including TNBC, HER2+, luminal A and luminal B as well as drug-resistant breast cancer cells on mature adipocytes and vice versa in the tumor microenvironment.In this study, we also studied the interactions between adipocytes and six different breast cancer cell lines, including MDA-MB-231, SKBR3, BT474, MCF-7 and the MCF-7 derived drug-resistant cell lines MCF-7 EpiIn this study, we firstly focused on how tumor cells modify the tumor microenvironment, focusing on the adipose tissue. We reviewed how different breast cancer cells modify the behavior of adipocytes within the tumor microenvironment and reconfirmed the previous finding that breast cancer cells promote lipid metabolism and increase its degree of delipidation . We alsoMoreover, it has also been suggested that tumor cells cocultured with mature adipocytes increases their lipid uptake, which is partially mediated by the fatty acid transporters ,31,32.Recently, palmitic acid has been shown to be strongly linked to cancer development and progression. In fact, it has been demonstrated tumor cells have a specific need for this lipid and it is capable of promoting a number of cancer hallmarks, particularly cancer survival and metastasis . It has As a result, we tracked the labeled palmitic acid, and confirmed that mature adipocytes first incorporated the labeled fatty acid, and then released it into the extracellular media, when they are treated with the conditional media from different breast cancer cell lines. We also obtained evidence that adipocyte-released fatty acids were taken up by the breast cancer cells and turned into lipids. Moreover, the internalized fatty acids will be used for the biosynthesis of new lipid compounds in the breast cancer cells, and the discovery of specific lipid signatures and metabolic pathways for distinct molecular breast cancer subtypes may help us to understand how different cancer cells internalize lipids from adjacent adipocytes and how they transform them into any lipid families in their own benefit. In fact, a previous study has demonstrated that cancer cells incorporate exogenous palmitic acid into their structural and oncogenic signaling lipid components . It has 13C-palmitic acid and confirmed that this isotope-labeled fatty acid was internalized into mature adipocytes as lipid droplets. Then, the adipocytes carrying the isotope-labeled fatty acid were cocultured with our different breast cancer cell lines. We observed a significant increase of the isotopic labels in media, suggesting that there was a releasement of these lipids form mature adipocytes to their environment. Subsequently, we also observed that the isotope signals that had appeared in media disappeared slowly into the cancer cells, suggesting the labeled lipid internalization into the cancer cells.To determine the lipid metabolic pathways involved in enhancing cancer progression and metastasis, we first cultured the fibroblast cell line 3T3-L1 in the presence of Next, we analyzed the fate of the labeled palmitic acid carbon in all different breast cancer cell lines using a LC-MS analysis, and interestingly, we found that cancer cells were able to synthetize new lipid species.As cancer cells need a huge amount of lipids in order to proliferate, to synthesize cellular structural components and to participate in intracellular signaling .Phosphatidylcholines are one of the main lipid subtypes present in the mammalian cells and their metabolism has been widely studied in cancer. According to bibliography, it has been described that there is an increase in the presence of different PC in worst prognosis BC patients\u2019 blood stream . MoreoveR and MCF-7 TAXR and the TNBC cell line MDA-MB-231 compared to the sensitive cell lines MCF-7, the luminal B cell line BT474, and the HER2+ cell line SKBR3. Interestingly, PC saturations such as PC (36:1), PC (38:2) have been closely related with worst prognosis [R and MCF-7 TAXR cells, MDA-MB-231 cells have previously been shown to be a more taxane  and anthracyclin  resistant cell line and more metastatic competence compared to MCF-7 and some of the other breast cancer cell lines used in the study [Our results show significant differences between the PC pattern of each studied BCC line. Interestingly, the PC biosynthesis pattern was more similar between the resistant MCF-7 cell lines MCF-7 Epich as PC :1, PC (3rognosis .As menti6:1), PC :2 have bR and MCF-7 TAXR cells and the TNBC MDA-MB-231 cells metabolize the palmitic acid derived from mature adipocytes in a different manner, in comparison to the parental drug-sensitive MCF-7 as well as to the luminal B and HER2+ cell lines, suggesting that more malignant and drug-resistant breast cancer cells acquire a specific PC biosynthesis pattern that differ from the drug-sensitive and less metastatic breast cancer cells. Furthermore, alterations in PE metabolism have been also linked with breast cancer progression. In fact, a number of studies have reported altered plasma and urine PE levels, specifically PE (15:0/19:1) to be linked to breast cancer development. In this study, we have also found this lipid family strongly altered in the drug-resistant cell lines  compared to the relatively more drug-sensitive cell lines.We have found that the way that the drug resistant MCF-7 EpiBioactive sphingolipids and ceramides are of special importance in promoting cancer progression due to their roles as signaling molecules and have been shown to regulate a number of critical cellular biological processes ,39. SM iIn summary, our study shows that defining the lipid signatures in breast cancer might be a new approach to understanding the behavior of cancer cells within the tumor microenvironment, particularly when they are in the vicinity of the adipose tissue. Moreover, our data also suggest that altered lipid metabolism may play a critical role in the malignant transformation as well as drug-resistance in the breast cancer cells. The altered lipid signatures found in the drug-resistant and more metastatic breast cancer cells might also be useful markers for breast cancer diagnosis and prognosis. Moreover, targeting the deregulated lipid uptake and metabolism in the drug resistant breast cancer cells may help to reverse the drug insensitivity of some breast cancer cells and lead to novel treatment strategies for breast cancer as well as drug resistance ."}
+{"text": "Cynara cardunculus). Three artichoke cultivars were evaluated, \u2018Green Globe Improved\u2019 (GGI), \u2018Imperial Star\u2019 (IS), and \u2018Romolo\u2019 (ROM). Plants established with the transplanting method had higher mean root length intensity (La), root length, and root surface area as compared to plants established by direct seeding. The topsoil (0\u201320 cm) had on average higher La, root length, and root surface area than deeper soil profiles. Transplanted plants had higher plant shoot width and leaf area index (LAI) chlorophyll content index (SPAD) than direct seeded plants at the vegetative stage in 2015. The improvement of root and shoot growth in transplants (compared to direct seeding) also resulted in higher (p < 0.05) marketable yield (21.1 vs. 19.9 ton ha\u22121 in 2015 and 18.3 vs. 13.7 ton ha\u22121 in 2016). Additionally, 46\u201350% of the total yield occurred during the first 30 days of harvest in the transplanting method compared to 13\u201338% for direct seeding. No significant differences were found between planting methods or cultivars in leaf-level gas exchange  and cynarin concentration in the marketable heads. Although chlorogenic acid was similar in both establishment methods in 2015, direct seeding had higher concentration in 2016. Comparing cultivars, GGI had higher root length, surface area, root volume, and earlier and higher marketable yield than ROM. However, ROM had higher mean root length intensity  than GGI in both growing seasons. This study showed significant and consistent improvements in root and shoot traits, and yield for transplants as compared to direct seeded plants.The objective of this two-year field study was to assess the influence of stand establishment methods (direct seeding or transplanting) on root growth dynamics, shoot morphology, leaf physiology, yield, and quality of globe artichoke ( Capsicum annuum), earlier studies comparing direct seeding with containerized transplants produced in nurseries showed significant effects on growth (leaf area and shoot weight) and developmental stages in the field [Cynara cardunculus) fields established with the transplanting method typically have less weed pressure and disease problems and higher yield and head uniformity as compared to direct seeding [Farming systems, nitrogen management, cultivar selection, and planting methods such as direct seeding and transplanting are cultural strategies that greatly influence root and shoot growth, yield, and fruit quality in high-value vegetable crops ,2,3,4. Ihe field . For cerhe field ,7. Howevhe field . The mai seeding . TransplAllium cepa), rice (Oryza sativa), bell pepper, tomato (Solanum lycopersicum), and watermelon (Citrullus lanatus) [\u22121) than direct seeding (19.5 t ha\u22121) and matured earlier (104 days) compared to the direct seeded (135 days) method [Albizia, Acacia, Phyllanthus, and Ocotea) [Transplanting is a reliable method to improve growth and achieve earliness and higher yield, as reported for several crops, including onion (lanatus) ,5,6,10. ) method . Transpl) method . In sout) method . A compa Ocotea) .La; total root length per specific area in the soil profile) can significantly affect plant morphology and leaf physiology, as reported in globe artichoke and olive crops [Root traits such as root length, root surface area, and length intensity  normally increases rapidly from leaf emergence, reaching maximum values at full leaf expansion. Physiological performance, including Pn and stomatal conductance (gs), can increase due to higher leaf thickness and contents of chlorophyll (a + b) and palisade parenchyma because those leaf variables help to capture a greater amount of light [Plant internal factors, such as leaf anatomy and morpho-physiology, can significantly affect growth and development, as well as yield . Photosyof light ,17. Howe\u22121), and cynarin from 2 to 20 (\u00b5g g\u22121) [La) in relation to the most common planting methods (transplant vs. direct seeding). We hypothesize that when compared to direct seeded plants, artichoke transplants will have a differential root growth pattern, with more biomass allocation directed towards root length, especially during the vegetative developmental stage and for early cultivars; these responses will in turn translate into improvements in early and total marketable yield. The findings of this study contribute to new knowledge centered on the importance of root traits to improve crop growth and productivity of artichoke transplants.Globe artichoke is a popular Mediterranean crop rich in antioxidant compounds such as chlorogenic acid, dicaffeoylquinic acids, and cynarin, which are known to be beneficial for human health ,19. In a(\u00b5g g\u22121) ,22,23. I(\u00b5g g\u22121)  also fouLa as affected by planting method, cultivar, and soil depth for two growing seasons, 2015\u20132016. Plants analyzed in 2015 were transplanted (or sown) in October 2014 while the 2016 plants were transplanted (or sown) in November 2015. Since the study considered the annual system the 2015-started plants were terminated at the end of the cycle and thus not analyzed in 2016. Mean La was significantly different for planting method, cultivar, and soil depth during 2015 and 2016. Transplants had higher mean La in both years (2015\u20132016) as well as the overall means. Root length values for direct seeded plants never exceeded those of transplants across months and over the study period 2015\u20132016. However, La response varied with cultivars. For example, ROM and IS had higher root La in March and April 2015 while GGI had higher La than IS in July 2015 and 2016  for the three tested artichoke cultivars were within 0\u201380 cm of soil depth. A soil depth of 0\u201320 cm had the highest mean La in 2015 while the 20\u201340 and 40\u201360 La were higher than the other soil depths in 2016. However, the overall mean (2015\u20132016) for La was similar across the 0\u201360 cm soil depths.and 2016 . The maiLa across months and over the study period 2015\u20132016, except in May 2015  to direct seeding across the soil depths (0\u2013100) and cultivars , except for GGI at a 0\u201320 cm soil depth in 2015 (There was a significant planting method and cultivar interaction for May 2015 . The pla in 2015 .La (0\u2013100 cm soil depth) during the vegetative stages  across planting methods (direct seeding and transplanting) and over cultivars  , and decreased thereafter (July) in 2015. However, both planting methods had the highest La after harvest (July) in 2016 (In both years (2015\u20132016), artichoke plants had the lowest IS, ROM) . Both di in 2016 . Roots iSoil cores sampling in July 2015 revealed that root component values, specifically length and surface area from the transplanting method, were higher than those from direct seeding . The GGIPn), stomatal conductance (gs), and transpiration (E)) were determined at the vegetative and harvesting stages in both growing seasons. In 2015, plant width, height, and LAI at the harvesting stage as well as SPAD at the vegetative stage were higher in transplanted vs. directly seeded artichokes  and across cultivars (data not presented). Photosynthesis values ranged from 19\u201321 \u00b5mol m\u22122 s\u22121 in 2015 and from 28\u201330 \u00b5mol m\u22122 s\u22121 in 2016 ; gs was about 0.4 mol m\u22122 s\u22121 in 2015 and 0.5 mol m\u22122 s\u22121 in 2016; E was about 2.5 mmol m\u22122 s\u22121 in 2015 and 5.5 mmol m\u22122 s\u22121 in 2016. However, gas exchange  values for 2015 were about 50% lower than 2016 across cultivars and over planting methods (direct seeding and transplanting) though the differences between years (2015 vs. 2016) were not statistically analyzed.Parameters used as a measure of plant morphology (width and height) and their main physiological processes (leaf area index (LAI), chlorophyll content index (SPAD), photosynthesis  compared to direct seeded plants [Lactuca sativa), cultivars with large root systems increased nitrogen use efficiency and displayed higher growth rates, leading to higher yields than those cultivars with smaller roots [La in 2016 (compared to 2015) was coupled with higher LAI (shoot canopy) at the harvesting stage. This increase in LAI and La in 2016 could be attributed to higher rainfall received by plants that year as compared to the 2015 growing season. In 2015, the total rainfall and irrigation applied to artichoke plants was 630 mm , while in the 2016 growing season, the total rainfall and applied irrigation was 787 mm . In addition, higher soil moisture in 2016 led to higher SPAD (vegetation stage) and gas exchange and consequently higher LAI compared to 2015. Interestingly, the transplanting method reduced applied water in a sugar beet (Beta vulgaris) field by about 24% and evapotranspiration by 25% as compared with direct seeding [Across the study period, the results described in d plants . Higher er roots . Higher  seeding .La, length, and surface area), shoot size, and early and total marketable yield from transplants across the study period (2015\u20132016), this establishment method could offer significant benefits to artichoke farmers over direct seeding. In both years, 46 to 50% of the total yield was harvested in the first month for transplants, while 13 to 38% in the same period for direct seeded plants (Zea mays) to N fertilization  showed that transplants reached the flowering stage 11 to 15 days earlier and had higher yield than plants established by direct seeding. It is well known that earliness is a trait highly dependent on the cultivar of choice. In our earlier study, that was the case of for IS, an artichoke cultivar classified as early blooming, while the GGI cultivar is considered to be late blooming [The observed increase in root and shoot growth and higher yield by the transplanting method compared to direct seeding in artichoke confirms previous results in other crops. In rice, transplanted plants had higher yield than direct seeded in both local and high-yielding cultivars . Tomato d plants . These reriod 201\u20132016, thperiod 20\u20132016, thblooming . In the Pn and LAI at harvest were about 40% higher than in 2015 (Although yield (treatments mean) in 2015 was about 28% higher than 2016, root and shoot growth was lower compared to 2015, though the differences between years (2015 vs. 2016) were not statistically analyzed. In the 2016 growing season,  in 2015 . Higher Globe artichoke is a valuable crop and a rich source of antioxidants, such as phenolic acids, flavonoids, and cynarin, which have been used for therapeutic effects ,19,34,35\u22121, P 55 mg kg\u22121, K 810 mg kg\u22121, Ca+2 12,939 mg kg\u22121, Mg+2 333 mg kg\u22121, S 29 mg kg\u22121, Na 50 mg kg\u22121, and nitrate-N 59 mg kg\u22121. In the 2015 growing season, the mean growing temperature was 23 \u00b0C, relative humidity 64%, and total rainfall 490 mm, while in 2016 the mean temperature was 21 \u00b0C, relative humidity 67%, and total rainfall 687 mm  from October 2014 to August 2016. The soil was a clay type  with the following chemical properties: pH 8.0, EC 0.6 dS ml 687 mm . The plaWe evaluated two planting methods, direct seeding and transplanting, on three artichoke cultivars, Green Globe Improved (GGI), Imperial Star (IS), and Romolo (ROM). GGI and IS  are open pollinated cultivar types with green to light purple heads, while ROM is a contemporary hybrid cultivar  with predominantly purple heads.For the transplanting treatment, artichoke seeds of the three cultivars were sown in polystyrene Speedling trays (one seed per cell) containing 128 cells (3.2 \u00d7 3.2 cm square and 6.4 cm deep) and placed in a germination chamber for 4 days in darkness inside an incubator chamber set at 20 \u00b0C. A 3:1 peatmoss:perlite growing medium was used and only initial watering was required during the incubation period. Then, seedlings were transferred to greenhouse conditions  and grown for 7 weeks before field planting. Direct seeding and transplanting were performed simultaneously in the open field on October 28, 2014 (first growing season) and on November 23, 2015 (second growing season). Plants started in 2014 were abandoned after harvest in 2015, and completely new plants were prepared for analysis in 2016. Both establishment and cultivar treatments were planted in separate blocks, each consisting of three beds 1.5 m apart, using a single row per bed at a spacing of 0.9 m between plants. Beds were laid out with a black plastic mulch to reduce weed pressure and soil evaporative water losses. The outside rows were used as buffers and the middle row was used for growth measurements and harvests. For the direct seeded treatment, three seeds per hole were seeded in the field and thinned to one plant after six weeks to be comparable with the transplanting method.\u22121. Fertilizers (4N-4.4P-8.3K and 32N-0P-0K) were applied in 3 split doses each year. The first dose  was applied the third week after transplanting, the second dose (40%) at the 8-leaf stage, and the third (40%) prior to the beginning of the harvest stage. In both seasons, irrigation was established by a subsurface drip system placed in the middle of the bed at a 15 cm depth. In the 2015 growing season, the number of irrigations was 10  while in 2016 the number of irrigations was 7 . The total rainfall and irrigation for the 2015 growing season was 630 mm  and 787 mm  for 2016. Overall, the total amount of water received by plants was between 630 and 787 mm across the study period. Gibberellic acid  was sprayed twice at 20 mg L\u22121, the first application at the 4th leaf stage and the second 10 d thereafter. Esfenvalerate  at 70 mL ha\u22121 was applied to control cucumber beetle (Diabrotica undecimpunctata) and cut worms during the vegetative stage. During early head development till harvest, calcium (5%) and zinc (5%)  were applied weekly to prevent head atrophia, a physiological disorder typically associated with calcium deficiency [In each growing season, N-P-K fertilizers were applied to reach a total rate of 150 N, 100 P and 100 K kg hacos (45\u00b0) \u00d7 tube depth of the photo. As the minirhizotron tubes were installed at a 45\u00b0 angle from the vertical line, four minirhizotron images were collected within each interval depth and the four values from each soil depth interval were averaged to one value prior to statistical analysis. A microscope camera system  was used to capture the root pictures from the upper interface of the tube and the soil [2. Images were analyzed using WinRHIZOTron software  and presented as La ).Root measurements were conducted four times during each growing season following the procedures of Othman and Leskovar  and Sharthe soil ,40. The Different soil horizons  were also collected during the harvesting stage in June 2015. Root samples from both treatments and across cultivars were carefully washed under a set of large to fine screens, roots were separated, and then root components were measured using a WinRHIZO image analysis system .Pn, gs, and E) were determined during vegetative and harvesting stages in both growing seasons. Gas exchange  was measured using a portable photosynthesis system  following the procedures of Othman et al. [2, flow rate to 500 \u03bcmol s\u22121, temperature in the cuvette to ambient air and reference CO2 to 390 \u03bcmol. SPAD was measured using a chlorophyll meter , and LAI was measured using a ceptometer . Artichoke harvests were conducted between April and May 2015 and 2016 and marketable yield (t ha\u22121) was determined. A head was considered marketable when its diameter was larger than 7 cm, without tipburn and/or open bracts [Parameters used as a measure of plant morphology (width and height) and their main physiological processes  in SAS  were used to identify differences between planting methods (direct seeding vs. transplanting), cultivars, and their interactions.The study was designed using a randomized complete block design with four replications and two factors . The analysis of variance (ANOVA) and the least significant difference test , and head cynarin concentration across the study period. Given that higher yield is the main concern for artichoke growers, this study supports that transplanting is the best growing method for globe artichoke cultivars. Since globe artichoke has one of the highest total antioxidant capacities among all vegetables, our future research will focus on how to couple the increase in artichoke yield with optimal concentrations of antioxidant compounds and enzymes in the heads. That research will provide a better understanding on the balance between yield promotion and phytonutrient quality, including the level of protection from oxidative stress in transplanted globe artichoke plants.Overall, the two-year field assessment of stand establishment methods, transplanting and direct seeding, revealed significant quantitative responses of root trait components, which were translated into yield differences between the two systems in the three cultivars evaluated. Transplants consistently exhibited increased"}
+{"text": "Moreover, the rsFC of the right anterior thalamus-left nucleus accumbens edge was significantly correlated with the NDSI scores  and NDLQI scores , the nodal efficiency of right anterior thalamus was significantly correlated with NDLQI scores  in FD patients. This study indicated the abnormal rsFC pattern, as well as global and nodal topological properties of the SCN, especially the bilateral anterior thalamus in FD patients, which enhanced our understanding of the central pathophysiology of FD and will lay the foundation for the objective diagnosis of FD and the development of new therapies.Functional dyspepsia (FD) is a disorder of gut-brain interaction. Previous studies have demonstrated a wide range of abnormalities in functional brain activity and connectivity patterns in FD. However, the connectivity pattern of the subcortical network (SCN), which is a hub of visceral information transmission and processing, remains unclear in FD patients. The study compared the resting-state functional connectivity (rsFC) and the global and nodal topological properties of SCN between 109 FD patients and 98 healthy controls, and then explored the correlations between the connectivity metrics and clinical symptoms in FD patients. The results demonstrated that FD patients manifested the increased rsFC in seventeen edges among the SCN, decreased small-worldness and local efficiency in SCN, as well as increased nodal efficiency and nodal degree centrality in the anterior thalamus than healthy controls ( Functional dyspepsia (FD) is one of the most common functional gastrointestinal disorders (FGIDs). According to the consensus of the Rome committee, FD refers to a group of upper gastrointestinal syndromes , which could not be explained by organic, systemic, or metabolic reasons . It was Functional dyspepsia is officially defined as a disorder of brain-gut interaction in the latest Rome diagnostic criteria , which pRecently, a detailed atlas for the segmentation of the subcortex regions was proposed , which pOne hundred and twenty FD patients and 103 HC were enrolled. The FD patients were recruited from the Hospital of Chengdu University of Traditional Chinese Medicine (CDUTCM) and the campus of CDUTCM from March 2016 to May 2018. After being diagnosed by 2 experienced gastroenterologists according to Rome IV Criteria for FD  and undeThe right-handed HC (aged from 18 to 40 years) without a history of gastrointestinal, neurological, or psychiatric disorders were recruited from the campus of CDUTCM. They underwent a basic evaluation including a review of medical history, physical examinations, and laboratory tests to exclude potential diseases.The Nepean Dyspepsia Symptom Index (NDSI) and Nepean Dyspepsia Life Quality Index (NDLQI) were used to assess the severity of clinical symptoms and the QoL of FD patients, respectively .via a 3.0 T magnetic resonance scanner  with an eight-channel-phased array head coil at Huaxi Magnetic Resonance Research Center of the West China Hospital. Parameters of the high-resolution 3-dimensional T1-weighted imaging were as follows: repetition time = 1900 ms, echo time = 2.26 ms, flip angle = 7\u00b0, slice thickness = 1 mm, slice number = 156, matrix size = 128 \u00d7 128, and field of view = 256 \u00d7 256 mm2. The blood oxygen level-dependent fMRI data were acquired with the echo-planar imaging: repetition time = 2000 ms, echo time = 30 ms, flip angle = 90\u00b0, slice number = 30, slice order = interleaved, matrix size = 64 \u00d7 64, field of view = 240 \u00d7 240 mm2, slice thickness = 5 mm, time points = 180. During the entire scanning procedure, patients were asked to keep their eyes closed and their ears plugged.The resting-state MRI data were acquired 1 and DPARSF 4.1 toolbox2  2.0 toolbox3 . First, 3 , and throftware4 .t-tests, Mann\u2013Whitney U test, and \u03c72 test were applied to the analysis of continuous and normally distributed data, non-normally distributed data, and dichotomous variable (the gender), respectively.SPSS 25.0  software was used for the demographic analysis between FD and HC groups. Student\u2019s p < 0.05, and the false discovery rate (FDR) was applied for the multiple comparison correction.With age, gender, and mean framewise displacement as covariates, analysis of covariance (ANCOVA) was applied to compare the between-group differences in rsFCs and topological properties. Moreover, to investigate the correlations between the clinical measures and neuroimaging metrics that showed group differences in FD patients, the partial correlation analyses were performed with age, gender, and mean framewise displacement as covariates. The significance thresholds for the between-group comparisons and correlation analyses were set to 2-tailed Eleven FD patients and 5 HC were excluded for the excessive head motion. Therefore, 109 FD patients and 98 HC were finally included in the data analysis. There were no significant differences between FD patients and HC in demographic characteristics  , right hippocampus (HIP_R), and left nucleus accumbens (NAc_L), bilateral amygdala (AMY), and left caudate nucleus (CAU_L), etc. (s tests) .Cp) and local efficiency (Eloc) of FD were significantly lower than HC   > 1, normalized shortest path length (\u03bb) \u2248 1, and small-worldness (\u03c3) > 1] . Among ts tests) .FDRp < 0.05, 2 times tests).Compared with HC, FD patients showed a significantly higher nodal efficiency  and nodapFDR < 0.05 (42 times tests). However, under the uncorrected threshold, the rsFC of the aTHA_R-NAC_L edge was positively correlated with the NDSI   and GP_L-CAU_L edge  were negatively correlated with the NDLQI   , the rsFhe NDLQI , and the= 0.036) .With a relatively large sample size, this study explored the rsFC pattern and the topological organization of SCN in FD patients for the first time. The results revealed that FD patients had abnormally increased rsFC, as well as aberrant global and nodal topological characteristics within the SCN, especially the bilateral aTHA.The subcortex region mainly included the thalamus, basal ganglia nucleus, hippocampus, etc. For its special location , the subcortical region mainly serves as a relay station for the transmission of peripheral signals to the cortical regions. In general, afferent visceral signals conveyed from the gastroduodenal projected to brain areas related to visceral sensorimotor processing such as the thalamus, basal ganglia, somatosensory cortex, etc. . RepeateCp of the SCN but no significant change in the shortest path length (Lp). Within a network, the Cp reflects the cliquishness or local specialization of a typical neighborhood and the Lp characterizes global integration . The patients/participants provided their written informed consent to participate in this study.FZ and TY conceived and designed the study. RS, ZH, SY, PM, YQ, and LC recruited the participants. PZ and YM analyzed the data. PZ drafted the manuscript. RS participated in MRI scan design and image collection. FZ revised the manuscript. All authors contributed to the article and approved the submitted version."}
+{"text": "Salmonella have changed in recent years as multidrug-resistant (MDR) strains have become prevalent among various serovars. The recent expansion of MDR Salmonella enterica serovar Indiana sequence type 17 (ST17) poses an increasing threat to global public health, as 24.3% (61/251) of S. Indiana isolates in this study exhibited resistance to three clinically important antimicrobial agents: fluoroquinolones (ciprofloxacin), extended-spectrum \u03b2-lactams , and macrolides (azithromycin). Both the evolutionary histories and antimicrobial resistance (AMR) profiles of this serovar remain to be described. Bioinformatic analysis revealed multiple lineages have coexisted and spread throughout China. Specifically, emergence of a predominant lineage appears to be associated with accumulated various substitutions in the chromosomal quinolone resistance-determining regions (GyrA S83F D87N and ParC T57S S80R) (141 [56.2%]), as well as acquisition of an extended-spectrum \u03b2-lactamase (ESBL)-producing IncHI2 plasmid that has subsequently undergone extensive rearrangement and an IncX1 plasmid that contains mph(A), conferring resistance to azithromycin. Several other evolutionary events influencing the trajectory of this drug-resistant serovar were also identified, including sporadic acquisitions of blaCTX-M-carrying plasmids, along with chromosomal integration of blaCTX-M within subclusters. Most human isolates reside in clusters containing isolates from animals, mainly from chickens, indicating the close relationship of human isolates with those from food animals. These data demonstrate that MDR S. Indiana ST17 is already widespread and capable of acquiring resistance traits against the clinical important antimicrobial agents, suggesting it should be considered a high-risk global MDR pathogen. The complexity of its evolutionary history has implications for AMR surveillance, epidemiological analysis, and control of emerging clinical lineages.The genetic features of foodborne IMPORTANCE The emergence and worldwide spread of AMR Salmonella constitute great public health concerns. S. enterica serovar Indiana is a typical MDR serovar characterized by sporadic reports. However, comprehensive population genomics studies have not been performed on this serovar. This study provides a detailed and comprehensive insight into the rapid evolution of AMR in this important Salmonella serovar in the past 15\u2009years in eight provinces of China. We documented diverse contributory genetic processes, including stable chromosomal integrations of resistance genes, the persistence and evolution of mobile resistance elements within sublineages, and sporadic acquisition of different resistance determinants that occur at all genetic levels . There are different mechanisms of antimicrobial resistance in S. enterica serovar Indiana from those of other serovars. This study sheds light on the formation of MDR S. enterica serovar Indiana with chickens as its potential reservoirs and paves the way to curb its further expansion among food animals. Salmonella enterica (NTS) remains one of the important foodborne pathogens globally -resistant Salmonella spp. were listed by the WHO in 2017 as priority pathogens for which new antimicrobials were urgently needed , or changes in the food chain. Some clonal lineages of MDR Salmonella have shaped the epidemiology of the disease at a global level, as in the case for sequence type 34 (ST34) S. enterica serovar 4,[5],12:i:\u2212, ST313 S.enterica serovar Typhimurium, and ST198 S.enterica serovar Kentucky , extended-spectrum \u03b2-lactams , and macrolides (azithromycin [AZM]) approved by the FDA in the United States to treat infections caused by Salmonella (S. Indiana isolates can express resistance to carbapenems or colistin (CT), the last-resort antimicrobials, suggesting that these bacteria have now become a serious challenge for public health  of DNA gyrase gene (gyrA) and DNA topoisomerase IV gene (parC) conferred FQs resistance, along with plasmid-mediated quinolone resistance (PMQR) genes [oqxAB and aac(6\u2032)-Ib-cr]. In addition, diverse blaCTX-M genes mapped on mobile genetic elements (MGEs) were reported earlier and found to be integrated into the chromosome (as in the case of blaCTX-M-55) (Recent studies investigated the genetic basis underpinning resistance to FQs and extended-spectrum \u03b2-lactamases (ESBLs) in TX-M-55) , 23. HowS. Indiana isolates collected from human and food-related samples in eight provinces of China during 2006 to 2017. Using phenotypic susceptibility data and whole-genome sequencing (WGS) analysis, we determined the prevalence and mechanisms of resistance and identified potential drivers of variation among the AMR profiles described within different lineages.Here, we report on the genomic epidemiology and AMR features of 251 S. Indiana isolates from eight provinces in China, 120 isolates were cultured from clinical samples  taken during 2007 to 2017 and 131 isolates from food-related samples taken during 2006 to 2016 (see in silico multilocus sequence typing (MLST) as S. Indiana ST17 after whole-genome analysis.Out of the 251 confirmed 10.1128/msystems.00253-22.4TABLE\u00a0S1Salmonella Indiana isolates. Download Table\u00a0S1, PDF file, 0.01 MB.Source and basic information of Copyright \u00a9 2022 Du et al.2022Du et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the S. Indiana isolates (P < 0.05) (P < 0.05).Testing of the susceptibility of 251 isolates  to 13 anisolates , with 21isolates . The res < 0.05) . Further10.1128/msystems.00253-22.5TABLE\u00a0S2S. Indiana isolates against ciprofloxacin. Download Table\u00a0S2, DOCX file, 0.02 MB.MIC value related to the PMQR gene and substitution mutations in QRDR of 251 Copyright \u00a9 2022 Du et al.2022Du et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the n\u2009=\u200911) had S83F and D87N amino acid substitutions in GyrA along with two ParC amino acid substitutions. Furthermore, five PMQR genes were detected, including aac(6\u2032)-Ib-cr (n\u2009=\u2009146), oqxAB (n\u2009=\u200968), qnrS1 (n\u2009=\u20092), qnrD (n\u2009=\u20091), and qepA (n\u2009=\u20091). PMQR genes aac(6\u2032)-Ib-cr and oqxAB coexisted in 54 isolates  and were only detected with 4 amino acid substitutions in GyrA and ParC, with MICs of ciprofloxacin ranging from 8 to 256\u2009mg/L (qnrS1 and oqxAB coexisted only in two food-related isolates. Of the 97 isolates possessing amino acid substitutions in GyrA (S83F and D87G) and ParC (T57S and S80R), the detection rate (47.5% [57/120]) in human-derived isolates was higher than that identified in food-related isolates (30.5% [40/131]) (P < 0.01). However, of the 141 isolates possessing amino acid substitutions in GyrA (S83F and D87N) and ParC (T57S and S80R), the detection rate in human isolates (47.5% [57/120]) was lower than that in food-related isolates (64.1% [84/131]) (P < 0.01).The genomes of 251 isolates were screened for known genetic determinants of AMR, including mobile resistance genes and mutations within QRDRs . For mut256\u2009mg/L , while q10.1128/msystems.00253-22.6TABLE\u00a0S3S. enterica serovar Indiana isolates. Download Table\u00a0S3, DOCX file, 0.02 MB.Comparisons of the resistance genes of human and food-related Copyright \u00a9 2022 Du et al.2022Du et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the blaCTX-M subtypes were identified among the 138 ESBL-producing isolates  distributed in different provinces, including blaCTX-M-65 , blaCTX-M-14 , blaCTX-M-55 , blaCTX-M-15 , blaCTX-M-27 , and blaCTX-M-123 . The three dominant subtypes blaCTX-M-65/55/14 were detected in human and food-related isolates, while blaCTX-M-15/123 was found only in human isolates. Moreover, the prevalence rate of blaCTX-M-65 among isolates from \u22641-year-old patients (42.6% [20/47]) was significantly higher than that among isolates from other patients (11.1% [8/72]) (P < 0.01), which is in line with the phenotypic characteristics of isolates from these two patient groups. In general, most of the blaCTX-M variants have been detected in humans and chickens.Six mph(A) gene, which is highly associated with azithromycin resistance, had the highest detection rate of 33.5% . The mph(E) (n\u2009=\u20097), msr(E) (n\u2009=\u20097), erm(42) (n\u2009=\u20091), and erm(B) (n\u2009=\u20091) genes were also detected.For macrolides, the 26). The pairwise co-occurrence matrix of AMR genes is shown in arr-3 (conferring resistance to rifamycin), catB3 (conferring resistance to chloramphenicols), aac(6\u2032)-Ib-cr (conferring resistance to aminoglycosides), and blaOXA-1 (conferring resistance to penicillins), which co-occurred in 58.2% of genomes (146/251); the combination of arr-3, catB3, aac(6\u2032)-Ib-cr, and blaOXA-1 occurred with sul1 (sulfonamides) in 50.6% (127/251), aac(3)-Iva (aminoglycosides)/aph(4)-Ia (aminoglycosides)/tet(A) (tetracycline) in 45.8% (115/251), floR (chloramphenicols) in 43.4% (109/251), and sul2 (sulfonamides) in 36.7% (92/251) of genomes. These co-occurring genes were formed into resistance regions comprising IS26 and tet(A), sul1, arr-3, catB3, blaOXA-1, aac(6\u2032)-Ib-cr, aac(3)-Iva, aph(4)-Ia, and sul2 located in ps15D023-IncHI2, ps12177-CTX, pIndS104-CTX, and ps11011-CTX (aph(3\u2033)-Ib, aph(6)-Id, and aadA5 co-occurred in 19.1% (48/251) of genomes; the combination of aph(3\u2033)-Ib, aph(6)-Id, and aadA5 occurred with oqxAB in 14.7% (37/251), fosA in 12.0% (30/251), blaTEM-1 in 11.5% (29/251), and blaCTX-M-65 in 9.2% (23/251) of genomes. These were caused by the resistance region IS26-aph(3\u2033)-Ib-aph(6)-Id-sul2-IS26 co-occurring with other resistance genes. Salmonella genomic island 1 (SGI1), the widely reported original chromosomal integron containing an antibiotic resistance gene cluster and identified in several S. enterica serovars . Download FIG\u00a0S2, TIF file, 0.9 MB.Sequence comparison of IncHI2 plasmids in Copyright \u00a9 2022 Du et al.2022Du et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the blaCTX-M-positive isolates, 90 (65.2%) could be classified by the locations of blaCTX-M in the genome from the fragmented short-read assemblies. blaCTX-M-14 in 14 isolates (42.4% [14/33]) and blaCTX-M-55 from 9 isolates (30.0% [9/30]) were located on the chromosome. blaCTX-M-15 from 9 isolates (100% [9/9]) and blaCTX-M-65 from 58 isolates (96.7% [58/60]) were carried by plasmids. In addition, 76 blaCTX-M-positive isolates were from humans and 62 were food related, accounting for 63% (76/120) and 47% (62/131) of the two groups, respectively. Although the positive ratio of blaCTX-M was significant higher in human isolates (P < 0.05), among the six subtypes, only the positive ratio of blaCTX-M-15 was significant higher in human isolates .Among the 138 blaCTX-M among representative nonclonal isolates from different sources, genome sequences of five isolates  were successfully completed. The IndS102 and s15D023 isolates separately carried blaCTX-M-14 and blaCTX-M-55 on their chromosomes within different genetic contexts. Another three isolates carried blaCTX-M on IncHI2 plasmids ranging from 200 to 322 kbp and sharing similar core structures  with the specific genetic context IS26-ISEcp1-blaCTX-M-65-IS903B located in an MDR region . BLASTn analysis demonstrated pIndS104-CTX was most similar (99.99% identity at 100% coverage) to a locus on the chromosome of Chinese blaCTX-M-65-positve S. Indiana SI43, obtained from a spiral shell in China in 2010 , indicating pIndS104-CTX may have the ability to recombine with the chromosome entirely or evolve from ancestor clones like SI43. ps11011-CTX was 263,731\u2009bp in size and possessed 783 predicted coding sequences. ps11011-CTX showed high similarity to ps12177-CTX , originating from a human sample from China in 2006, and also to Escherichiacoli plasmids pE648CTX-M-65  and pECJS-B60-267 , as well as Klebsiellapneumoniae plasmid pHNHF1_NDM-99 . ps12177-CTX was 200,106\u2009bp in size (48.61% GC content), and it encoded an MDR region different from that described in ps11011-CTX , which might have resulted from the truncation of ISEcp1 by IS26.Although genetic contexts of  by IS26 . ISEcp1 mph(A) was positive in the chicken isolate IndS104 and was located on plasmid pIndS104_3_29k, a typical IncX1 plasmid of size 29,056\u2009bp. It was found to be homologous  to six similar plasmids that ranged from 34,764 to 222,492\u2009bp among Salmonella spp. and E. coli, as well as a chromosomal locus in a human S. Indiana isolate SI111 (CP050764) (mph(A)-bearing IncX1 plasmids were hypothetically mobilizable and could move into the chromosome via insertion sequences such as IS26. The typical IS26-mphR(A)-mrx-mph(A)-IS26 transposition unit was embedded in the IncX1 plasmid and other MDR plasmids such as IncHI2 (S. Indiana SI111 chromosome demonstrated a variant of mph(A)-bearing IncX1 plasmid recombined into the SI85 chromosome by IS26 to generate the chromosomal IncX1 segment in SI111 (26 in the transmission of mph(A) among plasmids and chromosomes. Detailed analysis of mph(A)-bearing contigs in the 84\u2009mph(A)-positive isolates showed that the core structure mphR(A)-mrx-mph(A) (n\u2009=\u200984) and seven additional different core structures were prevalent among these isolates (mphR(A)-mrx-mph(A) were not identified because of short fragmented assembled contigs based on Illumina short-read data.Among the five isolates  with complete genome sequences, P050764) , which is IncHI2 . Linear in SI111 . This hiisolates . However10.1128/msystems.00253-22.3FIG\u00a0S3mph(A)-harboring S. Indiana isolates. Seven different genetic structures are listed above. The numbers of isolates of the seven types are 1, 1, 6, 1, 11, 63, and 1, respectively. Boxes or arrows represent the ORFs. Red arrows represent the mph(A) gene. Blue arrows indicate mobile elements. mphR(A) and mrx are shown by green arrows. Light gray arrows represent the resistance gene and hypothetical protein. A triangle represents the truncated gene. Download FIG\u00a0S3, TIF file, 1.3 MB.Genetic environment comparison of 84 Copyright \u00a9 2022 Du et al.2022Du et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the S. Indiana emerged within the study period and were transmitted to those enrolled provinces. All 251 isolates harbored the mutations on gyrA and parC associated with the FQ resistance. According to core-genome-based phylogenies, we divided them into six lineages : lineage 1 included seven isolates with D87G in GyrA and T57S in ParC, lineage 2 included two isolates with S83F in GyrA and T57S in ParC, and lineage 3 included four isolates with S83F in GyrA and T57S and S80R in ParC. The other three later lineages with 4- amino acid substitutions were the dominant groups. Lineage 4 (n\u2009=\u200949) and lineage 5 (n\u2009=\u200948) had S83F and D87G in GyrA and T57S and S80R in ParC, while lineage 6 (n\u2009=\u2009141) had S83F and D87N in GyrA and T57S and S80R in ParC, which was the most common lineage (141/251 [56.2%]). Moreover, in the early stages of quinolone resistance evolution, most of the isolates with double-amino-acid substitutions in GyrA (D87G [lineage 1] or D87F [lineage 2]) and ParC (T57S) were susceptible to ciprofloxacin, except in two isolates that also carried PMQR genes (oqxAB and qnrS1), and the isolates from lineage 3 with three amino acid substitutions in GyrA (S83F) and ParC (T57S and S80R) exhibited low MIC values of ciprofloxacin , 76.7% (23/30), and 70% (42/60) of the isolates harboring each genotype, respectively (mph(A) appeared most frequently in lineage 6 (88.1% [74/84]), followed by lineage 5 (9.5% [8/84]), and only occurred once in lineage 2 and lineage 3, respectively. Furthermore, co-occurrence of mph(A) with diverse ESBL genes was observed . Both IncN and IncX1 replicons were dominantly distributed in lineage 6, with prevalence of 75.3% (55/73) and 98.5% (64/65). Based on the complete genome sequences of IndS104, mph(A) was located in an IncX1 plasmid. In addition, among the 251 isolates, mph(A) and IncX1 were both detected in 55 isolates belonging to lineage 6, and both were negative in 157 isolates. The distribution of mph(A) and IncX1 displayed a significant correlation with a calculated coefficient of 0.64 . The isolates carrying IncX1 plasmids might be more likely to carry mph(A) .Based on the 2,904 core genome single nucleotide polymorphisms (SNPs) obtained from 251 genomes, we performed phylogenic analysis and displayed the phylogenetic relationships of sequenced isolates . Multipllineages , which ifloxacin . In contfloxacin . Of noteectively . MoreoveSalmonella have changed significantly in recent years as MDR Salmonella strains have become prevalent among various serovars, such as S. 1,4,[5],12:i:\u2212, S. Kentucky, and S. enterica serovar London  -Ib-cr was the dominant genotype, with the carriage rate increasing from 20% in 2006 to 65% in 2017  of the ciprofloxacin-resistant Salmonella strains of various serovars, the oqxAB and aac(6\u2032)-Ib-cr combination was the predominant one in our study, which was located in the IncHI2 plasmid. This gene combination was also located in a nonconjugative plasmid, pCFSA244-1, mainly transmitted among S. Typhimurium isolates, and qnrS2-aac(6\u2032)-lb-cr-oqxAB elements were also found on the chromosome in S. enterica serovar Derby (oqxAB-aac(6\u2032)-Ib-cr-bearing IncHI2 plasmid found in S. Indiana was mobilizable by conjugation  . Furtherservoirs . Since 2servoirs . Our who E. coli . Recent  E. coli . It has  strains . This mijugation . The hig studies . This mi studies .S. Indiana, contributing to their cefotaxime resistance phenotypes   variant of blaCTX-M-15, blaCTX-M-55, possessing enhanced cephalosporin-hydrolyzing activity, was both prevalent in both isolates from humans and those from food-related samples, particularly in lineage 6, indicating potential higher adaptability of blaCTX-M-55. IncHI2 plasmids were typical MDR plasmids positive for blaCTX-M, mcr-1, class 1 integrons, and oqxAB, similar to those found in other Enterobacteriaceae  . Most blaCTX-M-55 genes in S. Indiana are located on the chromosome, which is different from its plasmid origin in other serovars, such as S.enterica serovars Enteritidis, Goldcoast, Typhimurium, and Choleraesuis  . FurtherE. coli) , 41. Furplasmids . The blaosporins . The occeraesuis \u201346.S. Indiana isolates harboring the plasmid-borne mph(A), mph(E), erm(42), and erm(B) genes. Moreover, in the present study, 24% of isolates were coresistant to azithromycin, ciprofloxacin, and cefotaxime, which is considerably higher than the levels reported in a Chinese national surveillance study (0.2%) from 2005 to 2011 (mph(A) and mph(E), raising concern about the spread of resistance among bacteria (mph(A)-positive isolates were mostly grouped into lineages 5 and 6 coexisting with diverse ESBL genes. This feature is highly related to the IncX plasmid, which has played an important role in the spreading of resistance genes, such as blaNDM (IncX3) and mcr-1 (IncX4 and IncX2) (\u2013Macrolide (azithromycin) resistance was determined in 36.3% 91/251) of  to 2011  and a Ch to 2011 . In the bacteria . In our d IncX2) \u201351. More of  to 2 IncX2) \u2013.Salmonella. The high prevalence of IncHI2 plasmids in S. Indiana is similar to that reported for S. Typhimurium  and food  collected previously by the National Health Commission Key Laboratory of Food Safety Risk Assessment from four provinces in China during 2006 to 2016. In total, isolates from eight provinces were included. Clinical fecal samples were enriched in selenite brilliant green sulfa enrichment broth for 18 h at 37\u2009\u00b1\u20091\u00b0C, and anatomical site samples  were enriched on blood agar plates for 18 h at 37\u2009\u00b1\u20091\u00b0C. Clinical sample isolates were purified as described previously , along with amplification of the invA gene by PCR. All isolates were identified to the serogroup level and then serotyped by slide agglutination with commercial Salmonella antisera  following the Kauffmann-White scheme at the National Health Commission Key Laboratory of Food Safety Risk Assessment in Beijing, China.A total of 251 confirmed eviously . S. enteuidebook . The isoS. Indiana isolates was performed by the agar dilution method and interpreted according to 2018 Clinical and Laboratory Standards Institute (CLSI) guidelines (https://eucast.org/). The antimicrobial susceptibilities of the following antimicrobials were assessed: ampicillin (AMP), cefotaxime (CTX), cefotaxime-clavulanic acid (CTX-CLA), chloramphenicol (CHL), ciprofloxacin (CIP), nalidixic acid (NAL), gentamicin (GEN), streptomycin (STR), imipenem (IPM), meropenem (MEM), tetracycline (TET), azithromycin (AZM), sulfonamide (SUL), and colistin (CT). The MICs were calculated. Multidrug resistance was defined as resistance to three or more classes of antimicrobials. Escherichia coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as the quality control strains.Antimicrobial susceptibility testing (AST) of the idelines  and the in silico multilocus sequence typing (MLST) scheme was used to subtype the isolates using BLASTn and seven housekeeping genes: aroC, dnaN, hemD, hisD, purE, sucA, and thrA  and then sequenced using an Illumina HiSeq 2500 platform  to generate 150-bp paired-end reads from a library with an average insert size of 500 bp. Raw reads were filtered to remove low-quality reads by fastQC  and then62\u2013and thrA .blaCTX-M were determined after whole-genome sequence analysis. blaCTX-M-containing contigs were examined for plasmid Inc types using PlasmidFinder  was used as the reference in phylogenetic analysis. Illumina reads were mapped to the reference genome using Bowtie 2 v2.2.8, with single nucleotide polymorphisms (SNPs) identified using Samtools v1.9, and the data were combined as described previously . Multiple alignments of core genomes identified from the pairwise alignments with S. Indiana D90 were used as the input for Gubbins to detect and remove recombination sites (The complete genome sequence of eviously . The higon sites . Phylogeon sites  and seleon sites . The conon sites . The phyon sites .PRJNA850394.The genome sequences in this study were deposited into the National Center for Biotechnology Information database under BioProject accession no."}
+{"text": "We report a case of a 35-year-old pregnant female of Afghan origin who was admitted to the intensive care unit (ICU) because of pulmonary edema development when she was in the 30th week of gestation. During the bedside examination, the transthoracic echocardiogram (TTE) revealed severe mitral valve stenosis and pulmonary hypertension. The patient went into treatment with metoprolol for the control of tachycardia and furosemide for the prevention of fluid overload. During the 32nd week of gestation, the medical council decided on a cesarean section (CS) to be carried out under general anesthesia. The anesthesiologists decided to use the Vigileo monitor  as it is vitally important to approach fluid administration as fluid management is challenging concerning the obstetric patient.\u00a0Vigileo monitoring is based on the invasive measurement of cardiac output (CO), cardiac index (CI), stroke volume (SV), and stroke volume variation (SVV). Fluid resuscitation based on hemodynamic parameters is a key component of patient care, especially in scenarios such as cardiovascular disease. This is the first case report where a Vigileo monitor was applied to a patient with severe mitral valve stenosis and severe pulmonary hypertension undergoing a cesarean section, which was accomplished without any complications. The patient was discharged from the hospital on the 12th postoperative day, hemodynamically stable.Each immigrant woman, regardless of her financial, social, cultural, or any other situation, has the fundamental right to receive complete perinatal healthcare. Nevertheless, the most recent statistical data\u00a0show that those women\u2019s access to public healthcare is insufficient, leading to high rates of maternal mortality. The international medical community has to adapt to the new multicultural environment, and health services must be provided to this vulnerable population with the appropriate level of safety. In recent years, maternal morbidity has shown a significant increase, with cardiovascular diseases being the most prevalent cause. It is estimated that 25% of maternal deaths in the USA are attributed to cardiovascular diseases , which hDuring gestation, the pregnant patient is subjected to significant anatomical and physiological changes in response to the normal development of the fetus\u00a0so that the mother\u2019s body will be able to adapt sufficiently to the labor process. The plasma volume gradually increases, with 50% of that increase being accomplished by the 34th week of gestation. However, the red blood cell (RBC) volume does not increase at the same rate, and as a result, pregnant patients normally present a decrease in their levels of hemoglobin (Hb) and hematocrit (Hct). Regarding the number of platelets (PLTs), it tends to decrease as the gestation progresses, but it remains within the normal range. Changes in the coagulation system lead to a hypercoagulable state in pregnancy, which increases the risk of thrombosis. Meanwhile, significant changes occur also in the mother\u2019s cardiovascular system, since the early stages of gestation. Specifically, peripheral vasodilation\u00a0is mediated by endothelial factors and leads to a reduction of the peripheral resistance\u00a0of up to 25%-30%, with a compensatory rise of the cardiac output of up to 40%. The latter is being carried out mainly via the increase of the heart rate (HR) and, to a lower degree, via the increasing stroke volume. At the same time, heart preload is diminished\u00a0because of the pressure exerted from the distended uterus to the inferior vena cava. The lung capillary wedge pressure, as well as the central venous pressure (CVP), does not increase significantly during gestation, in contrast to the pulmonary vascular resistance, which decreases in proportion to the peripheral vascular resistance. Also, lung capillary wedge pressure does not decrease, but the plasma colloidal osmotic pressure is reduced by up to 10%-15%, which results in the vulnerability of pregnant women to pulmonary edema. The labor leads to an additional rise in the cardiac output, while the uterine contractions cause an autohemotransfusion of 300-500 mL of blood back into the woman\u2019s circulation [\u0391 35-year-old, 60 kg, 165 cm female of Afghan origin with a history of three labors and four gestations presented to Mytilene General Hospital at the 30th\u00a0week\u00a0of gestation complaining about persistent cough and dyspnea. The record of her medical  history was difficult because the woman was only speaking her native language, and there was no accompanying person thereby to help with the translation. The transthoracic echocardiogram (TTE) revealed mitral valve stenosis and pulmonary hypertension. The patient was diagnosed with pulmonary edema, and the physicians decided her transport to the Alexandra General Hospital of Athens for further investigation and treatment.In the intensive care unit (ICU) of Alexandra General Hospital of Athens, a complete TTE examination was performed by the intensivists. Table The patient was hospitalized for two weeks, and her medication included metoprolol 50 mg 1x3 for the control of her tachycardia and furosemide in proportion to her needs so that fluid overload would be avoided.\u00a0Administration of betamethasone in two doses of 12 mg was very important due to fetal lung immaturity.In view of her mitral valve stenosis and pulmonary hypertension, a cesarean section (CS) was scheduled by the medical council on the 32nd week of gestation, after daily monitoring of the fetal activity with cardiotocography with the assent of the neonatologists. Before surgery, a new TTE examination of the mother\u2019s heart function was performed, which showed an increase in diastolic pressure gradient and a decrease in pulmonary artery systolic pressure (PASP)  and pulse oximetry (SpO2) were applied. A 20-gauge radial arterial cannula and a 7.5-French triple lumen right jugular vein catheter were inserted. Hemodynamic variables, including cardiac output (CO), cardiac index (CI), stroke volume (SV), stroke volume variation (SVV), stroke volume index (SVI), and invasive blood pressure (BP), were continuously recorded using Vigileo\u00ae monitor . Images of the Vigileo\u00ae monitor are presented in the figure below. Her hemodynamic parameters during CS are reported in Table During her physical examination, she developed mild sinus tachycardia (109 bpm), and S1-S2 cardiac sounds were rhythmic, without any murmur. The rest of her physical examination did not show any pathological findings. For aspiration prophylaxis,\u00a0the patient was administered metoclopramide 10 mg intravenous (IV)\u00a0and cimetidine 200 mg IV. She was also administered cefuroxime 1.5 g IV for perioperative chemoprophylaxis and furosemide 20 mg IV for the prevention of fluid overload. Simultaneously with double preoxygenation with an anesthetic face mask (100%) and a nasal catheter at 5 L/minute, remifentanil 0.05 \u03bcg/kg/minute was administered by continuous IV infusion. When the expired oxygen percentage was 90%, etomidate 16 mg IV, succinylcholine 100 mg IV, and remifentanil 80 \u03bcg IV bolus were administered for the induction of anesthesia.Soon after the induction of anesthesia and the application of mechanical positive pressure ventilation with tidal volume (TV) of 450 mL, respiratory rate (RR) of 12 breaths/minute, and positive end-expiratory pressure (PEEP) of 6 cm H2O and 50% FiO2, the patient remained hemodynamically stable . The first hemodynamic parameters are presented in Figure Maintenance of anesthesia was performed by sevoflurane at 0.8% in an oxygen/air mix and continuous IV infusion of remifentanil at a rate of 0.05-0.1\u00a0\u03bcg/kg/minute.The neonate was delivered within three minutes after induction, and the appearance, pulse, grimace, activity, and respiration (APGAR) score was 8 and 9 at the first and fifth minute of birth, respectively.After delivery, the patient was administered three units of oxytocin bolus, followed by a slow infusion of another 17 units within 60 minutes. The vasodilation caused by oxytocin did not affect the patient hemodynamically. Morphine 10 mg IV and paracetamol 1 mg IV were also administrated after delivery. The arterial blood gases\u00a0after delivery revealed the following data: pH, 7.38; PCO2, 39 mmHg; PO2, 170 mmHg; Hct, 34%;\u00a0Hb, 10.5 g/dL; lactate acid (Lac), 1 mmol/ L;\u00a0base excess (\u0392\u0395), -2 mmol/L; and HCO3, 23.1 mmol/L.Twenty minutes after the induction of anesthesia, SVV decreased from 7% to 2%  was transferred to the ICU. Intravenous patient-controlled analgesia (PCA) with morphine was chosen for postoperative analgesia. Her pain was assessed using the visual analog\u00a0scale (VAS) and was found to be as mild as VAS < 3.On the first postoperative day, the patient was hemodynamically stable Table . On the This is the first case report where a Vigileo\u00ae monitor was applied to a patient with severe mitral valve stenosis and severe pulmonary hypertension undergoing cesarean section under general anesthesia. The catheterization of the pulmonary artery was considered too invasive, especially since the medical team was able to use the transesophageal ultrasound, after the intubation. Furthermore, in their article, McLean et\u00a0al.\u00a0reported that the cardiac output measurement performance of the Vigileo\u00ae program was comparable to that of the transesophageal Doppler in terms of reliability, with the only exception the cases of patients suffering from arrhythmia or severe aortic valve stenosis . FurtherThe successful fluid administration throughout the operation of the presented case study\u00a0was assisted by the Vigileo\u00ae monitor. The contribution of the Vigileo monitor was crucial concerning the administration of diuretics. Without the image of the advanced hemodynamic parameters estimated by Vigileo\u00ae, the optimization of fluid status in this patient would be unattainable. An SVV\u00a0value of\u00a0<13% is a predictor of volume overload . In our 2) did not exceed the normal ranges at any stage of the surgery. Twenty minutes after intubation, the measurement of SVV was 2% . CVP was raised to 13 mmHg while SVV was reduced to 2%. This led to the administration of 20 mg furosemide, and it was decided that hereinafter, the receiving fluids would be restricted to 5 mL/kg/hour, meaning that the total amount of crystalloids administrated was 500 mL until the end of the operation.As presented in Table In our regular practice, based on the mean arterial pressure, heart rate, and urinary output, we would not administrate a repeat dose of furosemide, and we would continue the fluid administration at a rate slightly higher than 5 mL/kg/hour. More aggressive fluid therapy and volume overload would have been associated with harmful consequences, including pulmonary edema.\u00a0In conclusion, Vigileo was a useful tool for the fluid replacement of ongoing losses during cesarean section ensuring hemodynamic stability and avoiding volume overload.\u00a0Stroke volume variation (SVV) is a reliable factor of fluid responsiveness ,8, whichAs illustrated in Table The type of anesthesia  depends on various factors, several of which are the severity of the disease, pulmonary hypertension, or coagulopathies. Generally, subarachnoid anesthesia is considered inappropriate in cases where severe mitral valve stenosis is detected .In our case study, we decided that general anesthesia was more appropriate taking into consideration its advantages: avoidance of sudden drops in systemic vascular resistance (SVR), no need for volume preload or co-load, possible immediate treatment of acute atrial fibrillation and cardioversion, maintenance of adequate venous return, and definite securement of the airway in case of acute pulmonary edema. Moreover, general anesthesia has the advantage of preventing pain, hypoxemia, hypercarbia, and acidosis . The afoRegardless of the type of anesthesia, the anesthesiologist should avoid tachycardia.\u00a0Tachycardia, alongside the pain during labor, increases the blood flow through the mitral valve, which causes a sudden increase in the pressure of the left atrium and leads to pulmonary edema . With ouA cardio-selective \u03b21-blocker was also utilized for tachycardia treatment during the patient extubation stage. Specifically, esmolol 50 mg bolus IV was administered, and a continuous infusion at a rate of 0.3 mg/kg/minute was started. This decision was based on its rapid initial activation and short-duration properties.It is important to mention that remifentanil provides insufficient postoperative analgesia\u00a0due to the short duration of action. For postoperative analgesia, morphine 10 mg IV was administered right after the neonate was delivered. In cases of severe valvulopathy, the suggested treatment involves the administration of opioids, as they have only a slight suppressive action on the cardiovascular system while they provide an excellent level of analgesia. Further pharmacological agents that are reported to increase heart rate, for instance, ketamine, should be avoided. Intravenous patient-controlled analgesia (PCA) with morphine was chosen for postoperative analgesia as it is important to ensure a sufficient level of postoperative analgesia to avoid tachycardia.More frequently, women with valvulopathies tend to develop cardiac comorbidities and obstetric complications during gestation and labor. The most frequent valvulopathy is mitral valve regurgitation, followed by mitral valve stenosis, tricuspid valve insufficiency, aortic valve insufficiency, aortic valve stenosis, and pulmonary valve stenosis. Mitral valve stenosis represents about 12% of all valvulopathies that have to be admitted to the hospital, while rheumatoid stenosis represents 85% of them .Streptococcus, and its incidence is high in developing countries, possibly because of the fact that in those countries, access to healthcare services is limited\u00a0and the provision of antibiotics is insufficient [Acute rheumatic fever is the main cause of mitral valve stenosis. Other causes include congenital valve stenosis and vegetations and calcifications of the cusps of the mitral valve. Acute rheumatic fever is attributed to group A fficient .At the same time, it is estimated that 60% of untreated patients develop chronic stenosis of the mitral valve\u00a0due to the final enlargement of the cusps of the mitral valve and the fusion of the papillary muscles. Epidemiologically, although both sexes are equally affected by acute rheumatic fever, more frequently, women tend to develop mitral valve stenosis (2:1) for unknown reasons .In mitral valve stenosis that occurs as a result of acute rheumatic fever, the obstruction of the blood flow via the mitral valve that occurs due to the reduction of the width of the opening causes an increase in the systolic pressure of the left atrium and of the pulmonary arterial pressure .Moderate and severe mitral valve stenosis are not well tolerated during gestation. The normal physiological changes that occur in pregnancy lead to tachycardia, which results in further reduction of the diastolic filling period. Pregnant women are at increased risk of heart failure, even those who are asymptomatic, especially during their second and third trimesters of gestation .During prenatal screening tests, physicians should take a full medical history of the pregnant woman , a full physical examination , and a full electrocardiographic and TTE examination .\u00a0Medical2 [The aim of the treatment of mitral valve stenosis is the avoidance of medical conditions  that increase heart rate and reduce the filling time of the left ventricle, thus resulting in a reduction in heart output. The cornerstone of that treatment lies in the administration of \u03b2-blockers, which reduce heart rate and increase the filling time of the left ventricle, with a subsequent increase in heart output. The most frequently used \u03b2-blockers are cardioselective \u03b21-blockers, such as metoprolol and bisoprolol. Atenolol should be avoided in pregnant women because it is responsible for delayed fetal development . Restric2 .Most pregnant women will respond to the above pharmacological treatment. However, a low percentage will still be categorized as stages III and IV according to the\u00a0New York Heart Association\u00a0(NYHA), or they will have a PASP of\u00a0more than 50 mmHg. In these cases, a percutaneous mitral commissurotomy (PMC) will be needed, which is mainly carried out during the second trimester of gestation . In the It should also be considered that the presented case study needed special handling due to its social dimension. In 2011, Canada was the first country to publish guidelines for the medical treatment of immigrant women . Each onIn Greece, the special program \u201cIntercultural Mediation\u201d is implemented since 2009. The aim of that program is the familiarization of healthcare providers with multiculturalism so that the provided healthcare services will be of greater quality. That program, however, is applied only in several Greek hospitals. Subsequently, there is an imperative need for the publication of specific guidelines so that effective treatment of pregnant immigrant women can be applied. Since 2011, a 24-hour translating facilitation program via telephone has been running at the Alexandra General Hospital of Athens. Furthermore, professional translators of the most commonly spoken languages are also available  during the morning working hours, opting to give immigrant patients easier access to medical care.The anesthesiologist, obstetrician, and cardiologist ought to collaborate closely, starting from the second trimester of pregnancy, and build a medical plan to handle mitral valve stenosis and secure a gestation without dangerous complications. It is certain that the healthcare services provided to each patient have to be individualized and any possible comorbidities should be taken into consideration. Regardless of the type of anesthesia, tachycardia and fluid overload must be avoided as those conditions have an impact on the hemodynamic stability of the patient. In our case study, we decided that general anesthesia was more appropriate taking into consideration its advantages. During the CS, we decided to use the Vigileo\u00ae monitor as it is vitally important to approach fluid administration as fluid management is challenging concerning the obstetric patient. Without the image of the advanced hemodynamic parameters estimated by Vigileo\u00ae, the optimization of fluid status in this patient would be unattainable. The total amount of crystalloids administrated was 500 mL. In addition, the contribution of the Vigileo\u00ae monitor was crucial concerning the administration of diuretics. Based on the abrupt decrease of SVV, she was administered furosemide 20 mg IV to prevent fluid overload. The total amount of furosemide administrated was 40 mg. Aiming to minimize tachycardia and hypertension during laryngoscopy, simultaneously with preoxygenation, remifentanil was initiated at an infusion rate of 0.1 \u03bcg/kg/minute. Esmolol, a cardioselective \u03b21-blocker, was also utilized for tachycardia treatment during the patient extubation stage. Hence, we avoided the development of pulmonary edema, and the cesarean section was accomplished without any complications. The patient was discharged from the hospital on the 12th postoperative day, hemodynamically stable without any postoperative complications."}
+{"text": "The results showed that the gene knockout mutant XJ25-\u0394citP lost the ability to utilize citric acid, while the gene complement mutant XJ25-\u0394citP-pMG36ek11-citP fully recovered the ability of citric acid utilization. Meanwhile, citP knockout and complement barely affected the utilization of l-malic acid. These indicated that citP in L. plantarum functioned as a citrate transporter and was the only gene responsible for citrate transporter. In addition, two modified plasmid vectors used for gene supplement in L. plantarum showed distinct transcription efficiency. The transcription efficiency of citP in XJ25-\u0394citP-pMG36ek11-citP mutant was 4.01 times higher than that in XJ25-\u0394citP-pMG36ek-citP mutant, and the utilization rate of citric acid in the former was 3.95 times higher than that in the latter, indicating that pMG36ek11 can be used as a high-level expression vector in lactic acid bacteria.Organic acid metabolism by lactic acid bacteria plays a significant role in improving wine quality. During this process, the uptake of extracellular organic acids by the transporters is the first rate-limiting step. However, up to now, there is very little published research on the functional verification of organic acid transporter genes in wine lactic acid bacteria. In this study, a predicted citrate transporter gene JKL54_04345 ( Lactiplantibacillus plantarum, which often has a broad range of natural habitats, is one of the major species dominating spontaneous MLF in wine  of Lactococcus lactis . Through automated computational analysis using the gene prediction method of protein homology, it is concluded that the gene JKL54_04345 may encode citrate transporter (CitP).Many lactic acid bacteria (LAB) species, known for their positive effects on human health, are of great importance in the food industry . The exc in wine . More ime aromas . In addie of SO2 . Moreoveompounds . Therefooduction . Citrateoduction . The 2-hoduction . The stus lactis , but theL. plantarum. In recent years, a number of expression vectors have been developed to express proteins in Lactococcus lactis, e.g., pMG36e. pMG36e has successfully expressed a number of proteins  and mutant purity (100%).Genetic manipulation is a key method for controlling the gene expression and studying the molecular mechanism of proteins . Howeverproteins . The orihia coli . Kanamycspectrum . Huang eKanR) from pLCNICK into pMG36e to obtain a double-resistant plasmid pMG36ek, and then replaced the P32 promoter with the synthetic promoter P11, in order to build a highly efficient expression vector pMG36ek11. Second, through gene knockout by pLCNICK based on CRISPR/Cas9 system and gene complement by the modified pMG36e, the function of the predicted citrate transporter gene JKL54_04345 (citP) was verified.Therefore, in this study, we first inserted the kanamycin resistance gene  cultured in Luris-Bertani (LB) broth . L. plantarum XJ25 isolated from wine were propagated statically at 37\u00b0C in de Man, Rogosa, and Sharpe (MRS) medium . The fermentation experiments were performed in MRSg 2SO4 2\u00a0g/L, NaCl 5\u00a0g/L, Tween-80 1\u00a0ml/L, MgSO4\u00b77H2O 0.2\u00a0g/L, MnSO4\u00b74H2O 0.04\u00a0g/L, l-malic acid 1\u00a0g/L, citric acid 1\u00a0g/L, and pH 3.8 adjusted with HCl), MRSc  and MRSm . The antibiotics were supplemented at the following concentrations when needed for plasmid maintenance: 50\u00a0\u03bcg/ml kanamycin for E. coli, and 50\u00a0\u03bcg/ml erythromycin for L. plantarum. All the strains used in this study were listed in The plasmid vectors used in this study were maintained in L. plantarum XJ25, gene JKL54_04345 as a citrate transport protein gene (citP) derived by automated computational analysis using gene prediction method of protein homology, was selected as a target.Plasmid vectors used and constructed in this study are listed in XbaI and ApaI (citP (citP-up and citP-down) were amplified from L. plantarum XJ25 genomic DNA using the primers citP-up-1/citP-up-2 and citP-down-1/citP-down-2, respectively. A 122 bp sgRNA framework that targets citP (citP-sgRNA) was obtained by PCR using the primers sgRNA-1/citP-sgRNA-2 with pLCNICK as the template. This fragment was then assembled with citP-up and citP-down by overlap extension PCR, which yielded a new fragment, citP-uds. Subsequently, the backbone of pLCNICK and the fragment citP-uds were assembled to produce a new plasmid, pLCNICK-\u0394citP, using the one-step cloning kit . Thereafter, positive clones were verified by PCR amplification with the primers pLCNICK-test-1 and pLCNICK-test-2.The skeleton of pLCNICK was obtained by double digestion with and ApaI . Two 1.0KanR gene and improve the expression efficiency. pMG36e contains an erythromycin resistance gene Emr, a P32 promoter, a multiple cloning sites (MCS), the start of an open reading frame, and a prtP transcriptional terminator, and it is known to be a constitutive expression vector for the inserted gene in Lactococcus lactis , the citP fragment (obtained by PCR using primers citP-express-1 and citP-express-2 with L. plantarum XJ25 genomic DNA as the template). The above two fragments are connected to form overexpression vector pMG36ek-citP.Plasmid pMG36ek-32 promoter with the P11 promoter  and 200\u00a0rpm for 1\u00a0h, the corresponding antibiotic plates were coated. A single colony was selected for colony PCR verification using primers pLCNICK-test-1 and pLCNICK-test-2, pMG36e-test-1, and pMG36e-test-2.Heat shock transformation was carried out according to the instructions of the competent cells of citP knockout mutant by electroporation. The preparation of electrocompetent cells and electrotransformation were performed as previously described (600 reached 0.4\u20130.6. The cell pellets were washed twice with 1\u00a0mM MgCl2 and resuspended in 1\u00a0ml SM buffer (952\u00a0mM sucrose and 3.5\u00a0mM MgCl2). The competent cells were aliquoted and stored at -80\u00b0C. The electroporation was performed with Gene Pulser Xcell  and 2\u00a0mm cuvette  with the following parameters: 2\u00a0kV, 25\u00a0\u03bcF, 400\u00a0\u03a9. One milliliter of the recovery SMRS medium  was added into a cuvette and the mixture was recovered within 2\u20133\u00a0h, and then plated on the MRS agar supplemented with erythromycin  was then performed to screen the putative mutants. Successful transformants were selected from the corresponding antibiotic plates. Positive clones were verified by PCR amplification with the primers citP-in-1 and citP-in-2 to obtain the mutants. The primers citP-ha-1 and citP-ha-2 were used to verify the genetic modification on the chromosome. The genome of L. plantarum XJ25 was used as the control. PCR products were sequenced to validate the knockout.The screening of mutants was performed following the protocol as described previously with modifications . The traFor continuous editing, the mutant was subcultured in the MRS medium for two generations, followed by streaking on the MRS agar plate. The single colonies were amplified with primers pLCNICK-test-1 and pLCNICK-test-2 to confirm the knockout plasmid curing.citP, XJ25-\u0394citP-pMG36ek-citP, and XJ25-\u0394citP-pMG36ek11-citP) were incubated overnight in the MRS medium at 37\u00b0C. Then overnight cultures were inoculated into the fresh MRS medium with an inoculum volume of 5% (v/v). When the OD600 reached 1.0, the cells were harvested, and washed twice with the MRSg medium, then resuspended in the same volume of the MRSg medium. The resuspension was inoculated into the MRSg medium with an inoculum volume of 5% (v/v). After incubation at 37\u00b0C for 30\u00a0min, the cells were collected for RNA extraction.The wild type XJ25 and the mutants , respectively, according to the instructions described by the manufacturer. The concentration and quality of the RNA samples were determined using BioDrop \u03bcLite Spectrophotometer  before reverse transcription.citP, L-ldh, and citR  calculated for citP, L-ldh, and citR were compared with values made from the calibration sample (16S rRNA). The values of these genes were normalized with that of 16S rRNA to estimate the relative copy numbers of the gene (\u0394\u0394Ct method (Quantitative PCR (qPCR) reactions were performed using SYBR Green Premix Pro Taq HS qPCR Kit  by a CFX-96 system . The primers of 16S rRNA, and citR  were usethe gene . The relt method .citP, XJ25-\u0394citP-pMG36ek-citP, and XJ25-\u0394citP-pMG36ek11-citP) were incubated in the MRS medium until OD600 reached 1.0, then 5% (v/v) inoculum of this culture was transferred into the fresh MRSg medium, respectively. The cells were immediately recovered by centrifugation at 5000 \u00d7 g for 5\u00a0min, then the fresh MRSg medium was added to the obtained bacteria, and after incubation at 37\u00b0C for 24\u00a0h, the supernatant solution was collected by centrifugation and filtering through a 0.45\u00a0\u00b5m filter membrane for further analysis. The samples were prepared in the MRSc and MRSm media using the same method.The wild type (XJ25) and the mutants  to those of the compounds reported in the NIST 17 and the literature. According to the method proposed by p-values < 0.05 were considered statistically significant. The statistical software utilized was SPSS 19.0 . The experimental results were analyzed using GraphPad Prism .The data were reported as means \u00b1 standard deviation of three triplicates and were analyzed statistically by one-way ANOVA. Means were compared by Duncan\u2019s multiple range tests. The differences with citP knockout vector used in this work is shown in citP was verified using PCR and sequencing. The sequencing of the PCR amplicon confirmed the precise knockout of citP as expected (citP knockout vector corresponded to the expected size of 14365 bp. The verified knockout vector was transformed into XJ25 to construct the citP deletion strains. All of the strains showed the expected electrophoretic bands (418 bp for citP). One citP knockout mutant (land 20), XJ25-\u0394citP, was obtained, which was obviously distinguishable from the wild types (land 01)  . These rg medium . ComparecitP overexpression vectors in this work is shown in citP complement mutants derived from the citP knockout mutant XJ25-\u0394citP. A kanamycin resistance gene (KanR) from pLCNICK was inserted into the original vector pMG36e to form pMG36ek, and then the P32 promoter of pMG36ek was replaced with the synthetic promoter P11 to form pMG36ek11. The length of these citP overexpression vectors corresponded to the expected size of 5717 bp or 5612 bp. The verified citP overexpression vectors were transformed into XJ25-\u0394citP to construct the complement mutants. Through PCR verification described in citP. Compared to land 05 in XJ25-\u0394citP, land 02, 08, and land 11 had the bright strip. These results indicate that citP complement mutants were successfully constructed using the pMG36ek and pMG36ek11 vectors. citP could be expressed successfully in XJ25-\u0394citP. As shown in citP in the citP overexpression mutants XJ25-\u0394citP-pMG36ek-citP and XJ25-\u0394citP-pMG36ek11-citP mutants were much higher than that in the wild type XJ25 in the MRSg medium. Compared with XJ25, 973.77-fold and 3900.47-fold increase was found in XJ25-\u0394citP-pMG36ek-citP and XJ25-\u0394citP-pMG36ek11-citP, respectively, for the expression level of citP. For the expression level of L-ldh, a 0.20-fold decrease was found in XJ25-\u0394citP-pMG36ek-citP and a 0.32-fold decrease was found in XJ25-\u0394citP-pMG36ek11-citP, compared with the wild-type XJ25. For the expression level of citR, it showed a 0.29-fold decrease in XJ25-\u0394citP-pMG36ek-citP and a 2.84-fold increase in XJ25-\u0394citP-pMG36ek11-citP, compared with the wild-type XJ25. Moreover, the relative expression levels of gene citP, L-ldh, and citR genes in XJ25-\u0394citP-pMG36ek11-citP were 4.01, 1.62, 9.80-fold higher than that in XJ25-\u0394citP-pMG36ek-citP (p < 0.05), respectively, indicating a significant difference in expression efficiency between the two vectors.The construction process of citP knockout mutant XJ25-\u0394citP showed no significant differences from that in the original MRSg medium (1.06\u00a0g/L), suggesting XJ25-\u0394citP strain could not utilize citric acid. The citric acid concentration in the culture medium for two citP complement mutants, XJ25 (0.21\u00a0g/L), XJ25-\u0394citP-pMG36ek-citP (0.79\u00a0g/L), and XJ25-\u0394citP-pMG36ek11-citP (0.00\u00a0g/L), were much lower than that for XJ25-\u0394citP, suggesting that XJ25-\u0394citP-pMG36ek-citP could not make full use of citric acid (25.47% utilization rate), and XJ25-\u0394citP-pMG36ek11-citP could make full use of citric acid (100.00% utilization rate). The utilization rate of citric acid for XJ25-\u0394citP-pMG36ek11-citP was 3.95 times higher than that for XJ25-\u0394citP-pMG36ek-citP (p < 0.05).The changes in organic acid concentration in MRSg medium after 24\u00a0h culture with the wild-type and the mutants are shown in citP-pMG36ek11-citP. The acetic acid concentration for XJ25-\u0394citP-pMG36ek11-citP (0.58\u00a0g/L) was higher than that for XJ25-\u0394citP-pMG36ek-citP (0.29\u00a0g/L) (p < 0.05). In addition, the acetic acid concentration for XJ25 (0.59\u00a0g/L) were much higher than that for XJ25-\u0394citP (0.22\u00a0g/L). The acetic acid concentration for XJ25-\u0394citP was 0.37-fold lower than that for the wild type XJ25. Additionally, a 1.99-fold increase in the acetic acid concentration was found in XJ25-\u0394citP-pMG36ek11-citP, compared with XJ25-\u0394citP-pMG36ek-citP.For acetic acid production , there wl-malic acid concentration are shown in l-malic acid content were observed in the medium cultured with XJ25 (0.12\u00a0g/L), XJ25-\u0394citP-pMG36ek-citP (0.11\u00a0g/L), and XJ25-\u0394citP-pMG36ek11-citP (0.10\u00a0g/L). The lowest concentration of l-malic acid was observed in the medium cultured with XJ25-\u0394citP (0.06\u00a0g/L), while the highest one was observed in the original MRSg medium (1.05\u00a0g/L). The l-malic acid concentration for XJ25-\u0394citP was 0.53-fold lower than that for XJ25.The changes in citP (p < 0.05). XJ25-\u0394citP (0.69\u00a0g/L) displayed a lower yield of lactic acid than XJ25 (0.84\u00a0g/L), XJ25-\u0394citP-pMG36ek-citP (0.74\u00a0g/L), and XJ25-\u0394citP-pMG36ek11-citP (0.77\u00a0g/L). The lactate production of the complement mutants was lower than that of the wild-type, which was consistent with the results of L-ldh expression (As shown in pression .citP still could barely utilize citric acid (2.03\u00a0g/L) (citP-pMG36ek-citP (1.81\u00a0g/L), and XJ25-\u0394citP-pMG36ek11-citP (1.65\u00a0g/L) could utilize citric acid; however, the utilization rate of citric acid decreased significantly compared with that in the MRSg medium, and the highest utilization rate of citric acid found in XJ25-\u0394citP-pMG36ek11-citP was only 19.73% after 24\u00a0h incubation. Compared with the l-malic acid concentration in the original MRSc medium (0.06\u00a0g/L), a slight decrease of l-malic acid concentration was found in the medium cultured with XJ25-\u0394citP (0.05\u00a0g/L); however, the l-malic acid concentration in the medium cultured with XJ25, XJ25-\u0394citP-pMG36ek-citP, and XJ25-\u0394citP-pMG36ek11-citP increased to 0.07\u00a0g/L, 0.10\u00a0g/L and 0.17\u00a0g/L, respectively  . The wilectively . The proectively . The prol-malic acid, all the strains could fully utilize l-malic acid (citP-pMG36ek-citP (0.01\u00a0g/L), and XJ25-\u0394citP-pMG36ek11-citP (0.01\u00a0g/L) could almost use up the citric acid, and XJ25-\u0394citP (0.08\u00a0g/L) almost could not utilize the citric acid (citP gave the lowest concentration of lactic acid and acetic acid in the MRSm medium (In the MRSm medium only containing 2.00\u00a0g/L lic acid . Though ric acid . Similarm medium .citP did not produce diacetyl after 24\u00a0h culture (citP-pMG36ek-citP (0.42\u00a0mg/L) but obviously lower than that of XJ25-\u0394citP-pMG36ek11-citP (5.27\u00a0mg/L). The production of diacetyl for XJ25-\u0394citP-pMG36ek11-citP was 12.64-fold higher than that for XJ25-\u0394citP-pMG36ek-citP.The changes in diacetyl and acetoin concentration in the MRSg medium after 24\u00a0h culture with the wild-type and the mutants are listed in  culture . The diacitP-pMG36ek-citP (27.07\u00a0mg/L) but obviously lower than that of XJ25-\u0394citP-pMG36ek11-citP (50.41\u00a0mg/L). The production of acetoin for XJ25-\u0394citP-pMG36ek11-citP was 1.86-fold higher than that for XJ25-\u0394citP-pMG36ek-citP. The only difference was that XJ25-\u0394citP also yield 7.64\u00a0mg/L acetoin.In the case of acetoin, the production in the MRSg medium , the trecitP showed no significant difference with that of XJ25; however, the diacetyl and acetoin production of the two complement mutants were obviously lower than that of XJ25  was knocked out successfully and efficiently in L. plantarum XJ25 using the CRISPR editing plasmid pLCNICK. However, the previous studies have reported that pLCNICK can effectively edit the genome of Lactobacillus casei LC2W but cannot edit the genome of L. plantarum WCFS1 (Leuconostoc mesenteroides and Lactococcus lactis (L. plantarum and the homologs of 2HCT in other LAB reached 34.1\u201336.5%. (citP of L. plantarum is located on the genome (NCBI accession number: NZ_CP068448). To verify the function of the predicted citrate transporter gene JKL54_04345 (citP) in L. plantarum, we constructed the citP knockout mutant (XJ25-\u0394citP) using pLCNICK vector and the citP supplement mutants (XJ25-\u0394citP-pMG36ek-citP and XJ25-\u0394citP-pMG36ek11-citP) using two modified pMG36e vector.In our study, a predicted citrate transporter gene JKL54_04345  ; however by CitP . This prlic acid .citP knockout gave an almost 63.09% decrease in acetic acid production  but almost no consumption of citric acid by XJ25-\u0394citP in the MRSm medium could also support this speculation, in which a small part of malate was metabolized into pyruvate by malate dehydrogenase (EC 1.1.1.38) or malic enzyme (EC 1.1.1.39), and the subsequent pyruvate metabolism gave acetoin.Diacetyl, as an important flavor compound with a very low sensory threshold concentration (0.1\u00a0mg/L), is also produced by some other LAB genera, including nococcus . Diacetynococcus . Howevernococcus . Citratenococcus . Therefo acetoin . HoweverL-ldh and citR are two genes structurally adjacent to citP in the same cluster and annotated with the functions closely related to citrate metabolism. L-LDH (l-lactate dehydrogenase) plays a key role in the conversion of pyruvate to lactate in Enterococcus faecalis  from the original pMG36e vector as abovementioned were used in our study to complement ted gene . Meanwhited gene . These icitP) in L. plantarum for the first time. citP knockout mutant could not utilize citric acid at all; however, citP complement mutant recovered the ability of citric acid utilization. Meanwhile, the knockout and complement of citP barely affected the utilization of L-malic but remarkably affected the production of metabolic end products of citrate utilization. Therefore, it was verified that citP functioned as a citrate transporter and was the only gene responsible for citrate transporter in L. plantarum. In addition, the modified vector pMG36ek11 possesses a high-level expression efficiency in L. plantarum and shows a great application potential in LAB expression systems.This study verified the function of a predicted citrate transporter gene JKL54_04345 ("}
+{"text": "Mantle cell lymphoma (MCL) is a type of non-Hodgkin (B-cell) lymphoma (NHL) with manifestations ranging from indolent to aggressive disease. This type of NHL is predominately found in western countries and affects men more often than women (M:F 2:1). The median age of diagnosis with the disease is around 60 years of age. In this report, the patient is a 68-year-old female who had an atraumatic splenic rupture with no past medical history of trauma. She presented to the emergency department with severe abdominal pain in her left upper quadrant. An emergency splenectomy was executed successfully, and the patient was stabilized. In this case report, we will discuss the pathogenesis, clinical presentation, known clinical treatment, diagnostic testing, and atraumatic splenic rupture. Mantle cell lymphoma (MCL) is a type of non-Hodgkin (B-cell) lymphoma (NHL) that can involve the lymph nodes, spleen, blood, and bone marrow -4. In 75In the case of splenomegaly, surgical removal or transcatheter ablation of splenic parenchyma is a vital option . PatientPatients with MCL can present with various signs and symptoms. Newly diagnosed patients usually present with lymphocytosis detected by peripheral blood flow cytometry with severe cytopenia. Roughly 14%-25% of patients diagnosed with MCL present with fever, malaise, weight loss, and night sweats [Immunophenotypically, MCL B-cells markers are CD5, CD19, CD20, CD22, PAX5, CD79a and Cyclin D1 . MCL alsThe patient is a 68-year-old female with a past medical history of hypothyroidism and newly diagnosed\u00a0MCL. The patient presented to the emergency department (ED) complaining of sharp abdominal pain located in the LUQ\u00a0and overall weakness. The patient started feeling progressively weak with abdominal pain four days prior. The patient was afebrile and hypotensive. Table On the day of her admission, the patient was found lying on the floor with severe pain in her LUQ. The patient reiterated that she did not fall, but rather voluntarily lay on the floor to alleviate her pain. The patient denied any loss of consciousness or traumatic falls. The patient also stated that she does not have a past medical history of traumatic events. Physical examination of the patient\u2019s abdomen reveals tenderness to palpation of the LUQ and left lower quadrant (LLQ). The patient showed no guarding or rebound tenderness. Once the\u00a0patient was partially stabilized, she was taken for an anterior/posterior computerized tomography (CT) of her abdomen Figures ,\u00a02. The The patient was transferred emergently to the operating room (OR) and placed in the supine position on the operating table. A midline laparotomy was performed.\u00a0Upon entry into the peritoneum, gross hemoperitoneum was noted. Over 1 liter of coagulated blood was removed from the abdomen by hand. There was gross bleeding from the posterior lateral surface of the spleen due to a laceration. The splenic arteries were located and clamped. The spleen was removed and sent to pathology. Patient was transferred to the intensive care unit (ICU) for further monitoring. The patient was given two units of RBC\u00a0during the operation and another two units post-operational (post-op). Once the patient\u2019s BP\u00a0stabilized, previously administered vasopressors were discontinued, and she remained in the ICU for further monitoring. She had a stable recovery and was eventually discharged to rehabilitation facility. She underwent one round of chemotherapy, but declined any further intervention. The patient did not receive post-splenectomy vaccinations against Streptococcus pneumonia, Hemophilus influenza, and Neisseria meningitidis.The pathology report on the excised spleen revealed a grossly enlarged, roughly oval-shaped spleen with overall dimensions of approximately 27.8 x 20.5 x thickness ranging from 3.0 to 8.2 cm. The total weight was 2,350 g. The capsule had a smooth texture. There was a V-shaped laceration with an approximate length, weight, and depth of 18.5 cm x 5.2 cm x 4.2 cm, respectively. There were multiple sub-capsular and parenchymal hemorrhages along with wedge-shaped infarctions. The parenchymal hemorrhage associated with the lacerations extended approximately 18 cm. Histology shows pleomorphic cells with irregular nuclear contour, relatively condensed chromatin, and enlarged cytoplasm (Figure\u00a0While spontaneous splenic rupture in patients with MCL is rare, this unusual complication should be considered in patients presenting with abdominal pain. In MCL, an enlarged spleen accounts for nearly 40% of cases ,7. In agThe clinical presentation of MCL varies from patient to patient; however, some clinical signs do correlate. The most common clinical feature of splenic ruptures is abdominal pain, which has been reported to be present in nearly 70% of cases ,7. NeverThe diagnosis of spontaneous splenic rupture associated with MCL relies on both clinical and confirmatory imaging studies ,7. The sIn this case, it can be argued that the approach of management of this patient being newly diagnosed with MCL\u00a0three weeks prior,\u00a0should have been to undergo an ultrasound screening for splenomegaly ,7. GivenThe awareness of spontaneous splenic rupture in patients with MCL\u00a0is rare but should be considered a possible complication. Uncontrollable progression through the cell cycle can present\u00a0with a highly aggressive neoplasm that can metastasize to various lymphoid tissues, which serve as a reservoir for the immune system. In high-risk patients, presenting with LUQ pain and hypotension, the probability of splenic rupture can be considered a differential in patients with MCL.\u00a0Understanding the structural and physiologic consequences of an enlarging spleen within the abdominal cavity is important for informational screening and treatment decisions. Using cost-effective methods like ultrasonography can be used to screen patients with MCL for possible splenomegaly. An early diagnosis of splenomegaly can help determine if a prophylactic splenectomy is needed. In patients with MCL, the early identification of splenomegaly is vital for the patient's safety and survival. While this type of NHL has a low survival rate and an increased risk of relapse, the usage of simple diagnostic tools can help prevent further complications associated with atraumatic splenic rupture."}
+{"text": "Intensive agricultural and horticultural cultivation, including consecutively growing the same crop in the same fields, has been contributing to meet the increasing food demands of a rapid growing human population  at the expense of plant-beneficial microbes  might be a major driving factor of replanting disease , forming complex microbial consortia that impact plant growth and health. Increasing evidence is showing that the accumulation of soil-borne pathogens . Pang et al. suggested that the sugarcane\u2013peanut intercropping pattern could potentially improve soil nutrients, cane agronomic parameters, peanut yield, and bacteria diversity in sugarcane root systems compared to the monoculture farming system. Similarly, Bai et al. found that intercropping walnut and tea positively impacted the soil's nutritional conditions and helped in enriching soil with beneficial bacterial and fungal taxa, suggesting that intercropping was able to alleviate the replant disease by altering the plant-associated microbial communities. He et al. studied the response mechanism of alien invasive and the native plants to acid rain by analyzing plant phenotypic characteristics, soil physicochemical properties, and rhizosphere microbial communities.As a response to the importance of plant-plant microbiome-soil interactions in replant disease, we proposed the Research Topic \u201cRhizosphere conversation among the Plant-Plant Microbiome-Soil under Consecutive Monoculture Regimes.\u201d In this Research Topic, we have collected six original research and one review articles that contribute on expanding our knowledge about the rhizosphere ecological processes under consecutive monoculture regimes. In their review, via root exudates directed from plants to microorganisms, and subsequent interactions between microorganisms and between microorganisms and the host plant , University Natural Science Research Project of Anhui Province (KJ2021A0137), and the High-Level Scientific Research Foundation for the introduction of talent (rc522103).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The amount of energy required by Cloud Data Centers (CDCs) has increased significantly in this digital age, and as a result, there is a pressing need to reduce CDC energy ingesting. Consolidation of virtual machines (VMs) and effective virtual machine placement (VMP) techniques are commonly employed in large data middles to reduce energy consumption. The VMP is an NP-hard subject with infeasible optimum explanations even for tiny data middles, and it is dealt with using the Metaheuristic Optimization Algorithm, which is an experiential approach to optimization. With this in mind, this study introduces a novel energy-aware VMP technique for CDCs that is founded on the Disordered Salp Swarm Optimization Algorithm (EAVMP-CSSA) and is enhanced for energy efficiency (EAVMP-CSSA). The EAVMP-CSSA technique attempts to reduce CDC energy ingesting by dropping the quantity of active servers supporting virtual machines. The recommended EAVMP-CSSA strategy also aims to balance the resource operation of active servers , hence reducing waste and increasing efficiency. Furthermore, by combining the ideas of chaotic maps with the standard Salp Swarm Optimization Algorithm (SSA), the CSSA is intended to improve overall performance and reduce computational costs (SSA). A comprehensive range of experimental analyses are performed to ensure that the EAVMP-CSSA technique performs better, and the findings are compared to current VMP techniques. The EAVMP-CSSA approach achieves an effective outcome with a maximum service rate of 98.12%, whereas the Random, FFD, ACO, and AP-ACO procedures achieve a minimum service rate of 74.40%, 78.80%, 90.70%, and 96.31%, respectively. The experimental results demonstrate that the EAVMP-CSSA approach outperforms other assessment metrics. Cloud Computing (CC) is one of the effective computing modules that delivers and hosts a broad variety of services via Internet. Several enterprises are based on cloud framework instead of in-house framework for the benefits provided by cloud platforms like removing maintenance burden, attaining on demand scalability, and pay as you go pricing module . The datThe VMP problem is similar to the resource allocation problems, concentrating on how to assign physical resources of PM to VM of users with their needs. The main problem in network virtualization is that the VMP problem has attained substantial interest recently. The multidimensional physical resource of the server in data center includes storage resources (Storage), computing resources (CPU), and memory resources (Memory) . To assuThe VMP method attempts to discover optimum allocations of VM over PM to attain their objectives of the design . SeveralThis study designs VMP approach using Chaotic Salp Swarm Optimization Algorithm (EAVMP-CSSA) for Cloud Data Centers (CDCs). The design of CSSA for the optimal placement of VMs shows the novelty of the work. The EAVMP-CSSA technique intends to effectively utilize the energy at the CDCs by reducing the active server count hosting VMs and turning off the idle ones. The planned EAVMP-CSSA technique derives a Fitness Function to achieve minimization of the complete liveliness ingesting of the cloud information servers with minimal resource wastage. Furthermore, it accomplishes the balanced utilization of multiple resources of the active sources to minimalize the resource wastage. To highlight the improved performance of the proposed EAVMP-CSSA technique, a set of simulations are performed and the results are investigated under different aspects.In Ramalingam and Mohan's work , a novelAlboaneen et al.  planned In Abdel-Basset et al.'s work , a bandwWei et al.  presenteIn Abohamama and Hamouda's work , a hybriThis section discusses the background details of PMs and VMs. Besides, the problem statement of the proposed model is as follows.m PMs P={p1,\u2026, pm}. A resource capacity vector p \u2208 P, whereas each dimension k \u2208  denotes the capability of all PM physical resources rk in the set R={r1,\u2026, rv}. In a usual Cloud situation, R=\u2009{CPU, memory, disk, network}, abstracted using the virtualization technique , Resource demand vectorvm task demands dk(t) for every resource rk at time instance t, through k \u2208 .They recognize dual groups of VMs that contribute to the deployment procedure. The received VMs are the novel VM, which increases the application or generate novel application placements. The hosted VM is now the running one , 25. TogN\u201d VMs and \u201cM\u201d PHs and the overall demand for the VM are lesser compared to the overall capabilities of PH. All VMs should be exactly allocated to one PM , pack the entire items to the quantity of bins; thus, the amount of wasted space of the utilized bin is reduced. In this work, VMs and PHs are signified by the tierce greatest important capitals such as system bandwidth, the CPU, and memory , 26. Giv one PM . All PM one PM (\u20137). \u03bdcp. \u03bdcpN\u201d VThe VMP problems could be equated as VSBPP.yj denotes the binary parameter that specifies whether PHj has VMs or not, cj represents the cost/wasted space of PM PHj, xij represents the binary parameter that specifies whether VMi is allocated to PHj or not, N indicates the overall VMs, and M represents the overall PMs, i \u2208 {1, \u20092,\u2026, N} and j \u2208 {1, \u20092,\u2026, M}.Here, d dimension search space, where d denotes the quantity of parameters in a specific problematic, like additional group-built method. The present location course of n salp in the exploration interplanetary is Xj=, j=1,2,\u2026, n. The spearhead salp upgrades its location, and it is given byXi1 denotes the location of the spearhead salp in the ith measurement, Fi represents food location in the ith measurement, and ubi and lbi characterize higher and lesser boundaries in the ith measurement correspondingly. C1, C2, and C3 denote module coefficients. These coefficients are arbitrary values that are utilized for specific determinations [C1 represents the balance between exploitation and exploration that denotes the primary variable in the method. C1 is determined by t denotes the present repetition and Tmax indicates the extreme number of repetitions. C2 and C3 represent arbitrary values created uniformly that lies between zero and one. The follower salp updates their position based on Newton's law of motion, and it is given byXik denotes the location of kth supporter salp in the ith dimension and n represents the entire amount of salp subdivisions. The process involved in SSA is given in Algorithm 1. Population-based metaheuristic method shares different benefits that includes simplicity, scalability, and computation time reduction. But this method has two major drawbacks, namely, low convergence rate and recession in local optimal. A specific method to conquer this problem and improve the efficacy of meta experiential procedures is to place the disorder model. The disordered chart is applied rather than arbitrary values in PSO-based method for enhancing the convergence.SSA is a recently presented metaheuristic algorithm that inspires the behaviour of salps in ocean. It is a class of Salpidae similar to that of jelly fish. It forages as well as navigates in a swarm that represents salp chain. SSA is a new kind of PSO that modules the salp cable , 27. Theinations , 27. TheC2. The value of C2 could be substituted by the value of a suitable disordered chart at the present repetition, and it is given by\u03c9(t) denotes the rate of disordered chart at tth repetition. Equation  substitutes arbitrary variable quantity with disordered ones. CSSA utilizes chaotic map for adjusting the values of succeeding constant Equation  could be\u03c9(t) means the rate of disordered chart at tth repetition. The original disorder of the disordered charts is considered to be 0.7 (\u03c9(0)=0.7).The chaos model is a popular numerical method utilized for analyzing the behavior of dynamic systems using crucial primary conditions. The specific method to show this behavior by utilizing chaotic map is moreover separate or else incessant. Disordered charts could be placed only for deterministic organizations using prediction performance. At present, confusion model turns more interesting in many streams like robotics, computer science, microbiology, and physics. The chaotic map becomes the robust solution for enhancing the efficiency of metaheuristic method with the enhancement of their arbitrary variables \u201329. ThisN\u201d VMs and \u201cM\u201d PMs, the EAVMP-CSSA technique recommends various variations for the VMs, which is required to be allocated to the existing PMs. The main objective of the EAVMP-CSSA technique is to decrease the total liveliness operation of the used PMs and thereby minimize the total cost of the cloud provider. The fitness function is given as follows.f(x) signifies the entire liveliness utilization of the PMs, yj is a binary mutable that designates whether PHj comprises VMs or not, Pjbusy is the higher energy operation of PM PHj, Pjidle is the lower energy utilization of PM PHj(Pjidle \u2248 0.6\u2217Pjbusy), and Ujcpu is the CPU operation ratio of PM PHj, and it is given byxij is the binary parameter indicating whether VMi is allocated to PHj or not, \u03bdicpu is the CPU demand of VM VMi, and pjcpu is the CPU volume of PM PHj.Provided \u201cWj denotes the resource wastage of PM PHj.Ljcpu, Ljmem, and LjBW represent the normalized residual CPU, memory, and bandwidth of PM PHj, respectively. Ujcpu, Ujmem, and UjBW represent the regularized CPU, reminiscence, and bandwidth utilization of PM PHj correspondingly [\u03b5 is an actual unimportant hopeful real number and the value is fixed to 0.0001. The aim of  required by the VMs , 30\u201332. ondingly . \u03b5 is anWj=2Ljcpuented in , while tThis unit deals with the presentation analysis of the EAVMP-CSSA method with other prevailing methods in terms of different evaluation parameters. For instance, with 54 VMs, the EAVMP-CSSA technique has attained a reduced power consumption of 4817\u2009W whereas the AP-ACO, ACO, FFD, and Random techniques have achieved an increased power consumption of 5283\u2009W, 5399\u2009W, 5690\u2009W, and 6853\u2009W, respectively. Moreover, with 108 VMs, the EAVMP-CSSA technique has resulted a lower power consumption of 6097\u2009W whereas the AP-ACO, ACO, FFD, and Random techniques have attained a higher power consumption of 6562\u2009W, 7376\u2009W, 7783\u2009W, and 9121\u2009W, respectively. Furthermore, with 162 VMs, the EAVMP-CSSA technique has attained a reduced power consumption of 6504\u2009W whereas the AP-ACO, ACO, FFD, and Random techniques have achieved an increased power consumption of 7725\u2009W, 9005\u2009W, 9761\u2009W, and 14472\u2009W, respectively.Eventually, with 108 VMs, the EAVMP-CSSA technique has gained a reduced communication cost of 59.58\u2009W whereas the AP-ACO, ACO, FFD, and Random techniques have resulted an increased communication cost of 65.32\u2009W, 71.43\u2009W, 80.22\u2009W, and 89.01\u2009W, respectively. Meanwhile, with 162 VMs, the EAVMP-CSSA technique has demonstrated better performance with the minimal communication cost of 73.72\u2009W whereas the AP-ACO, ACO, FFD, and Random techniques have accomplished a maximum communication cost of 81.36\u2009W, 92.44\u2009W, 96.67\u2009W, and 105.79\u2009W, respectively.Additionally, with 500\u2009Mbps bandwidth, the EAVMP-CSSA technique has demonstrated with the lesser time of 1.12\u2009s whereas the AP-ACO, ACO, FFD, and Random techniques have taken an increased time of 1.45\u2009s, 1.96\u2009s, 1.85, and 3.40\u2009s, respectively. At last, with 900\u2009Mbps bandwidth, the EAVMP-CSSA technique has gained an optimal outcome with the minimal time of 0.09\u2009s whereas the AP-ACO, ACO, FFD, and Random techniques have accomplished with the maximum time of 0.11\u2009s, 0.54\u2009s, 0.63\u2009s, and 3.03\u2009s, respectively.Finally, a service rate examination of the EAVMP-CSSA method takes residence beneath varying number of VMs in In the same way, with the presence of 162 VMs, the EAVMP-CSSA technique has illustrated proficient performance with an increased service rate of 59.20% whereas the Random, FFD, ACO, and AP-ACO methods have caused in the abridged service rate of 38%, 42.10%, 51.20%, and 54.80%, respectively. From the above benches and statistics, it is obvious that the EAVMP-CSSA method is originate to be an effective instrument for VMP in CDCs.This paper has designed a novel EAVMP-CSSA method to achieve liveliness competence in CDCs. The EAVMP-CSSA method is mainly based on the design of CSSA with the integration of chaotic maps and conventional SSA. In addition, the EAVMP-CSSA technique derives an objective function to reduce energy utilization and resource wastage . The proposed model has the ability to reduce the active server count by balancing the active servers that enables them to accommodate the upcoming VMP requests and eliminates the requirement of activating other servers. The performance of the EAVMP-CSSA technique is examined by the CloudSim tool and the results are investigated under different dimensions. The simulation results confirmed the betterment of the proposed EAVMP-CSSA technique over the recent state of art techniques. EAVMP-CSSA technique attains an effectual outcome with the maximum service rate of 98.12% whereas the Random, FFD, ACO, and AP-ACO techniques have gained a minimum service rate of 74.40%, 78.80%, 90.70%, and 96.31%, respectively. In the future, the design of EAVMP-CSSA technique can be extended to the design of task scheduling techniques to allocate resources in an optimal way. Besides, the presented technique can be employed to eradicate the overutilization of resources, which degrades the VM performance."}
+{"text": "Human transcriptome can undergo RNA mis-splicing due to spliceopathies contributing to the increasing number of genetic diseases including muscular dystrophy (MD), Alzheimer disease (AD), Huntington disease (HD), myelodysplastic syndromes (MDS). Intron retention (IR) is a major inducer of spliceopathies where two or more introns remain in the final mature mRNA and account for many intronic expansion diseases. Potential removal of such introns for therapeutic purposes can be feasible when utilizing bioinformatics, catalytic RNAs, and nano-drug delivery systems. Overcoming delivery challenges of catalytic RNAs was discussed in this review as a future perspective highlighting the significance of utilizing synthetic biology in addition to high throughput deep sequencing and computational approaches for the treatment of mis-spliced transcripts.  Various pathogenesis could result from spliceopathies, in which pre-mRNA undergoes a dysregulated-splicing process. Spliceosomes are the largest ribonucleoproteins that assemble around newly synthesized RNA transcripts in order to perform two distinctive trans-esterification reactions, which contribute to the precise removal of the intervening non-coding sequences (introns) followed by joining the coding regions (exons) during the transcription maturation step . Along wWithin the IR event, transcripts harbor two or more introns that failed to be spliced out from the mature mRNA due to spliceosomal dysfunction leading to spliceopathies . Among aInterestingly, spliceosomal dysfunction is often caused by errors in the transesterification reactions of the cis-acting elements and/or trans-acting factors during the spliceosomal assembly. Chemically, transesterification is a type of SN2 nucleophilic substitution reactions where synchronously one of the ester bonds is broken and another ester bond is formed. In a typical splicing reaction, two consecutive reaction takes place in the nucleus (nuclear splicing) as follows: first, nucleophilic attack of the hydroxyl group at 2\u2032 carbon atom of the branched adenosine located in the introns will results in releasing the first free 5\u2032exon and 2\u2032-5\u2032 unusual phosphodiester bond formation between the hydroxyl group of the branched adenosine and 5\u2032 phosphoryl group of the 5\u2032 end of intron to form partial lariat structure in step commonly known as branching. Second step known as ligation which involves the cleavage at 3\u2032 splice site done by the attack of the 3\u2032 hydroxyl group of the 5\u2032 exon and leads to joining of the exons together and release the intron .Consequently, mutations in both cis-acting elements and trans-acting factors could inevitably influence the functionality of spliceosome machinery leading to spliceosomopathies. For instance, alteration in the cis-acting elements such as enhancers and silencers significantly affects the catalytic reaction leading to mis-splicing . IR thatMammalian systems exert diverse regulatory processes to control the fate of IR-containing mRNA transcripts (IR-mRNAs) , which aThe survival of IR-mRNAs from the cellular regulatory control becomes more apparent due to the advancement in IR-mRNA detection methods such as deep sequencing . In a siin vivo cell-imaging techniques have been successfully implemented to detect the presence and the expression levels of IR-containing mRNAs where non-invasive bioluminescence reporters are used to screen the IR splicing events while offering real time quantification  (In vitro studies showed that these ribozymes can be re-engineered to employ the trans-splicing type of reaction in order to repair the mis-spliced transcripts and generate a functioning protein having high specificity and fidelity (The increased demands to treat spliceopathies have ignited the development of innovative therapeutic approaches such as spliceosome-mediated RNA  (SMaRT) , splice  (SMaRT) , CRISPR/ (SMaRT)  and nano (SMaRT) . For decfidelity . Nonethefidelity , which iin vitro intron removal via resembling the first two trans-esterification splicing reactions in the nucleus. The results showed the successful removal of introns and subsequent ligation of exons from synthetic oligonucleotides constructs forming IR-free RNA products  and CRISPR-Cas9 were encapsulated inside nanocarrier systems like lipid, organic, or inorganic NPs and have been used in humans to inhibit gene mutation and increase or correct gene expression , Alzheimer disease (AD), Huntington disease (HD), or myelodysplastic syndromes (MDS) can be feasible through nanotechnology by which engineered nanorobots can perform cellular level surgeries such as splicing with high precision. To the best of our knowledge, no reports have shown artificial pression .in-vivo results conducted on a small group of ATTR patients suffering from polyneuropathy showed a durable inhibition of TTR gene expression ranging from 80%\u201390% after 28 days of receiving a single dose  and European Commission (EC) have approved the first RNAi based therapy for clinical purposes called ONPATTRO (Patisiran), commercialized as a drug product to treat patients suffering from polyneuropathy, which is one of the symptoms associated with transthyretin amyloidosis (ATTR). A mutation in the gene coding for hereditary transthyretin (TTR), which is a protein synthesized mainly in the liver and responsible for carrying vitamin A and Thyroxine, causes protein misfolding and aggregation leading to the accumulation of formed amyloid at different locations and hence developing ATTR accompanied with several manifestations including polyneuropathy. ONPATTRO is produced using lipid NPs to encapsulate siRNA and enhance its delivery to the hepatocytes, thereby inhibiting the gene expression of both wild and mutant types . Similargle dose . New advgle dose . Similarreatment .Givosiran is another example of the developed RNAi based therapeutic agent loaded in lipid NPs to reduce the expression of delta aminolevulinic acid synthase 1 (ALAS1) gene and hence treating acute Intermittent porphyria (AIP). Overexpression of ALAS1 could lead to the deposition of neurotoxic heme compounds leading to painful neurovisceral attacks or causing chronic symptoms. Promising and effective reduction in the level of porphyria attacks was observed in clinical trials following the administration of Givosiran to AIP patients . Such fiDespite the great potency of using RNA therapies, a number of concerns need to be raised and tackled. For instance, RNAs degradation by endosomes and lysosomes must be avoided for the successful translocation to cytoplasm wherein selective targeting might occur. Wang et al. developed a novel endoplasmic reticulum membrane-modified hybrid nanoplexes (EhCv/siRNA NPs) encapsulating siRNA and protecting it from lysosomal degradation for efficient siRNA transportation to cytoplasm in order to improve siRNA silencing ability . Nanocar tissues . General tissues . Another tissues . The rec tissues  could be"}
+{"text": "This goal requires an increase in the chloroplast compartment of bundle sheath cells in C3 species. To facilitate large-scale testing of candidate regulators of chloroplast development in the rice bundle sheath, a simple and robust method to phenotype this tissue in C3 species is required.It has been proposed that engineering the C3 rice and C4 maize. Comparison of paradermal versus transverse bundle sheath cell width indicated that bundle sheath cells were intact after leaf ablation. Moreover, comparisons of planar chloroplast areas and chloroplast numbers per bundle sheath cell between wild-type and transgenic rice lines expressing the maize GOLDEN-2 (ZmG2) showed that the leaf ablation method allowed differences in chloroplast parameters to be detected.We established a leaf ablation method to accelerate phenotyping of rice bundle sheath cells. The bundle sheath cells and chloroplasts were visualized using light and confocal laser microscopy. Bundle sheath cell dimensions, chloroplast area and chloroplast number per cell were measured from the images obtained by confocal laser microscopy. Bundle sheath cell dimensions of maize were also measured and compared with rice. Our data show that bundle sheath width but not length significantly differed between C3 species. We show that this method is suitable for obtaining parameters associated with bundle sheath cell size, chloroplast area and chloroplast number per cell.Leaf ablation is a simple approach to accessing bundle sheath cell files in CThe online version contains supplementary material available at 10.1186/s13007-023-01041-x. However, plants that use C3 photosynthesis predominate such that species using C4 and Crassulacean Acid Metabolism account for only three and six% of land plants respectively [3 plants, mesophyll cells are filled with chloroplasts and so are the major site of photosynthesis  to generate four-carbon compounds such as malate and aspartate that then diffuse into bundle sheath cells. Decarboxylation of either aspartate or malate in the bundle sheath releases high concentrations of CO2 in bundle sheath cells that can then be assimilated by RuBisCO [Photosynthesis is fundamental to life on earth and allows assimilation of atmospheric COC3 cycle \u20133. In plectively . In C3 psis Fig.\u00a0a. In the RuBisCO .4 cycle concentrating CO2 around RuBisCO, C4 species are more efficient under dry and high-temperature conditions. Moreover, they often have improved water and nitrogen use efficiencies compared with C3 plants [4 photosynthesis [4 pathway is a specialised form of leaf morphology termed Kranz anatomy [3 to C4 trajectory, in some lineages while not always the case, evolution has generated bundle sheath cells that are larger in the medio-lateral leaf axis [Due to the C3 plants \u201311. Aparynthesis , a unify anatomy . Kranz aeaf axis , 15 and eaf axis , Fig.\u00a01b3 crops would help meet future demands for food, especially under changing climatic conditions. It has been predicted that introducing the C4 pathway into C3 crops could increase their photosynthetic efficiency by up to 50% [4 plants. On average, the bundle sheath chloroplast content of C4 species is ~\u200930% more than in C3 species [4 species [GOLDEN2 or GOLDEN2-LIKE 1 from C4Zea mays in rice increased bundle sheath chloroplast volume, this did not phenocopy the increase in chloroplast occupancy found in C4 plants [Increasing the photosynthetic efficiency of Cp to 50% . However species , 18, but species \u201321. Alth4 plants .4 bundle sheath anatomy into C3 rice is therefore likely to involve large-scale testing of candidate genes involved in bundle sheath cell and chloroplast development and phenotyping bundle sheath cells. However, the bundle sheath has been challenging to phenotype in C3 plants. Classical bright-field light microscopy after embedding samples in resin and thin sectioning has been used [4 grasses [3 grasses might not be feasible due to many mesophyll layers. Lastly, more advanced electron microscopy-based 3D reconstruction methods such as serial block-face scanning electron microscopy (SBF-SEM) can cover large fields of view and reconstruct ultrastructural features in 3D such that volume of leaf cells and chloroplasts can be quantified [3 rice.Introducing Ceen used . Althougeen used  but it ieen used . Mechani grasses , 25. Butantified . However4 species maize to measure bundle sheath cell dimensions and made comparisons between bundle sheath cells in these two species. When combined with genetic perturbations we anticipate that this approach will provide insight into structure function relations of bundle sheath cells in species such as rice.To address this, we established a simple and robust method to expose bundle sheath cell files in rice and measure their cell dimensions, as well as the planar chloroplast area and chloroplast number per cell. We show that these bundle sheath cells are intact and the chloroplast number per cell is comparable with previous reports . We also3 leaf because of the many layers of mesophyll cells [The middle region of fully expanded fourth leaves from rice and maize was fixed with glutaraldehyde. Prior to ablation, although parallel venation was detectable in rice at low magnification, when higher power objectives were used the significant amount of light scattering meant that individual cells including the bundle sheath were not visible Fig.\u00a0a, c. Howll cells , two to 4 maize has increased numbers of intermediate (rank-1\u2009+\u2009rank-2) veins between the larger laterals because of an increase in the density of rank-2 intermediates [4 maize it took less than one minute to ablate mesophyll layers such that bundle sheath cell files were clearly visible  than that of rice (598 \u00b5m2)  transcription factor under the control of the maize ubiquitin promoter are known to contain larger chloroplasts [ZmUbi::ZmG2 rice respectively were acquired by confocal laser scanning microscopy. Maximum intensity projection images  images is of course more time consuming than two-dimensional (2D) images. We therefore wanted to test if there was a difference between bundle sheath chloroplast numbers estimated by the two approaches and so obtained 2D and 3D images of the same 31 cells from wild-type Fig.\u00a0a. These We wanted to use the above data to understand the relationship between bundle sheath chloroplast occupancy and cell area in rice. Therefore, a simple linear regression model was performed between bundle sheath paradermal cell area and chloroplast size and number. This showed that the average planar and maximum chloroplast area per cell did not vary with bundle sheath cell area Fig.\u00a0a, b. But4 pathway into C3 crops such as rice and it is estimated that this could improve yields by up to 50%. However, this goal is challenging and would require a significant increase in the chloroplast compartment of bundle sheath cells from C3 crops such as rice. It has been challenging to phenotype bundle sheath tissue in C3 species as these cells are deeper in the leaf because of the many layers of mesophyll cells [3 rice.It is widely recognised that improving photosynthesis in crops is one mechanism to improve yield . One appll cells . Approacll cells , transmill cells , serial ll cells  and singll cells  are slow3 species.Including sample preparation time, the ablation method reported here requires about 30\u00a0min to phenotype one leaf sample and can capture images from 30 to 40 bundle sheath cells in one focal plane. To obtain three-dimensional imaging via acquisition of z-stacks approximately one hour is needed. This compares favourably with other approaches such as the published single-cell isolation method  which in3 to C4 trajectory bundle sheath cells elongate less along the axis of the vein but become wider [4 photosynthesis. The average bundle sheath cell length in maize is similar to what has been previously reported [To provide evidence that imaging after ablation captures parameters derived from intact bundle sheath cells, the width of rice bundle sheath cells was measured from transverse sections obtained from serial block-face scanning electron microscopy  but low2; Figs.\u00a0, 32. Thu2; Figs.\u00a0, 34 and 3 species such as rice. We show that this method is appropriate to measure bundle sheath cell dimensions, chloroplast areas and chloroplast numbers per cell. We also show bundle sheath cells are intact after the leaf ablation. As the approach is at least ten times faster than the next most efficient approach, ablation should significantly accelerate analysis of transgenic lines harbouring candidate genes aimed at modifying the rice bundle sheath.In conclusion, we report a simple and scalable leaf ablation method to access bundle sheath cell files in COryza sativa spp japonica cv. Kitaake) and maize GOLDEN-2 (ZmG2) overexpressing rice ([ZmUBIpro::ZmG2 line E131) were imbibed in sterile Milli-Q water and incubated at 30\u00a0\u00b0C in the dark for two days. Seeds were transferred onto Petri plates with moistened Whatman filter paper and germinated in the growth cabinet at 28\u00a0\u00b0C with 16/8 hrs. of light/dark cycle. After two days, germinated seedlings were potted into 9 by 9\u00a0cm pots (two plants/pot) filled with Profile Field and Fairway soil amendment (www.rigbytaylor.com). Plants were grown in a walk-in plant growth chamber under a 12-hour photoperiod at a photon flux density of 400 \u00b5mol m-2\u00a0s-1 at 28\u00b0c (day) and 20\u00a0\u00b0C night. Once a week, plants were fed with the Peters Excel Cal-Mag Grower fertiliser solution  with additionally supplied iron . The working fertiliser solution contains 0.33\u00a0g/L of Peters Excel Cal-Mag Grower and 0.065\u00a0g/L chelated iron. Maize (B73) seeds were germinated on wet filter paper in the dark at 28\u00a0\u00b0C for three days after which each germinated seed was transferred into a two litre pot containing a mixture of two parts nutrient-rich compost  to one part topsoil , 10 ml Miracle-Gro all-purpose fertiliser beads and 15 ml Miracle-Gro magnesium salt . They were grown in a growth cabinet operating at 28\u00a0\u00b0C (day)/ 20\u00a0\u00b0C (night) at a photon flux density of 550 \u00b5mol m-2\u00a0s-1 under a 14-hour photoperiod.Seeds of wild-type  glutaraldehyde in 1X PBS buffer. Once fixative was infiltrated, samples were left in that solution for about two hours and then washed twice with 1X PBS buffer, with each wash lasting\u2009~\u200930\u00a0min. Leaf samples can be stored in 1X PBS buffer at 4\u00a0\u00b0C for several weeks without losing chlorophyll autofluorescence. Before microscopy, the adaxial side of the fixed leaf material was ablated gently with a fine razor blade  and eight to ten cells per vein were obtained from each replicate. From three replicates, 82 and 90 bundle sheath cells from wild-type and E131 line were imaged respectively. Maximum intensity projection images were used to quantify bundle sheath cell dimensions, individual chloroplast areas and chloroplast number per cells. Bundle sheath cell length and width were measured at the mid-point of the proximal-distal and medio-lateral axes respectively. Images of 90 maize bundle sheath cells of intermediate veins from three replicates were captured using confocal laser microscopy to measure bundle sheath cell dimensions.Light microscopy images (Olympus BX51 microscope) of both rice and maize leaves were captured using an MP3.3-RTV-R-CLR-10-C MicroPublisher camera and QCapture Pro 7 software  to visualize the differences before and after the ablation. A Leica SP8X confocal microscope upright system (Leica Microsystems) was used for fluorescence imaging. It has two continuous wave laser lines, 405 and 442\u00a0nm, a 460\u2013670\u00a0nm super continuum white light laser (WLL) and four hybrid detectors and one photomultiplier tube. Imaging was conducted using a 25X water immersion objective and Leica Application Suite X  software. Calcofluor white was excited at 405\u00a0nm and emitted fluorescence captured from 452 to 472\u00a0nm. Chlorophyll autofluorescence was excited at 488\u00a0nm and emission captured 672\u2013692\u00a0nm. Three replicates from both wild-type Kitaake and oC. After washing five times with 0.05\u00a0M sodium cacodylate buffer pH 7.4, samples were osmicated  for three days at 4oC. After washing five times in DIW (deionised water) samples were treated with 0.1% (w/v) thiocarbohydrazide/DIW for 20\u00a0min at room temperature in the dark. After washing five times in DIW, samples were osmicated a second time for one hour at RT (2% osmium tetroxide/DIW). After washing five times in DIW, samples were block stained with uranyl acetate  for three days at 4oC. Samples were washed five times in DIW and then dehydrated in a graded series of ethanol (50%/70%/95%/100%/100% dry), 100% dry acetone and 100% dry acetonitrile, three times in each for at least five minutes. Samples were infiltrated with a 50/50 mixture of 100% dry acetonitrile/Quetol resin mix (without BDMA) overnight, followed by three days in 100% Quetol (without BDMA). Then, the sample was infiltrated for five days in 100% Quetol resin with BDMA, exchanging the resin each day. The Quetol resin mixture is: 12\u00a0g Quetol 651, 15.7\u00a0g NSA (nonenyl succinic anhydride), 5.7\u00a0g MNA (methyl nadic anhydride) and 0.5\u00a0g BDMA . Samples were placed in embedding moulds and cured at 60oC for three days.Wild-type rice leaf (middle region of fourth leaves) samples were fixed in fixative  overnight at 4Sections were cut at a thickness of about 70\u00a0nm using a Leica Ultracut E, placed on a Melinex plastic coverslip, and allowed to air dry. Coverslips were mounted on aluminium scanning electron microscopy stubs using conductive carbon tabs and the edges of the slides were painted with conductive silver paint. Then, samples were sputter coated with 30\u00a0nm carbon using a Quorum Q150 TE carbon coater. Samples were imaged in a Verios 460 scanning electron microscope (FEI/Thermofisher) at 4\u00a0keV accelerating voltage and 0.2 nA probe current in backscatter mode using the concentric backscatter detector (CBS) in field-free mode for low magnification imaging and in immersion mode at a working distance of 3.5-4\u00a0mm; 1536\u2009\u00d7\u20091024 pixel resolution, 3 us dwell time, 4 line integrations for higher magnification imaging. Stitched maps were acquired using FEI MAPS automated acquisition software using the default stitching profile and 5% image overlap. Transverse bundle sheath cell width was measured from bundle sheath cells of three minor veins per replicate, and three biological replicates were used. In total, dimensions of 92 bundle sheath cells were measured. The planar chloroplast areas were measured from paradermal sections of bundle sheath cells surrounding two minor veins per replicate. Total areas of 574 chloroplasts were measured across 130 cells.Bundle sheath cell dimensions , chloroplast area and numbers per cell were measured using ImageJ version 2.1.0/1.53c . RStudioBelow is the link to the electronic supplementary material.Additional file 1: Movie showing rice leaf ablation. Rice leaf image with different vein orders before and after leaf ablation (top) and video showing the leaf ablation process (bottom). A drop of water was added onto a glass plate to prevent the dehydration while ablating the leaf. 1\u00b0: primary/mid vein; 2\u00b0: secondary/large lateral veins; 3\u00b0: tertiary/intermediate veins. Movie courtesy: Dr Satish Kumar Eeda. Additional file 2: Comparison of bundle cell width in paradermal versus transverse sections obtained from confocal laser scanning microscopy versus serial block-face scanning electron microscopy (SBF-SEM), respectively. (a) Transverse section of a rice leaf obtained from serial block-face scanning electron microscopy, representing the bundle sheath cells of a tertiary vein (3\u00b0). Bundle sheath cell width was measured at the mid-point of the medio-lateral axes as annotated with a red arrow. (b) Comparison of bundle sheath cell width measurements from paradermal and transverse sections, obtained from confocal imaging . (a) Paradermal section of a rice leaf obtained from serial block-face scanning electron microscopy, representing the lateral bundle sheath cells of a tertiary vein (3\u00b0). Bundle sheath chloroplasts were pointed with red arrows. (b) Comparison of individual chloroplast areas from confocal (wild-type rice data from Fig."}
+{"text": "This study aimed to understand how the oncogenic transcription factor MYC affects cellular processes contributing to cancer. Therefore, we used cell lines derived from multiple myeloma (MM), a malignant plasma cell disorder that is highly dependent on MYC expression. Through quantitative mass spectrometry analysis, we examined how MYC depletion affects the proteome of MM cells. We observed that upon MYC depletion, the levels of the two RNA-binding proteins hnRNPC and LARP1 decreased, suggesting a direct regulation by MYC. Notably, a reanalysis of publicly available data demonstrated that high expression of hnRNPC and LARP1 was linked to poor survival and disease progression in MM patients, suggesting their potential as prognostic markers and therapeutic MYC target proteins. Our findings demonstrate the efficacy of our approach in identifying MYC-regulated target proteins that could potentially serve as predictors of both patient survival and disease progression in MM.Multiple myeloma (MM) is a malignant plasma cell disorder in which the MYC oncogene is frequently dysregulated. Due to its central role, MYC has been proposed as a drug target; however, the development of a clinically applicable molecule modulating MYC activity remains an unmet challenge. Consequently, an alternative is the development of therapeutic options targeting proteins located downstream of MYC. Therefore, we aimed to identify undescribed MYC-target proteins in MM cells using Stable Isotope Labeling with Amino Acids in Cell Culture (SILAC) and mass spectrometry. We revealed a cluster of proteins associated with the regulation of translation initiation. Herein, the RNA-binding proteins Heterogeneous Nuclear Ribonucleoprotein C (hnRNPC) and La Ribonucleoprotein 1 (LARP1) were predominantly downregulated upon MYC depletion. CRISPR-mediated knockout of either hnRNPC or LARP1 in conjunction with redundant LARP family proteins resulted in a proliferative disadvantage for MM cells. Moreover, high expression levels of these proteins correlate with high MYC expression and with poor survival and disease progression in MM patients. In conclusion, our study provides valuable insights into MYC\u2019s role in translation initiation by identifying hnRNPC and LARP1 as proliferation drivers of MM cells and as both predictive factors for survival and disease progression in MM patients. Multiple myeloma (MM) is a hematological malignancy characterized by the expansion of neoplastic plasma cells within the bone marrow, impaired hematopoiesis, osteolytic bone destruction, and renal failure . Over thOverexpression and enhanced activation of c-MYC (referred to as MYC) have been identified as one of the major key drivers of MM and are associated with an aggressive phenotype of the disease , resultiv/v) FCS , 100 U/mL penicillin, and 100 \u03bcg/mL streptomycin (1\u00d7 P/S) . Cell lines were chosen due to different patterns of MYC abnormalities (Human multiple myeloma (MM)-derived cell lines  were obtained from the DSMZ  and were cultured in RPMI-1640 medium , supplemented with 10%  FCS , and 1\u00d7 P/S. All cell lines were cultured at 37 \u00b0C in a humidified, 5% CO2 incubator. All used MM-derived cell lines and the HS5 cell line stably express spCas9 generated beforehand by lentiviral transduction  and then separated on an analytical column ) using an 80 min linear gradient from 5% to 42% buffer B  over buffer A (0.1% FA) at a flow rate of 300 nL/min. A data-dependent acquisition scheme was used to analyze eluting peptides. The 20 most abundant precursor ions with charge states of 2 to 64 were selected in an isolation window of m/z 2.0 and subjected to higher-energy collisional dissociation (HCD) at an NCE of 30%. The MS survey spectra ranged from m/z 350 to 1600, with a resolution of 70,000 FWHM at m/z 200. For the MS/MS product ion spectra, the resolution was set to 17,500 FWHM at m/z 200. The AGC target values and maximum injection times for MS and MS/MS were 1 \u00d7 106 at 50 ms and 1 \u00d7 105 at 54 ms, respectively. Fragmented ions were also excluded from isolation for 25 s.To identify MM-specific MYC-regulated proteins, the three technical replicates of 1:1:1 lysate mixtures of each cell line were separated by SDS\u2013PAGE using precast Bis-Tris minigels . The separated proteins were stained with Coomassie Brilliant Blue  and cut into 23 slices. The proteins in each slice were reduced with DTT (Sigma-Aldrich) and alkylated with iodoacetamide (Sigma-Aldrich) before being digested with trypsin overnight (SERVA Electrophoresis GmbH). The peptides were then extracted from the gel matrix and analyzed by liquid chromatography/tandem mass spectrometry (LC-MS/MS) using a quadrupole-Orbitrap hybrid mass spectrometer  coupled to an EASY n-LC 1000 HPLC system (Thermo Fisher Scientific). The samples were first desalted on a trap column ) at 5 \u03bcL/min in loading buffer , . (2004)  with the. (2004) ,23, desc6 cells were lysed by adding 50 \u00b5L of SDS lysis buffer , 150 mM NaCl , 10 mM EDTA pH8 , 10% SDS , freshly supplemented with protease inhibitors . Lysates were cleared by centrifugation. Protein concentrations were determined by the Lowry assay  according to the manufacturer\u2019s instructions. Equal protein amounts of the lysates were analyzed by SDS\u2013PAGE and Western blot.For protein lysates, 1 \u00d7 102-transformed expression data were correlated using the Spearman rank coefficient. For survival analyses, expression data for indicated genes was dichotomized into low (below median) and high (above median). Right-censored overall survival was estimated with the Kaplan\u2013Meier method, and the log-rank test implemented in R\u2019s survival 3.5-3 package was used to test for differences in survival between groups. Publicly available normalized microarray expression and associated metadata were retrieved from GEO (GSE6477) ,,15,14,152 [FC] values for protein regulations upon MYC knockout are consistent with previously published findings [2 [FC] values for significantly downregulated proteins was set to <8 fold (=log2 [FC] < (\u22120.32)) and \u2013log10 [p-value] > 1, as performed previously during mass spectrometry data validation  were usAmong the regulated candidates were mainly eukaryotic initiation factor (EIF) family members that regulate the initiation of translation. We followed up on Western blot validation of the results by assessing the protein expression of the known MYC target EIF 4E Binding Protein  as a positive control in MYC-depleted RPMI8226 and LP1 cells. In addition, we extended this investigation to explore the functionally related La Ribonucleoprotein 1 (LARP1), which was identified through our approach and is known to participate in the translation regulation of specific mRNA translations ,32 but iIn RPMI8226 cells, Western blot analysis revealed that both translation regulatory proteins involved in specific mRNA translation were downregulated to 40.9% (4EBP1) and 53.5% (LARP1) upon MYC depletion. In LP1 cells, 4EBP1 was downregulated to 25.2% and LARP1 to 36.1% . The res2 [FC] values determined for RPMI8226 and LP1  are deregulated in MM patients.Therefore, we analyzed publicly available data sets from patients with MM at initial diagnosis. First, we found a highly significant correlation between MYC expression and expression of 4EBP1, LARP1, and hnRNPC in primary material from 762 newly diagnosed MM patients in the MMRF CoMMpass study (NCT01454297)  Figure A. To looMultiple myeloma (MM) is a complex, frequently MYC-driven, hematological malignancy with a poorly understood etiology and inevitable progression. In this study, we aimed to gain insights into cellular pathways affected by MYC, a critical transcription factor that plays a key role in the proliferation and metabolism of MM cells. Despite being an excellent candidate for therapeutic targeting, however, it remains a challenge to develop drugs targeting MYC directly . To idenMYC expression and translation processes has been observed [Our overrepresentation analysis (ORA) of downregulated proteins primarily revealed MYC targets associated with protein synthesis/translation , therebyobserved . This coobserved , underscobserved . Howeverobserved .4EBP1 gene [As shown in BP1 gene . NotablyBP1 gene ,38,39,40BP1 gene  and LARPBP1 gene ,42, provBP1 gene ,44,45,46BP1 gene ,47. ManyBP1 gene ,48, indiBP1 gene . In addiBP1 gene . YB-1 exBP1 gene . This suUsing the GO database, we additionally found that the majority of MYC-regulated proteins share RNA-binding functions (GO:0003723), with mRNA processing factors and RBPs being downregulated upon MYC knockout in MM-derived cell lines A,B. AparAltogether, a high expression of the translation initiation proteins (4EBP1 and LARP1) and the RNA processing factor hnRNPC was frequently found in MM, associated with high MYC expression, unfavorable overall survival, and progressive disease stages . This isIn conclusion, our data indicate that the expression of RNA-binding proteins involved in translation is MYC-driven, prognostically unfavorable, and highly dysregulated in MM. As there are currently no effective strategies to target MYC directly, our findings indicate that intervening in certain translational sub-processes might be an effective therapeutic strategy to target MYC dependence in MM. The correlation between MYC expression, MM disease progression, and hnRNPC, as well as LARP1 expression, demonstrates these identified MYC target proteins as putative predictors of MM patient survival and disease progression."}
+{"text": "Guidelines recommend performing a flexible sigmoidoscopy in patients hospitalized with acute severe ulcerative colitis (ASUC). However, it is unclear if time to sigmoidoscopy affects relevant clinical outcomes. We aimed to assess the impact of early sigmoidoscopy on clinical outcomes using a well-characterized cohort of patients with ASUC.This is a single-center, retrospective study of all patients hospitalized with ASUC from January 1, 2012 to November 1, 2021. Early sigmoidoscopy was defined as occurring within 72 hours of admission while delayed sigmoidoscopy was defined as occurring >72 hours after admission. Primary outcomes were cumulative days of intravenous (IV) corticosteroid (CS) use, length of hospital stay, and colectomy rates. Secondary outcomes were time to infliximab (IFX) rescue and inpatient opioid medication use.P < .001), had shorter hospital stays , and shorter time to IFX rescue . Rates of colectomy in the early and delayed sigmoidoscopy groups were 17% versus 28%, respectively (P = .23). Longer time to sigmoidoscopy was associated with a 16% increased risk of colectomy .A total of 112 patients hospitalized with ASUC who underwent sigmoidoscopy were included in the analysis. Eighty-seven patients (78%) had early sigmoidoscopy and 25 (22%) had delayed sigmoidoscopy. Patients in the early sigmoidoscopy group were exposed to significantly fewer days of IV CS (4.5 vs 9.2 days; In this well-characterized cohort, early sigmoidoscopy in ASUC was associated with favorable clinical outcomes. These findings highlight the benefits of early sigmoidoscopy in patients with ASUC. Larger prospective studies are needed to corroborate these findings. The global burden of UC is increasing and is associated with increased healthcare costs.6 The rates of hospitalization due to ASUC remain significant despite multiple advances in treatment modalities and evolution of treatment targets. Various studies suggest a 20%\u201330% prevalence of an acute severe flare in patients with UC.8 More recently, a systematic review and meta-analysis showed that the 5-year risk of UC hospitalization can be as high as 21.5%.9 Initial management of ASUC involves performing a flexible sigmoidoscopy to grade the severity of inflammation and to obtain biopsies to rule out cytomegalovirus virus (CMV) infection. Endoscopic evaluation has important prognostic value in this setting as the presence of large/deep ulcers is associated with a high likelihood of treatment failure with intravenous (IV) corticosteroids and need for colectomy.10Acute severe ulcerative colitis (ASUC) is defined by the Truelove and Witts criteria as the following: bloody stool frequency > 6/day; AND one of the following as evidence of systemic toxicity: temperature > 37.8\u00b0C, pulse > 90 beats/min, hemoglobin < 10.5 g/dL, erythrocyte sedimentation rate (ESR) > 30 mm/h.11\u201314 However, not all guidelines offer a recommendation regarding the specific timing of the flexible sigmoidoscopy in ASUC. This is primarily driven by a lack of data on outcomes with an early versus delayed flexible sigmoidoscopy. Two studies using data from the National Inpatient Sample (NIS) have found that early endoscopy is associated with a reduction in hospital length of stay, hospital cost, and mortality.16 However, these studies were based on coding data. Moreover, the severity of UC flares, baseline disease activity, and medical therapy were not elucidated in these studies. The purpose of this study was to evaluate whether early flexible sigmoidoscopy is associated with favorable outcomes in patients with ASUC compared to delayed flexible sigmoidoscopy in a well-characterized cohort.Consensus guidelines from the American College of Gastroenterology (ACG), European, British, and Canadian gastroenterology societies recommend a flexible sigmoidoscopy after admission to assess disease severity, rule out CMV and other causes of symptoms including ischemic colitis.This study is a single-center, retrospective review of all UC patients who were admitted with ASUC from January 1, 2012 to November 1, 2021. The study protocol was approved by the Yale University Institutional Review Board (IRB# 2000031140). We included all adult (age \u2265 18 years) patients who were admitted to the hospital for ASUC and underwent a flexible sigmoidoscopy during the hospital admission. Determination of ASUC was based on the modified Truelove and Witts\u2019 clinical criteria: bloody stool frequency > 6/day and one of the following as evidence of systemic toxicity: temperature > 37.8\u00b0C, pulse > 90 beats/min, hemoglobin < 10.5 g/dL, ESR > 30 mm/h. Exclusion criteria included lack of endoscopic evaluation, lack of confirmed UC diagnosis, and patients with UC hospitalized for indications other than ASUC.Clostridioides difficile (C. difficile) infection, labs including admission C-reactive protein (CRP) and albumin, and need for rescue medical therapy.Demographic information at time of admission including age, sex, body mass index, and smoking status were extracted from each individual\u2019s medical record to form the data set. Disease-related variables including date of UC diagnosis, disease location, and presence of documented extraintestinal manifestations were noted. Other collected variables included all current and prior medical therapies for UC, dates and times of hospital admission, flexible sigmoidoscopy findings and timing, presence of CMV by histopathology, or 14 Variables were compared between the early and delayed flexible sigmoidoscopy groups. The primary outcomes were duration of IV corticosteroid use, length of hospital stay, and time to rescue medical therapy. Secondary outcomes included rates of colectomy and inpatient opioid medication use. The results of analyses using cutoffs for flexible sigmoidoscopy within 24 and 48 hours of admission were also performed are provided in Early flexible sigmoidoscopy was defined as within 72 hours of admission while delayed flexible sigmoidoscopy was defined as >72 hours after admission based on the latest ACG guidelines.t-test. Categorical variables were analyzed using a Pearson\u2019s chi-square test. To develop multivariate regression models to assess the impact of time to flexible sigmoidoscopy on clinically meaningful outcomes, an exploratory univariate analysis was first performed. To develop our model, clinically plausible variables, and variables with P < .10 on univariate analysis were identified and incorporated as independent variables in multivariate regression models. However, no variables were significant on univariate analysis and as such clinically plausible variables based on clinical experience and the literature were used to build the model. The variables included in the model were time to flexible sigmoidoscopy, baseline CRP, Mayo UC endoscopic subscore of 3, anti-tumor necrosis factor (TNF) exposure, and use of oral corticosteroids on admission. Linear regression models were used to determine factors associated with duration of IV steroids and time to salvage infliximab. Cox proportional hazards multivariate regression modeling and Kaplan\u2013Meier plots were used to model time to colectomy.Continuous variables were analyzed using an unpaired Student\u2019s P-value < .05 was considered statistically significant. JMP  and SPSS Statistics for Windows, version 28.0  were used for data analysis.A n = 9), outpatient flexible sigmoidoscopy performed in the past 30 days , treating physicians\u2019 discretion . The mean age at admission was 39.2 \u00b1 16.9 years and 54% of the patients were male. The median disease duration was 2 years with a range of 1\u201310 years. The early and delayed flexible sigmoidoscopy groups were similar in terms of baseline characteristics and disease activity  underwent early flexible sigmoidoscopy and 25 patients (22%) underwent delayed flexible sigmoidoscopy. The median time to flexible sigmoidoscopy in the entire cohort was 39.7 (interquartile range [IQR] 19.5\u201369.2) hours. The median time to flexible sigmoidoscopy in the early group was 34.3 (IQR 15.5\u201356.6) hours compared to 109.9 (IQR 92\u2013144) hours in the delayed group. Reasons for delay in flexible sigmoidoscopy were: early weekend admission . Clostridioides difficile infection rates were similar in the early versus delayed flexible sigmoidoscopy groups . The mean baseline CRP was 72.8 \u00b1 71.5 mg/dL in the early flexible sigmoidoscopy group and 98.8 \u00b1 72.7 mg/dL in the delayed flexible sigmoidoscopy group (P = .14). Mean baseline albumin levels were similar between the early and delayed flexible sigmoidoscopy groups . The mean follow-up time was 27.9 \u00b1 19.9 months in the early versus 26.9 \u00b1 26.6 months in the delayed flexible sigmoidoscopy groups (P = .86).A similar proportion of patients in the early flexible sigmoidoscopy group were biologic-na\u00efve compared to those in the delayed flexible sigmoidoscopy group . In addition, early flexible sigmoidoscopy was associated with decreased hospital length of stay .Patients undergoing early flexible sigmoidoscopy had fewer mean days of IV corticosteroid use compared to those undergoing delayed flexible sigmoidoscopy  in the early flexible sigmoidoscopy group and 48% of patients (n = 12) in the delayed flexible sigmoidoscopy group received rescue infliximab therapy (P = .86). Those who had an early flexible sigmoidoscopy had a shorter time to rescue infliximab therapy  (P = .06). Similarly, there was a nonsignificant trend toward decreased colectomy rates in the early flexible sigmoidoscopy group . Median time to colectomy was longer in the early compared to delayed flexible sigmoidoscopy group (1839 days vs 1618 days) but in unadjusted analysis, this did not reach statistical significance (log-rank P = .138)  . Compare = .138) . A totalP < .001)  .P = .008). In addition, we found that being on oral corticosteroids at the time of admission was associated with decreased time to infliximab salvage therapy   .P = .002) (P = .034) (P = .002).Cox proportional hazards analysis was performed to evaluate the impact of time to flexible sigmoidoscopy on colectomy. After adjusting for baseline CRP, albumin, Mayo UC endoscopic subscore of 3, prior anti-TNF exposure, as well as immunomodulator and corticosteroid use on admission, we found that each day that the flexible sigmoidoscopy was delayed was independently associated with a 16% increase in risk of colectomy  . We also = .034) . As a seIn supplementary analyses, using the cutoff point for an \u201cearly\u201d flexible sigmoidoscopy as 24 hours, we found there was a numerically shorter duration of IV corticosteroid use, shorter length of hospital stay, and shorter time to infliximab although none of these were statistically significant .In a similar model, flexible sigmoidoscopy performed within 48 hours of hospital admission was associated with a numerically shorter duration of IV corticosteroid use, and a statistically significant decrease in length of hospital stay, and shorter time to infliximab .In this single-center retrospective study of 112 patients with ASUC who had a flexible sigmoidoscopy, we found that early flexible sigmoidoscopy (within 72 hours of admission) was independently associated with multiple favorable clinical outcomes including shorter duration of IV corticosteroid use, shorter length of hospital stay, and a shorter time to infliximab rescue therapy. There was also a decreased risk of colectomy on multivariate regression modeling in patients who underwent an early flexible sigmoidoscopy.17 For example, the British Society of Gastroenterology guidelines recommends performing an \u201cearly\u201d flexible sigmoidoscopy but does not specify a time point.13 On the other hand, the most recent ACG guidelines recommend performing a flexible sigmoidoscopy within 72 hours of admission (preferably within 24 hours).14 Our results support the recommendations of the ACG as we have demonstrated clinical benefit in patients with ASUC who had a flexible sigmoidoscopy within 72 hours of admission.In ASUC, an expedient flexible sigmoidoscopy soon after hospital admission is essential. The roles of flexible sigmoidoscopy in this setting include evaluating endoscopic disease activity, which has prognostic value, and obtaining biopsies to rule out other etiologies such as CMV or ischemia. Multiple society guidelines and consensus statements have clearly recommended performing a flexible sigmoidoscopy in ASUC on admission, but few specified the optimal timing of the procedure.16 Obi et al. reviewed NIS data from 2003 to 2016 and defined early endoscopy as being performed within 2 days of admission.16 The authors concluded that delayed endoscopy is associated with prolonged hospital stay, higher hospital cost, and mortality.16 Bali et al. conducted a similar study of the NIS from 2012 to 2018.15 In that study, early endoscopy was defined as flexible sigmoidoscopy or colonoscopy being performed within 48 hours of hospital admission.15 The authors noted that early endoscopy is associated with decreased length of hospital stay, healthcare utilization, and mortality. We demonstrated a similar finding of decreased hospital length of stay in our study. Patients with UC are at risk of hospitalization-related adverse events such as venous thromboembolism, and hospital-acquired infections due to immunosuppression.19 Therefore, a shorter hospital stay is an important outcome to reduce the burden of these adverse events.Two administrative database studies from the NIS have investigated the timing of endoscopy on outcomes in ASUC.Administrative database studies, however, have multiple limitations including the potential for miscoding of diagnoses which we avoid in our study by detailed individual chart review to confirm all diagnoses and procedures. The strengths of our study also include the availability of granular data such as previous and current medication use, lab results , and endoscopic findings that allow us to clearly define UC disease activity and severity. The two groups in our study had relatively similar markers of disease activity and severity including endoscopic disease activity as measured by the Mayo UC endoscopic subscore. We used the Truelove and Witts\u2019 criteria to classify ASUC as it has been well-established to reflect disease severity. In addition, with access to granular data we were able to account and control for clinical confounders that can affect outcomes. Another strength of our study is the ability to account for other important clinical outcomes such as need for rescue infliximab, timing of infliximab, and need for colectomy.20 In patients with IBD, inpatient opioid administration has been linked to continued outpatient opioid medication use.21 Chronic outpatient opioid medication use in turn has been associated with a lower rate of compliance to biologic therapy and higher healthcare utilization.23 This highlights a potential negative impact of delayed flexible sigmoidoscopy in these patients.In our study, we found a numerically lower rate of inpatient opioid use in the early flexible sigmoidoscopy group. Patients with IBD have a higher rate of opioid use disorder in general, and longer hospital courses with uncontrolled disease activity may be an important contributing factor to this problem.25 An earlier assessment of endoscopic severity, and response (or lack thereof) to IV corticosteroids can expedite escalation to rescue therapy with biologics like infliximab. This could potentially improve long-term outcomes and colectomy rates.26 In our study, we were able to demonstrate a numerically lower rate of colectomy in the early flexible sigmoidoscopy group and a longer time to colectomy in those patients. These trends are similar to those seen from larger sample databases which also showed lower colectomy rates with early endoscopic evaluation.15Our results show that an earlier flexible sigmoidoscopy is associated with a shorter duration of IV corticosteroid use and a shorter time to infliximab therapy. Retrospective studies have shown that severe endoscopic lesions are associated with lack of response to corticosteroids and increased need for colectomy.C. difficile infection in UC has been shown to be associated with increased rates of poor clinical outcomes. A previously published systematic review revealed that the rate of C. difficile in inpatient UC ranges from 2.8% to 11.1%.27\u201330 The rate of C. difficile in our cohort was 3.6% (3.5% in the early vs 4% in the delayed flexible sigmoidoscopy groups), which is on the lower end of the published range. The differences in C. difficile rates can be partly attributed to testing assays/mechanisms. Our cohort utilized reflex C. difficile testing starting with glutamate dehydrogenase antigen and toxin A/B enzyme immunoassay followed polymerase chain reaction (PCR) toxin testing in discrepant results. This limits the false-positive rates of direct PCR testing and might account for our C. difficile rates being at the lower end of expected.Concomitant C. difficile/CMV infection, endoscopic Mayo UC score, and prior exposure to biological agents, residual confounders may have contributed to the delay in performing a flexible sigmoidoscopy.There are some limitations to our study. This includes the inherent limitations of retrospective studies such as missing data and lack of standardization. Another limitation is a relatively small sample size which may lead to inadequate power in determining statistical significance in certain outcomes. In addition, though the two groups were similar in terms of baseline disease activity and severity as measured by CRP, albumin, concomitant In conclusion, in patients admitted with ASUC, early flexible sigmoidoscopy is associated with shorter duration of IV corticosteroid use, shorter duration of hospital stay, and shorter time to treatment escalation with infliximab. In addition, in multivariate analysis, we also found that increased time to flexible sigmoidoscopy was associated with an increased risk of colectomy. Our findings highlight the importance of performing a flexible sigmoidoscopy early (within 72 hours) during hospitalization to optimize outcomes for patients with ASUC.otad032_suppl_Supplementary_TablesClick here for additional data file."}
+{"text": "The result is in excellent agreement with predictions from density functional theory and molecular dynamics. This work represents the first measurement, within the same setup, of experimental zT of a single molecule at room temperature and opens new opportunities for the screening of several possible molecules in the light of future thermoelectric applications. The protocol is verified using SAc-OPE3, for which individual measurements for its transport properties exist in the literature.Molecules are predicted to be chemically tunable towards high thermoelectric efficiencies and they could outperform existing materials in the field of energy conversion. However, their capabilities at the more technologically relevant temperature of 300\u2009K are yet to be demonstrated. A possible reason could be the lack of a comprehensive technique able to measure the thermal and (thermo)electrical properties, including the role of phonon conduction. Here, by combining the break junction technique with a suspended heat-flux sensor, we measured the total thermal and electrical conductance of a single molecule, at room temperature, together with its Seebeck coefficient. We used this method to extract the figure of merit  Here, the authors devise a method, combining the break junction technique with a suspended heat-flux sensor, to measure the total thermal and electrical conductance of a single molecule, at room temperature, together with its Seebeck coefficient. A better understanding of transport phenomena at this scale can lead to important progress in different fields, from power management in current computer architectures, to energy conversion. Careful experiments have enabled the study of molecular junctions at the level of single molecules, opening the way to the exploration of the limits of charge and phonon transport through single channels at the nanoscale5.The transport of heat and charge through molecular junctions exhibits rich transport physics8.Among the possible applications of molecular junctions, thermoelectric energy conversion has probably received the largest attention in recent research, as molecules hold the promise for a dramatic increase to the efficiency of heat-to-charge conversion. This is based on the possibility of atomically tuning their chemical structure, introducing novel features, like phonon suppression and quantum interference, that are not possible in standard thermoelectric materials9. Thus, a more comprehensive way to evaluate the efficiency of a molecule to convert heat into electricity is to consider the so-called material thermoelectric figure of merit zT. When the temperature difference \u0394T occurring across the molecular junction is not too large, zT can be expressed as:G is the electrical conductance, T is the average temperature across the two leads, and For this reason, many new and different molecules are currently fabricated, and their thermoelectric properties are extensively studied, both theoretically and experimentally. However, most studies in the literature focus on simulating, fabricating, and testing molecules in order to obtain the best possible results in terms of Seebeck effect, which is directly responsible for converting heat into electrical energy. However, to achieve an effective conversion, the temperature drop sustained between the ends of the molecule should be large enough to induce an appreciable charge current, requiring simultaneously a low level of thermal conductance and a high level of electrical conductancezT are hardly available in the literature, perhaps due to the difficulty in experimentally measuring the total thermal conductance zT required 2\u2009K absolute temperature and the fitting of a theoretical model to extract the thermal conductance of the molecule10. At the technologically more relevant temperature range around 300\u2009K, only alkanedithiol and an oligo(phenyleneethynylene) (OPE3) have been characterized in terms of their thermal conductance5. A demonstration of an experimental setup and protocol to fully characterize the thermoelectric figure of merit of single molecules has been lacking, in particular for operation at ambient temperatures and with the capability to account for the phononic contribution to the thermal conductance. It is important to combine the methods for measuring G, S, and \u03ba for a single setup, because of the statistical character of the measurements of molecular junctions using break-junction techniques. In these techniques the repeated opening and closing of a junction is used to determine a likely arrangement of a molecule between two metal electrodes by means of statistical averaging of measurement data. To combine such measurements from different setups is challenging and requires a high level of reproducibility.Experimental values of b]thiophene anchoring groups (DHBT-OPE3-An), by measuring its electronic, thermal, and thermoelectric properties at room temperature. Given the very tedious and slow thermal transport measurements, this particular molecule was chosen as to address some of the most important current questions in the field. Namely, the interesting aspect of this molecule is the increase of vibrational states by locally adding atoms to only one  part of the molecule with respect to the reference OPE3 molecule. This is an important step towards the inclusion of moieties to enhance or reduce the thermal conductance of a molecule through localization and quantum interference effects1. Furthermore, the attachment of side-groups in the central part of a molecule is a starting point of cross-linking strategy of molecular layers11. In addition, we study, in the thermal context, the enhanced binding yield reported for DHBT end groups, which may reduce the systematic risk of statistical approaches. These data then motivate further studies with series of molecules systematically varying only one aspect, which is commonly done for the simpler electrical conductance and thermoelectric measurements.In this work, we report on an exhaustive method to fully characterize experimentally the thermoelectric figure of merit of an oligo(phenyleneethynylene)-9,10-anthracenyl single molecule junction with dihydrobenzo[zT of a single molecule at room temperature and within the same setup, including the phononic contribution to the total thermal conductance.\u00a0In addition, the protocol is verified using SAc-OPE3, for which individual measurements for its transport properties exist in the literature.To verify the reliability of thermal transport studies, a comparison between the experimental and theoretically expected values for the thermal conductance is given, as well as a benchmark with respect to similar OPE3-based molecules. Our results represent, to our knowledge, the first ever experimental measurement of the complete 11.Molecules are deposited on the gold platform by dip coating, with concentrations ranging from 0.1 to 1\u2009mM, for 30\u2009s to 2\u2009h. After the deposition, samples are rinsed several times in clean solvent to wash away physically adsorbed molecules. The synthesis and purification of the molecule under study (DHBT-OPE3-An) are described by Dekkiche et al.The thermal transport measurements require a sample cleaning procedure compatible with the under-etched sensor structure described below. The post-fabrication cleaning procedure for the MEMS is a combination of oxygen plasma and ion milling to remove contaminants and retrieve a fresh gold surface.\u22127 mbar), at room temperature, and within a custom-built scanning tunneling microscope (STM), located in one of the IBM Noise Free Labs12.The experimental setup and procedure are shown schematically in Fig.\u00a04. Compared to other examples in the literature14 this protocol adds the possibility to measure the thermal conductance together with the electrical conductance, and it has been validated against two model systems, namely, dithiol-oligo(phenylene ethynylene) and octane dithiol junctions with gold electrodes. The results are in good agreement both with theory and other independent studies5. Briefly, to measure simultaneously the electrical and thermal transport properties of a single-molecule junction, a suspended micro-electro-mechanical system (MEMS) has been devised15, featuring a low thermal conductance MEMS (3.5\u20134.5\u2009\u00d7\u200910\u22128 W/K), Fig.\u00a0We follow the measuring protocol to extract the electrical and thermal conductance of a single molecule described by Mosso et al.G) between the tip and the platform is continuously monitored during contact formation (closing trace) and contact breaking (opening trace). When looking at the evolution of G versus electrodes separation, it is sometimes possible to observe a plateau below the value of the conductance quantum (G0). This usually indicates the presence of a molecule stretching inside the junction18. At the end of such a plateau the molecular contact is then eventually broken. Figure\u00a0The experiment is based on performing STM-Break Junction (STM-BJ) measurements, where an electrochemically etched gold tip is brought into and out of contact with the gold platform on top of the suspended MEMS. The electrical conductance , by applying a constant voltage  to the Pt-heater , corresponding to few \u03bcW of dissipated power. The temperature T as function of electrodes separation is then continuously monitored, by reading the four-probe electrical resistance of the Pt-heater. The slow retraction speeds on the order of nm/s enable the measurement of thermal measurements described below, which have a limited measurement bandwidth given by the thermal time constant of the MEMS sensor in the range of tens of ms.For measuring the thermal conductance of the molecular junction, the temperature of the suspended membrane is first increased to , where 19 can be avoided. On a molecular scale no convincing approach for a four-probe measurement  has been proposed. One therefore talks about the junction conductance rather than the conductance of a molecule.At the beginning of an opening trace, when the tip is in contact with the membrane, the total thermal conductance of the system is given by 4.During the course of the experiments the junction goes through the many possible binding configurations a molecule can assume between the two electrodes. Similar to what has been established for electrical conductance measurements, a statistical approach is used to determine the most probable configuration. We typically collect 3000\u22125000 traces per data set, out of which some hundreds showing a clear molecular signature.  With those traces, 2D histograms for the electrical conductance Fig.\u00a0 and therTo extract the thermal conductance of such junctions . In a typical experiment, the temperature bias between the two electrodes is first adjusted to have an accuracy and stability better than 0.01\u2009\u00b0C. The overall temperature difference, \u0394T, between the two electrodes ranges from 0 up to 60\u2009K. All measurements are performed in high vacuum and at room temperature. Once thermal equilibrium has been reached, the tip is moved closer to the counter electrode until a good electrical contact has been established (G\u2009>\u20095 G0). Then the two electrodes are slowly moved apart (opening trace), usually at a speed of 3\u2009nm/s. A typical opening trace for the Seebeck measurement is shown in Fig.\u00a0The experimental procedure for the measurement of the Seebeck coefficient is represented schematically in Fig.\u00a0\u22124G0 is predicted, a molecular region is defined in the interval of conductance between 10\u22123G0 and 10\u22125G0. In this region, the speed of the piezoelectric scanner is lowered to 1\u2009nm/s.Since for the DHBT-OPE3-An molecule, a conductance plateau of around 10Gbefore of the first 50 points of the plateau is measured. If the value stays between the boundaries (10\u22123G0\u201310\u22125G0), it is assumed a molecule is inside the junction. Afterward, the electrical bias VBias is turned off for a window of 80 datapoints , the electrical conductance (G), and the thermal conductance . The difference at 0 between the linear fits yields a molecular thermal conductance value. Averaging over two independent measurements , the optimized DHBT-OPE3-An was placed between two Au (111) surfaces containing six layers with 144 gold atoms per layer. The electronic thermal conductivity is estimated using a combination of non-equilibrium Green\u2019s functions (NEGF) and Density Functional Tight Binding (DFTB) calculations as described in refs. 22. In particular, the value of the electronic thermal conductivity at 300\u2009K was calculated using the transmission function of the device, as described in ref. 23.To construct a theoretical picture of thermal transport across the molecular junction, we employ two simulation methods: molecular dynamics (MD) and a combination of techniques based on density functional theory. The former method allows us to estimate the phonon thermal conductance while the latter method serves to estimate the electronic thermal conductivity. For electronic transport calculations, the molecular device has been constructed in several steps as detailed in Dekkiche et al.24, while gold is simulated with the Heinz potential25. The gold-sulfur interaction, instead, is described by the Morse potential21. The molecular junctions are first thermalized for 1\u2009ns in the NPT ensemble and then non-equilibrium MD simulations are employed to extract the thermal conductance. In these latter simulations, the two gold reservoirs were\u00a0respectively heated up\u00a0and cooled down by 50\u2009K and the thermal conductance was estimated based on the accumulated energy of the hot and cold gold reservoirs. The results presented here were obtained after averaging over 30 independent simulations each representing a total duration of 1\u2009ns.In parallel, MD simulations have been performed using the LAMMPS package. The interactions inside the molecule are described by the OPLS force fieldFrom the electronic transport calculations, we first deduce the value of the electronic thermal conductivity zT. This is a long-awaited result in the field of molecular thermoelectricity since it allows for the experimental screening of different molecules in vision of viable applications.The results represented in Fig.\u00a0G . The SAc-OPE3 molecule yields zT \u2243 2x 10-5.\u00a0These 11 was again observed here, supporting this anecdotal evidence. Further, this result confirms that the choice among these anchor groups has a relatively small influence on the phonon conductance. This is relevant, because theoretical predictions of thermal conductance of OPE3 molecules with different anchor groups cover a significant range between 19 and 34\u2009pW/K27. In this context, it appears that, within the accuracy of the experimental and theoretical results presented here, the DHBT-OPE3-An possesses a thermal conductance that is slightly lower than average despite the improved cleanliness of the binding.First, with respect to the more commonly used thiol anchor groups, this variant of OPE3 links to the gold electrodes with DHBT anchor groups. The previously reported high junction yield28, as well as to provide options for cross-linking of molecular junctions11.Secondly, within our experimental uncertainty, this work also confirms that phonon engineering is possible in single molecules. Indeed, it is interesting to notice that despite an increase of 30% in the number of atoms and degrees of freedom, the thermal conductance of the DHBT-OPE3-An only increases by about 10% compared to the predicted 22\u2009pW/K for the DHBT-OPE3-Ph analog, hinting at the influence of side groups. The reason could be the localized nature of vibrational modes within the molecule, which do not equally contribute to the coherent transport along the junction. In the context of potential technological use, the ability to readily attach side groups onto the central ring of OPE3 could be a way to independently tune thermal and thermo-electrical transportSupplementary InformationPeer Review File"}